Sample records for upstream vpu sequences

  1. Various plus unique: Viral protein U as a plurifunctional protein for HIV-1 replication.

    PubMed

    Soper, Andrew; Juarez-Fernandez, Guillermo; Aso, Hirofumi; Moriwaki, Miyu; Yamada, Eri; Nakano, Yusuke; Koyanagi, Yoshio; Sato, Kei

    2017-04-01

    Human immunodeficiency virus type 1 (HIV-1), the causative agent of acquired immunodeficiency syndrome, encodes four accessory genes, one of which is viral protein U (Vpu). Recently, the study of Vpu has been of great interest. For instance, various cellular proteins are degraded (e.g. CD4) and down-modulated (e.g. tetherin) by Vpu. Vpu also antagonizes the function of tetherin and inhibits NF-κB. Moreover, Vpu is a viroporin forming ion channels and may represent a promising target for anti-HIV-1 drugs. In this review, we summarize the domains/residues that are responsible for Vpu's functions, describe the current understanding of the role of Vpu in HIV-1-infected cells, and review the effect of Vpu on HIV-1 in replication and pathogenesis. Future investigations that simultaneously assess a combination of Vpu functions are required to clearly delineate the most important functions for viral replication. Impact statement Viral protein U (Vpu) is a unique protein encoded by human immunodeficiency virus type 1 (HIV-1) and related lentiviruses, playing multiple roles in viral replication and pathogenesis. In this review, we briefly summarize the most up-to-date knowledge of HIV-1 Vpu.

  2. Identification of novel key amino acids at the interface of the transmembrane domains of human BST-2 and HIV-1 Vpu.

    PubMed

    Pang, Xiaojing; Hu, Siqi; Li, Jian; Xu, Fengwen; Mei, Shan; Zhou, Jinming; Cen, Shan; Jin, Qi; Guo, Fei

    2013-08-06

    BST-2 (bone marrow stromal cell antigen 2) is an interferon-inducible protein that inhibits virus release by tethering viral particles to the cell surface. This antiviral activity of BST-2 is antagonized by HIV-1 accessory protein Vpu. Vpu physically interacts with BST-2 through their mutual transmembrane (TM) domains. In this study, we utilized the BRET assay and molecular dynamics (MD) simulation method to further characterize the interaction of BST-2 and Vpu. Amino acids I34, L37, P40 and L41 in the TM domain of BST-2, and L11, A18 and W22 in the TM domain of Vpu were identified to be critical for the interaction between BST-2 and Vpu. The residues P40 in the TM domain of BST-2 and L11 in the TM domain of Vpu were shown, for the first time, to be important for their interaction. Furthermore, triple-amino-acid substitutions, 14-16 (AII to VAA) and 26-28 (IIE to AAA) in Vpu TM, not the single-residue mutation, profoundly disrupted BST-2/Vpu interaction. The results of MD simulation revealed significant conformational changes of the BST-2/Vpu complex as a result of mutating P40 of BST-2 and L11, 14-16 (AII to VAA) and 26-28 (IIE to AAA) of Vpu. In addition, disrupting the interaction between BST-2 and Vpu rendered BST-2 resistant to Vpu antagonization. Through use of the BRET assay, we identified novel key residues P40 in the TM domain of BST-2 and L11 in the TM domain of Vpu that are important for their interaction. These results add new insights into the molecular mechanism behind BST-2 antagonization by HIV-1 Vpu.

  3. Identification of novel key amino acids at the interface of the transmembrane domains of human BST-2 and HIV-1 Vpu

    PubMed Central

    2013-01-01

    Background BST-2 (bone marrow stromal cell antigen 2) is an interferon-inducible protein that inhibits virus release by tethering viral particles to the cell surface. This antiviral activity of BST-2 is antagonized by HIV-1 accessory protein Vpu. Vpu physically interacts with BST-2 through their mutual transmembrane (TM) domains. In this study, we utilized the BRET assay and molecular dynamics (MD) simulation method to further characterize the interaction of BST-2 and Vpu. Results Amino acids I34, L37, P40 and L41 in the TM domain of BST-2, and L11, A18 and W22 in the TM domain of Vpu were identified to be critical for the interaction between BST-2 and Vpu. The residues P40 in the TM domain of BST-2 and L11 in the TM domain of Vpu were shown, for the first time, to be important for their interaction. Furthermore, triple-amino-acid substitutions, 14–16 (AII to VAA) and 26–28 (IIE to AAA) in Vpu TM, not the single-residue mutation, profoundly disrupted BST-2/Vpu interaction. The results of MD simulation revealed significant conformational changes of the BST-2/Vpu complex as a result of mutating P40 of BST-2 and L11, 14–16 (AII to VAA) and 26–28 (IIE to AAA) of Vpu. In addition, disrupting the interaction between BST-2 and Vpu rendered BST-2 resistant to Vpu antagonization. Conclusions Through use of the BRET assay, we identified novel key residues P40 in the TM domain of BST-2 and L11 in the TM domain of Vpu that are important for their interaction. These results add new insights into the molecular mechanism behind BST-2 antagonization by HIV-1 Vpu. PMID:23919512

  4. Serine Phosphorylation of HIV-1 Vpu and Its Binding to Tetherin Regulates Interaction with Clathrin Adaptors

    PubMed Central

    Sumner, Jonathan C.; Pickering, Suzanne; Neil, Stuart J. D.

    2015-01-01

    HIV-1 Vpu prevents incorporation of tetherin (BST2/ CD317) into budding virions and targets it for ESCRT-dependent endosomal degradation via a clathrin-dependent process. This requires a variant acidic dileucine-sorting motif (ExxxLV) in Vpu. Structural studies demonstrate that recombinant Vpu/tetherin fusions can form a ternary complex with the clathrin adaptor AP-1. However, open questions still exist about Vpu’s mechanism of action. Particularly, whether endosomal degradation and the recruitment of the E3 ubiquitin ligase SCFβTRCP1/2 to a conserved phosphorylated binding site, DSGNES, are required for antagonism. Re-evaluation of the phenotype of Vpu phosphorylation mutants and naturally occurring allelic variants reveals that the requirement for the Vpu phosphoserine motif in tetherin antagonism is dissociable from SCFβTRCP1/2 and ESCRT-dependent tetherin degradation. Vpu phospho-mutants phenocopy ExxxLV mutants, and can be rescued by direct clathrin interaction in the absence of SCFβTRCP1/2 recruitment. Moreover, we demonstrate physical interaction between Vpu and AP-1 or AP-2 in cells. This requires Vpu/tetherin transmembrane domain interactions as well as the ExxxLV motif. Importantly, it also requires the Vpu phosphoserine motif and adjacent acidic residues. Taken together these data explain the discordance between the role of SCFβTRCP1/2 and Vpu phosphorylation in tetherin antagonism, and indicate that phosphorylation of Vpu in Vpu/tetherin complexes regulates promiscuous recruitment of adaptors, implicating clathrin-dependent sorting as an essential first step in tetherin antagonism. PMID:26317613

  5. Validating Vegetable Production Unit (VPU) Plants, Protocols, Procedures and Requirements (P3R) using Currently Existing Flight Resources

    NASA Technical Reports Server (NTRS)

    Bingham, Gail; Bates, Scott; Bugbee, Bruce; Garland, Jay; Podolski, Igor; Levinskikh, Rita; Sychev, Vladimir; Gushin, Vadim

    2009-01-01

    Validating Vegetable Production Unit (VPU) Plants, Protocols, Procedures and Requirements (P3R) Using Currently Existing Flight Resources (Lada-VPU-P3R) is a study to advance the technology required for plant growth in microgravity and to research related food safety issues. Lada-VPU-P3R also investigates the non-nutritional value to the flight crew of developing plants on-orbit. The Lada-VPU-P3R uses the Lada hardware on the ISS and falls under a cooperative agreement between National Aeronautics and Space Administration (NASA) and the Russian Federal Space Association (FSA). Research Summary: Validating Vegetable Production Unit (VPU) Plants, Protocols, Procedures and Requirements (P3R) Using Currently Existing Flight Resources (Lada-VPU-P3R) will optimize hardware and

  6. HIV-1 Vpu protein mediates the transport of potassium in Saccharomyces cerevisiae.

    PubMed

    Herrero, Laura; Monroy, Noemí; González, María Eugenia

    2013-01-08

    Human immunodeficiency virus type 1 (HIV-1) Vpu is an integral membrane protein that belongs to the viroporin family. Viroporins interact with cell membranes, triggering membrane permeabilization and promoting release of viral particles. In vitro electrophysiological methods have revealed changes in membrane ion currents when Vpu is present; however, in vivo the molecular mechanism of Vpu at the plasma membrane is still uncertain. We used the yeast Saccharomyces cerevisiae as a genetic model system to analyze how Vpu ion channel impacts cellular homeostasis. Inducible expression of Vpu impaired cell growth, suggesting that this viral protein is toxic to yeast cultures. This toxicity decreased with extracellular acidic pH. Also, Vpu toxicity diminished as the extracellular K(+) concentration was increased. However, expression of the Vpu protein suppresses the growth defect of K(+) uptake-deficient yeast (Δtrk1,2). The phenotype rescue of these highly hyperpolarized cells was almost total when they were grown in medium supplemented with high concentrations of KCl (100 mM) at pH 7.0 but was significantly reduced when the extracellular K(+) concentration or pH was decreased. These results indicate that Vpu has the ability to modify K(+) transport in both yeast strains. Here, we show also that Vpu confers tolerance to the aminoglycoside antibiotic hygromycin B in Δtrk1,2 yeast. Our results suggest that Vpu interferes with cell growth of wild-type yeast but improves proliferation of the hyperpolarized trk1,2 mutant by inducing plasma membrane depolarization. Furthermore, evaluation of the ion channel activity of the Vpu protein in Δtrk1,2 yeast could aid in the development of a high-throughput screening assay for molecules that target the retroviral protein.

  7. HIV-1 Vpu Blocks Recycling and Biosynthetic Transport of the Intrinsic Immunity Factor CD317/Tetherin To Overcome the Virion Release Restriction

    PubMed Central

    Schmidt, Sarah; Fritz, Joëlle V.; Bitzegeio, Julia; Fackler, Oliver T.; Keppler, Oliver T.

    2011-01-01

    ABSTRACT The intrinsic immunity factor CD317 (BST-2/HM1.24/tetherin) imposes a barrier to HIV-1 release at the cell surface that can be overcome by the viral protein Vpu. Expression of Vpu results in a reduction of CD317 surface levels; however, the mechanism of this Vpu activity and its contribution to the virological antagonism are incompletely understood. Here, we characterized the influence of Vpu on major CD317 trafficking pathways using quantitative antibody-based endocytosis and recycling assays as well as a microinjection/microscopy-based kinetic de novo expression approach. We report that HIV-1 Vpu inhibited both the anterograde transport of newly synthesized CD317 and the recycling of CD317 to the cell surface, while the kinetics of CD317 endocytosis remained unaffected. Vpu trapped trafficking CD317 molecules at the trans-Golgi network, where the two molecules colocalized. The subversion of both CD317 transport pathways was dependent on the highly conserved diserine S52/S56 motif of Vpu; however, it did not require recruitment of the diserine motif interactor and substrate adaptor of the SCF-E3 ubiquitin ligase complex, β-TrCP. Treatment of cells with the malaria drug primaquine resulted in a CD317 trafficking defect that mirrored that induced by Vpu. Importantly, primaquine could functionally replace Vpu as a CD317 antagonist and rescue HIV-1 particle release. PMID:21610122

  8. HIV-1 Vpu Antagonizes CD317/Tetherin by Adaptor Protein-1-Mediated Exclusion from Virus Assembly Sites

    PubMed Central

    Pujol, François M.; Laketa, Vibor; Schmidt, Florian; Mukenhirn, Markus; Müller, Barbara; Boulant, Steeve; Grimm, Dirk; Keppler, Oliver T.

    2016-01-01

    ABSTRACT The host cell restriction factor CD317/tetherin traps virions at the surface of producer cells to prevent their release. The HIV-1 accessory protein Vpu antagonizes this restriction. Vpu reduces the cell surface density of the restriction factor and targets it for degradation; however, these activities are dispensable for enhancing particle release. Instead, Vpu has been suggested to antagonize CD317/tetherin by preventing recycling of internalized CD317/tetherin to the cell surface, blocking anterograde transport of newly synthesized CD317/tetherin, and/or displacing the restriction factor from virus assembly sites at the plasma membrane. At the molecular level, antagonism relies on the physical interaction of Vpu with CD317/tetherin. Recent findings suggested that phosphorylation of a diserine motif enables Vpu to bind to adaptor protein 1 (AP-1) trafficking complexes via two independent interaction motifs and to couple CD317/tetherin to the endocytic machinery. Here, we used a panel of Vpu proteins with specific mutations in individual interaction motifs to define which interactions are required for antagonism of CD317/tetherin. Impairing recycling or anterograde transport of CD317/tetherin to the plasma membrane was insufficient for antagonism. In contrast, excluding CD317/tetherin from HIV-1 assembly sites depended on Vpu motifs for interaction with AP-1 and CD317/tetherin and correlated with antagonism of the particle release restriction. Consistently, interference with AP-1 function or its expression blocked these Vpu activities. Our results define displacement from HIV-1 assembly sites as active principle of CD317/tetherin antagonism by Vpu and support a role of tripartite complexes between Vpu, AP-1, and CD317/tetherin in this process. IMPORTANCE CD317/tetherin poses an intrinsic barrier to human immunodeficiency virus type 1 (HIV-1) replication in human cells by trapping virus particles at the surface of producer cells and thereby preventing their release. The viral protein Vpu antagonizes this restriction, and molecular interactions with the restriction factor and adaptor protein complex 1 (AP-1) were suggested to mediate this activity. Vpu modulates intracellular trafficking of CD317/tetherin and excludes the restriction factor from HIV-1 assembly sites at the plasma membrane, but the relative contribution of these effects to antagonism remain elusive. Using a panel of Vpu mutants, as well as interference with AP-1 function and expression, we show here that Vpu antagonizes CD317/tetherin by blocking its recruitment to viral assembly sites in an AP-1-dependent manner. These results refine our understanding of the molecular mechanisms of CD317/tetherin antagonism and suggest complexes of Vpu with the restriction factor and AP-1 as targets for potential therapeutic intervention. PMID:27170757

  9. Efficient Vpu-Mediated Tetherin Antagonism by an HIV-1 Group O Strain

    PubMed Central

    Mack, Katharina; Starz, Kathrin; Sauter, Daniel; Langer, Simon; Bibollet-Ruche, Frederic; Learn, Gerald H.; Stürzel, Christina M.; Leoz, Marie; Plantier, Jean-Christophe; Geyer, Matthias; Hahn, Beatrice H.

    2017-01-01

    ABSTRACT Simian immunodeficiency viruses (SIVs) use their Nef proteins to counteract the restriction factor tetherin. However, a deletion in human tetherin prevents antagonism by the Nef proteins of SIVcpz and SIVgor, which represent the ape precursors of human immunodeficiency virus type 1 (HIV-1). To promote virus release from infected cells, pandemic HIV-1 group M strains evolved Vpu as a tetherin antagonist, while the Nef protein of less widespread HIV-1 group O strains acquired the ability to target a region adjacent to this deletion. In this study, we identified an unusual HIV-1 group O strain (RBF206) that evolved Vpu as an effective antagonist of human tetherin. While both RBF206 Vpu and Nef exert anti-tetherin activity in transient-transfection assays, mainly Vpu promotes RBF206 release in infected CD4+ T cells. Although mutations distinct from the adaptive changes observed in group M Vpus (M-Vpus) were critical for the acquisition of its anti-tetherin activity, RBF206 O-Vpu potently suppresses NF-κB activation and reduces CD4 cell surface expression. Interestingly, RBF206 Vpu counteracts tetherin in a largely species-independent manner, degrading both the long and short isoforms of human tetherin. Downmodulation of CD4, but not counteraction of tetherin, by RBF206 Vpu was dependent on the cellular ubiquitin ligase machinery. Our data present the first example of an HIV-1 group O Vpu that efficiently antagonizes human tetherin and suggest that counteraction by O-Nefs may be suboptimal. IMPORTANCE Previous studies showed that HIV-1 groups M and O evolved two alternative strategies to counteract the human ortholog of the restriction factor tetherin. While HIV-1 group M switched from Nef to Vpu due to a deletion in the cytoplasmic domain of human tetherin, HIV-1 group O, which lacks Vpu-mediated anti-tetherin activity, acquired a Nef protein that is able to target a region adjacent to the deletion. Here we report an unusual exception, identifying a strain of HIV-1 group O (RBF206) whose Vpu protein evolved an effective antagonism of human tetherin. Interestingly, the adaptive changes in RBF206 Vpu are distinct from those found in M-Vpus and mediate efficient counteraction of both the long and short isoforms of this restriction factor. Our results further illustrate the enormous flexibility of HIV-1 in counteracting human defense mechanisms. PMID:28077643

  10. HIV-1 encoded virus protein U (Vpu) solution structure of the 41-62 hydrophilic region containing the phosphorylated sites Ser52 and Ser56.

    PubMed

    Coadou, Gaël; Evrard-Todeschi, Nathalie; Gharbi-Benarous, Josyane; Benarous, Richard; Girault, Jean Pierre

    2002-03-08

    Degradation of the HIV receptor CD4 by the proteasome, mediated by the HIV-1 protein Vpu, is crucial for the release of fully infectious virions. To promote CD4 degradation Vpu has to be phosphorylated on a motif DSGXXS, which is conserved in several signalling proteins known to be degraded by the proteasome upon phosphorylation. Such phosphorylation is required for the interaction of Vpu with the ubiquitin ligase SCF-beta-TrCP that triggers CD4 degradation by the proteasome. In the present work, we used two peptides of 22 amino acids between residues 41 and 62 of Vpu. Vpu41-62 was predicted to form an alpha-helix-flexible-alpha-helix including the phosphorylation motif DS52GNES56 and Vpu_P41-62 was phosphorylated at the two sites Ser52 and Ser56. We analysed the conformational change induced by the phosphorylation of this peptide on the residues Ser52 and Ser56. Homo- and heteronuclear NMR techniques were used to assess the structural influence of phosphorylation. The spectra of the free peptides, Vpu_P41-62 and Vpu41-62, in both H2O (at pH 3.5 and 7.2) and a 1:1 mixture of H2O and trifluoroethanol were completely assigned by a combined application of several two-dimensional proton NMR methods. Analysis of the short- and medium-range NOE connectivities and of the secondary chemical shifts indicated that the peptide segment (42-49) shows a less well-defined helix propensity. The Vpu_P41-62 domain of residues 50-62 forms a loop with the phosphate group pointing away, a short beta-strand and a flexible extended 'tail' of residues 60-62. Residues 50-60 exhibit alpha-proton NMR secondary chemical shift changes from random coil toward more beta-like structure with the combined (temperature, solvent and pH) NMR and molecular calculation experiments. Differences in this molecular region 50-62 suggest that conformational changes of Vpu_P play an important role in Vpu_P-induced degradation of CD4 molecules.

  11. Conformational changes induced by a single amino acid substitution in the trans-membrane domain of Vpu: implications for HIV-1 susceptibility to channel blocking drugs.

    PubMed

    Park, Sang Ho; Opella, Stanley J

    2007-10-01

    The channel-forming trans-membrane domain of Vpu (Vpu TM) from HIV-1 is known to enhance virion release from the infected cells and is a potential target for ion-channel blockers. The substitution of alanine at position 18 by a histidine (A18H) has been shown to render HIV-1 infections susceptible to rimantadine, a channel blocker of M2 protein from the influenza virus. In order to describe the influence of the mutation on the structure and rimantadine susceptibility of Vpu, we determined the structure of A18H Vpu TM, and compared it to those of wild-type Vpu TM and M2 TM. Both isotropic and orientationally dependent NMR frequencies of the backbone amide resonance of His18 were perturbed by rimantadine, and those of Ile15 and Trp22 were also affected, suggesting that His18 is the key residue for rimantadine binding and that residues located on the same face of the TM helix are also involved. A18H Vpu TM has an ideal, straight alpha-helix spanning residues 6-27 with an average tilt angle of 41 degrees in C14 phospholipid bicelles, indicating that the tilt angle is increased by 11 degrees compared to that of wild-type Vpu TM. The longer helix formed by the A18H mutation has a larger tilt angle to compensate for the hydrophobic mismatch with the length of the phospholipids in the bilayer. These results demonstrate that the local change of the primary structure plays an important role in secondary and tertiary structures of Vpu TM in lipid bilayers and affects its ability to interact with channel blockers.

  12. Pandemic HIV-1 Vpu overcomes intrinsic herd immunity mediated by tetherin.

    PubMed

    Iwami, Shingo; Sato, Kei; Morita, Satoru; Inaba, Hisashi; Kobayashi, Tomoko; Takeuchi, Junko S; Kimura, Yuichi; Misawa, Naoko; Ren, Fengrong; Iwasa, Yoh; Aihara, Kazuyuki; Koyanagi, Yoshio

    2015-07-17

    Among the four groups of HIV-1 (M, N, O, and P), HIV-1M alone is pandemic and has rapidly expanded across the world. However, why HIV-1M has caused a devastating pandemic while the other groups remain contained is unclear. Interestingly, only HIV-1M Vpu, a viral protein, can robustly counteract human tetherin, which tethers budding virions. Therefore, we hypothesize that this property of HIV-1M Vpu facilitates human-to-human viral transmission. Adopting a multilayered experimental-mathematical approach, we demonstrate that HIV-1M Vpu confers a 2.38-fold increase in the prevalence of HIV-1 transmission. When Vpu activity is lost, protected human populations emerge (i.e., intrinsic herd immunity develops) through the anti-viral effect of tetherin. We also reveal that all Vpus of transmitted/founder HIV-1M viruses maintain anti-tetherin activity. These findings indicate that tetherin plays the role of a host restriction factor, providing 'intrinsic herd immunity', whereas Vpu has evolved in HIV-1M as a tetherin antagonist.

  13. Expression, purification and characterization of a full-length recombinant HIV-1 Vpu from inclusion bodies.

    PubMed

    Njengele, Zikhona; Kleynhans, Ronel; Sayed, Yasien; Mosebi, Salerwe

    2016-12-01

    Vpu is one of four accessory proteins encoded by human immunodeficiency virus type I (HIV-1). Vpu modulates the expression of several cellular restriction factors within the HIV-1 infected cell including CD4, CD74, the bone marrow stromal antigen 2 (BST-2) and NK-T-and-B antigen. The interaction of HIV-1 Vpu with these proteins interferes with the innate immune response directed against HIV-1; thereby promoting viral persistence. The involvement of HIV-1 Vpu in manipulating the cellular environment in ways that favor viral replication makes it an attractive target for anti-HIV drug intervention. This paper describes the over-expression and purification of a soluble HIV-1 Vpu from inclusion bodies by ion-exchange chromatography, allowing production of 6 mg of highly purified protein (>95% purity) per 10 mg of pelleted cells obtained from 1 L of bacterial culture. Far-UV circular dichroism showed that the recombinant protein is folded and retained its secondary structure. Moreover, using ELISA, known HIV-1 Vpu binding partners, BST-2 and CD74, showed that the refolded purified protein is functional or at least assumes a conformation that is capable of binding these putative binding partners. To our knowledge, this is the first report of the purification and successful solubilization of full-length, wild-type HIV-1 Vpu from inclusion bodies in Escherichia coli. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Characterization of a Novel Simian Immunodeficiency Virus (SIVmonNG1) Genome Sequence from a Mona Monkey (Cercopithecus mona)

    PubMed Central

    Barlow, Katrina L.; Ajao, Adebowale Oluwafemi; Clewley, Jonathan P.

    2003-01-01

    A novel simian immunodeficiency virus (SIV) sequence has been recovered from RNA extracted from the serum of a mona monkey (Cercopithecus mona) wild born in Nigeria. The sequence was obtained by using novel generic (degenerate) PCR primers and spans from two-thirds into the gag gene to the 3′ poly(A) tail of the SIVmonNG1 RNA genome. Analysis of the open reading frames revealed that the SIVmonNG1 genome codes for a Vpu protein, in addition to Gag, Pol, Vif, Vpr, Tat, Rev, Env, and Nef proteins. Previously, only lentiviruses infecting humans (human immunodeficiency virus type 1 [HIV-1]) and chimpanzees (SIVcpz) were known to have a vpu gene; more recently, this has also been found in SIVgsn from Cercopithecus nictitans. Overall, SIVmonNG1 most closely resembles SIVgsn: the env gene sequence groups with HIV-1/SIVcpz env sequences, whereas the pol gene sequence clusters closely with the pol sequence of SIVsyk from Cercopithecus albogaris. By bootscanning and similarity plotting, the first half of pol resembles SIVsyk, whereas the latter part is closer to SIVcol from Colobus guereza. The similarities between the complex mosaic genomes of SIVmonNG1 and SIVgsn are consistent with a shared or common lineage. These data further highlight the intricate nature of the relationships between the SIVs from different primate species and will be helpful for unraveling these associations. PMID:12768007

  15. Atomistic Detailed Mechanism and Weak Cation-Conducting Activity of HIV-1 Vpu Revealed by Free Energy Calculations

    PubMed Central

    Padhi, Siladitya; Burri, Raghunadha Reddy; Jameel, Shahid; Priyakumar, U. Deva

    2014-01-01

    The viral protein U (Vpu) encoded by HIV-1 has been shown to assist in the detachment of virion particles from infected cells. Vpu forms cation-specific ion channels in host cells, and has been proposed as a potential drug target. An understanding of the mechanism of ion transport through Vpu is desirable, but remains limited because of the unavailability of an experimental structure of the channel. Using a structure of the pentameric form of Vpu – modeled and validated based on available experimental data – umbrella sampling molecular dynamics simulations (cumulative simulation time of more than 0.4 µs) were employed to elucidate the energetics and the molecular mechanism of ion transport in Vpu. Free energy profiles corresponding to the permeation of Na+ and K+ were found to be similar to each other indicating lack of ion selection, consistent with previous experimental studies. The Ser23 residue is shown to enhance ion transport via two mechanisms: creating a weak binding site, and increasing the effective hydrophilic length of the channel, both of which have previously been hypothesized in experiments. A two-dimensional free energy landscape has been computed to model multiple ion permeation, based on which a mechanism for ion conduction is proposed. It is shown that only one ion can pass through the channel at a time. This, along with a stretch of hydrophobic residues in the transmembrane domain of Vpu, explains the slow kinetics of ion conduction. The results are consistent with previous conductance studies that showed Vpu to be a weakly conducting ion channel. PMID:25392993

  16. Vpu-Mediated Counteraction of Tetherin Is a Major Determinant of HIV-1 Interferon Resistance

    PubMed Central

    Kmiec, Dorota; Iyer, Shilpa S.; Stürzel, Christina M.; Sauter, Daniel; Hahn, Beatrice H.

    2016-01-01

    ABSTRACT Human immunodeficiency virus type 1 (HIV-1) groups M, N, O, and P are the result of independent zoonotic transmissions of simian immunodeficiency viruses (SIVs) infecting great apes in Africa. Among these, only Vpu proteins of pandemic HIV-1 group M strains evolved potent activity against the restriction factor tetherin, which inhibits virus release from infected cells. Thus, effective Vpu-mediated tetherin antagonism may have been a prerequisite for the global spread of HIV-1. To determine whether this particular function enhances primary HIV-1 replication and interferon resistance, we introduced mutations into the vpu genes of HIV-1 group M and N strains to specifically disrupt their ability to antagonize tetherin, but not other Vpu functions, such as degradation of CD4, down-modulation of CD1d and NTB-A, and suppression of NF-κB activity. Lack of particular human-specific adaptations reduced the ability of HIV-1 group M Vpu proteins to enhance virus production and release from primary CD4+ T cells at high levels of type I interferon (IFN) from about 5-fold to 2-fold. Interestingly, transmitted founder HIV-1 strains exhibited higher virion release capacity than chronic control HIV-1 strains irrespective of Vpu function, and group M viruses produced higher levels of cell-free virions than an N group HIV-1 strain. Thus, efficient virus release from infected cells seems to play an important role in the spread of HIV-1 in the human population and requires a fully functional Vpu protein that counteracts human tetherin. PMID:27531907

  17. Human-Specific Adaptations in Vpu Conferring Anti-tetherin Activity Are Critical for Efficient Early HIV-1 Replication In Vivo.

    PubMed

    Yamada, Eri; Nakaoka, Shinji; Klein, Lukas; Reith, Elisabeth; Langer, Simon; Hopfensperger, Kristina; Iwami, Shingo; Schreiber, Gideon; Kirchhoff, Frank; Koyanagi, Yoshio; Sauter, Daniel; Sato, Kei

    2018-01-10

    The HIV-1-encoded accessory protein Vpu exerts several immunomodulatory functions, including counteraction of the host restriction factor tetherin, downmodulation of CD4, and inhibition of NF-κB activity to facilitate HIV-1 infection. However, the relative contribution of individual Vpu functions to HIV-1 infection in vivo remained unclear. Here, we used a humanized mouse model and HIV-1 strains with selective mutations in vpu to demonstrate that the anti-tetherin activity of Vpu is a prerequisite for efficient viral spread during the early phase of infection. Mathematical modeling and gain-of-function mutations in SIVcpz, the simian precursor of pandemic HIV-1, corroborate this finding. Blockage of interferon signaling combined with transcriptome analyses revealed that basal tetherin levels are sufficient to control viral replication. These results establish tetherin as a key effector of the intrinsic immune defense against HIV-1, and they demonstrate that Vpu-mediated tetherin antagonism is critical for efficient viral spread during the initial phase of HIV-1 replication. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Lack of adaptation to human tetherin in HIV-1 Group O and P

    PubMed Central

    2011-01-01

    Background HIV-1 viruses are categorized into four distinct groups: M, N, O and P. Despite the same genomic organization, only the group M viruses are responsible for the world-wide pandemic of AIDS, suggesting better adaptation to human hosts. Previously, it has been reported that the group M Vpu protein is capable of both down-modulating CD4 and counteracting BST-2/tetherin restriction, while the group O Vpu cannot antagonize tetherin. This led us to investigate if group O, and the related group P viruses, possess functional anti-tetherin activities in Vpu or another viral protein, and to further map the residues required for group M Vpu to counteract human tetherin. Results We found a lack of activity against human tetherin for both the Vpu and Nef proteins from group O and P viruses. Furthermore, we found no evidence of anti-human tetherin activity in a fully infectious group O proviral clone, ruling out the possibility of an alternative anti-tetherin factor in this virus. Interestingly, an activity against primate tetherins was retained in the Nef proteins from both a group O and a group P virus. By making chimeras between a functional group M and non-functional group O Vpu protein, we were able to map the first 18 amino acids of group M Vpu as playing an essential role in the ability of the protein to antagonize human tetherin. We further demonstrated the importance of residue alanine-18 for the group M Vpu activity. This residue lies on a diagonal face of conserved alanines in the TM domain of the protein, and is necessary for specific Vpu-tetherin interactions. Conclusions The absence of human specific anti-tetherin activities in HIV-1 group O and P suggests a failure of these viruses to adapt to human hosts, which may have limited their spread. PMID:21955466

  19. Identification of Amino Acids in the Human Tetherin Transmembrane Domain Responsible for HIV-1 Vpu Interaction and Susceptibility▿ †

    PubMed Central

    Kobayashi, Tomoko; Ode, Hirotaka; Yoshida, Takeshi; Sato, Kei; Gee, Peter; Yamamoto, Seiji P.; Ebina, Hirotaka; Strebel, Klaus; Sato, Hironori; Koyanagi, Yoshio

    2011-01-01

    Tetherin, also known as BST-2/CD317/HM1.24, is an antiviral cellular protein that inhibits the release of HIV-1 particles from infected cells. HIV-1 viral protein U (Vpu) is a specific antagonist of human tetherin that might contribute to the high virulence of HIV-1. In this study, we show that three amino acid residues (I34, L37, and L41) in the transmembrane (TM) domain of human tetherin are critical for the interaction with Vpu by using a live cell-based assay. We also found that the conservation of an additional amino acid at position 45 and two residues downstream of position 22, which are absent from monkey tetherins, are required for the antagonism by Vpu. Moreover, computer-assisted structural modeling and mutagenesis studies suggest that an alignment of these four amino acid residues (I34, L37, L41, and T45) on the same helical face in the TM domain is crucial for the Vpu-mediated antagonism of human tetherin. These results contribute to the molecular understanding of human tetherin-specific antagonism by HIV-1 Vpu. PMID:21068238

  20. Identification of amino acids in the human tetherin transmembrane domain responsible for HIV-1 Vpu interaction and susceptibility.

    PubMed

    Kobayashi, Tomoko; Ode, Hirotaka; Yoshida, Takeshi; Sato, Kei; Gee, Peter; Yamamoto, Seiji P; Ebina, Hirotaka; Strebel, Klaus; Sato, Hironori; Koyanagi, Yoshio

    2011-01-01

    Tetherin, also known as BST-2/CD317/HM1.24, is an antiviral cellular protein that inhibits the release of HIV-1 particles from infected cells. HIV-1 viral protein U (Vpu) is a specific antagonist of human tetherin that might contribute to the high virulence of HIV-1. In this study, we show that three amino acid residues (I34, L37, and L41) in the transmembrane (TM) domain of human tetherin are critical for the interaction with Vpu by using a live cell-based assay. We also found that the conservation of an additional amino acid at position 45 and two residues downstream of position 22, which are absent from monkey tetherins, are required for the antagonism by Vpu. Moreover, computer-assisted structural modeling and mutagenesis studies suggest that an alignment of these four amino acid residues (I34, L37, L41, and T45) on the same helical face in the TM domain is crucial for the Vpu-mediated antagonism of human tetherin. These results contribute to the molecular understanding of human tetherin-specific antagonism by HIV-1 Vpu.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hout, David R.; Gomez, Melissa L.; Pacyniak, Erik

    The Vpu protein of human immunodeficiency virus type 1 has been shown to shunt the CD4 receptor molecule to the proteasome for degradation and to enhance virus release from infected cells. The exact mechanism by which the Vpu protein enhances virus release is currently unknown but some investigators have shown that this function is associated with the transmembrane domain and potential ion channel properties. In this study, we determined if the transmembrane domain of Vpu could be functionally substituted with that of the prototypical viroporin, the M2 protein of influenza A virus. We constructed chimeric vpu gene in which themore » transmembrane domain of Vpu was replaced with that of the M2 protein of influenza. This chimeric vpu gene was substituted for the vpu gene in the genome of a pathogenic simian human immunodeficiency virus, SHIV{sub KU-1bMC33}. The resulting virus, SHIV{sub M2}, synthesized a Vpu protein that had a slightly different M{sub r} compared to the parental SHIV{sub KU-1bMC33}, reflecting the different sizes of the two Vpu proteins. The SHIV{sub M2} was shown to replicate with slightly reduced kinetics when compared to the parental SHIV{sub KU-1bMC33} but electron microscopy revealed that the site of maturation was similar to the parental virus SHIV{sub KU1bMC33}. We show that the replication and spread of SHIV{sub M2} could be blocked with the antiviral drug rimantadine, which is known to target the M2 ion channel. Our results indicate a dose dependent inhibition of SHIV{sub M2} with 100 {mu}M rimantadine resulting in a >95% decrease in p27 released into the culture medium. Rimantadine did not affect the replication of the parental SHIV{sub KU-1bMC33}. Examination of SHIV{sub M2}-infected cells treated with 50 {mu}M rimantadine revealed numerous viral particles associated with the cell plasma membrane and within intracytoplasmic vesicles, which is similar to HIV-1 mutants lacking a functional vpu. To determine if SHIV{sub M2} was as pathogenic as the parental SHIV{sub KU-1bMC33} virus, two pig-tailed macaques were inoculated and followed for up to 8 months. Both pig-tailed macaques developed severe CD4{sup +} T cell loss within 1 month of inoculation, high viral loads, and histological lesions consistent with lymphoid depletion similar to the parental SHIV{sub KU-1bMC33}. Taken together, these results indicate for the first time that the TM domain of the Vpu protein can be functionally substituted with the TM of M2 of influenza A virus, and shows that compounds that target the TM domain of Vpu protein of HIV-1 could serve as novel anti-HIV-1 drugs.« less

  2. Characterization of the interface of the bone marrow stromal cell antigen 2-Vpu protein complex via computational chemistry.

    PubMed

    Zhou, Jinming; Zhang, Zhixin; Mi, Zeyun; Wang, Xin; Zhang, Quan; Li, Xiaoyu; Liang, Chen; Cen, Shan

    2012-02-14

    Bone marrow stromal cell antigen 2 (BST-2) inhibits the release of enveloped viruses from the cell surface. Various viral counter measures have been discovered, which allow viruses to escape BST-2 restriction. Human immunodeficiency virus type 1 (HIV-1) encodes viral protein U (Vpu) that interacts with BST-2 through their transmembrane domains and causes the downregulation of cell surface BST-2. In this study, we used a computer modeling method to establish a molecular model to investigate the binding interface of the transmembrane domains of BST-2 and Vpu. The model predicts that the interface is composed of Vpu residues I6, A10, A14, A18, V25, and W22 and BST-2 residues L23, I26, V30, I34, V35, L41, I42, and T45. Introduction of mutations that have been previously reported to disrupt the Vpu-BST-2 interaction led to a calculated higher binding free energy (MMGBSA), which supports our molecular model. A pharmacophore was also generated on the basis of this model. Our results provide a precise model that predicts the detailed interaction occurring between the transmembrane domains of Vpu and BST-2 and should facilitate the design of anti-HIV agents that are able to disrupt this interaction.

  3. Structural studies of the HIV-1 accessory protein Vpu in langmuir monolayers: synchrotron X-ray reflectivity.

    PubMed Central

    Zheng, S; Strzalka, J; Ma, C; Opella, S J; Ocko, B M; Blasie, J K

    2001-01-01

    Vpu is an 81 amino acid integral membrane protein encoded by the HIV-1 genome with a N-terminal hydrophobic domain and a C-terminal hydrophilic domain. It enhances the release of virus from the infected cell and triggers degradation of the virus receptor CD4. Langmuir monolayers of mixtures of Vpu and the phospholipid 1,2-dilignoceroyl-sn-glycero-3-phosphocholine (DLgPC) at the water-air interface were studied by synchrotron radiation-based x-ray reflectivity over a range of mole ratios at constant surface pressure and for several surface pressures at a maximal mole ratio of Vpu/DLgPC. Analysis of the x-ray reflectivity data by both slab model-refinement and model-independent box-refinement methods firmly establish the monolayer electron density profiles. The electron density profiles as a function of increasing Vpu/DLgPC mole ratio at a constant, relatively high surface pressure indicated that the amphipathic helices of the cytoplasmic domain lie on the surface of the phospholipid headgroups and the hydrophobic transmembrane helix is oriented approximately normal to the plane of monolayer within the phospholipid hydrocarbon chain layer. At maximal Vpu/DLgPC mole ratio, the tilt of the transmembrane helix with respect to the monolayer normal decreases with increasing surface pressure and the conformation of the cytoplasmic domain varies substantially with surface pressure. PMID:11259297

  4. Persistent infection of macaques with simian-human immunodeficiency viruses.

    PubMed Central

    Li, J T; Halloran, M; Lord, C I; Watson, A; Ranchalis, J; Fung, M; Letvin, N L; Sodroski, J G

    1995-01-01

    Chimeric simian-human immunodeficiency viruses (SHIV) containing the human immunodeficiency virus type 1 (HIV-1) tat, rev, env, and, in some cases, vpu genes were inoculated into eight cynomolgus monkeys. Viruses could be consistently recovered from the CD8-depleted peripheral blood lymphocytes of all eight animals for at least 2 months. After this time, virus isolation varied among the animals, with viruses continuing to be isolated from some animals beyond 600 days after inoculation. The level of viral RNA in plasma during acute infection and the frequency of virus isolation after the initial 2-month period were higher for the Vpu-positive viruses. All of the animals remained clinically healthy, and the absolute numbers of CD4-positive lymphocytes were stable. Antibodies capable of neutralizing HIV-1 were generated at high titers in animals exhibiting the greatest consistency of virus isolation. Strain-specific HIV-1-neutralizing antibodies were initially elicited, and then more broadly neutralizing antibodies were elicited. env sequences from two viruses isolated more than a year after infection were analyzed. In the Vpu-negative SHIV, for which virus loads were lower, a small amount of env variation, which did not correspond to that found in natural HIV-1 variants, was observed. By contrast, in the Vpu-positive virus, which was consistently isolated from the host animal, extensive variation of the envelope glycoproteins in the defined variable gp120 regions was observed. Escape from neutralization by CD4 binding site monoclonal antibodies was observed for the viruses with the latter envelope glycoproteins, and the mechanism of escape appears to involve decreased binding of the antibody to the monomeric gp120 glycoproteins. The consistency with which SHIV infection of cynomolgus monkeys is initiated and the similarities in the neutralizing antibody response to SHIV and HIV-1 support the utility of this model system for the study of HIV-1 prophylaxis. PMID:7474126

  5. A single amino acid substitution within the transmembrane domain of the human immunodeficiency virus type 1 Vpu protein renders simian-human immunodeficiency virus (SHIV{sub KU-1bMC33}) susceptible to rimantadine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hout, David R.; Gomez, Lisa M.; Pacyniak, Erik

    2006-05-10

    Previous studies from our laboratory have shown that the transmembrane domain (TM) of the Vpu protein of human immunodeficiency virus type 1 (HIV-1) contributes to the pathogenesis of SHIV{sub KU-1bMC33} in macaques and that the TM domain of Vpu could be replaced with the M2 protein viroporin from influenza A virus. Recently, we showed that the replacement of the TM domain of Vpu with that of the M2 protein of influenza A virus resulted in a virus (SHIV{sub M2}) that was sensitive to rimantadine [Hout, D.R., Gomez, M.L., Pacyniak, E., Gomez, L.M., Inbody, S.H., Mulcahy, E.R., Culley, N., Pinson, D.M.,more » Powers, M.F., Wong, S.W., Stephens, E.B., 2006. Substitution of the transmembrane domain of Vpu in simian human immunodeficiency virus (SHIV{sub KU-1bMC33}) with that of M2 of influenza A results in a virus that is sensitive to inhibitors of the M2 ion channel and is pathogenic for pig-tailed macaques. Virology 344, 541-558]. Based on previous studies of the M2 protein which have shown that the His-X-X-X-Trp motif within the M2 is essential to the function of the M2 proton channel, we have constructed a novel SHIV in which the alanine at position 19 of the TM domain was replaced with a histidine residue resulting in the motif His-Ile-Leu-Val-Trp. The SHIV{sub VpuA19H} replicated with similar kinetics as the parental SHIV{sub KU-1bMC33} and pulse-chase analysis revealed that the processing of viral proteins was similar to SHIV{sub KU-1bMC33}. This SHIV{sub VpuA19H} virus was found to be more sensitive to the M2 ion channel blocker rimantadine than SHIV{sub M2}. Electron microscopic examination of SHIV{sub VpuA19H}-infected cells treated with rimantadine revealed an accumulation of viral particles at the cell surface and within intracellular vesicles, which was similar to that previously observed to SHIV{sub M2}-infected cells treated with rimantadine. These data indicate that the Vpu protein of HIV-1 can be converted into a rimantadine-sensitive ion channel with the alteration of one amino acid and provide additional evidence that drugs targeting the Vpu TM/ion channel can be effective anti-HIV-1 drugs.« less

  6. Identification and genetic characterization of unique HIV-1 A1/C recombinant strain in South Africa.

    PubMed

    Musyoki, Andrew M; Rakgole, Johnny N; Selabe, Gloria; Mphahlele, Jeffrey

    2015-03-01

    HIV isolates from South Africa are predominantly subtype C. Sporadic isolation of non-C strains has been reported mainly in cosmopolitan cities. HIV isolate j51 was recovered from a rural South African heterosexual female aged 51 years. Near full length amplification of the genome was attempted using PCR with primers targeting overlapping segments of the HIV genome. Analysis of 5593 bp (gag to vpu) at a bootstrap value greater than 70% found that all but the vpu gene was HIV-1 subtype A1. The vpu gene was assigned HIV-1 subtype C. The recombination breaking point was estimated at position 6035+/- 15 bp with reference to the beginning of the HXB2 reference strain. Isolate j51 revealed a unique genome constellation to previously reported recombinant strains with parental A/C backbones from South Africa though a common recombination with subtype C within the vpu gene. Identification of recombinant strains supports continued surveillance of HIV genetic diversity.

  7. BST-2 Expression Modulates Small CD4-Mimetic Sensitization of HIV-1-Infected Cells to Antibody-Dependent Cellular Cytotoxicity

    PubMed Central

    Prévost, Jérémie; von Bredow, Benjamin; Ding, Shilei; Brassard, Nathalie; Medjahed, Halima; Coutu, Mathieu; Melillo, Bruno; Bibollet-Ruche, Frédéric; Hahn, Beatrice H.; Kaufmann, Daniel E.; Smith, Amos B.; Sodroski, Joseph; Sauter, Daniel; Kirchhoff, Frank; Gee, Katrina; Neil, Stuart J.; Evans, David T.

    2017-01-01

    ABSTRACT Antibodies recognizing conserved CD4-induced (CD4i) epitopes on human immunodeficiency virus type 1 (HIV-1) Env and able to mediate antibody-dependent cellular cytotoxicity (ADCC) have been shown to be present in sera from most HIV-1-infected individuals. These antibodies preferentially recognize Env in its CD4-bound conformation. CD4 downregulation by Nef and Vpu dramatically reduces exposure of CD4i HIV-1 Env epitopes and therefore reduce the susceptibility of HIV-1-infected cells to ADCC mediated by HIV-positive (HIV+) sera. Importantly, this mechanism of immune evasion can be circumvented with small-molecule CD4 mimetics (CD4mc) that are able to transition Env into the CD4-bound conformation and sensitize HIV-1-infected cells to ADCC mediated by HIV+ sera. However, HIV-1 developed additional mechanisms to avoid ADCC, including Vpu-mediated BST-2 antagonism, which decreases the overall amount of Env present at the cell surface. Accordingly, BST-2 upregulation in response to alpha interferon (IFN-α) was shown to increase the susceptibility of HIV-1-infected cells to ADCC despite the activity of Vpu. Here we show that BST-2 upregulation by IFN-β and interleukin-27 (IL-27) also increases the surface expression of Env and thus boosts the ability of CD4mc to sensitize HIV-1-infected cells to ADCC by sera from HIV-1-infected individuals. IMPORTANCE HIV-1 evolved sophisticated strategies to conceal Env epitopes from ADCC-mediating antibodies present in HIV+ sera. Vpu-mediated BST-2 downregulation was shown to decrease ADCC responses by limiting the amount of Env present at the cell surface. This effect of Vpu was shown to be attenuated by IFN-α treatment. Here we show that in addition to IFN-α, IFN-β and IL-27 also affect Vpu-mediated BST-2 downregulation and greatly enhance ADCC responses against HIV-1-infected cells in the presence of CD4mc. These findings may inform strategies aimed at HIV prevention and eradication. PMID:28331088

  8. A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

    PubMed

    Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

    2015-01-01

    The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

  9. HIV-1 Nef and Vpu Interfere with L-Selectin (CD62L) Cell Surface Expression To Inhibit Adhesion and Signaling in Infected CD4+ T Lymphocytes

    PubMed Central

    Vassena, Lia; Giuliani, Erica; Koppensteiner, Herwig; Bolduan, Sebastian; Schindler, Michael

    2015-01-01

    ABSTRACT Leukocyte recirculation between blood and lymphoid tissues is required for the generation and maintenance of immune responses against pathogens and is crucially controlled by the L-selectin (CD62L) leukocyte homing receptor. CD62L has adhesion and signaling functions and initiates the capture and rolling on the vascular endothelium of cells entering peripheral lymph nodes. This study reveals that CD62L is strongly downregulated on primary CD4+ T lymphocytes upon infection with human immunodeficiency virus type 1 (HIV-1). Reduced cell surface CD62L expression was attributable to the Nef and Vpu viral proteins and not due to increased shedding via matrix metalloproteases. Both Nef and Vpu associated with and sequestered CD62L in perinuclear compartments, thereby impeding CD62L transport to the plasma membrane. In addition, Nef decreased total CD62L protein levels. Importantly, infection with wild-type, but not Nef- and Vpu-deficient, HIV-1 inhibited the capacity of primary CD4+ T lymphocytes to adhere to immobilized fibronectin in response to CD62L ligation. Moreover, HIV-1 infection impaired the signaling pathways and costimulatory signals triggered in primary CD4+ T cells by CD62L ligation. We propose that HIV-1 dysregulates CD62L expression to interfere with the trafficking and activation of infected T cells. Altogether, this novel HIV-1 function could contribute to virus dissemination and evasion of host immune responses. IMPORTANCE L-selectin (CD62L) is an adhesion molecule that mediates the first steps of leukocyte homing to peripheral lymph nodes, thus crucially controlling the initiation and maintenance of immune responses to pathogens. Here, we report that CD62L is downmodulated on the surfaces of HIV-1-infected T cells through the activities of two viral proteins, Nef and Vpu, that prevent newly synthesized CD62L molecules from reaching the plasma membrane. We provide evidence that CD62L downregulation on HIV-1-infected primary T cells results in impaired adhesion and signaling functions upon CD62L triggering. Removal of cell surface CD62L may predictably keep HIV-1-infected cells away from lymph nodes, the privileged sites of both viral replication and immune response activation, with important consequences, such as systemic viral spread and evasion of host immune surveillance. Altogether, we propose that Nef- and Vpu-mediated subversion of CD62L function could represent a novel determinant of HIV-1 pathogenesis. PMID:25822027

  10. Molecular epidemiology of HIV-1 among the HIV infected people of Manipur, Northeastern India: Emergence of unique recombinant forms.

    PubMed

    Sharma, Adhikarimayum Lakhikumar; Singh, Thiyam Ramsing; Devi, Khuraijam Ranjana; Singh, Lisam Shanjukumar

    2017-06-01

    According to the Joint National Programme on HIV/AIDS (UNAIDS), the northeastern region of India has the highest HIV prevalence in the country. This study was conducted to determine the current HIV-1 molecular epidemiology of Manipur, a state in northeast India. Blood samples from HIV-1 seropositive subjects were collected between June 2011 and February 2014. The partial regions of HIV-1 genes; pol and tat-vpu-env were independently amplified, sequenced, analyzed, and genotyped. Based on all sequences generated from 110 samples using pol and/or tat-vpu-env gene, the overall HIV-1 genotypes distribution of Manipur was as follows: 65.45% (72/110) subtype C, 32.73% (36/110) unique recombinant forms (URFs), and 1.82% (2/110) subtype B. The distribution of HIV-1 genotypes among the risk groups was: heterosexual: 58.33% (35/60) subtype C, 38.33% (23/60) URFs, and 3.34% (2/60) subtype B; intravenous drug users (IDUs): 85.36% (35/41) subtype C, 9.76% (4/41) URFs, and 4.88% (2/41) subtype B; mother to child (MTC): 50% (3/6) URFs and 50% (3/6) subtype C and blood transfusion: 100% (3/3) subtype C. The findings for the first time revealed the emergence of URFs of HIV-1 in Manipur which is predominant among the sexual and MTC risk groups as compared to IDUs. Taking together, this study illustrated that Manipur is the "recombinant hotspot of HIV" of India. The results will provide the clinical importance for continuous monitoring of HIV-infections in order to design appropriate prevention measures to limit the spread of new HIV infections. © 2016 Wiley Periodicals, Inc.

  11. Novel Acylguanidine-Based Inhibitor of HIV-1

    PubMed Central

    Mwimanzi, Philip; Tietjen, Ian; Miller, Scott C.; Shahid, Aniqa; Cobarrubias, Kyle; Kinloch, Natalie N.; Baraki, Bemuluyigza; Richard, Jonathan; Finzi, Andrés; Fedida, David; Brumme, Zabrina L.

    2016-01-01

    ABSTRACT The emergence of transmissible HIV-1 strains with resistance to antiretroviral drugs highlights a continual need for new therapies. Here we describe a novel acylguanidine-containing compound, 1-(2-(azepan-1-yl)nicotinoyl)guanidine (or SM111), that inhibits in vitro replication of HIV-1, including strains resistant to licensed protease, reverse transcriptase, and integrase inhibitors, without major cellular toxicity. At inhibitory concentrations, intracellular p24Gag production was unaffected, but virion release (measured as extracellular p24Gag) was reduced and virion infectivity was substantially impaired, suggesting that SM111 acts at a late stage of viral replication. SM111-mediated inhibition of HIV-1 was partially overcome by a Vpu I17R mutation alone or a Vpu W22* truncation in combination with Env N136Y. These mutations enhanced virion infectivity and Env expression on the surface of infected cells in the absence and presence of SM111 but also impaired Vpu's ability to downregulate CD4 and BST2/tetherin. Taken together, our results support acylguanidines as a class of HIV-1 inhibitors with a distinct mechanism of action compared to that of licensed antiretrovirals. Further research on SM111 and similar compounds may help to elucidate knowledge gaps related to Vpu's role in promoting viral egress and infectivity. IMPORTANCE New inhibitors of HIV-1 replication may be useful as therapeutics to counteract drug resistance and as reagents to perform more detailed studies of viral pathogenesis. SM111 is a small molecule that blocks the replication of wild-type and drug-resistant HIV-1 strains by impairing viral release and substantially reducing virion infectivity, most likely through its ability to prevent Env expression at the infected cell surface. Partial resistance to SM111 is mediated by mutations in Vpu and/or Env, suggesting that the compound affects host/viral protein interactions that are important during viral egress. Further characterization of SM111 and similar compounds may allow more detailed pharmacological studies of HIV-1 egress and provide opportunities to develop new treatments for HIV-1. PMID:27512074

  12. Remodeling of the Host Cell Plasma Membrane by HIV-1 Nef and Vpu: A Strategy to Ensure Viral Fitness and Persistence.

    PubMed

    Sugden, Scott M; Bego, Mariana G; Pham, Tram N Q; Cohen, Éric A

    2016-03-03

    The plasma membrane protects the cell from its surroundings and regulates cellular communication, homing, and metabolism. Not surprisingly, the composition of this membrane is highly controlled through the vesicular trafficking of proteins to and from the cell surface. As intracellular pathogens, most viruses exploit the host plasma membrane to promote viral replication while avoiding immune detection. This is particularly true for the enveloped human immunodeficiency virus (HIV), which assembles and obtains its lipid shell directly at the plasma membrane. HIV-1 encodes two proteins, negative factor (Nef) and viral protein U (Vpu), which function primarily by altering the quantity and localization of cell surface molecules to increase virus fitness despite host antiviral immune responses. These proteins are expressed at different stages in the HIV-1 life cycle and employ a variety of mechanisms to target both unique and redundant surface proteins, including the viral receptor CD4, host restriction factors, immunoreceptors, homing molecules, tetraspanins and membrane transporters. In this review, we discuss recent progress in the study of the Nef and Vpu targeting of host membrane proteins with an emphasis on how remodeling of the cell membrane allows HIV-1 to avoid host antiviral immune responses leading to the establishment of systemic and persistent infection.

  13. A cell-free stock of simian-human immunodeficiency virus that causes AIDS in pig-tailed macaques has a limited number of amino acid substitutions in both SIVmac and HIV-1 regions of the genome and has offered cytotropism.

    PubMed

    Stephens, E B; Mukherjee, S; Sahni, M; Zhuge, W; Raghavan, R; Singh, D K; Leung, K; Atkinson, B; Li, Z; Joag, S V; Liu, Z Q; Narayan, O

    1997-05-12

    We have examined both the sequence changes in the LTR, gag, vif, vpr, vpx, tat, rev, vpu, env, and nef genes and the cell tropism of a cell-free stock of chimeric simian-human immunodeficiency virus (SHIV) isolated from the cerebrospinal fluid of a pig-tailed macaque (PNb) that developed AIDS. This virus (SHIVKU-1) is highly pathogenic when inoculated into other macaques. DNA sequence analysis of PCR-amplified products revealed a total of 5 nucleotide changes in the LTR while vif had 2 consensus amino acid changes. The gag, vif, and vpx had no consensus amino acid substitutions, whereas vpr had 1 consensus substitution. The tat and rev genes of the HXB2 region of SHIVKU-1 had 2 and 1 consensus amino acid changes, respectively. The vpu gene of the HXB2 region of SHIV, which originally had an ACG at the beginning of the gene, reverted to an initiation ATG codon and in addition contained a consensus amino acid substitution at position 69 of this protein. As expected, the majority of the nucleotide substitutions were found in the env and nef genes. Thirteen and 5 amino acid changes were predicted for the corresponding Env and Nef proteins, respectively. In addition, one-third of the env gene clones isolated from the SHIVKU-1 stock had a 5-amino-acid deletion in the V4 region. Using three independent assays, we determined that the changes in the SHIVKU-1 were associated with an increase in the efficiency of replication in macrophages. The strikingly few consensus changes in the virus suggest that conversion of this virus to one capable of causing AIDS in pig-tailed macaques was associated with relatively few changes in the viral envelope and/or accessory genes. These results will provide the basis for the development of a pathogenic, molecular clone of SHIV capable of causing AIDS in pig-tailed macaques.

  14. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    PubMed Central

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  15. Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

    PubMed

    Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

    2016-03-18

    Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

  16. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

    PubMed Central

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

  17. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

    PubMed

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

  18. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    PubMed

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  19. Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

    PubMed Central

    Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

    1984-01-01

    Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

  20. Transmitted/Founder HIV-1 Subtype C Viruses Show Distinctive Signature Patterns in Vif, Vpr, and Vpu That Are Under Subsequent Immune Pressure During Early Infection.

    PubMed

    Rossenkhan, Raabya; MacLeod, Iain J; Brumme, Zabrina L; Magaret, Craig A; Sebunya, Theresa K; Musonda, Rosemary; Gashe, Berhanu A; Edlefsen, Paul T; Novitsky, Vlad; Essex, M

    Viral variants that predominate during early infection may exhibit constrained diversity compared with those found during chronic infection and could contain amino acid signature patterns that may enhance transmission, establish productive infection, and influence early events that modulate the infection course. We compared amino acid distributions in 17 patients recently infected with HIV-1C with patients with chronic infection. We found significantly lower entropy in inferred transmitted/founder (t/f) compared with chronic viruses and identified signature patterns in Vif and Vpr from inferred t/f viruses. We investigated sequence evolution longitudinally up to 500 days postseroconversion and compared the impact of selected substitutions on predicted human leukocyte antigen (HLA) binding affinities of published and predicted cytotoxic T-lymphocyte epitopes. Polymorphisms in Vif and Vpr during early infection occurred more frequently at epitope-HLA anchor residues and significantly decreased predicted epitope-HLA binding. Transmission-associated sequence signatures may have implications for novel strategies to prevent HIV-1 transmission.

  1. Transmitted/Founder HIV-1 Subtype C Viruses Show Distinctive Signature Patterns in Vif, Vpr, and Vpu That Are Under Subsequent Immune Pressure During Early Infection

    PubMed Central

    Rossenkhan, Raabya; MacLeod, Iain J.; Brumme, Zabrina L.; Magaret, Craig A.; Sebunya, Theresa K.; Musonda, Rosemary; Gashe, Berhanu A.; Edlefsen, Paul T.; Novitsky, Vlad

    2016-01-01

    Abstract Viral variants that predominate during early infection may exhibit constrained diversity compared with those found during chronic infection and could contain amino acid signature patterns that may enhance transmission, establish productive infection, and influence early events that modulate the infection course. We compared amino acid distributions in 17 patients recently infected with HIV-1C with patients with chronic infection. We found significantly lower entropy in inferred transmitted/founder (t/f) compared with chronic viruses and identified signature patterns in Vif and Vpr from inferred t/f viruses. We investigated sequence evolution longitudinally up to 500 days postseroconversion and compared the impact of selected substitutions on predicted human leukocyte antigen (HLA) binding affinities of published and predicted cytotoxic T-lymphocyte epitopes. Polymorphisms in Vif and Vpr during early infection occurred more frequently at epitope-HLA anchor residues and significantly decreased predicted epitope-HLA binding. Transmission-associated sequence signatures may have implications for novel strategies to prevent HIV-1 transmission. PMID:27349335

  2. Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes.

    PubMed

    Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P

    2007-08-01

    To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.

  3. The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

    PubMed Central

    Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

    1980-01-01

    Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

  4. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    PubMed

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  5. The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

    PubMed Central

    White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

    1991-01-01

    By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

  6. Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

    PubMed Central

    Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

    1984-01-01

    We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

  7. Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication

    PubMed Central

    Robson, Nicole D.; Telesnitsky, Alice

    2000-01-01

    Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073

  8. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  9. Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.

    PubMed

    Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E

    2001-06-01

    Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.

  10. Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

    PubMed Central

    Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

    2015-01-01

    Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

  11. Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

    PubMed Central

    SivaRaman, L; Subramanian, S; Thimmappaya, B

    1986-01-01

    Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

  12. Primate lentiviruses use at least three alternative strategies to suppress NF-κB-mediated immune activation

    PubMed Central

    Gawanbacht, Ali; Van Driessche, Benoît; Van Lint, Carine; Peeters, Martine; Kirchhoff, Frank

    2017-01-01

    Primate lentiviruses have evolved sophisticated strategies to suppress the immune response of their host species. For example, HIV-2 and most simian immunodeficiency viruses (SIVs) use their accessory protein Nef to prevent T cell activation and antiviral gene expression by downmodulating the T cell receptor CD3. This Nef function was lost in HIV-1 and other vpu-encoding viruses suggesting that the acquisition of Vpu-mediated NF-κB inhibition reduced the selection pressure for inhibition of T cell activation by Nef. To obtain further insights into the modulation of NF-κB activity by primate lentiviral accessory factors, we analyzed 32 Vpr proteins from a large panel of divergent primate lentiviruses. We found that those of SIVcol and SIVolc infecting Colobinae monkeys showed the highest efficacy in suppressing NF-κB activation. Vpr-mediated inhibition of NF-κB resulted in decreased IFNβ promoter activity and suppressed type I IFN induction in virally infected primary cells. Interestingly, SIVcol and SIVolc differ from all other primate lentiviruses investigated by the lack of both, a vpu gene and efficient Nef-mediated downmodulation of CD3. Thus, primate lentiviruses have evolved at least three alternative strategies to inhibit NF-κB-dependent immune activation. Functional analyses showed that the inhibitory activity of SIVolc and SIVcol Vprs is independent of DCAF1 and the induction of cell cycle arrest. While both Vprs target the IKK complex or a factor further downstream in the NF-κB signaling cascade, only SIVolc Vpr stabilizes IκBα and inhibits p65 phosphorylation. Notably, only de-novo synthesized but not virion-associated Vpr suppressed the activation of NF-κB, thus enabling NF-κB-dependent initiation of viral gene transcription during early stages of the replication cycle, while minimizing antiviral gene expression at later stages. Our findings highlight the key role of NF-κB in antiviral immunity and demonstrate that primate lentiviruses follow distinct evolutionary paths to modulate NF-κB-dependent expression of viral and antiviral genes. PMID:28859166

  13. Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

    PubMed

    Joshee, N; Kisaka, H; Kitagawa, Y

    1998-01-01

    One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

  14. Functional identification and regulatory analysis of Δ6-fatty acid desaturase from the oleaginous fungus Mucor sp. EIM-10.

    PubMed

    Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong

    2017-03-01

    To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.

  15. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  16. Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

    PubMed Central

    Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

    1990-01-01

    We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

  17. The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

    PubMed Central

    Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

    1982-01-01

    The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

  18. Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

    PubMed

    Lin, Min; Dan, Hanhong; Li, Yijing

    2004-02-01

    Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

  19. Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

    PubMed

    Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

    2014-08-01

    30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

  20. The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

    PubMed Central

    Williams, N P; Mueller, P P; Hinnebusch, A G

    1988-01-01

    Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

  1. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  2. Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

    PubMed Central

    Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

    2003-01-01

    The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

  3. Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

    PubMed

    Lee, Sooncheol; Kang, Changwon

    2011-05-06

    The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

  4. DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

    PubMed Central

    Link, Gerhard

    1984-01-01

    A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

  5. Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours.

    PubMed

    Sastre-Garau, X; Favre, M; Couturier, J; Orth, G

    2000-08-01

    We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.

  6. Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements

    PubMed Central

    Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.

    2014-01-01

    The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924

  7. Avoidance of truncated proteins from unintended ribosome binding sites within heterologous protein coding sequences.

    PubMed

    Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E

    2015-03-20

    Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.

  8. Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

    PubMed Central

    Stone, D E; Craig, E A

    1990-01-01

    To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

  9. Characterization of ROP18 alleles in human toxoplasmosis.

    PubMed

    Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique

    2014-04-01

    The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.

  10. Building a dictionary for genomes: Identification of presumptive regulatory sites by statistical analysis

    PubMed Central

    Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.

    2000-01-01

    The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202

  11. Feline immunodeficiency virus envelope glycoproteins antagonize tetherin through a distinctive mechanism that requires virion incorporation.

    PubMed

    Morrison, James H; Guevara, Rebekah B; Marcano, Adriana C; Saenz, Dyana T; Fadel, Hind J; Rogstad, Daniel K; Poeschla, Eric M

    2014-03-01

    BST2/tetherin inhibits the release of enveloped viruses from cells. Primate lentiviruses have evolved specific antagonists (Vpu, Nef, and Env). Here we characterized tetherin proteins of species representing both branches of the order Carnivora. Comparison of tiger and cat (Feliformia) to dog and ferret (Caniformia) genes demonstrated that the tiger and cat share a start codon mutation that truncated most of the tetherin cytoplasmic tail early in the Feliformia lineage (19 of 27 amino acids, including the dual tyrosine motif). Alpha interferon (IFN-α) induced tetherin and blocked feline immunodeficiency virus (FIV) replication in lymphoid and nonlymphoid feline cells. Budding of bald FIV and HIV particles was blocked by carnivore tetherins. However, infectious FIV particles were resistant, and spreading FIV replication was uninhibited. Antagonism mapped to the envelope glycoprotein (Env), which rescued FIV from carnivore tetherin restriction when expressed in trans but, in contrast to known antagonists, did not rescue noncognate particles. Also unlike the primate lentiviral antagonists, but similar to the Ebola virus glycoprotein, FIV Env did not reduce intracellular or cell surface tetherin levels. Furthermore, FIV-enveloped FIV particles actually required tetherin for optimal release from cells. The results show that FIV Envs mediate a distinctive tetherin evasion. Well adapted to a phylogenetically ancient tetherin tail truncation in the Felidae, it requires functional virion incorporation of Env, and it shields the budding particle without downregulating plasma membrane tetherin. Moreover, FIV has evolved dependence on this protein: particles containing FIV Env need tetherin for optimal release from the cell, while Env(-) particles do not. HIV-1 antagonizes the restriction factor tetherin with the accessory protein Vpu, while HIV-2 and the filovirus Ebola use their envelope (Env) glycoproteins for this purpose. It turns out that the FIV tetherin antagonist is also its Env protein, but the mechanism is distinctive. Unlike other tetherin antagonists, FIV Env cannot act in trans to rescue vpu-deficient HIV-1. It must be incorporated specifically into FIV virions to be active. Also unlike other retroviral antagonists, but similar to Ebola virus Env, it does not act by downregulating or degrading tetherin. FIV Env might exclude tetherin locally or direct assembly to tetherin-negative membrane domains. Other distinctive features are apparent, including evidence that this virus evolved an equilibrium in which tetherin is both restriction factor and cofactor, as FIV requires tetherin for optimal particle release.

  12. Improved efficiency in amplification of Escherichia coli o-antigen gene clusters using genome-wide sequence comparison

    USDA-ARS?s Scientific Manuscript database

    Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...

  13. B-Bolivia, an Allele of the Maize b1 Gene with Variable Expression, Contains a High Copy Retrotransposon-Related Sequence Immediately Upstream1

    PubMed Central

    Selinger, David A.; Chandler, Vicki L.

    2001-01-01

    The maize (Zea mays) b1 gene encodes a transcription factor that regulates the anthocyanin pigment pathway. Of the b1 alleles with distinct tissue-specific expression, B-Peru and B-Bolivia are the only alleles that confer seed pigmentation. B-Bolivia produces variable and weaker seed expression but darker, more regular plant expression relative to B-Peru. Our experiments demonstrated that B-Bolivia is not expressed in the seed when transmitted through the male. When transmitted through the female the proportion of kernels pigmented and the intensity of pigment varied. Molecular characterization of B-Bolivia demonstrated that it shares the first 530 bp of the upstream region with B-Peru, a region sufficient for seed expression. Immediately upstream of 530 bp, B-Bolivia is completely divergent from B-Peru. These sequences share sequence similarity to retrotransposons. Transient expression assays of various promoter constructs identified a 33-bp region in B-Bolivia that can account for the reduced aleurone pigment amounts (40%) observed with B-Bolivia relative to B-Peru. Transgenic plants carrying the B-Bolivia promoter proximal region produced pigmented seeds. Similar to native B-Bolivia, some transgene loci are variably expressed in seeds. In contrast to native B-Bolivia, the transgene loci are expressed in seeds when transmitted through both the male and female. Some transgenic lines produced pigment in vegetative tissues, but the tissue-specificity was different from B-Bolivia, suggesting the introduced sequences do not contain the B-Bolivia plant-specific regulatory sequences. We hypothesize that the chromatin context of the B-Bolivia allele controls its epigenetic seed expression properties, which could be influenced by the adjacent highly repeated retrotransposon sequence. PMID:11244116

  14. Two alternative ways of start site selection in human norovirus reinitiation of translation.

    PubMed

    Luttermann, Christine; Meyers, Gregor

    2014-04-25

    The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

  15. Dissipative Particle Dynamics at Isothermal, Isobaric Conditions Using Shardlow-Like Splitting Algorithms

    DTIC Science & Technology

    2013-09-01

    probability density                                         Tk W p VPu m Tk W p VPH p,V i i ij CG ij i

  16. Activation/proliferation and apoptosis of bystander goat lymphocytes induced by a macrophage-tropic chimeric caprine arthritis encephalitis virus expressing SIV Nef

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bouzar, Baya Amel; Rea, Angela; Hoc-Villet, Stephanie

    Caprine arthritis encephalitis virus (CAEV) is the natural lentivirus of goats, well known for its tropism for macrophages and its inability to cause infection in lymphocytes. The viral genome lacks nef, tat, vpu and vpx coding sequences. To test the hypothesis that when nef is expressed by the viral genome, the virus became toxic for lymphocytes during replication in macrophages, we inserted the SIVsmm PBj14 nef coding sequences into the genome of CAEV thereby generating CAEV-nef. This recombinant virus is not infectious for lymphocytes but is fully replication competent in goat macrophages in which it constitutively expresses the SIV Nef.more » We found that goat lymphocytes cocultured with CAEV-nef-infected macrophages became activated, showing increased expression of the interleukin-2 receptor (IL-2R). Activation correlated with increased proliferation of the cells. Interestingly, a dual effect in terms of apoptosis regulation was observed in exposed goat lymphocytes. Nef was found first to induce a protection of lymphocytes from apoptosis during the first few days following exposure to infected macrophages, but later it induced increased apoptosis in the activated lymphocytes. This new recombinant virus provides a model to study the functions of Nef in the context of infection of macrophages, but in absence of infection of T lymphocytes and brings new insights into the biological effects of Nef on lymphocytes.« less

  17. Budding Capability of the Influenza Virus Neuraminidase Can Be Modulated by Tetherin▿

    PubMed Central

    Yondola, Mark A.; Fernandes, Fiona; Belicha-Villanueva, Alan; Uccelini, Melissa; Gao, Qinshan; Carter, Carol; Palese, Peter

    2011-01-01

    We have determined that, in addition to its receptor-destroying activity, the influenza virus neuraminidase is capable of efficiently forming virus-like particles (VLPs) when expressed individually from plasmid DNA. This observation applies to both human subtypes of neuraminidase, N1 and N2. However, it is not found with every strain of influenza virus. Through gain-of-function and loss-of-function analyses, a critical determinant within the neuraminidase ectodomain was identified that contributes to VLP formation but is not sufficient to accomplish release of plasmid-derived VLPs. This sequence lies on the plasma membrane-proximal side of the neuraminidase globular head. Most importantly, we demonstrate that the antiviral restriction factor tetherin plays a role in determining the strain-specific limitations of release competency. If tetherin is counteracted by small interfering RNA knockdown or expression of the HIV anti-tetherin factor vpu, budding and release capability is bestowed upon an otherwise budding-deficient neuraminidase. These data suggest that budding-competent neuraminidase proteins possess an as-yet-unidentified means of counteracting the antiviral restriction factor tetherin and identify a novel way in which the influenza virus neuraminidase can contribute to virus release. PMID:21209114

  18. In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

    PubMed Central

    Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

    2011-01-01

    To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

  19. Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.

    PubMed Central

    Lo, W Y; Ting, L P

    1994-01-01

    Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237

  20. LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

    PubMed

    Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

    2018-05-17

    Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

  1. Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol.

    PubMed

    Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R

    2004-07-01

    The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.

  2. PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

    PubMed Central

    Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

    2008-01-01

    Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

  3. Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

    PubMed

    Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

    2003-07-04

    The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

  4. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

    DOE PAGES

    Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

    2015-03-22

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

  5. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

  6. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

    PubMed

    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

    2015-06-01

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  7. Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

    PubMed Central

    Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

    2015-01-01

    Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

  8. Macrolide resistance in Legionella pneumophila: the role of LpeAB efflux pump.

    PubMed

    Massip, Clémence; Descours, Ghislaine; Ginevra, Christophe; Doublet, Patricia; Jarraud, Sophie; Gilbert, Christophe

    2017-05-01

    A previous study on 12 in vitro -selected azithromycin-resistant Legionella pneumophila lineages showed that ribosomal mutations were major macrolide resistance determinants. In addition to these mechanisms that have been well described in many species, mutations upstream of lpeAB operon, homologous to acrAB in Escherichia coli , were identified in two lineages. In this study, we investigated the role of LpeAB and of these mutations in macrolide resistance of L. pneumophila . The role of LpeAB was studied by testing the antibiotic susceptibility of WT, deleted and complemented L. pneumophila Paris strains. Translational fusion experiments using GFP as a reporter were conducted to investigate the consequences of the mutations observed in the upstream sequence of lpeAB operon. We demonstrated the involvement of LpeAB in an efflux pump responsible for a macrolide-specific reduced susceptibility of L. pneumophila Paris strain. Mutations in the upstream sequence of lpeAB operon were associated with an increased protein expression. Increased expression was also observed under sub-inhibitory macrolide concentrations in strains with both mutated and WT promoting regions. LpeAB are components of an efflux pump, which is a macrolide resistance determinant in L. pneumophila Paris strain. Mutations observed in the upstream sequence of lpeAB operon in resistant lineages led to an overexpression of this efflux pump. Sub-inhibitory concentrations of macrolides themselves participated in upregulating this efflux and could constitute a first step in the acquisition of a high macrolide resistance level. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Myostatin-2 gene structure and polymorphism of the promoter and first intron in the marine fish Sparus aurata: evidence for DNA duplications and/or translocations.

    PubMed

    Nadjar-Boger, Elisabeth; Funkenstein, Bruria

    2011-02-01

    Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.

  10. Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression.

    PubMed

    Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

    2008-04-08

    The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located approximately 2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation.

  11. LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).

    PubMed

    Hobson, Neil; Deyholos, Michael K

    2013-04-01

    Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.

  12. Analysis of alterative cleavage and polyadenylation by 3′ region extraction and deep sequencing

    PubMed Central

    Hoque, Mainul; Ji, Zhe; Zheng, Dinghai; Luo, Wenting; Li, Wencheng; You, Bei; Park, Ji Yeon; Yehia, Ghassan; Tian, Bin

    2012-01-01

    Alternative cleavage and polyadenylation (APA) leads to mRNA isoforms with different coding sequences (CDS) and/or 3′ untranslated regions (3′UTRs). Using 3′ Region Extraction And Deep Sequencing (3′READS), a method which addresses the internal priming and oligo(A) tail issues that commonly plague polyA site (pA) identification, we comprehensively mapped pAs in the mouse genome, thoroughly annotating 3′ ends of genes and revealing over five thousand pAs (~8% of total) flanked by A-rich sequences, which have hitherto been overlooked. About 79% of mRNA genes and 66% of long non-coding RNA (lncRNA) genes have APA; but these two gene types have distinct usage patterns for pAs in introns and upstream exons. Promoter-distal pAs become relatively more abundant during embryonic development and cell differentiation, a trend affecting pAs in both 3′-most exons and upstream regions. Upregulated isoforms generally have stronger pAs, suggesting global modulation of the 3′ end processing activity in development and differentiation. PMID:23241633

  13. Design, Development, Pre-Testing and Preparation for Full Scale Cold Testing of a System for Field Remediation of Vertical Pipe Units at the Hanford Site 618-10 Burial Grounds -12495

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Halliwell, Stephen

    2012-07-01

    At the Hanford site, in the 1950's and 60's, radioactive waste materials, including Transuranic (TRU) wastes from a number of laboratories were stored in vertical pipe units (VPUs) in what are now the 618-10 and 618-11 burial grounds. Although the current physical condition of the VPUs is unknown, initial R and D studies had shown that in-ground size reduction and stabilization of VPU contents was feasible. This paper describes the R and D work and testing activities to validate the concept of in-ground size reduction and stabilization of VPU contents, and the design and pre-testing of major plant items andmore » augering systems on full size simulated VPUs. The paper also describes the full size prototype equipment which will be used in full size cold testing of simulated VPUs off the Hanford site, to prove the equipment, develop operating procedures, and train operators prior to deployment on site. Safe and effective field remediation, removal and disposal of the VPUs in the 600 area are critical to the success of the River Corridor Closure Contract at the U.S. Department of Energy's Hanford Site. Safe and effective field remediation, removal and disposal of the VPUs in the 600 area are critical to the success of the River Corridor Closure Contract at the U.S. Department of Energy's Hanford Site. (authors)« less

  14. Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

    2010-02-19

    Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

  15. Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection

    NASA Technical Reports Server (NTRS)

    Harada, Kazuo; Orgel, Leslie E.

    1993-01-01

    We have used in vitro selection techniques to characterize DNA sequences that are ligated efficiently by T4 DNA ligase. We find that the ensemble of selected sequences ligates about 50 times as efficiently as the random mixture of sequences used as the input for selection. Surprisingly many of the selected sequences failed to produce a match at or close to the ligation junction. None of the 20 selected oligomers that we sequenced produced a match two bases upstream from the ligation junction.

  16. A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon

    PubMed Central

    Carlo, Troy; Sierra, Rebecca; Berget, Susan M.

    2000-01-01

    Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741

  17. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    PubMed

    Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

    2013-01-01

    Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  18. Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

    PubMed

    Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

    1991-11-20

    A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

  19. Feline Immunodeficiency Virus Envelope Glycoproteins Antagonize Tetherin through a Distinctive Mechanism That Requires Virion Incorporation

    PubMed Central

    Guevara, Rebekah B.; Marcano, Adriana C.; Saenz, Dyana T.; Fadel, Hind J.; Rogstad, Daniel K.

    2014-01-01

    ABSTRACT BST2/tetherin inhibits the release of enveloped viruses from cells. Primate lentiviruses have evolved specific antagonists (Vpu, Nef, and Env). Here we characterized tetherin proteins of species representing both branches of the order Carnivora. Comparison of tiger and cat (Feliformia) to dog and ferret (Caniformia) genes demonstrated that the tiger and cat share a start codon mutation that truncated most of the tetherin cytoplasmic tail early in the Feliformia lineage (19 of 27 amino acids, including the dual tyrosine motif). Alpha interferon (IFN-α) induced tetherin and blocked feline immunodeficiency virus (FIV) replication in lymphoid and nonlymphoid feline cells. Budding of bald FIV and HIV particles was blocked by carnivore tetherins. However, infectious FIV particles were resistant, and spreading FIV replication was uninhibited. Antagonism mapped to the envelope glycoprotein (Env), which rescued FIV from carnivore tetherin restriction when expressed in trans but, in contrast to known antagonists, did not rescue noncognate particles. Also unlike the primate lentiviral antagonists, but similar to the Ebola virus glycoprotein, FIV Env did not reduce intracellular or cell surface tetherin levels. Furthermore, FIV-enveloped FIV particles actually required tetherin for optimal release from cells. The results show that FIV Envs mediate a distinctive tetherin evasion. Well adapted to a phylogenetically ancient tetherin tail truncation in the Felidae, it requires functional virion incorporation of Env, and it shields the budding particle without downregulating plasma membrane tetherin. Moreover, FIV has evolved dependence on this protein: particles containing FIV Env need tetherin for optimal release from the cell, while Env− particles do not. IMPORTANCE HIV-1 antagonizes the restriction factor tetherin with the accessory protein Vpu, while HIV-2 and the filovirus Ebola use their envelope (Env) glycoproteins for this purpose. It turns out that the FIV tetherin antagonist is also its Env protein, but the mechanism is distinctive. Unlike other tetherin antagonists, FIV Env cannot act in trans to rescue vpu-deficient HIV-1. It must be incorporated specifically into FIV virions to be active. Also unlike other retroviral antagonists, but similar to Ebola virus Env, it does not act by downregulating or degrading tetherin. FIV Env might exclude tetherin locally or direct assembly to tetherin-negative membrane domains. Other distinctive features are apparent, including evidence that this virus evolved an equilibrium in which tetherin is both restriction factor and cofactor, as FIV requires tetherin for optimal particle release. PMID:24390322

  20. EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

    PubMed

    Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

    2014-11-01

    The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

  1. HIV, HBV, and HCV molecular epidemiology among trans (transvestites, transsexuals, and transgender) sex workers in Argentina.

    PubMed

    Carobene, Mauricio; Bolcic, Federico; Farías, María Sol Dos Ramos; Quarleri, Jorge; Avila, María Mercedes

    2014-01-01

    Commercial sex work is frequent among male-to-female transvestites, transsexuals and transgenders in Argentina, leading to high susceptibility to HIV, HBV, and HCV among other sexually transmitted infections. In a global context of scarce data on the trans sex workers population, this study was aimed to study the genomic characterization of these viruses. Plasma presence of HIV, HBV, and HCV genomic material was evaluated in samples from 273 trans sex workers. Genomic sequences of HIV-gag, pol, and vif-vpu genes, HBV-S gene, and HCV-5'UT and NS5B genes were obtained. Molecular characterization involved phylogenetic analysis and several in silico tools. Resistance-associated mutations in HIV and HBV pol genes were also analyzed. The HIV genomic characterization in 62 trans sex workers samples showed that 54.8% of the isolates corresponded to BF intersubtype recombinants, and 38.7% to subtype B. The remaining were classified as subtypes C (4.8%) and A (1.6%). HBV and HCV co-infection prevalence among HIV positive trans sex workers yielded rates of 3.2% and 6.5% respectively. Drug resistance-associated mutations were found in 12/62 (19%) HIV pol sequences, but none among HBV. Based on phylogenetic relationships, HIV isolates characterized as subtypes BF and B appeared intermingled with those from other high-risk groups. Despite trans sex workers declared not to have received antiviral treatment, complex drug resistance-associated mutation patterns were found in several HIV isolates. Planned prevention, screening, and treatment are needed to reduce further transmission and morbidity. © 2013 Wiley Periodicals, Inc.

  2. Similar Replicative Fitness Is Shared by the Subtype B and Unique BF Recombinant HIV-1 Isolates that Dominate the Epidemic in Argentina

    PubMed Central

    Rubio, Andrea E.; Abraha, Awet; Carpenter, Crystal A.; Troyer, Ryan M.; Reyes-Rodríguez, Ángel L.; Salomon, Horacio; Arts, Eric J.; Tebit, Denis M.

    2014-01-01

    The HIV-1 epidemic in South America is dominated by pure subtypes (mostly B and C) and more than 7 BF and BC recombinant forms. In Argentina, circulating recombinant forms (CRFs) comprised of subtypes B and F make up more than 50% of HIV infections. For this study, 28 HIV-1 primary isolates were obtained from patients in Buenos Aires, Argentina and initially classified into subtype B (n = 9, 32.1%), C (n = 1, 3.6%), and CRFs (n = 18, 64.3%) using partial pol and vpu-env sequences, which proved to be inconsistent and inaccurate for these phylogenetic analyses. Near full length genome sequences of these primary HIV-1 isolates revealed that nearly all intersubtype BF recombination sites were unique and countered previous “CRF” B/F classifications. The majority of these Argentinean HIV-1 isolates were CCR5-using but 4 had a dual/mixed tropism as predicted by both phenotypic and genotypic assays. Comparison of the replicative fitness of these BF primary HIV-1 isolates to circulating B, F, and C HIV-1 using pairwise competitions in peripheral blood mononuclear cells (PBMCs) indicated a similarity in fitness of these BF recombinants to subtypes B and F HIV-1 (of the same co-receptor usage) whereas subtype C HIV-1 was significantly less fit than all as previously reported. These results suggest that the multitude of BF HIV-1 strains present within the Argentinean population do not appear to have gained replicative fitness following recent B and F recombination events. PMID:24727861

  3. The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

    PubMed Central

    2014-01-01

    Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

  4. Sense transcription through the S region is essential for immunoglobulin class switch recombination

    PubMed Central

    Haddad, Dania; Oruc, Zéliha; Puget, Nadine; Laviolette-Malirat, Nathalie; Philippe, Magali; Carrion, Claire; Le Bert, Marc; Khamlichi, Ahmed Amine

    2011-01-01

    Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands. PMID:21378751

  5. Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

    PubMed Central

    Graveley, Brenton R.

    2008-01-01

    Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

  6. PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches

    PubMed Central

    Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David

    2001-01-01

    Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

  7. A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

    PubMed Central

    León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

    2013-01-01

    Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

  8. A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

    PubMed

    Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

    1994-12-01

    We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

  9. Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

    PubMed Central

    Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

    1993-01-01

    Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

  10. Reducing DNA context dependence in bacterial promoters

    PubMed Central

    Carr, Swati B.; Densmore, Douglas M.

    2017-01-01

    Variation in the DNA sequence upstream of bacterial promoters is known to affect the expression levels of the products they regulate, sometimes dramatically. While neutral synthetic insulator sequences have been found to buffer promoters from upstream DNA context, there are no established methods for designing effective insulator sequences with predictable effects on expression levels. We address this problem with Degenerate Insulation Screening (DIS), a novel method based on a randomized 36-nucleotide insulator library and a simple, high-throughput, flow-cytometry-based screen that randomly samples from a library of 436 potential insulated promoters. The results of this screen can then be compared against a reference uninsulated device to select a set of insulated promoters providing a precise level of expression. We verify this method by insulating the constitutive, inducible, and repressible promotors of a four transcriptional-unit inverter (NOT-gate) circuit, finding both that order dependence is largely eliminated by insulation and that circuit performance is also significantly improved, with a 5.8-fold mean improvement in on/off ratio. PMID:28422998

  11. Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

    PubMed Central

    Sasaki, H; Yokoyama, E; Kuroiwa, A

    1990-01-01

    The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

  12. Overexpression of the Lactobacillus plantarum peptidoglycan biosynthesis murA2 gene increases the tolerance of Escherichia coli to alcohols and enhances ethanol production.

    PubMed

    Yuan, Yongbo; Bi, Changhao; Nicolaou, Sergios A; Zingaro, Kyle A; Ralston, Matthew; Papoutsakis, Eleftherios T

    2014-10-01

    A major challenge in producing chemicals and biofuels is to increase the tolerance of the host organism to toxic products or byproducts. An Escherichia coli strain with superior ethanol and more generally alcohol tolerance was identified by screening a library constructed by randomly integrating Lactobacillus plantarum genomic DNA fragments into the E. coli chromosome via Cre-lox recombination. Sequencing identified the inserted DNA fragment as the murA2 gene and its upstream intergenic 973-bp sequence, both coded on the negative genomic DNA strand. Overexpression of this murA2 gene and its upstream 973-bp sequence significantly enhanced ethanol tolerance in both E. coli EC100 and wild type E. coli MG1655 strains by 4.1-fold and 2.0-fold compared to control strains, respectively. Tolerance to n-butanol and i-butanol in E. coli MG1655 was increased by 1.85-fold and 1.91-fold, respectively. We show that the intergenic 973-bp sequence contains a native promoter for the murA2 gene along with a long 5' UTR (286 nt) on the negative strand, while a noncoding, small RNA, named MurA2S, is expressed off the positive strand. MurA2S is expressed in E. coli and may interact with murA2, but it does not affect murA2's ability to enhance alcohol tolerance in E. coli. Overexpression of murA2 with its upstream region in the ethanologenic E. coli KO11 strain significantly improved ethanol production in cultures that simulate the industrial Melle-Boinot fermentation process.

  13. Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression

    PubMed Central

    Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

    2008-01-01

    The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located ≈2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation. PMID:18385377

  14. Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

    PubMed Central

    Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

    2012-01-01

    Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

  15. Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

    PubMed

    Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

    2013-06-21

    Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

  16. Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

    PubMed Central

    Gilmartin, G M; Fleming, E S; Oetjen, J

    1992-01-01

    The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

  17. End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

    PubMed

    Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

    2015-12-01

    Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

  18. Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica

    PubMed Central

    Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.

    2006-01-01

    The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115

  19. Induction of surfactin production in Bacillus subtilis by gsp, a gene located upstream of the gramicidin S operon in Bacillus brevis.

    PubMed Central

    Borchert, S; Stachelhaus, T; Marahiel, M A

    1994-01-01

    The deduced amino acid sequence of the gsp gene, located upstream of the 5' end of the gramicidin S operon (grs operon) in Bacillus brevis, showed a high degree of similarity to the sfp gene product, which is located downstream of the srfA operon in B. subtilis. The gsp gene complemented in trans a defect in the sfp gene (sfpO) and promoted production of the lipopeptide antibiotic surfactin. The functional homology of Gsp and Sfp and the sequence similarity of these two proteins to EntD suggest that the three proteins represent a new class of proteins involved in peptide secretion, in support of a hypothesis published previously (T. H. Grossman, M. Tuckman, S. Ellestad, and M. S. Osburne, J. Bacteriol. 175:6203-6211, 1993). Images PMID:7512553

  20. VIZARD: analysis of Affymetrix Arabidopsis GeneChip data

    NASA Technical Reports Server (NTRS)

    Moseyko, Nick; Feldman, Lewis J.

    2002-01-01

    SUMMARY: The Affymetrix GeneChip Arabidopsis genome array has proved to be a very powerful tool for the analysis of gene expression in Arabidopsis thaliana, the most commonly studied plant model organism. VIZARD is a Java program created at the University of California, Berkeley, to facilitate analysis of Arabidopsis GeneChip data. It includes several integrated tools for filtering, sorting, clustering and visualization of gene expression data as well as tools for the discovery of regulatory motifs in upstream sequences. VIZARD also includes annotation and upstream sequence databases for the majority of genes represented on the Affymetrix Arabidopsis GeneChip array. AVAILABILITY: VIZARD is available free of charge for educational, research, and not-for-profit purposes, and can be downloaded at http://www.anm.f2s.com/research/vizard/ CONTACT: moseyko@uclink4.berkeley.edu.

  1. Analysis of C. elegans VIG-1 expression.

    PubMed

    Shin, Kyoung-Hwa; Choi, Boram; Park, Yang-Seo; Cho, Nam Jeong

    2008-12-31

    Double-stranded RNA (dsRNA) induces gene silencing in a sequence-specific manner by a process known as RNA interference (RNAi). The RNA-induced silencing complex (RISC) is a multi-subunit ribonucleoprotein complex that plays a key role in RNAi. VIG (Vasa intronic gene) has been identified as a component of Drosophila RISC; however, the role VIG plays in regulating RNAi is poorly understood. Here, we examined the spatial and temporal expression patterns of VIG-1, the C. elegans ortholog of Drosophila VIG, using a vig-1::gfp fusion construct. This construct contains the 908-bp region immediately upstream of vig-1 gene translation initiation site. Analysis by confocal microscopy demonstrated GFP-VIG-1 expression in a number of tissues including the pharynx, body wall muscle, hypodermis, intestine, reproductive system, and nervous system at the larval and adult stages. Furthermore, western blot analysis showed that VIG-1 is present in each developmental stage examined. To investigate regulatory sequences for vig-1 gene expression, we generated constructs containing deletions in the upstream region. It was determined that the GFP expression pattern of a deletion construct (delta-908 to -597) was generally similar to that of the non-deletion construct. In contrast, removal of a larger segment (delta-908 to -191) resulted in the loss of GFP expression in most cell types. Collectively, these results indicate that the 406-bp upstream region (-596 to -191) contains essential regulatory sequences required for VIG-1 expression.

  2. Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

    PubMed

    Berends Sexton, T; Jones, J T; Mullet, J E

    1990-05-01

    A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

  3. Intron Definition Is Required for Excision of the Minute Virus of Mice Small Intron and Definition of the Upstream Exon

    PubMed Central

    Haut, Donald D.; Pintel, D. J.

    1998-01-01

    Alternative splicing of pre-mRNAs plays a critical role in maximizing the coding capacity of the small parvovirus genome. The small-intron region of minute virus of mice (MVM) pre-mRNAs undergoes an unusual pattern of overlapping alternative splicing—using two donors (D1 and D2) and two acceptors (A1 and A2) within a region of 120 nucleotides—that determines the steady-state ratios of the various viral mRNAs. In this report, we show that the determinants that govern excision of the small intron are complex and are also required for efficient definition of the upstream exon. For the MVM small intron in its natural context, the two donors appear to compete for the splicing machinery: the position of D1 favors its usage, while the primary sequence of D2 must be more like the consensus sequence than is D1 to be used efficiently. We have genetically defined the branch points that are used for generation of the major and minor spliced forms and show that recognition of components of the small-intron acceptors is likely to be the dominant determinant in alternative small-intron excision. We have also identified a G-rich intronic enhancer sequence within the small intron that is essential for splicing of the minor form (D2 to A2) but not the major form (D1 to A1) of MVM mRNAs and is required for efficient definition of the upstream NS2-specific exon. In its natural context, the small intron appears to be excised by a mechanism consistent with intron definition. When the MVM small intron is expanded, various parameters of its excision are altered, indicating that critical cis-acting signals are context dependent. Relative use of the donors and acceptors is altered, and the upstream NS2-specific exon is no longer efficiently defined. The fact that definition of the upstream NS2-specific exon can be achieved by the MVM small intron in its natural context, but not when it is expanded, suggests that the multiple determinants that govern definition and excision of the small intron are required, in concert, for upstream exon definition. Our data are consistent with a model in which alternative splicing of the MVM P4-generated pre-mRNAs is governed by a hybrid of intron- and exon-defining mechanisms. PMID:9499034

  4. Genetic diversity among the Eurytemora affinis species complex in the Scheldt estuary and its tributaries using ISSR-PCR marker assay

    NASA Astrophysics Data System (ADS)

    Gasmi, S.; Ferval, M.; Pelissier, C.; D'Amico, F.; Maris, T.; Tackx, M.; Legal, L.

    2014-05-01

    As an estuary being restored, the Scheldt (Belgium/The Netherlands) offers an interesting setting to study the response of organisms and ecosystems to changing conditions. This study specifically deals with this with regard to the spatio-temporal distribution and possible genetic differentiation among the species complex Eurytemora affinis (copepoda, calanoida). Until the 1990s, E. affinis typically occurred downstream the Scheldt estuary (Belgium/The Netherlands). In parallel to water quality improvement, E.affinis has recently also occurred upstream the estuary and in some of the tributaries. This paper aims to assess the origin of the copepod sibling species complex E. affinis occurring upstream the Scheldt estuary through genetic characterization. Using the Inter Simple Sequence Repeat (ISSR) technique, we explored genetic pools of the E. affinis complex in three Scheldt localities (downstream, middle-estuary and upstream) and two of its tributaries. Four ISSR primers produced 75 polymorphic loci. Bayesian and hierarchical analysis revealed different but close genetic entities in both down and upstream localities. The middle-estuary individuals were genetically a composite mix of downstream and upstream populations (84% from downstream and 16% from upstream). A distinctive separation of the tributaries and the main Scheldt stream populations suggests that two fully independent genetic pools are present. It is of note that the tributaries showed a lack of genetic subdivision, that upstream and downstream E. affinis populations are closely related, and that the downstream population is most likely at the origin of the upstream one, which implies the necessity to guarantee sufficient oxygen concentration levels throughout the estuarine continuum to guarantee the presence of this species upstream. The results of the ISSR technique are discussed in comparison with genetic studies on E. affinis using COI barcoding.

  5. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    PubMed

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  6. Prevalence and genotypic characterization of Human Parvovirus B19 in children with measles- and rubella-like illness in Iran.

    PubMed

    Rezaei, Farhad; Sarshari, Behrang; Ghavami, Nastaran; Meysami, Parisa; Shadab, Azadeh; Salimi, Hamid; Mokhtari-Azad, Talat

    2016-06-01

    Human Parvovirus B19 (B19V) is a prototype of the Erythroparvovirus genus in Parvoviridae family. B19V infections are often associated with fever and rash, and can be mistakenly reported as measles or rubella. Differential diagnosis of B19V illness is necessary for case management and also for public health control activities, particularly in outbreak situations in which measles or rubella is suspected. To investigate the causative role of B19V infection in children with measles- and rubella-like illness, a total of 583 sera from children with exanthema were tested for presence of B19V by determining anti-B19V IgG and IgM antibodies by ELISA as well as B19V DNA detection by nested PCR. DNA positive samples were assessed further for determination of viral load and sequence analysis by Real-Time PCR and Sanger sequencing method, respectively. Out of 583 patients, 112 (19.21%) patients were positive for B19V-IgM antibody, 110 (18.87%) were positive for B19V-IgG antibody, and 63 (10.81%) were positive for B19V viral DNA. The frequency of B19V-IgG antibodies were increased with age; that is children under 6 year old showed 7.11% seroprevalence for B19V-IgG as compared to 18.39% and 28.91% for age groups 6 to >11 and 11-14 years old, respectively. Phylogenetic analysis of the NS1-VPu1 overlapping region revealed that all sequenced B19V-DNA belonged to genotype 1. The results of this study may aid the surveillance programs aiming at eradicating measles/rubella virus in Iran, as infections with B19V can be mistakenly reported as measles or rubella if laboratory testing is not conducted. © 2015 Wiley Periodicals, Inc.

  7. Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

    PubMed Central

    Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

    1982-01-01

    The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

  8. Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

    PubMed

    Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

    2012-09-01

    Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

    PubMed

    Kim, K H; Hemenway, C

    1997-05-26

    The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

  10. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buchman, A.R.; Kimmerly, W.J.; Rine, J.

    1988-01-01

    Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

  11. Novel multiregion hybridization assay for the identification of the most prevalent genetic forms of the human immunodeficiency virus type 1 circulating in Portugal.

    PubMed

    Freitas, Ferdinando B; Esteves, Aida; Piedade, João; Parreira, Ricardo

    2013-02-01

    The most efficient method for HIV-1 genetic characterization involves full-genome sequencing, but the associated costs, technical features, and low throughput preclude it from being routinely used for the analysis of large numbers of viral strains. Multiregion hybridization assays (MHA) represent an alternative for a consistent genetic analysis of large numbers of viral strains. Classically, MHA rely on the amplification by real-time PCR of several regions scattered along the HIV-1 genome, and on their characterization with clade-specific TaqMan probes (also known as hydrolysis probes). In this context, the aim of our study was the development of a technical variant of an MHA (vMHA(B/G/02)) for genotyping the most prevalent genetic forms of HIV-1 circulating in Portugal. Different sets of primers were designed for universal and clade-specific amplifications of several sections of the viral genome: gag, pol(Pr), pol(RT), vpu, env(gp120), and env(gp41). vMHA(B/G/02) was implemented using a real-time PCR-based approach, with detection dependent on the use of SYBR Green I. As an alternative, a technically less demanding strategy based on conventional PCR and agarose gel analysis of the reaction products was also developed. This method performed with overall good sensitivity and specificity (>91%) when a convenience sample of 45 plasma-derived HIV-1 strains was analyzed. Apart from the detection of subtype B, G, CRF02_AG, and CRF14_BG viruses, several unique B/G recombinant were also detected. Curiously, recombinant viruses including CRF02_AG sequences were not detected in the group of samples analyzed.

  12. Modulation of tissue repair by regeneration enhancer elements.

    PubMed

    Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D

    2016-04-14

    How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.

  13. Translation of the mRNA of the maize transcriptional activator Opaque-2 is inhibited by upstream open reading frames present in the leader sequence.

    PubMed Central

    Lohmer, S; Maddaloni, M; Motto, M; Salamini, F; Thompson, R D

    1993-01-01

    The protein encoded by the Opaque-2 (O2) gene is a transcription factor, translated from an mRNA that possesses an unusually long 5' leader sequence containing three upstream open reading frames (uORFs). The efficiency of translation of O2 mRNA has been tested in vivo by a transient assay in which the level of activation of the b32 promoter, a natural target of O2 protein, is measured. We show that uORF-less O2 alleles possess a higher transactivation value than the wild-type allele and that the reduction in transactivation due to the uORFs is a cis-dominant effect. The data presented indicate that both uORF1 and uORF2 are involved in the reducing effect and suggest that both are likely to be translated. PMID:8439744

  14. Human Promoters Are Intrinsically Directional

    PubMed Central

    Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe

    2015-01-01

    Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469

  15. Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

    PubMed

    Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

    2017-11-01

    Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

    PubMed Central

    Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

    2014-01-01

    The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

  17. Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

    PubMed Central

    Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

    2010-01-01

    Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

  18. Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

    PubMed

    Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

    2013-10-01

    Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

  19. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

    1988-08-01

    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

  20. Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

    PubMed Central

    Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

    1988-01-01

    We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

  1. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

    PubMed

    Levis, R; Schlesinger, S; Huang, H V

    1990-04-01

    Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

  2. Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

    PubMed

    Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

    1987-12-08

    The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

  3. Characterization of Cer-1 cis-regulatory region during early Xenopus development.

    PubMed

    Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António

    2011-05-01

    Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.

  4. Multiple splicing defects in an intronic false exon.

    PubMed

    Sun, H; Chasin, L A

    2000-09-01

    Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

  5. A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

    PubMed

    Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

    2013-12-01

    The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  6. Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

    PubMed

    Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

    2005-08-01

    The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

  7. Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

    PubMed Central

    Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

    2005-01-01

    The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

  8. Development of a bioassay to screen for chemicals mimicking the anti-aging effects of calorie restriction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu

    2010-10-15

    Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less

  9. Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

    PubMed Central

    Laimins, L; Holmgren-König, M; Khoury, G

    1986-01-01

    The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

  10. Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

    PubMed

    Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

    2013-09-01

    The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

  11. Dual Transcriptomic Profiling of Host and Microbiota during Health and Disease in Pediatric Asthma.

    PubMed

    Pérez-Losada, Marcos; Castro-Nallar, Eduardo; Bendall, Matthew L; Freishtat, Robert J; Crandall, Keith A

    2015-01-01

    High-throughput sequencing (HTS) analysis of microbial communities from the respiratory airways has heavily relied on the 16S rRNA gene. Given the intrinsic limitations of this approach, airway microbiome research has focused on assessing bacterial composition during health and disease, and its variation in relation to clinical and environmental factors, or other microbiomes. Consequently, very little effort has been dedicated to describing the functional characteristics of the airway microbiota and even less to explore the microbe-host interactions. Here we present a simultaneous assessment of microbiome and host functional diversity and host-microbe interactions from the same RNA-seq experiment, while accounting for variation in clinical metadata. Transcriptomic (host) and metatranscriptomic (microbiota) sequences from the nasal epithelium of 8 asthmatics and 6 healthy controls were separated in silico and mapped to available human and NCBI-NR protein reference databases. Human genes differentially expressed in asthmatics and controls were then used to infer upstream regulators involved in immune and inflammatory responses. Concomitantly, microbial genes were mapped to metabolic databases (COG, SEED, and KEGG) to infer microbial functions differentially expressed in asthmatics and controls. Finally, multivariate analysis was applied to find associations between microbiome characteristics and host upstream regulators while accounting for clinical variation. Our study showed significant differences in the metabolism of microbiomes from asthmatic and non-asthmatic children for up to 25% of the functional properties tested. Enrichment analysis of 499 differentially expressed host genes for inflammatory and immune responses revealed 43 upstream regulators differentially activated in asthma. Microbial adhesion (virulence) and Proteobacteria abundance were significantly associated with variation in the expression of the upstream regulator IL1A; suggesting that microbiome characteristics modulate host inflammatory and immune systems during asthma.

  12. Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

    PubMed Central

    Kyöstiö, S R; Cramer, C L; Lacy, G H

    1991-01-01

    The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

  13. Identification and expression analysis of cDNA encoding insulin-like growth factor 2 in horses

    PubMed Central

    KIKUCHI, Kohta; SASAKI, Keisuke; AKIZAWA, Hiroki; TSUKAHARA, Hayato; BAI, Hanako; TAKAHASHI, Masashi; NAMBO, Yasuo; HATA, Hiroshi; KAWAHARA, Manabu

    2017-01-01

    Insulin-like growth factor 2 (IGF2) is responsible for a broad range of physiological processes during fetal development and adulthood, but genomic analyses of IGF2 containing the 5ʹ- and 3ʹ-untranslated regions (UTRs) in equines have been limited. In this study, we characterized the IGF2 mRNA containing the UTRs, and determined its expression pattern in the fetal tissues of horses. The complete equine IGF2 mRNA sequence harboring another exon approximately 2.8 kb upstream from the canonical transcription start site was identified as a new transcript variant. As this upstream exon did not contain the start codon, the amino acid sequence was identical to the canonical variant. Analysis of the deduced amino acid sequence revealed that the protein possessed two major domains, IlGF and IGF2_C, and analysis of IGF2 sequence polymorphism in fetal tissues of Hokkaido native horse and Thoroughbreds revealed a single nucleotide polymorphism (T to C transition) at position 398 in Thoroughbreds, which caused an amino acid substitution at position 133 in the IGF2 sequence. Furthermore, the expression pattern of the IGF2 mRNA in the fetal tissues of horses was determined for the first time, and was found to be consistent with those of other species. Taken together, these results suggested that the transcriptional and translational products of the IGF2 gene have conserved functions in the fetal development of mammals, including horses. PMID:29151450

  14. Identification, cloning, and sequencing of a fragment of Amsacta moorei entomopoxvirus DNA containing the spheroidin gene and three vaccinia virus-related open reading frames.

    PubMed Central

    Hall, R L; Moyer, R W

    1991-01-01

    Entomopoxvirus virions are frequently contained within crystalline occlusion bodies, which are composed of primarily a single protein, spheroidin, which is analogous to the polyhedrin protein of baculovirus. The spheroidin gene of Amsacta moorei entomopoxvirus was identified following the microsequencing of polypeptides generated from cyanogen bromide treatment of spheroidin and the subsequent synthesis of oligonucleotide hybridization probes. DNA sequencing of a 6.8-kb region of DNA containing the spheroidin gene showed that the spheroidin protein is derived from a 3.0-kb open reading frame potentially encoding a protein of 115 kDa. Three copies of the heptanucleotide, TTTTTNT, a sequence associated with early gene transcription in the vertebrate poxviruses, and four in-frame translational termination signals were found within 60 bp upstream of the putative spheroidin gene promoter (TAAATG). The spheroidin gene promoter region contains the sequence TAAATG, which is found in many late promoters of the vertebrate poxviruses and which serves as the site of transcriptional initiation, as shown by primer extension. Primer extension experiments also showed that spheroidin gene transcripts contain 5' poly(A) sequences typical of vertebrate poxvirus late transcripts. The 92 bases upstream of the initiating TAAATG are unusually A + T rich and contain only 7 G or C residues. An analysis of open reading frames around the spheroidin gene suggests that the colinear core of "essential genes" typical of the vertebrate poxviruses is absent in A. moorei entomopoxvirus. Images PMID:1942245

  15. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing

    PubMed Central

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

    2010-01-01

    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome. PMID:20392818

  16. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing.

    PubMed

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

    2010-08-01

    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

  17. Fungal Genes in Context: Genome Architecture Reflects Regulatory Complexity and Function

    PubMed Central

    Noble, Luke M.; Andrianopoulos, Alex

    2013-01-01

    Gene context determines gene expression, with local chromosomal environment most influential. Comparative genomic analysis is often limited in scope to conserved or divergent gene and protein families, and fungi are well suited to this approach with low functional redundancy and relatively streamlined genomes. We show here that one aspect of gene context, the amount of potential upstream regulatory sequence maintained through evolution, is highly predictive of both molecular function and biological process in diverse fungi. Orthologs with large upstream intergenic regions (UIRs) are strongly enriched in information processing functions, such as signal transduction and sequence-specific DNA binding, and, in the genus Aspergillus, include the majority of experimentally studied, high-level developmental and metabolic transcriptional regulators. Many uncharacterized genes are also present in this class and, by implication, may be of similar importance. Large intergenic regions also share two novel sequence characteristics, currently of unknown significance: they are enriched for plus-strand polypyrimidine tracts and an information-rich, putative regulatory motif that was present in the last common ancestor of the Pezizomycotina. Systematic consideration of gene UIR in comparative genomics, particularly for poorly characterized species, could help reveal organisms’ regulatory priorities. PMID:23699226

  18. Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase

    PubMed Central

    Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

    2008-01-01

    Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404

  19. Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.

    PubMed

    Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

    2008-04-28

    In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.

  20. Novel mechanism of conjoined gene formation in the human genome.

    PubMed

    Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

    2012-03-01

    Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

  1. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

    PubMed Central

    Levis, R; Schlesinger, S; Huang, H V

    1990-01-01

    Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

  2. Carbapenem-Resistant Acinetobacter baumannii from Serbia: Revision of CarO Classification

    PubMed Central

    Novovic, Katarina; Mihajlovic, Sanja; Vasiljevic, Zorica; Filipic, Brankica; Begovic, Jelena; Jovcic, Branko

    2015-01-01

    Carbapenem-resistant A. baumannii present a significant therapeutic challenge for the treatment of nosocomial infections in many European countries. Although it is known that the gradient of A. baumannii prevalence increases from northern to southern Europe, this study provides the first data from Serbia. Twenty-eight carbapenem-resistant A. baumannii clinical isolates were collected at a Serbian pediatric hospital during a 2-year period. The majority of isolates (67.68%) belonged to the sequence type Group 1, European clonal complex II. All isolates harbored intrinsic OXA-51 and AmpC cephalosporinase. OXA-23 was detected in 16 isolates (57.14%), OXA-24 in 23 isolates (82.14%) and OXA-58 in 11 isolates (39.29%). Six of the isolates (21.43%) harbored all of the analyzed oxacillinases, except OXA-143 and OXA-235 that were not detected in this study. Production of oxacillinases was detected in different pulsotypes indicating the presence of horizontal gene transfer. NDM-1, VIM and IMP were not detected in analyzed clinical A. baumannii isolates. ISAba1 insertion sequence was present upstream of OXA-51 in one isolate, upstream of AmpC in 13 isolates and upstream of OXA-23 in 10 isolates. In silico analysis of carO sequences from analyzed A. baumannii isolates revealed the existence of two out of six highly polymorphic CarO variants. The phylogenetic analysis of CarO protein among Acinetobacter species revised the previous classification CarO variants into three groups based on strong bootstraps scores in the tree analysis. Group I comprises four variants (I-IV) while Groups II and III contain only one variant each. One half of the Serbian clinical isolates belong to Group I variant I, while the other half belongs to Group I variant III. PMID:25822626

  3. Genetic characterization of the UCS and Kex1 loci of Pneumocystis jirovecii.

    PubMed

    Esteves, F; Tavares, A; Costa, M C; Gaspar, J; Antunes, F; Matos, O

    2009-02-01

    Nucleotide variation in the Pneumocystis jirovecii upstream conserved sequence (UCS) and kexin-like serine protease (Kex1) loci was studied in pulmonary specimens from Portuguese HIV-positive patients. DNA was extracted and used for specific molecular sequence analysis. The number of UCS tandem repeats detected in 13 successfully sequenced isolates ranged from three (9 isolates, 69%) to four (4 isolates, 31%). A novel tandem repeat pattern and two novel polymorphisms were detected in the UCS region. For the Kex1 gene, the wild-type (24 isolates, 86%) was the most frequent sequence detected among the 28 sequenced isolates. Nevertheless, a nonsynonymous (1 isolate, 3%) and three synonymous (3 isolates, 11%) polymorphisms were detected and are described here for the first time.

  4. The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsugu, H.; Horowitz, R.; Gibson, N.

    1994-12-01

    Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less

  5. Observations on the Growth of Roughness Elements Into Icing Feathers

    NASA Technical Reports Server (NTRS)

    Vargas, Mario; Tsao, Jen, Ching

    2007-01-01

    This work presents the results of an experiment conducted in the Icing Research Tunnel at NASA Glenn Research Center to understand the process by which icing feathers are formed in the initial stages of ice accretion formation on swept wings. Close-up photographic data were taken on an aluminum NACA 0012 swept wing tip airfoil. Two types of photographic data were obtained: time sequence close-up photographic data during the run and close-up photographic data of the ice accretion at the end of each run. Icing runs were conducted for short ice accretion times from 10 to 180 sec. The time sequence close-up photographic data was used to study the process frame by frame and to create movies of how the process developed. The movies confirmed that at glaze icing conditions in the attachment line area icing feathers develop from roughness elements. The close-up photographic data at the end of each run showed that roughness elements change into a pointed shape with an upstream facet and join on the side with other elements having the same change to form ridges with pointed shape and upstream facet. The ridges develop into feathers when the upstream facet grows away to form the stem of the feather. The ridges and their growth into feathers were observed to form the initial scallop tips present in complete scallops.

  6. Molecular characterization of a 40 kDa OmpC-like porin from Serratia marcescens.

    PubMed

    Hutsul, J A; Worobec, E

    1994-02-01

    An oligonucleotide that encodes the N-terminal portion of a 41 kDa porin of Serratia marcescens was used to probe S. marcescens UOC-51 genomic DNA. An 11 kb EcoRI fragment which hybridized with the oligonucleotide was subcloned into Escherichia coli, examined for expression, and sequenced. The product expressed by the cloned gene was 40 kDa. The nucleotide sequence has an ORF of 1.13 kb. When the deduced amino acid sequence was aligned and compared to other enterobacterial porins the cloned S. marcescens porin most closely resembled E. coli OmpC. Although we did not detect osmoregulation or thermoregulation of any porins in S. marcescens UOC-51, sequences analogous to the E. coli osmoregulator OmpR-binding regions are seen upstream to the cloned gene. We examined the regulation of the S. marcescens porin in E. coli and found that its expression increased in a high salt environment. A micF gene, whose transcriptional product functions to inhibit synthesis of OmpF by hybridizing with the ompF transcript, was also seen upstream of the S. marcescens ompC. An alignment with the E. coli micF gene revealed that the functional region of the S. marcescens micF gene is conserved. Based on the results obtained we have determined that S. marcescens UOC-51 produces a 40 kDa porin similar to the E. coli OmpC porin.

  7. Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

    PubMed

    O'Sullivan, D J; O'Gara, F

    1991-08-01

    An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liebhaber, S.A.; Weiss, I.; Cash, F.E.

    Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

  9. The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

    PubMed

    Neuhaus, H; Link, G

    1987-01-01

    The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

  10. Influence of Forced Flow on the Dendritic Growth of Fe-C Alloy: 3D vs 2D Simulation

    NASA Astrophysics Data System (ADS)

    Wang, Weiling; Wang, Zhaohui; Luo, Sen; Ji, Cheng; Zhu, Miaoyong

    2017-12-01

    A 3D parallel cellular automaton-finite volume method (CA-FVM) model was used to simulate the equiaxed dendritic growth of an Fe-0.82 wt pct C alloy with xy- in- out and xyz- in- out type forced flows and the columnar dendritic growth with y- in- out type forced flow. In addition, the similarities and differences between the results of the 3D and 2D models are discussed and summarized in detail. The capabilities of the 3D and 2D CA-FVM models to predict the dendritic growth of the alloy with forced flow are validated through comparison with the boundary layer correction and Oseen-Ivanstov models, respectively. Because the forced flow can pass around perpendicular arms of the dendrites, the secondary arms at the sides upstream from the perpendicular arms are more developed than those on the upstream side of the upstream arms, especially at higher inlet velocities. In addition, compared to the xy- in- out case, the growth of the downstream arms is less inhibited and the secondary arms are more developed in the xyz- in- out case because of the greater lateral flow around their tips. Compared to the 3D case, the 2D equiaxed dendrites are more asymmetrical and lack secondary arms because of the thicker solute envelope. In the 3D case, the columnar dendrites on the upstream side (left one) are promoted, while the middle and downstream dendrites are inhibited in sequence. However, the sequential inhibition starts on the upstream side in the 2D case. This is mainly because the melt can pass around the upstream branch in 3D space. However, it can only climb over the upstream tip in 2D space. Additionally, the secondary arms show upstream development, which is more significant with increasing inlet velocity. The level of development of the secondary arms is also affected by the decay of the forced flow in the flow direction.

  11. DNA methylation inhibits expression and transposition of the Neurospora Tad retrotransposon.

    PubMed

    Zhou, Y; Cambareri, E B; Kinsey, J A

    2001-06-01

    Tad is a LINE-like retrotransposon of the filamentous fungus Neurospora crassa. We have analyzed both expression and transposition of this element using strains with a single copy of Tad located in the 5' noncoding sequences of the am (glutamate dehydrogenase) gene. Tad in this position has been shown to carry a de novo cytosine methylation signal which causes reversible methylation of both Tad and am upstream sequences. Here we find that methylation of the Tad sequences inhibits both Tad expression and transposition. This inhibition can be relieved by the use of 5-azacytidine, a drug which reduces cytosine methylation, or by placing the Tad/am sequences in a dim-2 genetic background.

  12. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    PubMed

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  13. Promoters, toll like receptors and microRNAs: a strange association.

    PubMed

    Korla, Kalyani; Arrigo, Patrizio; Mitra, Chanchal K

    2013-06-01

    Toll-like receptors (TLRs) are proteins that play key role in the innate immune system. In the present study, -1000 base pairs upstream are taken from the transcription start site of the various TLR genes (10 known) in human. About 40 microRNAs have been identified that share 12-19 nucleotide sequence similarity with the promoter regions of 10 TLRs. It is proposed that the microRNA performs potential role in identification of promoter sequence and initiation of transcription.

  14. RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

    PubMed

    Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

    2006-11-21

    Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

  15. Isolation of a gene (pbsC) required for siderophore biosynthesis in fluorescent Pseudomonas sp. strain M114.

    PubMed

    Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F

    1994-06-03

    An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.

  16. TEs or not TEs? That is the evolutionary question.

    PubMed

    Vaknin, Keren; Goren, Amir; Ast, Gil

    2009-10-23

    Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

  17. Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

    PubMed Central

    Hirsh, J; Morgan, B A; Scholnick, S B

    1986-01-01

    We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

  18. Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana.

    PubMed

    Qin, Yuxiang; Tian, Yanchen; Han, Lu; Yang, Xinchao

    2013-10-25

    The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusion between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway. Copyright © 2013. Published by Elsevier Inc.

  19. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    PubMed

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  20. Transcription of two adjacent carbohydrate utilization gene clusters in Bifidobacterium breve UCC2003 is controlled by LacI- and repressor open reading frame kinase (ROK)-type regulators.

    PubMed

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe

    2014-06-01

    Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.

  1. Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.

    PubMed

    Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li

    2014-10-01

    This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.

  2. Zadoff-Chu sequence-based hitless ranging scheme for OFDMA-PON configured 5G fronthaul uplinks

    NASA Astrophysics Data System (ADS)

    Reza, Ahmed Galib; Rhee, June-Koo Kevin

    2017-05-01

    A Zadoff-Chu (ZC) sequence-based low-complexity hitless upstream time synchronization scheme is proposed for an orthogonal frequency division multiple access passive optical network configured cloud radio access network fronthaul. The algorithm is based on gradual loading of the ZC sequences, where the phase discontinuity due to the cyclic prefix is alleviated by a frequency domain phase precoder, eliminating the requirements of guard bands to mitigate intersymbol interference and inter-carrier interference. Simulation results for uncontrolled-wavelength asynchronous transmissions from four concurrent transmitting optical network units are presented to demonstrate the effectiveness of the proposed scheme.

  3. Molecular Characterization of Lactobacillus plantarum DMDL 9010, a Strain with Efficient Nitrite Degradation Capacity

    PubMed Central

    Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang

    2014-01-01

    Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity. PMID:25423449

  4. Molecular characterization of Lactobacillus plantarum DMDL 9010, a strain with efficient nitrite degradation capacity.

    PubMed

    Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang

    2014-01-01

    Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity.

  5. The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

    PubMed Central

    Grichnik, J M; French, B A; Schwartz, R J

    1988-01-01

    The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

  6. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

    PubMed

    Means, A L; Farnham, P J

    1990-02-01

    We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

  7. Transcriptional mapping of the varicella-zoster virus regulatory genes encoding open reading frames 4 and 63.

    PubMed Central

    Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E

    1994-01-01

    Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496

  8. Functional analysis of the upstream regulatory region of chicken miR-17-92 cluster.

    PubMed

    Cheng, Min; Zhang, Wen-jian; Xing, Tian-yu; Yan, Xiao-hong; Li, Yu-mao; Li, Hui; Wang, Ning

    2016-08-01

    miR-17-92 cluster plays important roles in cell proliferation, differentiation, apoptosis, animal development and tumorigenesis. The transcriptional regulation of miR-17-92 cluster has been extensively studied in mammals, but not in birds. To date, avian miR-17-92 cluster genomic structure has not been fully determined. The promoter location and sequence of miR-17-92 cluster have not been determined, due to the existence of a genomic gap sequence upstream of miR-17-92 cluster in all the birds whose genomes have been sequenced. In this study, genome walking was used to close the genomic gap upstream of chicken miR-17-92 cluster. In addition, bioinformatics analysis, reporter gene assay and truncation mutagenesis were used to investigate functional role of the genomic gap sequence. Genome walking analysis showed that the gap region was 1704 bp long, and its GC content was 80.11%. Bioinformatics analysis showed that in the gap region, there was a 200 bp conserved sequence among the tested 10 species (Gallus gallus, Homo sapiens, Pan troglodytes, Bos taurus, Sus scrofa, Rattus norvegicus, Mus musculus, Possum, Danio rerio, Rana nigromaculata), which is core promoter region of mammalian miR-17-92 host gene (MIR17HG). Promoter luciferase reporter gene vector of the gap region was constructed and reporter assay was performed. The result showed that the promoter activity of pGL3-cMIR17HG (-4228/-2506) was 417 times than that of negative control (empty pGL3 basic vector), suggesting that chicken miR-17-92 cluster promoter exists in the gap region. To further gain insight into the promoter structure, two different truncations for the cloned gap sequence were generated by PCR. One had a truncation of 448 bp at the 5'-end and the other had a truncation of 894 bp at the 3'-end. Further reporter analysis showed that compared with the promoter activity of pGL3-cMIR17HG (-4228/-2506), the reporter activities of the 5'-end truncation and the 3'-end truncation were reduced by 19.82% and 60.14%, respectively. These data demonstrated that the important promoter region of chicken miR-17-92 cluster is located in the -3400/-2506 bp region. Our results lay the foundation for revealing the transcriptional regulatory mechanisms of chicken miR-17-92 cluster.

  9. Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: prediction and validation.

    PubMed

    Datta, Moumita; Choudhury, Ananyo; Lahiri, Ansuman; Bhattacharyya, Nitai P

    2011-09-26

    HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD.

  10. Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation

    PubMed Central

    2011-01-01

    Background HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD. PMID:21943362

  11. Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

    PubMed

    Bricheux, G; Brugerolle, G

    1997-08-01

    The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

  12. Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

    PubMed Central

    Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

    1995-01-01

    The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

  13. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    PubMed

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  14. Complete nucleotide sequence, genome organization, and biological properties of human immunodeficiency virus type 1 in vivo: evidence for limited defectiveness and complementation.

    PubMed Central

    Li, Y; Hui, H; Burgess, C J; Price, R W; Sharp, P M; Hahn, B H; Shaw, G M

    1992-01-01

    Previous studies of the genetic and biologic characteristics of human immunodeficiency virus type 1 (HIV-1) have by necessity used tissue culture-derived virus. We recently reported the molecular cloning of four full-length HIV-1 genomes directly from uncultured human brain tissue (Y. Li, J. C. Kappes, J. A. Conway, R. W. Price, G. M. Shaw, and B. H. Hahn, J. Virol. 65:3973-3985, 1991). In this report, we describe the biologic properties of these four clones and the complete nucleotide sequences and genome organization of two of them. Clones HIV-1YU-2 and HIV-1YU-10 were 9,174 and 9,176 nucleotides in length, differed by 0.26% in nucleotide sequence, and except for a frameshift mutation in the pol gene in HIV-1YU-10, contained open reading frames corresponding to 5'-gag-pol-vif-vpr-tat-rev-vpu-env-nef-3' flanked by long terminal repeats. HIV-1YU-2 was fully replication competent, while HIV-1YU-10 and two other clones, HIV-1YU-21 and HIV-1YU-32, were defective. All three defective clones, however, when transfected into Cos-1 cells in any pairwise combination, yielded virions that were replication competent and transmissible by cell-free passage. The cellular host range of HIV-1YU-2 was strictly limited to primary T lymphocytes and monocyte-macrophages, a property conferred by its external envelope glycoprotein. Phylogenetic analyses of HIV-1YU-2 gene sequences revealed this virus to be a member of the North American/European HIV-1 subgroup, with specific similarity to other monocyte-tropic viruses in its V3 envelope amino acid sequence. These results indicate that HIV-1 infection of brain is characterized by the persistence of mixtures of fully competent, minimally defective, and more substantially altered viral forms and that complementation among them is readily attainable. In addition, the limited degree of genotypic heterogeneity observed among HIV-1YU and other brain-derived viruses and their preferential tropism for monocyte-macrophages suggest that viral replication within the central nervous system may differ from that within the peripheral lymphoid compartment in significant and clinically important ways. The availability of genetically and biologically well characterized HIV-1 clones from uncultured human tissue should facilitate future studies of virus-cell interactions relevant to viral pathogenesis and drug and vaccine development. Images PMID:1404605

  15. Bioinformatic dissecting of TP53 regulation pathway underlying butyrate-induced histone modification in epigenetic regulation

    USDA-ARS?s Scientific Manuscript database

    Butyrate affects cell proliferation, differentiation and motility. Butyrate inhibits histone deacetylase (HDAC) activities and induces cell cycle arrest and apoptosis. TP53 is one of the most active upstream regulators discovered by IPA in our RNA sequencing data set. The TP53 signaling pathway pl...

  16. The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

    PubMed

    Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

    1999-09-24

    To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

  17. The control of lambda DNA terminase synthesis.

    PubMed Central

    Murialdo, H; Davidson, A; Chow, S; Gold, M

    1987-01-01

    Nu1 and A, the genes coding for bacteriophage lambda DNA terminase, rank among the most poorly translated genes expressed in E. coli. To understand the reason for this low level of translation the genes were cloned into plasmids and their expression measured. In addition, the wild type DNA sequences immediately preceding the genes were reduced and modified. It was found that the elements that control translation are contained in the 100 base pairs upstream from the initiation codon. Interchanging these upstream sequences with those of an efficiently translated gene dramatically increased the translation of terminase subunits. It seems unlikely that the rare codons present in the genes, and any feature of their mRNA secondary structure play a role in the control of their translation. The elimination of cos from plasmids containing Nu1 and A also resulted in an increase in terminase production. This result suggests a role for cos in the control of late gene expression. The terminase subunit overproducer strains are potentially very useful for the design of improved DNA packaging and cosmid mapping techniques. Images PMID:3029667

  18. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    PubMed Central

    2012-01-01

    Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

  19. Broad and Cross-Clade CD4+ T-Cell Responses Elicited by a DNA Vaccine Encoding Highly Conserved and Promiscuous HIV-1 M-Group Consensus Peptides

    PubMed Central

    Almeida, Rafael Ribeiro; Rosa, Daniela Santoro; Ribeiro, Susan Pereira; Santana, Vinicius Canato; Kallás, Esper Georges; Sidney, John; Sette, Alessandro; Kalil, Jorge; Cunha-Neto, Edecio

    2012-01-01

    T-cell based vaccine approaches have emerged to counteract HIV-1/AIDS. Broad, polyfunctional and cytotoxic CD4+ T-cell responses have been associated with control of HIV-1 replication, which supports the inclusion of CD4+ T-cell epitopes in vaccines. A successful HIV-1 vaccine should also be designed to overcome viral genetic diversity and be able to confer immunity in a high proportion of immunized individuals from a diverse HLA-bearing population. In this study, we rationally designed a multiepitopic DNA vaccine in order to elicit broad and cross-clade CD4+ T-cell responses against highly conserved and promiscuous peptides from the HIV-1 M-group consensus sequence. We identified 27 conserved, multiple HLA-DR-binding peptides in the HIV-1 M-group consensus sequences of Gag, Pol, Nef, Vif, Vpr, Rev and Vpu using the TEPITOPE algorithm. The peptides bound in vitro to an average of 12 out of the 17 tested HLA-DR molecules and also to several molecules such as HLA-DP, -DQ and murine IAb and IAd. Sixteen out of the 27 peptides were recognized by PBMC from patients infected with different HIV-1 variants and 72% of such patients recognized at least 1 peptide. Immunization with a DNA vaccine (HIVBr27) encoding the identified peptides elicited IFN-γ secretion against 11 out of the 27 peptides in BALB/c mice; CD4+ and CD8+ T-cell proliferation was observed against 8 and 6 peptides, respectively. HIVBr27 immunization elicited cross-clade T-cell responses against several HIV-1 peptide variants. Polyfunctional CD4+ and CD8+ T cells, able to simultaneously proliferate and produce IFN-γ and TNF-α, were also observed. This vaccine concept may cope with HIV-1 genetic diversity as well as provide increased population coverage, which are desirable features for an efficacious strategy against HIV-1/AIDS. PMID:23028895

  20. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  1. Postnatal Passive Immunization of Neonatal Macaques with a Triple Combination of Human Monoclonal Antibodies against Oral Simian-Human Immunodeficiency Virus Challenge

    PubMed Central

    Hofmann-Lehmann, Regina; Vlasak, Josef; Rasmussen, Robert A.; Smith, Beverly A.; Baba, Timothy W.; Liska, Vladimir; Ferrantelli, Flavia; Montefiori, David C.; McClure, Harold M.; Anderson, Daniel C.; Bernacky, Bruce J.; Rizvi, Tahir A.; Schmidt, Russell; Hill, Lori R.; Keeling, Michale E.; Katinger, Hermann; Stiegler, Gabriela; Cavacini, Lisa A.; Posner, Marshall R.; Chou, Ting-Chao; Andersen, Janet; Ruprecht, Ruth M.

    2001-01-01

    To develop prophylaxis against mother-to-child human immunodeficiency virus (HIV) transmission, we established a simian-human immunodeficiency virus (SHIV) infection model in neonatal macaques that mimics intrapartum mucosal virus exposure (T. W. Baba et al., AIDS Res. Hum. Retroviruses 10:351–357, 1994). Using this model, neonates were protected from mucosal SHIV-vpu+ challenge by pre- and postnatal treatment with a combination of three human neutralizing monoclonal antibodies (MAbs), F105, 2G12, and 2F5 (Baba et al., Nat. Med. 6:200–206, 2000). In the present study, we used this MAb combination only postnatally, thereby significantly reducing the quantity of antibodies necessary and rendering their potential use in humans more practical. We protected two neonates with this regimen against oral SHIV-vpu+ challenge, while four untreated control animals became persistently infected. Thus, synergistic MAbs protect when used as immunoprophylaxis without the prenatal dose. We then determined in vitro the optimal MAb combination against the more pathogenic SHIV89.6P, a chimeric virus encoding env of the primary HIV89.6. Remarkably, the most potent combination included IgG1b12, which alone does not neutralize SHIV89.6P. We administered the combination of MAbs IgG1b12, 2F5, and 2G12 postnatally to four neonates. One of the four infants remained uninfected after oral challenge with SHIV89.6P, and two infants had no or a delayed CD4+ T-cell decline. In contrast, all control animals had dramatic drops in their CD4+ T cells by 2 weeks postexposure. We conclude that our triple MAb combination partially protected against mucosal challenge with the highly pathogenic SHIV89.6P. Thus, combination immunoprophylaxis with passively administered synergistic human MAbs may play a role in the clinical prevention of mother-to-infant transmission of HIV type 1. PMID:11462019

  2. Properties of an intergenic terminator and start site switch that regulate IMD2 transcription in yeast.

    PubMed

    Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel

    2008-06-01

    The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.

  3. Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

    PubMed Central

    Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

    2011-01-01

    Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

  4. Appearance of the pituitary factor Pit-1 increases chromatin remodeling at hypersensitive site III in the human GH locus.

    PubMed

    Yang, Xiaoyang; Jin, Yan; Cattini, Peter A

    2010-07-01

    Expression of pituitary and placental members of the human GH and chorionic somatomammotropin (CS) gene family is directed by an upstream remote locus control region (LCR). Pituitary-specific expression of GH requires direct binding of Pit-1 (listed as POU1F1 in the HUGO database) to sequences marked by a hypersensitive site (HS) region (HS I/II) 14.6 kb upstream of the GH-N gene (listed as GH1 in the HUGO database). We used human embryonic kidney 293 (HEK293) cells overexpressing wild-type and mutant Pit-1 proteins as a model system to gain insight into the mechanism by which Pit-1 gains access to the GH LCR. Addition of Pit-1 to these cells increased DNA accessibility at HS III, located 28 kb upstream of the human GH-N gene, in a POU homeodomain-dependent manner, as reflected by effects on histone hyperacetylation and RNA polymerase II activity. Direct binding of Pit-1 to HS III sequences is not supported. However, the potential for binding of ETS family members to this region has been demonstrated, and Pit-1 association with this ETS element in HS III sequences requires the POU homeodomain. Also, both ETS1 and ELK1 co-precipitate from human pituitary extracts using two independent sources of Pit-1 antibodies. Finally, overexpression of ELK1 or Pit-1 expression in HEK293 cells increased GH-N RNA levels. However, while ELK1 overexpression also stimulated placental CS RNA levels, the effect of Pit-1 appeared to correlate with ETS factor levels and target GH-N preferentially. These data are consistent with recruitment and an early role for Pit-1 in remodeling of the GH LCR at the constitutively open HS III through protein-protein interaction.

  5. Novel variable number of tandem repeats of gibbon MAOA gene and its evolutionary significance.

    PubMed

    Choi, Yuri; Jung, Yi-Deun; Ayarpadikannan, Selvam; Koga, Akihiko; Imai, Hiroo; Hirai, Hirohisa; Roos, Christian; Kim, Heui-Soo

    2014-08-01

    Variable number of tandem repeats (VNTRs) are scattered throughout the primate genome, and genetic variation of these VNTRs have been accumulated during primate radiation. Here, we analyzed VNTRs upstream of the monoamine oxidase A (MAOA) gene in 11 different gibbon species. An abundance of truncated VNTR sequences and copy number differences were observed compared to those of human VNTR sequences. To better understand the biological role of these VNTRs, a luciferase activity assay was conducted and results indicated that selected VNTR sequences of the MAOA gene from human and three different gibbon species (Hylobates klossii, Hylobates lar, and Nomascus concolor) showed silencing ability. Together, these data could be useful for understanding the evolutionary history and functional significance of MAOA VNTR sequences in gibbon species.

  6. Distal regulatory regions restrict the expression of cis-linked genes to the tapetal cells.

    PubMed

    Franco, Luciana O; de O Manes, Carmem Lara; Hamdi, Said; Sachetto-Martins, Gilberto; de Oliveira, Dulce E

    2002-04-24

    The oleosin glycine-rich protein genes Atgrp-6, Atgrp-7, and Atgrp-8 occur in clusters in the Arabidopsis genome and are expressed specifically in the tapetum cells. The cis-regulatory regions involved in the tissue-specific gene expression were investigated by fusing different segments of the gene cluster to the uidA reporter gene. Common distal regulatory regions were identified that coordinate expression of the sequential genes. At least two of these genes were regulated spatially by proximal and distal sequences. The cis-acting elements (122 bp upstream of the transcriptional start point) drive the uidA expression to floral tissues, whereas distal 5' upstream regions restrict the gene activity to tapetal cells.

  7. Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication

    NASA Astrophysics Data System (ADS)

    Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.

    1994-07-01

    We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.

  8. Kin28 regulates the transient association of Mediator with core promoters.

    PubMed

    Jeronimo, Célia; Robert, François

    2014-05-01

    Mediator is an essential, broadly used eukaryotic transcriptional coactivator. How and what Mediator communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence, upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity or in cells in which the RNAPII C-terminal domain is mutated to replace Ser5 with alanine, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is released quickly from promoters after phosphorylation of Ser5 by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter.

  9. [Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

    PubMed

    Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

    2015-04-01

    This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

  10. Balancing gene expression without library construction via a reusable sRNA pool.

    PubMed

    Ghodasara, Amar; Voigt, Christopher A

    2017-07-27

    Balancing protein expression is critical when optimizing genetic systems. Typically, this requires library construction to vary the genetic parts controlling each gene, which can be expensive and time-consuming. Here, we develop sRNAs corresponding to 15nt 'target' sequences that can be inserted upstream of a gene. The targeted gene can be repressed from 1.6- to 87-fold by controlling sRNA expression using promoters of different strength. A pool is built where six sRNAs are placed under the control of 16 promoters that span a ∼103-fold range of strengths, yielding ∼107 combinations. This pool can simultaneously optimize up to six genes in a system. This requires building only a single system-specific construct by placing a target sequence upstream of each gene and transforming it with the pre-built sRNA pool. The resulting library is screened and the top clone is sequenced to determine the promoter controlling each sRNA, from which the fold-repression of the genes can be inferred. The system is then rebuilt by rationally selecting parts that implement the optimal expression of each gene. We demonstrate the versatility of this approach by using the same pool to optimize a metabolic pathway (β-carotene) and genetic circuit (XNOR logic gate). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Transcription of Two Adjacent Carbohydrate Utilization Gene Clusters in Bifidobacterium breve UCC2003 Is Controlled by LacI- and Repressor Open Reading Frame Kinase (ROK)-Type Regulators

    PubMed Central

    O'Connell, Kerry Joan; O'Connell Motherway, Mary; Liedtke, Andrea; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; Zomer, Aldert

    2014-01-01

    Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control. PMID:24705323

  12. Isolation, characterization, and structure analysis of a vacuolar processing enzyme gene (MhVPEγ) from Malus hupehensis (Pamp) Rehd.

    PubMed

    Ran, Kun; Yang, Hongqiang; Sun, Xiaoli; Li, Qiang; Jiang, Qianqian; Zhang, Weiwei; Shen, Wei

    2014-05-01

    Vacuolar processing enzymes (VPEs) have received considerable attention recently, as they exhibit caspase-1-like cleavage activity and regulate the process of PCD. However, knowledge about their detailed characteristics and structures is relatively limited. In this study, a gamma vacuolar processing enzyme gene, MhVPEγ, has been isolated from the leaves of Malus hupehensis (Ramp) Rehd. var pinyiensis Jiang. MhVPEγ coded-translated protein sequence comprised of 494 amino acids with a signal peptide and a transmembrane helix structure at N-terminal, peptidase_C13 domain, and vacuolar sorting signal at C-terminal. Consequently, genomic walking approach was performed for the isolation of its upstream sequence. Computational analysis demonstrated several motifs of the promoter exhibiting hypothetic MeJA, ABA, and light-induced characteristics, as well as some typical domains universally discovered in promoter, such as TATA-box and CAAT-box. MhVPEγ transcript level was enhanced during wounding treatment, and WUN-motif, as one of the cis-acting regulatory elements existing in the upstream sequence perhaps regulates its expression. In silico-constructed 3D models revealed that MhCPYL successively interacts with MhVPEγ like that of "Induced Fit-Lock and Key" model, providing molecular conformation evidence that CPY is a direct substrate of VPEγ. This study is the first stride to understand the molecular mechanism of VPEγ and CPYL interactions.

  13. Control of asgE Expression during Growth and Development of Myxococcus xanthus

    PubMed Central

    Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

    2000-01-01

    One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

  14. Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

    PubMed Central

    Das, G; Henning, D; Wright, D; Reddy, R

    1988-01-01

    Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

  15. Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

    PubMed

    Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

    2012-07-01

    The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

    PubMed

    Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

    2012-05-01

    The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

  17. Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

    PubMed Central

    Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

    1987-01-01

    The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

  18. Nucleotide sequences of bovine alpha S1- and kappa-casein cDNAs.

    PubMed Central

    Stewart, A F; Willis, I M; Mackinlay, A G

    1984-01-01

    The nucleotide sequences corresponding to bovine alpha S1- and kappa-casein mRNAs are presented. An unusual alpha S1-casein cDNA has been characterised whose 5' end commences upstream from its putative TATA box. The alpha S1-casein mRNA is compared to rat alpha-casein mRNA and two components of divergence are identified. Firstly, the two sequences have diverged at a high point mutation rate and the rate of amino acid replacement by this mechanism is at least as great as the rate of divergence of any other part of the mRNAs. Secondly, the protein coding sequence has been subjected to several insertion/deletion events, one of which may be an example of exon shuffling . The kappa-casein mRNA sequence verifies the proposition that it has arisen from a different ancestral gene to the other caseins. Images PMID:6328443

  19. Nucleotide sequences and regulational analysis of genes involved in conversion of aniline to catechol in Pseudomonas putida UCC22(pTDN1).

    PubMed Central

    Fukumori, F; Saint, C P

    1997-01-01

    A 9,233-bp HindIII fragment of the aromatic amine catabolic plasmid pTDN1, isolated from a derivative of Pseudomonas putida mt-2 (UCC22), confers the ability to degrade aniline on P. putida KT2442. The fragment encodes six open reading frames which are arranged in the same direction. Their 5' upstream region is part of the direct-repeat sequence of pTDN1. Nucleotide sequence of 1.8 kb of the repeat sequence revealed only a single base pair change compared to the known sequence of IS1071 which is involved in the transposition of the chlorobenzoate genes (C. Nakatsu, J. Ng, R. Singh, N. Straus, and C. Wyndham, Proc. Natl. Acad. Sci. USA 88:8312-8316, 1991). Four open reading frames encode proteins with considerable homology to proteins found in other aromatic-compound degradation pathways. On the basis of sequence similarity, these genes are proposed to encode the large and small subunits of aniline oxygenase (tdnA1 and tdnA2, respectively), a reductase (tdnB), and a LysR-type regulatory gene (tdnR). The putative large subunit has a conserved [2Fe-2S]R Rieske-type ligand center. Two genes, tdnQ and tdnT, which may be involved in amino group transfer, are localized upstream of the putative oxygenase genes. The tdnQ gene product shares about 30% similarity with glutamine synthetases; however, a pUC-based plasmid carrying tdnQ did not support the growth of an Escherichia coli glnA strain in the absence of glutamine. TdnT possesses domains that are conserved among amidotransferases. The tdnQ, tdnA1, tdnA2, tdnB, and tdnR genes are essential for the conversion of aniline to catechol. PMID:8990291

  20. An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Damiani, R.D. Jr.; Wessler, S.R.

    1993-09-01

    The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open readingmore » frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.« less

  1. Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

    PubMed

    Sakumi, K; Sekiguchi, M

    1989-01-20

    The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

  2. The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

    PubMed

    Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

    2007-01-01

    Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

  3. Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sternberg, E.A.; Spizz, G.; Perry, W.M.

    1988-07-01

    Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

  4. The genetic basis of adaptive pigmentation variation in Drosophila melanogaster.

    PubMed

    Pool, John E; Aquadro, Charles F

    2007-07-01

    In a broad survey of Drosophila melanogaster population samples, levels of abdominal pigmentation were found to be highly variable and geographically differentiated. A strong positive correlation was found between dark pigmentation and high altitude, suggesting adaptation to specific environments. DNA sequence polymorphism at the candidate gene ebony revealed a clear association with the pigmentation of homozygous third chromosome lines. The darkest lines sequenced had nearly identical haplotypes spanning 14.5 kb upstream of the protein-coding exons of ebony. Thus, natural selection may have elevated the frequency of an allele that confers dark abdominal pigmentation by influencing the regulation of ebony.

  5. Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

    PubMed

    Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

    2000-05-31

    cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

  6. Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

    Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less

  7. Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Machlin, S.M.; Hanson, R.S.

    The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

  8. Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.

    1987-01-01

    The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less

  9. Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

    PubMed

    Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

    1987-01-01

    The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

  10. Kin28 regulates the transient association of Mediator with core promoters

    PubMed Central

    Jeronimo, Célia; Robert, François

    2014-01-01

    Mediator is an essential, broadly utilized eukaryotic transcriptional co-activator. How and what it communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence (UAS), upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity, or in cells where the RNAPII C-terminal domain (CTD) is mutated to replace Ser5 with alanines, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is quickly released from promoters upon Ser5 phosphorylation by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter. PMID:24704787

  11. RRE: a tool for the extraction of non-coding regions surrounding annotated genes from genomic datasets.

    PubMed

    Lazzarato, F; Franceschinis, G; Botta, M; Cordero, F; Calogero, R A

    2004-11-01

    RRE allows the extraction of non-coding regions surrounding a coding sequence [i.e. gene upstream region, 5'-untranslated region (5'-UTR), introns, 3'-UTR, downstream region] from annotated genomic datasets available at NCBI. RRE parser and web-based interface are accessible at http://www.bioinformatica.unito.it/bioinformatics/rre/rre.html

  12. Transferable green fluorescence-tagged pEI2 in Edwardsiella ictaluri

    USDA-ARS?s Scientific Manuscript database

    The pEI2 plasmid of Edwardsiella ictaluri isolate, I49, was tagged using a Tn10-GFP-kan cassette to create the green fluorescence-expressing derivative I49-gfp. The Tn10-GFP-kan insertion site was mapped by plasmid sequencing to 663 bp upstream of orf2 and appeared to be at a neutral site in the pla...

  13. Molecular analysis of a chromosome-carried erm(B) gene and its flanking insertion points in Lactobacillus johnsonii G41.

    PubMed

    Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar

    2006-12-01

    An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.

  14. Six Highly Conserved Targets of RNAi Revealed in HIV-1-Infected Patients from Russia Are Also Present in Many HIV-1 Strains Worldwide.

    PubMed

    Kretova, Olga V; Fedoseeva, Daria M; Gorbacheva, Maria A; Gashnikova, Natalya M; Gashnikova, Maria P; Melnikova, Nataliya V; Chechetkin, Vladimir R; Kravatsky, Yuri V; Tchurikov, Nickolai A

    2017-09-15

    RNAi has been suggested for use in gene therapy of HIV/AIDS, but the main problem is that HIV-1 is highly variable and could escape attack from the small interfering RNAs (siRNAs) due to even single nucleotide substitutions in the potential targets. To exhaustively check the variability in selected RNA targets of HIV-1, we used ultra-deep sequencing of six regions of HIV-1 from the plasma of two independent cohorts of patients from Russia. Six RNAi targets were found that are invariable in 82%-97% of viruses in both cohorts and are located inside the domains specifying reverse transcriptase (RT), integrase, vpu, gp120, and p17. The analysis of mutation frequencies and their characteristics inside the targets suggests a likely role for APOBEC3G (apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G, A3G) in G-to-A mutations and a predominant effect of RT biases in the detected variability of the virus. The lowest frequency of mutations was detected in the central part of all six targets. We also discovered that the identical RNAi targets are present in many HIV-1 strains from many countries and from all continents. The data are important for both the understanding of the patterns of HIV-1 mutability and properties of RT and for the development of gene therapy approaches using RNAi for the treatment of HIV/AIDS. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  15. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    PubMed

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  16. Comparative RNA-Sequence Transcriptome Analysis of Phenolic Acid Metabolism in Salvia miltiorrhiza, a Traditional Chinese Medicine Model Plant

    PubMed Central

    Song, Zhenqiao; Guo, Linlin; Liu, Tian; Lin, Caicai; Wang, Jianhua

    2017-01-01

    Salvia miltiorrhiza Bunge is an important traditional Chinese medicine (TCM). In this study, two S. miltiorrhiza genotypes (BH18 and ZH23) with different phenolic acid concentrations were used for de novo RNA sequencing (RNA-seq). A total of 170,787 transcripts and 56,216 unigenes were obtained. There were 670 differentially expressed genes (DEGs) identified between BH18 and ZH23, 250 of which were upregulated in ZH23, with genes involved in the phenylpropanoid biosynthesis pathway being the most upregulated genes. Nine genes involved in the lignin biosynthesis pathway were upregulated in BH18 and thus result in higher lignin content in BH18. However, expression profiles of most genes involved in the core common upstream phenylpropanoid biosynthesis pathway were higher in ZH23 than that in BH18. These results indicated that genes involved in the core common upstream phenylpropanoid biosynthesis pathway might play an important role in downstream secondary metabolism and demonstrated that lignin biosynthesis was a putative partially competing pathway with phenolic acid biosynthesis. The results of this study expanded our understanding of the regulation of phenolic acid biosynthesis in S. miltiorrhiza. PMID:28194403

  17. Genomic analysis of a new mammalian distal-less gene: Dlx7.

    PubMed

    Nakamura, S; Stock, D W; Wydner, K L; Bollekens, J A; Takeshita, K; Nagai, B M; Chiba, S; Kitamura, T; Freeland, T M; Zhao, Z; Minowada, J; Lawrence, J B; Weiss, K M; Ruddle, F H

    1996-12-15

    We have cloned a new Dlx gene (Dlx7) from human and mouse that may represent the mammalian orthologue of the newt gene NvHBox-5. The homeodomains of these genes are highly similar to all other vertebrate Dlx genes, and regions of similarity also exist between mammalian Dlx7 and a subset of vertebrate Dlx genes downstream of the homeodomain. The sequence divergence between human and mouse Dlx7 in these regions is greater than that predicted from comparisons of other vertebrate Dlx genes, however, and there is little sequence similarity upstream of the homeodomain both between these two genes and with other Dlx genes. We present evidence for alternative splicing of mouse Dlx7 upstream of the homeodomain that may account for some of this divergence. We have mapped human DLX7 distal to the 5' end of the HOXB cluster at an estimated distance of between 1 and 2 Mb by FISH. Both the human and the mouse Dlx7 are shown to be closely linked to Dlx3 in a convergently transcribed orientation. These mapping results support the possibility that vertebrate distal-less genes have been duplicated in concert with the Hox clusters.

  18. Alu-derived cis-element regulates tumorigenesis-dependent gastric expression of GASDERMIN B (GSDMB).

    PubMed

    Komiyama, Hiromitsu; Aoki, Aya; Tanaka, Shigekazu; Maekawa, Hiroshi; Kato, Yoriko; Wada, Ryo; Maekawa, Takeo; Tamura, Masaru; Shiroishi, Toshihiko

    2010-02-01

    GASDERMIN B (GSDMB) belongs to the novel gene family GASDERMIN (GSDM). All GSDM family members are located in amplicons, genomic regions often amplified during cancer development. Given that GSDMB is highly expressed in cancerous cells and the locus resides in an amplicon, GSDMB may be involved in cancer development and/or progression. However, only limited information is available on GSDMB expression in tissues, normal and cancerous, from cancer patients. Furthermore, the molecular mechanisms that regulate GSDMB expression in gastric tissues are poorly understood. We investigated the spatiotemporal expression patterns of GSDMB in gastric cancer patients and the 5' regulatory sequences upstream of GSDMB. GSDMB was not expressed in the majority of normal gastric-tissue samples, and the expression level was very low in the few normal samples with GSDMB expression. Most pre-cancer samples showed moderate GSDMB expression, and most cancerous samples showed augmented GSDMB expression. Analysis of genome sequences revealed that an Alu element resides in the 5' region upstream of GSDMB. Reporter assays using intact, deleted, and mutated Alu elements clearly showed that this Alu element positively regulates GSDMB expression and that a putative IKZF binding motif in this element is crucial to upregulate GSDMB expression.

  19. Deterministic chaos in a model of a simple delta network

    NASA Astrophysics Data System (ADS)

    Salter, G.; Voller, V. R.; Paola, C.

    2017-12-01

    An important aspect of delta dynamics is how sediment flux is partitioned to different parts of the delta through time, affecting patterns of land-building/loss, and the formation of stratigraphy. Here, we present results from a model of a simple distributary network consisting of two orders of bifurcations: an upstream channel splits into two branches, each of which splits into two additional branches. The 1D bed elevation profiles of each branch are modeled through time, and a nodal condition accounting for a transverse bed slope just upstream of the bifurcation is used to partition the flow at bifurcations. The model generates surprisingly complex dynamics despite its simplicity. Constrained by the need to distribute sediment evenly between branches in the long-run, the system undergoes repeated full and partial avulsions. We find that the solution to the system is aperiodic, but bounded. We also observe a sensitive dependence on the initial conditions: simulations started with slightly different initial conditions diverge exponentially. These observations are the hallmark of chaos, summarized by Edward Lorenz as "where the present determines the future, but the approximate present does not approximately determine the future." In our model, chaos results from the two-way coupling between upstream and downstream bifurcations. We find that a single bifurcation may be periodic, but it is never chaotic. However, when coupled, avulsions in the upstream channel change the upstream boundary conditions for the downstream bifurcations, and conversely, avulsions in the downstream bifurcations affect the slope of their feeder channel, propagating upstream to the first bifurcation. We explore how the system generates stratigraphy, using the Shields stress at the time of deposition as a proxy. We compare the stratigraphy to the single bifurcation case, which is periodic rather than chaotic. We also examine stratigraphic completeness, and find that hiatuses in the upstream portion of the domain tend to be erosional, whereas hiatuses further downstream tend to represent pauses. Our work suggests that deltas have a limited window of predictability, and indicates that chaotic and cyclic avulsion sequences should be distinguishable in the stratigraphic record.

  20. Total Nitrogen Sources of the Three Gorges Reservoir — A Spatio-Temporal Approach

    PubMed Central

    Ren, Chunping; Wang, Lijing; Zheng, Binghui; Holbach, Andreas

    2015-01-01

    Understanding the spatial and temporal variation of nutrient concentrations, loads, and their distribution from upstream tributaries is important for the management of large lakes and reservoirs. The Three Gorges Dam was built on the Yangtze River in China, the world’s third longest river, and impounded the famous Three Gorges Reservoir (TGR). In this study, we analyzed total nitrogen (TN) concentrations and inflow data from 2003 till 2010 for the main upstream tributaries of the TGR that contribute about 82% of the TGR’s total inflow. We used time series analysis for seasonal decomposition of TN concentrations and used non-parametric statistical tests (Kruskal-Walli H, Mann-Whitney U) as well as base flow segmentation to analyze significant spatial and temporal patterns of TN pollution input into the TGR. Our results show that TN concentrations had significant spatial heterogeneity across the study area (Tuo River> Yangtze River> Wu River> Min River> Jialing River>Jinsha River). Furthermore, we derived apparent seasonal changes in three out of five upstream tributaries of the TGR rivers (Kruskal-Walli H ρ = 0.009, 0.030 and 0.029 for Tuo River, Jinsha River and Min River in sequence). TN pollution from non-point sources in the upstream tributaries accounted for 68.9% of the total TN input into the TGR. Non-point source pollution of TN revealed increasing trends for 4 out of five upstream tributaries of the TGR. Land use/cover and soil type were identified as the dominant driving factors for the spatial distribution of TN. Intensifying agriculture and increasing urbanization in the upstream catchments of the TGR were the main driving factors for non-point source pollution of TN increase from 2003 till 2010. Land use and land cover management as well as chemical fertilizer use restriction were needed to overcome the threats of increasing TN pollution. PMID:26510158

  1. Genes encoding Xenopus laevis Ig L chains: Implications for the evolution of [kappa] and [lambda] chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zezza, D.J.; Stewart, S.E.; Steiner, L.A.

    1992-12-15

    Xenopus laevis Ig contain two distinct types of L chains, designated [rho] or L1 and [sigma] or L2. The authors have analyzed Xenopus genomic DNA by Southern blotting with cDNA probes specific for L1 V and C regions. Many fragments hybridized to the V probe, but only one or two fragments hybridized to the C probe. Corresponding C, J, and V gene segments were identified on clones isolated from a genomic library prepared from the same DNA. One clone contains a C gene segment separated from a J gene segment by an intron of 3.4 kb. The J and Cmore » gene segments are nearly identical in sequence to cDNA clones analyzed previously. The C segment is somewhat more similar and the J segment considerably more similar in sequence to the corresponding segments of mammalian [kappa] chains than to those of mammalian [lambda] chains. Upstream of the J segment is a typical recombination signal sequence with a spacer of 23 bp, as in J[kappa]. A second clone from the library contains four V gene segments, separated by 2.1 to 3.6 kb. Two of these, V1 and V3, have the expected structural and regulatory features of V genes, and are very similar in sequence to each other and to mammalian V[kappa]. A third gene segment, V2, resembles V1 and V3 in its coding region and nearby 5[prime]-flanking region, but diverges in sequence 5[prime] to position [minus]95 with loss of the octamer promoter element. The fourth V-like segment is similar to the others at the 3[prime]-end, but upstream of codon 64 bears no resemblance in sequence to any Ig V region. All four V segments have typical recombination signal sequences with 12-bp spacers at their 3[prime]-ends, as in V[kappa]. Taken together, the data suggest that Xenopus L1 L chain genes are members of the [kappa] gene family. 80 refs., 9 figs.« less

  2. An upstream sequence modulates phenazine production at the level of transcription and translation in the biological control strain Pseudomonas chlororaphis 30-84

    PubMed Central

    Wang, Dongping; Ries, Tessa R.; Pierson, Leland S.; Pierson, Elizabeth A.

    2018-01-01

    Phenazines are bacterial secondary metabolites and play important roles in the antagonistic activity of the biological control strain P. chlororaphis 30–84 against take-all disease of wheat. The expression of the P. chlororaphis 30–84 phenazine biosynthetic operon (phzXYFABCD) is dependent on the PhzR/PhzI quorum sensing system located immediately upstream of the biosynthetic operon as well as other regulatory systems including Gac/Rsm. Bioinformatic analysis of the sequence between the divergently oriented phzR and phzX promoters identified features within the 5’-untranslated region (5’-UTR) of phzX that are conserved only among 2OHPCA producing Pseudomonas. The conserved sequence features are potentially capable of producing secondary structures that negatively modulate one or both promoters. Transcriptional and translational fusion assays revealed that deletion of 90-bp of sequence at the 5’-UTR of phzX led to up to 4-fold greater expression of the reporters with the deletion compared to the controls, which indicated this sequence negatively modulates phenazine gene expression both transcriptionally and translationally. This 90-bp sequence was deleted from the P. chlororaphis 30–84 chromosome, resulting in 30-84Enh, which produces significantly more phenazine than the wild-type while retaining quorum sensing control. The transcriptional expression of phzR/phzI and amount of AHL signal produced by 30-84Enh also were significantly greater than for the wild-type, suggesting this 90-bp sequence also negatively affects expression of the quorum sensing genes. In addition, deletion of the 90-bp partially relieved RsmE-mediated translational repression, indicating a role for Gac/RsmE interaction. Compared to the wild-type, enhanced phenazine production by 30-84Enh resulted in improvement in fungal inhibition, biofilm formation, extracellular DNA release and suppression of take-all disease of wheat in soil without negative consequences on growth or rhizosphere persistence. This work provides greater insight into the regulation of phenazine biosynthesis with potential applications for improved biological control. PMID:29451920

  3. The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

    PubMed

    Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

    2014-01-01

    Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

  4. Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.

    PubMed

    Li, Shisheng; Smerdon, Michael J

    2004-04-02

    Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.

  5. Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data

    PubMed Central

    2010-01-01

    Background In bioinformatics it is common to search for a pattern of interest in a potentially large set of rather short sequences (upstream gene regions, proteins, exons, etc.). Although many methodological approaches allow practitioners to compute the distribution of a pattern count in a random sequence generated by a Markov source, no specific developments have taken into account the counting of occurrences in a set of independent sequences. We aim to address this problem by deriving efficient approaches and algorithms to perform these computations both for low and high complexity patterns in the framework of homogeneous or heterogeneous Markov models. Results The latest advances in the field allowed us to use a technique of optimal Markov chain embedding based on deterministic finite automata to introduce three innovative algorithms. Algorithm 1 is the only one able to deal with heterogeneous models. It also permits to avoid any product of convolution of the pattern distribution in individual sequences. When working with homogeneous models, Algorithm 2 yields a dramatic reduction in the complexity by taking advantage of previous computations to obtain moment generating functions efficiently. In the particular case of low or moderate complexity patterns, Algorithm 3 exploits power computation and binary decomposition to further reduce the time complexity to a logarithmic scale. All these algorithms and their relative interest in comparison with existing ones were then tested and discussed on a toy-example and three biological data sets: structural patterns in protein loop structures, PROSITE signatures in a bacterial proteome, and transcription factors in upstream gene regions. On these data sets, we also compared our exact approaches to the tempting approximation that consists in concatenating the sequences in the data set into a single sequence. Conclusions Our algorithms prove to be effective and able to handle real data sets with multiple sequences, as well as biological patterns of interest, even when the latter display a high complexity (PROSITE signatures for example). In addition, these exact algorithms allow us to avoid the edge effect observed under the single sequence approximation, which leads to erroneous results, especially when the marginal distribution of the model displays a slow convergence toward the stationary distribution. We end up with a discussion on our method and on its potential improvements. PMID:20205909

  6. Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data.

    PubMed

    Nuel, Gregory; Regad, Leslie; Martin, Juliette; Camproux, Anne-Claude

    2010-01-26

    In bioinformatics it is common to search for a pattern of interest in a potentially large set of rather short sequences (upstream gene regions, proteins, exons, etc.). Although many methodological approaches allow practitioners to compute the distribution of a pattern count in a random sequence generated by a Markov source, no specific developments have taken into account the counting of occurrences in a set of independent sequences. We aim to address this problem by deriving efficient approaches and algorithms to perform these computations both for low and high complexity patterns in the framework of homogeneous or heterogeneous Markov models. The latest advances in the field allowed us to use a technique of optimal Markov chain embedding based on deterministic finite automata to introduce three innovative algorithms. Algorithm 1 is the only one able to deal with heterogeneous models. It also permits to avoid any product of convolution of the pattern distribution in individual sequences. When working with homogeneous models, Algorithm 2 yields a dramatic reduction in the complexity by taking advantage of previous computations to obtain moment generating functions efficiently. In the particular case of low or moderate complexity patterns, Algorithm 3 exploits power computation and binary decomposition to further reduce the time complexity to a logarithmic scale. All these algorithms and their relative interest in comparison with existing ones were then tested and discussed on a toy-example and three biological data sets: structural patterns in protein loop structures, PROSITE signatures in a bacterial proteome, and transcription factors in upstream gene regions. On these data sets, we also compared our exact approaches to the tempting approximation that consists in concatenating the sequences in the data set into a single sequence. Our algorithms prove to be effective and able to handle real data sets with multiple sequences, as well as biological patterns of interest, even when the latter display a high complexity (PROSITE signatures for example). In addition, these exact algorithms allow us to avoid the edge effect observed under the single sequence approximation, which leads to erroneous results, especially when the marginal distribution of the model displays a slow convergence toward the stationary distribution. We end up with a discussion on our method and on its potential improvements.

  7. Leaderless mRNAs are circularized in Chlamydomonas reinhardtii mitochondria.

    PubMed

    Cahoon, A Bruce; Qureshi, Ali A

    2018-06-01

    The mitochondrial genome of Chlamydomonas reinhardtii encodes eight protein coding genes transcribed on two polycistronic primary transcripts. The mRNAs are endonucleolytically cleaved from these transcripts directly upstream of their AUG start codons, creating leaderless mRNAs with 3' untranslated regions (UTR) comprised of most or all of their downstream intergenic regions. In this report, we provide evidence that these processed linear mRNAs are circularized, which places the 3' UTR upstream of the 5' start codon, creating a leader sequence ex post facto. The circular mRNAs were found to be ribosome associate by polysome profiling experiments suggesting they are translated. Sequencing of the 3'-5' junctions of the circularized mRNAs found the intra-molecular ligations occurred between fully processed 5' ends (the start AUG) and a variable 3' terminus. For five genes (cob, cox, nd2, nd4, and nd6), some of the 3' ends maintained an oligonucleotide addition during ligation, and for two of them, cob and nd6, these 3' termini were the most commonly recovered sequence. Previous reports have shown that after cleavage, three untemplated oligonucleotide additions may occur on the 3' termini of these mRNAs-adenylation, uridylylation, or cytidylation. These results suggest oligo(U) and oligo(C) additions may be part of the maturation process since they are maintained in the circular mRNAs. Circular RNAs occur in organisms across the biological spectrum, but their purpose in some systems, such as organelles (mitochondria and chloroplasts) is unclear. We hypothesize, that in C. reinhardtii mitochondria it may create a leader sequence to facilitate translation initiation, which may negate the need for an alternative translation initiation mechanism in this system, as previously speculated. In addition, circularization may play a protective role against exonucleases, and/or increase translational productivity.

  8. A mutation in an alternative untranslated exon of hexokinase 1 associated with hereditary motor and sensory neuropathy -- Russe (HMSNR).

    PubMed

    Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald J A; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

    2009-12-01

    Hereditary Motor and Sensory Neuropathy -- Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to approximately 70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to approximately 26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS).

  9. A mutation in an alternative untranslated exon of hexokinase 1 associated with Hereditary Motor and Sensory Neuropathy – Russe (HMSNR)

    PubMed Central

    Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald JA; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

    2009-01-01

    Hereditary Motor and Sensory Neuropathy – Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to ∼70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to ∼26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS). PMID:19536174

  10. Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.

    PubMed

    Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E

    1998-05-01

    Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.

  11. Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

    PubMed Central

    2009-01-01

    Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

  12. Characterization of Rous sarcoma virus polyadenylation site use in vitro

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maciolek, Nicole L.; McNally, Mark T.

    2008-05-10

    Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

  13. Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

    PubMed Central

    Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

    2010-01-01

    Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

  14. Elements in the murine c-mos messenger RNA 5'-untranslated region repress translation of downstream coding sequences.

    PubMed

    Steel, L F; Telly, D L; Leonard, J; Rice, B A; Monks, B; Sawicki, J A

    1996-10-01

    Murine c-mos transcripts isolated from testes have 5'-untranslated regions (5'UTRs) of approximately 300 nucleotides with a series of four overlapping open reading frames (ORFs) upstream of the AUG codon that initiates the Mos ORF. Ovarian c-mos transcripts have shorter 5'UTRs (70-80 nucleotides) and contain only 1-2 of the upstream ORFs (uORFs). To test whether these 5'UTRs affect translational efficiency, we have constructed plasmids for the expression of chimeric transcripts with a mos-derived 5'UTR fused to the Escherichia coli beta-galactosidase coding region. Translational efficiency has been evaluated by measuring beta-galactosidase activity NIH3T3 cells transiently transfected with these plasmids and with plasmids where various mutations have been introduced into the 5'UTR. We show that the 5'UTR characteristic of testis-specific c-mos mRNA strongly represses translation relative to the translation of transcripts that contain a 5'UTR derived from beta-globin mRNA, and this is mainly due to the four uORFs. Each of the four upstream AUG triplets can be recognized as a start site for translation, and no single uAUG dominates the repressive effect. The uORFs repress translation by a mechanism that is not affected by the amino acid sequence in the COOH-terminal region of the uORF-encoded peptides. The very short uORF (AUGUGA) present in ovary-specific transcripts does not repress translation. Staining of testis sections from transgenic mice carrying chimeric beta-galactosidase transgene constructs, which contain a mos 5'UTR with or without the uATGs, suggests that the uORFs can dramatically change the pattern of expression in spermatogenic cells.

  15. Isolation of the endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.) and its functional analysis in transgenic rice plants.

    PubMed

    Xu, Li; Ye, Rongjian; Zheng, Yusheng; Wang, Zhekui; Zhou, Peng; Lin, Yongjun; Li, Dongdong

    2010-09-01

    As one of the key tropical crops, coconut (Cocos nucifera L.) is a member of the monocotyledonous family Aracaceae (Palmaceae). In this study, we amplified the upstream region of an endosperm-specific expression gene, Lysophosphatidyl acyltransferase (LPAAT), from the coconut genomic DNA by chromosome walking. In this sequence, we found several types of promoter-related elements including TATA-box, CAAT-box and Skn1-motif. In order to further examine its function, three different 5'-deletion fragments were inserted into pBI101.3, a plant expression vector harboring the LPAAT upstream sequence, leading to pBI101.3-L1, pBI101.3-L2 and pBI101.3-L3, respectively. We obtained transgenic plants of rice by Agrobacterium-mediated callus transformation and plant regeneration and detected the expression of gus gene by histochemical staining and fluorometric determination. We found that gus gene driven by the three deletion fragments was specifically expressed in the endosperm of rice seeds, but not in the empty vector of pBI101.3 and other tissues. The highest expression level of GUS was at 15 DAF in pBI101.3-L3 and pBI101.3-L2 transgenic lines, while the same level was detected at 10 DAF in pBI101.3-L1. The expression driven by the whole fragment was up to 1.76- and 2.8-fold higher than those driven by the -817 bp and -453 bp upstream fragments, and 10.7-fold higher than that driven by the vector without the promoter. Taken together, our results strongly suggest that these promoter fragments from coconut have a significant potential in genetically improving endosperm in main crops.

  16. Structural organization of the porcine and human genes coding for a leydig cell-specific insulin-like peptide (LEY I-L) and chromosomal localization of the human gene (INSL3)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burkhardt E.; Adham, I.M.; Brosig, B.

    1994-03-01

    Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less

  17. Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

    PubMed

    DeVry, C G; Tsai, W; Clarke, S

    1996-11-15

    The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

  18. Mrp--a new auxiliary gene essential for optimal expression of methicillin resistance in Staphylococcus aureus.

    PubMed

    Wu, S W; De Lencastre, H

    1999-01-01

    Screening of a library of Tn551 insertional mutants selected for reduction in the methicillin resistance level of the parental Staphylococcus aureus strain COL resulted in the isolation of mutant RUSA266 in which the minimal inhibitory concentration (MIC) of the parent was reduced from 1,600 to 1.5 micrograms/mL. Cloning and sequencing of the vicinity of the insertion site omega 726 identified an open reading frame (orf1365) encoding a very large polypeptide of more than 1,365 amino acids. A unique feature of the deduced amino acid sequence was the presence of multiple tandem repeats of 75 amino acids in the polypeptide, reminiscent of the structure of high-molecular-weight cell-surface proteins EF* and Emb identified in some streptococcal strains. Mutant RUSA266 with the inactivated gene, which we shall provisionally refer to as mrp (for multiple repeat polypeptide), produced a peptidoglycan with altered muropeptide composition, and both the reduced antibiotic resistance and the altered cell wall composition were co-transduced in back-crosses into the parental strain COL. Additional sequencing upstream of mrp has revealed that this gene was part of a five-gene cluster occupying a 9.2-kb region of the staphylococcal chromosome and was composed of glmM (directly upstream of mrp), two open reading frames orf310 and orf269 coding for two hypothetical proteins, and the gene encoding the staphylococcal arginase (arg). Transcriptional analysis demonstrated that the five genes in the cluster were transcribed together.

  19. RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.

    PubMed

    Brule, C E; Dean, K M; Grayhack, E J

    2016-01-01

    The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

  20. Sequences downstream of AAUAAA signals affect pre-mRNA cleavage and polyadenylation in vitro both directly and indirectly.

    PubMed Central

    Ryner, L C; Takagaki, Y; Manley, J L

    1989-01-01

    To investigate the role of sequences lying downstream of the conserved AAUAAA hexanucleotide in pre-mRNA cleavage and polyadenylation, deletions or substitutions were constructed in polyadenylation signals from simian virus 40 and adenovirus, and their effects were assayed in both crude and fractionated HeLa cell nuclear extracts. As expected, these sequences influenced the efficiency of both cleavage and polyadenylation as well as the accuracy of the cleavage reaction. Sequences near or upstream of the actual site of poly(A) addition appeared to specify a unique cleavage site, since their deletion resulted, in some cases, in heterogeneous cleavage. Furthermore, the sequences that allowed the simian virus 40 late pre-RNA to be cleaved preferentially by partially purified cleavage activity were also those at the cleavage site itself. Interestingly, sequences downstream of the cleavage site interacted with factors not directly involved in catalyzing cleavage and polyadenylation, since the effects of deletions were substantially diminished when partially purified components were used in assays. In addition, these sequences contained elements that could affect 3'-end formation both positively and negatively. Images PMID:2566911

  1. Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

    PubMed

    Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

    2008-01-01

    This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

  2. The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

    PubMed Central

    Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

    1988-01-01

    cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

  3. Identification of early zygotic genes in the yellow fever mosquito Aedes aegypti and discovery of a motif involved in early zygotic genome activation.

    PubMed

    Biedler, James K; Hu, Wanqi; Tae, Hongseok; Tu, Zhijian

    2012-01-01

    During early embryogenesis the zygotic genome is transcriptionally silent and all mRNAs present are of maternal origin. The maternal-zygotic transition marks the time over which embryogenesis changes its dependence from maternal RNAs to zygotically transcribed RNAs. Here we present the first systematic investigation of early zygotic genes (EZGs) in a mosquito species and focus on genes involved in the onset of transcription during 2-4 hr. We used transcriptome sequencing to identify the "pure" (without maternal expression) EZGs by analyzing transcripts from four embryonic time ranges of 0-2, 2-4, 4-8, and 8-12 hr, which includes the time of cellular blastoderm formation and up to the start of gastrulation. Blast of 16,789 annotated transcripts vs. the transcriptome reads revealed evidence for 63 (P<0.001) and 143 (P<0.05) nonmaternally derived transcripts having a significant increase in expression at 2-4 hr. One third of the 63 EZG transcripts do not have predicted introns compared to 10% of all Ae. aegypti genes. We have confirmed by RT-PCR that zygotic transcription starts as early as 2-3 hours. A degenerate motif VBRGGTA was found to be overrepresented in the upstream sequences of the identified EZGs using a motif identification software called SCOPE. We find evidence for homology between this motif and the TAGteam motif found in Drosophila that has been implicated in EZG activation. A 38 bp sequence in the proximal upstream sequence of a kinesin light chain EZG (KLC2.1) contains two copies of the mosquito motif. This sequence was shown to support EZG transcription by luciferase reporter assays performed on injected early embryos, and confers early zygotic activity to a heterologous promoter from a divergent mosquito species. The results of these studies are consistent with the model of early zygotic genome activation via transcriptional activators, similar to what has been found recently in Drosophila.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kennedy, M.A.; Morris, C.M.; Fitzgerald, P.H.

    The human kappa deleting element (Kde) mediates loss of CK and JK genes in B cells. A probe for Kde detects two genomic sequences on Southern blots. The Kde is located 24kb 3{prime} to CK, but the position of the homologous sequence is unknown. The authors in situ hybridized m141-2 to metaphase cells of JC11, a B-cell line bearing a t(2;14)(p11;q32) in which the chromosome 2 breakpoint is within JK or the VK-JK intron. Three peaks of labelled sites were obtained. Southern analysis of BamH1 digested DNA showed that Kde (14kb) and the homologous sequence (3kb) were both intact. Kdemore » accounts for hybridization to 14q+ and the 2p- signal presumably derives from the related sequence. This locates the sequence homologous to Kde upstream from JK, possibly within the VK cluster, and may reflect transposition or some other duplicative event as proposed for the evolution of other regions of the kappa locus.« less

  5. Recombined sequences between the non-coding control regions of JC and BK viruses found in the urine of a renal transplantation patient.

    PubMed

    Liaw, Yu-Ching; Chen, Cheng-Hsu; Shu, Kuo-Hsiung; Fang, Chiung-Yao; Ou, Wei-Chih; Chen, Pei-Lain; Shen, Cheng-Huang; Lin, Mien-Chun; Chang, Deching; Wang, Meilin

    2012-12-01

    Kidney cells are the common host for JC virus (JCV) and BK virus (BKV). Reactivation of JCV and/or BKV in patients after organ transplantation, such as renal transplantation, may cause hemorrhagic cystitis and polyomavirus-associated nephropathy. Furthermore, JCV and BKV may be shed in the urine after reactivation in the kidney. Rearranged as well as archetypal non-coding control regions (NCCRs) of JCV and BKV have been frequently identified in human samples. In this study, three JC/BK recombined NCCR sequences were identified in the urine of a patient who had undergone renal transplantation. They were designated as JC-BK hybrids 1, 2, and 3. The three JC/BK recombinant NCCRs contain up-stream JCV as well as down-stream BKV sequences. Deletions of both JCV and BKV sequences were found in these recombined NCCRs. Recombination of DNA sequences between JCV and BKV may occur during co-infection due to the relatively high homology of the two viral genomes.

  6. Spliced RNA of woodchuck hepatitis virus.

    PubMed

    Ogston, C W; Razman, D G

    1992-07-01

    Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.

  7. A high-throughput and quantitative method to assess the mutagenic potential of translesion DNA synthesis

    PubMed Central

    Taggart, David J.; Camerlengo, Terry L.; Harrison, Jason K.; Sherrer, Shanen M.; Kshetry, Ajay K.; Taylor, John-Stephen; Huang, Kun; Suo, Zucai

    2013-01-01

    Cellular genomes are constantly damaged by endogenous and exogenous agents that covalently and structurally modify DNA to produce DNA lesions. Although most lesions are mended by various DNA repair pathways in vivo, a significant number of damage sites persist during genomic replication. Our understanding of the mutagenic outcomes derived from these unrepaired DNA lesions has been hindered by the low throughput of existing sequencing methods. Therefore, we have developed a cost-effective high-throughput short oligonucleotide sequencing assay that uses next-generation DNA sequencing technology for the assessment of the mutagenic profiles of translesion DNA synthesis catalyzed by any error-prone DNA polymerase. The vast amount of sequencing data produced were aligned and quantified by using our novel software. As an example, the high-throughput short oligonucleotide sequencing assay was used to analyze the types and frequencies of mutations upstream, downstream and at a site-specifically placed cis–syn thymidine–thymidine dimer generated individually by three lesion-bypass human Y-family DNA polymerases. PMID:23470999

  8. Genome-wide mapping of autonomous promoter activity in human cells

    PubMed Central

    van Arensbergen, Joris; FitzPatrick, Vincent D.; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J.; van Steensel, Bas

    2017-01-01

    Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of sequences that could be tested. Here we present Survey of Regulatory Elements (SuRE), a method to assay more than 108 DNA fragments, each 0.2–2kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library is constructed of random genomic fragments upstream of a 20bp barcode and decoded by paired-end sequencing. This library is then transfected into cells and transcribed barcodes are quantified in the RNA by high throughput sequencing. When applied to the human genome, we achieved a 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide. By computational modeling we delineated subregions within promoters that are relevant for their activity. For instance, we show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites. PMID:28024146

  9. The genetic basis of adaptive pigmentation variation in Drosophila melanogaster

    PubMed Central

    Pool, John E.; Aquadro, Charles F.

    2009-01-01

    In a broad survey of Drosophila melanogaster population samples, levels of abdominal pigmentation were found to be highly variable and geographically differentiated. A strong positive correlation was found between dark pigmentation and high altitude, suggesting adaptation to specific environments. DNA sequence polymorphism at the candidate gene ebony revealed a clear association with the pigmentation of homozygous third chromosome lines. The darkest lines sequenced had nearly identical haplotypes spanning 14.5 kilobases upstream of the protein-coding exons of ebony. Thus, natural selection may have elevated the frequency of an allele that confers dark abdominal pigmentation by influencing the regulation of ebony. PMID:17614900

  10. A multi-scale mathematical modeling framework to investigate anti-viral therapeutic opportunities in targeting HIV-1 accessory proteins

    PubMed Central

    Suryawanshi, Gajendra W.; Hoffmann, Alexander

    2015-01-01

    Human immunodeficiency virus-1 (HIV-1) employs accessory proteins to evade innate immune responses by neutralizing the anti-viral activity of host restriction factors. Apolipoprotein B mRNA-editing enzyme 3G (APOBEC3G, A3G) and bone marrow stromal cell antigen 2 (BST2) are host resistance factors that potentially inhibit HIV-1 infection. BST2 reduces viral production by tethering budding HIV-1 particles to virus producing cells, while A3G inhibits the reverse transcription (RT) process and induces viral genome hypermutation through cytidine deamination, generating fewer replication competent progeny virus. Two HIV-1 proteins counter these cellular restriction factors: Vpu, which reduces surface BST2, and Vif, which degrades cellular A3G. The contest between these host and viral proteins influences whether HIV-1 infection is established and progresses towards AIDS. In this work, we present an age-structured multi-scale viral dynamics model of in vivo HIV-1 infection. We integrated the intracellular dynamics of anti-viral activity of the host factors and their neutralization by HIV-1 accessory proteins into the virus/cell population dynamics model. We calculate the basic reproductive ratio (Ro) as a function of host-viral protein interaction coefficients, and numerically simulated the multi-scale model to understand HIV-1 dynamics following host factor-induced perturbations. We found that reducing the influence of Vpu triggers a drop in Ro, revealing the impact of BST2 on viral infection control. Reducing Vif’s effect reveals the restrictive efficacy of A3G in blocking RT and in inducing lethal hypermutations, however, neither of these factors alone is sufficient to fully restrict HIV-1 infection. Interestingly, our model further predicts that BST2 and A3G function synergistically, and delineates their relative contribution in limiting HIV-1 infection and disease progression. We provide a robust modeling framework for devising novel combination therapies that target HIV-1 accessory proteins and boost antiviral activity of host factors. PMID:26385832

  11. Structural Ensemble of CD4 Cytoplasmic Tail (402-419) Reveals a Nearly Flat Free-Energy Landscape with Local α-Helical Order in Aqueous Solution.

    PubMed

    Ahalawat, Navjeet; Arora, Simran; Murarka, Rajesh K

    2015-08-27

    The human cluster determinant 4 (CD4), expressed primarily on the surface of T helper cells, serves as a coreceptor in T-cell receptor recognition of MHC II antigen complexes. Besides its cellular functions, CD4 serves as a primary receptor of human immunodeficiency virus (HIV) type 1. The cytoplasmic tail of CD4 (residues 402-419) is known to be involved in direct interaction with the HIV-1 proteins Vpu and Nef. These two viral accessory proteins (Vpu and Nef) downregulate CD4 in HIV-1 infected cells by multiple strategies and make the body susceptible to all forms of infections. In this work, we carried out extensive replica exchange molecular dynamics simulations in explicit water with three popular protein force fields Amber ff99SB, Amber ff99SB*-ILDN, and CHARMM36 to characterize the equilibrium conformational ensemble of CD4-tail (402-419) and further validated the simulated ensembles with known NMR data. We found that ff99SB*-ILDN gives a better description of the structural ensemble of this peptide compared with ff99SB and CHARMM36. The peptide adopts multiple distinct conformations with varying degree of residual secondary structures. In particular, we observed 28, 7, and 5% average α-helical, β-strand, and 3(10)-helix content, respectively, for ff99SB*-ILDN. The peptide chain shows the tendency of helix formation in a cooperative manner, seeding at residues 407-410, and subsequently extending toward both ends of the chain. Furthermore, we constructed Markov state model (MSM) from large-scale molecular dynamics simulations to study the dynamics of transitions between different metastable states explored by this peptide. The mean first passage times computed from MSM indicate rapid interconversion of these states, and the time scales of transitions range from several nanoseconds to hundreds of microseconds. Our results show good agreement with experimental data and could help to understand the key molecular mechanisms of T-cell activation and HIV-mediated receptor interference.

  12. Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

    PubMed

    Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

    2016-03-01

    Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

  13. Coliphage HK022 Nun protein inhibits RNA polymerase translocation

    PubMed Central

    Vitiello, Christal L.; Kireeva, Maria L.; Lubkowska, Lucyna; Kashlev, Mikhail; Gottesman, Max

    2014-01-01

    The Nun protein of coliphage HK022 arrests RNA polymerase (RNAP) in vivo and in vitro at pause sites distal to phage λ N-Utilization (nut) site RNA sequences. We tested the activity of Nun on ternary elongation complexes (TECs) assembled with templates lacking the λ nut sequence. We report that Nun stabilizes both translocation states of RNAP by restricting lateral movement of TEC along the DNA register. When Nun stabilized TEC in a pretranslocated register, immediately after NMP incorporation, it prevented binding of the next NTP and stimulated pyrophosphorolysis of the nascent transcript. In contrast, stabilization of TEC by Nun in a posttranslocated register allowed NTP binding and nucleotidyl transfer but inhibited pyrophosphorolysis and the next round of forward translocation. Nun binding to and action on the TEC requires a 9-bp RNA–DNA hybrid. We observed a Nun-dependent toe print upstream to the TEC. In addition, mutations in the RNAP β′ subunit near the upstream end of the transcription bubble suppress Nun binding and arrest. These results suggest that Nun interacts with RNAP near the 5′ edge of the RNA–DNA hybrid. By stabilizing translocation states through restriction of TEC lateral mobility, Nun represents a novel class of transcription arrest factors. PMID:24853501

  14. Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

    PubMed Central

    Mishima, Y; Mitsuma, T; Ogata, K

    1985-01-01

    An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

  15. DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

    DOE PAGES

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

    2014-08-23

    Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

  16. The great escape: viral strategies to counter BST-2/tetherin.

    PubMed

    Douglas, Janet L; Gustin, Jean K; Viswanathan, Kasinath; Mansouri, Mandana; Moses, Ashlee V; Früh, Klaus

    2010-05-13

    The interferon-induced BST-2 protein has the unique ability to restrict the egress of HIV-1, Kaposi's sarcoma-associated herpesvirus (KSHV), Ebola virus, and other enveloped viruses. The observation that virions remain attached to the surface of BST-2-expressing cells led to the renaming of BST-2 as "tetherin". However, viral proteins such as HIV-1 Vpu, simian immunodeficiency virus Nef, and KSHV K5 counteract BST-2, thereby allowing mature virions to readily escape from infected cells. Since the anti-viral function of BST-2 was discovered, there has been an explosion of research into several aspects of this intriguing interplay between host and virus. This review focuses on recent work addressing the molecular mechanisms involved in BST-2 restriction of viral egress and the species-specific countermeasures employed by various viruses.

  17. Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

    PubMed

    Butler, Nathaniel M; Hannapel, David J

    2012-12-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

  18. Two novel heat shock genes encoding proteins produced in response to heterologous protein expression in Escherichia coli.

    PubMed Central

    Allen, S P; Polazzi, J O; Gierse, J K; Easton, A M

    1992-01-01

    In Escherichia coli high-level production of some heterologous proteins (specifically, human prorenin, renin, and bovine insulin-like growth factor 2) resulted in the induction of two new E. coli heat shock proteins, both of which have molecular masses of 16 kDa and are tightly associated with inclusion bodies formed during heterologous protein production. We named these inclusion body-associated proteins IbpA and IbpB. The coding sequences for IbpA and IbpB were identified and isolated from the Kohara E. coli gene bank. The genes for these proteins (ibpA and ibpB) are located at 82.5 min on the chromosome. Nucleotide sequencing of the two genes revealed that they are transcribed in the same direction and are separated by 110 bp. Putative Shine-Dalgarno sequences are located upstream from the initiation codons of both genes. A putative heat shock promoter is located upstream from ibpA, and a putative transcription terminator is located downstream from ibpB. A temperature upshift experiment in which we used a wild-type E. coli strain and an isogenic rpoH mutant strain indicated that a sigma 32-containing RNA polymerase is involved in the regulation of expression of these genes. There is 57.5% identity between the genes at the nucleotide level and 52.2% identity at the amino acid level. A search of the protein data bases showed that both of these 16-kDa proteins exhibit low levels of homology to low-molecular-weight heat shock proteins from eukaryotic species. Images PMID:1356969

  19. The REP2 Repeats of the Genome of Neisseria meningitidis Are Associated with Genes Coordinately Regulated during Bacterial Cell Interaction

    PubMed Central

    Morelle, Sandrine; Carbonnelle, Etienne; Nassif, Xavier

    2003-01-01

    Interaction with host cells is essential in meningococcal pathogenesis especially at the blood-brain barrier. This step is likely to involve a common regulatory pathway allowing coordinate regulation of genes necessary for the interaction with endothelial cells. The analysis of the genomic sequence of Neisseria meningitidis Z2491 revealed the presence of many repeats. One of these, designated REP2, contains a −24/−12 type promoter and a ribosome binding site 5 to 13 bp before an ATG. In addition most of these REP2 sequences are located immediately upstream of an ORF. Among these REP2-associated genes are pilC1 and crgA, described as being involved in steps essential for the interaction of N. meningitidis with host cells. Furthermore, the REP2 sequences located upstream of pilC1 and crgA correspond to the previously identified promoters known to be induced during the initial localized adhesion of N. meningitidis with human cells. This characteristic led us to hypothesize that at least some of the REP2-associated genes were upregulated under the same circumstances as pilC1 and crgA. Quantitative PCR in real time demonstrated that the expression of 14 out of 16 REP2-associated genes were upregulated during the initial localized adhesion of N. meningitidis. Taken together, these data suggest that these repeats control a set of genes necessary for the efficient interaction of this pathogen with host cells. Subsequent mutational analysis was performed to address the role of these genes during meningococcus-cell interaction. PMID:12670987

  20. Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

    PubMed

    Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

    1994-05-01

    Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

  1. Sequencing and diversity analyses reveal extensive similarities between some epsilon-toxin-encoding plasmids and the pCPF5603 Clostridium perfringens enterotoxin plasmid.

    PubMed

    Miyamoto, Kazuaki; Li, Jihong; Sayeed, Sameera; Akimoto, Shigeru; McClane, Bruce A

    2008-11-01

    Clostridium perfringens type B and D isolates produce epsilon-toxin, the third most potent clostridial toxin. The epsilon-toxin gene (etx) is plasmid borne in type D isolates, but etx genetics have been poorly studied in type B isolates. This study reports the first sequencing of any etx plasmid, i.e., pCP8533etx, from type B strain NCTC8533. This etx plasmid is 64.7 kb, carries tcp conjugative transfer genes, and encodes additional potential virulence factors including beta2-toxin, sortase, and collagen adhesin but not beta-toxin. Interestingly, nearly 80% of pCP8533etx open reading frames (ORFs) are also present on pCPF5603, an enterotoxin-encoding plasmid from type A isolate F5603. Pulsed-field gel electrophoresis and overlapping PCR indicated that a pCP8533etx-like etx plasmid is also present in most, if not all, other type B isolates and some beta2-toxin-positive, cpe-negative type D isolates, while other type D isolates carry different etx plasmids. Sequences upstream of the etx gene vary between type B isolates and some type D isolates that do not carry a pCP8533etx-like etx plasmid. However, nearly all type B and D isolates have an etx locus with an upstream IS1151, and those etx loci typically reside near a dcm ORF. These results suggest that pCPF5603 and pCP8533etx evolved from insertion of mobile genetic elements carrying enterotoxin or etx genes, respectively, onto a common progenitor plasmid.

  2. Temporal and Spatial Expression of a Polygalacturonase during Leaf and Flower Abscission in Oilseed Rape and Arabidopsis1

    PubMed Central

    González-Carranza, Zinnia Haydé; Whitelaw, Catherine Ann; Swarup, Ranjan; Roberts, Jeremy Alan

    2002-01-01

    During leaf abscission in oilseed rape (Brassica napus), cell wall degradation is brought about by the action of several hydrolytic enzymes. One of these is thought to be polygalacturonase (PG). Degenerate primers were used to isolate a PG cDNA fragment by reverse transcriptase-polymerase chain reaction from RNA extracted from ethylene-promoted leaf abscission zones (AZs), and in turn a full-length clone (CAW471) from an oilseed rape AZ cDNA library. The highest homology of this cDNA (82%) was to an Arabidopsis sequence that was predicted to encode a PG protein. Analysis of expression revealed that CAW471 mRNA accumulated in the AZ of leaves and reached a peak 24 h after ethylene treatment. Ethylene-promoted leaf abscission in oilseed rape was not apparent until 42 h after exposure to the gas, reaching 50% at 48 h and 100% by 56 h. In floral organ abscission, expression of CAW471 correlated with cell separation. Genomic libraries from oilseed rape and Arabidopsis were screened with CAW471 and the respective genomic clones PGAZBRAN and PGAZAT isolated. Characterization of these PG genes revealed that they had substantial homology within both the coding regions and in the 5′-upstream sequences. Fusion of a 1,476-bp 5′-upstream sequence of PGAZAT to β-glucuronidase or green fluorescent protein and transformation of Arabidopsis revealed that this fragment was sufficient to drive expression of these reporter genes in the AZs at the base of the anther filaments, petals, and sepals. PMID:11842157

  3. Mechanisms of activation of the paternally expressed genes by the Prader-Willi imprinting center in the Prader-Willi/Angelman syndromes domains

    PubMed Central

    Rabinovitz, Shiri; Kaufman, Yotam; Ludwig, Guy; Razin, Aharon; Shemer, Ruth

    2012-01-01

    The Prader-Willi syndrome/Angelman syndrome (PWS/AS) imprinted domain is regulated by a bipartite imprinting control center (IC) composed of a sequence around the SNRPN promoter (PWS-IC) and a 880-bp sequence located 35 kb upstream (AS-IC). The AS-IC imprint is established during gametogenesis and confers repression upon PWS-IC on the maternal allele. Mutation at PWS-IC on the paternal allele leads to gene silencing across the entire PWS/AS domain. This silencing implies that PWS-IC functions on the paternal allele as a bidirectional activator. Here we examine the mechanism by which PWS-IC activates the paternally expressed genes (PEGs) using transgenes that include the PWS-IC sequence in the presence or absence of AS-IC and NDN, an upstream PEG, as an experimental model. We demonstrate that PWS-IC is in fact an activator of NDN. This activation requires an unmethylated PWS-IC in the gametes and during early embryogenesis. PWS-IC is dispensable later in development. Interestingly, a similar activation of a nonimprinted gene (APOA1) was observed, implying that PWS-IC is a universal activator. To decipher the mechanism by which PWS-IC confers activation of remote genes, we performed methylated DNA immunoprecipitation (MeDIP) array analysis on lymphoblast cell lines that revealed dispersed, rather than continued differential methylation. However, chromatin conformation capture (3c) experiments revealed a physical interaction between PWS-IC and the PEGs, suggesting that activation of PEGs may require their proximity to PWS-IC. PMID:22529396

  4. Microbial Community Structure and Arsenic Biogeochemistry in an Acid Vapor-Formed Spring in Tengchong Geothermal Area, China.

    PubMed

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Dai, Xinyue; Zhang, Rui; Wang, Yanhong; Wang, Yanxin

    2016-01-01

    Arsenic biogeochemistry has been studied extensively in acid sulfate-chloride hot springs, but not in acid sulfate hot springs with low chloride. In this study, Zhenzhuquan in Tengchong geothermal area, a representative acid sulfate hot spring with low chloride, was chosen to study arsenic geochemistry and microbial community structure using Illumina MiSeq sequencing. Over 0.3 million 16S rRNA sequence reads were obtained from 6-paired parallel water and sediment samples along its outflow channel. Arsenic oxidation occurred in the Zhenxhuquan pool, with distinctly high ratios of arsenate to total dissolved arsenic (0.73-0.86). Coupled with iron and sulfur oxidation along the outflow channel, arsenic accumulated in downstream sediments with concentrations up to 16.44 g/kg and appeared to significantly constrain their microbial community diversity. These oxidations might be correlated with the appearance of some putative functional microbial populations, such as Aquificae and Pseudomonas (arsenic oxidation), Sulfolobus (sulfur and iron oxidation), Metallosphaera and Acidicaldus (iron oxidation). Temperature, total organic carbon and dissolved oxygen significantly shaped the microbial community structure of upstream and downstream samples. In the upstream outflow channel region, most microbial populations were microaerophilic/anaerobic thermophiles and hyperthermophiles, such as Sulfolobus, Nocardia, Fervidicoccus, Delftia, and Ralstonia. In the downstream region, aerobic heterotrophic mesophiles and thermophiles were identified, including Ktedonobacteria, Acidicaldus, Chthonomonas and Sphingobacteria. A total of 72.41-95.91% unassigned-genus sequences were derived from the downstream high arsenic sediments 16S rRNA clone libraries. This study could enable us to achieve an integrated understanding on arsenic biogeochemistry in acid hot springs.

  5. CRF19_cpx is an Evolutionary fit HIV-1 Variant Strongly Associated With Rapid Progression to AIDS in Cuba

    PubMed Central

    Kouri, Vivian; Khouri, Ricardo; Alemán‬, Yoan; Abrahantes, Yeissel; Vercauteren, Jurgen; Pineda-Peña, Andrea-Clemencia; Theys, Kristof; Megens, Sarah; Moutschen, Michel; Pfeifer, Nico; Van Weyenbergh, Johan; Pérez, Ana B.; Pérez, Jorge; Pérez, Lissette; Van Laethem, Kristel; Vandamme, Anne-Mieke

    2015-01-01

    Background Clinicians reported an increasing trend of rapid progression (RP) (AIDS within 3 years of infection) in Cuba. Methods Recently infected patients were prospectively sampled, 52 RP at AIDS diagnosis (AIDS-RP) and 21 without AIDS in the same time frame (non-AIDS). 22 patients were sampled at AIDS diagnosis (chronic-AIDS) retrospectively assessed as > 3 years infected. Clinical, demographic, virological, epidemiological and immunological data were collected. Pol and env sequences were used for subtyping, transmission cluster analysis, and prediction of resistance, co-receptor use and evolutionary fitness. Host, immunological and viral predictors of RP were explored through data mining. Findings Subtyping revealed 26 subtype B strains, 6 C, 6 CRF18_cpx, 9 CRF19_cpx, 29 BG-recombinants and other subtypes/URFs. All patients infected with CRF19 belonged to the AIDS-RP group. Data mining identified CRF19, oral candidiasis and RANTES levels as the strongest predictors of AIDS-RP. CRF19 was more frequently predicted to use the CXCR4 co-receptor, had higher fitness scores in the protease region, and patients had higher viral load at diagnosis. Interpretation CRF19 is a recombinant of subtype D (C-part of Gag, PR, RT and nef), subtype A (N-part of Gag, Integrase, Env) and subtype G (Vif, Vpr, Vpu and C-part of Env). Since subtypes D and A have been associated with respectively faster and slower disease progression, our findings might indicate a fit PR driving high viral load, which in combination with co-infections may boost RANTES levels and thus CXCR4 use, potentially explaining the fast progression. We propose that CRF19 is evolutionary very fit and causing rapid progression to AIDS in many newly infected patients in Cuba. PMID:26137563

  6. CRF19_cpx is an Evolutionary fit HIV-1 Variant Strongly Associated With Rapid Progression to AIDS in Cuba.

    PubMed

    Kouri, Vivian; Khouri, Ricardo; Alemán, Yoan; Abrahantes, Yeissel; Vercauteren, Jurgen; Pineda-Peña, Andrea-Clemencia; Theys, Kristof; Megens, Sarah; Moutschen, Michel; Pfeifer, Nico; Van Weyenbergh, Johan; Pérez, Ana B; Pérez, Jorge; Pérez, Lissette; Van Laethem, Kristel; Vandamme, Anne-Mieke

    2015-03-01

    Clinicians reported an increasing trend of rapid progression (RP) (AIDS within 3 years of infection) in Cuba. Recently infected patients were prospectively sampled, 52 RP at AIDS diagnosis (AIDS-RP) and 21 without AIDS in the same time frame (non-AIDS). 22 patients were sampled at AIDS diagnosis (chronic-AIDS) retrospectively assessed as > 3 years infected. Clinical, demographic, virological, epidemiological and immunological data were collected. Pol and env sequences were used for subtyping, transmission cluster analysis, and prediction of resistance, co-receptor use and evolutionary fitness. Host, immunological and viral predictors of RP were explored through data mining. Subtyping revealed 26 subtype B strains, 6 C, 6 CRF18_cpx, 9 CRF19_cpx, 29 BG-recombinants and other subtypes/URFs. All patients infected with CRF19 belonged to the AIDS-RP group. Data mining identified CRF19, oral candidiasis and RANTES levels as the strongest predictors of AIDS-RP. CRF19 was more frequently predicted to use the CXCR4 co-receptor, had higher fitness scores in the protease region, and patients had higher viral load at diagnosis. CRF19 is a recombinant of subtype D (C-part of Gag, PR, RT and nef), subtype A (N-part of Gag, Integrase, Env) and subtype G (Vif, Vpr, Vpu and C-part of Env). Since subtypes D and A have been associated with respectively faster and slower disease progression, our findings might indicate a fit PR driving high viral load, which in combination with co-infections may boost RANTES levels and thus CXCR4 use, potentially explaining the fast progression. We propose that CRF19 is evolutionary very fit and causing rapid progression to AIDS in many newly infected patients in Cuba.

  7. Killed whole-HIV vaccine; employing a well established strategy for antiviral vaccines.

    PubMed

    Kang, C Yong; Gao, Yong

    2017-09-12

    The development of an efficient prophylactic HIV vaccine has been one of the major challenges in infectious disease research during the last three decades. Here, we present a mini review on strategies employed for the development of HIV vaccines with an emphasis on a well-established vaccine technology, the killed whole-virus vaccine approach. Recently, we reported an evaluation of the safety and the immunogenicity of a genetically modified and killed whole-HIV-1 vaccine designated as SAV001 [1]. HIV-1 Clade B NL4-3 was genetically modified by deleting the nef and vpu genes and substituting the coding sequence of the Env signal peptide with that of honeybee melittin to produce an avirulent and replication efficient HIV-1. This genetically modified virus (gmHIV-1 NL4-3 ) was propagated in a human T cell line followed by virus purification and inactivation by aldrithiol-2 and γ-irradiation. We found that SAV001 was well tolerated with no serious adverse events. HIV-1 NL4-3 -specific polymerase chain reaction showed no evidence of vaccine virus replication in participants receiving SAV001 and in human T cells infected in vitro. Furthermore, SAV001 with an adjuvant significantly increased the antibody response to HIV-1 structural proteins. Moreover, antibodies in the plasma from these vaccinations neutralized tier I and tier II of HIV-1 B, A, and D subtypes. These results indicated that the killed whole-HIV vaccine is safe and may trigger appropriate immune responses to prevent HIV infection. Utilization of this killed whole-HIV vaccine strategy may pave the way to develop an effective HIV vaccine.

  8. Detecting authorized and unauthorized genetically modified organisms containing vip3A by real-time PCR and next-generation sequencing.

    PubMed

    Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J

    2014-04-01

    The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.

  9. A Rapid Method for Engineering Recombinant Polioviruses or Other Enteroviruses.

    PubMed

    Bessaud, Maël; Pelletier, Isabelle; Blondel, Bruno; Delpeyroux, Francis

    2016-01-01

    The cloning of large enterovirus RNA sequences is labor-intensive because of the frequent instability in bacteria of plasmidic vectors containing the corresponding cDNAs. In order to circumvent this issue we have developed a PCR-based method that allows the generation of highly modified or chimeric full-length enterovirus genomes. This method relies on fusion PCR which enables the concatenation of several overlapping cDNA amplicons produced separately. A T7 promoter sequence added upstream the fusion PCR products allows its transcription into infectious genomic RNAs directly in transfected cells constitutively expressing the phage T7 RNA polymerase. This method permits the rapid recovery of modified viruses that can be subsequently amplified on adequate cell-lines.

  10. XX males SRY negative: a confirmed cause of infertility.

    PubMed

    Vetro, Annalisa; Ciccone, Roberto; Giorda, Roberto; Patricelli, Maria Grazia; Della Mina, Erika; Forlino, Antonella; Zuffardi, Orsetta

    2011-10-01

    SOX9 is a widely expressed transcription factor playing several relevant functions during development and essential for testes differentiation. It is considered to be the direct target gene of the protein encoded by SRY and its overexpression in an XX murine gonad can lead to male development in the absence of Sry. Recently, a family was reported with a 178 kb duplication in the gene desert region ending about 500 kb upstream of SOX9 in which 46,XY duplicated persons were completely normal and fertile whereas the 46,XX ones were males who came to clinical attention because of infertility. We report a family with two azoospermic brothers, both 46,XX, SRY negative, having a 96 kb triplication 500 kb upstream of SOX9. Both subjects have been analyzed trough oligonucleotide array-CGH and the triplication was confirmed and characterised through qPCR, defining the minimal region of amplification upstream of SOX9 associated with 46,XX infertile males, SRY negative. Our results confirm that even in absence of SRY, complete male differentiation may occur, possibly driven by overexpression of SOX9 in the gonadal ridge, as a consequence of the amplification of a gene desert region. We hypothesize that this region contains gonadal specific long-range regulation elements whose alteration may impair the normal sex development. Our data show that normal XX males, with alteration in copy number or, possibly, in the critical sequence upstream to SOX9 are a new category of infertility inherited in a dominant way with expression limited to the XX background.

  11. O2 and CO2 glow-discharge-assisted oxygen transport through Ag

    NASA Astrophysics Data System (ADS)

    Outlaw, R. A.

    1990-08-01

    The permeation of oxygen through Ag normally occurs by a sequence of steps which include the initial dissociative adsorption of molecular oxygen at the upstream surface, the dissolution of the atoms into the bulk, and the subsequent migration of the atoms between octahedral sites of the lattice until they arrive at the vacuum interface downstream. The dissociative adsorption step, however, proceeds slowly, as indicated by the low sticking coefficient of O2 on Ag(10-6-10-3). The application of a dc field in 0.5 Torr of O2 (E/n˜10-14 V cm2) on the upstream side of a Ag membrane generated gas phase atomic oxygen that substantially enhanced the transport. The transport flux was observed to increase from a value of 4.4×1013 cm-2 s-1 to a glow discharge value of 2.83×1014 cm-2 s-1 at a membrane temperature of 650 °C. This suggests that the dissociative adsorption step limits the supply of oxygen atoms to the upstream side of the membrane. When the upstream O2 was replaced by an equal pressure of CO2, only a small permeation signal was observed, but the application of the glow discharge substantially increased the transport flux from 3.25×1012 cm-2 s-1 to 1.74×1014 cm-2 s-1. This method of separating O2 from a CO2 environment may be a possible mechanism for providing a supply of oxygen for astronauts in a manned mission to Mars.

  12. Characterization of a Fluorescent Protein Reporter System

    DTIC Science & Technology

    2008-03-01

    pathways are initiated with the binding of a small molecule to a catalytic ribonucleic acid molecule (RNA), called a ribozyme (Thodima et al., 2006). The... ribozyme is part of a larger RNA construct, called a riboswitch, which initiates translation of a specific genetic sequence on a plasmid (circular...protein gene. Yen et al. (2004) reported insertion of a self-cleaving ribozyme upstream of the reporter gene. In the absence of a regulator (“off

  13. The pineapple AcMADS1 promoter confers high level expression in tomato and arabidopsis flowering and fruiting tissues, but AcMADS1 does not complement the tomato LeMADS-RIN (rin) mutant

    USDA-ARS?s Scientific Manuscript database

    A previous EST study identified a MADS box transcription factor coding sequence, AcMADS1, that is strongly induced during non-climacteric pineapple fruit ripening. Phylogenetic analyses place the AcMADS1 protein in the same superclade as LeMADS-RIN, a master regulator of fruit ripening upstream of e...

  14. In Vivo Imaging of MDR1A Gene Expression

    DTIC Science & Technology

    2004-12-01

    Engineer PGK-neo and Renilla luciferase cassettes, already available, with appropriate loxP sites, into mdrla locus. Repeat for HSV-tk reporter. The...of the gene-targeting vector. under the control of the PGK promoter. Luc: Renilla luciferase fused in- frame with the translated sequences of exon 2...between the two loxP sites, upstream of the Neo cassette. A cloning strategy was then devised to fuse Renilla luciferase in-frame with the translated

  15. Crosstalk between mTORC1 and cAMP Signaling

    DTIC Science & Technology

    2016-09-01

    2010). It has been suggested that the low mTOR activity retained under moderate hyper - tonic conditions facilitates the expression of some osmo...member of the MAP kinase (MAPK) subfamily. It is notable that the activation loop ofNLK protein possesses the sequence Thr–Gln–Glu (TQE) motif...Ishitani et al. 2011). Thus, NLK can be activated without being phosphorylated in the activation loop by upstream kinases. Moreover, high levels of

  16. The Role of eIF4E Activity in Breast Cancer

    DTIC Science & Technology

    2010-08-01

    ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less product...have previously shown that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem

  17. An Upstream Truncation of the furA-katG Operon Confers High-Level Isoniazid Resistance in a Mycobacterium tuberculosis Clinical Isolate with No Known Resistance-Associated Mutations

    PubMed Central

    Yam, Wing Cheong; Zhang, Ying; Kao, Richard Y. T.

    2014-01-01

    Although the major causes of isoniazid (INH) resistance in Mycobacterium tuberculosis are confined to structural mutations in katG and promoter mutations in the mabA-inhA operon, a significant proportion of INH-resistant strains have unknown resistance mechanisms. Recently, we identified a high-level INH-resistant M. tuberculosis clinical isolate, GB005, with no known resistance-associated mutations. A comprehensive study was performed to investigate the molecular basis of drug resistance in this strain. Although no mutations were found throughout the katG and furA-katG intergenic region, the katG expression and the catalase activity were greatly diminished compared to those in H37Rv (P < 0.01). Northern blotting revealed that the katG transcript from the isolate was smaller than that of H37Rv. Sequencing analysis of furA and upstream genes discovered a 7.2-kb truncation extended from the 96th base preceding the initiation codon of katG. Complementation of the M. tuberculosis Δ(furA-katG) strain with katG and different portions of the truncated region identified a 134-bp upstream fragment of furA that was essential for full catalase activity and INH susceptibility in M. tuberculosis. The promoter activity of this fragment was also shown to be stronger than that of the furA-katG intergenic region (P < 0.01). Collectively, these findings demonstrate that deletion of the 134-bp furA upstream fragment is responsible for the reduction in katG expression, resulting in INH resistance in GB005. To our knowledge, this is the first report showing that deletion of the upstream region preceding the furA-katG operon causes high-level INH resistance in a clinical isolate of M. tuberculosis. PMID:25092698

  18. Evolutionary mechanisms involved in the virulence of infectious salmon anaemia virus (ISAV), a piscine orthomyxovirus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Markussen, Turhan; Jonassen, Christine Monceyron; Numanovic, Sanela

    2008-05-10

    Infectious salmon anaemia virus (ISAV) is an orthomyxovirus causing a multisystemic, emerging disease in Atlantic salmon. Here we present, for the first time, detailed sequence analyses of the full-genome sequence of a presumed avirulent isolate displaying a full-length hemagglutinin-esterase (HE) gene (HPR0), and compare this with full-genome sequences of 11 Norwegian ISAV isolates from clinically diseased fish. These analyses revealed the presence of a virulence marker right upstream of the putative cleavage site R{sub 267} in the fusion (F) protein, suggesting a Q{sub 266} {yields} L{sub 266} substitution to be a prerequisite for virulence. To gain virulence in isolates lackingmore » this substitution, a sequence insertion near the cleavage site seems to be required. This strongly suggests the involvement of a protease recognition pattern at the cleavage site of the fusion protein as a determinant of virulence, as seen in highly pathogenic influenza A virus H5 or H7 and the paramyxovirus Newcastle disease virus.« less

  19. Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

    PubMed

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

  20. DNA sequences of three beta-1,4-endoglucanase genes from Thermomonospora fusca.

    PubMed Central

    Lao, G; Ghangas, G S; Jung, E D; Wilson, D B

    1991-01-01

    The DNA sequences of the Thermomonospora fusca genes encoding cellulases E2 and E5 and the N-terminal end of E4 were determined. Each sequence contains an identical 14-bp inverted repeat upstream of the initiation codon. There were no significant homologies between the coding regions of the three genes. The E2 gene is 73% identical to the celA gene from Microbispora bispora, but this was the only homology found with other cellulase genes. E2 belongs to a family of cellulases that includes celA from M. bispora, cenA from Cellulomonas fimi, casA from an alkalophilic Streptomyces strain, and cellobiohydrolase II from Trichoderma reesei. E4 shows 44% identity to an avocado cellulase, while E5 belongs to the Bacillus cellulase family. There were strong similarities between the amino acid sequences of the E2 and E5 cellulose binding domains, and these regions also showed homology with C. fimi and Pseudomonas fluorescens cellulose binding domains. PMID:1904434

  1. Leaf Litter Decomposition as a Functional Assessment of a Natural Stream Channel Design Project

    NASA Astrophysics Data System (ADS)

    Gentry, A.; Word, D.; Carreiro, M.; Jack, J.

    2005-05-01

    In October 2003, a 965m reach of Wilson Creek (Bernheim Research Forest, Kentucky, USA) was relocated, and meanders and riffle-pool sequences were restored, providing a unique opportunity to measure the re-establishment of post-restoration stream functions. Leaf litter bags were placed across riffles in the restored reach, in an upstream reference site and in two reference streams. Bags were collected for nine months, and mass loss, N dynamics and fungal ergosterol were measured. Daily mass loss rates in the restored and reference riffles in Wilson Creek were faster (k= -0.00759 and k= -0.00855, respectively) than those of the two reference streams (k= -0.00511 and k= -0.00308). This is equivalent to litter mean residence times of 132 days for the restored reach in Wilson, 117 days in the upstream reference site, and 196 and 325 days for the reference streams. It appears that the decay rate in the restored reach is similar to the upstream portion of Wilson Creek, indicating rapid mass loss recovery in the restored reach. We also determined that same-stream reference sites are important for evaluating the restoration of stream functions, because of high decay rate variation among nearby streams within the same watershed.

  2. Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene

    PubMed Central

    Layman, Lawrence C.; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G.; Kim, Hyung-Goo; Carr, Bruce R.

    2014-01-01

    Background 46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. Methods DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. Results A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. Conclusion This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. PMID:24907458

  3. Role of the open reading frames of Rous sarcoma virus leader RNA in translation and genome packaging.

    PubMed Central

    Donzé, O; Spahr, P F

    1992-01-01

    The Rous sarcoma virus (RSV) RNA leader sequence carries three open reading frames (uORFs) upstream of the AUG initiator of the gag gene. We studied, in vivo, the role of these uORFs by changing two or three nucleotides of the three AUGs or by deleting the first uORF. Our results show that (i) unlike most previously characterized uORFs, which decrease translation, the first uORF (AUG1) of RSV acts as an enhancer of translation, since absence of the first AUG decreased translation; AUG3 also modulates translation, probably by interfering with scanning ribosomes as described for other upstream ORFs, and mutation of AUG2 had no effect on translation. (ii) Mutation of each of the upstream AUGs lowered the infectivity of progeny virions. (iii) Unexpectedly, mutation of AUG1 and/or AUG3 dramatically reduced RNA packaging by 50-to 100-fold, unlike mutation of AUG2 which did not alter RNA packaging efficiency. Additional mutants in the vicinity of uORF1 and uORF3 were constructed in order to elucidate the mechanism by which uORFs affect RNA packaging: a translation model requiring uORFs 1 and 3, and involving ribosome pausing at AUG 3 is discussed. Images PMID:1327749

  4. Long interspersed repeated DNA (LINE) causes polymorphism at the rat insulin 1 locus.

    PubMed

    Lakshmikumaran, M S; D'Ambrosio, E; Laimins, L A; Lin, D T; Furano, A V

    1985-09-01

    The insulin 1, but not the insulin 2, locus is polymorphic (i.e., exhibits allelic variation) in rats. Restriction enzyme analysis and hybridization studies showed that the polymorphic region is 2.2 kilobases upstream of the insulin 1 coding region and is due to the presence or absence of an approximately 2.7-kilobase repeated DNA element. DNA sequence determination showed that this DNA element is a member of a long interspersed repeated DNA family (LINE) that is highly repeated (greater than 50,000 copies) and highly transcribed in the rat. Although the presence or absence of LINE sequences at the insulin 1 locus occurs in both the homozygous and heterozygous states, LINE-containing insulin 1 alleles are more prevalent in the rat population than are alleles without LINEs. Restriction enzyme analysis of the LINE-containing alleles indicated that at least two versions of the LINE sequence may be present at the insulin 1 locus in different rats. Either repeated transposition of LINE sequences or gene conversion between the resident insulin 1 LINE and other sequences in the genome are possible explanations for this.

  5. Use of signal sequences as an in situ removable sequence element to stimulate protein synthesis in cell-free extracts

    PubMed Central

    Ahn, Jin-Ho; Hwang, Mi-Yeon; Lee, Kyung-Ho; Choi, Cha-Yong; Kim, Dong-Myung

    2007-01-01

    This study developed a method to boost the expression of recombinant proteins in a cell-free protein synthesis system without leaving additional amino acid residues. It was found that the nucleotide sequences of the signal peptides serve as an efficient downstream box to stimulate protein synthesis when they were fused upstream of the target genes. The extent of stimulation was critically affected by the identity of the second codons of the signal sequences. Moreover, the yield of the synthesized protein was enhanced by as much as 10 times in the presence of an optimal second codon. The signal peptides were in situ cleaved and the target proteins were produced in their native sizes by carrying out the cell-free synthesis reactions in the presence of Triton X-100, most likely through the activation of signal peptidase in the S30 extract. The amplification of the template DNA and the addition of the signal sequences were accomplished by PCR. Hence, elevated levels of recombinant proteins were generated within several hours. PMID:17185295

  6. Tenebrio molitor antifreeze protein gene identification and regulation.

    PubMed

    Qin, Wensheng; Walker, Virginia K

    2006-02-15

    The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.

  7. Membrane-bound human orphan cytochrome P450 2U1: Sequence singularities, construction of a full 3D model, and substrate docking.

    PubMed

    Ducassou, Lionel; Dhers, Laura; Jonasson, Gabriella; Pietrancosta, Nicolas; Boucher, Jean-Luc; Mansuy, Daniel; André, François

    2017-09-01

    Human cytochrome P450 2U1 (CYP2U1) is an orphan CYP that exhibits several distinctive characteristics among the 57 human CYPs with a highly conserved sequence in almost all living organisms. We compared its protein sequence with those of the 57 human CYPs and constructed a 3D structure of a full-length CYP2U1 model bound to a POPC membrane. We also performed docking experiments of arachidonic acid (AA) and N-arachidonoylserotonin (AS) in this model. The protein sequence of CYP2U1 displayed two unique characteristics when compared to those of the human CYPs, the presence of a longer N-terminal region upstream of the putative trans-membrane helix (TMH) containing 8 proline residues, and of an insert of about 20 amino acids containing 5 arginine residues between helices A' and A. Its N-terminal part upstream of TMH involved an additional short terminal helix, in a manner similar to what was reported in the crystal structure of Saccharomyces cerevisiae CYP51. Our model also showed a specific interaction between the charged residues of insert AA' and phosphate groups of lipid polar heads, suggesting a possible role of this insert in substrate recruitment. Docking of AA and AS in this model showed these substrates in channel 2ac, with the terminal alkyl chain of AA or the indole ring of AS close to the heme, in agreement with the reported CYP2U1-catalyzed AA and AS hydroxylation regioselectivities. This model should be useful to find new endogenous or exogenous CYP2U1 substrates and to interpret the regioselectivity of their hydroxylation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  8. The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

    1994-12-31

    Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

  9. An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

    PubMed

    Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

    2009-10-19

    Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

  10. 5’-Terminal AUGs in Escherichia coli mRNAs with Shine-Dalgarno Sequences: Identification and Analysis of Their Roles in Non-Canonical Translation Initiation

    PubMed Central

    Beck, Heather J.; Fleming, Ian M. C.

    2016-01-01

    Analysis of the Escherichia coli transcriptome identified a unique subset of messenger RNAs (mRNAs) that contain a conventional untranslated leader and Shine-Dalgarno (SD) sequence upstream of the gene’s start codon while also containing an AUG triplet at the mRNA’s 5’- terminus (5’-uAUG). Fusion of the coding sequence specified by the 5’-terminal putative AUG start codon to a lacZ reporter gene, as well as primer extension inhibition assays, reveal that the majority of the 5’-terminal upstream open reading frames (5’-uORFs) tested support some level of lacZ translation, indicating that these mRNAs can function both as leaderless and canonical SD-leadered mRNAs. Although some of the uORFs were expressed at low levels, others were expressed at levels close to that of the respective downstream genes and as high as the naturally leaderless cI mRNA of bacteriophage λ. These 5’-terminal uORFs potentially encode peptides of varying lengths, but their functions, if any, are unknown. In an effort to determine whether expression from the 5’-terminal uORFs impact expression of the immediately downstream cistron, we examined expression from the downstream coding sequence after mutations were introduced that inhibit efficient 5’-uORF translation. These mutations were found to affect expression from the downstream cistrons to varying degrees, suggesting that some 5’-uORFs may play roles in downstream regulation. Since the 5’-uAUGs found on these conventionally leadered mRNAs can function to bind ribosomes and initiate translation, this indicates that canonical mRNAs containing 5’-uAUGs should be examined for their potential to function also as leaderless mRNAs. PMID:27467758

  11. Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7

    PubMed Central

    Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain

    2017-01-01

    ABSTRACT Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent −12/−24 promoter consensus. The expression of an exaA::lacZ fusion was induced maximally by glycerol and was dependent on σ54. Bioinformatic analysis of the sequence flanking the −12/−24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA. EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense. We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ54-dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ54. The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ54 in other bacteria. PMID:28439037

  12. Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7.

    PubMed

    Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain; Tripathi, Anil Kumar

    2017-07-01

    Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent -12/-24 promoter consensus. The expression of an exaA :: lacZ fusion was induced maximally by glycerol and was dependent on σ 54 Bioinformatic analysis of the sequence flanking the -12/-24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ 54 -dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ 54 The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ 54 in other bacteria. Copyright © 2017 American Society for Microbiology.

  13. A duplication upstream of SOX9 was not positively correlated with the SRY-negative 46,XX testicular disorder of sex development: A case report and literature review

    PubMed Central

    XIA, XIN-YI; ZHANG, CUI; LI, TIAN-FU; WU, QIU-YUE; LI, NA; LI, WEI-WEI; CUI, YING-XIA; LI, XIAO-JUN; SHI, YI-CHAO

    2015-01-01

    The 46,XX male disorder of sex development (DSD) is rarely observed in humans. Patients with DSD are all male with testicular tissue differentiation. The mechanism of sex determination and differentiation remains to be elucidated. In the present case report, an 46,XX inv (9) infertile male negative for the sex-determining region of the Y chromosome (SRY) gene was examined. This infertile male was systemically assessed by semen analysis, serum hormone testing and gonadal biopsy. Formalin-fixed and paraffin-embedded gonad tissues were assessed histochemically. The SRY gene was analyzed by fluorescence in situ hybridization (FISH) and polymerase chain reaction (PCR). The other 23 specific loci, including the azoospermia factor region on the Y chromosome and the sequence-targeted sites of the SRY-box 9 (SOX9) gene were analyzed by PCR. The genes RSPO1, DAX1, SOX3, ROCK, DMRT1, SPRY2 and FGF9 were also assessed using sequencing analysis. Affymetrix Cytogenetics Whole Genome 2.7 M Arrays were used for detecting the genomic DNA from the patient and the parents. The patient with the 46,XX inv (9) (p11q13) karyotype exhibited male primary, however, not secondary sexual characteristics. However, the patient's mother with the 46, XX inv (9) karyotype was unaffected. The testicular tissue dysplasia of the patient was confirmed by tissue biopsy and absence of the SRY gene, and the other 23 loci on the Y chromosome were confirmed by FISH and/or PCR. The RSPO1, DAX1, SOX3, ROCK, DMRT1, SPRY2 and FGF9 genes were sequenced and no mutations were detected. A duplication on the 3 M site in the upstream region of SOX9 was identified in the patient as well as in the mother. The patient with the 46,XX testicular DSD and SRY-negative status was found to be infertile. The duplication on the 3 M site in the upstream region of SOX9 was a polymorphism, which indicated that the change was not a cause of 46,XX male SDS. These clinical, molecular and cytogenetic findings suggested that other unidentified genetic or environmental factors are significant in the regulation of SDS. PMID:26260363

  14. A duplication upstream of SOX9 was not positively correlated with the SRY‑negative 46,XX testicular disorder of sex development: A case report and literature review.

    PubMed

    Xia, Xin-Yi; Zhang, Cui; Li, Tian-Fu; Wu, Qiu-Yue; Li, Na; Li, Wei-Wei; Cui, Ying-Xia; Li, Xiao-Jun; Shi, Yi-Chao

    2015-10-01

    The 46,XX male disorder of sex development (DSD) is rarely observed in humans. Patients with DSD are all male with testicular tissue differentiation. The mechanism of sex determination and differentiation remains to be elucidated. In the present case report, an 46,XX inv (9) infertile male negative for the sex‑determining region of the Y chromosome (SRY) gene was examined. This infertile male was systemically assessed by semen analysis, serum hormone testing and gonadal biopsy. Formalin‑fixed and paraffin‑embedded gonad tissues were assessed histochemically. The SRY gene was analyzed by fluorescence in situ hybridization (FISH) and polymerase chain reaction (PCR). The other 23 specific loci, including the azoospermia factor region on the Y chromosome and the sequence-targeted sites of the SRY‑box 9 (SOX9) gene were analyzed by PCR. The genes RSPO1, DAX1, SOX3, ROCK, DMRT1, SPRY2 and FGF9 were also assessed using sequencing analysis. Affymetrix Cytogenetics Whole Genome 2.7 M Arrays were used for detecting the genomic DNA from the patient and the parents. The patient with the 46,XX inv (9) (p11q13) karyotype exhibited male primary, however, not secondary sexual characteristics. However, the patient's mother with the 46, XX inv (9) karyotype was unaffected. The testicular tissue dysplasia of the patient was confirmed by tissue biopsy and absence of the SRY gene, and the other 23 loci on the Y chromosome were confirmed by FISH and/or PCR. The RSPO1, DAX1, SOX3, ROCK, DMRT1, SPRY2 and FGF9 genes were sequenced and no mutations were detected. A duplication on the 3 M site in the upstream region of SOX9 was identified in the patient as well as in the mother. The patient with the 46,XX testicular DSD and SRY‑negative status was found to be infertile. The duplication on the 3 M site in the upstream region of SOX9 was a polymorphism, which indicated that the change was not a cause of 46,XX male SDS. These clinical, molecular and cytogenetic findings suggested that other unidentified genetic or environmental factors are significant in the regulation of SDS.

  15. X-Prolyl Dipeptidyl Aminopeptidase Gene (pepX) Is Part of the glnRA Operon in Lactobacillus rhamnosus

    PubMed Central

    Varmanen, Pekka; Savijoki, Kirsi; Åvall, Silja; Palva, Airi; Tynkkynen, Soile

    2000-01-01

    A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate l-glycyl-l-prolyl-β-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA-pepX intergenic region, a sequence that showed homology to a 23S-5S intergenic spacer and to several other L. rhamnosus-related entries in data banks. PMID:10613874

  16. X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

    PubMed

    Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

    2000-01-01

    A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA-pepX intergenic region, a sequence that showed homology to a 23S-5S intergenic spacer and to several other L. rhamnosus-related entries in data banks.

  17. Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

    PubMed

    Fahrner, Karen A; Berg, Howard C

    2015-10-01

    Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

    PubMed

    Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

    2005-06-03

    We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

  19. [A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].

    PubMed

    Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming

    2003-01-01

    To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.

  20. Sequences required for transcription termination at the intrinsic lambdatI terminator.

    PubMed

    Martínez-Trujillo, Miguel; Sánchez-Trujillo, Alejandra; Ceja, Víctor; Avila-Moreno, Federico; Bermúdez-Cruz, Rosa María; Court, Donald; Montañez, Cecilia

    2010-02-01

    The lambdatI terminator is located approximately 280 bp beyond the lambdaint gene, and it has a typical structure of an intrinsic terminator. To identify sequences required for lambdatI transcription termination a set of deletion mutants were generated, either from the 5' or the 3' end onto the lambdatI region. The termination efficiency was determined by measuring galactokinase (galK) levels by Northern blot assays and by in vitro transcription termination. The importance of the uridines and the stability of the stem structure in the termination were demonstrated. The nontranscribed DNA beyond the 3' end also affects termination. Additionally, sequences upstream have a small effect on transcription termination. The in vivo RNA termination sites at lambdatI were determined by S1 mapping and were located at 8 different positions. Processing of transcripts from the 3' end confirmed the importance of the hairpin stem in protection against exonuclease.

  1. A Gibbs sampler for motif detection in phylogenetically close sequences

    NASA Astrophysics Data System (ADS)

    Siddharthan, Rahul; van Nimwegen, Erik; Siggia, Eric

    2004-03-01

    Genes are regulated by transcription factors that bind to DNA upstream of genes and recognize short conserved ``motifs'' in a random intergenic ``background''. Motif-finders such as the Gibbs sampler compare the probability of these short sequences being represented by ``weight matrices'' to the probability of their arising from the background ``null model'', and explore this space (analogous to a free-energy landscape). But closely related species may show conservation not because of functional sites but simply because they have not had sufficient time to diverge, so conventional methods will fail. We introduce a new Gibbs sampler algorithm that accounts for common ancestry when searching for motifs, while requiring minimal ``prior'' assumptions on the number and types of motifs, assessing the significance of detected motifs by ``tracking'' clusters that stay together. We apply this scheme to motif detection in sporulation-cycle genes in the yeast S. cerevisiae, using recent sequences of other closely-related Saccharomyces species.

  2. Tobacco chloroplast tRNALys(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron

    PubMed Central

    Sugita, Mamoru; Shinozaki, Kazuo; Sugiura, Masahiro

    1985-01-01

    The nucleotide sequence of a tRNALys(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNAGly(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long. Images PMID:16593561

  3. Tobacco chloroplast tRNA(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron.

    PubMed

    Sugita, M; Shinozaki, K; Sugiura, M

    1985-06-01

    The nucleotide sequence of a tRNA(Lys)(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNA(Gly)(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long.

  4. Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species.

    PubMed

    Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K

    2014-01-01

    Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Characterization of the Structural Gene Promoter of Aedes aegypti Densovirus

    PubMed Central

    Ward, Todd W.; Kimmick, Michael W.; Afanasiev, Boris N.; Carlson, Jonathan O.

    2001-01-01

    Aedes aegypti densonucleosis virus (AeDNV) has two promoters that have been shown to be active by reporter gene expression analysis (B. N. Afanasiev, Y. V. Koslov, J. O. Carlson, and B. J. Beaty, Exp. Parasitol. 79:322–339, 1994). Northern blot analysis of cells infected with AeDNV revealed two transcripts 1,200 and 3,500 nucleotides in length that are assumed to express the structural protein (VP) gene and nonstructural protein genes, respectively. Primer extension was used to map the transcriptional start site of the structural protein gene. Surprisingly, the structural protein gene transcript began at an initiator consensus sequence, CAGT, 60 nucleotides upstream from the map unit 61 TATAA sequence previously thought to define the promoter. Constructs with the β-galactosidase gene fused to the structural protein gene were used to determine elements necessary for promoter function. Deletion or mutation of the initiator sequence, CAGT, reduced protein expression by 93%, whereas mutation of the TATAA sequence at map unit 61 had little effect. An additional open reading frame was observed upstream of the structural protein gene that can express β-galactosidase at a low level (20% of that of VP fusions). Expression of the AeDNV structural protein gene was shown to be stimulated by the major nonstructural protein NS1 (Afanasiev et al., Exp. parasitol., 1994). To determine the sequences required for transactivation, expression of structural protein gene–β-galactosidase gene fusion constructs differing in AeDNV genome content was measured with and without NS1. The presence of NS1 led to an 8- to 10-fold increase in expression when either genomic end was present, compared to a 2-fold increase with a construct lacking the genomic ends. An even higher (37-fold) increase in expression occurred with both genomic ends present; however, this was in part due to template replication as shown by Southern blot analysis. These data indicate the location and importance of various elements necessary for efficient protein expression and transactivation from the structural protein gene promoter of AeDNV. PMID:11152505

  6. The HIV-1 Tat protein modulates CD4 expression in human T cells through the induction of miR-222.

    PubMed

    Orecchini, Elisa; Doria, Margherita; Michienzi, Alessandro; Giuliani, Erica; Vassena, Lia; Ciafrè, Silvia Anna; Farace, Maria Giulia; Galardi, Silvia

    2014-01-01

    Several cellular microRNAs show substantial changes in expression during HIV-1 infection and their active role in the viral life cycle is progressively emerging. In the present study, we found that HIV-1 infection of Jurkat T cells significantly induces the expression of miR-222. We show that this induction depends on HIV-1 Tat protein, which is able to increase the transcriptional activity of NFkB on miR-222 promoter. Moreover, we demonstrate that miR-222 directly targets CD4, a key receptor for HIV-1, thus reducing its expression. We propose that Tat, by inducing miR-222 expression, complements the CD4 downregulation activity exerted by other viral proteins (i.e., Nef, Vpu, and Env), and we suggest that this represents a novel mechanism through which HIV-1 efficiently represses CD4 expression in infected cells.

  7. The HIV-1 Tat protein modulates CD4 expression in human T cells through the induction of miR-222

    PubMed Central

    Orecchini, Elisa; Doria, Margherita; Michienzi, Alessandro; Giuliani, Erica; Vassena, Lia; Ciafrè, Silvia Anna; Farace, Maria Giulia; Galardi, Silvia

    2014-01-01

    Several cellular microRNAs show substantial changes in expression during HIV-1 infection and their active role in the viral life cycle is progressively emerging. In the present study, we found that HIV-1 infection of Jurkat T cells significantly induces the expression of miR-222. We show that this induction depends on HIV-1 Tat protein, which is able to increase the transcriptional activity of NFkB on miR-222 promoter. Moreover, we demonstrate that miR-222 directly targets CD4, a key receptor for HIV-1, thus reducing its expression. We propose that Tat, by inducing miR-222 expression, complements the CD4 downregulation activity exerted by other viral proteins (i.e., Nef, Vpu, and Env), and we suggest that this represents a novel mechanism through which HIV-1 efficiently represses CD4 expression in infected cells. PMID:24717285

  8. The Role of elF4E Activity in Breast Cancer

    DTIC Science & Technology

    2011-08-01

    protein; ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...Reactions were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less...that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem-loop structure6. This

  9. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

    PubMed Central

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

    2016-01-01

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

  10. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

    PubMed

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

  11. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    PubMed

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  12. ASR5 is involved in the regulation of miRNA expression in rice.

    PubMed

    Neto, Lauro Bücker; Arenhart, Rafael Augusto; de Oliveira, Luiz Felipe Valter; de Lima, Júlio Cesar; Bodanese-Zanettini, Maria Helena; Margis, Rogerio; Margis-Pinheiro, Márcia

    2015-11-01

    The work describes an ASR knockdown transcriptomic analysis by deep sequencing of rice root seedlings and the transactivation of ASR cis-acting elements in the upstream region of a MIR gene. MicroRNAs are key regulators of gene expression that guide post-transcriptional control of plant development and responses to environmental stresses. ASR (ABA, Stress and Ripening) proteins are plant-specific transcription factors with key roles in different biological processes. In rice, ASR proteins have been suggested to participate in the regulation of stress response genes. This work describes the transcriptomic analysis by deep sequencing two libraries, comparing miRNA abundance from the roots of transgenic ASR5 knockdown rice seedlings with that of the roots of wild-type non-transformed rice seedlings. Members of 59 miRNA families were detected, and 276 mature miRNAs were identified. Our analysis detected 112 miRNAs that were differentially expressed between the two libraries. A predicted inverse correlation between miR167abc and its target gene (LOC_Os07g29820) was confirmed using RT-qPCR. Protoplast transactivation assays showed that ASR5 is able to recognize binding sites upstream of the MIR167a gene and drive its expression in vivo. Together, our data establish a comparative study of miRNAome profiles and is the first study to suggest the involvement of ASR proteins in miRNA gene regulation.

  13. Interaction of the Transcription Start Site Core Region and Transcription Factor YY1 Determine Ascorbate Transporter SVCT2 Exon 1a Promoter Activity

    PubMed Central

    Qiao, Huan; May, James M.

    2012-01-01

    Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872

  14. COUP-TF (chicken ovalbumin upstream promoter transcription factor)-interacting protein 1 (CTIP1) is a sequence-specific DNA binding protein.

    PubMed Central

    Avram, Dorina; Fields, Andrew; Senawong, Thanaset; Topark-Ngarm, Acharawan; Leid, Mark

    2002-01-01

    Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 [CTIP1/Evi9/B cell leukaemia (Bcl) l1a and CTIP2/Bcl11b respectively] are highly related C(2)H(2) zinc finger proteins that are abundantly expressed in brain and the immune system, and are associated with immune system malignancies. A selection procedure was employed to isolate high-affinity DNA binding sites for CTIP1. The core binding site on DNA identified in these studies, 5'-GGCCGG-3' (upper strand), is highly related to the canonical GC box and was bound by a CTIP1 oligomeric complex(es) in vitro. Furthermore, both CTIP1 and CTIP2 repressed transcription of a reporter gene harbouring a multimerized CTIP binding site, and this repression was neither reversed by trichostatin A (an inhibitor of known class I and II histone deacetylases) nor stimulated by co-transfection of a COUP-TF family member. These results demonstrate that CTIP1 is a sequence-specific DNA binding protein and a bona fide transcriptional repressor that is capable of functioning independently of COUP-TF family members. These findings may be relevant to the physiological and/or pathological action(s) of CTIPs in cells that do not express COUP-TF family members, such as cells of the haematopoietic and immune systems. PMID:12196208

  15. Noncanonical expression of a murine cytomegalovirus early protein CD8 T-cell epitope as an immediate early epitope based on transcription from an upstream gene.

    PubMed

    Fink, Annette; Büttner, Julia K; Thomas, Doris; Holtappels, Rafaela; Reddehase, Matthias J; Lemmermann, Niels A W

    2014-02-14

    Viral CD8 T-cell epitopes, represented by viral peptides bound to major histocompatibility complex class-I (MHC-I) glycoproteins, are often identified by "reverse immunology", a strategy not requiring biochemical and structural knowledge of the actual viral protein from which they are derived by antigen processing. Instead, bioinformatic algorithms predicting the probability of C-terminal cleavage in the proteasome, as well as binding affinity to the presenting MHC-I molecules, are applied to amino acid sequences deduced from predicted open reading frames (ORFs) based on the genomic sequence. If the protein corresponding to an antigenic ORF is known, it is usually inferred that the kinetic class of the protein also defines the phase in the viral replicative cycle during which the respective antigenic peptide is presented for recognition by CD8 T cells. We have previously identified a nonapeptide from the predicted ORFm164 of murine cytomegalovirus that is presented by the MHC-I allomorph H-2 Dd and that is immunodominant in BALB/c (H-2d haplotype) mice. Surprisingly, although the ORFm164 protein gp36.5 is expressed as an Early (E) phase protein, the m164 epitope is presented already during the Immediate Early (IE) phase, based on the expression of an upstream mRNA starting within ORFm167 and encompassing ORFm164.

  16. Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

    PubMed Central

    Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

    1992-01-01

    Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

  17. In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

    PubMed

    Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

    1996-03-01

    In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

  18. Specific Increase of Protein Levels by Enhancing Translation Using Antisense Oligonucleotides Targeting Upstream Open Frames.

    PubMed

    Liang, Xue-Hai; Shen, Wen; Crooke, Stanley T

    2017-01-01

    A number of diseases are caused by low levels of key proteins; therefore, increasing the amount of specific proteins in human bodies is of therapeutic interest. Protein expression is downregulated by some structural or sequence elements present in the 5' UTR of mRNAs, such as upstream open reading frames (uORF). Translation initiation from uORF(s) reduces translation from the downstream primary ORF encoding the main protein product in the same mRNA, leading to a less efficient protein expression. Therefore, it is possible to use antisense oligonucleotides (ASOs) to specifically inhibit translation of the uORF by base-pairing with the uAUG region of the mRNA, redirecting translation machinery to initiate from the primary AUG site. Here we review the recent findings that translation of specific mRNAs can be enhanced using ASOs targeting uORF regions. Appropriately designed and optimized ASOs are highly specific, and they act in a sequence- and position-dependent manner, with very minor off-target effects. Protein levels can be increased using this approach in different types of human and mouse cells, and, importantly, also in mice. Since uORFs are present in around half of human mRNAs, the uORF-targeting ASOs may thus have valuable potential as research tools and as therapeutics to increase the levels of proteins for a variety of genes.

  19. A novel pathogenic variant in an Iranian Ataxia telangiectasia family revealed by next-generation sequencing followed by in silico analysis.

    PubMed

    Tabatabaiefar, Mohammad Amin; Alipour, Paria; Pourahmadiyan, Azam; Fattahi, Najmeh; Shariati, Laleh; Golchin, Neda; Mohammadi-Asl, Javad

    2017-08-15

    Ataxia telangiectasia (A-T) is a neurodegenerative autosomal recessive disorder with the main characteristics of progressive cerebellar degeneration, sensitivity to ionizing radiation, immunodeficiency, telangiectasia, premature aging, recurrent sinopulmonary infections, and increased risk of malignancy, especially of lymphoid origin. Ataxia Telangiectasia Mutated gene, ATM, as a causative gene for the A-T disorder, encodes the ATM protein, which plays an important role in the activation of cell-cycle checkpoints and initiation of DNA repair in response to DNA damage. Targeted next-generation sequencing (NGS) was performed on an Iranian 5-year-old boy presented with truncal and limb ataxia, telangiectasia of the eye, Hodgkin lymphoma, hyper pigmentation, total alopecia, hepatomegaly, and dysarthria. Sanger sequencing was used to confirm the candidate pathogenic variants. Computational docking was done using the HEX software to examine how this change affects the interactions of ATM with the upstream and downstream proteins. Three different variants were identified comprising two homozygous SNPs and one novel homozygous frameshift variant (c.80468047delTA, p.Thr2682ThrfsX5), which creates a stop codon in exon 57 leaving the protein truncated at its C-terminal portion. Therefore, the activation and phosphorylation of target proteins are lost. Moreover, the HEX software confirmed that the mutated protein lost its interaction with upstream and downstream proteins. The variant was classified as pathogenic based on the American College of Medical Genetics and Genomics guideline. This study expands the spectrum of ATM pathogenic variants in Iran and demonstrates the utility of targeted NGS in genetic diagnostics. Copyright © 2017. Published by Elsevier B.V.

  20. Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qin, Yuxiang, E-mail: yuxiangqin@126.com; Tian, Yanchen; Han, Lu

    Highlights: •A class II WRKY transcription factor, TaWRKY79 was isolated and characterized. •TaWRKY79 was induced by NaCl or abscisic acid. •843 bp regulatory segment was sufficient to respond to ABA or NaCl treatment. •TaWRKY79 enhanced salinity and ionic tolerance while reduced sensitivity to ABA. •TaWRKY79 increased salinity and ionic tolerance in an ABA-dependent pathway. -- Abstract: The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusionmore » between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway.« less

  1. Identification of a Novel Transcript and Regulatory Mechanism for Microsomal Triglyceride Transfer Protein

    PubMed Central

    Suzuki, Takashi; Brown, Judy J.; Swift, Larry L.

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is essential for the assembly of triglyceride-rich apolipoprotein B-containing lipoproteins. Previous studies in our laboratory identified a novel splice variant of MTP in mice that we named MTP-B. MTP-B has a unique first exon (1B) located 2.7 kB upstream of the first exon (1A) for canonical MTP (MTP-A). The two mature isoforms, though nearly identical in sequence and function, have different tissue expression patterns. In this study we report the identification of a second MTP splice variant (MTP-C), which contains both exons 1B and 1A. MTP-C is expressed in all the tissues we tested. In cells transfected with MTP-C, protein expression was less than 15% of that found when the cells were transfected with MTP-A or MTP-B. In silico analysis of the 5’-UTR of MTP-C revealed seven ATGs upstream of the start site for MTP-A, which is the only viable start site in frame with the main coding sequence. One of those ATGs was located in the 5’-UTR for MTP-A. We generated reporter constructs in which the 5’-UTRs of MTP-A or MTP-C were inserted between an SV40 promoter and the coding sequence of the luciferase gene and transfected these constructs into HEK 293 cells. Luciferase activity was significantly reduced by the MTP-C 5’-UTR, but not by the MTP-A 5’-UTR. We conclude that alternative splicing plays a key role in regulating MTP expression by introducing unique 5’-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP levels and activity. PMID:26771188

  2. Microbial Community Structure and Arsenic Biogeochemistry in an Acid Vapor-Formed Spring in Tengchong Geothermal Area, China

    PubMed Central

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Dai, Xinyue; Zhang, Rui; Wang, Yanhong; Wang, Yanxin

    2016-01-01

    Arsenic biogeochemistry has been studied extensively in acid sulfate-chloride hot springs, but not in acid sulfate hot springs with low chloride. In this study, Zhenzhuquan in Tengchong geothermal area, a representative acid sulfate hot spring with low chloride, was chosen to study arsenic geochemistry and microbial community structure using Illumina MiSeq sequencing. Over 0.3 million 16S rRNA sequence reads were obtained from 6-paired parallel water and sediment samples along its outflow channel. Arsenic oxidation occurred in the Zhenxhuquan pool, with distinctly high ratios of arsenate to total dissolved arsenic (0.73–0.86). Coupled with iron and sulfur oxidation along the outflow channel, arsenic accumulated in downstream sediments with concentrations up to 16.44 g/kg and appeared to significantly constrain their microbial community diversity. These oxidations might be correlated with the appearance of some putative functional microbial populations, such as Aquificae and Pseudomonas (arsenic oxidation), Sulfolobus (sulfur and iron oxidation), Metallosphaera and Acidicaldus (iron oxidation). Temperature, total organic carbon and dissolved oxygen significantly shaped the microbial community structure of upstream and downstream samples. In the upstream outflow channel region, most microbial populations were microaerophilic/anaerobic thermophiles and hyperthermophiles, such as Sulfolobus, Nocardia, Fervidicoccus, Delftia, and Ralstonia. In the downstream region, aerobic heterotrophic mesophiles and thermophiles were identified, including Ktedonobacteria, Acidicaldus, Chthonomonas and Sphingobacteria. A total of 72.41–95.91% unassigned-genus sequences were derived from the downstream high arsenic sediments 16S rRNA clone libraries. This study could enable us to achieve an integrated understanding on arsenic biogeochemistry in acid hot springs. PMID:26761709

  3. Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

    1994-04-01

    The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

  4. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    PubMed

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  5. The Oenococcus oeni clpX Homologue Is a Heat Shock Gene Preferentially Expressed in Exponential Growth Phase

    PubMed Central

    Jobin, Michel-Philippe; Garmyn, Dominique; Diviès, Charles; Guzzo, Jean

    1999-01-01

    Using degenerated primers from conserved regions of previously studied clpX gene products, we cloned the clpX gene of the malolactic bacterium Oenococcus oeni. The clpX gene was sequenced, and the deduced protein of 413 amino acids (predicted molecular mass of 45,650 Da) was highly similar to previously analyzed clpX gene products from other organisms. An open reading frame located upstream of the clpX gene was identified as the tig gene by similarity of its predicted product to other bacterial trigger factors. ClpX was purified by using a maltose binding protein fusion system and was shown to possess an ATPase activity. Northern analyses indicated the presence of two independent 1.6-kb monocistronic clpX and tig mRNAs and also showed an increase in clpX mRNA amount after a temperature shift from 30 to 42°C. The clpX transcript is abundant in the early exponential growth phase and progressively declines to undetectable levels in the stationary phase. Thus, unlike hsp18, the gene encoding one of the major small heat shock proteins of Oenococcus oeni, clpX expression is related to the exponential growth phase and requires de novo protein synthesis. Primer extension analysis identified the 5′ end of clpX mRNA which is located 408 nucleotides upstream of a putative AUA start codon. The putative transcription start site allowed identification of a predicted promoter sequence with a high similarity to the consensus sequence found in the housekeeping gene promoter of gram-positive bacteria as well as Escherichia coli. PMID:10542163

  6. Sequencing artifacts in the type A influenza databases and attempts to correct them.

    PubMed

    Suarez, David L; Chester, Nikki; Hatfield, Jason

    2014-07-01

    There are over 276 000 influenza gene sequences in public databases, with the quality of the sequences determined by the contributor. As part of a high school class project, influenza sequences with possible errors were identified in the public databases based on the size of the gene being longer than expected, with the hypothesis that these sequences would have an error. Students contacted sequence submitters alerting them of the possible sequence issue(s) and requested they the suspect sequence(s) be correct as appropriate. Type A influenza viruses were screened, and gene segments longer than the accepted size were identified for further analysis. Attention was placed on sequences with additional nucleotides upstream or downstream of the highly conserved non-coding ends of the viral segments. A total of 1081 sequences were identified that met this criterion. Three types of errors were commonly observed: non-influenza primer sequence wasn't removed from the sequence; PCR product was cloned and plasmid sequence was included in the sequence; and Taq polymerase added an adenine at the end of the PCR product. Internal insertions of nucleotide sequence were also commonly observed, but in many cases it was unclear if the sequence was correct or actually contained an error. A total of 215 sequences, or 22.8% of the suspect sequences, were corrected in the public databases in the first year of the student project. Unfortunately 138 additional sequences with possible errors were added to the databases in the second year. Additional awareness of the need for data integrity of sequences submitted to public databases is needed to fully reap the benefits of these large data sets. © 2014 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

  7. Standardization and quality management in next-generation sequencing.

    PubMed

    Endrullat, Christoph; Glökler, Jörn; Franke, Philipp; Frohme, Marcus

    2016-09-01

    DNA sequencing continues to evolve quickly even after > 30 years. Many new platforms suddenly appeared and former established systems have vanished in almost the same manner. Since establishment of next-generation sequencing devices, this progress gains momentum due to the continually growing demand for higher throughput, lower costs and better quality of data. In consequence of this rapid development, standardized procedures and data formats as well as comprehensive quality management considerations are still scarce. Here, we listed and summarized current standardization efforts and quality management initiatives from companies, organizations and societies in form of published studies and ongoing projects. These comprise on the one hand quality documentation issues like technical notes, accreditation checklists and guidelines for validation of sequencing workflows. On the other hand, general standard proposals and quality metrics are developed and applied to the sequencing workflow steps with the main focus on upstream processes. Finally, certain standard developments for downstream pipeline data handling, processing and storage are discussed in brief. These standardization approaches represent a first basis for continuing work in order to prospectively implement next-generation sequencing in important areas such as clinical diagnostics, where reliable results and fast processing is crucial. Additionally, these efforts will exert a decisive influence on traceability and reproducibility of sequence data.

  8. The silent mutation MLH1 c.543C>T resulting in aberrant splicing can cause Lynch syndrome: a case report.

    PubMed

    Yamaguchi, Tatsuro; Wakatsuki, Tomokazu; Kikuchi, Mari; Horiguchi, Shin-Ichiro; Akagi, Kiwamu

    2017-06-01

    The proband was a 67-year-old man with transverse and sigmoid colon cancer. Microsatellite instability analysis revealed a high frequency of microsatellite instability, and immunohistochemical staining showed the absence of both MLH1 and PMS2 proteins in the sigmoid colon cancer tissue specimens from the patient. DNA sequencing revealed a nucleotide substitution c.543C>T in MLH1, but this variant did not substitute an amino acid. The MLH1 c.543C>T variant was located 3 bases upstream from the end of exon 6 and created a new splice donor site 4 bases upstream from the end of exon 6. Consequently, the last 4 bases of exon 6 were deleted and frameshift occurred. Thus, the MLH1 c.543C>T silent mutation is considered 'pathogenic'. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. A murC gene from coryneform bacteria.

    PubMed

    Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K

    1999-02-01

    The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.

  10. Flow Instabilities in Feather Seals due to Upstream Harmonic Pressure Fluctuations

    NASA Technical Reports Server (NTRS)

    Deng, D.; Braun, M. J.; Henricks, Robert C.

    2008-01-01

    Feather seals (also called slot seals) typically found in turbine stators limit leakage from the platform into the core cavities and from the shroud to the case. They are of various geometric shapes, yet all are contoured to fit the aerodynamic shape of the stator and placed as close as thermomechanically reasonable the powerstream flow passage. Oscillations engendered in the compressor or combustor alter the steady leakage characteristics of these sealing elements and in some instances generate flow instabilities downstream of the seal interface. In this study, a generic feather seal geometry was studied numerically by imposing an upstream harmonic pressure disturbance on the simulated stator-blade gap. The flow and thermal characteristics were determined; it was found that for high pressure drops, large fluctuations in flows in the downstream blade-stator gap can occur. These leakages and pulsations in themselves are not all that significant, yet if coupled with cavity parameters, they could set up resonance events. Computationally generated time-dependent flow fields are captured in sequence video streaming.

  11. Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

    PubMed Central

    Hunt, C; Morimoto, R I

    1985-01-01

    We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

  12. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  13. High cancer-specific expression of mesothelin (MSLN) is attributable to an upstream enhancer containing a transcription enhancer factor dependent MCAT motif.

    PubMed

    Hucl, Tomas; Brody, Jonathan R; Gallmeier, Eike; Iacobuzio-Donahue, Christine A; Farrance, Iain K; Kern, Scott E

    2007-10-01

    Identification of genes with cancer-specific overexpression offers the potential to efficiently discover cancer-specific activities in an unbiased manner. We apply this paradigm to study mesothelin (MSLN) overexpression, a nearly ubiquitous, diagnostically and therapeutically useful characteristic of pancreatic cancer. We identified an 18-bp upstream enhancer, termed CanScript, strongly activating transcription from an otherwise weak tissue-nonspecific promoter and operating selectively in cells having aberrantly elevated cancer-specific MSLN transcription. Introducing mutations into CanScript showed two functionally distinct sites: an Sp1-like site and an MCAT element. Gel retardation and chromatin immunoprecipitation assays showed the MCAT element to be bound by transcription enhancer factor (TEF)-1 (TEAD1) in vitro and in vivo. The presence of TEF-1 was required for MSLN protein overexpression as determined by TEF-1 knockdown experiments. The cancer specificity seemed to be provided by a putative limiting cofactor of TEF-1 that could be outcompeted by exogenous TEF-1 only in a MSLN-overexpressing cell line. A CanScript concatemer offered enhanced activity. These results identify a TEF family member as a major regulator of MSLN overexpression, a fundamental characteristic of pancreatic and other cancers, perhaps due to an upstream and highly frequent aberrant cellular activity. The CanScript sequence represents a modular element for cancer-specific targeting, potentially suitable for nearly a third of human malignancies.

  14. Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

    PubMed Central

    Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

    2005-01-01

    Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

  15. Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

    PubMed Central

    Lloyd, G S; Busby, S J; Savery, N J

    1998-01-01

    During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

  16. The katG mRNA of Mycobacterium tuberculosis and Mycobacterium smegmatis is processed at its 5' end and is stabilized by both a polypurine sequence and translation initiation

    PubMed Central

    Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela

    2008-01-01

    Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are shown to contribute to mRNA stability. The furA-katG mRNA is transcribed from the furA promoter and immediately processed; this processing is prevented by a double stranded RNA at the cutting site, suggesting that the endoribonuclease responsible for the cleavage cuts single stranded RNA. PMID:18394163

  17. Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

    PubMed Central

    Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

    1985-01-01

    The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

  18. Long interspersed repeated DNA (LINE) causes polymorphism at the rat insulin 1 locus.

    PubMed Central

    Lakshmikumaran, M S; D'Ambrosio, E; Laimins, L A; Lin, D T; Furano, A V

    1985-01-01

    The insulin 1, but not the insulin 2, locus is polymorphic (i.e., exhibits allelic variation) in rats. Restriction enzyme analysis and hybridization studies showed that the polymorphic region is 2.2 kilobases upstream of the insulin 1 coding region and is due to the presence or absence of an approximately 2.7-kilobase repeated DNA element. DNA sequence determination showed that this DNA element is a member of a long interspersed repeated DNA family (LINE) that is highly repeated (greater than 50,000 copies) and highly transcribed in the rat. Although the presence or absence of LINE sequences at the insulin 1 locus occurs in both the homozygous and heterozygous states, LINE-containing insulin 1 alleles are more prevalent in the rat population than are alleles without LINEs. Restriction enzyme analysis of the LINE-containing alleles indicated that at least two versions of the LINE sequence may be present at the insulin 1 locus in different rats. Either repeated transposition of LINE sequences or gene conversion between the resident insulin 1 LINE and other sequences in the genome are possible explanations for this. Images PMID:3016521

  19. Genomic structure of two ras family genes in the slime mold Physarum polycephalum.

    PubMed

    Trzcińska-Danielewicz, Joanna; Kozlowski, Piotr; Gierdal, Katarzyna; Wiejak, Jolanta; Jagielski, Adam; Toczko, Kazimierz; Fronk, Jan

    2002-08-01

    Genomic structure of two Physarum polycephalum ras family genes, Ppras2 and Pprap1, has been determined, including the upstream region of the latter. The genes are interrupted by three and four introns, respectively. The first intron of Ppras2 has the same location within the coding sequence as the first intron in another ras homolog from this organism, Ppras1 [Trzcińska-Danielewicz, J., Kozlowski, P., and Toczko, K. (1996). "Cloning and genomic sequence of the Physarum polycephalum Ppras1 gene, a homologue of the ras protooncogene", Gene 169, pp. 143-144]. All introns, ranging from 53 to ca. 460 base pairs, have the canonical 5' and 3' ends, are greatly enriched in pyrimidines in the coding strand and have frequent pyrimidines-only tracts. These latter features seem to be responsible for the difficulties in cloning and sequencing of parts of these genes. Short sequences shared with P. polycephalum transposon-like repeats are common in the introns, indicating a possible role of transposition in intron evolution. In all three ras family genes phase zero introns are located mostly between sequences coding for regular protein secondary structure elements.

  20. Deep learning of the regulatory grammar of yeast 5′ untranslated regions from 500,000 random sequences

    PubMed Central

    Groves, Benjamin; Kuchina, Anna; Rosenberg, Alexander B.; Jojic, Nebojsa; Fields, Stanley; Seelig, Georg

    2017-01-01

    Our ability to predict protein expression from DNA sequence alone remains poor, reflecting our limited understanding of cis-regulatory grammar and hampering the design of engineered genes for synthetic biology applications. Here, we generate a model that predicts the protein expression of the 5′ untranslated region (UTR) of mRNAs in the yeast Saccharomyces cerevisiae. We constructed a library of half a million 50-nucleotide-long random 5′ UTRs and assayed their activity in a massively parallel growth selection experiment. The resulting data allow us to quantify the impact on protein expression of Kozak sequence composition, upstream open reading frames (uORFs), and secondary structure. We trained a convolutional neural network (CNN) on the random library and showed that it performs well at predicting the protein expression of both a held-out set of the random 5′ UTRs as well as native S. cerevisiae 5′ UTRs. The model additionally was used to computationally evolve highly active 5′ UTRs. We confirmed experimentally that the great majority of the evolved sequences led to higher protein expression rates than the starting sequences, demonstrating the predictive power of this model. PMID:29097404

  1. DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1.

    PubMed

    Choudhary, M; Kaplan, S

    2000-02-15

    This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1 (T). The photosynthesis gene cluster is located within a approximately 73 kb Ase I genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The data were compared with the corresponding genes/ORFs from a different strain of R.sphaeroides and Rhodobacter capsulatus, a close relative of R. sphaeroides. A detailed analysis of the gene organization in the photosynthesis region revealed a similar gene order in both species with some notable differences located to the pucBAC = cycA region. In addition, photosynthesis gene regulatory protein (PpsR, FNR, IHF) binding motifs in upstream sequences of a number of photosynthesis genes have been identified and shown to differ between these two species. The difference in gene organization relative to pucBAC and cycA suggests that this region originated independently of the photosynthesis gene cluster of R.sphaeroides.

  2. Investigation of DNA sequence recognition by a streptomycete MarR family transcriptional regulator through surface plasmon resonance and X-ray crystallography

    PubMed Central

    Stevenson, Clare E. M.; Assaad, Aoun; Chandra, Govind; Le, Tung B. K.; Greive, Sandra J.; Bibb, Mervyn J.; Lawson, David M.

    2013-01-01

    Consistent with their complex lifestyles and rich secondary metabolite profiles, the genomes of streptomycetes encode a plethora of transcription factors, the vast majority of which are uncharacterized. Herein, we use Surface Plasmon Resonance (SPR) to identify and delineate putative operator sites for SCO3205, a MarR family transcriptional regulator from Streptomyces coelicolor that is well represented in sequenced actinomycete genomes. In particular, we use a novel SPR footprinting approach that exploits indirect ligand capture to vastly extend the lifetime of a standard streptavidin SPR chip. We define two operator sites upstream of sco3205 and a pseudopalindromic consensus sequence derived from these enables further potential operator sites to be identified in the S. coelicolor genome. We evaluate each of these through SPR and test the importance of the conserved bases within the consensus sequence. Informed by these results, we determine the crystal structure of a SCO3205-DNA complex at 2.8 Å resolution, enabling molecular level rationalization of the SPR data. Taken together, our observations support a DNA recognition mechanism involving both direct and indirect sequence readout. PMID:23748564

  3. Molecular cloning and sequence analysis of the Anticarsia gemmatalis multicapsid nuclear polyhedrosis virus GP64 glycoprotein.

    PubMed

    Pilloff, Marcela Gabriela; Bilen, Marcos Fabián; Belaich, Mariano Nicolás; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel

    2003-01-01

    The gp64 locus of Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate Santa Fe (AgMNPV-SF) was characterised molecularly in our laboratory. To this end, we have located and cloned a AgMNPV-SF genomic DNA fragment containing the gp64 gene and sequenced the complete gp64 locus. Nucleotide sequence analysis indicated that the AgMNPV gp64 gene consists of a 1500 nucleotide open reading frame (ORF), encoding a protein of 499 amino acids. Of the seven gp64 homologues identified to date, the AgMNPV gp64 ORF shared most sequence similarity with the gp64 gene of Orgyia pseudotsugata MNPV. The GP64 from AgMNPV is the smallest baculoviral envelope glycoprotein found to date, differing in 10 or more residues from the other group I nucleopolyhedroviruses. The biological activity of AgMNPV GP64 protein was assessed by cell fusion assays in UFL-AG-286 cells using the obtained recombinant plasmids. In the upstream and downstream regions, relative to the gp64 ORF, we found different conserved transcriptional and post-transcriptional regulatory elements, respectively.

  4. Designing robust watermark barcodes for multiplex long-read sequencing.

    PubMed

    Ezpeleta, Joaquín; Krsticevic, Flavia J; Bulacio, Pilar; Tapia, Elizabeth

    2017-03-15

    To attain acceptable sample misassignment rates, current approaches to multiplex single-molecule real-time sequencing require upstream quality improvement, which is obtained from multiple passes over the sequenced insert and significantly reduces the effective read length. In order to fully exploit the raw read length on multiplex applications, robust barcodes capable of dealing with the full single-pass error rates are needed. We present a method for designing sequencing barcodes that can withstand a large number of insertion, deletion and substitution errors and are suitable for use in multiplex single-molecule real-time sequencing. The manuscript focuses on the design of barcodes for full-length single-pass reads, impaired by challenging error rates in the order of 11%. The proposed barcodes can multiplex hundreds or thousands of samples while achieving sample misassignment probabilities as low as 10-7 under the above conditions, and are designed to be compatible with chemical constraints imposed by the sequencing process. Software tools for constructing watermark barcode sets and demultiplexing barcoded reads, together with example sets of barcodes and synthetic barcoded reads, are freely available at www.cifasis-conicet.gov.ar/ezpeleta/NS-watermark . ezpeleta@cifasis-conicet.gov.ar. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  5. DLocalMotif: a discriminative approach for discovering local motifs in protein sequences.

    PubMed

    Mehdi, Ahmed M; Sehgal, Muhammad Shoaib B; Kobe, Bostjan; Bailey, Timothy L; Bodén, Mikael

    2013-01-01

    Local motifs are patterns of DNA or protein sequences that occur within a sequence interval relative to a biologically defined anchor or landmark. Current protein motif discovery methods do not adequately consider such constraints to identify biologically significant motifs that are only weakly over-represented but spatially confined. Using negatives, i.e. sequences known to not contain a local motif, can further increase the specificity of their discovery. This article introduces the method DLocalMotif that makes use of positional information and negative data for local motif discovery in protein sequences. DLocalMotif combines three scoring functions, measuring degrees of motif over-representation, entropy and spatial confinement, specifically designed to discriminatively exploit the availability of negative data. The method is shown to outperform current methods that use only a subset of these motif characteristics. We apply the method to several biological datasets. The analysis of peroxisomal targeting signals uncovers several novel motifs that occur immediately upstream of the dominant peroxisomal targeting signal-1 signal. The analysis of proline-tyrosine nuclear localization signals uncovers multiple novel motifs that overlap with C2H2 zinc finger domains. We also evaluate the method on classical nuclear localization signals and endoplasmic reticulum retention signals and find that DLocalMotif successfully recovers biologically relevant sequence properties. http://bioinf.scmb.uq.edu.au/dlocalmotif/

  6. A two-stage stochastic rule-based model to determine pre-assembly buffer content

    NASA Astrophysics Data System (ADS)

    Gunay, Elif Elcin; Kula, Ufuk

    2018-01-01

    This study considers instant decision-making needs of the automobile manufactures for resequencing vehicles before final assembly (FA). We propose a rule-based two-stage stochastic model to determine the number of spare vehicles that should be kept in the pre-assembly buffer to restore the altered sequence due to paint defects and upstream department constraints. First stage of the model decides the spare vehicle quantities, where the second stage model recovers the scrambled sequence respect to pre-defined rules. The problem is solved by sample average approximation (SAA) algorithm. We conduct a numerical study to compare the solutions of heuristic model with optimal ones and provide following insights: (i) as the mismatch between paint entrance and scheduled sequence decreases, the rule-based heuristic model recovers the scrambled sequence as good as the optimal resequencing model, (ii) the rule-based model is more sensitive to the mismatch between the paint entrance and scheduled sequences for recovering the scrambled sequence, (iii) as the defect rate increases, the difference in recovery effectiveness between rule-based heuristic and optimal solutions increases, (iv) as buffer capacity increases, the recovery effectiveness of the optimization model outperforms heuristic model, (v) as expected the rule-based model holds more inventory than the optimization model.

  7. Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects.

    PubMed

    Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2008-04-30

    The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.

  8. Recognition of the Xenopus ribosomal core promoter by the transcription factor xUBF involves multiple HMG box domains and leads to an xUBF interdomain interaction.

    PubMed

    Leblanc, B; Read, C; Moss, T

    1993-02-01

    The interaction of the ribosomal transcription factor xUBF with the RNA polymerase I core promoter of Xenopus laevis has been studied both at the DNA and protein levels. It is shown that a single xUBF-DNA complex forms over the 40S initiation site (+1) and involves at least the DNA sequences between -20 and +60 bp. DNA sequences upstream of +10 and downstream of +18 are each sufficient to direct complex formation independently. HMG box 1 of xUBF independently recognizes the sequences -20 to -1 and +1 to +22 and the addition of the N-terminal dimerization domain to HMG box 1 stabilizes its interaction with these sequences approximately 10-fold. HMG boxes 2/3 interact with the DNA downstream of +22 and can independently position xUBF across the initiation site. The C-terminal segment of xUBF, HMG boxes 4, 5 or the acidic domain, directly or indirectly interact with HMG box 1, making the core promoter sequences between -11 and -15 hypersensitive to DNase. This interaction also requires the DNA sequences between +17 and +32, i.e. the HMG box 2/3 binding site. The data suggest extensive folding of the core promoter within the xUBF complex.

  9. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    PubMed Central

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of the enzyme. PMID:18442387

  10. Development of a Tightly Controlled Off Switch for Saccharomyces cerevisiae Regulated by Camphor, a Low-Cost Natural Product

    PubMed Central

    Ikushima, Shigehito; Zhao, Yu; Boeke, Jef D.

    2015-01-01

    Here we describe the engineering of a distant homolog of the Tet repressor, CamR, isolated from Pseudomonas putida, that is regulated by camphor, a very inexpensive small molecule (at micromolar concentrations) for use in Saccharomyces cerevisiae. The repressor was engineered by expression from a constitutive yeast promoter, fusion to a viral activator protein cassette, and codon optimization. A suitable promoter responsive to the CamR fusion protein was engineered by embedding a P. putida operator binding sequence within an upstream activating sequence (UAS)-less CYC1 promoter from S. cerevisiae. The switch, named the Camphor-Off switch, activates expression of a reporter gene in camphor-free media and represses it with micromolar concentrations of camphor. PMID:26206350

  11. Characterization of a highly polymorphic region 5′ to JH in the human immunoglobulin heavy chain

    PubMed Central

    Silva, Alcino J.; Johnson, John P.; White, Raymond L.

    1987-01-01

    A cloned DNA segment 1.25 kilobases (kb) upstream from the joining segments of the human heavy chain immunoglobulin gene revealed extensive polymorphic variation at this locus, and the polymorphic pattern was stably transmitted to the next generation. Genomic restriction analysis showed that the polymorphism was caused by insertions/deletions within an MspI/BamHI fragment. Sequencing of one allele, 848 base pairs (bp) long, revealed eleven 50-base-pair tandem repeats. A second allele, 648 bp long, was cloned from a human genomic cosmid library, sequenced, and found to contain four fewer repeats than the first allele. A survey of 186 chromosomes from unrelated individuals of primarily northern European descent revealed at least six alleles. Images PMID:2884636

  12. Use of the multipurpose transposon Tn KPK2 for the mutational analysis of chromosomal regions upstream and downstream of the sipF gene in Bradyrhizobium japonicum.

    PubMed

    Müller, P

    2004-04-01

    The DNA regions upstream and downstream of the Bradyrhizobium japonicum gene sipF were cloned by in vivo techniques and subsequently sequenced. In order to study the function of the predicted genes, a new transposon for in vitro mutagenesis, Tn KPK2, was constructed. This mutagenesis system has a number of advantages over other transposons. Tn KPK2 itself has no transposase gene, making transposition events stable. Extremely short inverted repeats minimize the length of the transposable element and facilitate the determination of the nucleotide sequence of the flanking regions. Since the transposable element carries a promoterless ' phoA reporter gene, the appearance of functional PhoA fusion proteins indicates that Tn KPK2 has inserted in a gene encoding a periplasmic or secreted protein. Although such events are extremely rare, because the transposon has to insert in-frame, in the correct orientation, and at an appropriate location in the target molecule, a direct screening procedure on agar indicator plates permits the identification of candidate clones from large numbers of colonies. In this study, Tn KPK2 was used for the construction of various symbiotic mutants of B. japonicum. One of the mutant strains, A2-10, which is defective in a gene encoding a protein that comigrates with bacterioferritin ( bcpB), was found to induce the formation of small and ineffective nodules.

  13. Abundance and functional diversity of riboswitches in microbial communities

    PubMed Central

    Kazanov, Marat D; Vitreschak, Alexey G; Gelfand, Mikhail S

    2007-01-01

    Background Several recently completed large-scale enviromental sequencing projects produced a large amount of genetic information about microbial communities ('metagenomes') which is not biased towards cultured organisms. It is a good source for estimation of the abundance of genes and regulatory structures in both known and unknown members of microbial communities. In this study we consider the distribution of RNA regulatory structures, riboswitches, in the Sargasso Sea, Minnesota Soil and Whale Falls metagenomes. Results Over three hundred riboswitches were found in about 2 Gbp metagenome DNA sequences. The abundabce of riboswitches in metagenomes was highest for the TPP, B12 and GCVT riboswitches; the S-box, RFN, YKKC/YXKD, YYBP/YKOY regulatory elements showed lower but significant abundance, while the LYS, G-box, GLMS and YKOK riboswitches were rare. Regions downstream of identified riboswitches were scanned for open reading frames. Comparative analysis of identified ORFs revealed new riboswitch-regulated functions for several classes of riboswitches. In particular, we have observed phosphoserine aminotransferase serC (COG1932) and malate synthase glcB (COG2225) to be regulated by the glycine (GCVT) riboswitch; fatty acid desaturase ole1 (COG1398), by the cobalamin (B12) riboswitch; 5-methylthioribose-1-phosphate isomerase ykrS (COG0182), by the SAM-riboswitch. We also identified conserved riboswitches upstream of genes of unknown function: thiamine (TPP), cobalamine (B12), and glycine (GCVT, upstream of genes from COG4198). Conclusion This study demonstrates applicability of bioinformatics to the analysis of RNA regulatory structures in metagenomes. PMID:17908319

  14. Scapula development is governed by genetic interactions of Pbx1 with its family members and with Emx2 via their cooperative control of Alx1

    PubMed Central

    Capellini, Terence D.; Vaccari, Giulia; Ferretti, Elisabetta; Fantini, Sebastian; He, Mu; Pellegrini, Massimo; Quintana, Laura; Di Giacomo, Giuseppina; Sharpe, James; Selleri, Licia; Zappavigna, Vincenzo

    2010-01-01

    The genetic pathways underlying shoulder blade development are largely unknown, as gene networks controlling limb morphogenesis have limited influence on scapula formation. Analysis of mouse mutants for Pbx and Emx2 genes has suggested their potential roles in girdle development. In this study, by generating compound mutant mice, we examined the genetic control of scapula development by Pbx genes and their functional relationship with Emx2. Analyses of Pbx and Pbx1;Emx2 compound mutants revealed that Pbx genes share overlapping functions in shoulder development and that Pbx1 genetically interacts with Emx2 in this process. Here, we provide a biochemical basis for Pbx1;Emx2 genetic interaction by showing that Pbx1 and Emx2 can bind specific DNA sequences as heterodimers. Moreover, the expression of genes crucial for scapula development is altered in these mutants, indicating that Pbx genes act upstream of essential pathways for scapula formation. In particular, expression of Alx1, an effector of scapula blade patterning, is absent in all compound mutants. We demonstrate that Pbx1 and Emx2 bind in vivo to a conserved sequence upstream of Alx1 and cooperatively activate its transcription via this potential regulatory element. Our results establish an essential role for Pbx1 in genetic interactions with its family members and with Emx2 and delineate novel regulatory networks in shoulder girdle development. PMID:20627960

  15. Co-expression of the Thermotoga neapolitana aglB gene with an upstream 3'-coding fragment of the malG gene improves enzymatic characteristics of recombinant AglB cyclomaltodextrinase.

    PubMed

    Lunina, Natalia A; Agafonova, Elena V; Chekanovskaya, Lyudmila A; Dvortsov, Igor A; Berezina, Oksana V; Shedova, Ekaterina N; Kostrov, Sergey V; Velikodvorskaya, Galina A

    2007-07-01

    A cluster of Thermotoga neapolitana genes participating in starch degradation includes the malG gene of sugar transport protein and the aglB gene of cyclomaltodextrinase. The start and stop codons of these genes share a common overlapping sequence, aTGAtg. Here, we compared properties of expression products of three different constructs with aglB from T. neapolitana. The first expression vector contained the aglB gene linked to an upstream 90-bp 3'-terminal region of the malG gene with the stop codon overlapping with the start codon of aglB. The second construct included the isolated coding sequence of aglB with two tandem potential start codons. The expression product of this construct in Escherichia coli had two tandem Met residues at its N terminus and was characterized by low thermostability and high tendency to aggregate. In contrast, co-expression of aglB and the 3'-terminal region of malG (the first construct) resulted in AglB with only one N-terminal Met residue and a much higher specific activity of cyclomaltodextrinase. Moreover, the enzyme expressed by such a construct was more thermostable and less prone to aggregation. The third construct was the same as the second one except that it contained only one ATG start codon. The product of its expression had kinetic and other properties similar to those of the enzyme with only one N-terminal Met residue.

  16. ICAM-1-related long non-coding RNA: promoter analysis and expression in human retinal endothelial cells.

    PubMed

    Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy

    2018-05-09

    Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.

  17. Comparative transcriptome analysis of rumen papillae in suckling and weaned Japanese Black calves using RNA sequencing.

    PubMed

    Nishihara, Koki; Kato, Daichi; Suzuki, Yutaka; Kim, Dahye; Nakano, Misato; Yajima, Yu; Haga, Satoshi; Nakano, Miwa; Ishizaki, Hiroshi; Kawahara-Miki, Ryouka; Kono, Tomohiro; Katoh, Kazuo; Roh, Sang-Gun

    2018-06-04

    The length and density of rumen papillae starts to increase during weaning and growth of ruminants. This significant development increases the intraruminal surface area and the efficiency of VFA (acetate, propionate, butyrate, etc.) uptake. Thus, it is important to investigate the factors controlling the growth and development of rumen papillae during weaning. This study aimed to compare the transcriptomes of rumen papillae in suckling and weaned calves. Total RNA was extracted from the rumen papillae of 10 male Japanese Black calves (5 suckling calves, 5 wk old; 5 weaned calves, 15 wk old) and used in RNA-sequencing. Transcript abundance was estimated and differentially expressed genes were identified and these data were then used in Ingenuity Pathway Analysis (IPA) to predict the major canonical pathways and upstream regulators. Among the 871 differentially expressed genes screened by IPA, 466 genes were upregulated and 405 were downregulated in the weaned group. Canonical pathway analysis showed that "atherosclerosis" was the most significant pathway, and "tretinoin," a derivative of vitamin A, was predicted as the most active upstream regulator during weaning. Analyses also predicted IgG, lipopolysaccharides, and tumor-necrosis factor-α as regulators of the microbe-epithelium interaction that activates rumen-related immune responses. The functional category and the up-regulators found in this study provide a valuable resource for studying new candidate genes related to the proliferation and development of rumen papillae from suckling to weaning Japanese Black calves.

  18. A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

    PubMed

    Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

    2012-09-01

    The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.

  19. The dicistronic RNA from the mouse LINE-1 retrotransposon contains an internal ribosome entry site upstream of each ORF: implications for retrotransposition

    PubMed Central

    2006-01-01

    Most eukaryotic mRNAs are monocistronic and translated by cap-dependent initiation. LINE-1 RNA is exceptional because it is naturally dicistronic, encoding two proteins essential for retrotransposition, ORF1p and ORF2p. Here, we show that sequences upstream of ORF1 and ORF2 in mouse L1 function as internal ribosome entry sites (IRESes). Deletion analysis of the ORF1 IRES indicates that RNA structure is critical for its function. Conversely, the ORF2 IRES localizes to 53 nt near the 3′ end of ORF1, and appears to depend upon sequence rather than structure. The 40 nt intergenic region (IGR) is not essential for ORF2 IRES function or retrotransposition. Because of strong cis-preference for both proteins during L1 retrotransposition, correct stoichiometry of the two proteins can only be achieved post-transcriptionally. Although the precise stoichiometry is unknown, the retrotransposition intermediate likely contains hundreds of ORF1ps for every ORF2p, together with one L1 RNA. IRES-mediated translation initiation is a well-established mechanism of message-specific regulation, hence, unique mechanisms for the recognition and control of these two IRESes in the L1 RNA could explain differences in translational efficiency of ORF1 and ORF2. In addition, translational regulation may provide an additional layer of control on L1 retrotransposition efficiency, thereby protecting the integrity of the genome. PMID:16464823

  20. Virtual Genome Walking across the 32 Gb Ambystoma mexicanum genome; assembling gene models and intronic sequence.

    PubMed

    Evans, Teri; Johnson, Andrew D; Loose, Matthew

    2018-01-12

    Large repeat rich genomes present challenges for assembly using short read technologies. The 32 Gb axolotl genome is estimated to contain ~19 Gb of repetitive DNA making an assembly from short reads alone effectively impossible. Indeed, this model species has been sequenced to 20× coverage but the reads could not be conventionally assembled. Using an alternative strategy, we have assembled subsets of these reads into scaffolds describing over 19,000 gene models. We call this method Virtual Genome Walking as it locally assembles whole genome reads based on a reference transcriptome, identifying exons and iteratively extending them into surrounding genomic sequence. These assemblies are then linked and refined to generate gene models including upstream and downstream genomic, and intronic, sequence. Our assemblies are validated by comparison with previously published axolotl bacterial artificial chromosome (BAC) sequences. Our analyses of axolotl intron length, intron-exon structure, repeat content and synteny provide novel insights into the genic structure of this model species. This resource will enable new experimental approaches in axolotl, such as ChIP-Seq and CRISPR and aid in future whole genome sequencing efforts. The assembled sequences and annotations presented here are freely available for download from https://tinyurl.com/y8gydc6n . The software pipeline is available from https://github.com/LooseLab/iterassemble .

  1. Molecular Characterization of Transgene Integration by Next-Generation Sequencing in Transgenic Cattle

    PubMed Central

    Zhang, Ran; Yin, Yinliang; Zhang, Yujun; Li, Kexin; Zhu, Hongxia; Gong, Qin; Wang, Jianwu; Hu, Xiaoxiang; Li, Ning

    2012-01-01

    As the number of transgenic livestock increases, reliable detection and molecular characterization of transgene integration sites and copy number are crucial not only for interpreting the relationship between the integration site and the specific phenotype but also for commercial and economic demands. However, the ability of conventional PCR techniques to detect incomplete and multiple integration events is limited, making it technically challenging to characterize transgenes. Next-generation sequencing has enabled cost-effective, routine and widespread high-throughput genomic analysis. Here, we demonstrate the use of next-generation sequencing to extensively characterize cattle harboring a 150-kb human lactoferrin transgene that was initially analyzed by chromosome walking without success. Using this approach, the sites upstream and downstream of the target gene integration site in the host genome were identified at the single nucleotide level. The sequencing result was verified by event-specific PCR for the integration sites and FISH for the chromosomal location. Sequencing depth analysis revealed that multiple copies of the incomplete target gene and the vector backbone were present in the host genome. Upon integration, complex recombination was also observed between the target gene and the vector backbone. These findings indicate that next-generation sequencing is a reliable and accurate approach for the molecular characterization of the transgene sequence, integration sites and copy number in transgenic species. PMID:23185606

  2. Rat prostatic steroid binding protein: DNA sequence and transcript maps of the two C3 genes.

    PubMed Central

    Hurst, H C; Parker, M G

    1983-01-01

    In the rat there are two non-allelic genes C3(1) and C3(2) for the C3 polypeptide of prostatic steroid binding protein. We have cloned and sequenced both genes and show that only C3(1) is responsible for the production of authentic C3. Although there is a marked difference in their transcriptional activity, the two genes share extensive DNA sequence homology there being only one base difference from nucleotide - 235 to within the first intron. Transcript mapping has shown that there are two distinct C3 transcripts which share a unique 3' terminus but have 5' termini 38 bases apart each preceded by a 'TATA' box homology. Interestingly, an identical repetitive element is present just upstream of both genes. Both families of transcripts, which are produced in a ratio of 18:1, are coordinately regulated by testosterone. Images Fig. 3. Fig. 4. Fig. 5. PMID:6685625

  3. A 5′ Noncoding Exon Containing Engineered Intron Enhances Transgene Expression from Recombinant AAV Vectors in vivo

    PubMed Central

    Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.

    2017-01-01

    We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072

  4. (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase, a product of the mva operon of Pseudomonas mevalonii, is regulated at the transcriptional level.

    PubMed Central

    Wang, Y L; Beach, M J; Rodwell, V W

    1989-01-01

    We have cloned and sequenced a 505-base-pair (bp) segment of DNA situated upstream of mvaA, the structural gene for (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.88) of Pseudomonas mevalonii. The DNA segment that we characterized includes the promoter region for the mva operon. Nuclease S1 mapping and primer extension analysis showed that mvaA is the promoter-proximal gene of the mva operon. Transcription initiates at -56 bp relative to the first A (+1) of the translation start site. Transcription in vivo was induced by mevalonate. Structural features of the mva promoter region include an 80-bp A + T-rich region, and -12, -24 consensus sequences that resemble sequences of sigma 54 promoters in enteric organisms. The relative amplitudes of catalytic activity, enzyme protein, and mvaA mRNA are consistent with a model of regulation of this operon at the transcriptional level. Images PMID:2477360

  5. Deep intronic GPR143 mutation in a Japanese family with ocular albinism

    PubMed Central

    Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei

    2015-01-01

    Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease. PMID:26061757

  6. Deep intronic GPR143 mutation in a Japanese family with ocular albinism.

    PubMed

    Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei

    2015-06-10

    Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease.

  7. Systematic screening for mutations in the human serotonin 1F receptor gene in patients with bipolar affective disorder and schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shimron-Abarbanell, D.; Harms, H.; Erdmann, J.

    1996-04-09

    Using single strand conformational analysis we screened the complete coding sequence of the serotonin 1F (5-HT{sub 1F}) receptor gene for the presence of DNA sequence variation in a sample of 137 unrelated individuals including 45 schizophrenic patients, 46 bipolar patients, as well as 46 healthy controls. We detected only three rare sequence variants which are characterized by single base pair substitutions, namely a silent T{r_arrow}A transversion in the third position of codon 261 (encoding isoleucine), a silent C{r_arrow}T transition in the third position of codon 176 (encoding histidine), and a C{r_arrow}T transition in position -78 upstream from the start codon.more » The lack of significant mutations in patients suffering from schizophrenia and bipolar affective disorder indicates that the 5-HT{sub 1F} receptor is not commonly involved in the etiology of these diseases. 12 refs., 1 fig., 2 tabs.« less

  8. Sequencing and functional analysis of the nifENXorf1orf2 gene cluster of Herbaspirillum seropedicae.

    PubMed

    Klassen, G; Pedrosa, F O; Souza, E M; Yates, M G; Rigo, L U

    1999-12-01

    A 5.1-kb DNA fragment from the nifHDK region of H. seropedicae was isolated and sequenced. Sequence analysis showed the presence of nifENXorf1orf2 but nifTY were not present. No nif or consensus promoter was identified. Furthermore, orf1 expression occurred only under nitrogen-fixing conditions and no promoter activity was detected between nifK and nifE, suggesting that these genes are expressed from the upstream nifH promoter and are parts of a unique nif operon. Mutagenesis studies indicate that nifN was essential for nitrogenase activity whereas nifXorf1orf2 were not. High homology between the C-terminal region of the NifX and NifB proteins from H. seropedicae was observed. Since the NifX and NifY proteins are important for FeMo cofactor (FeMoco) synthesis, we propose that alternative proteins with similar activities exist in H. seropedicae.

  9. The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.

    PubMed

    Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

    2003-02-01

    The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.

  10. The complete mitochondrial genome of Liobagrus marginatus (Teleostei, Siluriformes: Amblycipitidae).

    PubMed

    Li, Qiang; Du, Jun; Liu, Ya; Zhou, Jian; Ke, Hongyu; Liu, Chao; Liu, Guangxun

    2014-04-01

    The Liobagrus marginatus is an economic fish which distribute in the upstream of Yangtze river and its distributary. For its taste fresh, environmental pollution and overfishing, its population declined drastically and body miniaturization in recent decades, so it is essential to protect its resource. In this study, the complete mitochondrial genome sequence of Liobagrus marginatus was sequenced, which contains 22 tRNA genes, 13 protein-coding genes, 2 rRNA genes, and a non-coding control region with the total length of 16,497 bp. The gene arrangement and composition are similar to most of other fish. Most of the genes are encoded on heavy-strand, except for eight tRNA and ND6 genes. Just like most other vertebrates, the bias of G and C has been found in statistics results of different genes/regions. The complete mitochondrial genome sequence of Liobagrus marginatus would contribute to better understand population genetics, evolution of this lineage, and will help administrative departments to make rules and laws to protect it.

  11. An analysis by metabolic labelling of the encephalomyocarditis virus ribosomal frameshifting efficiency and stimulators.

    PubMed

    Ling, Roger; Firth, Andrew E

    2017-08-01

    Programmed -1 ribosomal frameshifting is a mechanism of gene expression whereby specific signals within messenger RNAs direct a proportion of ribosomes to shift -1 nt and continue translating in the new reading frame. Such frameshifting normally depends on an RNA structure stimulator 3'-adjacent to a 'slippery' heptanucleotide shift site sequence. Recently we identified an unusual frameshifting mechanism in encephalomyocarditis virus, where the stimulator involves a trans-acting virus protein. Thus, in contrast to other examples of -1 frameshifting, the efficiency of frameshifting in encephalomyocarditis virus is best studied in the context of virus infection. Here we use metabolic labelling to analyse the frameshifting efficiency of wild-type and mutant viruses. Confirming previous results, frameshifting depends on a G_GUU_UUU shift site sequence and a 3'-adjacent stem-loop structure, but is not appreciably affected by the 'StopGo' sequence present ~30 nt upstream. At late timepoints, frameshifting was estimated to be 46-76 % efficient.

  12. Expression of Human Hemojuvelin (HJV) Is Tightly Regulated by Two Upstream Open Reading Frames in HJV mRNA That Respond to Iron Overload in Hepatic Cells

    PubMed Central

    Onofre, Cláudia; Tomé, Filipa; Barbosa, Cristina; Silva, Ana Luísa

    2015-01-01

    The gene encoding human hemojuvelin (HJV) is one of the genes that, when mutated, can cause juvenile hemochromatosis, an early-onset inherited disorder associated with iron overload. The 5′ untranslated region of the human HJV mRNA has two upstream open reading frames (uORFs), with 28 and 19 codons formed by two upstream AUGs (uAUGs) sharing the same in-frame stop codon. Here we show that these uORFs decrease the translational efficiency of the downstream main ORF in HeLa and HepG2 cells. Indeed, ribosomal access to the main AUG is conditioned by the strong uAUG context, which results in the first uORF being translated most frequently. The reach of the main ORF is then achieved by ribosomes that resume scanning after uORF translation. Furthermore, the amino acid sequences of the uORF-encoded peptides also reinforce the translational repression of the main ORF. Interestingly, when iron levels increase, translational repression is relieved specifically in hepatic cells. The upregulation of protein levels occurs along with phosphorylation of the eukaryotic initiation factor 2α. Nevertheless, our results support a model in which the increasing recognition of the main AUG is mediated by a tissue-specific factor that promotes uORF bypass. These results support a tight HJV translational regulation involved in iron homeostasis. PMID:25666510

  13. Novel targets for HIV therapy.

    PubMed

    Greene, Warner C; Debyser, Zeger; Ikeda, Yasuhiro; Freed, Eric O; Stephens, Edward; Yonemoto, Wes; Buckheit, Robert W; Esté, José A; Cihlar, Tomas

    2008-12-01

    There are currently 25 drugs belonging to 6 different inhibitor classes approved for the treatment of human immunodeficiency virus (HIV) infection. However, new anti-HIV agents are still needed to confront the emergence of drug resistance and various adverse effects associated with long-term use of antiretroviral therapy. The 21st International Conference on Antiviral Research, held in April 2008 in Montreal, Canada, therefore featured a special session focused on novel targets for HIV therapy. The session included presentations by world-renowned experts in HIV virology and covered a diverse array of potential targets for the development of new classes of HIV therapies. This review contains concise summaries of discussed topics that included Vif-APOBEC3G, LEDGF/p75, TRIM 5alpha, virus assembly and maturation, and Vpu. The described viral and host factors represent some of the most noted examples of recent scientific breakthroughs that are opening unexplored avenues to novel anti-HIV target discovery and validation, and should feed the antiretroviral drug development pipeline in the near future.

  14. ATP1B3 Protein Modulates the Restriction of HIV-1 Production and Nuclear Factor κ Light Chain Enhancer of Activated B Cells (NF-κB) Activation by BST-2*

    PubMed Central

    Nishitsuji, Hironori; Sugiyama, Ryuichi; Abe, Makoto; Takaku, Hiroshi

    2016-01-01

    Here, we identify ATP1B3 and fibrillin-1 as novel BST-2-binding proteins. ATP1B3 depletion in HeLa cells (BST-2-positive cells), but not 293T cells (BST-2-negative cells), induced the restriction of HIV-1 production in a BST-2-dependent manner. In contrast, fibrillin-1 knockdown reduced HIV-1 production in 293T and HeLa cells in a BST-2-independent manner. Moreover, NF-κB activation was enhanced by siATP1B3 treatment in HIV-1- and HIV-1ΔVpu-infected HeLa cells. In addition, ATP1B3 silencing induced high level BST-2 expression on the surface of HeLa cells. These results indicate that ATP1B3 is a co-factor that accelerates BST-2 degradation and reduces BST-2-mediated restriction of HIV-1 production and NF-κB activation. PMID:26694617

  15. Canonical and Non-Canonical Autophagy in HIV-1 Replication Cycle

    PubMed Central

    Leymarie, Olivier; Lepont, Leslie; Berlioz-Torrent, Clarisse

    2017-01-01

    Autophagy is a lysosomal-dependent degradative process essential for maintaining cellular homeostasis, and is a key player in innate and adaptive immune responses to intracellular pathogens such as human immunodeficiency virus type 1 (HIV-1). In HIV-1 target cells, autophagy mechanisms can (i) selectively direct viral proteins and viruses for degradation; (ii) participate in the processing and presentation of viral-derived antigens through major histocompatibility complexes; and (iii) contribute to interferon production in response to HIV-1 infection. As a consequence, HIV-1 has evolved different strategies to finely regulate the autophagy pathway to favor its replication and dissemination. HIV-1 notably encodes accessory genes encoding Tat, Nef and Vpu proteins, which are able to perturb and hijack canonical and non-canonical autophagy mechanisms. This review outlines the current knowledge on the complex interplay between autophagy and HIV-1 replication cycle, providing an overview of the autophagy-mediated molecular processes deployed both by infected cells to combat the virus and by HIV-1 to evade antiviral response. PMID:28946621

  16. Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

    PubMed

    Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

    2002-03-01

    To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

  17. Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

    PubMed

    Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M

    1995-12-01

    Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible.

  18. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.

    PubMed

    Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K

    1991-09-15

    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kerr, J.M.; Fisher, L.W.; Termine, J.D.

    The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less

  20. G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

    PubMed Central

    Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

    2016-01-01

    Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

  1. Conserved noncoding sequences conserve biological networks and influence genome evolution.

    PubMed

    Xie, Jianbo; Qian, Kecheng; Si, Jingna; Xiao, Liang; Ci, Dong; Zhang, Deqiang

    2018-05-01

    Comparative genomics approaches have identified numerous conserved cis-regulatory sequences near genes in plant genomes. Despite the identification of these conserved noncoding sequences (CNSs), our knowledge of their functional importance and selection remains limited. Here, we used a combination of DNA methylome analysis, microarray expression analyses, and functional annotation to study these sequences in the model tree Populus trichocarpa. Methylation in CG contexts and non-CG contexts was lower in CNSs, particularly CNSs in the 5'-upstream regions of genes, compared with other sites in the genome. We observed that CNSs are enriched in genes with transcription and binding functions, and this also associated with syntenic genes and those from whole-genome duplications, suggesting that cis-regulatory sequences play a key role in genome evolution. We detected a significant positive correlation between CNS number and protein interactions, suggesting that CNSs may have roles in the evolution and maintenance of biological networks. The divergence of CNSs indicates that duplication-degeneration-complementation drives the subfunctionalization of a proportion of duplicated genes from whole-genome duplication. Furthermore, population genomics confirmed that most CNSs are under strong purifying selection and only a small subset of CNSs shows evidence of adaptive evolution. These findings provide a foundation for future studies exploring these key genomic features in the maintenance of biological networks, local adaptation, and transcription.

  2. Structural basis of UGUA recognition by the Nudix protein CFIm25 and implications for a regulatory role in mRNA 3′ processing

    PubMed Central

    Yang, Qin; Gilmartin, Gregory M.; Doublié, Sylvie

    2010-01-01

    Human Cleavage Factor Im (CFIm) is an essential component of the pre-mRNA 3′ processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFIm25) of the CFIm complex possesses a characteristic α/β/α Nudix fold, CFIm25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFIm25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson–Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap4A (diadenosine tetraphosphate) by CFIm25 suggests a potential role for small molecules in the regulation of mRNA 3′ processing. PMID:20479262

  3. Structural basis of UGUA recognition by the Nudix protein CFI(m)25 and implications for a regulatory role in mRNA 3' processing.

    PubMed

    Yang, Qin; Gilmartin, Gregory M; Doublié, Sylvie

    2010-06-01

    Human Cleavage Factor Im (CFI(m)) is an essential component of the pre-mRNA 3' processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFI(m)25) of the CFI(m) complex possesses a characteristic alpha/beta/alpha Nudix fold, CFI(m)25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFI(m)25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFI(m)25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson-Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap(4)A (diadenosine tetraphosphate) by CFI(m)25 suggests a potential role for small molecules in the regulation of mRNA 3' processing.

  4. Direct molecular regulation of the myogenic determination gene Myf5 by Pax3, with modulation by Six1/4 factors, is exemplified by the -111 kb-Myf5 enhancer.

    PubMed

    Daubas, Philippe; Buckingham, Margaret E

    2013-04-15

    The Myf5 gene plays an important role in myogenic determination during mouse embryo development. Multiple genomic regions of the Mrf4-Myf5 locus have been characterised as enhancer sequences responsible for the complex spatiotemporal expression of the Myf5 gene at the onset of myogenesis. These include an enhancer sequence, located at -111 kb upstream of the Myf5 transcription start site, which is responsible of Myf5 activation in ventral somitic domains (Ribas et al., 2011. Dev. Biol. 355, 372-380). We show that the -111 kb-Myf5 enhancer also directs transgene expression in some limb muscles, and is active at foetal as well as embryonic stages. We have carried out further characterisation of the regulation of this enhancer and show that the paired-box Pax3 transcription factor binds to it in vitro as in vivo, and that Pax binding sites are essential for its activity. This requirement is independent of the previously reported regulation by TEAD transcription factors. Six1/4 which, like Pax3, are important upstream regulators of myogenesis, also bind in vivo to sites in the -111 kb-Myf5 enhancer and modulate its activity. The -111 kb-Myf5 enhancer therefore shares common functional characteristics with another Myf5 regulatory sequence, the hypaxial and limb 145 bp-Myf5 enhancer, both being directly regulated in vivo by Pax3 and Six1/4 proteins. However, in the case of the -111 kb-Myf5 enhancer, Six has less effect and we conclude that Pax regulation plays a major role in controlling this aspect of the Myf5 gene expression at the onset of myogenesis in the embryo. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Molecular characterization of a genomic region in a Lactococcus bacteriophage that is involved in its sensitivity to the phage defense mechanism AbiA.

    PubMed

    Dinsmore, P K; Klaenhammer, T R

    1997-05-01

    A spontaneous mutant of the lactococcal phage phi31 that is insensitive to the phage defense mechanism AbiA was characterized in an effort to identify the phage factor(s) involved in sensitivity of phi31 to AbiA. A point mutation was localized in the genome of the AbiA-insensitive phage (phi31A) by heteroduplex analysis of a 9-kb region. The mutation (G to T) was within a 738-bp open reading frame (ORF245) and resulted in an arginine-to-leucine change in the predicted amino acid sequence of the protein. The mutant phi31A-ORF245 reduced the sensitivity of phi31 to AbiA when present in trans, indicating that the mutation in ORF245 is responsible for the AbiA insensitivity of phi31A. Transcription of ORF245 occurs early in the phage infection cycles of phi31 and phi31A and is unaffected by AbiA. Expansion of the phi31 sequence revealed ORF169 (immediately upstream of ORF245) and ORF71 (which ends 84 bp upstream of ORF169). Two inverted repeats lie within the 84-bp region between ORF71 and ORF169. Sequence analysis of an independently isolated AbiA-insensitive phage, phi31B, identified a mutation (G to A) in one of the inverted repeats. A 118-bp fragment from phi31, encompassing the 84-bp region between ORF71 and ORF169, eliminates AbiA activity against phi31 when present in trans, establishing a relationship between AbiA and this fragment. The study of this region of phage phi31 has identified an open reading frame (ORF245) and a 118-bp DNA fragment that interact with AbiA and are likely to be involved in the sensitivity of this phage to AbiA.

  6. Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

    PubMed Central

    Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang

    2007-01-01

    Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802

  7. The Pochonia chlamydosporia serine protease gene vcp1 is subject to regulation by carbon, nitrogen and pH: implications for nematode biocontrol.

    PubMed

    Ward, Elaine; Kerry, Brian R; Manzanilla-López, Rosa H; Mutua, Gerald; Devonshire, Jean; Kimenju, John; Hirsch, Penny R

    2012-01-01

    The alkaline serine protease VCP1 of the fungus Pochonia chlamydosporia belongs to a family of subtilisin-like enzymes that are involved in infection of nematode and insect hosts. It is involved early in the infection process, removing the outer proteinaceous vitelline membrane of nematode eggs. Little is known about the regulation of this gene, even though an understanding of how nutrients and other factors affect its expression is critical for ensuring its efficacy as a biocontrol agent. This paper provides new information on the regulation of vcp1 expression. Sequence analysis of the upstream regulatory region of this gene in 30 isolates revealed that it was highly conserved and contained sequence motifs characteristic of genes that are subject to carbon, nitrogen and pH-regulation. Expression studies, monitoring enzyme activity and mRNA, confirmed that these factors affect VCP1 production. As expected, glucose reduced VCP1 expression and for a few hours so did ammonium chloride. Surprisingly, however, by 24 h VCP1 levels were increased in the presence of ammonium chloride for most isolates. Ambient pH also regulated VCP1 expression, with most isolates producing more VCP1 under alkaline conditions. There were some differences in the response of one isolate with a distinctive upstream sequence including a variant regulatory-motif profile. Cryo-scanning electron microscopy studies indicated that the presence of nematode eggs stimulates VCP1 production by P. chlamydosporia, but only where the two are in close contact. Overall, the results indicate that readily-metabolisable carbon sources and unfavourable pH in the rhizosphere/egg-mass environment may compromise nematode parasitism by P. chlamydosporia. However, contrary to previous indications using other nematophagous and entomopathogenic fungi, ammonium nitrate (e.g. from fertilizers) may enhance biocontrol potential in some circumstances.

  8. Control of transcription of the Bacillus subtilis spoIIIG gene, which codes for the forespore-specific transcription factor sigma G.

    PubMed

    Sun, D X; Cabrera-Martinez, R M; Setlow, P

    1991-05-01

    The Bacillus subtilis spoIIIG gene codes for a sigma factor termed sigma G which directs transcription of genes expressed only in the forespore compartment of the sporulating cell. Use of spoIIIG-lacZ transcriptional fusions showed that spoIIIG is cotranscribed with the spoIIG operon beginning at t0.5-1 of sporulation. However, this large mRNA produced little if any sigma G, and transferring the spoIIIG gene without the spoIIG promoter into the amyE locus resulted in a Spo+ phenotype. Significant translation of spoIIIG began at t2.5-3 with use of an mRNA whose 5' end is just upstream of the spoIIIG coding sequence. Synthesis of this spoIIIG-specific mRNA was not abolished by a deletion in spoIIIG itself. Similar results were obtained when a spoIIIG-lacZ translational fusion lacking the spoIIG promoter was integrated at the amyE locus. These data suggest that synthesis of sigma G is dependent neither on transcription from the spoIIG promoter nor on sigma G itself but can be due to another transcription factor. This transcription factor may be sigma F, the product of the spoIIAC locus, since a spoIIAC mutation blocked spoIIIG expression, and sequences upstream of the 5' end of the spoIIIG-specific mRNA agree well with the recognition sequence for sigma F. RNA polymerase containing sigma F (E sigma F) initiated transcription in vitro on a spoIIIG template at the 5' end found in vivo, as did E sigma G. However, E sigma F showed a greater than 20-fold preference for spoIIIG over a known sigma G-dependent gene compared with the activity of E sigma G.

  9. Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

    PubMed Central

    Murthy, S C; Bhat, G P; Thimmappaya, B

    1985-01-01

    A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

  10. Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

    PubMed Central

    Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

    2006-01-01

    Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

  11. Identification of a precursor genomic segment that provided a sequence unique to glycophorin B and E genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Onda, M.; Kudo, S.; Fukuda, M.

    Human glycophorin A, B, and E (GPA, GPB, and GPE) genes belong to a gene family located at the long arm of chromosome 4. These three genes are homologous from the 5'-flanking sequence to the Alu sequence, which is 1 kb downstream from the exon encoding the transmembrane domain. Analysis of the Alu sequence and flanking direct repeat sequences suggested that the GPA gene most closely resembles the ancestral gene, whereas the GPB and GPE gene arose by homologous recombination within the Alu sequence, acquiring 3' sequences from an unrelated precursor genomic segment. Here the authors describe the identification ofmore » this putative precursor genomic segment. A human genomic library was screened by using the sequence of the 3' region of the GPB gene as a probe. The genomic clones isolated were found to contain an Alu sequence that appeared to be involved in the recombination. Downstream from the Alu sequence, the nucleotide sequence of the precursor genomic segment is almost identical to that of the GPB or GPE gene. In contrast, the upstream sequence of the genomic segment differs entirely from that of the GPA, GPB, and GPE genes. Conservation of the direct repeats flanking the Alu sequence of the genomic segment strongly suggests that the sequence of this genomic segment has been maintained during evolution. This identified genomic segment was found to reside downstream from the GPA gene by both gene mapping and in situ chromosomal localization. The precursor genomic segment was also identified in the orangutan genome, which is known to lack GPB and GPE genes. These results indicate that one of the duplicated ancestral glycophorin genes acquired a unique 3' sequence by unequal crossing-over through its Alu sequence and the further downstream Alu sequence present in the duplicated gene. Further duplication and divergence of this gene yielded the GPB and GPE genes. 37 refs., 5 figs.« less

  12. A unique mitigator sequence determines the species specificity of the major late promoter in adenovirus type 12 DNA.

    PubMed Central

    Zock, C; Iselt, A; Doerfler, W

    1993-01-01

    Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643

  13. Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

    PubMed Central

    Zhao, A; Guo, A; Liu, Z; Pape, L

    1997-01-01

    The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

  14. Continuous measurements of water surface height and width along a 6.5km river reach for discharge algorithm development

    NASA Astrophysics Data System (ADS)

    Tuozzolo, S.; Durand, M. T.; Pavelsky, T.; Pentecost, J.

    2015-12-01

    The upcoming Surface Water and Ocean Topography (SWOT) satellite will provide measurements of river width and water surface elevation and slope along continuous swaths of world rivers. Understanding water surface slope and width dynamics in river reaches is important for both developing and validating discharge algorithms to be used on future SWOT data. We collected water surface elevation and river width data along a 6.5km stretch of the Olentangy River in Columbus, Ohio from October to December 2014. Continuous measurements of water surface height were supplemented with periodical river width measurements at twenty sites along the study reach. The water surface slope of the entire reach ranged from during 41.58 cm/km at baseflow to 45.31 cm/km after a storm event. The study reach was also broken into sub-reaches roughly 1km in length to study smaller scale slope dynamics. The furthest upstream sub-reaches are characterized by free-flowing riffle-pool sequences, while the furthest downstream sub-reaches were directly affected by two low-head dams. In the sub-reaches immediately upstream of each dam, baseflow slope is as low as 2 cm/km, while the furthest upstream free-flowing sub-reach has a baseflow slope of 100 cm/km. During high flow events the backwater effect of the dams was observed to propagate upstream: sub-reaches impounded by the dams had increased water surface slopes, while free flowing sub-reaches had decreased water surface slopes. During the largest observed flow event, a stage change of 0.40 m affected sub-reach slopes by as much as 30 cm/km. Further analysis will examine height-width relationships within the study reach and relate cross-sectional flow area to river stage. These relationships can be used in conjunction with slope data to estimate discharge using a modified Manning's equation, and are a core component of discharge algorithms being developed for the SWOT mission.

  15. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

    PubMed

    Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

    2016-01-01

    Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

  16. Hereditary mixed polyposis syndrome is caused by a 40-kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1.

    PubMed

    Jaeger, Emma; Leedham, Simon; Lewis, Annabelle; Segditsas, Stefania; Becker, Martin; Cuadrado, Pedro Rodenas; Davis, Hayley; Kaur, Kulvinder; Heinimann, Karl; Howarth, Kimberley; East, James; Taylor, Jenny; Thomas, Huw; Tomlinson, Ian

    2012-05-06

    Hereditary mixed polyposis syndrome (HMPS) is characterized by apparent autosomal dominant inheritance of multiple types of colorectal polyp, with colorectal carcinoma occurring in a high proportion of affected individuals. Here, we use genetic mapping, copy-number analysis, exclusion of mutations by high-throughput sequencing, gene expression analysis and functional assays to show that HMPS is caused by a duplication spanning the 3' end of the SCG5 gene and a region upstream of the GREM1 locus. This unusual mutation is associated with increased allele-specific GREM1 expression. Whereas GREM1 is expressed in intestinal subepithelial myofibroblasts in controls, GREM1 is predominantly expressed in the epithelium of the large bowel in individuals with HMPS. The HMPS duplication contains predicted enhancer elements; some of these interact with the GREM1 promoter and can drive gene expression in vitro. Increased GREM1 expression is predicted to cause reduced bone morphogenetic protein (BMP) pathway activity, a mechanism that also underlies tumorigenesis in juvenile polyposis of the large bowel.

  17. Multistress Regulation in Escherichia coli: Expression of osmB Involves Two Independent Promoters Responding either to σS or to the RcsCDB His-Asp Phosphorelay

    PubMed Central

    Boulanger, Alice; Francez-Charlot, Anne; Conter, Annie; Castanié-Cornet, Marie-Pierre; Cam, Kaymeuang; Gutierrez, Claude

    2005-01-01

    Transcription of the Escherichia coli osmB gene is induced by several stress conditions. osmB is expressed from two promoters, osmBp1 and osmBp2. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a σS-dependent manner. The upstream promoter, osmBp1, is independent of σS and is activated by RcsB, the response regulator of the His-Asp phosphorelay signal transduction system RcsCDB. RcsB is responsible for the induction of osmBp1 following treatment with chlorpromazine. Activation of osmBp1 by RcsB requires a sequence upstream of its −35 element similar to the RcsB binding site consensus, suggesting a direct regulatory role. osmB appears as another example of a multistress-responsive gene whose transcription involves both a σS-dependent promoter and a second one independent of σS but controlled by stress-specific transcription factors. PMID:15838058

  18. Bed load tracer mobility in a mixed bedrock/alluvial channel

    NASA Astrophysics Data System (ADS)

    Ferguson, R. I.; Sharma, B. P.; Hodge, R. A.; Hardy, R. J.; Warburton, J.

    2017-04-01

    The presence of bare or partially covered rock in an otherwise alluvial river implies a downstream change in transport capacity relative to supply. Field investigations of this change and what causes it are lacking. We used two sets of magnet-tagged tracer clasts to investigate bed load transport during the same sequence of floods in fully alluvial, bare rock, and partial-cover reaches of an upland stream. High-flow shear stresses in different reaches were calculated by using stage loggers. Tracers seeded in the upstream alluvial channel moved more slowly than elsewhere until the frontrunners reached bare rock and sped up. Tracers seeded on bare rock moved rapidly off it and accumulated just upstream from, and later in, a partial-cover zone with many boulders. The backwater effect of the boulder-rich zone is significant in reducing tracer mobility. Tracer movement over full or partial sediment cover was size selective but dispersion over bare rock was not. Along-channel changes in tracer mobility are interpreted in terms of measured differences in shear stress and estimated differences in threshold stress.

  19. Differential regulation of hepatitis B virus core protein expression and genome replication by a small upstream open reading frame and naturally occurring mutations in the precore region.

    PubMed

    Zong, Li; Qin, Yanli; Jia, Haodi; Ye, Lei; Wang, Yongxiang; Zhang, Jiming; Wands, Jack R; Tong, Shuping; Li, Jisu

    2017-05-01

    Hepatitis B virus (HBV) transcribes two subsets of 3.5-kb RNAs: precore RNA for hepatitis B e antigen (HBeAg) expression, and pregenomic RNA for core and P protein translation as well as genome replication. HBeAg expression could be prevented by mutations in the precore region, while an upstream open reading frame (uORF) has been proposed as a negative regulator of core protein translation. We employed replication competent HBV DNA constructs and transient transfection experiments in Huh7 cells to verify the uORF effect and to explore the alternative function of precore RNA. Optimized Kozak sequence for the uORF or extra ATG codons as present in some HBV genotypes reduced core protein expression. G1896A nonsense mutation promoted more efficient core protein expression than mutated precore ATG, while a +1 frameshift mutation was ineffective. In conclusion, various HBeAg-negative precore mutations and mutations affecting uORF differentially regulate core protein expression and genome replication. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Metagenomic exploration reveals a marked change in the river resistome and mobilome after treated wastewater discharges.

    PubMed

    Lekunberri, Itziar; Balcázar, José Luis; Borrego, Carles M

    2018-03-01

    Mobile genetic elements (MGEs) are key agents in the spread of antibiotic resistance genes (ARGs) across environments. Here we used metagenomics to compare the river resistome (collection of all ARGs) and mobilome (e.g., integrases, transposases, integron integrases and insertion sequence common region "ISCR" elements) between samples collected upstream (n = 6) and downstream (n = 6) of an urban wastewater treatment plant (UWWTP). In comparison to upstream metagenomes, downstream metagenomes showed a drastic increase in the abundance of ARGs, as well as markers of MGEs, particularly integron integrases and ISCR elements. These changes were accompanied by a concomitant prevalence of 16S rRNA gene signatures of bacteria affiliated to families encompassing well-known human and animal pathogens. Our results confirm that chronic discharges of treated wastewater severely impact the river resistome affecting not only the abundance and diversity of ARGs but also their potential spread by enriching the river mobilome in a wide variety of MGEs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Eukaryotic Elongation Factor 1A Interacts with the Upstream Pseudoknot Domain in the 3′ Untranslated Region of Tobacco Mosaic Virus RNA

    PubMed Central

    Zeenko, Vladimir V.; Ryabova, Lyubov A.; Spirin, Alexander S.; Rothnie, Helen M.; Hess, Daniel; Browning, Karen S.; Hohn, Thomas

    2002-01-01

    The genomic RNA of tobacco mosaic virus (TMV), like that of other positive-strand RNA viruses, acts as a template for both translation and replication. The highly structured 3′ untranslated region (UTR) of TMV RNAs plays an important role in both processes; it is not polyadenylated but ends with a tRNA-like structure (TLS) preceded by a conserved upstream pseudoknot domain (UPD). The TLS of tobamoviral RNAs can be specifically aminoacylated and, in this state, can interact with eukaryotic elongation factor 1A (eEF1A)/GTP with high affinity. Using a UV cross-linking assay, we detected another specific binding site for eEF1A/GTP, within the UPDs of TMV and crucifer-infecting tobamovirus (crTMV), that does not require aminoacylation. A mutational analysis revealed that UPD pseudoknot conformation and some conserved primary sequence elements are required for this interaction. Its possible role in the regulation of tobamovirus gene expression and replication is discussed. PMID:11991996

  2. Late-onset spastic paraplegia: Aberrant SPG11 transcripts generated by a novel splice site donor mutation.

    PubMed

    Kawarai, Toshitaka; Miyamoto, Ryosuke; Mori, Atsuko; Oki, Ryosuke; Tsukamoto-Miyashiro, Ai; Matsui, Naoko; Miyazaki, Yoshimichi; Orlacchio, Antonio; Izumi, Yuishin; Nishida, Yoshihiko; Kaji, Ryuji

    2015-12-15

    We identified a novel homozygous mutation in the splice site donor (SSD) of intron 30 (c.5866+1G>A) in consanguineous Japanese SPG11 siblings showing late-onset spastic paraplegia using the whole-exome sequencing. Phenotypic variability was observed, including age-at-onset, dysarthria and pes cavus. Coding DNA sequencing revealed that the mutation affected the recognition of the constitutive SSD of intron 30, splicing upstream onto a nearby cryptic SSD in exon 30. The use of constitutive splice sites of intron 29 was confirmed by sequencing. The mutant transcripts are mostly subject to degradation by the nonsense-mediated mRNA decay system. SPG11 transcripts, escaping from the nonsense-mediated mRNA decay pathway, would generate a truncated protein (p.Tyr1900Phefs5X) containing the first 1899 amino acids and followed by 4 aberrant amino acids. This study showed a successful clinical application of whole-exome sequencing in spastic paraplegia and demonstrated a further evidence of allelic heterogeneity in SPG11. The confirmation of aberrant transcript by splice site mutation is a prerequisite for a more precise molecular diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Position-specific binding of FUS to nascent RNA regulates mRNA length

    PubMed Central

    Masuda, Akio; Takeda, Jun-ichi; Okuno, Tatsuya; Okamoto, Takaaki; Ohkawara, Bisei; Ito, Mikako; Ishigaki, Shinsuke; Sobue, Gen

    2015-01-01

    More than half of all human genes produce prematurely terminated polyadenylated short mRNAs. However, the underlying mechanisms remain largely elusive. CLIP-seq (cross-linking immunoprecipitation [CLIP] combined with deep sequencing) of FUS (fused in sarcoma) in neuronal cells showed that FUS is frequently clustered around an alternative polyadenylation (APA) site of nascent RNA. ChIP-seq (chromatin immunoprecipitation [ChIP] combined with deep sequencing) of RNA polymerase II (RNAP II) demonstrated that FUS stalls RNAP II and prematurely terminates transcription. When an APA site is located upstream of an FUS cluster, FUS enhances polyadenylation by recruiting CPSF160 and up-regulates the alternative short transcript. In contrast, when an APA site is located downstream from an FUS cluster, polyadenylation is not activated, and the RNAP II-suppressing effect of FUS leads to down-regulation of the alternative short transcript. CAGE-seq (cap analysis of gene expression [CAGE] combined with deep sequencing) and PolyA-seq (a strand-specific and quantitative method for high-throughput sequencing of 3' ends of polyadenylated transcripts) revealed that position-specific regulation of mRNA lengths by FUS is operational in two-thirds of transcripts in neuronal cells, with enrichment in genes involved in synaptic activities. PMID:25995189

  4. Sequence-length variation of mtDNA HVS-I C-stretch in Chinese ethnic groups.

    PubMed

    Chen, Feng; Dang, Yong-hui; Yan, Chun-xia; Liu, Yan-ling; Deng, Ya-jun; Fulton, David J R; Chen, Teng

    2009-10-01

    The purpose of this study was to investigate mitochondrial DNA (mtDNA) hypervariable segment-I (HVS-I) C-stretch variations and explore the significance of these variations in forensic and population genetics studies. The C-stretch sequence variation was studied in 919 unrelated individuals from 8 Chinese ethnic groups using both direct and clone sequencing approaches. Thirty eight C-stretch haplotypes were identified, and some novel and population specific haplotypes were also detected. The C-stretch genetic diversity (GD) values were relatively high, and probability (P) values were low. Additionally, C-stretch length heteroplasmy was observed in approximately 9% of individuals studied. There was a significant correlation (r=-0.961, P<0.01) between the expansion of the cytosine sequence length in the C-stretch of HVS-I and a reduction in the number of upstream adenines. These results indicate that the C-stretch could be a useful genetic maker in forensic identification of Chinese populations. The results from the Fst and dA genetic distance matrix, neighbor-joining tree, and principal component map also suggest that C-stretch could be used as a reliable genetic marker in population genetics.

  5. The tripartite leader sequence is required for ectopic expression of HAdV-B and HAdV-E E3 CR1 genes.

    PubMed

    Bair, Camden R; Kotha Lakshmi Narayan, Poornima; Kajon, Adriana E

    2017-05-01

    The unique repertoire of genes that characterizes the early region 3 (E3) of the different species of human adenovirus (HAdV) likely contributes to their distinct pathogenic traits. The function of many E3 CR1 proteins remains unknown possibly due to unidentified intrinsic properties that make them difficult to express ectopically. This study shows that the species HAdV-B- and HAdV-E-specific E3 CR1 genes can be expressed from vectors carrying the HAdV tripartite leader (TPL) sequence but not from traditional mammalian expression vectors. Insertion of the TPL sequence upstream of the HAdV-B and HAdV-E E3 CR1 open reading frames was sufficient to rescue protein expression from pCI-neo constructs in transfected 293T cells. The detection of higher levels of HAdV-B and HAdV-E E3 CR1 transcripts suggests that the TPL sequence may enhance gene expression at both the transcriptional and translational levels. Our findings will facilitate the characterization of additional AdV E3 proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Comparative analysis on the structural features of the 5' flanking region of κ-casein genes from six different species

    PubMed Central

    Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A

    2002-01-01

    κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628

  7. A Spiking Neural Network System for Robust Sequence Recognition.

    PubMed

    Yu, Qiang; Yan, Rui; Tang, Huajin; Tan, Kay Chen; Li, Haizhou

    2016-03-01

    This paper proposes a biologically plausible network architecture with spiking neurons for sequence recognition. This architecture is a unified and consistent system with functional parts of sensory encoding, learning, and decoding. This is the first systematic model attempting to reveal the neural mechanisms considering both the upstream and the downstream neurons together. The whole system is a consistent temporal framework, where the precise timing of spikes is employed for information processing and cognitive computing. Experimental results show that the system is competent to perform the sequence recognition, being robust to noisy sensory inputs and invariant to changes in the intervals between input stimuli within a certain range. The classification ability of the temporal learning rule used in the system is investigated through two benchmark tasks that outperform the other two widely used learning rules for classification. The results also demonstrate the computational power of spiking neurons over perceptrons for processing spatiotemporal patterns. In summary, the system provides a general way with spiking neurons to encode external stimuli into spatiotemporal spikes, to learn the encoded spike patterns with temporal learning rules, and to decode the sequence order with downstream neurons. The system structure would be beneficial for developments in both hardware and software.

  8. A Noninvasive In Vitro Monitoring System Reporting Skeletal Muscle Differentiation.

    PubMed

    Öztürk-Kaloglu, Deniz; Hercher, David; Heher, Philipp; Posa-Markaryan, Katja; Sperger, Simon; Zimmermann, Alice; Wolbank, Susanne; Redl, Heinz; Hacobian, Ara

    2017-01-01

    Monitoring of cell differentiation is a crucial aspect of cell-based therapeutic strategies depending on tissue maturation. In this study, we have developed a noninvasive reporter system to trace murine skeletal muscle differentiation. Either a secreted bioluminescent reporter (Metridia luciferase) or a fluorescent reporter (green fluorescent protein [GFP]) was placed under the control of the truncated muscle creatine kinase (MCK) basal promoter enhanced by variable numbers of upstream MCK E-boxes. The engineered pE3MCK vector, coding a triple tandem of E-Boxes and the truncated MCK promoter, showed twentyfold higher levels of luciferase activation compared with a Cytomegalovirus (CMV) promoter. This newly developed reporter system allowed noninvasive monitoring of myogenic differentiation in a straining bioreactor. Additionally, binding sequences of endogenous microRNAs (miRNAs; seed sequences) that are known to be downregulated in myogenesis were ligated as complementary seed sequences into the reporter vector to reduce nonspecific signal background. The insertion of seed sequences improved the signal-to-noise ratio up to 25% compared with pE3MCK. Due to the highly specific, fast, and convenient expression analysis for cells undergoing myogenic differentiation, this reporter system provides a powerful tool for application in skeletal muscle tissue engineering.

  9. Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

    PubMed

    Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

    1993-12-01

    Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.

  10. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    PubMed

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  11. Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow.

    PubMed

    Suryawanshi, Gajendra W; Xu, Song; Xie, Yiming; Chou, Tom; Kim, Namshin; Chen, Irvin S Y; Kim, Sanggu

    2017-06-14

    Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.

  12. Target Site Recognition by a Diversity-Generating Retroelement

    PubMed Central

    Guo, Huatao; Tse, Longping V.; Nieh, Angela W.; Czornyj, Elizabeth; Williams, Steven; Oukil, Sabrina; Liu, Vincent B.; Miller, Jeff F.

    2011-01-01

    Diversity-generating retroelements (DGRs) are in vivo sequence diversification machines that are widely distributed in bacterial, phage, and plasmid genomes. They function to introduce vast amounts of targeted diversity into protein-encoding DNA sequences via mutagenic homing. Adenine residues are converted to random nucleotides in a retrotransposition process from a donor template repeat (TR) to a recipient variable repeat (VR). Using the Bordetella bacteriophage BPP-1 element as a prototype, we have characterized requirements for DGR target site function. Although sequences upstream of VR are dispensable, a 24 bp sequence immediately downstream of VR, which contains short inverted repeats, is required for efficient retrohoming. The inverted repeats form a hairpin or cruciform structure and mutational analysis demonstrated that, while the structure of the stem is important, its sequence can vary. In contrast, the loop has a sequence-dependent function. Structure-specific nuclease digestion confirmed the existence of a DNA hairpin/cruciform, and marker coconversion assays demonstrated that it influences the efficiency, but not the site of cDNA integration. Comparisons with other phage DGRs suggested that similar structures are a conserved feature of target sequences. Using a kanamycin resistance determinant as a reporter, we found that transplantation of the IMH and hairpin/cruciform-forming region was sufficient to target the DGR diversification machinery to a heterologous gene. In addition to furthering our understanding of DGR retrohoming, our results suggest that DGRs may provide unique tools for directed protein evolution via in vivo DNA diversification. PMID:22194701

  13. Wastewater Treatment Effluent Reduces the Abundance and Diversity of Benthic Bacterial Communities in Urban and Suburban Rivers

    PubMed Central

    Drury, Bradley; Rosi-Marshall, Emma

    2013-01-01

    In highly urbanized areas, wastewater treatment plant (WWTP) effluent can represent a significant component of freshwater ecosystems. As it is impossible for the composition of WWTP effluent to match the composition of the receiving system, the potential exists for effluent to significantly impact the chemical and biological characteristics of the receiving ecosystem. We assessed the impacts of WWTP effluent on the size, activity, and composition of benthic microbial communities by comparing two distinct field sites in the Chicago metropolitan region: a highly urbanized river receiving effluent from a large WWTP and a suburban river receiving effluent from a much smaller WWTP. At sites upstream of effluent input, the urban and suburban rivers differed significantly in chemical characteristics and in the composition of their sediment bacterial communities. Although effluent resulted in significant increases in inorganic nutrients in both rivers, surprisingly, it also resulted in significant decreases in the population size and diversity of sediment bacterial communities. Tag pyrosequencing of bacterial 16S rRNA genes revealed significant effects of effluent on sediment bacterial community composition in both rivers, including decreases in abundances of Deltaproteobacteria, Desulfococcus, Dechloromonas, and Chloroflexi sequences and increases in abundances of Nitrospirae and Sphingobacteriales sequences. The overall effect of the WWTP inputs was that the two rivers, which were distinct in chemical and biological properties upstream of the WWTPs, were almost indistinguishable downstream. These results suggest that WWTP effluent has the potential to reduce the natural variability that exists among river ecosystems and indicate that WWTP effluent may contribute to biotic homogenization. PMID:23315724

  14. Identification and characterization of novel and potent transcription promoters of Francisella tularensis.

    PubMed

    Zaide, Galia; Grosfeld, Haim; Ehrlich, Sharon; Zvi, Anat; Cohen, Ofer; Shafferman, Avigdor

    2011-03-01

    Two alternative promoter trap libraries, based on the green fluorescence protein (gfp) reporter and on the chloramphenicol acetyltransferase (cat) cassette, were constructed for isolation of potent Francisella tularensis promoters. Of the 26,000 F. tularensis strain LVS gfp library clones, only 3 exhibited visible fluorescence following UV illumination and all appeared to carry the bacterioferritin promoter (Pbfr). Out of a total of 2,000 chloramphenicol-resistant LVS clones isolated from the cat promoter library, we arbitrarily selected 40 for further analysis. Over 80% of these clones carry unique F. tularensis DNA sequences which appear to drive a wide range of protein expression, as determined by specific chloramphenicol acetyltransferase (CAT) Western dot blot and enzymatic assays. The DNA sequence information for the 33 unique and novel F. tularensis promoters reported here, along with the results of in silico and primer extension analyses, suggest that F. tularensis possesses classical Escherichia coli σ(70)-related promoter motifs. These motifs include the -10 (TATAAT) and -35 [TTGA(C/T)A] domains and an AT-rich region upstream from -35, reminiscent of but distinct from the E. coli upstream region that is termed the UP element. The most efficient promoter identified (Pbfr) appears to be about 10 times more potent than the F. tularensis groEL promoter and is probably among the strongest promoters in F. tularensis. The battery of promoters identified in this work will be useful, among other things, for genetic manipulation in the background of F. tularensis intended to gain better understanding of the mechanisms involved in pathogenesis and virulence, as well as for vaccine development studies.

  15. Isolation and functional characterization of TIF-IB, a factor that confers promoter specificity to mouse RNA polymerase I.

    PubMed

    Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I

    1990-03-25

    The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.

  16. Pathogenetics of alveolar capillary dysplasia with misalignment of pulmonary veins.

    PubMed

    Szafranski, Przemyslaw; Gambin, Tomasz; Dharmadhikari, Avinash V; Akdemir, Kadir Caner; Jhangiani, Shalini N; Schuette, Jennifer; Godiwala, Nihal; Yatsenko, Svetlana A; Sebastian, Jessica; Madan-Khetarpal, Suneeta; Surti, Urvashi; Abellar, Rosanna G; Bateman, David A; Wilson, Ashley L; Markham, Melinda H; Slamon, Jill; Santos-Simarro, Fernando; Palomares, María; Nevado, Julián; Lapunzina, Pablo; Chung, Brian Hon-Yin; Wong, Wai-Lap; Chu, Yoyo Wing Yiu; Mok, Gary Tsz Kin; Kerem, Eitan; Reiter, Joel; Ambalavanan, Namasivayam; Anderson, Scott A; Kelly, David R; Shieh, Joseph; Rosenthal, Taryn C; Scheible, Kristin; Steiner, Laurie; Iqbal, M Anwar; McKinnon, Margaret L; Hamilton, Sara Jane; Schlade-Bartusiak, Kamilla; English, Dawn; Hendson, Glenda; Roeder, Elizabeth R; DeNapoli, Thomas S; Littlejohn, Rebecca Okashah; Wolff, Daynna J; Wagner, Carol L; Yeung, Alison; Francis, David; Fiorino, Elizabeth K; Edelman, Morris; Fox, Joyce; Hayes, Denise A; Janssens, Sandra; De Baere, Elfride; Menten, Björn; Loccufier, Anne; Vanwalleghem, Lieve; Moerman, Philippe; Sznajer, Yves; Lay, Amy S; Kussmann, Jennifer L; Chawla, Jasneek; Payton, Diane J; Phillips, Gael E; Brosens, Erwin; Tibboel, Dick; de Klein, Annelies; Maystadt, Isabelle; Fisher, Richard; Sebire, Neil; Male, Alison; Chopra, Maya; Pinner, Jason; Malcolm, Girvan; Peters, Gregory; Arbuckle, Susan; Lees, Melissa; Mead, Zoe; Quarrell, Oliver; Sayers, Richard; Owens, Martina; Shaw-Smith, Charles; Lioy, Janet; McKay, Eileen; de Leeuw, Nicole; Feenstra, Ilse; Spruijt, Liesbeth; Elmslie, Frances; Thiruchelvam, Timothy; Bacino, Carlos A; Langston, Claire; Lupski, James R; Sen, Partha; Popek, Edwina; Stankiewicz, Paweł

    2016-05-01

    Alveolar capillary dysplasia with misalignment of pulmonary veins (ACDMPV) is a lethal lung developmental disorder caused by heterozygous point mutations or genomic deletion copy-number variants (CNVs) of FOXF1 or its upstream enhancer involving fetal lung-expressed long noncoding RNA genes LINC01081 and LINC01082. Using custom-designed array comparative genomic hybridization, Sanger sequencing, whole exome sequencing (WES), and bioinformatic analyses, we studied 22 new unrelated families (20 postnatal and two prenatal) with clinically diagnosed ACDMPV. We describe novel deletion CNVs at the FOXF1 locus in 13 unrelated ACDMPV patients. Together with the previously reported cases, all 31 genomic deletions in 16q24.1, pathogenic for ACDMPV, for which parental origin was determined, arose de novo with 30 of them occurring on the maternally inherited chromosome 16, strongly implicating genomic imprinting of the FOXF1 locus in human lungs. Surprisingly, we have also identified four ACDMPV families with the pathogenic variants in the FOXF1 locus that arose on paternal chromosome 16. Interestingly, a combination of the severe cardiac defects, including hypoplastic left heart, and single umbilical artery were observed only in children with deletion CNVs involving FOXF1 and its upstream enhancer. Our data demonstrate that genomic imprinting at 16q24.1 plays an important role in variable ACDMPV manifestation likely through long-range regulation of FOXF1 expression, and may be also responsible for key phenotypic features of maternal uniparental disomy 16. Moreover, in one family, WES revealed a de novo missense variant in ESRP1, potentially implicating FGF signaling in the etiology of ACDMPV.

  17. Pathogenetics of Alveolar Capillary Dysplasia with Misalignment of Pulmonary Veins

    PubMed Central

    Szafranski, Przemyslaw; Gambin, Tomasz; Dharmadhikari, Avinash V.; Akdemir, Kadir Caner; Jhangiani, Shalini N.; Schuette, Jennifer; Godiwala, Nihal; Yatsenko, Svetlana A.; Sebastian, Jessica; Madan-Khetarpal, Suneeta; Surti, Urvashi; Abellar, Rosanna G.; Bateman, David A.; Wilson, Ashley L.; Markham, Melinda H.; Slamon, Jill; Santos-Simarro, Fernando; Palomares, María; Nevado, Julián; Lapunzina, Pablo; Hon-Yin, Brian Chung; Wai-Lap, Wong; Chu, Yoyo Wing Yiu; Mok, Gary Tsz Kin; Eitan, Kerem; Reiter, Joel; Ambalavanan, Namasivayam; Anderson, Scott A.; Kelly, David R.; Shieh, Joseph; Rosenthal, Taryn C.; Scheible, Kristin; Steiner, Laurie; Iqbal, M. Anwar; McKinnon, Margaret; Hamilton, Sara Jane; Schlade-Bartusiak, Kamilla; English, Dawn; Hendson, Glenda; Roeder, Elizabeth R.; DeNapoli, Thomas S.; Littlejohn, Rebecca Okashah; Wolff, Daynna J.; Wagner, Carol L.; Yeung, Alison; Francis, David; Fiorino, Elizabeth K.; Edelman, Morris; Fox, Joyce; Hayes, Denise A.; Janssens, Sandra; De Baere, Elfride; Menten, Bjorn; Loccufier, Anne; Van Walleghem, Lieve; Moerman, Philippe; Sznajer, Yves; Lay, Amy S.; Kussmann, Jennifer L.; Chawla, Jasneek; Payton, Diane J.; Phillips, Gael E.; Brosens, Erwin; Tibboel, Dick; de Klein, Annelies; Maystadt, Isabelle; Fisher, Richard; Sebire, Neil; Male, Alison; Chopra, Maya; Pinner, Jason; Malcolm, Girvan; Peters, Gregory; Arbuckle, Susan; Lees, Melissa; Mead, Zoe; Quarrell, Oliver; Sayers, Richard; Owens, Martina; Shaw-Smith, Charles; Lioy, Janet; McKay, Eileen; de Leeuw, Nicole; Feenstra, Ilse; Spruijt, Liesbeth; Elmslie, Frances; Thiruchelvam, Timothy; Bacino, Carlos A.; Langston, Claire; Lupski, James R.; Sen, Partha; Popek, Edwina; Stankiewicz, Paweł

    2017-01-01

    Alveolar capillary dysplasia with misalignment of pulmonary veins (ACDMPV) is a lethal lung developmental disorder caused by heterozygous point mutations or genomic deletion copy-number variants (CNVs) of FOXF1 or its upstream enhancer involving fetal lung-expressed long noncoding RNA genes LINC01081 and LINC01082. Using custom-designed array comparative genomic hybridization, Sanger sequencing, whole exome sequencing (WES), and bioinformatic analyses, we studied 22 new unrelated families (20 postnatal and two prenatal) with clinically diagnosed ACDMPV. We describe novel deletion CNVs at the FOXF1 locus in 13 unrelated ACDMPV patients. Together with the previously reported cases, all 31 genomic deletions in 16q24.1, pathogenic for ACDMPV, for which parental origin was determined, arose de novo with 30 of them occurring on the maternally inherited chromosome 16, strongly implicating genomic imprinting of the FOXF1 locus in human lungs. Surprisingly, we have also identified four ACDMPV families with the pathogenic variants in the FOXF1 locus that arose on paternal chromosome 16. Interestingly, a combination of the severe cardiac defects, including hypoplastic left heart, and single umbilical artery were observed only in children with deletion CNVs involving FOXF1 and its upstream enhancer. Our data demonstrate that genomic imprinting at 16q24.1 plays an important role in variable ACDMPV manifestation likely through long-range regulation of FOXF1 expression, and may be also responsible for key phenotypic features of maternal uniparental disomy 16. Moreover, in one family, WES revealed a de novo missense variant in ESRP1, potentially implicating FGF signaling in etiology of ACDMPV. PMID:27071622

  18. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

    PubMed Central

    Mavrothalassitis, G J; Watson, D K; Papas, T S

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

  19. Bacterio-opsin mutants of Halobacterium halobium

    PubMed Central

    Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

    1983-01-01

    The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

  20. DNA barcoding and evaluation of genetic diversity in Cyprinidae fish in the midstream of the Yangtze River.

    PubMed

    Shen, Yanjun; Guan, Lihong; Wang, Dengqiang; Gan, Xiaoni

    2016-05-01

    The Yangtze River is the longest river in China and is divided into upstream and mid-downstream regions by the Three Gorges (the natural barriers of the Yangtze River), resulting in a complex distribution of fish. Dramatic changes to habitat environments may ultimately threaten fish survival; thus, it is necessary to evaluate the genetic diversity and propose protective measures. Species identification is the most significant task in many fields of biological research and in conservation efforts. DNA barcoding, which constitutes the analysis of a short fragment of the mitochondrial cytochrome c oxidase subunit I (COI) sequence, has been widely used for species identification. In this study, we collected 561 COI barcode sequences from 35 fish from the midstream of the Yangtze River. The intraspecific distances of all species were below 2% (with the exception of Acheilognathus macropterus and Hemibarbus maculatus). Nevertheless, all species could be unambiguously identified from the trees, barcoding gaps and taxonomic resolution ratio values. Furthermore, the COI barcode diversity was found to be low (≤0.5%), with the exception of H. maculatus (0.87%), A. macropterus (2.02%) and Saurogobio dabryi (0.82%). No or few shared haplotypes were detected between the upstream and downstream populations for ten species with overall nucleotide diversities greater than 0.00%, which indicated the likelihood of significant population genetic structuring. Our analyses indicated that DNA barcoding is an effective tool for the identification of cyprinidae fish in the midstream of the Yangtze River. It is vital that some protective measures be taken immediately because of the low COI barcode diversity.

  1. Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

    PubMed

    Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

    2015-09-01

    The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

  2. Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

    PubMed Central

    Takaesu, Azusa; Watanabe, Kiyotaka; Takai, Shinji; Sasaki, Yukako; Orino, Koichi

    2008-01-01

    Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit). Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR) fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas). The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98) ; L: 98–100%). The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed. PMID:18954429

  3. CSReport: A New Computational Tool Designed for Automatic Analysis of Class Switch Recombination Junctions Sequenced by High-Throughput Sequencing.

    PubMed

    Boyer, François; Boutouil, Hend; Dalloul, Iman; Dalloul, Zeinab; Cook-Moreau, Jeanne; Aldigier, Jean-Claude; Carrion, Claire; Herve, Bastien; Scaon, Erwan; Cogné, Michel; Péron, Sophie

    2017-05-15

    B cells ensure humoral immune responses due to the production of Ag-specific memory B cells and Ab-secreting plasma cells. In secondary lymphoid organs, Ag-driven B cell activation induces terminal maturation and Ig isotype class switch (class switch recombination [CSR]). CSR creates a virtually unique IgH locus in every B cell clone by intrachromosomal recombination between two switch (S) regions upstream of each C region gene. Amount and structural features of CSR junctions reveal valuable information about the CSR mechanism, and analysis of CSR junctions is useful in basic and clinical research studies of B cell functions. To provide an automated tool able to analyze large data sets of CSR junction sequences produced by high-throughput sequencing (HTS), we designed CSReport, a software program dedicated to support analysis of CSR recombination junctions sequenced with a HTS-based protocol (Ion Torrent technology). CSReport was assessed using simulated data sets of CSR junctions and then used for analysis of Sμ-Sα and Sμ-Sγ1 junctions from CH12F3 cells and primary murine B cells, respectively. CSReport identifies junction segment breakpoints on reference sequences and junction structure (blunt-ended junctions or junctions with insertions or microhomology). Besides the ability to analyze unprecedentedly large libraries of junction sequences, CSReport will provide a unified framework for CSR junction studies. Our results show that CSReport is an accurate tool for analysis of sequences from our HTS-based protocol for CSR junctions, thereby facilitating and accelerating their study. Copyright © 2017 by The American Association of Immunologists, Inc.

  4. Long-read sequencing of the coffee bean transcriptome reveals the diversity of full-length transcripts

    PubMed Central

    Cheng, Bing; Furtado, Agnelo

    2017-01-01

    Abstract Polyploidization contributes to the complexity of gene expression, resulting in numerous related but different transcripts. This study explored the transcriptome diversity and complexity of the tetraploid Arabica coffee (Coffea arabica) bean. Long-read sequencing (LRS) by Pacbio Isoform sequencing (Iso-seq) was used to obtain full-length transcripts without the difficulty and uncertainty of assembly required for reads from short-read technologies. The tetraploid transcriptome was annotated and compared with data from the sub-genome progenitors. Caffeine and sucrose genes were targeted for case analysis. An isoform-level tetraploid coffee bean reference transcriptome with 95 995 distinct transcripts (average 3236 bp) was obtained. A total of 88 715 sequences (92.42%) were annotated with BLASTx against NCBI non-redundant plant proteins, including 34 719 high-quality annotations. Further BLASTn analysis against NCBI non-redundant nucleotide sequences, Coffea canephora coding sequences with UTR, C. arabica ESTs, and Rfam resulted in 1213 sequences without hits, were potential novel genes in coffee. Longer UTRs were captured, especially in the 5΄UTRs, facilitating the identification of upstream open reading frames. The LRS also revealed more and longer transcript variants in key caffeine and sucrose metabolism genes from this polyploid genome. Long sequences (>10 kilo base) were poorly annotated. LRS technology shows the limitation of previous studies. It provides an important tool to produce a reference transcriptome including more of the diversity of full-length transcripts to help understand the biology and support the genetic improvement of polyploid species such as coffee. PMID:29048540

  5. Direct repeat sequences in the Streptomyces chitinase-63 promoter direct both glucose repression and chitin induction

    PubMed Central

    Ni, Xiangyang; Westpheling, Janet

    1997-01-01

    The chi63 promoter directs glucose-sensitive, chitin-dependent transcription of a gene involved in the utilization of chitin as carbon source. Analysis of 5′ and 3′ deletions of the promoter region revealed that a 350-bp segment is sufficient for wild-type levels of expression and regulation. The analysis of single base changes throughout the promoter region, introduced by random and site-directed mutagenesis, identified several sequences to be important for activity and regulation. Single base changes at −10, −12, −32, −33, −35, and −37 upstream of the transcription start site resulted in loss of activity from the promoter, suggesting that bases in these positions are important for RNA polymerase interaction. The sequences centered around −10 (TATTCT) and −35 (TTGACC) in this promoter are, in fact, prototypical of eubacterial promoters. Overlapping the RNA polymerase binding site is a perfect 12-bp direct repeat sequence. Some base changes within this direct repeat resulted in constitutive expression, suggesting that this sequence is an operator for negative regulation. Other base changes resulted in loss of glucose repression while retaining the requirement for chitin induction, suggesting that this sequence is also involved in glucose repression. The fact that cis-acting mutations resulted in glucose resistance but not inducer independence rules out the possibility that glucose repression acts exclusively by inducer exclusion. The fact that mutations that affect glucose repression and chitin induction fall within the same direct repeat sequence module suggests that the direct repeat sequence facilitates both chitin induction and glucose repression. PMID:9371809

  6. Search for 5'-leader regulatory RNA structures based on gene annotation aided by the RiboGap database.

    PubMed

    Naghdi, Mohammad Reza; Smail, Katia; Wang, Joy X; Wade, Fallou; Breaker, Ronald R; Perreault, Jonathan

    2017-03-15

    The discovery of noncoding RNAs (ncRNAs) and their importance for gene regulation led us to develop bioinformatics tools to pursue the discovery of novel ncRNAs. Finding ncRNAs de novo is challenging, first due to the difficulty of retrieving large numbers of sequences for given gene activities, and second due to exponential demands on calculation needed for comparative genomics on a large scale. Recently, several tools for the prediction of conserved RNA secondary structure were developed, but many of them are not designed to uncover new ncRNAs, or are too slow for conducting analyses on a large scale. Here we present various approaches using the database RiboGap as a primary tool for finding known ncRNAs and for uncovering simple sequence motifs with regulatory roles. This database also can be used to easily extract intergenic sequences of eubacteria and archaea to find conserved RNA structures upstream of given genes. We also show how to extend analysis further to choose the best candidate ncRNAs for experimental validation. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Characterizing the Specificity and Co-operation of Aminopeptidases in the Cytosol and ER During MHC Class I antigen Presentation1

    PubMed Central

    Hearn, Arron; York, Ian A.; Bishop, Courtney; Rock, Kenneth L.

    2010-01-01

    Many MHC class I binding peptides are generated as N-extended precursors during protein degradation by the proteasome. These peptides can be subsequently trimmed by aminopeptidases in the cytosol and/or the ER to produce mature epitope. However, the contribution and specificity of each of these subcellular compartments in removing N-terminal amino acids for antigen presentation is not well defined. Here we investigate this issue for antigenic precursors that are expressed in the cytosol. By systematically varying the N-terminal flanking sequences of peptides we show that the amino acids upstream of an epitope precursor are a major determinant of the amount of antigen presentation. In many cases MHC class I binding peptides are produced through sequential trimming in both the cytosol and ER. Trimming of flanking residues in the cytosol contributes most to sequences that are poorly trimmed in the ER. Since N-terminal trimming has different specificity in the cytosol and ER, the cleavage of peptides in both of these compartments serves to broaden the repertoire of sequences that are presented. PMID:20351195

  8. A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

    PubMed Central

    Clos, J; Buttgereit, D; Grummt, I

    1986-01-01

    A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

  9. Highly conserved non-coding elements on either side of SOX9 associated with Pierre Robin sequence.

    PubMed

    Benko, Sabina; Fantes, Judy A; Amiel, Jeanne; Kleinjan, Dirk-Jan; Thomas, Sophie; Ramsay, Jacqueline; Jamshidi, Negar; Essafi, Abdelkader; Heaney, Simon; Gordon, Christopher T; McBride, David; Golzio, Christelle; Fisher, Malcolm; Perry, Paul; Abadie, Véronique; Ayuso, Carmen; Holder-Espinasse, Muriel; Kilpatrick, Nicky; Lees, Melissa M; Picard, Arnaud; Temple, I Karen; Thomas, Paul; Vazquez, Marie-Paule; Vekemans, Michel; Roest Crollius, Hugues; Hastie, Nicholas D; Munnich, Arnold; Etchevers, Heather C; Pelet, Anna; Farlie, Peter G; Fitzpatrick, David R; Lyonnet, Stanislas

    2009-03-01

    Pierre Robin sequence (PRS) is an important subgroup of cleft palate. We report several lines of evidence for the existence of a 17q24 locus underlying PRS, including linkage analysis results, a clustering of translocation breakpoints 1.06-1.23 Mb upstream of SOX9, and microdeletions both approximately 1.5 Mb centromeric and approximately 1.5 Mb telomeric of SOX9. We have also identified a heterozygous point mutation in an evolutionarily conserved region of DNA with in vitro and in vivo features of a developmental enhancer. This enhancer is centromeric to the breakpoint cluster and maps within one of the microdeletion regions. The mutation abrogates the in vitro enhancer function and alters binding of the transcription factor MSX1 as compared to the wild-type sequence. In the developing mouse mandible, the 3-Mb region bounded by the microdeletions shows a regionally specific chromatin decompaction in cells expressing Sox9. Some cases of PRS may thus result from developmental misexpression of SOX9 due to disruption of very-long-range cis-regulatory elements.

  10. Human U2 snRNA Genes Exhibit a Persistently Open Transcriptional State and Promoter Disassembly at Metaphase▿

    PubMed Central

    Pavelitz, Thomas; Bailey, Arnold D.; Elco, Christopher P.; Weiner, Alan M.

    2008-01-01

    In mammals, small multigene families generate spliceosomal U snRNAs that are nearly as abundant as rRNA. Using the tandemly repeated human U2 genes as a model, we show by footprinting with DNase I and permanganate that nearly all sequences between the enhancer-like distal sequence element and the initiation site are protected during interphase whereas the upstream half of the U2 snRNA coding region is exposed. We also show by chromatin immunoprecipitation that the SNAPc complex, which binds the TATA-like proximal sequence element, is removed at metaphase but remains bound under conditions that induce locus-specific metaphase fragility of the U2 genes, such as loss of CSB, BRCA1, or BRCA2 function, treatment with actinomycin D, or overexpression of the tetrameric p53 C terminus. We propose that the U2 snRNA promoter establishes a persistently open state to facilitate rapid reinitiation and perhaps also to bypass TFIIH-dependent promoter melting; this open state would then be disassembled to allow metaphase chromatin condensation. PMID:18378697

  11. Analysis of Microbe-Associated Molecular Pattern-Responsive Synthetic Promoters with the Parsley Protoplast System.

    PubMed

    Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard

    2016-01-01

    Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.

  12. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    PubMed

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  13. Pea chloroplast tRNA(Lys) (UUU) gene: transcription and analysis of an intron-containing gene.

    PubMed

    Boyer, S K; Mullet, J E

    1988-07-01

    The pea chloroplast trnK gene which encodes tRNA(Lys) (UUU) was sequenced. TrnK is located 210 bp upstream from the promoter of psbA and immediately downstream from the 3'-end of rbcL. The gene is transcribed from the same DNA strand as psbA and rbcL. A 2447 bp intron with class II features is located in the trnK anticodon loop. The intron contains a 506 amino acid open reading frame which could encode an RNA maturase. The primary transcript of trnK is 2.9 kb long; its 5'-end was identified as a site of transcription initiation by in vitro transcription experiments. The 5'-terminus is adjacent to DNA sequences previously identified as transcription promoter elements. The most abundant trnK transcript is 2.5 kb long with termini corresponding to the 5' and 3' ends of the trnK exons. Intron specific RNAs were not detected. This suggests that RNA processing which produces tRNA(Lys) leads to rapid degradation of intron sequences.

  14. Integrating DNA strand displacement circuitry to the nonlinear hybridization chain reaction.

    PubMed

    Zhang, Zhuo; Fan, Tsz Wing; Hsing, I-Ming

    2017-02-23

    Programmable and modular attributes of DNA molecules allow one to develop versatile sensing platforms that can be operated isothermally and enzyme-free. In this work, we present an approach to integrate upstream DNA strand displacement circuits that can be turned on by a sequence-specific microRNA analyte with a downstream nonlinear hybridization chain reaction for a cascading hyperbranched nucleic acid assembly. This system provides a two-step amplification strategy for highly sensitive detection of the miRNA analyte, conducive for multiplexed detection. Multiple miRNA analytes were tested with our integrated circuitry using the same downstream signal amplification setting, showing the decoupling of nonlinear self-assembly with the analyte sequence. Compared with the reported methods, our signal amplification approach provides an additional control module for higher-order DNA self-assembly and could be developed into a promising platform for the detection of critical nucleic-acid based biomarkers.

  15. Investigations of Escherichia coli promoter sequences with artificial neural networks: New signals discovered upstream of the transcriptional startpoint

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pedersen, A.G.; Engelbrecht, J.

    1995-12-31

    In this paper we present a novel method for using the learning ability of a neural network as a measure of information in local regions of input data. Using the method to analyze Escherichia coli promoters, we discover all previously described signals, and furthermore find new signals that are regularly spaced along the promoter region. The spacing of all signals correspond to the helical periodicity of DNA, meaning that the signals are all present on the same face of the DNA helix in the promoter region. This is consistent with a model where the RNA polymerase contacts the promoter onmore » one side of the DNA, and suggests that the regions important for promoter recognition may include more positions on the DNA than usually assumed. We furthermore analyze the E.coli promoters by calculating the Kullback Leibler distance, and by constructing sequence logos.« less

  16. Authentication of meat from game and domestic species by SNaPshot minisequencing analysis.

    PubMed

    La Neve, Fabio; Civera, Tiziana; Mucci, Nadia; Bottero, Maria Teresa

    2008-10-01

    The aim of the present study is to develop an assay for the specific identification of meat from Capreolus capreolus, Cervus elaphus, Capra ibex, Rupicapra rupicapra, targeting sequences of the cytochrome b (cyt b) gene of mitochondrial DNA. The assay is also intended to enable differentiation between meat from these wild species as well as Ovis aries, Capra hircus, Bubalus bubalis, Bos taurus and Sus scrofa domestic species. The primers used in the preliminary PCR were designed in well conserved regions upstream and downstream of the diagnosis sites. They successfully amplified a conserved 232bp region from the cyt b gene of all the species taken into consideration. The sites of diagnosis have been interrogated using a minisequencing reaction and capillary electrophoresis. All the results of the multiplex PER (primer extension reaction) test were confirmed by fragment sequencing. The assay offers the possibility of discriminating nine species at the same time.

  17. Identification of the Coumermycin A1 Biosynthetic Gene Cluster of Streptomyces rishiriensis DSM 40489

    PubMed Central

    Wang, Zhao-Xin; Li, Shu-Ming; Heide, Lutz

    2000-01-01

    The biosynthetic gene cluster of the aminocoumarin antibiotic coumermycin A1 was cloned by screening of a cosmid library of Streptomyces rishiriensis DSM 40489 with heterologous probes from a dTDP-glucose 4,6-dehydratase gene, involved in deoxysugar biosynthesis, and from the aminocoumarin resistance gyrase gene gyrBr. Sequence analysis of a 30.8-kb region upstream of gyrBr revealed the presence of 28 complete open reading frames (ORFs). Fifteen of the identified ORFs showed, on average, 84% identity to corresponding ORFs in the biosynthetic gene cluster of novobiocin, another aminocoumarin antibiotic. Possible functions of 17 ORFs in the biosynthesis of coumermycin A1 could be assigned by comparison with sequences in GenBank. Experimental proof for the function of the identified gene cluster was provided by an insertional gene inactivation experiment, which resulted in an abolishment of coumermycin A1 production. PMID:11036020

  18. The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.

    1988-01-01

    Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer.more » This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.« less

  19. Metatranscriptomic insights on gene expression and regulatory controls in Candidatus Accumulibacter phosphatis

    DOE PAGES

    Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina; ...

    2015-11-10

    Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less

  20. Metatranscriptomic insights on gene expression and regulatory controls in Candidatus Accumulibacter phosphatis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oyserman, Ben O.; Noguera, Daniel R.; del Rio, Tijana Glavina

    Previous studies on enhanced biological phosphorus removal (EBPR) have focused on reconstructing genomic blueprints for the model polyphosphate-accumulating organism Candidatus Accumulibacter phosphatis. Here, a time series metatranscriptome generated from enrichment cultures of Accumulibacter was used to gain insight into anerobic/aerobic metabolism and regulatory mechanisms within an EBPR cycle. Co-expressed gene clusters were identified displaying ecologically relevant trends consistent with batch cycle phases. Transcripts displaying increased abundance during anerobic acetate contact were functionally enriched in energy production and conversion, including upregulation of both cytoplasmic and membrane-bound hydrogenases demonstrating the importance of transcriptional regulation to manage energy and electron flux during anerobicmore » acetate contact. We hypothesized and demonstrated hydrogen production after anerobic acetate contact, a previously unknown strategy for Accumulibacter to maintain redox balance. Genes involved in anerobic glycine utilization were identified and phosphorus release after anerobic glycine contact demonstrated, suggesting that Accumulibacter routes diverse carbon sources to acetyl-CoA formation via previously unrecognized pathways. A comparative genomics analysis of sequences upstream of co-expressed genes identified two statistically significant putative regulatory motifs. One palindromic motif was identified upstream of genes involved in PHA synthesis and acetate activation and is hypothesized to be a phaR binding site, hence representing a hypothetical PHA modulon. A second motif was identified ~35 base pairs (bp) upstream of a large and diverse array of genes and hence may represent a sigma factor binding site. As a result, this analysis provides a basis and framework for further investigations into Accumulibacter metabolism and the reconstruction of regulatory networks in uncultured organisms.« less

  1. Lactate Utilization Is Regulated by the FadR-Type Regulator LldR in Pseudomonas aeruginosa

    PubMed Central

    Gao, Chao; Hu, Chunhui; Zheng, Zhaojuan; Jiang, Tianyi; Dou, Peipei; Zhang, Wen; Che, Bin; Wang, Yujiao; Lv, Min

    2012-01-01

    NAD-independent l-lactate dehydrogenase (l-iLDH) and NAD-independent d-lactate dehydrogenase (d-iLDH) activities are induced coordinately by either enantiomer of lactate in Pseudomonas strains. Inspection of the genomic sequences of different Pseudomonas strains revealed that the lldPDE operon comprises 3 genes, lldP (encoding a lactate permease), lldD (encoding an l-iLDH), and lldE (encoding a d-iLDH). Cotranscription of lldP, lldD, and lldE in Pseudomonas aeruginosa strain XMG starts with the base, C, that is located 138 bp upstream of the lldP ATG start codon. The lldPDE operon is located adjacent to lldR (encoding an FadR-type regulator, LldR). The gel mobility shift assays revealed that the purified His-tagged LldR binds to the upstream region of lldP. An XMG mutant strain that constitutively expresses d-iLDH and l-iLDH was found to contain a mutation in lldR that leads to an Ile23-to-serine substitution in the LldR protein. The mutated protein, LldRM, lost its DNA-binding activity. A motif with a hyphenated dyad symmetry (TGGTCTTACCA) was identified as essential for the binding of LldR to the upstream region of lldP by using site-directed mutagenesis. l-Lactate and d-lactate interfered with the DNA-binding activity of LldR. Thus, l-iLDH and d-iLDH were expressed when the operon was induced in the presence of l-lactate or d-lactate. PMID:22408166

  2. Flow of wormlike micellar solutions around confined microfluidic cylinders.

    PubMed

    Zhao, Ya; Shen, Amy Q; Haward, Simon J

    2016-10-26

    Wormlike micellar (WLM) solutions are frequently used in enhanced oil and gas recovery applications in porous rock beds where complex microscopic geometries result in mixed flow kinematics with strong shear and extensional components. Experiments with WLM solutions through model microfluidic porous media have revealed a variety of complex flow phenomena, including the formation of stable gel-like structures known as a Flow-Induced Structured Phase (FISP), which undoubtedly play an important role in applications of WLM fluids, but are still poorly understood. A first step in understanding flows of WLM fluids through porous media can be made by examining the flow around a single micro-scale cylinder aligned on the flow axis. Here we study flow behavior of an aqueous WLM solution consisting of cationic surfactant cetyltrimethylammonium bromide (CTAB) and a stable hydrotropic salt 3-hydroxy naphthalene-2-carboxylate (SHNC) in microfluidic devices with three different cylinder blockage ratios, β. We observe a rich sequence of flow instabilities depending on β as the Weissenberg number (Wi) is increased to large values while the Reynolds number (Re) remains low. Instabilities upstream of the cylinder are associated with high stresses in fluid that accelerates into the narrow gap between the cylinder and the channel wall; vortex growth upstream is reminiscent of that seen in microfluidic contraction geometries. Instability downstream of the cylinder is associated with stresses generated at the trailing stagnation point and the resulting flow modification in the wake, coupled with the onset of time-dependent flow upstream and the asymmetric division of flow around the cylinder.

  3. The role of polymorphisms in the spliced leader addition domain in determining promoter activity in Brugia malayi.

    PubMed

    Bailey, Michelle; Chauhan, Chitra; Liu, Canhui; Unnasch, Thomas R

    2011-03-01

    Previous studies of Brugia malayi promoters have suggested that they are unusual in that they lack the CAAT or TATAA boxes that are often emblematic of eucaryotic core promoter domains. Instead, the region surrounding the spliced leader (SL) addition site appears to function as the core promoter domain in B. malayi. To test the hypothesis that polymorphisms in this SL addition domain are important determinants of promoter activity, a series of domain swap mutants were prepared replacing the SL addition domain of the B. malayi 13kDa large subunit ribosomal protein (BmRPL13) with those of other ribosomal protein (RP) promoters exhibiting a wide range of activities. These constructs were then tested for promoter activity in a homologous transient transfection system. On average, polymorphisms in the SL addition domain were found to be responsible for 80% of the variation in promoter activity exhibited by the RP promoters tested. Essentially all of this effect could be attributable to polymorphisms in the 10nt located directly upstream of the SL addition site. A comparison of the sequence of this domain to the promoter activity exhibited by the domain swap mutants suggested that promoter activity was related to the number of T residues present in the coding strand of the upstream domain. Confirming this, mutation of the upstream domain of the promoter of the BmRPS4 gene to a homogeneous stretch of 10 T residues resulted in a significant increase in promoter activity. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. Photographic copy of drawing by Modjeski and Masters, Engineers of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of drawing by Modjeski and Masters, Engineers of the proposed Huey P. Long Bridge Widening. Original drawing located in the office of Modjeski and Masters, Consulting Engineers at 1055 St. Charles Avenue, New Orleans, LA. 70130. JUNE 30, 2004 DRAWING OF THE PROPOSED HUEY P. LONG BRIDGE WIDENING, U.S. 90, MAIN BRIDGE SUPERSTRUCTURE, SHOWING SEQUENCE OF CONSTRUCTION – 16, STAGE 5 (PLACEMENT OF NEW DECK AND FLOOR SYSTEM) AND STAGE 6. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  5. Photographic copy of drawing by Modjeski and Masters, Engineers of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of drawing by Modjeski and Masters, Engineers of the proposed Huey P. Long Bridge Widening. Original drawing located in the office of Modjeski and Masters, Consulting Engineers at 1055 St. Charles Avenue, New Orleans, LA. 70130. JUNE 30, 2004 DRAWING OF THE PROPOSED HUEY P. LONG BRIDGE WIDENING, U.S. 90, MAIN BRIDGE SUPERSTRUCTURE, SHOWING SEQUENCE OF CONSTRUCTION – 14, STAGE 3 – PHASE 1 AND STAGE 3 – PHASE 2. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  6. Photographic copy of drawing by Modjeski and Masters, Engineers of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of drawing by Modjeski and Masters, Engineers of the proposed Huey P. Long Bridge Widening. Original drawing located in the office of Modjeski and Masters, Consulting Engineers at 1055 St. Charles Avenue, New Orleans, LA. 70130. JUNE 30, 2004 DRAWING OF THE PROPOSED HUEY P. LONG BRIDGE WIDENING, U.S. 90, MAIN BRIDGE SUPERSTRUCTURE, SHOWING SEQUENCE OF CONSTRUCTION – 13, STAGE 1 AND STAGE 2 – PHASE 1 AND STAGE 2 – PHASE 2. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  7. Photographic copy of drawing by Modjeski and Masters, Engineers of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of drawing by Modjeski and Masters, Engineers of the proposed Huey P. Long Bridge Widening. Original drawing located in the office of Modjeski and Masters, Consulting Engineers at 1055 St. Charles Avenue, New Orleans, LA. 70130. JUNE 30, 2004 DRAWING OF THE PROPOSED HUEY P. LONG BRIDGE WIDENING, U.S. 90, MAIN BRIDGE SUPERSTRUCTURE, SHOWING SEQUENCE OF CONSTRUCTION – 15, STAGE 4 AND STAGE 5 (DECK AND FLOOR SYSTEM REMOVAL). - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  8. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  9. Nucleotide sequence of the gene for the Mr 32,000 thylakoid membrane protein from Spinacia oleracea and Nicotiana debneyi predicts a totally conserved primary translation product of Mr 38,950

    PubMed Central

    Zurawski, Gerard; Bohnert, Hans J.; Whitfeld, Paul R.; Bottomley, Warwick

    1982-01-01

    The gene for the so-called Mr 32,000 rapidly labeled photosystem II thylakoid membrane protein (here designated psbA) of spinach (Spinacia oleracea) chloroplasts is located on the chloroplast DNA in the large single-copy region immediately adjacent to one of the inverted repeat sequences. In this paper we show that the size of the mRNA for this protein is ≈ 1.25 kilobases and that the direction of transcription is towards the inverted repeat unit. The nucleotide sequence of the gene and its flanking regions is presented. The only large open reading frame in the sequence codes for a protein of Mr 38,950. The nucleotide sequence of psbA from Nicotiana debneyi also has been determined, and comparison of the sequences from the two species shows them to be highly conserved (>95% homology) throughout the entire reading frame. Conservation of the amino acid sequence is absolute, there being no changes in a total of 353 residues. This leads us to conclude that the primary translation product of psbA must be a protein of Mr 38,950. The protein is characterized by the complete absence of lysine residues and is relatively rich in hydrophobic amino acids, which tend to be clustered. Transcription of spinach psbA starts about 86 base pairs before the first ATG codon. Immediately upstream from this point there is a sequence typical of that found in E. coli promoters. An almost identical sequence occurs in the equivalent region of N. debneyi DNA. Images PMID:16593262

  10. Mammalian genome projects reveal new growth hormone (GH) sequences. Characterization of the GH-encoding genes of armadillo (Dasypus novemcinctus), hedgehog (Erinaceus europaeus), bat (Myotis lucifugus), hyrax (Procavia capensis), shrew (Sorex araneus), ground squirrel (Spermophilus tridecemlineatus), elephant (Loxodonta africana), cat (Felis catus) and opossum (Monodelphis domestica).

    PubMed

    Wallis, Michael

    2008-01-15

    Mammalian growth hormone (GH) sequences have been shown previously to display episodic evolution: the sequence is generally strongly conserved but on at least two occasions during mammalian evolution (on lineages leading to higher primates and ruminants) bursts of rapid evolution occurred. However, the number of mammalian orders studied previously has been relatively limited, and the availability of sequence data via mammalian genome projects provides the potential for extending the range of GH gene sequences examined. Complete or nearly complete GH gene sequences for six mammalian species for which no data were previously available have been extracted from the genome databases-Dasypus novemcinctus (nine-banded armadillo), Erinaceus europaeus (western European hedgehog), Myotis lucifugus (little brown bat), Procavia capensis (cape rock hyrax), Sorex araneus (European shrew), Spermophilus tridecemlineatus (13-lined ground squirrel). In addition incomplete data for several other species have been extended. Examination of the data in detail and comparison with previously available sequences has allowed assessment of the reliability of deduced sequences. Several of the new sequences differ substantially from the consensus sequence previously determined for eutherian GHs, indicating greater variability than previously recognised, and confirming the episodic pattern of evolution. The episodic pattern is not seen for signal sequences, 5' upstream sequence or synonymous substitutions-it is specific to the mature protein sequence, suggesting that it relates to the hormonal function. The substitutions accumulated during the course of GH evolution have occurred mainly on the side of the hormone facing away from the receptor, in a non-random fashion, and it is suggested that this may reflect interaction of the receptor-bound hormone with other proteins or small ligands.

  11. Immediate changes in stream channel geomorphology, aquatic habitat, and fish assemblages following dam removal in a small upland catchment

    NASA Astrophysics Data System (ADS)

    Magilligan, F. J.; Nislow, K. H.; Kynard, B. E.; Hackman, A. M.

    2016-01-01

    Dam removal is becoming an increasingly important component of river restoration, with > 1100 dams having been removed nationwide over the past three decades. Despite this recent progression of removals, the lack of pre- to post-removal monitoring and assessment limits our understanding of the magnitude, rate, and sequence of geomorphic and/or ecological recovery to dam removal. Taking advantage of the November 2012 removal of an old ( 190 year-old) 6-m high, run-of-river industrial dam on Amethyst Brook (26 km2) in central Massachusetts, we identify the immediate eco-geomorphic responses to removal. To capture the geomorphic responses to dam removal, we collected baseline data at multiple scales, both upstream ( 300 m) and downstream (> 750 m) of the dam, including monumented cross sections, detailed channel-bed longitudinal profiles, embeddedness surveys, and channel-bed grain size measurements, which were repeated during the summer of 2013. These geomorphic assessments were combined with detailed quantitative electrofishing surveys of stream fish richness and abundance above and below the dam site and throughout the watershed and visual surveys of native anadromous sea lamprey (Petromyzon marinus) nest sites. Post-removal assessments were complicated by two events: (1) upstream knickpoint migration exhumed an older (ca. late eighteenth century) intact wooden crib dam 120 m upstream of the former stone dam, and (2) the occurrence of a 10-20 year RI flood 6 months after removal that caused further upstream incision and downstream aggradation. Now that the downstream reach has been reconnected to upstream sediment supply, the predominant geomorphic response was bed aggradation and associated fining (30-60% reduction). At dam proximal locations, aggradation ranged from 0.3 to > 1 m where a large woody debris jam enhanced aggradation. Although less pronounced, distal locations still showed aggradation with a mean depth of deposition of 0.20 m over the 750-m downstream reach. Post-removal, but pre-flood, bed surveys indicate 2 m of incision had migrated 25 m upstream of the former reservoir before encountering the exhumed dam, which now acts as the new grade control, limiting progressive headcutting. Approximately 1000 m3 of sediment was evacuated in the first year, with 67% of the volume occurring by pre-flood, process-driven (e.g., changes in base level) controls. The combination of changes in channel-bed sedimentology, the occurrence of a large magnitude flood, and the emergence of the new crib dam that is a likely barrier to fish movement was associated with major reductions in abundance and richness in sites downstream and immediately upstream adjacent to the former dam in post-removal sampling. At the same time, we documented the presence of four species of fish, including sea lamprey, which were not present above the dam prior to removal, indicating that upstream passage has been achieved; and we also documented lamprey spawning activity at sites immediately below the dam, which had previously been unsuitable owing to an excessively coarse and armored riverbed. Our results point to the importance of interactions between dam removal and flood disturbance effects, with important implications for short- and long-term monitoring and assessment of dam impacts to river systems.

  12. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    PubMed

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  13. Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

    PubMed

    Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

    2018-05-01

    Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.

  14. Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains.

    PubMed

    Tatár-Kis, Tímea; Mató, Tamás; Markos, Béla; Palya, Vilmos

    2004-08-01

    Polymerase chain reaction and sequencing were used to analyse goose parvovirus field isolates and vaccine strains. Two fragments of the genome were amplified. Fragment "A" represents a region of VP3 gene, while fragment "B" represents a region upstream of the VP3 gene, encompassing part of the VP1 gene. In the region of fragment "A" the deduced amino acid sequence of the strains was identical, therefore differentiation among strains could be done only at the nucleotide level, which resulted in the formation of three groups: Hungarian, West-European and Asian strains. In the region of fragment "B", separation of groups could be done by both nucleotide and deduced amino acid sequence level. The nucleotide sequences resulted in the same groups as for fragment "A" but with a different clustering pattern among the Hungarian strains. Within the "Hungarian" group most of the recent field isolates fell into one cluster, very closely related or identical to each other, indicating a very slow evolutionary change. The attenuated strains and field isolates from 1979/80 formed a separate cluster. When vaccine strains and field isolates were compared, two specific amino acid differences were found that can be considered as possible markers for vaccinal strains. Sequence analysis of fragment "B" seems to be a suitable method for differentiation of attenuated vaccine strains from virulent strains. Copyright 2004 Houghton Trust Ltd

  15. Inferring gene expression from ribosomal promoter sequences, a crowdsourcing approach

    PubMed Central

    Meyer, Pablo; Siwo, Geoffrey; Zeevi, Danny; Sharon, Eilon; Norel, Raquel; Segal, Eran; Stolovitzky, Gustavo; Siwo, Geoffrey; Rider, Andrew K.; Tan, Asako; Pinapati, Richard S.; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael T.; Tung, Yi-An; Chen, Yong-Syuan; Chen, Mei-Ju May; Chen, Chien-Yu; Knight, Jason M.; Sahraeian, Sayed Mohammad Ebrahim; Esfahani, Mohammad Shahrokh; Dreos, Rene; Bucher, Philipp; Maier, Ezekiel; Saeys, Yvan; Szczurek, Ewa; Myšičková, Alena; Vingron, Martin; Klein, Holger; Kiełbasa, Szymon M.; Knisley, Jeff; Bonnell, Jeff; Knisley, Debra; Kursa, Miron B.; Rudnicki, Witold R.; Bhattacharjee, Madhuchhanda; Sillanpää, Mikko J.; Yeung, James; Meysman, Pieter; Rodríguez, Aminael Sánchez; Engelen, Kristof; Marchal, Kathleen; Huang, Yezhou; Mordelet, Fantine; Hartemink, Alexander; Pinello, Luca; Yuan, Guo-Cheng

    2013-01-01

    The Gene Promoter Expression Prediction challenge consisted of predicting gene expression from promoter sequences in a previously unknown experimentally generated data set. The challenge was presented to the community in the framework of the sixth Dialogue for Reverse Engineering Assessments and Methods (DREAM6), a community effort to evaluate the status of systems biology modeling methodologies. Nucleotide-specific promoter activity was obtained by measuring fluorescence from promoter sequences fused upstream of a gene for yellow fluorescence protein and inserted in the same genomic site of yeast Saccharomyces cerevisiae. Twenty-one teams submitted results predicting the expression levels of 53 different promoters from yeast ribosomal protein genes. Analysis of participant predictions shows that accurate values for low-expressed and mutated promoters were difficult to obtain, although in the latter case, only when the mutation induced a large change in promoter activity compared to the wild-type sequence. As in previous DREAM challenges, we found that aggregation of participant predictions provided robust results, but did not fare better than the three best algorithms. Finally, this study not only provides a benchmark for the assessment of methods predicting activity of a specific set of promoters from their sequence, but it also shows that the top performing algorithm, which used machine-learning approaches, can be improved by the addition of biological features such as transcription factor binding sites. PMID:23950146

  16. Cloning, sequencing, and expression of the Zymomonas mobilis phosphoglycerate mutase gene (pgm) in Escherichia coli.

    PubMed Central

    Yomano, L P; Scopes, R K; Ingram, L O

    1993-01-01

    Phosphoglycerate mutase is an essential glycolytic enzyme for Zymomonas mobilis, catalyzing the reversible interconversion of 3-phosphoglycerate and 2-phosphoglycerate. The pgm gene encoding this enzyme was cloned on a 5.2-kbp DNA fragment and expressed in Escherichia coli. Recombinants were identified by using antibodies directed against purified Z. mobilis phosphoglycerate mutase. The pgm gene contains a canonical ribosome-binding site, a biased pattern of codon usage, a long upstream untranslated region, and four promoters which share sequence homology. Interestingly, adhA and a D-specific 2-hydroxyacid dehydrogenase were found on the same DNA fragment and appear to form a cluster of genes which function in central metabolism. The translated sequence for Z. mobilis pgm was in full agreement with the 40 N-terminal amino acid residues determined by protein sequencing. The primary structure of the translated sequence is highly conserved (52 to 60% identity with other phosphoglycerate mutases) and also shares extensive homology with bisphosphoglycerate mutases (51 to 59% identity). Since Southern blots indicated the presence of only a single copy of pgm in the Z. mobilis chromosome, it is likely that the cloned pgm gene functions to provide both activities. Z. mobilis phosphoglycerate mutase is unusual in that it lacks the flexible tail and lysines at the carboxy terminus which are present in the enzyme isolated from all other organisms examined. Images PMID:8320209

  17. Expression of caveolin in trabecular meshwork cells and its possible implication in pathogenesis of primary open angle glaucoma

    PubMed Central

    Surgucheva, Irina

    2011-01-01

    Purpose Primary open-angle glaucoma (POAG), which is the most common form of glaucoma, has been associated with a heterogeneous genetic component. A genome-wide association study has identified a common sequence variant at 7q31 (rs4236601 [A]) near the caveolin genes in patients with POAG. Caveolins are a family of integral membrane proteins which participate in many cellular processes, including vesicular transport, cholesterol homeostasis, signal transduction, cell adhesion and migration. The goal of this study was to investigate the expression and regulation of caveolin 1 (CAV-1) and caveolin 2 (CAV-2) in normal and glaucoma trabecular meshwork (TM) cells. Methods CAV-1 and CAV-2 protein expression was quantified by immunoblot analysis using lysates isolated from primary and immortalized TM cells or TM tissue dissected from normal and POAG eyes. The localization of caveolins in TM cells was assessed by immunofluorescent microscopy. CAV-1 and CAV-2 protein expression was also investigated in TM cells at various time points after subjecting the cells to known glaucomatous insults like dexamethasone (DEX) and tumor growth factor beta2 (TGF-β2) treatment. Phosphorylation of CAV-1 at tyrosine 14 in normal and glaucoma TM cell lines was evaluated using a specific monoclonal antibody (Ab). The 5′ upstream region of the CAV-1 gene was amplified and the sequence variant rs4236601 (A/G polymorphic site) and several putative transcription factor-binding sites were modified by in vitro mutagenesis. The effect of nucleotide sequence modifications in the CAV-1 upstream region on gene expression was assayed in a luciferase-based system in TM and non-TM cells. Results CAV-1 and CAV-2 are expressed in TM cells, with localization to the cytoplasm and perinuclear region. DEX increased CAV-1 expression in immortalized glaucoma TM cells by 2.8±0.1 (n=3) fold at 24 h and 2.5±0.1 (n=3) fold at 48 h, compared to 1.3±0.06 (n=3) fold at 24 and 48 h in immortalized normal TM cells. Phosphorylation of CAV-1 at Tyr14 was reduced by 3.2±0.15 (n=3) fold in glaucomatous TM cells when compared to normal TM cells. In POAG and normal TM tissue, CAV-1 expression was found to be uniform. CAV-2, on the other hand, was variable in independent normal and glaucoma TM tissue. Substitution of a G for an A at base pair −2,388 upstream of the start codon of CAV-1, corresponding to the minor allele rs4236601 [A], increased transcriptional activity in TM and non-TM cells when compared to the native sequence. Deletion analysis of putative transcription factor binding sites in the CAV-1 promoter region caused cell-specific effects on gene expression. Conclusions CAV-1 and CAV-2 are expressed in normal and glaucoma tissue and TM cell lines. Phosphorylation of Tyr14 in CAV-1 and transcriptional regulation of CAV-1 expression may have a role in glaucomatous alterations in TM cells. PMID:22128235

  18. Deep RNA sequencing analysis of readthrough gene fusions in human prostate adenocarcinoma and reference samples

    PubMed Central

    2011-01-01

    Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs), have been estimated using expressed sequence tag (EST) libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq) now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal samples and 9 lung cancer cell lines. Conclusions Deep transcriptional sequencing and analysis with targeted and spliced alignment methods can effectively identify TIC events across the genome in individual tissues. Prostate and reference samples exhibit a wide range of TIC events, involving more genes than estimated previously using ESTs. Tissue specificity of TIC events is correlated with expression patterns of the upstream gene. Some TIC events, such as MSMB-NCOA4, may play functional roles in cancer. PMID:21261984

  19. Engineering an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium/Rhodotorula species.

    PubMed

    Liu, Yanbin; Koh, Chong Mei John; Ngoh, Si Te; Ji, Lianghui

    2015-10-26

    Rhodosporidium and Rhodotorula are two genera of oleaginous red yeast with great potential for industrial biotechnology. To date, there is no effective method for inducible expression of proteins and RNAs in these hosts. We have developed a luciferase gene reporter assay based on a new codon-optimized LUC2 reporter gene (RtLUC2), which is flanked with CAR2 homology arms and can be integrated into the CAR2 locus in the nuclear genome at >90 % efficiency. We characterized the upstream DNA sequence of a D-amino acid oxidase gene (DAO1) from R. toruloides ATCC 10657 by nested deletions. By comparing the upstream DNA sequences of several putative DAO1 homologs of Basidiomycetous fungi, we identified a conserved DNA motif with a consensus sequence of AGGXXGXAGX11GAXGAXGG within a 0.2 kb region from the mRNA translation initiation site. Deletion of this motif led to strong mRNA transcription under non-inducing conditions. Interestingly, DAO1 promoter activity was enhanced about fivefold when the 108 bp intron 1 was included in the reporter construct. We identified a conserved CT-rich motif in the intron with a consensus sequence of TYTCCCYCTCCYCCCCACWYCCGA, deletion or point mutations of which drastically reduced promoter strength under both inducing and non-inducing conditions. Additionally, we created a selection marker-free DAO1-null mutant (∆dao1e) which displayed greatly improved inducible gene expression, particularly when both glucose and nitrogen were present in high levels. To avoid adding unwanted peptide to proteins to be expressed, we converted the original translation initiation codon to ATC and re-created a translation initiation codon at the start of exon 2. This promoter, named P DAO1-in1m1 , showed very similar luciferase activity to the wild-type promoter upon induction with D-alanine. The inducible system was tunable by adjusting the levels of inducers, carbon source and nitrogen source. The intron 1-containing DAO1 promoters coupled with a DAO1 null mutant makes an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium and Rhodotorula genera. The system will be a valuable tool for metabolic engineering and enzyme expression in these yeast hosts.

  20. Structure of the horseradish peroxidase isozyme C genes.

    PubMed

    Fujiyama, K; Takemura, H; Shibayama, S; Kobayashi, K; Choi, J K; Shinmyo, A; Takano, M; Yamada, Y; Okada, H

    1988-05-02

    We have isolated, cloned and characterized three cDNAs and two genomic DNAs corresponding to the mRNAs and genes for the horseradish (Armoracia rusticana) peroxidase isoenzyme C (HPR C). The amino acid sequence of HRP C1, deduced from the nucleotide sequence of one of the cDNA clone, pSK1, contained the same primary sequence as that of the purified enzyme established by Welinder [FEBS Lett. 72, 19-23 (1976)] with additional sequences at the N and C terminal. All three inserts in the cDNA clones, pSK1, pSK2 and pSK3, coded the same size of peptide (308 amino acid residues) if these are processed in the same way, and the amino acid sequence were homologous to each other by 91-94%. Functional amino acids, including His40, His170, Tyr185 and Arg183 and S-S-bond-forming Cys, were conserved in the three isozymes, but a few N-glycosylation sites were not the same. Two HRP C isoenzyme genomic genes, prxC1 and prxC2, were tandem on the chromosomal DNA and each gene consisted of four exons and three introns. The positions in the exons interrupted by introns were the same in two genes. We observed a putative promoter sequence 5' upstream and a poly(A) signal 3' downstream in both genes. The gene product of prxC1 might be processed with a signal sequence of 30 amino acid residues at the N terminus and a peptide consisting of 15 amino acid residues at the C terminus.

  1. Computational methods in sequence and structure prediction

    NASA Astrophysics Data System (ADS)

    Lang, Caiyi

    This dissertation is organized into two parts. In the first part, we will discuss three computational methods for cis-regulatory element recognition in three different gene regulatory networks as the following: (a) Using a comprehensive "Phylogenetic Footprinting Comparison" method, we will investigate the promoter sequence structures of three enzymes (PAL, CHS and DFR) that catalyze sequential steps in the pathway from phenylalanine to anthocyanins in plants. Our result shows there exists a putative cis-regulatory element "AC(C/G)TAC(C)" in the upstream of these enzyme genes. We propose this cis-regulatory element to be responsible for the genetic regulation of these three enzymes and this element, might also be the binding site for MYB class transcription factor PAP1. (b) We will investigate the role of the Arabidopsis gene glutamate receptor 1.1 (AtGLR1.1) in C and N metabolism by utilizing the microarray data we obtained from AtGLR1.1 deficient lines (antiAtGLR1.1). We focus our investigation on the putatively co-regulated transcript profile of 876 genes we have collected in antiAtGLR1.1 lines. By (a) scanning the occurrence of several groups of known abscisic acid (ABA) related cisregulatory elements in the upstream regions of 876 Arabidopsis genes; and (b) exhaustive scanning of all possible 6-10 bps motif occurrence in the upstream regions of the same set of genes, we are able to make a quantative estimation on the enrichment level of each of the cis-regulatory element candidates. We finally conclude that one specific cis-regulatory element group, called "ABRE" elements, are statistically highly enriched within the 876-gene group as compared to their occurrence within the genome. (c) We will introduce a new general purpose algorithm, called "fuzzy REDUCE1", which we have developed recently for automated cis-regulatory element identification. In the second part, we will discuss our newly devised protein design framework. With this framework we have developed a software package which is capable of designing novel protein structures at the atomic resolution. This software package allows us to perform protein structure design with a flexible backbone. The backbone flexibility includes loop region relaxation as well as a secondary structure collective mode relaxation scheme. (Abstract shortened by UMI.)

  2. Sedimentary structures formed under water surface waves: examples from a sediment-laden flash flood observed by remote camer

    NASA Astrophysics Data System (ADS)

    Froude, Melanie; Alexander, Jan; Cole, Paul; Barclay, Jenni

    2014-05-01

    On 13-14 October 2012, Tropical Storm Rafael triggered sediment-laden flash floods in the Belham Valley on Montserrat, West Indies. Rainfall was continuous for ~38 hours and intensity peaked at 48 mm/hr. Flow was strongly unsteady, turbulent with sediment concentrations varying up to hyperconcentrated. Time-lapse images captured at >1 frame per second by remote camera overlooking a surveyed valley section show the development of trains of water surface waves at multiple channel locations during different flow stages. Waves grew and diminished in height and remained stationary or migrated upstream. Trains of waves persisted for <5 minutes, until a single wave broke, sometimes initiating the breaking of adjacent waves within the train. Channel-wide surges (bores) propagating downstream with distinct turbulent flow fronts, were observed at irregular intervals during and up to 7 hours after peak stage. These bores are mechanically similar to breaking front tidal bores and arid flood bores, and resulted in a sudden increase in flow depth and velocity. When a bore front came into close proximity (within ~10 m) upstream of a train of water surface waves, the waves appeared to break simultaneously generating a localised surge of water upstream, that was covered by the bore travelling downstream. Those trains in which waves did not break during the passage of a bore temporarily reduced in height. In both cases, water surface waves reformed immediately after the surge in the same location. Deposits from the event, were examined in <4 m deep trenches ~0.5 km downstream of the remote camera. These contained laterally extensive lenticular and sheet-like units comprised of varying admixtures of sand and gravel that are attributed to antidunes, and associated transitions from upper-stage-plane-beds. Some of the structures are organised within concave upward sequences which contain downflow shifts between foreset and backset laminae; interpreted as trough fills from chute-and-pools or water surface wave breaking. At least 90% of the deposit is interpreted upper flow regime origin. The sequence, geometry and lamina-scale texture of the sedimentary structures will be discussed with reference to remote camera images of rapidly varying, unsteady and pulsatory flow behaviour.

  3. The immunoglobulin heavy chain locus of the duck. Genomic organization and expression of D, J, and C region genes.

    PubMed

    Lundqvist, M L; Middleton, D L; Hazard, S; Warr, G W

    2001-12-14

    The region of the duck IgH locus extending from upstream of the proximal diversity (D) segment to downstream of the constant gene cluster has been cloned and mapped. A sequence contig of 48,796 base pairs established that the organization of the genes is D-J(H)-mu-alpha-upsilon. No evidence for a functional homologue (or remnant) of a delta gene was found. The alpha gene is in inverted transcriptional orientation; class switch to IgA expression thus requires inversion of the approximately 27-kilobase pair region that includes both mu and alpha genes. The secreted forms of duck alpha and mu are each encoded by 4 constant region exons, and the hydrophobic C-terminal regions of the membrane receptor forms of alpha and mu are encoded by one and two transmembrane exons, respectively. Putative switch (S) regions were identified for duck mu and upsilon by comparison with chicken Smu and Supsilon sequences and for duck alpha by comparison with mouse Salpha. The duck IgH locus is rich in complex variable number tandem repeats, which occupy approximately 60% of the sequenced region, and occur at a much higher frequency in the IgH locus than in other sequenced regions of the duck genome.

  4. Friedelin Synthase from Maytenus ilicifolia: Leucine 482 Plays an Essential Role in the Production of the Most Rearranged Pentacyclic Triterpene

    PubMed Central

    Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; De Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.

    2016-01-01

    Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65–74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase. PMID:27874020

  5. Identification and characterization of mutant clones with enhanced propagation rates from phage-displayed peptide libraries.

    PubMed

    Nguyen, Kieu T H; Adamkiewicz, Marta A; Hebert, Lauren E; Zygiel, Emily M; Boyle, Holly R; Martone, Christina M; Meléndez-Ríos, Carola B; Noren, Karen A; Noren, Christopher J; Hall, Marilena Fitzsimons

    2014-10-01

    A target-unrelated peptide (TUP) can arise in phage display selection experiments as a result of a propagation advantage exhibited by the phage clone displaying the peptide. We previously characterized HAIYPRH, from the M13-based Ph.D.-7 phage display library, as a propagation-related TUP resulting from a G→A mutation in the Shine-Dalgarno sequence of gene II. This mutant was shown to propagate in Escherichia coli at a dramatically faster rate than phage bearing the wild-type Shine-Dalgarno sequence. We now report 27 additional fast-propagating clones displaying 24 different peptides and carrying 14 unique mutations. Most of these mutations are found either in or upstream of the gene II Shine-Dalgarno sequence, but still within the mRNA transcript of gene II. All 27 clones propagate at significantly higher rates than normal library phage, most within experimental error of wild-type M13 propagation, suggesting that mutations arise to compensate for the reduced virulence caused by the insertion of a lacZα cassette proximal to the replication origin of the phage used to construct the library. We also describe an efficient and convenient assay to diagnose propagation-related TUPS among peptide sequences selected by phage display. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Adaptation of the Haloarcula hispanica CRISPR-Cas system to a purified virus strictly requires a priming process

    PubMed Central

    Li, Ming; Wang, Rui; Zhao, Dahe; Xiang, Hua

    2014-01-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)-Cas system mediates adaptive immunity against foreign nucleic acids in prokaryotes. However, efficient adaptation of a native CRISPR to purified viruses has only been observed for the type II-A system from a Streptococcus thermophilus industry strain, and rarely reported for laboratory strains. Here, we provide a second native system showing efficient adaptation. Infected by a newly isolated virus HHPV-2, Haloarcula hispanica type I-B CRISPR system acquired spacers discriminatively from viral sequences. Unexpectedly, in addition to Cas1, Cas2 and Cas4, this process also requires Cas3 and at least partial Cascade proteins, which are involved in interference and/or CRISPR RNA maturation. Intriguingly, a preexisting spacer partially matching a viral sequence is also required, and spacer acquisition from upstream and downstream sequences of its target sequence (i.e. priming protospacer) shows different strand bias. These evidences strongly indicate that adaptation in this system strictly requires a priming process. This requirement, if validated also true for other CRISPR systems as implied by our bioinformatic analysis, may help to explain failures to observe efficient adaptation to purified viruses in many laboratory strains, and the discrimination mechanism at the adaptation level that has confused scientists for years. PMID:24265226

  7. An Archaeal Immune System Can Detect Multiple Protospacer Adjacent Motifs (PAMs) to Target Invader DNA*

    PubMed Central

    Fischer, Susan; Maier, Lisa-Katharina; Stoll, Britta; Brendel, Jutta; Fischer, Eike; Pfeiffer, Friedhelm; Dyall-Smith, Mike; Marchfelder, Anita

    2012-01-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated (Cas) system provides adaptive and heritable immunity against foreign genetic elements in most archaea and many bacteria. Although this system is widespread and diverse with many subtypes, only a few species have been investigated to elucidate the precise mechanisms for the defense of viruses or plasmids. Approximately 90% of all sequenced archaea encode CRISPR/Cas systems, but their molecular details have so far only been examined in three archaeal species: Sulfolobus solfataricus, Sulfolobus islandicus, and Pyrococcus furiosus. Here, we analyzed the CRISPR/Cas system of Haloferax volcanii using a plasmid-based invader assay. Haloferax encodes a type I-B CRISPR/Cas system with eight Cas proteins and three CRISPR loci for which the identity of protospacer adjacent motifs (PAMs) was unknown until now. We identified six different PAM sequences that are required upstream of the protospacer to permit target DNA recognition. This is only the second archaeon for which PAM sequences have been determined, and the first CRISPR group with such a high number of PAM sequences. Cells could survive the plasmid challenge if their CRISPR/Cas system was altered or defective, e.g. by deletion of the cas gene cassette. Experimental PAM data were supplemented with bioinformatics data on Haloferax and Haloquadratum. PMID:22767603

  8. Friedelin Synthase from Maytenus ilicifolia: Leucine 482 Plays an Essential Role in the Production of the Most Rearranged Pentacyclic Triterpene

    NASA Astrophysics Data System (ADS)

    Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.

    2016-11-01

    Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.

  9. The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element.

    PubMed Central

    Bäumlein, H; Wobus, U; Pustell, J; Kafatos, F C

    1986-01-01

    The field bean, Vicia faba L. var. minor, possesses two sub-families of 11 S legumin genes named A and B. We isolated from a genomic library a B-type gene (LeB4) and determined its primary DNA sequence. Gene LeB4 codes for a 484 amino acid residue prepropolypeptide, encompassing a signal peptide of 22 amino acid residues, an acidic, very hydrophilic alpha-chain of 281 residues and a basic, somewhat hydrophobic beta-chain of 181 residues. The latter two coding regions are immediately contiguous, but each is interrupted by a short intron. Type A legumin genes from soybean and pea are known to have introns in the same two positions, in addition to an extra intron (within the alpha-coding sequence). Sequence comparisons of legumin genes from these three plants revealed a highly conserved sequence element of at least 28 bp, centered at approximately 100 bp upstream of each cap site. The element is absent from the equivalent position of all non-legumin and other plant and fungal genes examined. We tentatively name this element "legumin box" and suggest that it may have a function in the regulation of legumin gene expression. PMID:3960730

  10. Massive programmed translational jumping in mitochondria

    PubMed Central

    Lang, B. Franz; Jakubkova, Michaela; Hegedusova, Eva; Daoud, Rachid; Forget, Lise; Brejova, Brona; Vinar, Tomas; Kosa, Peter; Fricova, Dominika; Nebohacova, Martina; Griac, Peter; Tomaska, Lubomir; Burger, Gertraud; Nosek, Jozef

    2014-01-01

    Programmed translational bypassing is a process whereby ribosomes “ignore” a substantial interval of mRNA sequence. Although discovered 25 y ago, the only experimentally confirmed example of this puzzling phenomenon is expression of the bacteriophage T4 gene 60. Bypassing requires translational blockage at a “takeoff codon” immediately upstream of a stop codon followed by a hairpin, which causes peptidyl-tRNA dissociation and reassociation with a matching “landing triplet” 50 nt downstream, where translation resumes. Here, we report 81 translational bypassing elements (byps) in mitochondria of the yeast Magnusiomyces capitatus and demonstrate in three cases, by transcript analysis and proteomics, that byps are retained in mitochondrial mRNAs but not translated. Although mitochondrial byps resemble the bypass sequence in the T4 gene 60, they utilize unused codons instead of stops for translational blockage and have relaxed matching rules for takeoff/landing sites. We detected byp-like sequences also in mtDNAs of several Saccharomycetales, indicating that byps are mobile genetic elements. These byp-like sequences lack bypassing activity and are tolerated when inserted in-frame in variable protein regions. We hypothesize that byp-like elements have the potential to contribute to evolutionary diversification of proteins by adding new domains that allow exploration of new structures and functions. PMID:24711422

  11. Energetic-ion acceleration and transport in the upstream region of Jupiter: Voyager 1 and 2

    NASA Technical Reports Server (NTRS)

    Baker, D. N.; Zwickl, R. D.; Carbary, J. F.; Krimigis, S. M.; Lepping, R. P.

    1982-01-01

    Long-lived upstream energetic ion events at Jupiter appear to be very similar in nearly all respects to upstream ion events at Earth. A notable difference between the two planetary systems is the enhanced heavy ion compositional signature reported for the Jovian events. This compositional feature has suggested that ions escaping from the Jovian magnetosphere play an important role in forming upstream ion populations at Jupiter. In contrast, models of energetic upstream ions at Earth emphasize in situ acceleration of reflected solar wind ions within the upstream region itself. Using Voyager 1 and 2 energetic ( approximately 30 keV) ion measurements near the magnetopause, in the magnetosheath, and immediately upstream of the bow shock, the compositional patterns are examined together with typical energy spectra in each of these regions. A model involving upstream Fermi acceleration early in events and emphasizing energetic particle escape in the prenoon part of the Jovian magnetosphere late in events is presented to explain many of the features in the upstream region of Jupiter.

  12. Hot Spots of Recombination in Fission Yeast: Inactivation of the M26 Hot Spot by Deletion of the Ade6 Promoter and the Novel Hotspot Ura4-Aim

    PubMed Central

    Zahn-Zabal, M.; Lehmann, E.; Kohli, J.

    1995-01-01

    The M26 mutation in the ade6 gene of Schizosaccharomyces pombe creates a hot spot of meiotic recombination. A single base substitution, the M26 mutation is situated within the open reading frame, near the 5' end. It has previously been shown that the heptanucleotide sequence 5' ATGACGT 3', which includes the M26 mutation, is required for hot spot activity. The 510-bp ade6-delXB deletion encompasses the promoter and the first 23 bp of the open reading frame, ending 112 bp upstream of M26. Deletion of the promoter in cis to M26 abolishes hot spot activity, while deletion in trans to M26 has no effect. Homozygous deletion of the promoter also eliminates M26 hot spot activity, indicating that the heterology created through deletion of the promoter per se is not responsible for the loss of hot spot activity. Thus, DNA sequences other than the heptanucleotide 5' ATGACGT 3', which must be located at the 5' end of the ade6 gene, appear to be required for hot spot activity. While the M26 hotspot stimulates crossovers associated with M26 conversion, it does not affect the crossover frequency in the intervals adjacent to ade6. The flanking marker ura4-aim, a heterology created by insertion of the ura4(+) gene upstream of ade6, turned out to be a hot spot itself. It shows disparity of conversion with preferential loss of the insertion. The frequency of conversion at ura4-aim is reduced when the M26 hot spot is active 15 kb away, indicating competition for recombination factors by hot spots in close proximity. PMID:7498729

  13. Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

    PubMed Central

    Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2017-01-01

    The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

  14. ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

    PubMed

    Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

    2008-07-01

    Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

  15. Homologous genetic recombination in the yellow head complex of nidoviruses infecting Penaeus monodon shrimp.

    PubMed

    Wijegoonawardane, Priyanjalie K M; Sittidilokratna, Nusra; Petchampai, Natthida; Cowley, Jeff A; Gudkovs, Nicholas; Walker, Peter J

    2009-07-20

    Yellow head virus (YHV) is a highly virulent pathogen of Penaeus monodon shrimp. It is one of six known genotypes in the yellow head complex of nidoviruses which also includes mildly pathogenic gill-associated virus (GAV, genotype 2) and four other genotypes (genotypes 3-6) that have been detected only in healthy shrimp. In this study, comparative phylogenetic analyses conducted on replicase- (ORF1b) and glycoprotein- (ORF3) gene amplicons identified 10 putative natural recombinants amongst 28 viruses representing all six genotypes from across the Indo-Pacific region. The approximately 4.6 kb genomic region spanning the two amplicons was sequenced for three putative recombinant viruses from Vietnam (genotype 3/5), the Philippines (genotype 5/2) and Indonesia (genotype 3/2). SimPlot analysis using these and representative parental virus sequences confirmed that each was a recombinant genotype and identified a recombination hotspot in a region just upstream of the ORF1b C-terminus. Maximum-likelihood breakpoint analysis predicted identical crossover positions in the Vietnamese and Indonesian recombinants, and a crossover position 12 nt upstream in the Philippine recombinant. Homologous genetic recombination in the same genome region was also demonstrated in recombinants generated experimentally in shrimp co-infected with YHV and GAV. The high frequency with which natural recombinants were identified indicates that genetic exchange amongst genotypes is occurring commonly in Asia and playing a significant role in expanding the genetic diversity in the yellow head complex. This is the first evidence of genetic recombination in viruses infecting crustaceans and has significant implications for the pathogenesis of infection and diagnosis of these newly emerging invertebrate pathogens.

  16. Genome-wide analysis of salinity-stress induced DNA methylation alterations in cotton (Gossypium hirsutum L.) using the Me-DIP sequencing technology.

    PubMed

    Lu, X K; Shu, N; Wang, J J; Chen, X G; Wang, D L; Wang, S; Fan, W L; Guo, X N; Guo, L X; Ye, W W

    2017-06-29

    Cytosine DNA methylation is a significant form of DNA modification closely associated with gene expression in eukaryotes, fungi, animals, and plants. Although the reference genomes of cotton (Gossypium hirsutum L.) have been publically available, the salinity-stress-induced DNA methylome alterations in cotton are not well understood. Here, we constructed a map of genome-wide DNA methylation characteristics of cotton leaves under salt stress using the methylated DNA immunoprecipitation sequencing method. The results showed that the methylation reads on chromosome 9 were most comparable with those on the other chromosomes, but the greatest changes occurred on chromosome 8 under salt stress. The DNA methylation pattern analysis indicated that a relatively higher methylation density was found in the upstream2k and downstream2k elements of the CDS region and CG-islands. Almost 94% of the reads belonged to LTR-gspsy and LTR-copia, and the number of methylation reads in LTR-gypsy was four times greater than that in LTR-copia in both control and stressed samples. The analysis of differentially methylated regions (DMRs) showed that the gene elements upstream2k, intron, and downstream2k were hypomethylated, but the CDS regions were hypermethylated. The GO (Gene Ontology) analysis suggested that the methylated genes were most enriched in cellular processes, metabolic processes, cell parts and catalytic activities, which might be closely correlated with response to NaCl stress. In this study, we completed a genomic DNA methylation profile and conducted a DMR analysis under salt stress, which provided valuable information for the better understanding of epigenetics in response to salt stress in cotton.

  17. Efficient activation of transcription in yeast by the BPV1 E2 protein.

    PubMed Central

    Stanway, C A; Sowden, M P; Wilson, L E; Kingsman, A J; Kingsman, S M

    1989-01-01

    The full-length gene product encoded by the E2 open reading frame (ORF) of bovine papillomavirus type 1 (BPV1) is a transcriptional transactivator. It is believed to mediate its effect on the BPV1 long control region (LCR) by binding to motifs with the consensus sequence ACCN6GGT. The minimal functional cis active site, called the E2 response element (E2RE), in mammalian cells comprises two copies of this motif. Here we have shown that E2 can function in Saccharomyces cerevisiae by placing an E2RE upstream of a synthetic yeast assay promoter which consists of a TATA motif and an mRNA initiation site, spaced correctly. This E2RE-minimal promoter is only transcriptionally active in the presence of E2 protein and the resulting mRNA is initiated at the authentic start site. This is the first report of a mammalian viral transactivator functioning in yeast. The level of activation by E2 via the E2RE was the same as observed with the highly efficient authentic PGK promoter where the upstream activation sequence is composed of three distinct elements. Furthermore a single E2 motif which is insufficient in mammalian cells as an activation site was as efficiently utilized in yeast as the E2RE (2 motifs). Previous studies have shown that mammalian cellular activators can function in yeast and our data now extend this to viral-specific activators. Our data indicate however that while the mechanism of transactivation is broadly conserved there may be significant differences at the detailed level. Images PMID:2539584

  18. Tissue specific expression of the retinoic acid receptor-beta 2: regulation by short open reading frames in the 5'-noncoding region

    PubMed Central

    1994-01-01

    The 40-S subunit of eukaryotic ribosomes binds to the capped 5'-end of mRNA and scans for the first AUG in a favorable sequence context to initiate translation. Most eukaryotic mRNAs therefore have a short 5'- untranslated region (5'-UTR) and no AUGs upstream of the translational start site; features that seem to assure efficient translation. However, approximately 5-10% of all eukaryotic mRNAs, particularly those encoding for regulatory proteins, have complex leader sequences that seem to compromise translational initiation. The retinoic-acid- receptor-beta 2 (RAR beta 2) mRNA is such a transcript with a long (461 nucleotides) 5'-UTR that contains five, partially overlapping, upstream open reading frames (uORFs) that precede the major ORF. We have begun to investigate the function of this complex 5'-UTR in transgenic mice, by introducing mutations in the start/stop codons of the uORFs in RAR beta 2-lacZ reporter constructs. When we compared the expression patterns of mutant and wild-type constructs we found that these mutations affected expression of the downstream RAR beta 2-ORF, resulting in an altered regulation of RAR beta 2-lacZ expression in heart and brain. Other tissues were unaffected. RNA analysis of adult tissues demonstrated that the uORFs act at the level of translation; adult brains and hearts of transgenic mice carrying a construct with either the wild-type or a mutant UTR, had the same levels of mRNA, but only the mutant produced protein. Our study outlines an unexpected role for uORFs: control of tissue-specific and developmentally regulated gene expression. PMID:7962071

  19. Sort-Seq Approach to Engineering a Formaldehyde-Inducible Promoter for Dynamically Regulated Escherichia coli Growth on Methanol

    PubMed Central

    2017-01-01

    Tight and tunable control of gene expression is a highly desirable goal in synthetic biology for constructing predictable gene circuits and achieving preferred phenotypes. Elucidating the sequence–function relationship of promoters is crucial for manipulating gene expression at the transcriptional level, particularly for inducible systems dependent on transcriptional regulators. Sort-seq methods employing fluorescence-activated cell sorting (FACS) and high-throughput sequencing allow for the quantitative analysis of sequence–function relationships in a robust and rapid way. Here we utilized a massively parallel sort-seq approach to analyze the formaldehyde-inducible Escherichia coli promoter (Pfrm) with single-nucleotide resolution. A library of mutated formaldehyde-inducible promoters was cloned upstream of gfp on a plasmid. The library was partitioned into bins via FACS on the basis of green fluorescent protein (GFP) expression level, and mutated promoters falling into each expression bin were identified with high-throughput sequencing. The resulting analysis identified two 19 base pair repressor binding sites, one upstream of the −35 RNA polymerase (RNAP) binding site and one overlapping with the −10 site, and assessed the relative importance of each position and base therein. Key mutations were identified for tuning expression levels and were used to engineer formaldehyde-inducible promoters with predictable activities. Engineered variants demonstrated up to 14-fold lower basal expression, 13-fold higher induced expression, and a 3.6-fold stronger response as indicated by relative dynamic range. Finally, an engineered formaldehyde-inducible promoter was employed to drive the expression of heterologous methanol assimilation genes and achieved increased biomass levels on methanol, a non-native substrate of E. coli. PMID:28463494

  20. Role of UME6 in transcriptional regulation of a DNA repair gene in Saccharomyces cerevisiae.

    PubMed

    Sweet, D H; Jang, Y K; Sancar, G B

    1997-11-01

    In Saccharomyces cerevisiae UV radiation and a variety of chemical DNA-damaging agents induce the transcription of specific genes, including several involved in DNA repair. One of the best characterized of these genes is PHR1, which encodes the apoenzyme for DNA photolyase. Basal-level and damage-induced expression of PHR1 require an upstream activation sequence, UAS(PHR1), which has homology with DRC elements found upstream of at least 19 other DNA repair and DNA metabolism genes in yeast. Here we report the identification of the UME6 gene of S. cerevisiae as a regulator of UAS(PHR1) activity. Multiple copies of UME6 stimulate expression from UAS(PHR1) and the intact PHR1 gene. Surprisingly, the effect of deletion of UME6 is growth phase dependent. In wild-type cells PHR1 is induced in late exponential phase, concomitant with the initiation of glycogen accumulation that precedes the diauxic shift. Deletion of UME6 abolishes this induction, decreases the steady-state concentration of photolyase molecules and PHR1 mRNA, and increases the UV sensitivity of a rad2 mutant. Despite the fact that UAS(PHR1) does not contain the URS1 sequence, which has been previously implicated in UME6-mediated transcriptional regulation, we find that Ume6p binds to UAS(PHR1) with an affinity and a specificity similar to those seen for a URS1 site. Similar binding is also seen for DRC elements from RAD2, RAD7, and RAD53, suggesting that UME6 contributes to the regulated expression of a subset of damage-responsive genes in yeast.

Top