Jain, Rohan; Peräniemi, Sirpa; Jordan, Norbert; Vogel, Manja; Weiss, Stephan; Foerstendorf, Harald; Lakaniemi, Aino-Maija
2018-05-24
This study demonstrated the removal and recovery of uranium(VI) in a fed-batch stirred tank reactor (STR) using waste digested activated sludge (WDAS). The batch adsorption experiments showed that WDAS can adsorb 200 (±9.0) mg of uranium(VI) per g of WDAS. The maximum adsorption of uranium(VI) was achieved even at an acidic initial pH of 2.7 which increased to a pH of 4.0 in the equilibrium state. Desorption of uranium(VI) from WDAS was successfully demonstrated from the release of more than 95% of uranium(VI) using both acidic (0.5 M HCl) and alkaline (1.0 M Na 2 CO 3 ) eluents. Due to the fast kinetics of uranium(VI) adsorption onto WDAS, the fed-batch STR was successfully operated at a mixing time of 15 min. Twelve consecutive uranium(VI) adsorption steps with an average adsorption efficiency of 91.5% required only two desorption steps to elute more than 95% of uranium(VI) from WDAS. Uranium(VI) was shown to interact predominantly with the phosphoryl and carboxyl groups of the WDAS, as revealed by in situ infrared spectroscopy and time-resolved laser-induced fluorescence spectroscopy studies. This study provides a proof-of-concept of the use of fed-batch STR process based on WDAS for the removal and recovery of uranium(VI). Copyright © 2018 Elsevier Ltd. All rights reserved.
Preparation of carbon coated Fe3O4 nanoparticles for magnetic separation of uranium
NASA Astrophysics Data System (ADS)
Zhang, Xiaofei; Wang, Jun
2018-01-01
Uranium(VI) was removed from aqueous solutions using carbon coated Fe3O4 nanoparticles (Fe3O4@C). Batch experiments were conducted to study the effects of initial pH, shaking time and temperature on uranium sorption efficiency. It was found that the maximum adsorption capacity of the Fe3O4@C toward uranium(VI) was ∼120.20 mg g-1 when the initial uranium(VI) concentration was 100 mg L-1, displaying a high efficiency for the removal of uranium(VI) ions. Kinetics of the uranium(VI) removal is found to follow pseudo-second-order rate equation. In addition, the uranium(VI)-loaded Fe3O4@C nanoparticles can be recovered easily from aqueous solution by magnetic separation and regenerated by acid treatment. Present study suggested that magnetic Fe3O4@C composite particles can be used as an effective and recyclable adsorbent for the removal of uranium(VI) from aqueous solutions.
Mechanisms of uranium interactions with hydroxyapatite: Implications for groundwater remediation
Fuller, C.C.; Bargar, J.R.; Davis, J.A.; Piana, M.J.
2002-01-01
The speciation of U(VI) sorbed to synthetic hydroxyapatite was investigated using a combination of U LIII-edge XAS, synchrotron XRD, batch uptake measurements, and SEM-EDS. The mechanisms of U(VI) removal by apatite were determined in order to evaluate the feasibility of apatitebased in-situ permeable reactive barriers (PRBs). In batch U(VI) uptake experiments with synthetic hydroxyapatite (HA), near complete removal of dissolved uranium (>99.5%) to <0.05 ??M was observed over a range of total U(VI) concentrations up to equimolar of the total P in the suspension. XRD and XAS analyses of U(VI)-reacted HA at sorbed concentrations ???4700 ppm U(VI) suggested that uranium(VI) phosphate, hydroxide, and carbonate solids were not present at these concentrations. Fits to EXAFS spectra indicate the presence of Ca neighbors at 3.81 A??. U-Ca separation, suggesting that U(VI) adsorbs to the HA surfaces as an inner-sphere complex. Uranium(VI) phosphate solid phases were not detected in HA with 4700 ppm sorbed U(VI) by backscatter SEM or EDS, in agreement with the surface complexation process. In contrast, U(VI) speciation in samples that exceeded 7000 ppm sorbed U(VI) included a crystalline uranium(VI) phosphate solid phase, identified as chernikovite by XRD. At these higher concentrations, a secondary, uranium(VI) phosphate solid was detected by SEM-EDS, consistent with chernikovite precipitation. Autunite formation occurred at total U:P molar ratios ???0.2. Our findings provide a basis for evaluating U(VI) sorption mechanisms by commercially available natural apatites for use in development of PRBs for groundwater U(VI) remediation.
Lysandrou, M; Pashalidis, I
2008-02-01
The effect of the matrix composition (main constituents) on the concentration and chemical behavior of uranium in phosphogypsum stack solutions and leachates has been investigated. Solid and aqueous samples were taken from three different sub-areas of a phosphogypsum stack at a coastal area in Vasilikos (Cyprus). The sub-areas are characterized whether by their acidity (e.g. "aged" and "non-aged" phosphogypsum) or by their salt content, originating from pulping water during wet stacking or (after deposition) from the adjacent sea. Measurements in stack solutions and leachates showed that phosphogypsum characteristics affect both, the concentration and the chemical behavior of uranium in solution. Uranium concentration in solutions of increased salinity is up to three orders of magnitude higher than in solutions of low salinity and this is attributed to the effect of ionic strength on the solubility of phosphogypsum. Modelling showed that uranium in stack solutions is predominantly present in the form of uranium(VI) phosphate complexes (e.g. UO(2)(H(2)PO(4))(2), UO(2)HPO(4)), whereas in leachates uranium(VI) fluoro complexes (e.g. UO(2)F(2), UO(2)F(3)(-)) are predominant in solution. The latter indicates that elution of uranium from phosphogypsum takes places most probably in the form of fluoro complexes. Both, effective elution by saline water and direct migration of uranium to the sea, where it forms very stable uranium(VI) carbonato complexes, indicate that the adjacent sea will be the final receptor of uranium released from Vasilikos phosphogypsum.
Solid phase extraction of uranium(VI) onto benzoylthiourea-anchored activated carbon.
Zhao, Yongsheng; Liu, Chunxia; Feng, Miao; Chen, Zhen; Li, Shuqiong; Tian, Gan; Wang, Li; Huang, Jingbo; Li, Shoujian
2010-04-15
A new solid phase extractant selective for uranium(VI) based on benzoylthiourea anchored to activated carbon was developed via hydroxylation, amidation and reaction with benzoyl isothiocyanate in sequence. Fourier transform infrared spectroscopy and total element analysis proved that benzoylthiourea had been successfully grafted to the surface of the activated carbon, with a loading capacity of 1.2 mmol benzoylthiourea per gram of activated carbon. The parameters that affect the uranium(VI) sorption, such as contact time, solution pH, initial uranium(VI) concentration, adsorbent dose and temperature, have been investigated. Results have been analyzed by Langmuir and Freundlich isotherm; the former was more suitable to describe the sorption process. The maximum sorption capacity (82 mg/g) for uranium(VI) was obtained at experimental conditions. The rate constant for the uranium sorption by the as-synthesized extractant was 0.441 min(-1) from the first order rate equation. Thermodynamic parameters (DeltaH(0)=-46.2 kJ/mol; DeltaS(0)=-98.0 J/mol K; DeltaG(0)=-17.5 kJ/mol) showed the adsorption of an exothermic process and spontaneous nature, respectively. Additional studies indicated that the benzoylthiourea-anchored activated carbon (BT-AC) selectively sorbed uranyl ions in the presence of competing ions, Na(+), Co(2+), Sr(2+), Cs(+) and La(3+). 2009 Elsevier B.V. All rights reserved.
The effect of calcium on aqueous uranium(VI) speciation and adsorption to ferrihydrite and quartz
Fox, P.M.; Davis, J.A.; Zachara, J.M.
2006-01-01
Recent studies of uranium(VI) geochemistry have focused on the potentially important role of the aqueous species, CaUO2 (CO3)32- and Ca2 UO2(CO3)30(aq), on inhibition of microbial reduction and uranium(VI) aqueous speciation in contaminated groundwater. However, to our knowledge, there have been no direct studies of the effects of these species on U(VI) adsorption by mineral phases. The sorption of U(VI) on quartz and ferrihydrite was investigated in NaNO3 solutions equilibrated with either ambient air (430 ppm CO2) or 2% CO2 in the presence of 0, 1.8, or 8.9 mM Ca2+. Under conditions where the Ca2UO2(CO3)30 (aq) species predominates U(VI) aqueous speciation, the presence of Ca in solution lowered U(VI) adsorption on quartz from 77% in the absence of Ca to 42% and 10% at Ca concentrations of 1.8 and 8.9 mM, respectively. U(VI) adsorption to ferrihydrite decreased from 83% in the absence of Ca to 57% in the presence of 1.8 mM Ca. Surface complexation model predictions that included the formation constant for aqueous Ca2UO2(CO3)30(aq) accurately simulated the effect of Ca2+ on U(VI) sorption onto quartz and ferrihydrite within the thermodynamic uncertainty of the stability constant value. This study confirms that Ca2+ can have a significant impact on the aqueous speciation of U(VI), and consequently, on the sorption and mobility of U(VI) in aquifers. ?? 2005 Elsevier Inc. All rights reserved.
Fermentation and Hydrogen Metabolism Affect Uranium Reduction by Clostridia
Gao, Weimin; Francis, Arokiasamy J.
2013-01-01
Previously, it has been shown that not only is uranium reduction under fermentation condition common among clostridia species, but also the strains differed in the extent of their capability and the pH of the culture significantly affected uranium(VI) reduction. In this study, using HPLC and GC techniques, metabolic properties of those clostridial strains active in uranium reduction under fermentation conditions have been characterized and their effects on capability variance of uranium reduction discussed. Then, the relationship between hydrogen metabolism and uranium reduction has been further explored and the important role played by hydrogenase in uranium(VI) and iron(III) reduction by clostridiamore » demonstrated. When hydrogen was provided as the headspace gas, uranium(VI) reduction occurred in the presence of whole cells of clostridia. This is in contrast to that of nitrogen as the headspace gas. Without clostridia cells, hydrogen alone could not result in uranium(VI) reduction. In alignment with this observation, it was also found that either copper(II) addition or iron depletion in the medium could compromise uranium reduction by clostridia. In the end, a comprehensive model was proposed to explain uranium reduction by clostridia and its relationship to the overall metabolism especially hydrogen (H 2 ) production.« less
Singh, Dhruv K; Mishra, Shraddha
2009-06-30
Ion-imprinted polymers (IIPs) were prepared for uranyl ion (imprint ion) by formation of binary (salicylaldoxime (SALO) or 4-vinylpyridine (VP)) or ternary (salicylaldoxime and 4-vinylpyridine) complex in 2-methoxy ethanol (porogen) following copolymerization with methacrylic acid (MAA) as a functional monomer and ethylene glycol dimethacrylate (EGDMA) as crosslinking monomer using 2,2'-azobisisobutyronitrile as initiator. Control polymers (CPs) were also prepared under identical experimental conditions without using imprint ion. The above synthesized polymers were characterized by surface area measurement, microanalysis and FT-IR analysis techniques. The imprinted polymer formed with ternary complex of UO(2)(2+)-SALO-VP (1:2:2, IIP3) showed quantitative enrichment of uranyl ion from dilute aqueous solution and hence was chosen for detailed studies. The optimal pH for quantitative enrichment is 3.5-6.5. The adsorbed UO(2)(2+) was completely eluted with 10 mL of 1.0 M HCl. The retention capacity of IIP3 was found to be 0.559 mmol g(-1). Further, the distribution ratio and selectivity coefficients of uranium and other selected inorganic ions were also evaluated. Five replicate determinations of 25 microg L(-1) of uranium(VI) gave a mean absorbance of 0.032 with a relative standard deviation of 2.20%. The detection limit corresponding to three times the standard deviation of the blank was found to be 5 microg L(-1). IIP3 was tested for preconcentration of uranium(VI) from ground, river and sea water samples.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tournassat, C.; Tinnacher, R. M.; Grangeon, S.
The prediction of U(VI) adsorption onto montmorillonite clay is confounded by the complexities of: (1) the montmorillonite structure in terms of adsorption sites on basal and edge surfaces, and the complex interactions between the electrical double layers at these surfaces, and (2) U(VI) solution speciation, which can include cationic, anionic and neutral species. Previous U(VI)-montmorillonite adsorption and modeling studies have typically expanded classical surface complexation modeling approaches, initially developed for simple oxides, to include both cation exchange and surface complexation reactions. However, previous models have not taken into account the unique characteristics of electrostatic surface potentials that occur at montmorillonitemore » edge sites, where the electrostatic surface potential of basal plane cation exchange sites influences the surface potential of neighboring edge sites (‘spillover’ effect).« less
Tournassat, C.; Tinnacher, R. M.; Grangeon, S.; ...
2017-10-06
The prediction of U(VI) adsorption onto montmorillonite clay is confounded by the complexities of: (1) the montmorillonite structure in terms of adsorption sites on basal and edge surfaces, and the complex interactions between the electrical double layers at these surfaces, and (2) U(VI) solution speciation, which can include cationic, anionic and neutral species. Previous U(VI)-montmorillonite adsorption and modeling studies have typically expanded classical surface complexation modeling approaches, initially developed for simple oxides, to include both cation exchange and surface complexation reactions. However, previous models have not taken into account the unique characteristics of electrostatic surface potentials that occur at montmorillonitemore » edge sites, where the electrostatic surface potential of basal plane cation exchange sites influences the surface potential of neighboring edge sites (‘spillover’ effect).« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Yingjie, E-mail: yzx@ansto.gov.au; Karatchevtseva, Inna; Bhadbhade, Mohan
With the coordination of dimethylformamide (DMF), two new uranium(VI) complexes with either 4-hydroxybenzoic acid (H{sub 2}phb) or terephthalic acid (H{sub 2}tph) have been synthesized under solvothermal conditions and structurally characterized. [(UO{sub 2}){sub 2}(Hphb){sub 2}(phb)(DMF)(H{sub 2}O){sub 3}]·4H{sub 2}O (1) has a dinuclear structure constructed with both pentagonal and hexagonal bipyramidal uranium polyhedra linked through a µ{sub 2}-bridging ligand via both chelating carboxylate arm and alcohol oxygen bonding, first observation of such a coordination mode of 4-hydroxybenzoate for 5 f ions. [(UO{sub 2})(tph)(DMF)] (2) has a three-dimensional (3D) framework built with pentagonal bipyramidal uranium polyhedra linked with µ{sub 4}-terephthalate ligands. The 3Dmore » channeled structure is facilitated by the unique carboxylate bonding with nearly linear C–O–U angles and the coordination of DMF molecules. The presence of phb ligands in different coordination modes, uranyl ions in diverse environments and DMF in complex 1, and tph ligand, DMF and uranyl ion in complex 2 has been confirmed by Raman spectroscopy. In addition, their thermal stability and photoluminescence properties have been investigated. - Graphical abstract: With the coordination of dimethylformamide, two new uranyl complexes with either 4-hydroxybenzoate or terephthalate have been synthesized under solvothermal conditions and structurally characterized. - Highlights: • Solvent facilitates the synthesis of two new uranium(VI) complexes. • A dinuclear complex with both penta- and hexagonal bipyramidal uranium polyhedral. • A unique µ{sub 2}-bridging mode of 4-hydroxybenzoate via alcohol oxygen for 5 f ions. • A 3D framework with uranium polyhedra and µ{sub 4}-terephthalate ligands. • Vibration modes and photoluminescence properties are reported.« less
Schlosser, Florian; Moskaleva, Lyudmila V; Kremleva, Alena; Krüger, Sven; Rösch, Notker
2010-06-28
With a relativistic all-electron density functional method, we studied two anionic uranium(VI) carbonate complexes that are important for uranium speciation and transport in aqueous medium, the mononuclear tris(carbonato) complex [UO(2)(CO(3))(3)](4-) and the trinuclear hexa(carbonato) complex [(UO(2))(3)(CO(3))(6)](6-). Focusing on the structures in solution, we applied for the first time a full solvation treatment to these complexes. We approximated short-range effects by explicit aqua ligands and described long-range electrostatic interactions via a polarizable continuum model. Structures and vibrational frequencies of "gas-phase" models with explicit aqua ligands agree best with experiment. This is accidental because the continuum model of the solvent to some extent overestimates the electrostatic interactions of these highly anionic systems with the bulk solvent. The calculated free energy change when three mono-nuclear complexes associate to the trinuclear complex, agrees well with experiment and supports the formation of the latter species upon acidification of a uranyl carbonate solution.
Wang, Zimeng; Lee, Sung-Woo; Catalano, Jeffrey G; Lezama-Pacheco, Juan S; Bargar, John R; Tebo, Bradley M; Giammar, Daniel E
2013-01-15
The mobility of hexavalent uranium in soil and groundwater is strongly governed by adsorption to mineral surfaces. As strong naturally occurring adsorbents, manganese oxides may significantly influence the fate and transport of uranium. Models for U(VI) adsorption over a broad range of chemical conditions can improve predictive capabilities for uranium transport in the subsurface. This study integrated batch experiments of U(VI) adsorption to synthetic and biogenic MnO(2), surface complexation modeling, ζ-potential analysis, and molecular-scale characterization of adsorbed U(VI) with extended X-ray absorption fine structure (EXAFS) spectroscopy. The surface complexation model included inner-sphere monodentate and bidentate surface complexes and a ternary uranyl-carbonato surface complex, which was consistent with the EXAFS analysis. The model could successfully simulate adsorption results over a broad range of pH and dissolved inorganic carbon concentrations. U(VI) adsorption to synthetic δ-MnO(2) appears to be stronger than to biogenic MnO(2), and the differences in adsorption affinity and capacity are not associated with any substantial difference in U(VI) coordination.
Spectrophotometric study of the thorium-morin mixed-color system
Fletcher, M.H.; Milkey, R.G.
1956-01-01
A spectrophotometric study was made of the thoriummorin reaction to evaluate the suitability of morin as a reagent for the determination of trace amounts of thorium. At pH 2, the equilibrium constant for the reaction is 1 ?? 106, and a single complex having a thorium-morin ratio of 1 to 2 is formed. The complex shows maximum absorbance at a wave length of 410 m??, and its absorbance obeys Beer's law. The absorbance readings are highly reproducible, and the sensitivity is relatively high, an absorbance difference of 0.001 being equivalent to 0.007 ?? of ThO2 per sq. cm. The effects of acid, alcohol, and morin concentration, time, temperature, and age of the morin reagent as well as the behavior of morin with zirconium(IV), iron(III), aluminum(III), ytterbium(III), yttrium(III), uranium(VI), praseodymium(III), lead(II), lanthanum(III), and calcium(II) ions are discussed. A method is presented for the determination of thorium in pure solutions. Appropriate separations for the isolation of thorium may extend the usefulness of the method and permit the determination of trace amounts of thorium in complex materials.
Yousefi, Seyed Reza; Ahmadi, Seyed Javad; Shemirani, Farzaneh; Jamali, Mohammad Reza; Salavati-Niasari, Masoud
2009-11-15
A new synthesized modified mesoporous silica (MCM-41) using 5-nitro-2-furaldehyde (fural) was applied as an effective sorbent for the solid phase extraction of uranium(VI) and thorium(IV) ions from aqueous solution for the measurement by inductively coupled plasma optical emission spectrometry (ICP OES). The influences of some analytical parameters on the quantitative recoveries of the analyte ions were investigated in batch method. Under optimal conditions, the analyte ions were sorbed by the sorbent at pH 5.5 and then eluted with 1.0 mL of 1.0 mol L(-1) HNO(3). The preconcentration factor was 100 for a 100mL sample volume. The limits of detection (LOD) obtained for uranium(VI) and thorium(IV) were 0.3 microg L(-1). The maximum sorption capacity of the modified MCM-41 was found to be 47 and 49 mg g(-1) for uranium(VI) and thorium(IV), respectively. The sorbent exhibited good stability, reusability, high adsorption capacity and fast rate of equilibrium for sorption/desorption of uranium and thorium ions. The applicability of the synthesized sorbent was examined using CRM and real water samples.
Uranium(VI) adsorption to ferrihydrite: Application of a surface complexation model
Waite, T.D.; Davis, J.A.; Payne, T.E.; Waychunas, G.A.; Xu, N.
1994-01-01
A study of U(VI) adsorption by ferrihydrite was conducted over a wide range of U(VI) concentrations, pH, and at two partial pressures of carbon dioxide. A two-site (strong- and weak-affinity sites, FesOH and FewOH, respectively) surface complexation model was able to describe the experimental data well over a wide range of conditions, with only one species formed with each site type: an inner-sphere, mononuclear, bidentate complex of the type (FeO2)UO2. The existence of such a surface species was supported by results of uranium EXAFS spectroscopy performed on two samples with U(VI) adsorption density in the upper range observed in this study (10 and 18% occupancy of total surface sites). Adsorption data in the alkaline pH range suggested the existence of a second surface species, modeled as a ternary surface complex with UO2CO30 binding to a bidentate surface site. Previous surface complexation models for U(VI) adsorption have proposed surface species that are identical to the predominant aqueous species, e.g., multinuclear hydrolysis complexes or several U(VI)-carbonate complexes. The results demonstrate that the speciation of adsorbed U(VI) may be constrained by the coordination environment at the surface, giving rise to surface speciation for U(VI) that is significantly less complex than aqueous speciation.
Characterization of complexes of nucleoside-5'-phosphorothioate analogues with zinc ions.
Sayer, Alon Haim; Itzhakov, Yehudit; Stern, Noa; Nadel, Yael; Fischer, Bilha
2013-10-07
On the basis of the high affinity of Zn(2+) to sulfur and imidazole, we targeted nucleotides such as GDP-β-S, ADP-β-S, and AP3(β-S)A, as potential biocompatible Zn(2+)-chelators. The thiophosphate moiety enhanced the stability of the Zn(2+)-nucleotide complex by about 0.7 log units. ATP-α,β-CH2-γ-S formed the most stable Zn(2+)-complex studied here, log K 6.50, being ~0.8 and ~1.1 log units more stable than ATP-γ-S-Zn(2+) and ATP-Zn(2+) complexes, and was the major species, 84%, under physiological pH. Guanine nucleotides Zn(2+) complexes were more stable by 0.3-0.4 log units than the corresponding adenine nucleotide complexes. Likewise, AP3(β-S)A-zinc complex was ~0.5 log units more stable than AP3A complex. (1)H- and (31)P NMR monitored Zn(2+) titration showed that Zn(2+) coordinates with the purine nucleotide N7-nitrogen atom, the terminal phosphate, and the adjacent phosphate. In conclusion, replacement of a terminal phosphate by a thiophosphate group resulted in decrease of the acidity of the phosphate moiety by approximately one log unit, and increase of stability of Zn(2+)-complexes of the latter analogues by up to 0.7 log units. A terminal phosphorothioate contributed more to the stability of nucleotide-Zn(2+) complexes than a bridging phosphorothioate.
PRECIPITATION OF ZIRCONIUM AND FLUORIDE IONS FROM SOLUTIONS
Newby, B.J.
1963-06-11
A process is given for removing zirconium and fluorine ions from aqueous solutions also containing uranium(VI). The precipitation is carried out with sodium formate, and the uranium remains in solution. (AEC)
Effect of uranium(VI) speciation on simultaneous microbial reduction of uranium(VI) and iron(III).
Stewart, Brandy D; Amos, Richard T; Fendorf, Scott
2011-01-01
Uranium is a pollutant of concern to both human and ecosystem health. Uranium's redox state often dictates whether it will reside in the aqueous or solid phase and thus plays an integral role in the mobility of uranium within the environment. In anaerobic environments, the more oxidized and mobile form of uranium (UO2(2+) and associated species) may be reduced, directly or indirectly, by microorganisms to U(IV) with subsequent precipitation of UO. However, various factors within soils and sediments, such as U(VI) speciation and the presence of competitive electron acceptors, may limit biological reduction of U(VI). Here we examine simultaneous dissimilatory reduction of Fe(III) and U(VI) in batch systems containing dissolved uranyl acetate and ferrihydrite-coated sand. Varying amounts of calcium were added to induce changes in aqueous U(VI) speciation. The amount of uranium removed from solution during 100 h of incubation with S. putrefaciens was 77% in absence of Ca or ferrihydrite, but only 24% (with ferrihydrite) and 14% (without ferrihydrite) were removed for systems with 0.8 mM Ca. Dissimilatory reduction of Fe(III) and U(VI) proceed through different enzyme pathways within one type of organism. We quantified the rate coefficients for simultaneous dissimilatory reduction of Fe(III) and U(VI) in systems varying in Ca concecentration (0-0.8 mM). The mathematical construct, implemented with the reactive transport code MIN3P, reveals predominant factors controlling rates and extent of uranium reduction in complex geochemical systems.
Shen, Yanghao; Zheng, Xinyan; Wang, Xiaoyu; Wang, Tieshan
2018-05-01
Microorganisms play a significant role in uranium(VI) biogeochemistry and influence U(VI) transformation through biomineralization. In the present work, the process of uranium mineralization was investigated by Saccharomyces cerevisiae. The toxicity experiments showed that the viability of cell was not significantly affected by 100 mg L -1 U(VI) under 4 days of exposure time. The batch experiments showed that the phosphate concentration and pH value increased over time during U(VI) adsorption. Meanwhile, thermodynamic calculations demonstrated that the adsorption system was supersaturated with respect to UO 2 HPO 4 . The X-ray powder diffraction spectroscopy (XRD), field emission scanning electron microscopy (FE-SEM) equipped with energy dispersive spectroscopy (EDX), Fourier transform infrared spectroscopy (FTIR), and X-ray photoelectron spectroscopy (XPS) analyses indicated that the U(VI) was first attached onto the cell surface and reacted with hydroxyl, carboxyl, and phosphate groups through electrostatic interactions and complexation. As the immobilization of U(VI) transformed it from the ionic to the amorphous state, lamellar uranium precipitate was formed on the cell surface. With the prolongation of time, the amorphous uranium compound disappeared, and there were some crystalline substances observed extracellularly, which were well-characterized as tetragonal-chernikovite. Furthermore, the size of chernikovite was regulated at nano-level by cells, and the perfect crystal was formed finally. These findings provided an understanding of the non-reductive transformation process of U(VI) from the amorphous to crystalline state within microbe systems, which would be beneficial for the U(VI) treatment and reuse of nuclides and heavy metals.
Uranium removal from a contaminated effluent using a combined microbial and nanoparticle system.
Baiget, Mar; Constantí, Magda; López, M Teresa; Medina, Francesc
2013-09-25
Reduction of soluble uranium(VI) to insoluble uranium(IV) for remediating a uranium-contaminated effluent (EF-03) was examined using a biotic and abiotic integrated system. Shewanella putrefaciens was first used and reduced U(VI) in a synthetic medium but not in the EF-03 effluent sample. Subsequently the growth of autochthonous microorganisms was stimulated with lactate. When lactate was supported on active carbon 77% U(VI) was removed in 4 days. Separately, iron nanoparticles that were 50 nm in diameter reduced U(VI) by 60% in 4 hours. The efficiency of uranium(VI) removal was improved to 96% in 30 min by using a system consisting of lactate and iron nanoparticles immobilized on active carbon. Lactate also stimulated the growth of potential uranium-reducing microorganisms in the EF-03 sample. This system can be efficiently used for the bioremediation of uranium-contaminated effluents. Copyright © 2013 Elsevier B.V. All rights reserved.
Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi
2010-11-19
Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.
XAS and TRLIF spectroscopy of uranium and neptunium in seawater.
Maloubier, Melody; Solari, Pier Lorenzo; Moisy, Philippe; Monfort, Marguerite; Den Auwer, Christophe; Moulin, Christophe
2015-03-28
Seawater contains radionuclides at environmental levels; some are naturally present and others come from anthropogenic nuclear activity. In this report, the molecular speciation in seawater of uranium(VI) and neptunium(V) at a concentration of 5 × 10(-5) M has been investigated for the first time using a combination of two spectroscopic techniques: Time-resolved laser-induced fluorescence (TRLIF) for U and extended X-ray absorption fine structure (EXAFS) for U and Np at the LIII edge. In parallel, the theoretical speciation of uranium and neptunium in seawater at the same concentration is also discussed and compared to spectroscopic data. The uranium complex was identified as the neutral carbonato calcic complex UO2(CO3)3Ca2, which has been previously described in other natural systems. In the case of neptunium, the complex identified is mainly a carbonato complex whose exact stoichiometry is more difficult to assess. The knowledge of the actinide molecular speciation and reactivity in seawater is of fundamental interest in the particular case of uranium recovery and more generally regarding the actinide life cycle within the biosphere in the case of accidental release. This is the first report of actinide direct speciation in seawater medium that can complement inventory data.
Isolation and characterization of a uranium(VI)-nitride triple bond
NASA Astrophysics Data System (ADS)
King, David M.; Tuna, Floriana; McInnes, Eric J. L.; McMaster, Jonathan; Lewis, William; Blake, Alexander J.; Liddle, Stephen T.
2013-06-01
The nature and extent of covalency in uranium bonding is still unclear compared with that of transition metals, and there is great interest in studying uranium-ligand multiple bonds. Although U=O and U=NR double bonds (where R is an alkyl group) are well-known analogues to transition-metal oxo and imido complexes, the uranium(VI)-nitride triple bond has long remained a synthetic target in actinide chemistry. Here, we report the preparation of a uranium(VI)-nitride triple bond. We highlight the importance of (1) ancillary ligand design, (2) employing mild redox reactions instead of harsh photochemical methods that decompose transiently formed uranium(VI) nitrides, (3) an electrostatically stabilizing sodium ion during nitride installation, (4) selecting the right sodium sequestering reagent, (5) inner versus outer sphere oxidation and (6) stability with respect to the uranium oxidation state. Computational analyses suggest covalent contributions to U≡N triple bonds that are surprisingly comparable to those of their group 6 transition-metal nitride counterparts.
Sorption of uranyl ions from various acido systems by amphoteric epoxy amine ion-exchange resins
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rychkov, V.N.; Radionov, B.K.; Molochnikov, L.S.
1995-03-01
Sorption of uranyl ions by epoxy amine ampholytes with N-monomethylenephosphonic acid groups modified with pyridine or quaternary ammonium groups was studied under dynamic conditions. Heterocyclic nitrogen favors sorption of uranyl ion from fluoride, sulfate, and fluoride-sulfate solutions. The ESR studies of mono- and bimetallic forms of nitrogen-containing ampholytes with copper(II) as paramagnetic marker revealed the characteristics of uranium(VI) interaction with cation- and anion-exchange groups and its dependence on the fluoride content in solution.
Approaches to surface complexation modeling of Uranium(VI) adsorption on aquifer sediments
NASA Astrophysics Data System (ADS)
Davis, James A.; Meece, David E.; Kohler, Matthias; Curtis, Gary P.
2004-09-01
Uranium(VI) adsorption onto aquifer sediments was studied in batch experiments as a function of pH and U(VI) and dissolved carbonate concentrations in artificial groundwater solutions. The sediments were collected from an alluvial aquifer at a location upgradient of contamination from a former uranium mill operation at Naturita, Colorado (USA). The ranges of aqueous chemical conditions used in the U(VI) adsorption experiments (pH 6.9 to 7.9; U(VI) concentration 2.5 · 10 -8 to 1 · 10 -5 M; partial pressure of carbon dioxide gas 0.05 to 6.8%) were based on the spatial variation in chemical conditions observed in 1999-2000 in the Naturita alluvial aquifer. The major minerals in the sediments were quartz, feldspars, and calcite, with minor amounts of magnetite and clay minerals. Quartz grains commonly exhibited coatings that were greater than 10 nm in thickness and composed of an illite-smectite clay with occluded ferrihydrite and goethite nanoparticles. Chemical extractions of quartz grains removed from the sediments were used to estimate the masses of iron and aluminum present in the coatings. Various surface complexation modeling approaches were compared in terms of the ability to describe the U(VI) experimental data and the data requirements for model application to the sediments. Published models for U(VI) adsorption on reference minerals were applied to predict U(VI) adsorption based on assumptions about the sediment surface composition and physical properties (e.g., surface area and electrical double layer). Predictions from these models were highly variable, with results overpredicting or underpredicting the experimental data, depending on the assumptions used to apply the model. Although the models for reference minerals are supported by detailed experimental studies (and in ideal cases, surface spectroscopy), the results suggest that errors are caused in applying the models directly to the sediments by uncertain knowledge of: 1) the proportion and types of surface functional groups available for adsorption in the surface coatings; 2) the electric field at the mineral-water interface; and 3) surface reactions of major ions in the aqueous phase, such as Ca 2+, Mg 2+, HCO 3-, SO 42-, H 4SiO 4, and organic acids. In contrast, a semi-empirical surface complexation modeling approach can be used to describe the U(VI) experimental data more precisely as a function of aqueous chemical conditions. This approach is useful as a tool to describe the variation in U(VI) retardation as a function of chemical conditions in field-scale reactive transport simulations, and the approach can be used at other field sites. However, the semi-empirical approach is limited by the site-specific nature of the model parameters.
Approaches to surface complexation modeling of Uranium(VI) adsorption on aquifer sediments
Davis, J.A.; Meece, D.E.; Kohler, M.; Curtis, G.P.
2004-01-01
Uranium(VI) adsorption onto aquifer sediments was studied in batch experiments as a function of pH and U(VI) and dissolved carbonate concentrations in artificial groundwater solutions. The sediments were collected from an alluvial aquifer at a location upgradient of contamination from a former uranium mill operation at Naturita, Colorado (USA). The ranges of aqueous chemical conditions used in the U(VI) adsorption experiments (pH 6.9 to 7.9; U(VI) concentration 2.5 ?? 10-8 to 1 ?? 10-5 M; partial pressure of carbon dioxide gas 0.05 to 6.8%) were based on the spatial variation in chemical conditions observed in 1999-2000 in the Naturita alluvial aquifer. The major minerals in the sediments were quartz, feldspars, and calcite, with minor amounts of magnetite and clay minerals. Quartz grains commonly exhibited coatings that were greater than 10 nm in thickness and composed of an illite-smectite clay with occluded ferrihydrite and goethite nanoparticles. Chemical extractions of quartz grains removed from the sediments were used to estimate the masses of iron and aluminum present in the coatings. Various surface complexation modeling approaches were compared in terms of the ability to describe the U(VI) experimental data and the data requirements for model application to the sediments. Published models for U(VI) adsorption on reference minerals were applied to predict U(VI) adsorption based on assumptions about the sediment surface composition and physical properties (e.g., surface area and electrical double layer). Predictions from these models were highly variable, with results overpredicting or underpredicting the experimental data, depending on the assumptions used to apply the model. Although the models for reference minerals are supported by detailed experimental studies (and in ideal cases, surface spectroscopy), the results suggest that errors are caused in applying the models directly to the sediments by uncertain knowledge of: 1) the proportion and types of surface functional groups available for adsorption in the surface coatings; 2) the electric field at the mineral-water interface; and 3) surface reactions of major ions in the aqueous phase, such as Ca2+, Mg2+, HCO3-, SO42-, H4SiO4, and organic acids. In contrast, a semi-empirical surface complexation modeling approach can be used to describe the U(VI) experimental data more precisely as a function of aqueous chemical conditions. This approach is useful as a tool to describe the variation in U(VI) retardation as a function of chemical conditions in field-scale reactive transport simulations, and the approach can be used at other field sites. However, the semi-empirical approach is limited by the site-specific nature of the model parameters. ?? 2004 Elsevier Ltd.
Complexation of uranium(VI) with glutarimidoxioxime: thermodynamic and computational studies.
Endrizzi, Francesco; Melchior, Andrea; Tolazzi, Marilena; Rao, Linfeng
2015-08-21
The complex formation between a cyclic ligand glutarimidoxioxime (denoted as HL(III) in this paper) and UO2(2+) is studied by potentiometry and microcalorimetry. Glutarimidoxioxime (HL(III)), together with glutarimidedioxime (H2L(I)) and glutardiamidoxime (H2L(II)), belongs to a family of amidoxime derivatives with prospective applications as binding agents for the recovery of uranium from seawater. An optimized procedure of synthesis that leads to the preparation of glutarimidoxioxime in the absence of other amidoxime byproducts is described in this paper. Speciation models based on the thermodynamic results from this study indicate that, compared with H2L(I) and H2L(II), HL(III) forms a much weaker complex with UO2(2+), UO2(L(III))(+), and cannot effectively compete with the hydrolysis equilibria of UO2(2+) under neutral or alkaline conditions. DFT computations, taking into account the solvation by including discrete hydration water molecules and bulk solvent effects, were performed to evaluate the structures and energies of the possible isomers of UO2(L(III))(+). Differing from the tridentate or η(2)-coordination modes previously found in the U(vi) complexes with amidoxime-related ligands, a bidentate mode, involving the oxygen of the oxime group and the nitrogen of the imino group, is found to be the most probable mode in UO2(L(III))(+). The bidentate coordination mode seems to be stabilized by the formation of a hydrogen bond between the carbonyl group of HL(III) and a water molecule in the hydration sphere of UO2(2+).
Kachhap, Sangita; Singh, Balvinder
2015-01-01
In most of homeodomain-DNA complexes, glutamine or lysine is present at 50th position and interacts with 5th and 6th nucleotide of core recognition region. Molecular dynamics simulations of Msx-1-DNA complex (Q50-TG) and its variant complexes, that is specific (Q50K-CC), nonspecific (Q50-CC) having mutation in DNA and (Q50K-TG) in protein, have been carried out. Analysis of protein-DNA interactions and structure of DNA in specific and nonspecific complexes show that amino acid residues use sequence-dependent shape of DNA to interact. The binding free energies of all four complexes were analysed to define role of amino acid residue at 50th position in terms of binding strength considering the variation in DNA on stability of protein-DNA complexes. The order of stability of protein-DNA complexes shows that specific complexes are more stable than nonspecific ones. Decomposition analysis shows that N-terminal amino acid residues have been found to contribute maximally in binding free energy of protein-DNA complexes. Among specific protein-DNA complexes, K50 contributes more as compared to Q50 towards binding free energy in respective complexes. The sequence dependence of local conformation of DNA enables Q50/Q50K to make hydrogen bond with nucleotide(s) of DNA. The changes in amino acid sequence of protein are accommodated and stabilized around TAAT core region of DNA having variation in nucleotides.
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
[Positioning of mRNA 3' of the a site bound codon on the human 80S ribosome].
Molotkov, M V; Graĭfer, D M; Demeshkina, N A; Repkova, M N; Ven'iaminova, A G; Karpova, G G
2005-01-01
Short mRNA analogues carrying a UUU triplet at the 5'-termini and a perfluorophenylazide group at either the N7 atom of the guanosine or the C5 atom of the uridine 3' of the triplet were applied to study positioning of mRNA 3' of the A site codon. Complexes of 80S ribosomes with the mRNA analogues were obtained in the presence of tRNAPhe that directed UUU codon to the P site and consequently provided placement of the nucleotide with cross-linker in positions +9 or +12 with respect to the first nucleotide of the P site bound codon. Both types mRNA analogues cross-linked to the 18S rRNA and 40S proteins under mild UV-irradiation. Cross-linking patterns in the complexes where modified nucleotides of the mRNA analogues were in position +7 were analyzed for comparison (cross-linking to the 18S rRNA in such complexes has been studied previously). The efficiency of cross-linking to the ribosomal components depended on the nature of the modified nucleotide in the mRNA analogue and its position on the ribosome, extent of cross-linking to the 18S rRNA being decreased drastically when the modified nucleotide was moved from position +7 to position +12. The nucleotides of 18S rRNA cross-linked to mRNA analogues were determined. Modified nucleotides in positions +9 and +12 cross-linked to the invariant dinucleotide A1824/A1825 and to variable A1823 in the 3'-minidomain of 18S rRNA as well as to protein S15. The same ribosomal components have been found earlier to cross-link to modified mRNA nucleotides in positions from +4 to +7. Besides, all mRNA analogues cross-linked to the invariant nucleotide c1698 in the 3'-minidomain and to and the conserved region 605-620 closing helix 18 in the 5'-domain.
Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.
Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E
2016-11-18
Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.
Gasowska, A
2005-08-01
The interactions between pyrimidine nucleotides: cytidine-5'-diphosphate (CDP) and cytidine-5'-triphosphate (CTP) and Cu(II) ions, spermine (Spm) and 1,11-diamino-4,8-diazaundecane (3,3,3-tet) have been studied. The composition and stability constants of the complexes formed have been determined by means of the potentiometric method, while the centres of interactions in the ligands have been identified by the spectral methods (UV-Vis, Ultraviolet and Visible spectroscopy; EPR, electron spin resonance; NMR). In the systems without metal, formation of the molecular complexes nucleotide-polyamine with the interaction centres at the endocyclic nitrogen atom of purine ring N3, the oxygen atoms of the phosphate group from the nucleotide and protonated nitrogen atoms of the polyamine have been detected. Significant differences have been found in the metallation between the systems with Spm and with 3,3,3-tet. In the systems with spermine, mainly protonated species are formed with the phosphate group of the nucleotide and deprotonated nitrogen atoms of the polyamine making the coordination centres, while the donor nitrogen atom of the nucleotide N3 is involved in the intramolecular interligand interactions, additionally stabilising the complex. In the systems with 3,3,3-tet, the MLL' type species are formed in which the oxygen atoms of the phosphate group and nitrogen atoms of the polyamine are involved in metallation, whereas the N3 atom from the pyrimidine ring of the nucleotide is located outside the inner coordination sphere of copper ion. The main centre of Cu(II) interaction in the nucleotide, both in the system with Spm and 3,3,3-tet is the phosphate group of the nucleotide.
Bauer, Anne; Jäschke, Astrid; Schöne, Sebastian; Barthen, Robert; März, Juliane; Patzschke, Michael; Kersting, Berthold; Fahmy, Karim; Oertel, Jana; Brendler, Vinzenz; Stumpf, Thorsten
2018-01-01
Abstract The environmental aspects of ore processing and waste treatment call for an optimization of applied technologies. There, understanding of the structure and complexation mechanism on a molecular scale is indispensable. Here, the complexation of UVI with a calix[4]arene‐based 8‐hydroxyquinoline ligand was investigated by applying a wide range of complementary methods. In solution, the formation of two complex species was proven with stability constants of log ß 1:1=5.94±0.02 and log ß 2:1=6.33±0.01, respectively. The formation of the 1:1 complex was found to be enthalpy driven [ΔH 1:1=(−71.5±10.0) kJ mol−1; TΔS 1:1=(−37.57±10.0) kJ mol−1], whereas the second complexation step was found to be endothermic and entropy driven [ΔH 2:1=(32.8±4.0) kJ mol−1; TΔS 2:1=(68.97±4.0) kJ mol−1]. Moreover, the molecular structure of [UO2(H6L)(NO3)](NO3) (1) was determined by single‐crystal X‐ray diffraction. Concluding, radiotoxic UVI was separated from a EuIII‐containing solution by the calix[4]arene‐based ligand in solvent extractions. PMID:29930893
Misra, S N; Anjaiah, K; Joseph, G; Abdi, S H
1992-02-01
The interactions of praseodymium(III) and neodymium(III) with nucleosides and nucleotides have been studied in different stoichiometry in water and water-DMF mixtures by employing absorption difference and comparative absorption spectrophotometry. The 4f-4f bands were analysed by linear curve analysis followed by gaussian curve analysis, and various spectral parameters were computed, using partial and multiple regression method. The magnitude of changes in both energy interaction and intensity were used to explore the degree of outer and inner sphere coordination, incidence of covalency and the extent of metal 4f-orbital involvement in chemical bonding. Crystalline complexes of the type [Ln(nucleotide)2(H2O)2]- (where nucleotide--GMP or IMP) were characterized by IR, 1H NMR, 31P NMR data. These studies indicated that the binding of the nucleotide is through phosphate oxygen in a bidentate manner and the complexes undergo substantial ionisation in aqueous medium, thereby supporting the observed weak 4f-4f bands and lower values for nephelauxetic effect (1-beta), bonding (b) and covalency (delta) parameters derived from coulombic and spin orbit interaction parameters.
Rouhana, Jad; Padilla, André; Estaran, Sébastien; Bakari, Sana; Delbecq, Stephan; Boublik, Yvan; Chopineau, Joel; Pugnière, Martine; Chavanieu, Alain
2013-01-01
The GDP/GTP nucleotide exchange of Arf1 is catalyzed by nucleotide exchange factors (GEF), such as Arno, which act through their catalytic Sec7 domain. This exchange is a complex mechanism that undergoes conformational changes and intermediate complex species involving several allosteric partners such as nucleotides, Mg2+, and Sec7 domains. Using a surface plasmon resonance approach, we characterized the kinetic binding parameters for various intermediate complexes. We first confirmed that both GDP and GTP counteract equivalently to the free-nucleotide binary Arf1-Arno complex stability and revealed that Mg2+ potentiates by a factor of 2 the allosteric effect of GDP. Then we explored the uncompetitive inhibitory mechanism of brefeldin A (BFA) that conducts to an abortive pentameric Arf1-Mg2+-GDP-BFA-Sec7 complex. With BFA, the association rate of the abortive complex is drastically reduced by a factor of 42, and by contrast, the 15-fold decrease of the dissociation rate concurs to stabilize the pentameric complex. These specific kinetic signatures have allowed distinguishing the level and nature as well as the fate in real time of formed complexes according to experimental conditions. Thus, we showed that in the presence of GDP, the BFA-resistant Sec7 domain of Arno can also associate to form a pentameric complex, which suggests that the uncompetitive inhibition by BFA and the nucleotide allosteric effect combine to stabilize such abortive complex. PMID:23255605
Database of amino acid-nucleotide contacts in contacts in DNA-homeodomain protein
NASA Astrophysics Data System (ADS)
Grokhlina, T. I.; Zrelov, P. V.; Ivanov, V. V.; Polozov, R. V.; Chirgadze, Yu. N.; Sivozhelezov, V. S.
2013-09-01
The analysis of amino acid-nucleotide contacts in interfaces of the protein-DNA complexes, intended to find consistencies in the protein-DNA recognition, is a complex problem that requires an analysis of the physicochemical characteristics of these contacts and the positions of the participating amino acids and nucleotides in the chains of the protein and the DNA, respectively, as well as conservatism of these contacts. Thus, those heterogeneous data should be systematized. For this purpose we have developed a database of amino acid-nucleotide contacts ANTPC (Amino acid Nucleotide Type Position Conservation) following the archetypal example of the proteins in the homeodomain family. We show that it can be used to compare and classify the interfaces of the protein-DNA complexes.
Interaction between macrocyclic nickel complexes and the nucleotides GMP, AMP and ApG.
Liu, Yangzhong; Sletten, Einar
2003-01-15
Reactions between the nucleotides GMP, AMP and ApG and the complexes Ni(tren), Ni(cyclam) and NiCR in aqueous solution have been monitored by (1)H, (15)N NMR and UV spectroscopy. The three nickel complexes display different properties in reactions with nucleotides. Ni(tren) which has a pseudo-octahedral coordination geometry was shown to bind to all three nucleotides. Ni(cyclam) and NiCR, both with four nitrogen atoms in a square planar arrangement are not able to bind to nucleotides efficiently because of steric hindrance. Oxidation of Ni(cyclam) by KHSO(5) to produce trivalent Ni(III)(cyclam) improves the coordination capacity, while oxidation of NiCR does not produce a similar effect. The nucleotides interact with trivalent nickel complexes to different extent. Ni(III)CR is seen to oxidize GMP gradually but does not affect AMP significantly. Ni(III)(cyclam), on the other hand, does not oxidize either GMP or AMP at the 1:1 concentration of oxidant used. This result is probably due to the lower redox potential of Ni(cyclam). ApG binds less efficiently to the Ni complexes but is easier oxidized than the mononucleotides.
Herrmann, Andrea; Tillmann, Britta A M; Schürmann, Janine; Bölker, Michael; Tudzynski, Paul
2014-04-01
Monomeric GTPases of the Rho subfamily are important mediators of polar growth and NADPH (Nox) signaling in a variety of organisms. These pathways influence the ability of Claviceps purpurea to infect host plants. GTPase regulators contribute to the nucleotide loading cycle that is essential for proper functionality of the GTPases. Scaffold proteins gather GTPase complexes to facilitate proper function. The guanine nucleotide exchange factors (GEFs) CpCdc24 and CpDock180 activate GTPase signaling by triggering nucleotide exchange of the GTPases. Here we show that CpCdc24 harbors nucleotide exchange activity for both Rac and Cdc42 homologues. The GEFs partly share the cellular distribution of the GTPases and interact with the putative upstream GTPase CpRas1. Interaction studies show the formation of higher-order protein complexes, mediated by the scaffold protein CpBem1. Besides the GTPases and GEFs, these complexes also contain the GTPase effectors CpSte20 and CpCla4, as well as the regulatory protein CpNoxR. Functional characterizations suggest a role of CpCdc24 mainly in polarity, whereas CpDock180 is involved in stress tolerance mechanisms. These findings indicate the dynamic formation of small GTPase complexes and improve the model for GTPase-associated signaling in C. purpurea.
NASA Astrophysics Data System (ADS)
Wang, Qing; Cheng, Tao; Wu, Yang
2014-12-01
Mineral colloids and humic substances often co-exist in subsurface environment and substantially influence uranium (U) transport. However, the combined effects of mineral colloids and humic substances on U transport are not clear. This study is aimed at quantifying U transport and elucidating geochemical processes that control U transport when both mineral colloids and humic acid (HA) are present. U-spiked solutions/suspensions were injected into water-saturated sand columns, and U and colloid concentrations in column effluent were monitored. We found that HA promoted U transport via (i) formation of aqueous U-HA complexes, and (ii) competition against aqueous U for surface sites on transport media. Illite colloids had no influence on U transport at pH 5 in the absence of HA due to low mobility of the colloids. At pH 9, U desorbed from mobile illite and the presence of illite decreased U transport. At pH 5, high U transport occurred when both illite colloids and HA were present, which was attributed to enhanced U adsorption to illite colloids via formation of ternary illite-HA-U surface complexes, and enhanced illite transport due to HA attachment to illite and transport media. This study demonstrates that the combined effects of mineral colloids and HA on contaminant transport is different from simple addition of the individual effect.
Analysis of single nucleotide polymorphisms in case-control studies.
Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer
2011-01-01
Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.
NASA Technical Reports Server (NTRS)
Orenberg, J. B.; Kjos, K. M.; Winkler, R.; Link, J.; Lawless, J. G.
1982-01-01
The interactions of Ni(II) cation with a representative suite of purine bases and the respective nucleosides and nucleotides have been studied by ultraviolet difference spectroscopy. Apparent association constants were determined for each system at pH 7.0, using computer linear regression coupled with an iteration technique. The specificity of binding of Ni(2+) for the purine nucleotides studied at pH 7.0 was 5-prime-GMP greater than 5-prime-AMP; a similar ordering was also found for the respective nucleosides and bases. In this study binding was not observed for the suite of pyramidines used, although an Ni(2+) -cytidine complex has been observed (Fiskin and Beer, 1965). It was also found that Ni(2+) bound more strongly to the purine 5-prime-nucleotides than to the respective nucleosides and bases. These trends are explained in terms of metal-ligand bonds and available bonding positions on the ligands. A role for metal-ion-nucleotide types of complexes is suggested in the processes that might have given rise to the origin of life.
Abiogenic synthesis of nucleotides on the surface of small space bodies with high energy particles
NASA Astrophysics Data System (ADS)
Simakov, M. B.; Kuzicheva, E. A.; Antropov, A. E.; Dodonova, N. Ya
Abiotic formation of such complex biochemical compounds as nucleotides and oligopeptides on the surface of interstellar and interplanetary dust particles (IDP) by cosmic radiation was examined. In order to study the formation of organic compounds on IDPs, solid films prepared from nucleososide and inorganic phosphate were irradiated with high energy protons. Irradiated products were analyzed with HPLC. The natural nucleotides were detected. The main products were 5' AMP (3.2%) and 2'3' cAMP (2.7%). The results were compared with others experiments on the action of ultraviolet radiation with different wavelengths, γ-radiation and heat on solid mixtures of biologically significant compounds. The experiment on abiogenic synthesis of nucleotides on board of space satellite "BION-11" was compared also. The present results suggest that a considerable amount of complex biochemical compounds formed in extraterrestrial environments could have been supplied to the primitive earth before the origin of life.
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
Uranium(VI) interactions with mackinawite in the presence and absence of bicarbonate and oxygen.
Gallegos, Tanya J; Fuller, Christopher C; Webb, Samuel M; Betterton, William
2013-07-02
Mackinawite, Fe(II)S, samples loaded with uranium (10(-5), 10(-4), and 10(-3) mol U/g FeS) at pH 5, 7, and 9, were characterized using X-ray absorption spectroscopy and X-ray diffraction to determine the effects of pH, bicarbonate, and oxidation on uptake. Under anoxic conditions, a 5 g/L suspension of mackinawite lowered 5 × 10(-5) M uranium(VI) to below 30 ppb (1.26 × 10(-7) M) U. Between 82 and 88% of the uranium removed from solution by mackinawite was U(IV) and was nearly completely reduced to U(IV) when 0.012 M bicarbonate was added. Near-neighbor coordination consisting of uranium-oxygen and uranium-uranium distances indicates the formation of uraninite in the presence and absence of bicarbonate, suggesting reductive precipitation as the dominant removal mechanism. Following equilibration in air, mackinawite was oxidized to mainly goethite and sulfur and about 76% of U(IV) was reoxidized to U(VI) with coordination of uranium to axial and equatorial oxygen, similar to uranyl. Additionally, uranium-iron distances, typical of coprecipitation of uranium with iron oxides, and uranium-sulfur distances indicating bidentate coordination of U(VI) to sulfate were evident. The affinity of mackinawite and its oxidation products for U(VI) provides impetus for further study of mackinawite as a potential reactive medium for remediation of uranium-contaminated water.
Uranium(VI) interactions with mackinawite in the presence and absence of bicarbonate and oxygen
Gallegos, Tanya J.; Fuller, Christopher C.; Webb, Samuel M.; Betterton, William J.
2013-01-01
Mackinawite, Fe(II)S, samples loaded with uranium (10-5, 10-4, and 10-3 mol U/g FeS) at pH 5, 7, and 9, were characterized using X-ray absorption spectroscopy and X-ray diffraction to determine the effects of pH, bicarbonate, and oxidation on uptake. Under anoxic conditions, a 5 g/L suspension of mackinawite lowered 5 × 10-5 M uranium(VI) to below 30 ppb (1.26 × 10-7 M) U. Between 82 and 88% of the uranium removed from solution by mackinawite was U(IV) and was nearly completely reduced to U(IV) when 0.012 M bicarbonate was added. Near-neighbor coordination consisting of uranium–oxygen and uranium-uranium distances indicates the formation of uraninite in the presence and absence of bicarbonate, suggesting reductive precipitation as the dominant removal mechanism. Following equilibration in air, mackinawite was oxidized to mainly goethite and sulfur and about 76% of U(IV) was reoxidized to U(VI) with coordination of uranium to axial and equatorial oxygen, similar to uranyl. Additionally, uranium-iron distances, typical of coprecipitation of uranium with iron oxides, and uranium-sulfur distances indicating bidentate coordination of U(VI) to sulfate were evident. The affinity of mackinawite and its oxidation products for U(VI) provides impetus for further study of mackinawite as a potential reactive medium for remediation of uranium-contaminated water.
Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.
2016-01-01
The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325
Lee, Jun-Yeop; Yun, Jong-Il
2013-07-21
The chemical behavior of ternary Ca-UO2-CO3 complexes was investigated by using time-resolved laser fluorescence spectroscopy (TRLFS) in combination with EDTA complexation at pH 7-9. A novel TRLFS revealed two distinct fluorescence lifetimes of 12.7 ± 0.2 ns and 29.2 ± 0.4 ns for uranyl complexes which were formed increasingly dependent upon the calcium ion concentration, even though nearly indistinguishable fluorescence peak shapes and positions were measured for both Ca-UO2-CO3 complexes. For identifying the stoichiometric number of complexed calcium ions, slope analysis in terms of relative fluorescence intensity versus calcium concentration was employed in a combination with the complexation reaction of CaEDTA(2-) by adding EDTA. The formation of CaUO2(CO3)3(2-) and Ca2UO2(CO3)3(aq) was identified under given conditions and their formation constants were determined at I = 0.1 M Na/HClO4 medium, and extrapolated to infinitely dilute solution using specific ion interaction theory (SIT). As a result, the formation constants for CaUO2(CO3)3(2-) and Ca2UO2(CO3)3(aq) were found to be log β113(0) = 27.27 ± 0.14 and log β213(0) = 29.81 ± 0.19, respectively, providing that the ternary Ca-UO2-CO3 complexes were predominant uranium(vi) species at neutral to weakly alkaline pH in the presence of Ca(2+) and CO3(2-) ions.
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
Vuković, Lela; Chipot, Christophe; Makino, Debora L; Conti, Elena; Schulten, Klaus
2016-03-30
Recent experimental studies revealed structural details of 3' to 5' degradation of RNA molecules, performed by the exosome complex. ssRNA is channeled through its multisubunit ring-like core into the active site tunnel of its key exonuclease subunit Rrp44, which acts both as an enzyme and a motor. Even in isolation, Rrp44 can pull and sequentially cleave RNA nucleotides, one at a time, without any external energy input and release a final 3-5 nucleotide long product. Using molecular dynamics simulations, we identify the main factors that control these processes. Our free energy calculations reveal that RNA transfer from solution into the active site of Rrp44 is highly favorable, but dependent on the length of the RNA strand. While RNA strands formed by 5 nucleotides or more correspond to a decreasing free energy along the translocation coordinate toward the cleavage site, a 4-nucleotide RNA experiences a free energy barrier along the same direction, potentially leading to incomplete cleavage of ssRNA and the release of short (3-5) nucleotide products. We provide new insight into how Rrp44 catalyzes a localized enzymatic reaction and performs an action distributed over several RNA nucleotides, leading eventually to the translocation of whole RNA segments into the position suitable for cleavage.
Lomozik, L; Gasowska, A; Krzysko, G
2006-11-01
The interactions of Cu(II) ions with adenosine-5'-monophosphate (AMP), cytidine-5'-monophosphate (CMP) and 1,12-diamino-4,9-dioxadodecane (OSpm) were studied. A potentiometric method was applied to determine the composition and stability constants of complexes formed, while the mode of interactions was analysed by spectral methods (ultraviolet and visible spectroscopy (UV-Vis), electron paramagnetic resonance (EPR), (13)C NMR, (31)P NMR). In metal-free systems, molecular complexes nucleotide-polyamine (NMP)H(x)(OSpm) were formed. The endocyclic nitrogen atoms of the purine ring N(1), N(7), the nitrogen atom of the pyrimidine ring N(3), the oxygen atoms of the phosphate group of the nucleotide and the protonated nitrogen atoms of the polyamine were the reaction centres. The mode of interaction of the metal ion with OSpm and the nucleotides (AMP or CMP) in the coordination compounds was established. In the system Cu(II)/OSpm the dinuclear complex Cu(2)(OSpm) forms, while in the ternary systems Cu(II)/nucleotide/OSpm the species type MH(x)LL' and MLL' appear. In the MH(x)LL' type species, the main centres of copper (II) ion binding in the nucleotide are the phosphate groups. The protonated amino groups of OSpm are involved in non-covalent interaction with the nitrogen atoms N(1), N(7) or N(3) of the purine or pyrimidine ring, whereas at higher pH, deprotonated nitrogen atoms of polyamine are engaged in metallation in MLL' species.
Biogenic formation and growth of uraninite (UO₂).
Lee, Seung Yeop; Baik, Min Hoon; Choi, Jong Won
2010-11-15
Biogenic UO₂ (uraninite) nanocrystals may be formed as a product of a microbial reduction process in uranium-enriched environments near the Earth's surface. We investigated the size, nanometer-scale structure, and aggregation state of UO₂ formed by iron-reducing bacterium, Shewanella putrefaciens CN32, from a uranium-rich solution. Characterization of biogenic UO₂ precipitates by high-resolution transmission electron microscopy (HRTEM) revealed that the UO₂ nanoparticles formed were highly aggregated by organic polymers. Nearly all of the nanocrystals were networked in more or less 100 nm diameter spherical aggregates that displayed some concentric UO₂ accumulation with heterogeneity. Interestingly, pure UO₂ nanocrystals were piled on one another at several positions via UO₂-UO₂ interactions, which seem to be intimately related to a specific step in the process of growing large single crystals. In the process, calcium that was easily complexed with aqueous uranium(VI) appeared not to be combined with bioreduced uranium(IV), probably due to its lower binding energy. However, when phosphate was added to the system, calcium was found to be easily associated with uranium(IV), forming a new uranium phase, ningyoite. These results will extend the limited knowledge of microbial uraniferous mineralization and may provide new insights into the fate of aqueous uranium complexes.
Identification of amino acids that promote specific and rigid TAR RNA-tat protein complex formation.
Edwards, Thomas E; Robinson, Bruce H; Sigurdsson, Snorri Th
2005-03-01
The Tat protein and the transactivation responsive (TAR) RNA form an essential complex in the HIV lifecycle, and mutations in the basic region of the Tat protein alter this RNA-protein molecular recognition. Here, EPR spectroscopy was used to identify amino acids, flanking an essential arginine of the Tat protein, which contribute to specific and rigid TAR-Tat complex formation by monitoring changes in the mobility of nitroxide spin-labeled TAR RNA nucleotides upon binding. Arginine to lysine N-terminal mutations did not affect TAR RNA interfacial dynamics. In contrast, C-terminal point mutations, R56 in particular, affected the mobility of nucleotides U23 and U38, which are involved in a base-triple interaction in the complex. This report highlights the role of dynamics in specific molecular complex formation and demonstrates the ability of EPR spectroscopy to study interfacial dynamics of macromolecular complexes.
Nucleotide cleaving agents and method
Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.
2000-01-01
The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.
Semimicrodetermination of combined tantalum and niobium with selenous acid
Grimaldi, F.S.; Schnepfe, M.
1959-01-01
Tantalum and niobium are separated and determined gravimetrically by precipitation with selenous acid from highly acidic solutions in the absence of complexing agents. Hydrogen peroxide is used in the preparation of the solution and later catalytically destroyed during digestion of the precipitate. From 0.2 to 30 mg., separately or in mixtures, of niobium or tantalum pentoxide can be separated from mixtures containing 100 mg. each of the oxides of scandium, yttrium, cerium, vanadium, molybdenum, iron, aluminum, tin, lead, and bismuth with a single precipitation; and from 30 mg. of titanium dioxide, and 50 mg. each of the oxides of antimony and thorium, when present separately, with three precipitations. At least 50 mg. of uranium(VI) oxide can be separated with a single precipitation when present alone; otherwise, three precipitations may be needed. Zirconium does not interfere when the tantalum and niobium contents of the sample are small, but in general, zirconium as well as tungsten interfere. The method is applied to the determination of the earth acids in tantaloniobate ores.
Krasheninina, Olga A; Novopashina, Darya S; Lomzov, Alexander A; Venyaminova, Alya G
2014-09-05
The synthesis and properties two series of new 2'-O-methyl RNA probes, each containing a single insertion of a 2'-bispyrenylmethylphosphorodiamidate derivative of a nucleotide (U, C, A, and G), are described. As demonstrated by UV melting studies, the probes form stable complexes with model RNAs and DNAs. Significant increases (up to 21-fold) in pyrene excimer fluorescence intensity were observed upon binding of most of the probes with complementary RNAs, but not with DNAs. The fluorescence spectra are independent of the nature of the modified nucleotides. The nucleotides on the 5'-side of the modified nucleotide have no effect on the fluorescence spectra, whereas the natures of the two nucleotides on the 3'-side are important: CC, CG, and UC dinucleotide units on the 3'-side of the modified nucleotide provide the maximum increases in excimer fluorescence intensity. This study suggests that these 2'-bispyrene-labeled 2'-O-methyl RNA probes might be useful tools for detection of RNAs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Synergistic effect of ATP for RuvA-RuvB-Holliday junction DNA complex formation.
Iwasa, Takuma; Han, Yong-Woon; Hiramatsu, Ryo; Yokota, Hiroaki; Nakao, Kimiko; Yokokawa, Ryuji; Ono, Teruo; Harada, Yoshie
2015-12-14
The Escherichia coli RuvB hexameric ring motor proteins, together with RuvAs, promote branch migration of Holliday junction DNA. Zero mode waveguides (ZMWs) constitute of nanosized holes and enable the visualization of a single fluorescent molecule under micromolar order of the molecules, which is applicable to characterize the formation of RuvA-RuvB-Holliday junction DNA complex. In this study, we used ZMWs and counted the number of RuvBs binding to RuvA-Holliday junction DNA complex. Our data demonstrated that different nucleotide analogs increased the amount of Cy5-RuvBs binding to RuvA-Holliday junction DNA complex in the following order: no nucleotide, ADP, ATPγS, and mixture of ADP and ATPγS. These results suggest that not only ATP binding to RuvB but also ATP hydrolysis by RuvB facilitates a stable RuvA-RuvB-Holliday junction DNA complex formation.
Redefining the genetics of Murine Gammaherpesvirus 68 via transcriptome-based annotation
Johnson, L. Steven; Willert, Erin K.; Virgin, Herbert W.
2010-01-01
Summary Viral genetic studies often focus on large open reading frames (ORFs) identified during genome annotation (ORF-based annotation). Here we provide a tool and software set for defining gene expression by murine gammaherpesvirus 68 (γHV68) nucleotide-by-nucleotide across the 119,450 basepair (bp) genome. These tools allowed us to determine that viral RNA expression was significantly more complex than predicted from ORF-based annotation, including over 73,000 nucleotides of unexpected transcription within 30 expressed genomic regions (EGRs). Approximately 90% of this RNA expression was antisense to genomic regions containing known large ORFs. We verified the existence of novel transcripts in three EGRs using standard methods to validate the approach and determined which parts of the transcriptome depend on protein or viral DNA synthesis. This redefines the genetic map of γHV68, indicates that herpesviruses contain significantly more genetic complexity than predicted from ORF-based genome annotations, and provides new tools and approaches for viral genetic studies. PMID:20542255
mRNA 3' of the A site bound codon is located close to protein S3 on the human 80S ribosome.
Molotkov, Maxim V; Graifer, Dmitri M; Popugaeva, Elena A; Bulygin, Konstantin N; Meschaninova, Maria I; Ven'yaminova, Aliya G; Karpova, Galina G
2006-07-01
Ribosomal proteins neighboring the mRNA downstream of the codon bound at the decoding site of human 80S ribosomes were identified using three sets of mRNA analogues that contained a UUU triplet at the 5' terminus and a perfluorophenylazide cross-linker at guanosine, adenosine or uridine residues placed at various locations 3' of this triplet. The positions of modified mRNA nucleotides on the ribosome were governed by tRNA(Phe) cognate to the UUU triplet targeted to the P site. Upon mild UV-irradiation, the mRNA analogues cross-linked preferentially to the 40S subunit, to the proteins and to a lesser extent to the 18S rRNA. Cross-linked nucleotides of 18S rRNA were identified previously. In the present study, it is shown that among the proteins the main target for cross-linking with all the mRNA analogues tested was protein S3 (homologous to prokaryotic S3, S3p); minor cross-linking to protein S2 (S5p) was also detected. Both proteins cross-linked to mRNA analogues in the ternary complexes as well as in the binary complexes (without tRNA). In the ternary complexes protein S15 (S19p) also cross-linked, the yield of the cross-link decreased significantly when the modified nucleotide moved from position +5 to position +12 with respect to the first nucleotide of the P site bound codon. In several ternary complexes minor cross-linking to protein S30 was likewise detected. The results of this study indicate that S3 is a key protein at the mRNA binding site neighboring mRNA downstream of the codon at the decoding site in the human ribosome.
Uranium(VI) Reduction by Anaeromyxobacter dehalogenans Strain 2CP-C
Wu, Qingzhong; Sanford, Robert A.; Löffler, Frank E.
2006-01-01
Previous studies demonstrated growth of Anaeromyxobacter dehalogenans strain 2CP-C with acetate or hydrogen as the electron donor and Fe(III), nitrate, nitrite, fumarate, oxygen, or ortho-substituted halophenols as electron acceptors. In this study, we explored and characterized U(VI) reduction by strain 2CP-C. Cell suspensions of fumarate-grown 2CP-C cells reduced U(VI) to U(IV). More-detailed growth studies demonstrated that hydrogen was the required electron donor for U(VI) reduction and could not be replaced by acetate. The addition of nitrate to U(VI)-reducing cultures resulted in a transitory increase in U(VI) concentration, apparently caused by the reoxidation of reduced U(IV), but U(VI) reduction resumed following the consumption of N-oxyanions. Inhibition of U(VI) reduction occurred in cultures amended with Fe(III) citrate, or citrate. In the presence of amorphous Fe(III) oxide, U(VI) reduction proceeded to completion but the U(VI) reduction rates decreased threefold compared to control cultures. Fumarate and 2-chlorophenol had no inhibitory effects on U(VI) reduction, and both electron acceptors were consumed concomitantly with U(VI). Since cocontaminants (e.g., nitrate, halogenated compounds) and bioavailable ferric iron are often encountered at uranium-impacted sites, the metabolic versatility makes Anaeromyxobacter dehalogenans a promising model organism for studying the complex interaction of multiple electron acceptors in U(VI) reduction and immobilization. PMID:16672509
Comparative analysis of activator-Eσ54 complexes formed with nucleotide-metal fluoride analogues
Burrows, Patricia C.; Joly, Nicolas; Nixon, B. Tracy; Buck, Martin
2009-01-01
Bacterial RNA polymerase (RNAP) containing the major variant σ54 factor forms open promoter complexes in a reaction in which specialized activator proteins hydrolyse ATP. Here we probe binding interactions between σ54-RNAP (Eσ54) and the ATPases associated with various cellular activities (AAA+) domain of the Escherichia coli activator protein, PspF, using nucleotide-metal fluoride (BeF and AlF) analogues representing ground and transition states of ATP, which allow complexes (that are otherwise too transient with ATP) to be captured. We show that the organization and functionality of the ADP–BeF- and ADP–AlF-dependent complexes greatly overlap. Our data support an activation pathway in which the initial ATP-dependent binding of the activator to the Eσ54 closed complex results in the re-organization of Eσ54 with respect to the transcription start-site. However, the nucleotide-dependent binding interactions between the activator and the Eσ54 closed complex are in themselves insufficient for forming open promoter complexes when linear double-stranded DNA is present in the initial closed complex. PMID:19553192
Profiling of Sugar Nucleotides.
Rejzek, Martin; Hill, Lionel; Hems, Edward S; Kuhaudomlarp, Sakonwan; Wagstaff, Ben A; Field, Robert A
2017-01-01
Sugar nucleotides are essential building blocks for the glycobiology of all living organisms. Detailed information on the types of sugar nucleotides present in a particular cell and how they change as a function of metabolic, developmental, or disease status is vital. The extraction, identification, and quantification of sugar nucleotides in a given sample present formidable challenges. In this chapter, currently used techniques for sugar nucleotide extraction from cells, separation from complex biological matrices, and detection by optical and mass spectrometry methods are discussed. © 2017 Elsevier Inc. All rights reserved.
Complexes of oligo(poly)nucleotides with structural anomalies
NASA Astrophysics Data System (ADS)
Dolinnaya, N. G.; Gryaznova, O. I.
1989-08-01
The results of studies on the structure and properties of DNA-RNA hybrids and complexes of oligo(poly)nucleotides containing non-canonical base pairs or unpaired bases both within and at the ends of the double helix are surveyed. The methods used in the study of such systems are briefly characterised: X-ray diffraction analysis, NMR and UV spectroscopy, circular dichroism, scanning microcalorimetry, etc. A comparative analysis of the influence of the non-canonical pairs on the structure and the energetic and kinetic parameters of the formation and dissociation of the oligonucleotide complexes has been carried out. The question of the stability of the non-canonical pairs as a function of their nature and position in the double helix is considered. The mechanisms of the formation of the hydrogen bonds between the bases of non-complementary pairs are discussed. The bibliography includes 171 references.
Van Eps, Ned; Thomas, Celestine J.; Hubbell, Wayne L.; Sprang, Stephen R.
2015-01-01
Heterotrimeric G proteins are activated by exchange of GDP for GTP at the G protein alpha subunit (Gα), most notably by G protein-coupled transmembrane receptors. Ric-8A is a soluble cytoplasmic protein essential for embryonic development that acts as both a guanine nucleotide exchange factor (GEF) and a chaperone for Gα subunits of the i, q, and 12/13 classes. Previous studies demonstrated that Ric-8A stabilizes a dynamically disordered state of nucleotide-free Gα as the catalytic intermediate for nucleotide exchange, but no information was obtained on the structures involved or the magnitude of the structural fluctuations. In the present study, site-directed spin labeling (SDSL) together with double electron-electron resonance (DEER) spectroscopy is used to provide global distance constraints that identify discrete members of a conformational ensemble in the Gαi1:Ric-8A complex and the magnitude of structural differences between them. In the complex, the helical and Ras-like nucleotide-binding domains of Gαi1 pivot apart to occupy multiple resolved states with displacements as large as 25 Å. The domain displacement appears to be distinct from that observed in Gαs upon binding of Gs to the β2 adrenergic receptor. Moreover, the Ras-like domain exhibits structural plasticity within and around the nucleotide-binding cavity, and the switch I and switch II regions, which are known to adopt different conformations in the GDP- and GTP-bound states of Gα, undergo structural rearrangements. Collectively, the data show that Ric-8A induces a conformationally heterogeneous state of Gαi and provide insight into the mechanism of action of a nonreceptor Gα GEF. PMID:25605908
Enhancing genomic prediction with genome-wide association studies in multiparental maize populations
USDA-ARS?s Scientific Manuscript database
Genome-wide association mapping using dense marker sets has identified some nucleotide variants affecting complex traits which have been validated with fine-mapping and functional analysis. Many sequence variants associated with complex traits in maize have small effects and low repeatability, howev...
Azab, Hassan Ahmed; Anwar, Zeinab M; Abdel-Salam, Enas T; el-Sayed-Sebak, Mahmoud
2012-01-01
Two new ligands derived from phloroglucinol 2-{[(4-methoxy benzoyl)oxy]} methyl benzoic acid[L1] and 2-{[(4-methyl benzoyl)oxy] methyl} benzoic acid[L2] were synthesized. The solid complex Eu(III)-L2 has been synthesised and characterized by elemental analysis, UV and IR spectra. The reaction of Eu(III) with the two synthesized ligands has been investigated in I = 0.1 mol dm(-3) p-toluene sulfonate by cyclic voltammetry and square wave voltammetry. The reaction of Eu (III)-L1 and Eu (III)-L2 binary complexes with nucleotide 5'-AMP, 5'-ADP, 5'-ATP, 5'- GMP, 5'-IMP, and 5'-CMP has been investigated using UV, fluorescence and electrochemical methods. The experimental conditions were selected such that self-association of the nucleotides and their complexes was negligibly small, that is, the monomeric complexes were studied. The interaction of the Eu(III)-L1 or L2 solid complexes with calf-thymus DNA has been investigated by fluorescence and electrochemical methods including cyclic voltammetery(CV), differential pulse polarography (DPP) and square wave voltammetry (SWV) on a glassy carbon electrode. The fluorescence intensity of Eu(III)-L2 complex was enhanced with the addition of DNA. Under optimal conditions in phosphate buffer pH 7.0 at 25 °C the linear range is 3-20 μM for calf thymus DNA (CT-DNA) and the corresponding determination limit is 1.8 μM.
NASA Astrophysics Data System (ADS)
Tournassat, C.; Tinnacher, R. M.; Grangeon, S.; Davis, J. A.
2018-01-01
The prediction of U(VI) adsorption onto montmorillonite clay is confounded by the complexities of: (1) the montmorillonite structure in terms of adsorption sites on basal and edge surfaces, and the complex interactions between the electrical double layers at these surfaces, and (2) U(VI) solution speciation, which can include cationic, anionic and neutral species. Previous U(VI)-montmorillonite adsorption and modeling studies have typically expanded classical surface complexation modeling approaches, initially developed for simple oxides, to include both cation exchange and surface complexation reactions. However, previous models have not taken into account the unique characteristics of electrostatic surface potentials that occur at montmorillonite edge sites, where the electrostatic surface potential of basal plane cation exchange sites influences the surface potential of neighboring edge sites ('spillover' effect). A series of U(VI) - Na-montmorillonite batch adsorption experiments was conducted as a function of pH, with variable U(VI), Ca, and dissolved carbonate concentrations. Based on the experimental data, a new type of surface complexation model (SCM) was developed for montmorillonite, that specifically accounts for the spillover effect using the edge surface speciation model by Tournassat et al. (2016a). The SCM allows for a prediction of U(VI) adsorption under varying chemical conditions with a minimum number of fitting parameters, not only for our own experimental results, but also for a number of published data sets. The model agreed well with many of these datasets without introducing a second site type or including the formation of ternary U(VI)-carbonato surface complexes. The model predictions were greatly impacted by utilizing analytical measurements of dissolved inorganic carbon (DIC) concentrations in individual sample solutions rather than assuming solution equilibration with a specific partial pressure of CO2, even when the gas phase was laboratory air. Because of strong aqueous U(VI)-carbonate solution complexes, the measurement of DIC concentrations was even important for systems set up in the 'absence' of CO2, due to low levels of CO2 contamination during the experiment.
Li, Yunlang; Schlick, Tamar
2013-01-01
Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTP
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
Ghosh, Supratim; Mallick, Sumana; Das, Upasana; Verma, Ajay; Pal, Uttam; Chatterjee, Sabyasachi; Nandy, Abhishek; Saha, Krishna D; Maiti, Nakul Chandra; Baishya, Bikash; Suresh Kumar, G; Gmeiner, William H
2018-03-01
We report, based on biophysical studies and molecular mechanical calculations that curcumin binds DNA hairpin in the minor groove adjacent to the loop region forming a stable complex. UV-Vis and fluorescence spectroscopy indicated interaction of curcumin with DNA hairpin. In this novel binding motif, two ɣ H of curcumin heptadiene chain are closely positioned to the A 16 -H8 and A 17 -H8, while G 12 -H8 is located in the close proximity of curcumin α H. Molecular dynamics (MD) simulations suggest, the complex is stabilized by noncovalent forces including; π-π stacking, H-bonding and hydrophobic interactions. Nuclear magnetic resonance (NMR) spectroscopy in combination with molecular dynamics simulations indicated curcumin is bound in the minor groove, while circular dichroism (CD) spectra suggested minute enhancement in base stacking and a little change in DNA helicity, without significant conformational change of DNA hairpin structure. The DNA:curcumin complex formed with FdU nucleotides rather than Thymidine, demonstrated enhanced cytotoxicity towards oral cancer cells relative to the only FdU substituted hairpin. Fluorescence co-localization demonstrated stability of the complex in biologically relevant conditions, including its cellular uptake. Acridine orange/EtBr staining further confirmed the enhanced cytotoxic effects of the complex, suggesting apoptosis as mode of cell death. Thus, curcumin can be noncovalently complexed to small DNA hairpin for cellular delivery and the complex showed increased cytotoxicity in combination with FdU nucleotides, demonstrating its potential for advanced cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.
Oswald, Christine; Jenewein, Stefan; Smits, Sander H J; Holland, I Barry; Schmitt, Lutz
2008-04-01
TNP-modified nucleotides have been used extensively to study protein-nucleotide interactions. In the case of ABC-ATPases, application of these powerful tools has been greatly restricted due to the significantly higher affinity of the TNP-nucleotide for the corresponding ABC-ATPase in comparison to the non-modified nucleotides. To understand the molecular changes occurring upon binding of the TNP-nucleotide to an ABC-ATPase, we have determined the crystal structure of the TNP-ADP/HlyB-NBD complex at 1.6A resolution. Despite the higher affinity of TNP-ADP, no direct fluorophore-protein interactions were observed. Unexpectedly, only water-mediated interactions were detected between the TNP moiety and Tyr(477), that is engaged in pi-pi stacking with the adenine ring, as well as with two serine residues (Ser(504) and Ser(509)) of the Walker A motif. Interestingly, the side chains of these two serine residues adopt novel conformations that are not observed in the corresponding ADP structure. However, in the crystal structure of the S504A mutant, which binds TNP-ADP with similar affinity to the wild type enzyme, a novel TNP-water interaction compensates for the missing serine side chain. Since this water molecule is not present in the wild type enzyme, these results suggest that only water-mediated interactions provide a structural explanation for the increased affinity of TNP-nucleotides towards ABC-ATPases. However, our results also imply that in silico approaches such as docking or modeling cannot directly be applied to generate 'affinity-adopted' ADP- or ATP-analogs for ABC-ATPases.
Mallik, Saurav; Kundu, Sudip
2017-04-01
Understanding the molecular evolution of macromolecular complexes in the light of their structure, assembly, and stability is of central importance. Here, we address how the modular organization of native molecular contacts shapes the selection pressure on individual residue sites of ribosomal complexes. The bacterial ribosomal complex is represented as a residue contact network where nodes represent amino acid/nucleotide residues and edges represent their van der Waals interactions. We find statistically overrepresented native amino acid-nucleotide contacts (OaantC, one amino acid contacts one or multiple nucleotides, internucleotide contacts are disregarded). Contact number is defined as the number of nucleotides contacted. Involvement of individual amino acids in OaantCs with smaller contact numbers is more random, whereas only a few amino acids significantly contribute to OaantCs with higher contact numbers. An investigation of structure, stability, and assembly of bacterial ribosome depicts the involvement of these OaantCs in diverse biophysical interactions stabilizing the complex, including high-affinity protein-RNA contacts, interprotein cooperativity, intersubunit bridge, packing of multiple ribosomal RNA domains, etc. Amino acid-nucleotide constituents of OaantCs with higher contact numbers are generally associated with significantly slower substitution rates compared with that of OaantCs with smaller contact numbers. This evolutionary rate heterogeneity emerges from the strong purifying selection pressure that conserves the respective amino acid physicochemical properties relevant to the stabilizing interaction with OaantC nucleotides. An analysis of relative molecular orientations of OaantC residues and their interaction energetics provides the biophysical ground of purifying selection conserving OaantC amino acid physicochemical properties. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
StructAlign, a Program for Alignment of Structures of DNA-Protein Complexes.
Popov, Ya V; Galitsyna, A A; Alexeevski, A V; Karyagina, A S; Spirin, S A
2015-11-01
Comparative analysis of structures of complexes of homologous proteins with DNA is important in the analysis of DNA-protein recognition. Alignment is a necessary stage of the analysis. An alignment is a matching of amino acid residues and nucleotides of one complex to residues and nucleotides of the other. Currently, there are no programs available for aligning structures of DNA-protein complexes. We present the program StructAlign, which should fill this gap. The program inputs a pair of complexes of DNA double helix with proteins and outputs an alignment of DNA chains corresponding to the best spatial fit of the protein chains.
Cherepanov, A V; de Vries, S
2001-01-01
The interaction of nucleotides with T4 DNA and RNA ligases has been characterized using ultraviolet visible (UV-VIS) absorbance and fluorescence spectroscopy. Both enzymes bind nucleotides with the K(d) between 0.1 and 20 microM. Nucleotide binding results in a decrease of absorbance at 260 nm due to pi-stacking with an aromatic residue, possibly phenylalanine, and causes red-shifting of the absorbance maximum due to hydrogen bonding with the exocyclic amino group. T4 DNA ligase is shown to have, besides the catalytic ATP binding site, another noncovalent nucleotide binding site. ATP bound there alters the pi-stacking of the nucleotide in the catalytic site, increasing its optical extinction. The K(d) for the noncovalent site is approximately 1000-fold higher than for the catalytic site. Nucleotides quench the protein fluorescence showing that a tryptophan residue is located in the active site of the ligase. The decrease of absorbance around 298 nm suggests that the hydrogen bonding interactions of this tryptophan residue are weakened in the ligase-nucleotide complex. The excitation/emission properties of T4 RNA ligase indicate that its ATP binding pocket is in contact with solvent, which is excluded upon binding of the nucleotide. Overall, the spectroscopic analysis reveals important similarities between T4 ligases and related nucleotidyltransferases, despite the low sequence similarity. PMID:11721015
Li, Juan; Yang, Xiaodan; Bai, Chiyao; Tian, Yin; Li, Bo; Zhang, Shuang; Yang, Xiaoyu; Ding, Songdong; Xia, Chuanqin; Tan, Xinyu; Ma, Lijian; Li, Shoujian
2015-01-01
A novel COF-based material (COF-COOH) containing large amounts of carboxylic groups was prepared for the first time by using a simple and effective one-step synthetic method, in which the cheap and commercially available raw materials, trimesoyl chloride and p-phenylenediamine, were used. The as-synthesized COF-COOH was modified with previously synthesized 2-(2,4-dihydroxyphenyl)-benzimidazole (HBI) by "grafting to" method, and a new solid-phase extractant (COF-HBI) with highly efficient sorption performance for uranium(VI) was consequently obtained. A series of characterizations demonstrated that COF-COOH and COF-HBI exhibited great thermostabilities and irradiation stabilities. Sorption behavior of the COF-based materials toward U(VI) was compared in simulated nuclear industrial effluent containing UO2(2+) and 11 undesired ions, and the UO2(2+) sorption amount of COF-HBI was 81 mg g(-1), accounting for approximately 58% of the total sorption amount, which was much higher than the sorption selectivity of COF-COOH to UO2(2+) (39%). Batch sorption experiment results indicated that the uranium(VI) sorption on COF-HBI was a pH dependent, rapid (sorption equilibrium was reached in 30 min), endothermic and spontaneous process. In the most favorable conditions, the equilibrium sorption capacity of the adsorbent for uranium could reach 211 mg g(-1). Copyright © 2014 Elsevier Inc. All rights reserved.
Li, Peng; Zhun, Bao; Wang, Xuegang; Liao, PingPing; Wang, Guanghui; Wang, Lizhang; Guo, Yadan; Zhang, Weimin
2017-12-19
A new strategy combining iron-electrocoagulation and organic ligands (OGLs) cooperative chelation was proposed to screen and precipitate low concentrations (0-18.52 μmol/L) of uranium contaminant in aqueous solution. We hypothesized that OGLs with amino, hydroxyl, and carboxyl groups hydrophobically/hydrophilically would realize precuring of uranyl ion at pH < 3.0, and the following iron-electrocoagulation would achieve faster and more efficient uranium precipitation. Experimentally, the strategy demonstrated highly efficient uranium(VI) precipitation efficiency, especially with hydrophilic macromolecular OGLs. The uranium removal efficiency at optimized experimental condition reached 99.65%. The decrease of zeta potential and the lattice enwrapping between U-OGLs chelates and flocculation precursor were ascribed to the enhanced uranium precipitation activity. Uranium was precipitated as oxides of U(VI) or higher valences that were easily captured in aggregated micelles under low operation current potential. The actual uranium tailing wastewater was treated, and a satisfied uranium removal efficiency of 99.02% was discovered. After elution of the precipitated flocs, a concentrated uranium solution (up to 106.52 μmol/L) with very few other metallic impurities was obtained. Therefore, the proposed strategy could remove uranium and concentrate it concurrently. This work could provide new insights into the purification and recovery of uranium from aqueous solutions in a cost-effective and environmentally friendly process.
Characteristics of uranium biosorption from aqueous solutions on fungus Pleurotus ostreatus.
Zhao, Changsong; Liu, Jun; Tu, Hong; Li, Feize; Li, Xiyang; Yang, Jijun; Liao, Jiali; Yang, Yuanyou; Liu, Ning; Sun, Qun
2016-12-01
Uranium(VI) biosorption from aqueous solutions was investigated in batch studies by using fungus Pleurotus ostreatus biomass. The optimal biosorption conditions were examined by investigating the reaction time, biomass dosage, pH, temperature, and uranium initial concentration. The interaction between fungus biomass and uranium was confirmed using Fourier transformed infrared (FT-IR), scanning electronic microscopy energy dispersive X-ray (SEM-EDX), and X-ray photoelectron spectroscopy (XPS) analysis. Results exhibited that the maximum biosorption capacity of uranium on P. ostreatus was 19.95 ± 1.17 mg/g at pH 4.0. Carboxylic, amine, as well as hydroxyl groups were involved in uranium biosorption according to FT-IR analysis. The pseudo-second-order model properly evaluated the U(VI) biosorption on fungus P. ostreatus biomass. The Langmuir equation provided better fitting in comparison with Freundlich isotherm models. The obtained thermodynamic parameters suggested that biosorption is feasible, endothermic, and spontaneous. SEM-EDX and XPS were additionally conducted to comprehend the biosorption process that could be described as a complex process involving several mechanisms of physical adsorption, chemisorptions, and ion exchange. Results obtained from this work indicated that fungus P. ostreatus biomass can be used as potential biosorbent to eliminate uranium or other radionuclides from aqueous solutions.
Stewart, Brandy D; Mayes, Melanie A; Fendorf, Scott
2010-02-01
Adsorption on soil and sediment solids may decrease aqueous uranium concentrations and limit its propensity for migration in natural and contaminated settings. Uranium adsorption will be controlled in large part by its aqueous speciation, with a particular dependence on the presence of dissolved calcium and carbonate. Here we quantify the impact of uranyl speciation on adsorption to both goethite and sediments from the Hanford Clastic Dike and Oak Ridge Melton Branch Ridgetop formations. Hanford sediments were preconditioned with sodium acetate and acetic acid to remove carbonate grains, and Ca and carbonate were reintroduced at defined levels to provide a range of aqueous uranyl species. U(VI) adsorption is directly linked to UO(2)(2+) speciation, with the extent of retention decreasing with formation of ternary uranyl-calcium-carbonato species. Adsorption isotherms under the conditions studied are linear, and K(d) values decrease from 48 to 17 L kg(-1) for goethite, from 64 to 29 L kg (-1) for Hanford sediments, and from 95 to 51 L kg(-1) for Melton Branch sediments as the Ca concentration increases from 0 to 1 mM at pH 7. Our observations reveal that, in carbonate-bearing waters, neutral to slightly acidic pH values ( approximately 5) and limited dissolved calcium are optimal for uranium adsorption.
Ikeda, Atsushi; Hennig, Christoph; Rossberg, André; Tsushima, Satoru; Scheinost, Andreas C; Bernhard, Gert
2008-02-15
A multitechnique approach using extended X-ray absorption fine structure (EXAFS) spectroscopy based on iterative transformation factor analysis (ITFA), UV-visible absorption spectroscopy, and density functional theory (DFT) calculations has been performed in order to investigate the speciation of uranium(VI) nitrate species in acetonitrile and to identify the complex structure of individual species in the system. UV-visible spectral titration suggests that there are four different species in the system, that is, pure solvated species, mono-, di-, and trinitrate species. The pure EXAFS spectra of these individual species are extracted by ITFA from the measured spectral mixtures on the basis of the speciation distribution profile calculated from the UV-visible data. Data analysis of the extracted EXAFS spectra, with the help of DFT calculations, reveals the most probable complex structures of the individual species. The pure solvated species corresponds to a uranyl hydrate complex with an equatorial coordination number (CNeq) of 5, [UO2(H2O)5]2+. Nitrate ions tend to coordinate to the uranyl(VI) ion in a bidentate fashion rather than a unidentate one in acetonitrile for all the nitrate species. The mononitrate species forms the complex of [UO2(H2O)3NO3]+ with a CNeq value of 5, while the di- and trinitrate species have a CNeq value of 6, corresponding to [UO2(H2O)2(NO3)2]0 (D2h) and [UO2(NO3)3]- (D3h), respectively.
Transient state kinetics of transcription elongation by T7 RNA polymerase.
Anand, Vasanti Subramanian; Patel, Smita S
2006-11-24
The single subunit DNA-dependent RNA polymerase (RNAP) from bacteriophage T7 catalyzes both promoter-dependent transcription initiation and promoter-independent elongation. Using a promoter-free substrate, we have dissected the kinetic pathway of single nucleotide incorporation during elongation. We show that T7 RNAP undergoes a slow conformational change (0.01-0.03 s(-1)) to form an elongation competent complex with the promoter-free substrate (dissociation constant (Kd) of 96 nM). The complex binds to a correct NTP (Kd of 80 microM) and incorporates the nucleoside monophosphate (NMP) into RNA primer very efficiently (220 s(-1) at 25 degrees C). An overall free energy change (-5.5 kcal/mol) and internal free energy change (-3.7 kcal/mol) of single NMP incorporation was calculated from the measured equilibrium constants. In the presence of inorganic pyrophosphate (PPi), the elongation complex catalyzes the reverse pyrophosphorolysis reaction at a maximum rate of 0.8 s(-1) with PPi Kd of 1.2 mM. Several experiments were designed to investigate the rate-limiting step in the pathway of single nucleotide addition. Acid-quench and pulse-chase kinetics indicated that an isomerization step before chemistry is rate-limiting. The very similar rate constants of sequential incorporation of two nucleotides indicated that the steps after chemistry are fast. Based on available data, we propose that the preinsertion to insertion isomerization of NTP observed in the crystallographic studies of T7 RNAP is a likely candidate for the rate-limiting step. The studies here provide a kinetic framework to investigate structure-function and fidelity of RNA synthesis and to further explore the role of the conformational change in nucleotide selection during RNA synthesis.
Weck, Philippe F; Kim, Eunja
2014-12-07
The structure of dehydrated schoepite, α-UO2(OH)2, was investigated using computational approaches that go beyond standard density functional theory and include van der Waals dispersion corrections (DFT-D). Thermal properties of α-UO2(OH)2, were also obtained from phonon frequencies calculated with density functional perturbation theory (DFPT) including van der Waals dispersion corrections. While the isobaric heat capacity computed from first-principles reproduces available calorimetric data to within 5% up to 500 K, some entropy estimates based on calorimetric measurements for UO3·0.85H2O were found to overestimate by up to 23% the values computed in this study.
Ishida, Hisashi; Matsumoto, Atsushi
2016-09-01
In order to understand how MutS recognizes mismatched DNA and induces the reaction of DNA repair using ATP, the dynamics of the complexes of MutS (bound to the ADP and ATP nucleotides, or not) and DNA (with mismatched and matched base-pairs) were investigated using molecular dynamics simulations. As for DNA, the structure of the base-pairs of the homoduplex DNA which interacted with the DNA recognition site of MutS was intermittently disturbed, indicating that the homoduplex DNA was unstable. As for MutS, the disordered loops in the ATPase domains, which are considered to be necessary for the induction of DNA repair, were close to (away from) the nucleotide-binding sites in the ATPase domains when the nucleotides were (not) bound to MutS. This indicates that the ATPase domains changed their structural stability upon ATP binding using the disordered loop. Conformational analysis by principal component analysis showed that the nucleotide binding changed modes which have structurally solid ATPase domains and the large bending motion of the DNA from higher to lower frequencies. In the MutS-mismatched DNA complex bound to two nucleotides, the bending motion of the DNA at low frequency modes may play a role in triggering the formation of the sliding clamp for the following DNA-repair reaction step. Moreover, MM-PBSA/GBSA showed that the MutS-homoduplex DNA complex bound to two nucleotides was unstable because of the unfavorable interactions between MutS and DNA. This would trigger the ATP hydrolysis or separation of MutS and DNA to continue searching for mismatch base-pairs. Proteins 2016; 84:1287-1303. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yan, Ming; Li, Jingzhi; Sha, Bingdong
2013-01-16
Sil1 functions as a NEF (nucleotide-exchange factor) for the ER (endoplasmic reticulum) Hsp70 (heat-shock protein of 70 kDa) Bip in eukaryotic cells. Sil1 may catalyse the ADP release from Bip by interacting directly with the ATPase domain of Bip. In the present study we show the complex crystal structure of the yeast Bip and the NEF Sil1 at the resolution of 2.3 {angstrom} (1 {angstrom} = 0.1 nm). In the Sil1-Bip complex structure, the Sil1 molecule acts as a 'clamp' which binds lobe IIb of the Bip ATPase domain. The binding of Sil1 causes the rotation of lobe IIb {approx}more » 13.5{sup o} away from the ADP-binding pocket. The complex formation also induces lobe Ib to swing in the opposite direction by {approx} 3.7{sup o}. These conformational changes open up the nucleotide-binding pocket in the Bip ATPase domain and disrupt the hydrogen bonds between Bip and bound ADP, which may catalyse ADP release. Mutation of the Sil1 residues involved in binding the Bip ATPase domain compromise the binding affinity of Sil1 to Bip, and these Sil1 mutants also abolish the ability to stimulate the ATPase activity of Bip.« less
Tron, Adriana E; Comelli, Raúl N; Gonzalez, Daniel H
2005-12-27
Homeodomain-leucine zipper (HD-Zip) proteins, unlike most homeodomain proteins, bind a pseudopalindromic DNA sequence as dimers. We have investigated the structure of the DNA complexes formed by two HD-Zip proteins with different nucleotide preferences at the central position of the binding site using footprinting and interference methods. The results indicate that the respective complexes are not symmetric, with the strand bearing a central purine (top strand) showing higher protection around the central region and the bottom strand protected toward the 3' end. Binding to a sequence with a nonpreferred central base pair produces a decrease in protection in either the top or the bottom strand, depending upon the protein. Modeling studies derived from the complex formed by the monomeric Antennapedia homeodomain with DNA indicate that in the HD-Zip/DNA complex the recognition helix of one of the monomers is displaced within the major groove respective to the other one. This monomer seems to lose contacts with a part of the recognition sequence upon binding to the nonpreferred site. The results show that the structure of the complex formed by HD-Zip proteins with DNA is dependent upon both protein intrinsic characteristics and the nucleotides present at the central position of the recognition sequence.
Structures of Human Pumilio with Noncognate RNAs Reveal Molecular Mechanisms for Binding Promiscuity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gupta,Y.; Nair, D.; Wharton, R.
2008-01-01
Pumilio is a founder member of the evolutionarily conserved Puf family of RNA-binding proteins that control a number of physiological processes in eukaryotes. A structure of human Pumilio (hPum) Puf domain bound to a Drosophila regulatory sequence showed that each Puf repeat recognizes a single nucleotide. Puf domains in general bind promiscuously to a large set of degenerate sequences, but the structural basis for this promiscuity has been unclear. Here, we describe the structures of hPum Puf domain complexed to two noncognate RNAs, CycBreverse and Puf5. In each complex, one of the nucleotides is ejected from the binding surface, inmore » effect, acting as a 'spacer.' The complexes also reveal the plasticity of several Puf repeats, which recognize noncanonical nucleotides. Together, these complexes provide a molecular basis for recognition of degenerate binding sites, which significantly increases the number of mRNAs targeted for regulation by Puf proteins in vivo.« less
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...
2016-10-13
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
3D RNA and functional interactions from evolutionary couplings
Weinreb, Caleb; Riesselman, Adam; Ingraham, John B.; Gross, Torsten; Sander, Chris; Marks, Debora S.
2016-01-01
Summary Non-coding RNAs are ubiquitous, but the discovery of new RNA gene sequences far outpaces research on their structure and functional interactions. We mine the evolutionary sequence record to derive precise information about function and structure of RNAs and RNA-protein complexes. As in protein structure prediction, we use maximum entropy global probability models of sequence co-variation to infer evolutionarily constrained nucleotide-nucleotide interactions within RNA molecules, and nucleotide-amino acid interactions in RNA-protein complexes. The predicted contacts allow all-atom blinded 3D structure prediction at good accuracy for several known RNA structures and RNA-protein complexes. For unknown structures, we predict contacts in 160 non-coding RNA families. Beyond 3D structure prediction, evolutionary couplings help identify important functional interactions, e.g., at switch points in riboswitches and at a complex nucleation site in HIV. Aided by accelerating sequence accumulation, evolutionary coupling analysis can accelerate the discovery of functional interactions and 3D structures involving RNA. PMID:27087444
Hung, Siu Chun; Gottesman, Max E.
1997-01-01
Bacteriophage HK022 Nun protein blocks transcription elongation by Escherichia coli RNA polymerase in vitro without dissociating the transcription complex. Nun is active on complexes located at any template site tested. Ultimately, only the 3′-OH terminal nucleotide of the nascent transcript in an arrested complex can turn over; it is removed by pyrophosphate and restored with NTPs. This suggests that Nun inhibits the translocation of RNA polymerase without abolishing its catalytic activities. Unlike spontaneously arrested complexes, Nun-arrested complexes cannot be reactivated by transcription factor GreB. The various complexes show distinct patterns of nucleotide incorporation and pyrophosphorolysis before or after treatment with Nun, suggesting that the configuration of RNAP, transcript, and template DNA is different in each complex. PMID:9334329
Structural Basis for a Unique ATP Synthase Core Complex from Nanoarcheaum equitans*
Mohanty, Soumya; Jobichen, Chacko; Chichili, Vishnu Priyanka Reddy; Velázquez-Campoy, Adrián; Low, Boon Chuan; Hogue, Christopher W. V.; Sivaraman, J.
2015-01-01
ATP synthesis is a critical and universal life process carried out by ATP synthases. Whereas eukaryotic and prokaryotic ATP synthases are well characterized, archaeal ATP synthases are relatively poorly understood. The hyperthermophilic archaeal parasite, Nanoarcheaum equitans, lacks several subunits of the ATP synthase and is suspected to be energetically dependent on its host, Ignicoccus hospitalis. This suggests that this ATP synthase might be a rudimentary machine. Here, we report the crystal structures and biophysical studies of the regulatory subunit, NeqB, the apo-NeqAB, and NeqAB in complex with nucleotides, ADP, and adenylyl-imidodiphosphate (non-hydrolysable analog of ATP). NeqB is ∼20 amino acids shorter at its C terminus than its homologs, but this does not impede its binding with NeqA to form the complex. The heterodimeric NeqAB complex assumes a closed, rigid conformation irrespective of nucleotide binding; this differs from its homologs, which require conformational changes for catalytic activity. Thus, although N. equitans possesses an ATP synthase core A3B3 hexameric complex, it might not function as a bona fide ATP synthase. PMID:26370083
Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A
2013-09-27
Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation.
Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan
2012-01-01
A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.
Sequence Complexity of Chromosome 3 in Caenorhabditis elegans
Pierro, Gaetano
2012-01-01
The nucleotide sequences complexity in chromosome 3 of Caenorhabditis elegans (C. elegans) is studied. The complexity of these sequences is compared with some random sequences. Moreover, by using some parameters related to complexity such as fractal dimension and frequency, indicator matrix is given a first classification of sequences of C. elegans. In particular, the sequences with highest and lowest fractal value are singled out. It is shown that the intrinsic nature of the low fractal dimension sequences has many common features with the random sequences. PMID:22919380
Osmium Tag for Posttranscriptionally Modified RNA.
Debnath, Turja Kanti; Okamoto, Akimitsu
2018-05-25
Nucleotide modifications of cellular RNA are highly abundant and diverse, but their origin and functions have not yet been investigated. 5-Methylcytidine (m5C) and 5-methyluridine (m5U) are highly abundant posttranscriptionally modified nucleotides observed in various natural RNAs. Such nucleotides have been labeled through a chemical approach as both undergo oxidation at the C5-C6 double bond, leading to the formation of osmium-bipyridine complexes, which are identified by mass spectrometry. This osmium tag made it possible to distinguished m5C and m5U from their isomers 2'-O-methylcytidine and 2'-O-methyluridine, respectively. Queuosine and 2-methylthio-N6-isopentenyladenosine in tRNA were also tagged through this complex formation--this is the first time that this has ever been achieved. Osmylation has emerged as a structure-selective reaction and largely governed by the environment of the target site (the steric and higher order structure), therefore it could be helpful for studying the structure and dynamics of RNA-protein interactions. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Complexes of yeast adenylate kinase and nucleotides investigated by sup 1 H NMR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vetter, I.R.; Konrad, M.; Rosch, P.
1991-04-30
The role of one of the histidine residues present in many adenylate kinases (H36 in the porcine cytosolic enzyme) is highly disputed. The authors studied the yeast enzyme (AK{sub ye}) containing this His residue. AK{sub ye} is highly homologous to the Escherichia coli enzyme (AK{sub ec}), a protein that is already well characterized by NMR and does not contain the His residue in question. In addition, discrepancies between solution structural and X-ray crystallographic studies on the location of the nucleotide binding sites of adenylate kinases are clarified. One- and two-dimensional nuclear magnetic resonance (NMR) spectroscopy was used to investigate AK{submore » ye} and its complex with the bisubstrate analogue P{sup 1},P{sup 5}-bis(5{prime}-adenosyl)pentaphosphate (AP{sub 5}A). From these studies, all aromatic residues of AK{sub ec} involved in the binding of ATP{center dot}Mg{sup 2+} have functional analogues in AK{sub ye}. The AMP site seems to make no contacts to aromatic side chains, neither in the AK{sub ye}{center dot}AP{sub 5}A{center dot}Mg{sup 2+} nor in the AK{sub ec}{center dot}AP{sub 5}A{center dot}Mg{sup 2+} complexes, so that it is presently not possible to localize this binding site by NMR. In combination with the recent X-ray results on the AP{sub 5}A complexes AK{sub ye} and AK{sub ec} and the GMP complex of guanylate kinase the latter one leading to the definition of the monophosphate site, the problem of the location of the nucleotide sites can be considered to be solved in a way contradicting earlier work and denying the His residue homologous to H36 in porcine adenylate kinase a direct role in substrate binding.« less
Sorption behavior of uranium(VI) on a biotite mineral
DOE Office of Scientific and Technical Information (OSTI.GOV)
Idemitsu, K.; Obata, K.; Furuya, H.
1995-12-31
Biotite has the most important role for the sorption of radionuclides in granitic rocks. Experiments on the sorption of uranium(VI) on biotite were conducted to understand the fundamental controls on uranium sorption on biotite mineral, including the effects of pH and uranium concentration in solution. Biotite powder (mesh 32--60) were washed with 1N HCl for a week and were rinsed twice with deionized water for a week. This HCl treatment was necessary to avoid the effects by other minerals. The agreement between surface adsorption coefficient, Ka, of both biotites with and without HCl treatment was within one order of magnitude.more » The peak Ka value was in the range of 0.1 to 0.01 cm{sup 3}/cm{sup 2} around pH 6. A comparison of aqueous uranium speciations and sorption results indicates that neutral uranyl hydroxide could be an important species sorbed on the biotite. Sequential desorption experiments with KCl and HCl solutions were also carried out after sorption experiments to investigate sorption forms of uranium. Approximately 20% of uranium in solution were sorbed on the biotite as an exchangeable ion. The fraction of exchangeable uranium had a little dependence on pH. The other uranium could not be extracted even by 6N HCl solution. It is possible that most of the uranium could be precipitated as U(IV) via Fe(II) reduction on the biotite surface.« less
Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing
2009-06-01
The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.
Burnett, Benjamin J; Altman, Roger B; Ferrao, Ryan; Alejo, Jose L; Kaur, Navdep; Kanji, Joshua; Blanchard, Scott C
2013-05-10
Aminoacyl-tRNA (aa-tRNA) enters the ribosome in a ternary complex with the G-protein elongation factor Tu (EF-Tu) and GTP. EF-Tu·GTP·aa-tRNA ternary complex formation and decay rates are accelerated in the presence of the nucleotide exchange factor elongation factor Ts (EF-Ts). EF-Ts directly facilitates the formation and disassociation of ternary complex. This system demonstrates a novel function of EF-Ts. Aminoacyl-tRNA enters the translating ribosome in a ternary complex with elongation factor Tu (EF-Tu) and GTP. Here, we describe bulk steady state and pre-steady state fluorescence methods that enabled us to quantitatively explore the kinetic features of Escherichia coli ternary complex formation and decay. The data obtained suggest that both processes are controlled by a nucleotide-dependent, rate-determining conformational change in EF-Tu. Unexpectedly, we found that this conformational change is accelerated by elongation factor Ts (EF-Ts), the guanosine nucleotide exchange factor for EF-Tu. Notably, EF-Ts attenuates the affinity of EF-Tu for GTP and destabilizes ternary complex in the presence of non-hydrolyzable GTP analogs. These results suggest that EF-Ts serves an unanticipated role in the cell of actively regulating the abundance and stability of ternary complex in a manner that contributes to rapid and faithful protein synthesis.
Feldman, Sanford H; Ntenda, Abraham M
2011-01-01
We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574
An uracil-linked hydroxyflavone probe for the recognition of ATP
Bojtár, Márton; Janzsó-Berend, Péter Zoltán; Mester, Dávid; Hessz, Dóra; Kállay, Mihály; Kubinyi, Miklós
2018-01-01
Background: Nucleotides are essential molecules in living systems due to their paramount importance in various physiological processes. In the past years, numerous attempts were made to selectively recognize and detect these analytes, especially ATP using small-molecule fluorescent chemosensors. Despite the various solutions, the selective detection of ATP is still challenging due to the structural similarity of various nucleotides. In this paper, we report the conjugation of a uracil nucleobase to the known 4’-dimethylamino-hydroxyflavone fluorophore. Results: The complexation of this scaffold with ATP is already known. The complex is held together by stacking and electrostatic interactions. To achieve multi-point recognition, we designed the uracil-appended version of this probe to include complementary base-pairing interactions. The theoretical calculations revealed the availability of multiple complex structures. The synthesis was performed using click chemistry and the nucleotide recognition properties of the probe were evaluated using fluorescence spectroscopy. Conclusions: The first, uracil-containing fluorescent ATP probe based on a hydroxyflavone fluorophore was synthesized and evaluated. A selective complexation with ATP was observed and a ratiometric response in the excitation spectrum. PMID:29719572
Exploring the Fate of Nitrogen Heterocycles in Complex Prebiotic Mixtures
NASA Technical Reports Server (NTRS)
Smith, Karen E.; Callahan, Michael P.; Cleaves, Henderson J.; Dworkin, Jason P.; House, Christopher H.
2011-01-01
A long standing question in the field of prebiotic chemistry is the origin of the genetic macromolecules DNA and RNA. DNA and RNA have very complex structures with repeating subunits of nucleotides, which are composed of nucleobases (nitrogen heterocycles) connected to sugar-phosphate. Due to the instability of some nucleobases (e.g. cytosine), difficulty of synthesis and instability of D-ribose, and the likely scarcity of polyphosphates necessary for the modern nucleotides, alternative nucleotides have been proposed for constructing the first genetic material. Thus, we have begun to investigate the chemistry of nitrogen heterocycles in plausible, complex prebiotic mixtures in an effort to identify robust reactions and potential alternative nucleotides. We have taken a complex prebiotic mixture produced by a spark discharge acting on a gas mixture of N2, CO2, CH4, and H2, and reacted it with four nitrogen heterocycles: uracil, 5-hydroxymethyluracil, guanine, and isoxanthopterin (2-amino-4,7-dihydroxypteridine). The products of the reaction between the spark mixture and each nitrogen heterocycle were characterized by liquid chromatography coupled to UV spectroscopy and Orbitrap mass spectrometry. We found that the reaction between the spark mixtUl'e and isoxanthopterin formed one major product, which was a cyanide adduct. 5-hydroxymethyluracil also reacted with the spark mixture to form a cyanide adduct, uracil-5-acetonitrile, which has been synthesized previously by reacting HCN with S-hydroxymethyluracil. Unlike isoxanthopterin, the chromatogram of the 5-hydroxymethyluracil reaction was much more complex with multiple products including spark-modified dimers. Additionally, we observed that HMU readily self-polymerizes in solution to a variety of oligomers consistent with those suggested by Cleaves. Guanine and uracil, the biological nucleobases, did not react with the spark mixture, even at high temperature (100 C). This suggests that there are alternative nucleobases which are more reactive under prebiotic conditions and may have been involved in producing precursor nucleotides.
Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A.
2013-01-01
Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation. PMID:23935102
Heavy atom labeled nucleotides for measurement of kinetic isotope effects.
Weissman, Benjamin P; Li, Nan-Sheng; York, Darrin; Harris, Michael; Piccirilli, Joseph A
2015-11-01
Experimental analysis of kinetic isotope effects represents an extremely powerful approach for gaining information about the transition state structure of complex reactions not available through other methodologies. The implementation of this approach to the study of nucleic acid chemistry requires the synthesis of nucleobases and nucleotides enriched for heavy isotopes at specific positions. In this review, we highlight current approaches to the synthesis of nucleic acids enriched site specifically for heavy oxygen and nitrogen and their application in heavy atom isotope effect studies. This article is part of a special issue titled: Enzyme Transition States from Theory and Experiment. Copyright © 2015 Elsevier B.V. All rights reserved.
Temple, Henry; Saez-Aguayo, Susana; Reyes, Francisca C; Orellana, Ariel
2016-09-01
The cell wall is a complex extracellular matrix composed primarily of polysaccharides. Noncellulosic polysaccharides, glycoproteins and proteoglycans are synthesized in the Golgi apparatus by glycosyltransferases (GTs), which use nucleotide sugars as donors to glycosylate nascent glycan and glycoprotein acceptors that are subsequently exported to the extracellular space. Many nucleotide sugars are synthesized in the cytosol, leading to a topological issue because the active sites of most GTs are located in the Golgi lumen. Nucleotide sugar transporters (NSTs) overcome this problem by translocating nucleoside diphosphate sugars from the cytosol into the lumen of the organelle. The structures of the cell wall components synthesized in the Golgi are diverse and complex; therefore, transporter activities are necessary so that the nucleotide sugars can provide substrates for the GTs. In this review, we describe the topology of reactions involved in polysaccharide biosynthesis in the Golgi and focus on the roles of NSTs as well as their impacts on cell wall structure when they are altered. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Preuveneers, M. J.; Peacock, D.; Crook, E. M.; Clark, J. B.; Brocklehurst, K.
1973-01-01
1. The reversible NAD+-linked oxidation of d-3-hydroxybutyrate to acetoacetate in 0.1m-sodium pyrophosphate buffer, pH8.5, at 25.0°C, catalysed by d-3-hydroxybutyrate dehydrogenase (d-3-hydroxybutyrate–NAD+ oxidoreductase, EC 1.1.1.30), was studied by initial-velocity, dead-end inhibition and product-inhibition analysis. 2. The reactions were carried out on (a) the soluble enzyme from Rhodopseudomonas spheroides and (b) an insoluble derivative of this enzyme prepared by its covalent attachment to DEAE-cellulose by using 2-amino-4,6-dichloro-s-triazine as coupling agent. 3. The insolubilized enzyme preparation contained 5mg of protein/g wet wt. of total material, and when freshly prepared its specific activity was 1.2μmol/min per mg of protein, which is 67% of that of the soluble dialysed enzyme. 4. The reactions catalysed by both the enzyme in solution and the insolubilized enzyme were shown to follow sequential pathways in which the nicotinamide nucleotides bind obligatorily first to the enzyme. Evidence is presented for kinetically significant ternary complexes and that the rate-limiting step(s) of both catalyses probably involves isomerization of the enzyme–nicotinamide nucleotide complexes and/or dissociation of the nicotinamide nucleotides from the enzyme. Both catalyses therefore are probably best described as ordered Bi Bi mechanisms, possibly with multiple enzyme–nicotinamide nucleotide complexes. 5. The kinetic parameters and the calculable rate constants for the catalysis by the soluble enzyme are similar to the corresponding parameters and rate constants for the catalysis by the insolubilized enzyme. PMID:4352835
The SAM domain of mouse SAMHD1 is critical for its activation and regulation.
Buzovetsky, Olga; Tang, Chenxiang; Knecht, Kirsten M; Antonucci, Jenna M; Wu, Li; Ji, Xiaoyun; Xiong, Yong
2018-01-29
Human SAMHD1 (hSAMHD1) is a retroviral restriction factor that blocks HIV-1 infection by depleting the cellular nucleotides required for viral reverse transcription. SAMHD1 is allosterically activated by nucleotides that induce assembly of the active tetramer. Although the catalytic core of hSAMHD1 has been studied extensively, previous structures have not captured the regulatory SAM domain. Here we report the crystal structure of full-length SAMHD1 by capturing mouse SAMHD1 (mSAMHD1) structures in three different nucleotide bound states. Although mSAMHD1 and hSAMHD1 are highly similar in sequence and function, we find that mSAMHD1 possesses a more complex nucleotide-induced activation process, highlighting the regulatory role of the SAM domain. Our results provide insights into the regulation of SAMHD1 activity, thereby facilitating the improvement of HIV mouse models and the development of new therapies for certain cancers and autoimmune diseases.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stewart, B.D.; Mayes, Melanie; Fendorf, Scott
2010-01-01
Adsorption on soil and sediment solids may decrease aqueous uranium concentrations and limit its propensity for migration in natural and contaminated settings. Uranium adsorption will be controlled in large part by its aqueous speciation, with a particular dependence on the presence of dissolved calcium and carbonate. Here we quantify the impact of uranyl speciation on adsorption to both goethite and sediments from the Hanford Clastic Dike and Oak Ridge Melton Branch Ridgetop formations. Hanford sediments were preconditioned with sodium acetate and acetic acid to remove carbonate grains, and Ca and carbonate were reintroduced at defined levels to provide a rangemore » of aqueous uranyl species. U(VI) adsorption is directly linked to UO{sub 2}{sup 2+} speciation, with the extent of retention decreasing with formation of ternary uranyl-calcium-carbonato species. Adsorption isotherms under the conditions studied are linear, and K{sub d} values decrease from 48 to 17 L kg{sup -1} for goethite, from 64 to 29 L kg{sup -1} for Hanford sediments, and from 95 to 51 L kg{sup -1} for Melton Branch sediments as the Ca concentration increases from 0 to 1 mM at pH 7. Our observations reveal that, in carbonate-bearing waters, neutral to slightly acidic pH values ({approx}5) and limited dissolved calcium are optimal for uranium adsorption.« less
Wang, Tieshan; Zheng, Xinyan; Wang, Xiaoyu; Lu, Xia; Shen, Yanghao
2017-02-01
Uranium adsorption mechanisms of live and heat-killed Saccharomyces cerevisiae in different pH values and biomass concentrations were studied under environmentally relevant conditions. Compared with live cells, the adsorption capacity of heat-killed cells is almost one order of magnitude higher in low biomass concentration and highly acidic pH conditions. To explore the mesoscopic surface interactions between uranium and cells, the characteristic of uranium deposition was investigated by SEM-EDX, XPS and FTIR. Biosorption process of live cells was considered to be metabolism-dependent. Under stimulation by uranyl ions, live cells could gradually release phosphorus and reduce uranium from U(VI) to U(IV) to alleviate uranium toxicity. The uranyl-phosphate complexes were formed in scale-like shapes on cell surface. The metabolic detoxification mechanisms such as reduction and "self-protection" are of significance to the migration of radionuclides. In the metabolism-independent biosorption process of heat-killed cells: the cells cytomembrane was damaged by autoclaving which led to the free diffusion of phosphorous from intracellular, and the rough surface and nano-holes indicated that the dead cells provided larger contact area to precipitate U(VI) as spherical nano-particles. The high biosorption capacity of heat-killed cells makes it become a suitable biological adsorbent for uranium removal. Copyright © 2016 Elsevier Ltd. All rights reserved.
A phylogenetic delimitation of the "Sphagnum subsecundum complex" (Sphagnaceae, Bryophyta).
Shaw, A Jonathan; Boles, Sandra; Shaw, Blanka
2008-06-01
A seemingly obvious but sometimes overlooked premise of any evolutionary analysis is delineating the group of taxa under study. This is especially problematic in some bryophyte groups because of morphological simplicity and convergence. This research applies information from nucleotide sequences for eight plastid and nuclear loci to delineate a group of northern hemisphere peat moss species, the so-called Sphagnum subsecundum complex, which includes species known to be gametophytically haploid or diploid (i.e., sporophytically diploid-tetraploid). Despite the fact that S. subsecundum and several species in the complex have been attributed disjunct ranges that include all major continents, phylogenetic analyses suggest that the group is actually restricted to Europe and eastern North America. Plants from western North America, from California to Alaska, which are morphologically similar to species of the S. subsecundum complex in eastern N. America and Europe, actually belong to a different deep clade within Sphagnum section Subsecunda. One species often considered part of the S. subsecundum complex, S. contortum, likely has a reticulate history involving species in the two deepest clades within section Subsecunda. Nucleotide sequences have a strong geographic structure across the section Subsecunda, but shallow tip clades suggest repeated long-distance dispersal in the section as well.
Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R
2018-05-01
Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.
A structure-based kinetic model of transcription.
Zuo, Yuhong; Steitz, Thomas A
2017-01-01
During transcription, RNA polymerase moves downstream along the DNA template and maintains a transcription bubble. Several recent structural studies of transcription complexes with a complete transcription bubble provide new insights into how RNAP couples the nucleotide addition reaction to its directional movement.
New Mycobacterium tuberculosis Complex Sublineage, Brazzaville, Congo
Malm, Sven; Linguissi, Laure S. Ghoma; Tekwu, Emmanuel M.; Vouvoungui, Jeannhey C.; Kohl, Thomas A.; Beckert, Patrick; Sidibe, Anissa; Rüsch-Gerdes, Sabine; Madzou-Laboum, Igor K.; Kwedi, Sylvie; Penlap Beng, Véronique; Frank, Matthias; Ntoumi, Francine
2017-01-01
Tuberculosis is a leading cause of illness and death in Congo. No data are available about the population structure and transmission dynamics of the Mycobacterium tuberculosis complex strains prevalent in this central Africa country. On the basis of single-nucleotide polymorphisms detected by whole-genome sequencing, we phylogenetically characterized 74 MTBC isolates from Brazzaville, the capital of Congo. The diversity of the study population was high; most strains belonged to the Euro-American lineage, which split into Latin American Mediterranean, Uganda I, Uganda II, Haarlem, X type, and a new dominant sublineage named Congo type (n = 26). Thirty strains were grouped in 5 clusters (each within 12 single-nucleotide polymorphisms), from which 23 belonged to the Congo type. High cluster rates and low genomic diversity indicate recent emergence and transmission of the Congo type, a new Euro-American sublineage of MTBC. PMID:28221129
New Mycobacterium tuberculosis Complex Sublineage, Brazzaville, Congo.
Malm, Sven; Linguissi, Laure S Ghoma; Tekwu, Emmanuel M; Vouvoungui, Jeannhey C; Kohl, Thomas A; Beckert, Patrick; Sidibe, Anissa; Rüsch-Gerdes, Sabine; Madzou-Laboum, Igor K; Kwedi, Sylvie; Penlap Beng, Véronique; Frank, Matthias; Ntoumi, Francine; Niemann, Stefan
2017-03-01
Tuberculosis is a leading cause of illness and death in Congo. No data are available about the population structure and transmission dynamics of the Mycobacterium tuberculosis complex strains prevalent in this central Africa country. On the basis of single-nucleotide polymorphisms detected by whole-genome sequencing, we phylogenetically characterized 74 MTBC isolates from Brazzaville, the capital of Congo. The diversity of the study population was high; most strains belonged to the Euro-American lineage, which split into Latin American Mediterranean, Uganda I, Uganda II, Haarlem, X type, and a new dominant sublineage named Congo type (n = 26). Thirty strains were grouped in 5 clusters (each within 12 single-nucleotide polymorphisms), from which 23 belonged to the Congo type. High cluster rates and low genomic diversity indicate recent emergence and transmission of the Congo type, a new Euro-American sublineage of MTBC.
Polyaniline (PANI) modified bentonite by plasma technique for U(VI) removal from aqueous solution
NASA Astrophysics Data System (ADS)
Liu, Xinghao; Cheng, Cheng; Xiao, Chengjian; Shao, Dadong; Xu, Zimu; Wang, Jiaquan; Hu, Shuheng; Li, Xiaolong; Wang, Weijuan
2017-07-01
Polyaniline (PANI) modified bentonite (PANI/bentonie) was synthesized by plasma induced polymerization of aniline on bentonite surface, and applied to uptake of uranium(VI) ions from aqueous solution. The as-synthesized PANI/bentonie was characterized by scanning electron microscopy (SEM), powder X-ray diffraction (XRD), thermal gravimetric analysis (TGA), and X-ray photoelectron spectroscopy (XPS). Batch adsorption technique was utilized to investigate the adsorption of U(VI) on bentonite and PANI/bentonite. The adsorption of U(VI) (10 mg/L) on PANI/bentonite surface is fairly depend on solution pH, ionic strength, and temperature in solution. The modified PANI on PANI/bentonite surface significantly enhances its adsorption capability for U(VI). The presence of humic acid (HA) can sound enhance U(VI) adsorption on PANI/bentonite at pH < 6.5 because of the strong complexation, and inhibits U(VI) adsorption at pH > 6.5. According to the thermodynamic parameters, the adsorption of U(VI) on PANI/bentonite surface is a spontaneous and endothermic process. The results highlight the application of PANI/bentonite composites as candidate material for the uptake of trace U(VI) from aqueous solution.
Yan, Sen; Chen, Yongheng; Xiang, Wu; Bao, Zhengyu; Liu, Chongxuan; Deng, Baolin
2014-12-01
The role of Fe(II) and Fe(III) in U(VI) reduction by nanoscale zerovalent iron (nanoFe0) was investigated using two iron chelators 1,10-phenanthroline and triethanolamine (TEA) under a CO2-free anoxic condition. The results showed that U(VI) reduction was strongly inhibited by 1,10-phenanthroline and TEA in a pH range from 6.9 to 9.0. For instance, at pH 6.9 the observed U(VI) reduction rates decreased by 81% and 82% in the presence of 1,10-phenanthroline and TEA, respectively. The inhibition was attributed to the formation of stable complexes between 1,10-phenanthroline and Fe(II) or TEA and Fe(III). In the absence of iron chelators, U(VI) reduction can be enhanced by surface-bound Fe(II) on nanoFe0. Our results suggested that Fe(III) and Fe(II) possibly acted as an electron shuttle to ferry the electrons from nanoFe0 to U(VI), therefore a combined system with Fe(II), Fe(III) and nanoFe0 could facilitate U(VI) reductive immobilization in the contaminated groundwater.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yan, Sen; Chen, Yongheng; Xiang, Wu
2014-12-01
The role of Fe(II) and Fe(III) on U(VI) reduction by nanoscale zerovalent iron (nanoFe0) was investigated using two iron chelators 1,10-phenanthroline and triethanolamine (TEA) under a CO2-free anoxic condition. The results showed U(VI) reduction was strongly inhibited by 1,10-phenanthroline and TEA in a pH range from 6.92 to 9.03. For instance, at pH 6.92 the observed U(VI) reduction rates decreased by 80.7% and 82.3% in the presence of 1,10-phenanthroline and TEA, respectively. The inhibition was attributed to the formation of stable complexes between 1,10-phenanthroline and Fe(II) or TEA and Fe(III). In the absence of iron chelators, U(VI) reduction can bemore » enhanced by surface-bound Fe(II) on nanoFe0. Our results suggested that Fe(III) and Fe(II) probably acted as an electron shuttle to mediate the transfer of electrons from nanoFe0 to U(VI), therefore a combined system with Fe(II), Fe(III) and nanoFe0 can facilitate the U(VI) reductive immobilization in the contaminated groundwater.« less
Stoliker, Deborah L.; Kent, Douglas B.; Zachara, John M.
2011-01-01
Uranium adsorption-desorption on sediment samples collected from the Hanford 300-Area, Richland, WA varied extensively over a range of field-relevant chemical conditions, complicating assessment of possible differences in equilibrium adsorption properties. Adsorption equilibrium was achieved in 500-1000 h although dissolved uranium concentrations increased over thousands of hours owing to changes in aqueous chemical composition driven by sediment-water reactions. A nonelectrostatic surface complexation reaction, >SOH + UO22+ + 2CO32- = >SOUO2(CO3HCO3)2-, provided the best fit to experimental data for each sediment sample resulting in a range of conditional equilibrium constants (logKc) from 21.49 to 21.76. Potential differences in uranium adsorption properties could be assessed in plots based on the generalized mass-action expressions yielding linear trends displaced vertically by differences in logKc values. Using this approach, logKc values for seven sediment samples were not significantly different. However, a significant difference in adsorption properties between one sediment sample and the fines (Kc uncertainty were improved by capturing all data points within experimental errors. The mass-action expression plots demonstrate that applying models outside the range of conditions used in model calibration greatly increases potential errors.
Triest, Sarah; Wohlkönig, Alexandre; Pardon, Els; Steyaert, Jan
2014-11-01
GPCR-G-protein complexes are one of the most important components of cell-signalling cascades. Extracellular signals are sensed by membrane-associated G-protein-coupled receptors (GPCRs) and transduced via G proteins towards intracellular effector molecules. Structural studies of these transient complexes are crucial to understand the molecular details of these interactions. Although a nucleotide-free GPCR-G-protein complex is stable, it is not an ideal sample for crystallization owing to the intrinsic mobility of the Gαs α-helical domain (AHD). To stabilize GPCR-G-protein complexes in a nucleotide-free form, nanobodies were selected that target the flexible GαsAHD. One of these nanobodies, CA9177, was co-crystallized with the GαsAHD. Initial crystals were obtained using the sitting-drop method in a sparse-matrix screen and further optimized. The crystals diffracted to 1.59 Å resolution and belonged to the monoclinic space group P2₁, with unit-cell parameters a=44.07, b=52.55, c=52.66 Å, α=90.00, β=107.89, γ=90.00°. The structure of this specific nanobody reveals its binding epitope on GαsAHD and will help to determine whether this nanobody could be used as crystallization chaperone for GPCR-G-protein complexes.
Guzder, S N; Sung, P; Prakash, L; Prakash, S
1998-11-20
Saccharomyces cerevisiae Rad4 and Rad23 proteins are required for the nucleotide excision repair of UV light-damaged DNA. Previous studies have indicated that these two DNA repair proteins are associated in a tight complex, which we refer to as nucleotide excision repair factor 2 (NEF2). In a reconstituted nucleotide excision repair reaction, incision of UV-damaged DNA is dependent on NEF2, indicating a role of NEF2 in an early step of the repair process. NEF2 does not, however, possess an enzymatic activity, and its function in the damage-specific incision reaction has not yet been defined. Here we use a DNA mobility shift assay to demonstrate that NEF2 binds specifically to UV-damaged DNA. Elimination of cyclobutane pyrimidine dimers from the UV-damaged DNA by enzymatic photoreactivation has little effect on the affinity of NEF2 for the DNA, suggesting that NEF2 recognizes the 6-(1, 2)-dihydro-2-oxo-4-pyrimidinyl)-5-methyl-2,4-(1H,3H)-pyrimidinedione photoproducts in the damaged DNA. These results highlight the intricacy of the DNA damage-demarcation reaction during nucleotide excision repair in eukaryotes.
VarDetect: a nucleotide sequence variation exploratory tool
Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades
2008-01-01
Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032
Genetic structure and genealogy in the Sphagnum subsecundum complex (Sphagnaceae: Bryophyta).
Shaw, A J; Pokorny, L; Shaw, B; Ricca, M; Boles, S; Szövényi, P
2008-10-01
Allopolyploidy is probably the most extensively studied mode of plant speciation and allopolyploid species appear to be common in the mosses (Bryophyta). The Sphagnum subsecundum complex includes species known to be gametophytically haploid or diploid, and it has been proposed that the diploids (i.e., with tetraploid sporophytes) are allopolyploids. Nucleotide sequence and microsatellite variation among haploids and diploids from Newfoundland and Scandinavia indicate that (1) the diploids exhibit fixed or nearly fixed heterozygosity at the majority of loci sampled, and are clearly allopolyploids, (2) diploids originated independently in North America and Europe, (3) the European diploids appear to have the haploid species, S. subsecundum, as the maternal parent based on shared chloroplast DNA haplotypes, (4) the North American diploids do not have the chloroplast DNA of any sampled haploid, (5) both North American and European diploids share nucleotide and microsatellite similarities with S. subsecundum, (6) the diploids harbor more nucleotide and microsatellite diversity than the haploids, and (7) diploids exhibit higher levels of linkage disequilibrium among microsatellite loci. An experiment demonstrates significant artifactual recombination between interspecific DNAs coamplified by PCR, which may be a complicating factor in the interpretation of sequence-based analyses of allopolyploids.
Mahajan, Shikha; Manetsch, Roman; Merkler, David J.; Stevens Jr., Stanley M.
2015-01-01
Proteomics is a powerful approach used for investigating the complex molecular mechanisms of disease pathogenesis and progression. An important challenge in modern protein profiling approaches involves targeting of specific protein activities in order to identify altered molecular processes associated with disease pathophysiology. Adenosine-binding proteins represent an important subset of the proteome where aberrant expression or activity changes of these proteins have been implicated in numerous human diseases. Herein, we describe an affinity-based approach for the enrichment of adenosine-binding proteins from a complex cell proteome. A novel N 6-biotinylated-8-azido-adenosine probe (AdoR probe) was synthesized, which contains a reactive group that forms a covalent bond with the target proteins, as well as a biotin tag for affinity enrichment using avidin chromatography. Probe specificity was confirmed with protein standards prior to further evaluation in a complex protein mixture consisting of a lysate derived from mouse neuroblastoma N18TG2 cells. Protein identification and relative quantitation using mass spectrometry allowed for the identification of small variations in abundance of nucleoside- and nucleotide-binding proteins in these samples where a significant enrichment of AdoR-binding proteins in the labeled proteome from the neuroblastoma cells was observed. The results from this study demonstrate the utility of this method to enrich for nucleoside- and nucleotide-binding proteins in a complex protein mixture, pointing towards a unique set of proteins that can be examined in the context of further understanding mechanisms of disease, or fundamental biological processes in general. PMID:25671571
Morcillo, Fernando; González-Muñoz, María T.; Reitz, Thomas; Romero-González, María E.; Arias, José M.; Merroun, Mohamed L.
2014-01-01
The main goal of this study is to compare the effects of pH, uranium concentration, and background electrolyte (seawater and NaClO4 solution) on the speciation of uranium(VI) associated with the marine bacterium Idiomarina loihiensis MAH1. This was done at the molecular level using a multidisciplinary approach combining X-ray Absorption Spectroscopy (XAS), Time-Resolved Laser-Induced Fluorescence Spectroscopy (TRLFS), and High Resolution Transmission Electron Microscopy (HRTEM). We showed that the U(VI)/bacterium interaction mechanism is highly dependent upon pH but also the nature of the used background electrolyte played a role. At neutral conditions and a U concentration ranging from 5·10−4 to 10−5 M (environmentally relevant concentrations), XAS analysis revealed that uranyl phosphate mineral phases, structurally resembling meta-autunite [Ca(UO2)2(PO4)2 2–6H2O] are precipitated at the cell surfaces of the strain MAH1. The formation of this mineral phase is independent of the background solution but U(VI) luminescence lifetime analyses demonstrated that the U(VI) speciation in seawater samples is more intricate, i.e., different complexes were formed under natural conditions. At acidic conditions, pH 2, 3 and 4.3 ([U] = 5·10−4 M, background electrolyte = 0.1 M NaClO4), the removal of U from solution was due to biosorption to Extracellular Polysaccharides (EPS) and cell wall components as evident from TEM analysis. The L III-edge XAS and TRLFS studies showed that the biosorption process observed is dependent of pH. The bacterial cell forms a complex with U through organic phosphate groups at pH 2 and via phosphate and carboxyl groups at pH 3 and 4.3, respectively. The differences in the complexes formed between uranium and bacteria on seawater compared to NaClO4 solution demonstrates that the actinide/microbe interactions are influenced by the three studied factors, i.e., the pH, the uranium concentration and the chemical composition of the solution. PMID:24618567
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yanli; Juranek, Stefan; Li, Haitao
Here we report on a 3.0 {angstrom} crystal structure of a ternary complex of wild-type Thermus thermophilus argonaute bound to a 5'-phosphorylated 21-nucleotide guide DNA and a 20-nucleotide target RNA containing cleavage-preventing mismatches at the 10-11 step. The seed segment (positions 2 to 8) adopts an A-helical-like Watson-Crick paired duplex, with both ends of the guide strand anchored in the complex. An arginine, inserted between guide-strand bases 10 and 11 in the binary complex, locking it in an inactive conformation, is released on ternary complex formation. The nucleic-acid-binding channel between the PAZ- and PIWI-containing lobes of argonaute widens on formationmore » of a more open ternary complex. The relationship of structure to function was established by determining cleavage activity of ternary complexes containing position-dependent base mismatch, bulge and 2'-O-methyl modifications. Consistent with the geometry of the ternary complex, bulges residing in the seed segments of the target, but not the guide strand, were better accommodated and their complexes were catalytically active.« less
Chakraborty, Srirupa; Zheng, Wenjun
2015-01-27
We have employed molecular dynamics (MD) simulation to investigate, with atomic details, the structural dynamics and energetics of three major ATPase states (ADP, APO, and ATP state) of a human kinesin-1 monomer in complex with a tubulin dimer. Starting from a recently solved crystal structure of ATP-like kinesin-tubulin complex by the Knossow lab, we have used flexible fitting of cryo-electron-microscopy maps to construct new structural models of the kinesin-tubulin complex in APO and ATP state, and then conducted extensive MD simulations (total 400 ns for each state), followed by flexibility analysis, principal component analysis, hydrogen bond analysis, and binding free energy analysis. Our modeling and simulation have revealed key nucleotide-dependent changes in the structure and flexibility of the nucleotide-binding pocket (featuring a highly flexible and open switch I in APO state) and the tubulin-binding site, and allosterically coupled motions driving the APO to ATP transition. In addition, our binding free energy analysis has identified a set of key residues involved in kinesin-tubulin binding. On the basis of our simulation, we have attempted to address several outstanding issues in kinesin study, including the possible roles of β-sheet twist and neck linker docking in regulating nucleotide release and binding, the structural mechanism of ADP release, and possible extension and shortening of α4 helix during the ATPase cycle. This study has provided a comprehensive structural and dynamic picture of kinesin's major ATPase states, and offered promising targets for future mutational and functional studies to investigate the molecular mechanism of kinesin motors.
Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.
Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook
2014-11-01
As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Porebski, Przemyslaw J.; Klimecka, Maria; Chruszcz, Maksymilian
2012-07-11
Dethiobiotin synthetase (DTBS) is involved in the biosynthesis of biotin in bacteria, fungi, and plants. As humans lack this pathway, DTBS is a promising antimicrobial drug target. We determined structures of DTBS from Helicobacter pylori (hpDTBS) bound with cofactors and a substrate analog, and described its unique characteristics relative to other DTBS proteins. Comparison with bacterial DTBS orthologs revealed considerable structural differences in nucleotide recognition. The C-terminal region of DTBS proteins, which contains two nucleotide-recognition motifs, differs greatly among DTBS proteins from different species. The structure of hpDTBS revealed that this protein is unique and does not contain a C-terminalmore » region containing one of the motifs. The single nucleotide-binding motif in hpDTBS is similar to its counterpart in GTPases; however, isothermal titration calorimetry binding studies showed that hpDTBS has a strong preference for ATP. The structural determinants of ATP specificity were assessed with X-ray crystallographic studies of hpDTBS-ATP and hpDTBS-GTP complexes. The unique mode of nucleotide recognition in hpDTBS makes this protein a good target for H. pylori-specific inhibitors of the biotin synthesis pathway.« less
Oldham, William M.; Van Eps, Ned; Preininger, Anita M.; Hubbell, Wayne L.; Hamm, Heidi E.
2007-01-01
Heterotrimeric G proteins function as molecular relays that mediate signal transduction from heptahelical receptors in the cell membrane to intracellular effector proteins. Crystallographic studies have demonstrated that guanine nucleotide exchange on the Gα subunit causes specific conformational changes in three key “switch” regions of the protein, which regulate binding to Gβγ subunits, receptors, and effector proteins. In the present study, nitroxide side chains were introduced at sites within the switch I region of Gαi to explore the structure and dynamics of this region throughout the G protein cycle. EPR spectra obtained for each of the Gα(GDP), Gα(GDP)βγ heterotrimer and Gα(GTPγS) conformations are consistent with the local environment observed in the corresponding crystal structures. Binding of the heterotrimer to activated rhodopsin to form the nucleotide-free (empty) complex, for which there is no crystal structure, causes prominent changes relative to the heterotrimer in the structure of switch I and contiguous sequences. The data identify a putative pathway of allosteric changes triggered by receptor binding and, together with previously published data, suggest elements of a mechanism for receptor-catalyzed nucleotide exchange. PMID:17463080
NASA Astrophysics Data System (ADS)
Bayramov, F. B.; Poloskin, E. D.; Chernev, A. L.; Toporov, V. V.; Dubina, M. V.; Sprung, C.; Lipsanen, H. K.; Bairamov, B. Kh.
2018-01-01
Results of studying nanocrystalline nc-Si/SiO2 quantum dots (QDs) functionalized by short oligonucleotides show that complexes of isolated crystalline semiconductor QDs are unique objects for detecting the manifestation of new quantum confinement phenomena. It is established that narrow lines observed in high-resolution spectra of inelastic light scattering can be used for determining the characteristic time scale of vibrational excitations of separate nucleotide molecules and for studying structural-dynamic properties of fast oscillatory processes in biomacromolecules.
Structural model of the p14/SF3b155 · branch duplex complex.
Schellenberg, Matthew J; Dul, Erin L; MacMillan, Andrew M
2011-01-01
Human p14 (SF3b14), a component of the spliceosomal U2 snRNP, interacts directly with the pre-mRNA branch adenosine within the context of the bulged duplex formed between the pre-mRNA branch region and U2 snRNA. This association occurs early in spliceosome assembly and persists within the fully assembled spliceosome. Analysis of the crystal structure of a complex containing p14 and a peptide derived from p14-associated SF3b155 combined with the results of cross-linking studies has suggested that the branch nucleotide interacts with a pocket on a non-canonical RNA binding surface formed by the complex. Here we report a structural model of the p14 · bulged duplex interaction based on a combination of X-ray crystallography of an adenine p14/SF3b155 peptide complex, biochemical comparison of a panel of disulfide cross-linked protein-RNA complexes, and small-angle X-ray scattering (SAXS). These studies reveal specific recognition of the branch adenosine within the p14 pocket and establish the orientation of the bulged duplex RNA bound on the protein surface. The intimate association of one surface of the bulged duplex with the p14/SF3b155 peptide complex described by this model buries the branch nucleotide at the interface and suggests that p14 · duplex interaction must be disrupted before the first step of splicing.
Structural model of the p14/SF3b155·branch duplex complex
Schellenberg, Matthew J.; Dul, Erin L.; MacMillan, Andrew M.
2011-01-01
Human p14 (SF3b14), a component of the spliceosomal U2 snRNP, interacts directly with the pre-mRNA branch adenosine within the context of the bulged duplex formed between the pre-mRNA branch region and U2 snRNA. This association occurs early in spliceosome assembly and persists within the fully assembled spliceosome. Analysis of the crystal structure of a complex containing p14 and a peptide derived from p14-associated SF3b155 combined with the results of cross-linking studies has suggested that the branch nucleotide interacts with a pocket on a non-canonical RNA binding surface formed by the complex. Here we report a structural model of the p14•bulged duplex interaction based on a combination of X-ray crystallography of an adenine p14/SF3b155 peptide complex, biochemical comparison of a panel of disulfide cross-linked protein–RNA complexes, and small-angle X-ray scattering (SAXS). These studies reveal specific recognition of the branch adenosine within the p14 pocket and establish the orientation of the bulged duplex RNA bound on the protein surface. The intimate association of one surface of the bulged duplex with the p14/SF3b155 peptide complex described by this model buries the branch nucleotide at the interface and suggests that p14•duplex interaction must be disrupted before the first step of splicing. PMID:21062891
Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc
2014-08-01
Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Hein, David W.
2009-01-01
Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125
A structure-based kinetic model of transcription
Steitz, Thomas A.
2017-01-01
ABSTRACT During transcription, RNA polymerase moves downstream along the DNA template and maintains a transcription bubble. Several recent structural studies of transcription complexes with a complete transcription bubble provide new insights into how RNAP couples the nucleotide addition reaction to its directional movement. PMID:27656764
Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S
2015-09-01
The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.
Khachatoorian, Ronik; Ganapathy, Ekambaram; Ahmadieh, Yasaman; Wheatley, Nicole; Sundberg, Christopher; Jung, Chun-Ling; Arumugaswami, Vaithilingaraja; Raychaudhuri, Santanu; Dasgupta, Asim; French, Samuel W
2014-04-01
We previously identified HSP70 and HSC70 in complex with NS5A in a proteomic screen. Here, coimmunoprecipitation studies confirmed NS5A/HSC70 complex formation during infection, and immunofluorescence studies showed NS5A and HSC70 to colocalize. Unlike HSP70, HSC70 knockdown did not decrease viral protein levels. Rather, intracellular infectious virion assembly was significantly impaired by HSC70 knockdown. We also discovered that both HSC70 nucleotide binding and substrate binding domains directly bind NS5A whereas only the HSP70 nucleotide binding domain does. Knockdown of both HSC70 and HSP70 demonstrated an additive reduction in virus production. This data suggests that HSC70 and HSP70 play discrete roles in the viral life cycle. Investigation of these different functions may facilitate developing of novel strategies that target host proteins to treat HCV infection. Copyright © 2014 Elsevier Inc. All rights reserved.
Baghdadi, S; Bouvier-Capely, C; Ritt, A; Peroux, A; Fevrier, L; Rebiere, F; Agarande, M; Cote, G
2015-11-01
Actinides determination in urine samples is part of the analyses performed to monitor internal contamination in case of an accident or a terrorist attack involving nuclear matter. Mineralisation is the first step of any of these analyses. It aims at reducing the sample volume and at destroying all organic compounds present. The mineralisation protocol is usually based on a wet ashing step, followed by actinides co-precipitation and a furnace ashing step, before redissolution and the quantification of the actinides by the appropriate techniques. Amongst the existing methods to perform the actinides co-precipitation, alkali-earth (typically calcium) precipitation is widely used. In the present work, the extraction of uranium(VI), plutonium(IV) and americium(III) from the redissolution solutions (called "mineralised urines") on calix[6]arene columns bearing hydroxamic groups was investigated as such an extraction is a necessary step before their determination by ICP-MS or alpha spectrometry. Difficulties were encountered in the transfer of uranium(VI) from raw to mineralised urines, with yield of transfer ranging between 0% and 85%, compared to about 90% for Pu and Am, depending on the starting raw urines. To understand the origin of such a difficulty, the speciation of uranium (VI) in mineralised urines was investigated by computer simulation using the MEDUSA software and the associated HYDRA database, compiled with recently published data. These calculations showed that the presence of phosphates in the "mineralised urines" leads to the formation of strong uranyl-phosphate complexes (such as UO2HPO4) which compete with the uranium (VI) extraction by the calix[6]arene bearing hydroxamic groups. The extraction constant of uranium (VI) by calix[6]arene bearing hydroxamic groups was determined in a 0.04 mol L(-1) sodium nitrate solution (logK=4.86±0.03) and implemented in an extraction model taking into account the speciation in the aqueous phase. This model allowed to simulate satisfactorily the experimental uranium extraction data and to support the preliminary conclusions about the role of the phosphates present in mineralised urines. These calculations also showed that the phosphate/calcium ratio is a key parameter as far as the efficiency of the uranium (VI) extraction by the calix[6]arene columns is concerned. It predicted that the addition of CaCl2 in mineralised urines would release uranium (VI) from phosphates by forming calcium (II)-phosphate complexes and thus facilitate the uranium (VI) extraction on calix[6]arene columns. These predictions were confirmed experimentally as the addition of 0.1 mol L(-1) CaCl2 to a mineralised urine containing naturally a high concentration of phosphate (typically 0.04 mol L(-1)) significantly increased the percentage of uranium (VI) extraction on the calix[6]arene columns. Copyright © 2015 Elsevier B.V. All rights reserved.
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
Uranium(VI) Scavenging by Amorphous Iron Phosphate Encrusting Sphaerotilus natans Filaments.
Seder-Colomina, Marina; Morin, Guillaume; Brest, Jessica; Ona-Nguema, Georges; Gordien, Nilka; Pernelle, Jean-Jacques; Banerjee, Dipanjan; Mathon, Olivier; Esposito, Giovanni; van Hullebusch, Eric D
2015-12-15
U(VI) sorption to iron oxyhydroxides, precipitation of phosphate minerals, as well as biosorption on bacterial biomass are among the most reported processes able to scavenge U(VI) under oxidizing conditions. Although phosphates significantly influence bacterially mediated as well as iron oxyhydroxide mediated scavenging of uranium, the sorption or coprecipitation of U(VI) with poorly crystalline nanosized iron phosphates has been scarcely documented, especially in the presence of microorganisms. Here we show that dissolved U(VI) can be bound to amorphous iron phosphate during their deposition on Sphaerotilus natans filamentous bacteria. Uranium LIII-edge EXAFS analysis reveals that the adsorbed uranyl ions share an equatorial oxygen atom with a phosphate tetrahedron of the amorphous iron phosphate, with a characteristic U-P distance of 3.6 Å. In addition, the uranyl ions are connected to FeO6 octahedra with U-Fe distances at ~3.4 Å and at ~4.0 Å. The shortest U-Fe distance corresponds to a bidentate edge-sharing complex often reported for uranyl adsorption onto iron oxyhydroxides, whereas the longest U-Fe and U-P distances can be interpreted as a bidentate corner-sharing complex, in which two adjacent equatorial oxygen atoms are shared with the vertices of a FeO6 octahedron and of a phosphate tetrahedron. Furthermore, based on these sorption reactions, we demonstrate the ability of an attached S. natans biofilm to remove uranium from solution without any filtration step.
Gładysz-Płaska, A; Majdan, M; Tarasiuk, B; Sternik, D; Grabias, E
2018-07-15
Elimination of U(VI) from nuclear wastes and from the underground water near the uranium mines is the serious problem. Therefore search for new sorbents for U(VI) is still a big challenge for the scientists. This paper investigates of U(VI) ions sorption on halloysite modified with the isothiouronium salts: S-dodecaneisothiouronium bromide (ligand 1), S,S'-dodecane-1,12-diylbis(isothiouronium bromide) (ligand 2), S-hexadecaneisothiouronium chloride (ligand 3), S,S'-naphthalene-1,4-diylbis(methylisothiouronium) dichloride (ligand 4), and S,S'-2,5-dimethylbenzene-1,4-diylbis(methylisothiouronium) dichloride (ligand 5). It was established that halloysite modified by the ligands with four nitrogen atoms in their structure (ligand-5, 2 and 4) was characterized by higher sorption capacity compared with that modified by the ligands with two donor nitrogens (ligand-1 and 3). The maximum sorption capacity of halloysite-5 toward U(VI) was 157 mg U/g and this places the modified mineral among the most effective sorbents for U(VI) removal from wastes. As follows from ATR, XPS and thermal degradation spectra of the sorption products [R-S-C(NH)(NH 2 )] n = 1-2 (UO 2 2+ ) complexes are formed on the external surface of the halloysite whereas oligomeric hydroxy complexes (UO 2 ) 3 (OH) 5 + and (UO 2 ) 4 (OH) 7 + are present in the interior of halloysite structure and interact predominantly with aluminols. Copyright © 2018 Elsevier B.V. All rights reserved.
Bregier-Jarzebowska, R; Gasowska, A; Hoffmann, S K; Lomozik, L
2016-09-01
Interactions were studied in the systems ATP/tn and ATP/Put (tn=1,3-diaminopropane, Put=putrescine) whereas the complexation reactions in ternary systems Cu(II)/ATP/tn and Cu(II)/ATP/Put. Results of the potentiometric and spectroscopic studies evidenced the formation of adducts of the type (ATP)H x (PA), where PA=diamine. The thermodynamic stability of the complexes and the mode of interactions were determined. On the basis of analysis of changes in the positions of NMR signals, in the pH range of (ATP)H 3 (Put) formation, the preferred centres of the interaction between ATP and Put are the endocyclic nitrogen atoms from the nucleotide. On the other hand, the shorter diamine tn in the entire pH range reacts with the phosphate groups from ATP. The positive centres of noncovalent interactions are the protonated NH x + groups from amines. In both complexes Cu(ATP)H 2 (tn) and Cu(ATP)H 3 (Put) formed in ternary systems at pH<6.5, the amines are in the outer sphere of coordination with the noncovalent interaction with anchoring Cu(ATP). Only the phosphate groups from the nucleotide take part in metalation. At higher pH in the range of Cu(ATP)(PA) complex formation, significant differences in the reactions of the two amines appear. The shorter one (tn) binds Cu(II) ions with two nitrogen atoms, while putrescine coordinates in the monofunctional mode, which is undoubtedly related to the differences in lengths of methylene chain. This explains the considerable differences in the stability of Cu(ATP)(tn) and Cu(ATP)(Put). In both complexes the nucleotide is coordinated through phosphate groups. As a result of noncovalent interactions ATP forms molecular complexes with 1,3-diaminopropane and 1,4-diaminobutane (putrescine). Significant differences in the mode of interactions between the two diamines were observed in ATP/diamine binary systems and in ternary systems Cu(II)/ATP/diamine, at high pH. Copyright © 2016 Elsevier Inc. All rights reserved.
Inter-ring rotations of AAA ATPase p97 revealed by electron cryomicroscopy
Yeung, Heidi O.; Förster, Andreas; Bebeacua, Cecilia; Niwa, Hajime; Ewens, Caroline; McKeown, Ciarán; Zhang, Xiaodong; Freemont, Paul S.
2014-01-01
The type II AAA+ protein p97 is involved in numerous cellular activities, including endoplasmic reticulum-associated degradation, transcription activation, membrane fusion and cell-cycle control. These activities are at least in part regulated by the ubiquitin system, in which p97 is thought to target ubiquitylated protein substrates within macromolecular complexes and assist in their extraction or disassembly. Although ATPase activity is essential for p97 function, little is known about how ATP binding or hydrolysis is coupled with p97 conformational changes and substrate remodelling. Here, we have used single-particle electron cryomicroscopy (cryo-EM) to study the effect of nucleotides on p97 conformation. We have identified conformational heterogeneity within the cryo-EM datasets from which we have resolved two major p97 conformations. A comparison of conformations reveals inter-ring rotations upon nucleotide binding and hydrolysis that may be linked to the remodelling of target protein complexes. PMID:24598262
Silva-Junior, Orzenil B; Grattapaglia, Dario
2015-11-01
We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing
2014-12-01
Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.
Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi
2017-01-01
Background: Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. Aims: To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Study Design: Case-control study. Methods: The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Results: Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. Conclusion: The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients. PMID:28443596
A movie of the RNA polymerase nucleotide addition cycle.
Brueckner, Florian; Ortiz, Julio; Cramer, Patrick
2009-06-01
During gene transcription, RNA polymerase (Pol) passes through repetitive cycles of adding a nucleotide to the growing mRNA chain. Here we obtained a movie of the nucleotide addition cycle by combining structural information on different functional states of the Pol II elongation complex (EC). The movie illustrates the two-step loading of the nucleoside triphosphate (NTP) substrate, closure of the active site for catalytic nucleotide incorporation, and the presumed two-step translocation of DNA and RNA, which is accompanied by coordinated conformational changes in the polymerase bridge helix and trigger loop. The movie facilitates teaching and a mechanistic analysis of transcription and can be downloaded from http://www.lmb.uni-muenchen.de/cramer/pr-materials.
Conformational transitions in DNA polymerase I revealed by single-molecule FRET
Santoso, Yusdi; Joyce, Catherine M.; Potapova, Olga; Le Reste, Ludovic; Hohlbein, Johannes; Torella, Joseph P.; Grindley, Nigel D. F.; Kapanidis, Achillefs N.
2010-01-01
The remarkable fidelity of most DNA polymerases depends on a series of early steps in the reaction pathway which allow the selection of the correct nucleotide substrate, while excluding all incorrect ones, before the enzyme is committed to the chemical step of nucleotide incorporation. The conformational transitions that are involved in these early steps are detectable with a variety of fluorescence assays and include the fingers-closing transition that has been characterized in structural studies. Using DNA polymerase I (Klenow fragment) labeled with both donor and acceptor fluorophores, we have employed single-molecule fluorescence resonance energy transfer to study the polymerase conformational transitions that precede nucleotide addition. Our experiments clearly distinguish the open and closed conformations that predominate in Pol-DNA and Pol-DNA-dNTP complexes, respectively. By contrast, the unliganded polymerase shows a broad distribution of FRET values, indicating a high degree of conformational flexibility in the protein in the absence of its substrates; such flexibility was not anticipated on the basis of the available crystallographic structures. Real-time observation of conformational dynamics showed that most of the unliganded polymerase molecules sample the open and closed conformations in the millisecond timescale. Ternary complexes formed in the presence of mismatched dNTPs or complementary ribonucleotides show unique FRET species, which we suggest are relevant to kinetic checkpoints that discriminate against these incorrect substrates. PMID:20080740
The first 3':5'-cyclic nucleotide-amino acid complex: L-His-cIMP.
Slepokura, Katarzyna
2012-08-01
In the crystal structure of the L-His-cIMP complex, i.e. L-histidinium inosine 3':5'-cyclic phosphate [systematic name: 5-(2-amino-2-carboxyethyl)-1H-imidazol-3-ium 7-hydroxy-2-oxo-6-(6-oxo-6,9-dihydro-1H-purin-9-yl)-4a,6,7,7a-tetrahydro-4H-1,3,5,2λ(5)-furo[3,2-d][1,3,2λ(5)]dioxaphosphinin-2-olate], C(6)H(10)N(3)O(2)(+)·C(10)H(10)N(4)O(7)P(-), the Hoogsteen edge of the hypoxanthine (Hyp) base of cIMP and the Hyp face are engaged in specific amino acid-nucleotide (His···cIMP) recognition, i.e. by abutting edge-to-edge and by π-π stacking, respectively. The Watson-Crick edge of Hyp and the cIMP phosphate group play a role in nonspecific His···cIMP contacts. The interactions between the cIMP anions (anti/C3'-endo/trans-gauche/chair conformers) are realized mainly between riboses and phosphate groups. The results for this L-His-cIMP complex, compared with those for the previously reported solvated L-His-IMP crystal structure, indicate a different nature of amino acid-nucleotide recognition and interactions upon the 3':5'-cyclization of the nucleotide phosphate group.
Crystal Structures of MEK1 Binary and Ternary Complexes with Nucleotides and Inhibitors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fischmann, Thierry O.; Smith, Catherine K.; Mayhood, Todd W.
MEK1 is a member of the MAPK signal transduction pathway that responds to growth factors and cytokines. We have determined that the kinase domain spans residues 35-382 by proteolytic cleavage. The complete kinase domain has been crystallized and its X-ray crystal structure as a complex with magnesium and ATP-{gamma}S determined at 2.1 {angstrom}. Unlike crystals of a truncated kinase domain previously published, the crystals of the intact domain can be grown either as a binary complex with a nucleotide or as a ternary complex with a nucleotide and one of a multitude of allosteric inhibitors. Further, the crystals allow formore » the determination of costructures with ATP competitive inhibitors. We describe the structures of nonphosphorylated MEK1 (npMEK1) binary complexes with ADP and K252a, an ATP-competitive inhibitor (see Table 1), at 1.9 and 2.7 {angstrom} resolution, respectively. Ternary complexes have also been solved between npMEK1, a nucleotide, and an allosteric non-ATP competitive inhibitor: ATP-{gamma}S with compound 1 and ADP with either U0126 or the MEK1 clinical candidate PD325089 at 1.8, 2.0, and 2.5 {angstrom}, respectively. Compound 1 is structurally similar to PD325901. These structures illustrate fundamental differences among various mechanisms of inhibition at the molecular level. Residues 44-51 have previously been shown to play a negative regulatory role in MEK1 activity. The crystal structure of the integral kinase domain provides a structural rationale for the role of these residues. They form helix A and repress enzymatic activity by stabilizing an inactive conformation in which helix C is displaced from its active state position. Finally, the structure provides for the first time a molecular rationale that explains how mutations in MEK may lead to the cardio-facio-cutaneous syndrome.« less
Translational genomics for analysis of complex traits in peanut and sorghum
USDA-ARS?s Scientific Manuscript database
The integration of sequencing and genotype data from natural variation studies (by whole genome resequencing [wgs] or genotype by sequencing [gbs]), transcriptome (RNA-seq) and mutant analysis (also by wgs) facilitated the development of DNA markers in the form of single nucleotide polymorphic (SNP)...
Viral replication. Structural basis for RNA replication by the hepatitis C virus polymerase.
Appleby, Todd C; Perry, Jason K; Murakami, Eisuke; Barauskas, Ona; Feng, Joy; Cho, Aesop; Fox, David; Wetmore, Diana R; McGrath, Mary E; Ray, Adrian S; Sofia, Michael J; Swaminathan, S; Edwards, Thomas E
2015-02-13
Nucleotide analog inhibitors have shown clinical success in the treatment of hepatitis C virus (HCV) infection, despite an incomplete mechanistic understanding of NS5B, the viral RNA-dependent RNA polymerase. Here we study the details of HCV RNA replication by determining crystal structures of stalled polymerase ternary complexes with enzymes, RNA templates, RNA primers, incoming nucleotides, and catalytic metal ions during both primed initiation and elongation of RNA synthesis. Our analysis revealed that highly conserved active-site residues in NS5B position the primer for in-line attack on the incoming nucleotide. A β loop and a C-terminal membrane-anchoring linker occlude the active-site cavity in the apo state, retract in the primed initiation assembly to enforce replication of the HCV genome from the 3' terminus, and vacate the active-site cavity during elongation. We investigated the incorporation of nucleotide analog inhibitors, including the clinically active metabolite formed by sofosbuvir, to elucidate key molecular interactions in the active site. Copyright © 2015, American Association for the Advancement of Science.
Single-molecule comparison of DNA Pol I activity with native and analog nucleotides
NASA Astrophysics Data System (ADS)
Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip
2014-03-01
DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.
Souza, Tatiana A C B; Trindade, Daniel M; Tonoli, Celisa C C; Santos, Camila R; Ward, Richard J; Arni, Raghuvir K; Oliveira, Arthur H C; Murakami, Mário T
2011-07-01
Nucleoside diphosphate kinases play a crucial role in the purine-salvage pathway of trypanosomatid protozoa and have been found in the secretome of Leishmania sp., suggesting a function related to host-cell integrity for the benefit of the parasite. Due to their importance for housekeeping functions in the parasite and by prolonging the life of host cells in infection, they become an attractive target for drug discovery and design. In this work, we describe the first structural characterization of nucleoside diphosphate kinases b from trypanosomatid parasites (tNDKbs) providing insights into their oligomerization, stability and structural determinants for nucleotide binding. Crystallographic studies of LmNDKb when complexed with phosphate, AMP and ADP showed that the crucial hydrogen-bonding residues involved in the nucleotide interaction are fully conserved in tNDKbs. Depending on the nature of the ligand, the nucleotide-binding pocket undergoes conformational changes, which leads to different cavity volumes. SAXS experiments showed that tNDKbs, like other eukaryotic NDKs, form a hexamer in solution and their oligomeric state does not rely on the presence of nucleotides or mimetics. Fluorescence-based thermal-shift assays demonstrated slightly higher stability of tNDKbs compared to human NDKb (HsNDKb), which is in agreement with the fact that tNDKbs are secreted and subjected to variations of temperature in the host cells during infection and disease development. Moreover, tNDKbs were stabilized upon nucleotide binding, whereas HsNDKb was not influenced. Contrasts on the surface electrostatic potential around the nucleotide-binding pocket might be a determinant for nucleotide affinity and protein stability differentiation. All these together demonstrated the molecular adaptation of parasite NDKbs in order to exert their biological functions intra-parasite and when secreted by regulating ATP levels of host cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bae, Brian; Nayak, Dhananjaya; Ray, Ananya
RNA polymerase inhibitors like the CBR class that target the enzyme’s complex catalytic center are attractive leads for new antimicrobials. The catalysis by RNA polymerase involves multiple rearrangements of bridge helix, trigger loop, and active-center side chains that isomerize the triphosphate of bound NTP and two Mg 2+ ions from a preinsertion state to a reactive configuration. CBR inhibitors target a crevice between the N-terminal portion of the bridge helix and a surrounding cap region within which the bridge helix is thought to rearrange during the nucleotide addition cycle. Here, we report crystal structures of CBR inhibitor/Escherichia coli RNA polymerasemore » complexes as well as biochemical tests that establish two distinct effects of the inhibitors on the RNA polymerase catalytic site. One effect involves inhibition of trigger-loop folding via the F loop in the cap, which affects both nucleotide addition and hydrolysis of 3'-terminal dinucleotides in certain backtracked complexes. The second effect is trigger-loop independent, affects only nucleotide addition and pyrophosphorolysis, and may involve inhibition of bridge-helix movements that facilitate reactive triphosphate alignment.« less
Freiderich, John W.; Wanigasekara, Eranda P.; Sun, Xiao-Guang; ...
2013-11-11
Our study demonstrates a direct electrodeposition of UO 2 at a Pt cathode from a solution of uranyl bis(trifluoromethanesulfonyl)imide [UO 2(NTf 2) 2)] in a bulk room-temperature ionic liquid (RTIL), 1-ethyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide (EMIM +NTf 2 –). Cyclic voltammetry (CV) studies revealed two reduction waves corresponding to the conversion of uranium(VI) to uranium(IV), and a mechanism for the overall electroreduction is proposed. A controlled-potential experiment was performed, holding the reduction potential at–1.0 V for 24 h to obtain a brown-black deposit of UO 2 on the Pt cathode. The Faradaic efficiency of the reduction process was determined to be >80%. Themore » UO 2deposit was characterized by powder X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS).« less
De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim
2016-10-28
Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Vries, D.D.; Oost, B.A. van; Went, L.N.
1996-04-01
A rare form of Leber hereditary optic neuropathy (LHON) that is associated with hereditary spastic dystonia has been studied in a large Dutch family. Neuropathy and ophthalmological lesions were present together in some family members, whereas only one type of abnormality was found in others. mtDNA mutations previously reported in LHON were not present. Sequence analysis of the protein-coding mitochondrial genes revealed two previously unreported mtDNA mutations. A heteroplasmic A{yields}G transition at nucleotide position 11696 in the ND4 gene resulted in the substitution of an isoleucine for valine at amino acid position 312. A second mutation, a homoplasmic T{yields}A transitionmore » at nucleotide position 14596 in the ND6 gene, resulted in the substitution of a methionine for the isoleucine at amino acid residue 26. Biochemical analysis of a muscle biopsy revealed a severe complex I deficiency, providing a link between these unique mtDNA mutations and this rare, complex phenotype including Leber optic neuropathy. 80 refs., 2 figs., 3 tabs.« less
Cuomo, Francesca; Mosca, Monica; Murgia, Sergio; Avino, Pasquale; Ceglie, Andrea; Lopez, Francesco
2013-11-15
In this work, the interaction of nucleotide-monophosphates (NMPs) with unilamellar liposomes made of 1,2-Dioleoyl-3-Trimethylammonium-Propane (DOTAP) and 1,2-Dioleoyl-sn-Glycero-3-Phosphoethanolamine (DOPE) was investigated. Here, we demonstrate how adsorption is affected by the type of nucleotide-monophosphate. Dynamic light scattering (DLS) results revealed, for each NMP, that a distinguishable concentration exists at which a significant growth of the aggregates occurs. Adenosine 5'-monophosphate (AMP) and guanosine 5'-monophosphate (GMP) have shown a higher propensity to induce liposome aggregation process and in particular GMP appears to be the most effective. From ζ-potential experiments we found that liposomes loaded with purine based nucleotides (AMP and GMP) are able to decrease the ζ-potential values to a greater extent in comparison with the pyrimidine based nucleotides thimydine 5'-monophosphate (TMP) and uridine 5'-monophosphate (UMP). Moreover, a careful analysis of nucleotide-liposome interactions revealed that nucleotides have different capacity to induce the formation of nucleotide-liposome complexes, and purine based nucleotides have higher affinities with lipid membranes. On the whole, the data emphasize that the mechanisms driving the interactions between liposomes and NMPs are also influenced by the existence of hydrophobic forces. Copyright © 2013 Elsevier Inc. All rights reserved.
Man, Si Ming; Hopkins, Lee J; Nugent, Eileen; Cox, Susan; Glück, Ivo M; Tourlomousis, Panagiotis; Wright, John A; Cicuta, Pietro; Monie, Tom P; Bryant, Clare E
2014-05-20
Pathogen recognition by nucleotide-binding oligomerization domain-like receptor (NLR) results in the formation of a macromolecular protein complex (inflammasome) that drives protective inflammatory responses in the host. It is thought that the number of inflammasome complexes forming in a cell is determined by the number of NLRs being activated, with each NLR initiating its own inflammasome assembly independent of one another; however, we show here that the important foodborne pathogen Salmonella enterica serovar Typhimurium (S. Typhimurium) simultaneously activates at least two NLRs, whereas only a single inflammasome complex is formed in a macrophage. Both nucleotide-binding domain and leucine-rich repeat caspase recruitment domain 4 and nucleotide-binding domain and leucine-rich repeat pyrin domain 3 are simultaneously present in the same inflammasome, where both NLRs are required to drive IL-1β processing within the Salmonella-infected cell and to regulate the bacterial burden in mice. Superresolution imaging of Salmonella-infected macrophages revealed a macromolecular complex with an outer ring of apoptosis-associated speck-like protein containing a caspase activation and recruitment domain and an inner ring of NLRs, with active caspase effectors containing the pro-IL-1β substrate localized internal to the ring structure. Our data reveal the spatial localization of different components of the inflammasome and how different members of the NLR family cooperate to drive robust IL-1β processing during Salmonella infection.
Zhang, Jin; Ruhlman, Tracey A.; Sabir, Jamal S. M.; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K.
2016-01-01
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear–plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. PMID:26893456
Tuominen, H; Salminen, A; Oksanen, E; Jämsen, J; Heikkilä, O; Lehtiö, L; Magretova, N N; Goldman, A; Baykov, A A; Lahti, R
2010-05-07
Nucleotide-binding cystathionine beta-synthase (CBS) domains serve as regulatory units in numerous proteins distributed in all kingdoms of life. However, the underlying regulatory mechanisms remain to be established. Recently, we described a subfamily of CBS domain-containing pyrophosphatases (PPases) within family II PPases. Here, we express a novel CBS-PPase from Clostridium perfringens (CPE2055) and show that the enzyme is inhibited by AMP and activated by a novel effector, diadenosine 5',5-P1,P4-tetraphosphate (AP(4)A). The structures of the AMP and AP(4)A complexes of the regulatory region of C. perfringens PPase (cpCBS), comprising a pair of CBS domains interlinked by a DRTGG domain, were determined at 2.3 A resolution using X-ray crystallography. The structures obtained are the first structures of a DRTGG domain as part of a larger protein structure. The AMP complex contains two AMP molecules per cpCBS dimer, each bound to a single monomer, whereas in the activator-bound complex, one AP(4)A molecule bridges two monomers. In the nucleotide-bound structures, activator binding induces significant opening of the CBS domain interface, compared with the inhibitor complex. These results provide structural insight into the mechanism of CBS-PPase regulation by nucleotides. Copyright 2010 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barta, Michael L.; McWhorter, William J.; Miziorko, Henry M.
2012-09-17
Mevalonate diphosphate decarboxylase (MDD) catalyzes the final step of the mevalonate pathway, the Mg{sup 2+}-ATP dependent decarboxylation of mevalonate 5-diphosphate (MVAPP), producing isopentenyl diphosphate (IPP). Synthesis of IPP, an isoprenoid precursor molecule that is a critical intermediate in peptidoglycan and polyisoprenoid biosynthesis, is essential in Gram-positive bacteria (e.g., Staphylococcus, Streptococcus, and Enterococcus spp.), and thus the enzymes of the mevalonate pathway are ideal antimicrobial targets. MDD belongs to the GHMP superfamily of metabolite kinases that have been extensively studied for the past 50 years, yet the crystallization of GHMP kinase ternary complexes has proven to be difficult. To further ourmore » understanding of the catalytic mechanism of GHMP kinases with the purpose of developing broad spectrum antimicrobial agents that target the substrate and nucleotide binding sites, we report the crystal structures of wild-type and mutant (S192A and D283A) ternary complexes of Staphylococcus epidermidis MDD. Comparison of apo, MVAPP-bound, and ternary complex wild-type MDD provides structural information about the mode of substrate binding and the catalytic mechanism. Structural characterization of ternary complexes of catalytically deficient MDD S192A and D283A (k{sub cat} decreased 10{sup 3}- and 10{sup 5}-fold, respectively) provides insight into MDD function. The carboxylate side chain of invariant Asp{sup 283} functions as a catalytic base and is essential for the proper orientation of the MVAPP C3-hydroxyl group within the active site funnel. Several MDD amino acids within the conserved phosphate binding loop ('P-loop') provide key interactions, stabilizing the nucleotide triphosphoryl moiety. The crystal structures presented here provide a useful foundation for structure-based drug design.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Yen-Chen; Naveen, Vankadari; Molecular Cell Biology, Taiwan International Graduate Program, Institute of Molecular Biology, Academia Sinica, and Graduate Institute of Life Sciences, National Defense Medical Center, Taipei, Taiwan
During DNA replication, bacterial helicase is recruited as a complex in association with loader proteins to unwind the parental duplex. Previous structural studies have reported saturated 6:6 helicase-loader complexes with different conformations. However, structural information on the sub-stoichiometric conformations of these previously-documented helicase-loader complexes remains elusive. Here, with the aid of single particle electron-microscopy (EM) image reconstruction, we present the Geobacillus kaustophilus HTA426 helicase-loader (DnaC-DnaI) complex with a 6:2 binding stoichiometry in the presence of ATPγS. In the 19 Å resolution EM map, the undistorted and unopened helicase ring holds a robust loader density above the C-terminal RecA-like domain. Meanwhile, themore » path of the central DNA binding channel appears to be obstructed by the reconstructed loader density, implying its potential role as a checkpoint conformation to prevent the loading of immature complex onto DNA. Our data also reveals that the bound nucleotides and the consequently induced conformational changes in the helicase hexamer are essential for active association with loader proteins. These observations provide fundamental insights into the formation of the helicase-loader complex in bacteria that regulates the DNA replication process. - Highlights: • Helicase-loader complex structure with 6:2 sub-stoichiometry is resolved by EM. • Helicase hexamer in 6:2 sub-stoichiometry is constricted and un-opened. • 6:2 binding ratio of helicase-loader complex could act as a DNA loading checkpoint. • Nucleotides stabilize helicase-loader complex at low protein concentrations.« less
Substitution rate and natural selection in parvovirus B19
Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.
2016-01-01
The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080
Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A
2017-04-01
Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.
Evidence for a Complex Class of Nonadenylated mRNA in Drosophila
Zimmerman, J. Lynn; Fouts, David L.; Manning, Jerry E.
1980-01-01
The amount, by mass, of poly(A+) mRNA present in the polyribosomes of third-instar larvae of Drosophila melanogaster, and the relative contribution of the poly(A+) mRNA to the sequence complexity of total polysomal RNA, has been determined. Selective removal of poly(A+) mRNA from total polysomal RNA by use of either oligo-dT-cellulose, or poly(U)-sepharose affinity chromatography, revealed that only 0.15% of the mass of the polysomal RNA was present as poly(A+) mRNA. The present study shows that this RNA hybridized at saturation with 3.3% of the single-copy DNA in the Drosophila genome. After correction for asymmetric transcription and reactability of the DNA, 7.4% of the single-copy DNA in the Drosophila genome is represented in larval poly(A+) mRNA. This corresponds to 6.73 x 106 nucleotides of mRNA coding sequences, or approximately 5,384 diverse RNA sequences of average size 1,250 nucleotides. However, total polysomal RNA hybridizes at saturation to 10.9% of the single-copy DNA sequences. After correcting this value for asymmetric transcription and tracer DNA reactability, 24% of the single-copy DNA in Drosophila is represented in total polysomal RNA. This corresponds to 2.18 x 107 nucleotides of RNA coding sequences or 17,440 diverse RNA molecules of size 1,250 nucleotides. This value is 3.2 times greater than that observed for poly(A+) mRNA, and indicates that ≃69% of the polysomal RNA sequence complexity is contributed by nonadenylated RNA. Furthermore, if the number of different structural genes represented in total polysomal RNA is ≃1.7 x 104, then the number of genes expressed in third-instar larvae exceeds the number of chromomeres in Drosophila by about a factor of three. This numerology indicates that the number of chromomeres observed in polytene chromosomes does not reflect the number of structural gene sequences in the Drosophila genome. PMID:6777246
Andhirka, Sai Krishna; Vignesh, Ravichandran; Aradhyam, Gopala Krishna
2017-08-01
Deciphering the mechanism of activation of heterotrimeric G proteins by their cognate receptors continues to be an intriguing area of research. The recently solved crystal structure of the ternary complex captured the receptor-bound α-subunit in an open conformation, without bound nucleotide has improved our understanding of the activation process. Despite these advancements, the mechanism by which the receptor causes GDP release from the α-subunit remains elusive. To elucidate the mechanism of activation, we studied guanine nucleotide-induced structural stability of the α-subunit (in response to thermal/chaotrope-mediated stress). Inherent stabilities of the inactive (GDP-bound) and active (GTP-bound) forms contribute antagonistically to the difference in conformational stability whereas the GDP-bound protein is able to switch to a stable intermediate state, GTP-bound protein loses this ability. Partial perturbation of the protein fold reveals the underlying influence of the bound nucleotide providing an insight into the mechanism of activation. An extra stable, pretransition intermediate, 'empty pocket' state (conformationally active-state like) in the unfolding pathway of GDP-bound protein mimics a gating system - the activation process having to overcome this stable intermediate state. We demonstrate that a relatively more complex conformational fold of the GDP-bound protein is at the core of the gating system. We report capturing this threshold, 'metastable empty pocket' conformation (the gate) of α-subunit of G protein and hypothesize that the receptor activates the G protein by enabling it to achieve this structure through mild structural perturbation. © 2017 Federation of European Biochemical Societies.
Sounds of silence: synonymous nucleotides as a key to biological regulation and complexity
Shabalina, Svetlana A.; Spiridonov, Nikolay A.; Kashina, Anna
2013-01-01
Messenger RNA is a key component of an intricate regulatory network of its own. It accommodates numerous nucleotide signals that overlap protein coding sequences and are responsible for multiple levels of regulation and generation of biological complexity. A wealth of structural and regulatory information, which mRNA carries in addition to the encoded amino acid sequence, raises the question of how these signals and overlapping codes are delineated along non-synonymous and synonymous positions in protein coding regions, especially in eukaryotes. Silent or synonymous codon positions, which do not determine amino acid sequences of the encoded proteins, define mRNA secondary structure and stability and affect the rate of translation, folding and post-translational modifications of nascent polypeptides. The RNA level selection is acting on synonymous sites in both prokaryotes and eukaryotes and is more common than previously thought. Selection pressure on the coding gene regions follows three-nucleotide periodic pattern of nucleotide base-pairing in mRNA, which is imposed by the genetic code. Synonymous positions of the coding regions have a higher level of hybridization potential relative to non-synonymous positions, and are multifunctional in their regulatory and structural roles. Recent experimental evidence and analysis of mRNA structure and interspecies conservation suggest that there is an evolutionary tradeoff between selective pressure acting at the RNA and protein levels. Here we provide a comprehensive overview of the studies that define the role of silent positions in regulating RNA structure and processing that exert downstream effects on proteins and their functions. PMID:23293005
Mostapha, S; Berthon, C; Fontaine-Vive, F; Gaysinski, M; Guérin, L; Guillaumont, D; Massi, L; Monfardini, I; Solari, P L; Thomas, O P; Charbonnel, M C; Den Auwer, C
2014-02-01
Although the physiological impact of the actinide elements as nuclear toxicants has been widely investigated for half a century, a description of their interactions with biological molecules remains limited. It is however of primary importance to better assess the determinants of actinide speciation in cells and more generally in living organisms to unravel the molecular processes underlying actinide transport and deposition in tissues. The biological pathways of this family of elements in case of accidental contamination or chronic natural exposure (in the case of uranium rich soils for instance) are therefore a crucial issue of public health and of societal impact. Because of the high chemical affinity of those actinide elements for phosphate groups and the ubiquity of such chemical functions in biochemistry, phosphate derivatives are considered as probable targets of these cations. Among them, nucleotides and in particular adenosine mono- (AMP) and triphosphate (ATP) nucleotides occur in more chemical reactions than any other compounds on the earth's surface, except water, and are therefore critical target molecules. In the present study, we are interested in trans-plutonium actinide elements, in particular americium and curium that are more rarely considered in environmental and bioaccumulation studies than early actinides like uranium, neptunium and plutonium. A first step in this strategy is to work with chemical analogues like lanthanides that are not radioactive and therefore allow extended physical chemical characterization to be conducted that are difficult to perform with radioactive materials. We describe herein the interaction of lutetium(III) with adenosine AMP and ATP. With AMP and ATP, insoluble amorphous compounds have been obtained with molar ratios of 1:2 and 1:1, respectively. With an excess of ATP, with 1:2 molar ratio, a soluble complex has been obtained. A combination of spectroscopic techniques (IR, NMR, ESI-MS, EXAFS) together with quantum chemical calculations has been implemented in order to assess the lutetium coordination arrangement for the two nucleotides. In all the complexes described in the article, the lutetium cation is coordinated by the phosphate groups of the nucleotide plus additional putative water molecules with various tridimensional arrangements. With AMP 1:2 and ATP 1:1 solid-state compounds, polynuclear complexes are assumed to be obtained. In contrast, with ATP 1:2 soluble compound, the Lu coordination sphere is saturated by two ATP ligands, and this favors the formation of a mononuclear complex. In order to further interpret the EXAFS data obtained at the Lu LIII edge, model structures have been calculated for the 1:1 and 1:2 ATP complexes. They are discussed and compared to the EXAFS best fit metrical parameters.
Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi
2017-05-05
Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Case-control study. The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients.
van der Spek, P J; Eker, A; Rademakers, S; Visser, C; Sugasawa, K; Masutani, C; Hanaoka, F; Bootsma, D; Hoeijmakers, J H
1996-01-01
The xeroderma pigmentosum syndrome complementation group C (XP-C) is due to a defect in the global genome repair subpathway of nucleotide excision repair (NER). The XPC protein is complexed with HHR23B, one of the two human homologs of the yeast NER protein, RAD23 (Masutani at al. (1994) EMBO J. 8, 1831-1843). Using heparin chromatography, gel filtration and native gel electrophoresis we demonstrate that the majority of HHR23B is in a free, non-complexed form, and that a minor fraction is tightly associated with XPC. In contrast, we cannot detect any bound HHR23A. Thus the HHR23 proteins may have an additional function independent of XPC. The fractionation behaviour suggests that the non-bound forms of the HHR23 proteins are not necessary for the core of the NER reaction. Although both HHR23 proteins share a high level of overall homology, they migrate very differently on native gels, pointing to a difference in conformation. Gel filtration suggests the XPC-HHR23B heterodimer resides in a high MW complex. However, immunodepletion studies starting from repair-competent Manley extracts fall to reveal a stable association of a significant fraction of the HHR23 proteins or the XPC-HHR23B complex with the basal transcription/repair factor TFIIH, or with the ERCC1 repair complex. Consistent with a function in repair or DNA/chromatin metabolism, immunofluorescence studies show all XPC, HHR23B and (the free) HHR23A to reside in the nucleus. PMID:8692695
Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.
Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L
2014-07-08
We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are complex, with internal promoters and terminators generating multiple transcription units and allowing differential gene expression within these operons. We discovered extensive antisense transcription that results from more than 500 operons, which fully overlap or extensively overlap adjacent divergent or convergent operons. The genomic regions corresponding to these antisense transcripts are highly conserved in E. coli (including Shigella species), although it remains to be proven whether or not they are functional. Our observations of features unearthed by single-nucleotide transcriptome mapping suggest that deeper layers of transcriptional regulation in bacteria are likely to be revealed in the future. Copyright © 2014 Conway et al.
Nucleotide-dependent assembly of the peroxisomal receptor export complex
Grimm, Immanuel; Saffian, Delia; Girzalsky, Wolfgang; Erdmann, Ralf
2016-01-01
Pex1p and Pex6p are two AAA-ATPases required for biogenesis of peroxisomes. Both proteins form a hetero-hexameric complex in an ATP-dependent manner, which has a dual localization in the cytosol and at the peroxisomal membrane. At the peroxisomal membrane, the complex is responsible for the release of the import receptor Pex5p at the end of the matrix protein import cycle. In this study, we analyzed the recruitment of the AAA-complex to its anchor protein Pex15p at the peroxisomal membrane. We show that the AAA-complex is properly assembled even under ADP-conditions and is able to bind efficiently to Pex15p in vivo. We reconstituted binding of the Pex1/6p-complex to Pex15p in vitro and show that Pex6p mediates binding to the cytosolic part of Pex15p via a direct interaction. Analysis of the isolated complex revealed a stoichiometry of Pex1p/Pex6p/Pex15p of 3:3:3, indicating that each Pex6p molecule of the AAA-complex binds Pex15p. Binding of the AAA-complex to Pex15p in particular and to the import machinery in general is stabilized when ATP is bound to the second AAA-domain of Pex6p and its hydrolysis is prevented. The data indicate that receptor release in peroxisomal protein import is associated with a nucleotide-depending Pex1/6p-cycle of Pex15p-binding and release. PMID:26842748
Clifton, Matthew C.; Simon, Michael J.; Erramilli, Satchal K.; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A.; Stauffacher, Cynthia V.
2015-01-01
Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg2+. We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg2+, and VO4); a RbsAC complex in the presence of ADP and Mg2+; and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters. PMID:25533465
The effect of humic acid on uranyl sorption onto bentonite at trace uranium levels.
Ivanov, Peter; Griffiths, Tamara; Bryan, Nick D; Bozhikov, Gospodin; Dmitriev, Serguei
2012-11-01
The effect of humic acid (HA) on U(VI) sorption on bentonite was studied in batch experiments at room temperature and ambient atmosphere at a (237)U(VI) concentration of 8.4 × 10(-11) M and HA concentration of 100 mg L(-1). The distribution of U(VI) between the liquid and solid phases was studied as a function of pH and ionic strength both in the absence and presence of HA. It was shown that the uranyl sorption on bentonite is strongly dependent on pH and the presence of humics, and the effect of the addition order was negligible. In the absence of HA an enhancement in the uptake with increasing pH was observed and a sharp sorption edge was found to take place between pH 3.2 and 4.2. The presence of HA slightly increases uranium(VI) sorption at low pH and curtails it at moderate pH, compared to the absence of HA. In the basic pH range for both the presence and absence of HA the sorption of uranium is significantly reduced, which could be attributed to the formation of soluble uranyl carbonate complexes. The influence of ionic strength on U(VI) and HA uptake by bentonite were investigated in the range of 0.01-1.0 M, and while there was an enhancement in the sorption of humic acid with increasing ionic strength, no significant effect of the ionic strength on the U(VI) sorption was observed in both the absence and presence of HA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Yingjie, E-mail: yzx@ansto.gov.au; Bhadbhade, Mohan; Karatchevtseva, Inna
Three new coordination polymers of uranium(VI) with pyromellitic acid (H{sub 4}btca) have been synthesized and structurally characterized. (ED)[(UO{sub 2})(btca)]·(DMSO)·3H{sub 2}O (1) (ED=ethylenediammonium; DMSO=dimethylsulfoxide) has a lamellar structure with intercalation of ED and DMSO. (NH{sub 4}){sub 2}[(UO{sub 2}){sub 6}O{sub 2}(OH){sub 6}(btca)]·~6H{sub 2}O (2) has a 3D framework built from 7-fold coordinated uranyl trinuclear units and btca ligands with 1D diamond-shaped channels (~8.5 Å×~8.6 Å). [(UO{sub 2}){sub 2}(H{sub 2}O)(btca)]·4H{sub 2}O (3) has a 3D network constructed by two types of 7-fold coordinated uranium polyhedron. The unique μ{sub 5}-coordination mode of btca in 3 enables the formation of 1D olive-shaped large channels (~4.5more » Å×~19 Å). Vibrational modes, thermal stabilities and fluorescence properties have been investigated. - Graphical abstract: Table of content: three new uranium(VI) coordination polymers with pyromellitic acid (H{sub 4}btca) have been synthesized via room temperature and hydrothermal synthesis methods, and structurally characterized. Two to three dimensional (3D) frameworks are revealed. All 3D frameworks have unique 1D large channels. Their vibrational modes, thermal stabilities and photoluminescence properties have been investigated. - Highlights: • Three new coordination polymers of U(VI) with pyromellitic acid (H{sub 4}btca). • Structures from a 2D layer to 3D frameworks with unique 1D channels. • Unusual µ{sub 5}-(η{sub 1}:η{sub 2}:η{sub 1}:η{sub 2:}η{sub 1}) coordination mode of btca ligand. • Vibrational modes, thermal stabilities and luminescent properties reported.« less
Superstatistical model of bacterial DNA architecture
NASA Astrophysics Data System (ADS)
Bogachev, Mikhail I.; Markelov, Oleg A.; Kayumov, Airat R.; Bunde, Armin
2017-02-01
Understanding the physical principles that govern the complex DNA structural organization as well as its mechanical and thermodynamical properties is essential for the advancement in both life sciences and genetic engineering. Recently we have discovered that the complex DNA organization is explicitly reflected in the arrangement of nucleotides depicted by the universal power law tailed internucleotide interval distribution that is valid for complete genomes of various prokaryotic and eukaryotic organisms. Here we suggest a superstatistical model that represents a long DNA molecule by a series of consecutive ~150 bp DNA segments with the alternation of the local nucleotide composition between segments exhibiting long-range correlations. We show that the superstatistical model and the corresponding DNA generation algorithm explicitly reproduce the laws governing the empirical nucleotide arrangement properties of the DNA sequences for various global GC contents and optimal living temperatures. Finally, we discuss the relevance of our model in terms of the DNA mechanical properties. As an outlook, we focus on finding the DNA sequences that encode a given protein while simultaneously reproducing the nucleotide arrangement laws observed from empirical genomes, that may be of interest in the optimization of genetic engineering of long DNA molecules.
Huang, Xuhui; Wang, Dong; Weiss, Dahlia R.; Bushnell, David A.; Kornberg, Roger D.; Levitt, Michael
2010-01-01
A structurally conserved element, the trigger loop, has been suggested to play a key role in substrate selection and catalysis of RNA polymerase II (pol II) transcription elongation. Recently resolved X-ray structures showed that the trigger loop forms direct interactions with the β-phosphate and base of the matched nucleotide triphosphate (NTP) through residues His1085 and Leu1081, respectively. In order to understand the role of these two critical residues in stabilizing active site conformation in the dynamic complex, we performed all-atom molecular dynamics simulations of the wild-type pol II elongation complex and its mutants in explicit solvent. In the wild-type complex, we found that the trigger loop is stabilized in the “closed” conformation, and His1085 forms a stable interaction with the NTP. Simulations of point mutations of His1085 are shown to affect this interaction; simulations of alternative protonation states, which are inaccessible through experiment, indicate that only the protonated form is able to stabilize the His1085-NTP interaction. Another trigger loop residue, Leu1081, stabilizes the incoming nucleotide position through interaction with the nucleotide base. Our simulations of this Leu mutant suggest a three-component mechanism for correctly positioning the incoming NTP in which (i) hydrophobic contact through Leu1081, (ii) base stacking, and (iii) base pairing work together to minimize the motion of the incoming NTP base. These results complement experimental observations and provide insight into the role of the trigger loop on transcription fidelity. PMID:20798057
Su, Ming; Lee, Daniel; Ganss, Bernhard; Sodek, Jaro
2006-04-14
Basal transcription of the bone sialoprotein gene is mediated by highly conserved inverted CCAAT (ICE; ATTGG) and TATA elements (TTTATA) separated by precisely 21 nucleotides. Here we studied the importance of the relative position and orientation of the CCAAT and TATA elements in the proximal promoter by measuring the transcriptional activity of a series of mutated reporter constructs in transient transfection assays. Whereas inverting the TTTATA (wild type) to a TATAAA (consensus TATA) sequence increased transcription slightly, transcription was reduced when the flanking dinucleotides were also inverted. In contrast, reversing the ATTGG (wild type; ICE) to a CCAAT (RICE) sequence caused a marked reduction in transcription, whereas both transcription and NF-Y binding were progressively increased with the simultaneous inversion of flanking nucleotides (f-RICE-f). Reducing the distance between the ICE and TATA elements produced cyclical changes in transcriptional activity that correlated with progressive alterations in the relative positions of the CCAAT and TATA elements on the face of the DNA helix. Minimal transcription was observed after 5 nucleotides were deleted (equivalent to approximately one half turn of the helix), whereas transcription was fully restored after deleting 10 nucleotides (approximately one full turn of the DNA helix), transcriptional activity being progressively lost with deletions beyond 10 nucleotides. In comparison, when deletions were made with the ICE in the reversed (f-RICE-f) orientation transcriptional activity was progressively lost with no recovery. These results show that, although transcription can still occur when the CCAAT box is reversed and/or displaced relative to the TATA box, the activity is dependent upon the flexibility of the intervening DNA helix needed to align the NF-Y complex on the CCAAT box with preinitiation complex proteins that bind to the TATA box. Thus, the precise location and orientation of the CCAAT element is necessary for optimizing basal transcription of the bone sialoprotein gene.
Cell proteins bind to multiple sites within the 5' untranslated region of poliovirus RNA.
del Angel, R M; Papavassiliou, A G; Fernández-Tomás, C; Silverstein, S J; Racaniello, V R
1989-01-01
The 5' noncoding region of poliovirus RNA contains sequences necessary for translation and replication. These functions are probably carried out by recognition of poliovirus RNA by cellular and/or viral proteins. Using a mobility-shift electrophoresis assay and 1,10-phenanthroline/Cu+ footprinting, we demonstrate specific binding of cytoplasmic factors with a sequence from nucleotides 510-629 within the 5' untranslated region (UTR). Complex formation was also observed with a second sequence (nucleotides 97-182) within the 5' UTR. These two regions of the 5' UTR appear to be recognized by distinct cell factors as determined by competition analysis and the effects of ionic strength on complex formation. However, both complexes contain eukaryotic initiation factor 2 alpha, as revealed by their reaction with specific antibody. Images PMID:2554308
Ribosome Biogenesis in the Yeast Saccharomyces cerevisiae
Woolford, John L.; Baserga, Susan J.
2013-01-01
Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922
Ding, Xi-Qin; Matveev, Alexander; Singh, Anil; Komori, Naoka; Matsumoto, Hiroyuki
2012-01-01
Cone vision mediated by photoreceptor cyclic nucleotide-gated (CNG) channel is essential for central and color vision and visual acuity. Cone CNG channel is composed of two structurally related subunit types, CNGA3 and CNGB3. Naturally occurring mutations in cone CNG channel are associated with a variety of cone diseases including achromatopsia, progressive cone dystrophy, and some maculopathies. Nevertheless, our understanding of the structure of cone CNG channel is quite limited. This is, in part, due to the challenge of studying cones in a rod-dominant mammalian retina. We have demonstrated a robust expression of cone CNG channel and lack of rod CNG channel in the cone-dominant Nrl−/− retina and shown that the Nrl−/− mouse line is a valuable model to study cone CNG channel. This work examined the complex structure of cone CNG channel using infrared fluorescence Western detection combined with chemical cross-linking and blue native-PAGE. Our results suggest that the native cone CNG channel is a heterotetrameric complex likely at a stoichiometry of three CNGA3 and one CNGB3. PMID:22183405
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome
Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274
Burnett, Benjamin J.; Altman, Roger B.; Ferrao, Ryan; Alejo, Jose L.; Kaur, Navdep; Kanji, Joshua; Blanchard, Scott C.
2013-01-01
Aminoacyl-tRNA enters the translating ribosome in a ternary complex with elongation factor Tu (EF-Tu) and GTP. Here, we describe bulk steady state and pre-steady state fluorescence methods that enabled us to quantitatively explore the kinetic features of Escherichia coli ternary complex formation and decay. The data obtained suggest that both processes are controlled by a nucleotide-dependent, rate-determining conformational change in EF-Tu. Unexpectedly, we found that this conformational change is accelerated by elongation factor Ts (EF-Ts), the guanosine nucleotide exchange factor for EF-Tu. Notably, EF-Ts attenuates the affinity of EF-Tu for GTP and destabilizes ternary complex in the presence of non-hydrolyzable GTP analogs. These results suggest that EF-Ts serves an unanticipated role in the cell of actively regulating the abundance and stability of ternary complex in a manner that contributes to rapid and faithful protein synthesis. PMID:23539628
Chen, L P; E, G X; Zhao, Y J; Na, R S; Zhao, Z Q; Zhang, J H; Ma, Y H; Sun, Y W; Zhong, T; Zhang, H P; Huang, Y F
2015-06-18
DRA encodes the alpha chain of the DR heterodimer, is closely linked to DRB and is considered almost monomorphic in major histocompatibility complex region. In this study, we identified the exon 2 of DRA to evaluate the immunogenetic diversity of Chinese south indigenous goat. Two single nucleotide polymorphisms in an untranslated region and one synonymous substitution in coding region were identified. These data suggest that high immunodiversity in native Chinese population.
RNActive® Technology: Generation and Testing of Stable and Immunogenic mRNA Vaccines.
Rauch, Susanne; Lutz, Johannes; Kowalczyk, Aleksandra; Schlake, Thomas; Heidenreich, Regina
2017-01-01
Developing effective mRNA vaccines poses certain challenges concerning mRNA stability and ability to induce sufficient immune stimulation and requires a specific panel of techniques for production and testing. Here, we describe the production of stabilized mRNA with enhanced immunogenicity, generated using conventional nucleotides only, by introducing changes to the mRNA sequence and by complexation with the nucleotide-binding peptide protamine (RNActive® technology). Methods described here include the synthesis, purification, and protamine complexation of mRNA vaccines as well as a comprehensive panel of in vitro and in vivo methods for evaluation of vaccine quality and immunogenicity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harmer, Nicholas J., E-mail: nic@cryst.bioc.cam.ac.uk; King, Jerry D.; Department of Veterinary Medicine, Cambridge CB3 0ES
2007-08-01
The expression, purification, and crystallisation of the short-chain dehydrogenases WbmF, WbmG and WbmH from B. bronchiseptica are described. Native diffraction data to 1.5, 2.0, and 2.2 Å were obtained for the three proteins, together with complexes with nucleotides. The short-chain dehydrogenase enzymes WbmF, WbmG and WbmH from Bordetella bronchiseptica were cloned into Escherichia coli expression vectors, overexpressed and purified to homogeneity. Crystals of all three wild-type enzymes were obtained using vapour-diffusion crystallization with high-molecular-weight PEGs as a primary precipitant at alkaline pH. Some of the crystallization conditions permitted the soaking of crystals with cofactors and nucleotides or nucleotide sugars, whichmore » are possible substrate compounds, and further conditions provided co-complexes of two of the proteins with these compounds. The crystals diffracted to resolutions of between 1.50 and 2.40 Å at synchrotron X-ray sources. The synchrotron data obtained were sufficient to determine eight structures of the three enzymes in complex with a variety of cofactors and substrate molecules.« less
Structure of Shigella IpgB2 in Complex with Human RhoA
Klink, Björn U.; Barden, Stephan; Heidler, Thomas V.; Borchers, Christina; Ladwein, Markus; Stradal, Theresia E. B.; Rottner, Klemens; Heinz, Dirk W.
2010-01-01
A common theme in bacterial pathogenesis is the manipulation of eukaryotic cells by targeting the cytoskeleton. This is in most cases achieved either by modifying actin, or indirectly via activation of key regulators controlling actin dynamics such as Rho-GTPases. A novel group of bacterial virulence factors termed the WXXXE family has emerged as guanine nucleotide exchange factors (GEFs) for these GTPases. The precise mechanism of nucleotide exchange, however, has remained unclear. Here we report the structure of the WXXXE-protein IpgB2 from Shigella flexneri and its complex with human RhoA. We unambiguously identify IpgB2 as a bacterial RhoA-GEF and dissect the molecular mechanism of GDP release, an essential prerequisite for GTP binding. Our observations uncover that IpgB2 induces conformational changes on RhoA mimicking DbI- but not DOCK family GEFs. We also show that dissociation of the GDP·Mg2+ complex is preceded by the displacement of the metal ion to the α-phosphate of the nucleotide, diminishing its affinity to the GTPase. These data refine our understanding of the mode of action not only of WXXXE GEFs but also of mammalian GEFs of the DH/PH family. PMID:20363740
GDP-tubulin incorporation into growing microtubules modulates polymer stability.
Valiron, Odile; Arnal, Isabelle; Caudron, Nicolas; Job, Didier
2010-06-04
Microtubule growth proceeds through the endwise addition of nucleotide-bound tubulin dimers. The microtubule wall is composed of GDP-tubulin subunits, which are thought to come exclusively from the incorporation of GTP-tubulin complexes at microtubule ends followed by GTP hydrolysis within the polymer. The possibility of a direct GDP-tubulin incorporation into growing polymers is regarded as hardly compatible with recent structural data. Here, we have examined GTP-tubulin and GDP-tubulin incorporation into polymerizing microtubules using a minimal assembly system comprised of nucleotide-bound tubulin dimers, in the absence of free nucleotide. We find that GDP-tubulin complexes can efficiently co-polymerize with GTP-tubulin complexes during microtubule assembly. GDP-tubulin incorporation into microtubules occurs with similar efficiency during bulk microtubule assembly as during microtubule growth from seeds or centrosomes. Microtubules formed from GTP-tubulin/GDP-tubulin mixtures display altered microtubule dynamics, in particular a decreased shrinkage rate, apparently due to intrinsic modifications of the polymer disassembly properties. Thus, although microtubules polymerized from GTP-tubulin/GDP-tubulin mixtures or from homogeneous GTP-tubulin solutions are both composed of GDP-tubulin subunits, they have different dynamic properties, and this may reveal a novel form of microtubule "structural plasticity."
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
McCutchen-Maloney, Sandra L.
2002-01-01
DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.
Structural dynamics of the MecA-ClpC complex: a type II AAA+ protein unfolding machine.
Liu, Jing; Mei, Ziqing; Li, Ningning; Qi, Yutao; Xu, Yanji; Shi, Yigong; Wang, Feng; Lei, Jianlin; Gao, Ning
2013-06-14
The MecA-ClpC complex is a bacterial type II AAA(+) molecular machine responsible for regulated unfolding of substrates, such as transcription factors ComK and ComS, and targeting them to ClpP for degradation. The six subunits of the MecA-ClpC complex form a closed barrel-like structure, featured with three stacked rings and a hollow passage, where substrates are threaded and translocated through successive pores. Although the general concepts of how polypeptides are unfolded and translocated by internal pore loops of AAA(+) proteins have long been conceived, the detailed mechanistic model remains elusive. With cryoelectron microscopy, we captured four different structures of the MecA-ClpC complexes. These complexes differ in the nucleotide binding states of the two AAA(+) rings and therefore might presumably reflect distinctive, representative snapshots from a dynamic unfolding cycle of this hexameric complex. Structural analysis reveals that nucleotide binding and hydrolysis modulate the hexameric complex in a number of ways, including the opening of the N-terminal ring, the axial and radial positions of pore loops, the compactness of the C-terminal ring, as well as the relative rotation between the two nucleotide-binding domain rings. More importantly, our structural and biochemical data indicate there is an active allosteric communication between the two AAA(+) rings and suggest that concerted actions of the two AAA(+) rings are required for the efficiency of the substrate unfolding and translocation. These findings provide important mechanistic insights into the dynamic cycle of the MecA-ClpC unfoldase and especially lay a foundation toward the complete understanding of the structural dynamics of the general type II AAA(+) hexamers.
2012-01-01
The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at http://www.annotate-it.org. PMID:23013645
Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar
2017-06-01
Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.
Reference genotype and exome data from an Australian Aboriginal population for health-based research
Tang, Dave; Anderson, Denise; Francis, Richard W.; Syn, Genevieve; Jamieson, Sarra E.; Lassmann, Timo; Blackwell, Jenefer M.
2016-01-01
Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians. PMID:27070114
Tang, Dave; Anderson, Denise; Francis, Richard W; Syn, Genevieve; Jamieson, Sarra E; Lassmann, Timo; Blackwell, Jenefer M
2016-04-12
Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians.
Structural basis of reverse nucleotide polymerization
Nakamura, Akiyoshi; Nemoto, Taiki; Heinemann, Ilka U.; Yamashita, Keitaro; Sonoda, Tomoyo; Komoda, Keisuke; Tanaka, Isao; Söll, Dieter; Yao, Min
2013-01-01
Nucleotide polymerization proceeds in the forward (5′-3′) direction. This tenet of the central dogma of molecular biology is found in diverse processes including transcription, reverse transcription, DNA replication, and even in lagging strand synthesis where reverse polymerization (3′-5′) would present a “simpler” solution. Interestingly, reverse (3′-5′) nucleotide addition is catalyzed by the tRNA maturation enzyme tRNAHis guanylyltransferase, a structural homolog of canonical forward polymerases. We present a Candida albicans tRNAHis guanylyltransferase-tRNAHis complex structure that reveals the structural basis of reverse polymerization. The directionality of nucleotide polymerization is determined by the orientation of approach of the nucleotide substrate. The tRNA substrate enters the enzyme’s active site from the opposite direction (180° flip) compared with similar nucleotide substrates of canonical 5′-3′ polymerases, and the finger domains are on opposing sides of the core palm domain. Structural, biochemical, and phylogenetic data indicate that reverse polymerization appeared early in evolution and resembles a mirror image of the forward process. PMID:24324136
Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A
2009-01-01
The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.
Alchemical Free Energy Calculations for Nucleotide Mutations in Protein-DNA Complexes.
Gapsys, Vytautas; de Groot, Bert L
2017-12-12
Nucleotide-sequence-dependent interactions between proteins and DNA are responsible for a wide range of gene regulatory functions. Accurate and generalizable methods to evaluate the strength of protein-DNA binding have long been sought. While numerous computational approaches have been developed, most of them require fitting parameters to experimental data to a certain degree, e.g., machine learning algorithms or knowledge-based statistical potentials. Molecular-dynamics-based free energy calculations offer a robust, system-independent, first-principles-based method to calculate free energy differences upon nucleotide mutation. We present an automated procedure to set up alchemical MD-based calculations to evaluate free energy changes occurring as the result of a nucleotide mutation in DNA. We used these methods to perform a large-scale mutation scan comprising 397 nucleotide mutation cases in 16 protein-DNA complexes. The obtained prediction accuracy reaches 5.6 kJ/mol average unsigned deviation from experiment with a correlation coefficient of 0.57 with respect to the experimentally measured free energies. Overall, the first-principles-based approach performed on par with the molecular modeling approaches Rosetta and FoldX. Subsequently, we utilized the MD-based free energy calculations to construct protein-DNA binding profiles for the zinc finger protein Zif268. The calculation results compare remarkably well with the experimentally determined binding profiles. The software automating the structure and topology setup for alchemical calculations is a part of the pmx package; the utilities have also been made available online at http://pmx.mpibpc.mpg.de/dna_webserver.html .
Zhang, X; Gottlieb, P A
1995-01-01
Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate binding of the complex by altering the intrinsic properties of the DNA. Two specific attributes are required to achieve the lowest free energy of interaction. The DNA must have two interstrand hydrogen bonds to stabilize the duplex and it must have properties associated with directional bending or unwinding. This analysis does not rule out contributions by direct interactions between the protein and the central region of the operator but underscores how indirect effects play a major role in complex formation in this system. Images PMID:7784203
Ketkar, Amit; Zafar, Maroof K; Banerjee, Surajit; Marquez, Victor E; Egli, Martin; Eoff, Robert L
2012-06-27
Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2'-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2'-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle, which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base-stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase.
Ketkar, Amit; Zafar, Maroof K.; Banerjee, Surajit; Marquez, Victor E.; Egli, Martin; Eoff, Robert L
2012-01-01
Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2′-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2′-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle (χ), which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase. PMID:22632140
Hollis, Thomas; Ichikawa, Yoshitaka; Ellenberger, Tom
2000-01-01
The Escherichia coli AlkA protein is a base excision repair glycosylase that removes a variety of alkylated bases from DNA. The 2.5 Å crystal structure of AlkA complexed to DNA shows a large distortion in the bound DNA. The enzyme flips a 1–azaribose abasic nucleotide out of DNA and induces a 66° bend in the DNA with a marked widening of the minor groove. The position of the 1–azaribose in the enzyme active site suggests an SN1-type mechanism for the glycosylase reaction, in which the essential catalytic Asp238 provides direct assistance for base removal. Catalytic selectivity might result from the enhanced stacking of positively charged, alkylated bases against the aromatic side chain of Trp272 in conjunction with the relative ease of cleaving the weakened glycosylic bond of these modified nucleotides. The structure of the AlkA–DNA complex offers the first glimpse of a helix–hairpin–helix (HhH) glycosylase complexed to DNA. Modeling studies suggest that other HhH glycosylases can bind to DNA in a similar manner. PMID:10675345
Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko
2017-04-04
Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.
pH profile of the adsorption of nucleotides onto montmorillonite. I - Selected homoionic clays
NASA Technical Reports Server (NTRS)
Lawless, J. G.; Church, F. M.; Mazzurco, J.; Banin, A.; Huff, R.; Kao, J.; Cook, A.; Lowe, T.; Orenberg, J. B.; Edelson, E.
1985-01-01
The effect of pH and adsorbed ions on the adsorption of purine and pyrimidine nucleotides on montmorillonite clay was studied experimentally. The specific nucleotides examined were: 5 prime-AMP; 3-prime AMP; and 5 prime-CMP. The pH of the clay samples was adjusted to various levels in the 2-12 pH range using microliter volumes of concentrated acid (1N HCl) and base (1NHNaOH). It was found that preferential adsorption among nulceotides was dependent on the pH level and on the characteristics of the substituted metal cation and anion exchange mechanisms. Below pH 4, adsorption was attributed to cation and anion exchange mechanisms. Above pH 4, however, adsorption was attributed to the complexation mechanisms occurring between the metal cations in the clay exchange site and in the biomolecule. The possible role of homoionic clays in the concentration mechanisms of biomonomers in the prebiotic environment is discussed.
MARHOLD, KAROL; LIHOVÁ, JUDITA; PERNÝ, MARIÁN; BLEEKER, WALTER
2004-01-01
• Background and Aims Diploid representatives from the related polyploid complexes of Cardamine amara, C. pratensis and C. raphanifolia (Brassicaceae), were studied to elucidate phylogenetic relationships among the complexes and among the individual taxa included. • Methods Two independent molecular data sets were used: nucleotide sequences from the internal transcribed spacers (ITS) of nrDNA, and amplified fragment length polymorphism (AFLP) markers. Seventeen diploid taxa from the studied groups were sampled. • Key Results Both ITS and AFLP analyses provided congruent results in inferred relationships, and revealed two main lineages. While the C. amara group, consisting of C. wiedemanniana and four subspecies of C. amara, was resolved as a well‐supported monophyletic group, taxa from the C. pratensis and C. tenera groups (the latter representing diploid taxa of the complex of C. raphanifolia) all appeared together in a single clade/cluster with no support for the recognition of either of the groups. Intra‐individual polymorphisms and patterns of nucleotide variation in the ITS region in C. uliginosa and C. tenera, together with the distribution of AFLP bands, indicate ancient hybridization and introgression among these Caucasian diploids. • Conclusions The lack of supported hierarchical structure suggests that extensive reticulate evolution between these groups, even at the diploid level, has occurred (although an alternative explanation, namely ancestral polymorphism in ITS data, cannot be completely excluded). Several implications for the investigation of the polyploid complexes of concern are drawn. When tracing origins of polyploid taxa, a much more complex scenario should be expected, taking into account all relatives as potential parents, irrespective of the group in which they are classified. PMID:15037449
Jauch, Ralf; Ng, Calista K L; Narasimhan, Kamesh; Kolatkar, Prasanna R
2012-04-01
It has recently been proposed that the sequence preferences of DNA-binding TFs (transcription factors) can be well described by models that include the positional interdependence of the nucleotides of the target sites. Such binding models allow for multiple motifs to be invoked, such as principal and secondary motifs differing at two or more nucleotide positions. However, the structural mechanisms underlying the accommodation of such variant motifs by TFs remain elusive. In the present study we examine the crystal structure of the HMG (high-mobility group) domain of Sox4 [Sry (sex-determining region on the Y chromosome)-related HMG box 4] bound to DNA. By comparing this structure with previously solved structures of Sox17 and Sox2, we observed subtle conformational differences at the DNA-binding interface. Furthermore, using quantitative electrophoretic mobility-shift assays we validated the positional interdependence of two nucleotides and the presence of a secondary Sox motif in the affinity landscape of Sox4. These results suggest that a concerted rearrangement of two interface amino acids enables Sox4 to accommodate primary and secondary motifs. The structural adaptations lead to altered dinucleotide preferences that mutually reinforce each other. These analyses underline the complexity of the DNA recognition by TFs and provide an experimental validation for the conceptual framework of positional interdependence and secondary binding motifs.
Labeled nucleotide phosphate (NP) probes
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2009-02-03
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
The adsorption and reaction of adenine nucleotides on montmorillonite
NASA Technical Reports Server (NTRS)
Ferris, James P.; Hagan, William J., Jr.
1986-01-01
The binding of AMP to Zn(2+)-montmorillonite is investigated in the presence of salts and Good's zwitterion buffers, PIPES and MES. The initial concentrations of nucleotide and the percent adsorbtion are used to calculate the adsorption isotherms, and the Langmuir adsorption equation is used for the analysis of data. The adsorption coefficient was found to be three times greater in the presence of 0.2 M PIPES than in its absence. In addition, basal spacings measured by X-ray diffraction were increased by the buffer. These results are interpreted in terms of a model in which the adsorption of AMP is mediated by a Zn(2+) complex of PIPES in different orientations in the interlamellar region of the montmorillonite. Mixed ligand complexes of this type are reminiscent of the complexes observed between metal ions and biological molecules in living systems.
Mougel, M; Philippe, C; Ebel, J P; Ehresmann, B; Ehresmann, C
1988-01-01
We have investigated in detail the secondary and tertiary structures of E. coli 16S rRNA binding site of protein S15 using a variety of enzymatic and chemical probes. RNase T1 and nuclease S1 were used to probe unpaired nucleotides and RNase V1 to monitor base-paired or stacked nucleotides. Bases were probed with dimethylsulfate (at A(N-1), C(N-3) and G(N-7)), with 1-cyclohexyl-3 (2-(1-methylmorpholino)-ethyl)-carboiimide-p- toluenesulfonate (at U(N-3) and G(N-1)) and with diethylpyrocarbonate (at A(N-7)). The RNA region corresponding to nucleotides 652 to 753 was tested within: (1) the complete 16S rRNA molecule; (2) a 16S rRNA fragment corresponding to nucleotides 578 to 756 obtained by transcription in vitro; (3) the S15-16S rRNA complex; (4) the S15-fragment complex. Cleavage and modification sites were detected by primer extension with reverse transcriptase. Our results show that: (1) The synthetized fragment folds into the same overall secondary structure as in the complete 16S rRNA, with the exception of the large asymmetrical internal loop (nucleotides 673-676/714-733) which is fully accessible in the fragment while it appears conformationally heterogeneous in the 16S rRNA; (2) the reactivity patterns of the S15-16S rRNA and S15-fragment complexes are identical; (3) the protein protects defined RNA regions, located in the large interior loop and in the 3'-end strand of helix [655-672]-[734-751]; (4) the protein also causes enhanced chemical reactivity and enzyme accessibility interpreted as resulting from a local conformational rearrangement, induced by S15 binding. Images PMID:2453025
Structural basis for the D-stereoselectivity of human DNA polymerase β
Vyas, Rajan; Reed, Andrew J.; Raper, Austin T.; Zahurancik, Walter J.; Wallenmeyer, Petra C.
2017-01-01
Abstract Nucleoside reverse transcriptase inhibitors (NRTIs) with L-stereochemistry have long been an effective treatment for viral infections because of the strong D-stereoselectivity exhibited by human DNA polymerases relative to viral reverse transcriptases. The D-stereoselectivity of DNA polymerases has only recently been explored structurally and all three DNA polymerases studied to date have demonstrated unique stereochemical selection mechanisms. Here, we have solved structures of human DNA polymerase β (hPolβ), in complex with single-nucleotide gapped DNA and L-nucleotides and performed pre-steady-state kinetic analysis to determine the D-stereoselectivity mechanism of hPolβ. Beyond a similar 180° rotation of the L-nucleotide ribose ring seen in other studies, the pre-catalytic ternary crystal structures of hPolβ, DNA and L-dCTP or the triphosphate forms of antiviral drugs lamivudine ((-)3TC-TP) and emtricitabine ((-)FTC-TP) provide little structural evidence to suggest that hPolβ follows the previously characterized mechanisms of D-stereoselectivity. Instead, hPolβ discriminates against L-stereochemistry through accumulation of several active site rearrangements that lead to a decreased nucleotide binding affinity and incorporation rate. The two NRTIs escape some of the active site selection through the base and sugar modifications but are selected against through the inability of hPolβ to complete thumb domain closure. PMID:28402499
Schierz, A; Zänker, H
2009-04-01
The objective of this study is to obtain information on the behaviour of carbon nanotubes (CNTs) as potential carriers of pollutants in the case of accidental CNT release to the environment and on the properties of CNTs as a potential adsorbent material in water purification. The effects of acid treatment of CNTs on (i) the surface properties, (ii) the colloidal stability and (iii) heavy metal sorption are investigated, the latter being exemplified by uranium(VI) sorption. There is a pronounced influence of surface treatment on the behaviour of the CNTs in aqueous suspension. Results showed that acid treatment increases the amount of acidic surface groups on the CNTs. Therefore, acid treatment has an increasing effect on the colloidal stability of the CNTs and on their adsorption capacity for U(VI). Another way to stabilise colloids of pristine CNTs in aqueous suspension is the addition of humic acid.
Danylovych, H V
2016-01-01
We prove the feasibility of evaluation of mitochondrial electron transport chain function in isolated mitochondria of smooth muscle cells of rats from uterus using fluorescence of NADH and FAD coenzymes. We found the inversely directed changes in FAD and NADH fluorescence intensity under normal functioning of mitochondrial electron transport chain. The targeted effect of inhibitors of complex I, III and IV changed fluorescence of adenine nucleotides. Rotenone (5 μM) induced rapid increase in NADH fluorescence due to inhibition of complex I, without changing in dynamics of FAD fluorescence increase. Antimycin A, a complex III inhibitor, in concentration of 1 μg/ml caused sharp increase in NADH fluorescence and moderate increase in FAD fluorescence in comparison to control. NaN3 (5 mM), a complex IV inhibitor, and CCCP (10 μM), a protonophore, caused decrease in NADH and FAD fluorescence. Moreover, all the inhibitors caused mitochondria swelling. NO donors, e.g. 0.1 mM sodium nitroprusside and sodium nitrite similarly to the effects of sodium azide. Energy-dependent Ca2+ accumulation in mitochondrial matrix (in presence of oxidation substrates and Mg-ATP2- complex) is associated with pronounced drop in NADH and FAD fluorescence followed by increased fluorescence of adenine nucleotides, which may be primarily due to Ca2+- dependent activation of dehydrogenases of citric acid cycle. Therefore, the fluorescent signal of FAD and NADH indicates changes in oxidation state of these nucleotides in isolated mitochondria, which may be used to assay the potential of effectors of electron transport chain.
Use of spectroscopic techniques for uranium(VI)/montmorillonite interaction modeling.
Kowal-Fouchard, A; Drot, R; Simoni, E; Ehrhardt, J J
2004-03-01
To experimentally identify both clay sorption sites and sorption equilibria and to understand the retention mechanisms at a molecular level, we have characterized the structure of hexavalent uranium surface complexes resulting from the interaction between the uranyl ions and the surface retention groups of a montmorillonite clay. We have performed laser-induced fluorescence spectroscopy (LIFS) and X-ray photoelectron spectroscopy (XPS) on uranyl ion loaded montmorillonite. These structural results were then compared to those obtained from the study of uranyl ions sorbed onto an alumina and also from U(VI) sorbed on an amorphous silica. This experimental approach allowed for a clear determination of the reactive surface sites of montmorillonite for U(VI) sorption. The lifetime values and the U4f XPS spectra of uranium(VI) sorbed on montmorillonite have shown that this ion is sorbed on both exchange and edge sites. The comparison of U(VI)/clay and U(VI)/oxide systems has determined that the interaction between uranyl ions and montmorillonite edge sites occurs via both [triple bond]AlOH and [triple bond]SiOH surface groups and involves three distinct surface complexes. The surface complexation modeling of the U(VI)/montmorillonite sorption edges was determined using the constant capacitance model and the above experimental constraints. The following equilibria were found to account for the uranyl sorption mechanisms onto montmorillonite for metal concentrations ranged from 10(-6) to 10(-3) M and two ionic strengths (0.1 and 0.5 M): 2[triple bond]XNa + UO2(2+) <==> ([triple bond]X)2UO2 + 2Na+, log K0(exch) = 3.0; [triple bond]Al(OH)2 + UO2(2+) <==> [triple bond]Al(OH)2UO2(2+), log K0(Al) = 14.9; [triple bond]Si(OH)2 + UO2(2+) <==> [triple bond]SiO2UO2 + 2H+, log K0(Si1) = -3.8; and [triple bond]Si(OH)2 + 3UO2(2+) + 5H2O <==> [triple bond]SiO2(UO2)3(OH)5- + 7H+, log K0(Si2) = -20.0.
Pley, H W; Flaherty, K M; McKay, D B
1994-11-03
In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.
[Protein S3 in the human 80S ribosome adjoins mRNA from 3'-side of the A-site codon].
Molotkov, M V; Graĭfer, D M; Popugaeva, E A; Bulygin, K N; Meshchaninova, M I; Ven'iaminova, A G; Karpova, G G
2007-01-01
The protein environment of mRNA 3' of the A-site codon (the decoding site) in the human 80S ribosome was studied using a set of oligoribonucleotide derivatives bearing a UUU triplet at the 5'-end and a perfluoroarylazide group at one of the nucleotide residues at the 3'-end of this triplet. Analogues of mRNA were phased into the ribosome using binding at the tRNAPhe P-site, which recognizes the UUU codon. Mild UV irradiation of ribosome complexes with tRNAPhe and mRNA analogues resulted in the predominant crosslinking of the analogues with the 40S subunit components, mainly with proteins and, to a lesser extent, with rRNA. Among the 40S subunit ribosomal proteins, the S3 protein was the main target for modification in all cases. In addition, minor crosslinking with the S2 protein was observed. The crosslinking with the S3 and S2 proteins occurred both in triple complexes and in the absence of tRNA. Within triple complexes, crosslinking with S15 protein was also found, its efficiency considerably falling when the modified nucleotide was moved from positions +5 to +12 relative to the first codon nucleotide in the P-site. In some cases, crosslinking with the S30 protein was observed, it was most efficient for the derivative containing a photoreactive group at the +7 adenosine residue. The results indicate that the S3 protein in the human ribosome plays a key role in the formation of the mRNA binding site 3' of the codon in the decoding site.
Nucleotide exchange and excision technology DNA shuffling and directed evolution.
Speck, Janina; Stebel, Sabine C; Arndt, Katja M; Müller, Kristian M
2011-01-01
Remarkable success in optimizing complex properties within DNA and proteins has been achieved by directed evolution. In contrast to various random mutagenesis methods and high-throughput selection methods, the number of available DNA shuffling procedures is limited, and protocols are often difficult to adjust. The strength of the nucleotide exchange and excision technology (NExT) DNA shuffling described here is the robust, efficient, and easily controllable DNA fragmentation step based on random incorporation of the so-called 'exchange nucleotides' by PCR. The exchange nucleotides are removed enzymatically, followed by chemical cleavage of the DNA backbone. The oligonucleotide pool is reassembled into full-length genes by internal primer extension, and the recombined gene library is amplified by standard PCR. The technique has been demonstrated by shuffling a defined gene library of chloramphenicol acetyltransferase variants using uridine as fragmentation defining exchange nucleotide. Substituting 33% of the dTTP with dUTP in the incorporation PCR resulted in shuffled clones with an average parental fragment size of 86 bases and revealed a mutation rate of only 0.1%. Additionally, a computer program (NExTProg) has been developed that predicts the fragment size distribution depending on the relative amount of the exchange nucleotide.
Detection of possible restriction sites for type II restriction enzymes in DNA sequences.
Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L
2011-01-01
In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.
Large Scale Single Nucleotide Polymorphism Study of PD Susceptibility
2005-03-01
identification of eight genetic loci in the familial PD, the results of intensive investigations of polymorphisms in dozens of genes related to sporadic, late...1) investigate the association between classical, sporadic PD and 2386 SNPs in 23 genes implicated in the pathogenesis of PD; (2) construct...addition, experiences derived from this study may be applied in other complex disorders for the identification of susceptibility genes , as well as in genome
Nucleic acid analysis using terminal-phosphate-labeled nucleotides
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-04-22
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Wendland, M F; Stevens, T H; Buttlaire, D H; Everett, G W; Himes, R H
1983-02-15
Using nuclear magnetic resonance techniques, we have measured the internuclear distances separating the nucleotide-bound metal from the carbon and hydrogen nuclei of formate as well as the carbon of methylammonium cation when bound to formyltetrahydrofolate synthetase. Measurements were made of the paramagnetic effect on the spin-lattice relaxation rates (1/T1) of 13C and 1H nuclei arising from the replacement of Mg2+ with Mn2+, which binds to the enzyme in the form of a metal-nucleotide complex. Distances from Mn2+ to the formate carbon and proton were found to be 6.3 and 7.4 A, respectively, in the E . ATP . Mn2+ . formate complex and 6.0 and 7.1 A, respectively, in the E . ADP . Mn2+ . formate complex. When tetrahydrofolate was added to the latter complex, the exchange of formate was greatly reduced and became rate limiting for relaxation. These results are consistent with substantial conformational effects produced by the binding of the cofactor. The distance from Mn2+ to the methylammonium carbon in the E . ADP . Mn2+ . CH3NH+3, E . ADP . Mn2+ . formate . CH3NH3+, and E . ADP . Mn2+ . tetrahydrofolate . CH3NH3+ complexes was estimated to be in the range of 7.4-12 A. However, in the E . ADP . Mn2+ formate . tetrahydrofolate . CH3NH3+ complex, the data suggest that exchange of cation contributes significantly to relaxation. These results, combined with other known features of the enzyme, suggest that there may be a monovalent cation site within the active site of the enzyme.
Osman, Alfatih A A; Geipel, Gerhard; Barkleit, Astrid; Bernhard, Gert
2015-02-16
Human exposure to uranium increasingly becomes a subject of interest in many scientific disciplines such as environmental medicine, toxicology, and radiation protection. Knowledge about uranium chemical binding forms(speciation) in human body fluids can be of great importance to understand not only its biokinetics but also its relevance in risk assessment and in designing decorporation therapy in the case of accidental overexposure. In this study, thermodynamic calculations of uranium speciation in relevant simulated and original body fluids were compared with spectroscopic data after ex-situ uranium addition. For the first time, experimental data on U(VI) speciation in body fluids (saliva, sweat, urine) was obtained by means of cryogenic time-resolved laser-induced fluorescence spectroscopy (cryo-TRLFS) at 153 K. By using the time dependency of fluorescence decay and the band positions of the emission spectra, various uranyl complexes were demonstrated in the studied samples. The variations of the body fluids in terms of chemical composition, pH, and ionic strength resulted in different binding forms of U(VI). The speciation of U(VI) in saliva and in urine was affected by the presence of bioorganic ligands, whereas in sweat, the distribution depends mainly on inorganic ligands. We also elucidated the role of biological buffers, i.e., phosphate (H(2)PO(4−)/HPO(4)(2−)) on U(VI) distribution, and the system Ca(2+)/UO(2)(2+)/PO(4)(3−) was discussed in detail in both saliva and urine. The theoretical speciation calculations of the main U(VI) species in the investigated body fluids were significantly consistent with the spectroscopic data. Laser fluorescence spectroscopy showed success and reliability for direct determination of U(VI) in such biological matrices with the possibility for further improvement.
Composition for nucleic acid sequencing
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-08-26
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-06-06
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-05-30
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Conformational changes in the AAA ATPase p97–p47 adaptor complex
Beuron, Fabienne; Dreveny, Ingrid; Yuan, Xuemei; Pye, Valerie E; Mckeown, Ciaran; Briggs, Louise C; Cliff, Matthew J; Kaneko, Yayoi; Wallis, Russell; Isaacson, Rivka L; Ladbury, John E; Matthews, Steve J; Kondo, Hisao; Zhang, Xiaodong; Freemont, Paul S
2006-01-01
The AAA+ATPase p97/VCP, helped by adaptor proteins, exerts its essential role in cellular events such as endoplasmic reticulum-associated protein degradation or the reassembly of Golgi, ER and the nuclear envelope after mitosis. Here, we report the three-dimensional cryo-electron microscopy structures at ∼20 Å resolution in two nucleotide states of the endogenous hexameric p97 in complex with a recombinant p47 trimer, one of the major p97 adaptor proteins involved in membrane fusion. Depending on the nucleotide state, we observe the p47 trimer to be in two distinct arrangements on top of the p97 hexamer. By combining the EM data with NMR and other biophysical measurements, we propose a model of ATP-dependent p97(N) domain motions that lead to a rearrangement of p47 domains, which could result in the disassembly of target protein complexes. PMID:16601695
Structure of the Rigor Actin-Tropomyosin-Myosin Complex
Behrmann, Elmar; Müller, Mirco; Penczek, Pawel A.; Mannherz, Hans Georg; Manstein, Dietmar J.; Raunser, Stefan
2014-01-01
The interaction of myosin with actin filaments is the central feature of muscle contraction and cargo movement along actin filaments of the cytoskeleton. Myosin converts the chemical energy stored in ATP into force and movement along actin filaments. Myosin binding to actin induces conformational changes that are coupled to the nucleotide-binding pocket and amplified by a specialized region of the motor domain for efficient force generation. Tropomyosin plays a key role in regulating the productive interaction between myosins and actin. Here, we report the 8 Å resolution structure of the actin-tropomyosin-myosin complex determined by cryo electron microscopy. The pseudo-atomic model of the complex obtained from fitting crystal structures into the map defines the large actin-myosin-tropomyosin interface and the molecular interactions between the proteins in detail and allows us to propose a structural model for tropomyosin dependent myosin binding to actin and actin-induced nucleotide release from myosin. PMID:22817895
Morton, B R; Oberholzer, V M; Clegg, M T
1997-09-01
Substitutions occurring in noncoding sequences of the plant chloroplast genome violate the independence of sites that is assumed by substitution models in molecular evolution. The probability that a substitution at a site is a transversion, as opposed to a transition, increases significantly with increasing A + T content of the two adjacent nucleotides. In the present study, this dependency of substitutions on local context is examined further in a number of noncoding regions from the chloroplast genome of members of the grass family (Poaceae). Two features were examined; the influence of specific neighboring bases, as opposed to the general A + T content, on transversion proportion and an influence on substitutions by nucleotides other than the two immediately adjacent to the site of substitution. In both cases, a significant effect was found. In the case of specific nucleotides, transversion proportion is significantly higher at sites with a pyrimidine immediately 5' on either strand. Substitutions at sites of the type YNR, where N is the site of substitution, have the highest rate of transversion. This specific effect is secondary to the A + T content effect such that, in terms of proportion of substitutions that are transversions, the nucleotides are ranked T > A > C > G as to their effect when they are immediately 5' to the site of substitution. In the case of nucleotides other than the immediate neighbors, a significant influence on substitution dynamics is observed in the case where the two neighboring bases are both A and/or T. Thus, substitutions are primarily, but not exclusively, influenced by the composition of the two nucleotides that are immediately adjacent. These results indicate that the pattern of molecular evolution of the plant chloroplast genome is extremely complex as a result of a variety of inter-site dependencies.
Revisiting the Roco G-protein cycle.
Terheyden, Susanne; Ho, Franz Y; Gilsbach, Bernd K; Wittinghofer, Alfred; Kortholt, Arjan
2015-01-01
Mutations in leucine-rich-repeat kinase 2 (LRRK2) are the most frequent cause of late-onset Parkinson's disease (PD). LRRK2 belongs to the Roco family of proteins which share a conserved Ras-like G-domain (Roc) and a C-terminal of Roc (COR) domain tandem. The nucleotide state of small G-proteins is strictly controlled by guanine-nucleotide-exchange factors (GEFs) and GTPase-activating proteins (GAPs). Because of contradictory structural and biochemical data, the regulatory mechanism of the LRRK2 Roc G-domain and the RocCOR tandem is still under debate. In the present study, we solved the first nucleotide-bound Roc structure and used LRRK2 and bacterial Roco proteins to characterize the RocCOR function in more detail. Nucleotide binding induces a drastic structural change in the Roc/COR domain interface, a region strongly implicated in patients with an LRRK2 mutation. Our data confirm previous assumptions that the C-terminal subdomain of COR functions as a dimerization device. We show that the dimer formation is independent of nucleotide. The affinity for GDP/GTP is in the micromolar range, the result of which is high dissociation rates in the s-1 range. Thus Roco proteins are unlikely to need GEFs to achieve activation. Monomeric LRRK2 and Roco G-domains have a similar low GTPase activity to small G-proteins. We show that GTPase activity in bacterial Roco is stimulated by the nucleotide-dependent dimerization of the G-domain within the complex. We thus propose that the Roco proteins do not require GAPs to stimulate GTP hydrolysis but stimulate each other by one monomer completing the catalytic machinery of the other.
Podda, Maria Vittoria; Grassi, Claudio
2014-07-01
Cyclic nucleotides play fundamental roles in the central nervous system (CNS) under both physiological and pathological conditions. The impact of cAMP and cGMP signaling on neuronal and glial cell functions has been thoroughly characterized. Most of their effects have been related to cyclic nucleotide-dependent protein kinase activity. However, cyclic nucleotide-gated (CNG) channels, first described as key mediators of sensory transduction in retinal and olfactory receptors, have been receiving increasing attention as possible targets of cyclic nucleotides in the CNS. In the last 15 years, consistent evidence has emerged for their expression in neurons and astrocytes of the rodent brain. Far less is known, however, about the functional role of CNG channels in these cells, although several of their features, such as Ca(2+) permeability and prolonged activation in the presence of cyclic nucleotides, make them ideal candidates for mediators of physiological functions in the CNS. Here, we review literature suggesting the involvement of CNG channels in a number of CNS cellular functions (e.g., regulation of membrane potential, neuronal excitability, and neurotransmitter release) as well as in more complex phenomena, like brain plasticity, adult neurogenesis, and pain sensitivity. The emerging picture is that functional and dysfunctional cyclic nucleotide signaling in the CNS has to be reconsidered including CNG channels among possible targets. However, concerted efforts and multidisciplinary approaches are still needed to get more in-depth knowledge in this field.
THE RHODOPSIN-TRANSDUCIN COMPLEX HOUSES TWO DISTINCT RHODOPSIN MOLECULES
Jastrzebska, Beata; Ringler, Philipe; Palczewski, Krzysztof; Engel, Andreas
2013-01-01
Upon illumination the visual receptor rhodopsin (Rho) transitions to the activated form Rho*, which binds the heterotrimeric G protein, transducin (Gt) causing GDP to GTP exchange and Gt dissociation. Using succinylated concanavalin A (sConA) as a probe, we visualized native Rho dimers solubilized in 1 mM n-dodecyl-β-D-maltoside (DDM) and Rho monomers 5 mM in DDM. By nucleotide depletion and affinity chromatography together with crosslinking and size exclusion chromatography, we trapped and purified nucleotide-free Rho*•Gt and sConA-Rho*•Gt complexes kept in solution by either DDM or lauryl-maltose-neopentyl-glycol (LMNG). The 3-D envelope calculated from projections of negatively stained Rho*•Gt-LMNG complexes accommodated two Rho molecules, one Gt heterotrimer and a detergent belt. Visualization of triple sConA-Rho*•Gt complexes unequivocally demonstrated a pentameric assembly of the Rho*•Gt complex in which the photoactivated Rho* dimer serves as a platform for binding the Gt heterotrimer. Importantly, individual monomers of the Rho* dimer in the heteropentameric complex exhibited different capabilities to be regenerated with either 11-cis or 9-cis-retinal. PMID:23458690
PAM-Dependent Target DNA Recognition and Cleavage by C2c1 CRISPR-Cas Endonuclease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Hui; Gao, Pu; Rajashankar, Kanagalaghatta R.
C2c1 is a newly identified guide RNA-mediated type V-B CRISPR-Cas endonuclease that site-specifically targets and cleaves both strands of target DNA. We have determined crystal structures of Alicyclobacillus acidoterrestris C2c1 (AacC2c1) bound to sgRNA as a binary complex and to target DNAs as ternary complexes, thereby capturing catalytically competent conformations of AacC2c1 with both target and non-target DNA strands independently positioned within a single RuvC catalytic pocket. Moreover, C2c1-mediated cleavage results in a staggered seven-nucleotide break of target DNA. crRNA adopts a pre-ordered five-nucleotide A-form seed sequence in the binary complex, with release of an inserted tryptophan, facilitating zippering upmore » of 20-bp guide RNA:target DNA heteroduplex on ternary complex formation. Notably, the PAM-interacting cleft adopts a “locked” conformation on ternary complex formation. Structural comparison of C2c1 ternary complexes with their Cas9 and Cpf1 counterparts highlights the diverse mechanisms adopted by these distinct CRISPR-Cas systems, thereby broadening and enhancing their applicability as genome editing tools.« less
Dong, Biqin; Almassalha, Luay M.; Stypula-Cyrus, Yolanda; Urban, Ben E.; Chandler, John E.; Nguyen, The-Quyen; Sun, Cheng; Zhang, Hao F.; Backman, Vadim
2016-01-01
Visualizing the nanoscale intracellular structures formed by nucleic acids, such as chromatin, in nonperturbed, structurally and dynamically complex cellular systems, will help expand our understanding of biological processes and open the next frontier for biological discovery. Traditional superresolution techniques to visualize subdiffractional macromolecular structures formed by nucleic acids require exogenous labels that may perturb cell function and change the very molecular processes they intend to study, especially at the extremely high label densities required for superresolution. However, despite tremendous interest and demonstrated need, label-free optical superresolution imaging of nucleotide topology under native nonperturbing conditions has never been possible. Here we investigate a photoswitching process of native nucleotides and present the demonstration of subdiffraction-resolution imaging of cellular structures using intrinsic contrast from unmodified DNA based on the principle of single-molecule photon localization microscopy (PLM). Using DNA-PLM, we achieved nanoscopic imaging of interphase nuclei and mitotic chromosomes, allowing a quantitative analysis of the DNA occupancy level and a subdiffractional analysis of the chromosomal organization. This study may pave a new way for label-free superresolution nanoscopic imaging of macromolecular structures with nucleotide topologies and could contribute to the development of new DNA-based contrast agents for superresolution imaging. PMID:27535934
Proks, Peter; de Wet, Heidi; Ashcroft, Frances M
2014-11-01
Sulfonylureas, which stimulate insulin secretion from pancreatic β-cells, are widely used to treat both type 2 diabetes and neonatal diabetes. These drugs mediate their effects by binding to the sulfonylurea receptor subunit (SUR) of the ATP-sensitive K(+) (KATP) channel and inducing channel closure. The mechanism of channel inhibition is unusually complex. First, sulfonylureas act as partial antagonists of channel activity, and second, their effect is modulated by MgADP. We analyzed the molecular basis of the interactions between the sulfonylurea gliclazide and Mg-nucleotides on β-cell and cardiac types of KATP channel (Kir6.2/SUR1 and Kir6.2/SUR2A, respectively) heterologously expressed in Xenopus laevis oocytes. The SUR2A-Y1206S mutation was used to confer gliclazide sensitivity on SUR2A. We found that both MgATP and MgADP increased gliclazide inhibition of Kir6.2/SUR1 channels and reduced inhibition of Kir6.2/SUR2A-Y1206S. The latter effect can be attributed to stabilization of the cardiac channel open state by Mg-nucleotides. Using a Kir6.2 mutation that renders the KATP channel insensitive to nucleotide inhibition (Kir6.2-G334D), we showed that gliclazide abolishes the stimulatory effects of MgADP and MgATP on β-cell KATP channels. Detailed analysis suggests that the drug both reduces nucleotide binding to SUR1 and impairs the efficacy with which nucleotide binding is translated into pore opening. Mutation of one (or both) of the Walker A lysines in the catalytic site of the nucleotide-binding domains of SUR1 may have a similar effect to gliclazide on MgADP binding and transduction, but it does not appear to impair MgATP binding. Our results have implications for the therapeutic use of sulfonylureas. © 2014 Proks et al.
Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon
2014-11-24
Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Four Linked Genes Participate in Controlling Sporulation Efficiency in Budding Yeast
Ben-Ari, Giora; Zenvirth, Drora; Sherman, Amir; David, Lior; Klutstein, Michael; Lavi, Uri; Hillel, Jossi; Simchen, Giora
2006-01-01
Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs) is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four “high” sporulation alleles are derived from the “low” sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one “QTL region” that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes. PMID:17112318
Gorzkiewicz, Michał; Buczkowski, Adam; Appelhans, Dietmar; Voit, Brigitte; Pułaski, Łukasz; Pałecz, Bartłomiej; Klajnert-Maculewicz, Barbara
2018-06-10
Adenosine analogue drugs (such as fludarabine or cladribine) require transporter-mediated uptake into cells and subsequent phosphorylation for anticancer activity. Therefore, application of nanocarrier systems for direct delivery of active triphosphate forms has been proposed. Here, we applied isothermal titration calorimetry and zeta potential titration to determine the stoichiometry and thermodynamic parameters of interactions between 4th generation poly(propyleneimine) dendrimers (unmodified or sugar-modified for increased biocompatibility) and ATP as a model adenosine nucleotide. We showed that glycodendrimers have the ability to efficiently interact with nucleoside triphosphates and to form stable complexes via electrostatic interactions between the ionized phosphate and amino groups on the nucleotide and the dendrimer, respectively. The complexation process is spontaneous, enthalpy-driven and depends on buffer composition (strongest interactions in organic buffer) and pH (more binding sites in acidic pH). These properties allow us to consider maltose-modified dendrimers as especially promising carriers for adenosine analogues. Copyright © 2018 Elsevier B.V. All rights reserved.
Mosaic Origins of a Complex Chimeric Mitochondrial Gene in Silene vulgaris
Storchova, Helena; Müller, Karel; Lau, Steffen; Olson, Matthew S.
2012-01-01
Chimeric genes are significant sources of evolutionary innovation that are normally created when portions of two or more protein coding regions fuse to form a new open reading frame. In plant mitochondria astonishingly high numbers of different novel chimeric genes have been reported, where they are generated through processes of rearrangement and recombination. Nonetheless, because most studies do not find or report nucleotide variation within the same chimeric gene, evolution after the origination of these chimeric genes remains unstudied. Here we identify two alleles of a complex chimera in Silene vulgaris that are divergent in nucleotide sequence, genomic position relative to other mitochondrial genes, and expression patterns. Structural patterns suggest a history partially influenced by gene conversion between the chimeric gene and functional copies of subunit 1 of the mitochondrial ATP synthase gene (atp1). We identified small repeat structures within the chimeras that are likely recombination sites allowing generation of the chimera. These results establish the potential for chimeric gene divergence in different plant mitochondrial lineages within the same species. This result contrasts with the absence of diversity within mitochondrial chimeras found in crop species. PMID:22383961
Simon, Andrea; Britton, Robert; Gozlan, Rodolphe; van Oosterhout, Cock; Volckaert, Filip A. M.; Hänfling, Bernd
2011-01-01
The Asian cyprinid fish, the topmouth gudgeon (Pseudorasbora parva), was introduced into Europe in the 1960s. A highly invasive freshwater fish, it is currently found in at least 32 countries outside its native range. Here we analyse a 700 base pair fragment of the mitochondrial cytochrome b gene to examine different models of colonisation and spread within the invasive range, and to investigate the factors that may have contributed to their invasion success. Haplotype and nucleotide diversity of the introduced populations from continental Europe was higher than that of the native populations, although two recently introduced populations from the British Isles showed low levels of variability. Based on coalescent theory, all introduced and some native populations showed a relative excess of nucleotide diversity compared to haplotype diversity. This suggests that these populations are not in mutation-drift equilibrium, but rather that the relative inflated level of nucleotide diversity is consistent with recent admixture. This study elucidates the colonisation patterns of P. parva in Europe and provides an evolutionary framework of their invasion. It supports the hypothesis that their European colonisation was initiated by their introduction to a single location or small geographic area with subsequent complex pattern of spread including both long distance and stepping-stone dispersal. Furthermore, it was preceded by, or associated with, the admixture of genetically diverse source populations that may have augmented its invasive-potential. PMID:21674031
Segers-Nolten, G M J; Wyman, C; Wijgers, N; Vermeulen, W; Lenferink, A T M; Hoeijmakers, J H J; Greve, J; Otto, C
2002-11-01
We used scanning confocal fluorescence microscopy to observe and analyze individual DNA- protein complexes formed between human nucleotide excision repair (NER) proteins and model DNA substrates. For this purpose human XPA protein was fused to EGFP, purified and shown to be functional. Binding of EGFP-labeled XPA protein to a Cy3.5-labeled DNA substrate, in the presence and absence of RPA, was assessed quantitatively by simultaneous excitation and emission detection of both fluorophores. Co-localization of Cy3.5 and EGFP signals within one diffraction limited spot indicated complexes of XPA with DNA. Measurements were performed on samples in a 1% agarose matrix in conditions that are compatible with protein activity and where reactions can be studied under equilibrium conditions. In these samples DNA alone was freely diffusing and protein-bound DNA was immobile, whereby they could be discriminated resulting in quantitative data on DNA binding. On the single molecule level approximately 10% of XPA co-localized with DNA; this increased to 32% in the presence of RPA. These results, especially the enhanced binding of XPA in the presence of RPA, are similar to those obtained in bulk experiments, validating the utility of scanning confocal fluorescence microscopy for investigating functional interactions at the single molecule level.
Diagnosis of skin cancer by correlation and complexity analyses of damaged DNA
Namazi, Hamidreza; Kulish, Vladimir V.; Delaviz, Fatemeh; Delaviz, Ali
2015-01-01
Skin cancer is a common, low-grade cancerous (malignant) growth of the skin. It starts from cells that begin as normal skin cells and transform into those with the potential to reproduce in an out-of-control manner. Cancer develops when DNA, the molecule found in cells that encodes genetic information, becomes damaged and the body cannot repair the damage. A DNA walk of a genome represents how the frequency of each nucleotide of a pairing nucleotide couple changes locally. In this research in order to diagnose the skin cancer, first DNA walk plots of genomes of patients with skin cancer were generated. Then, the data so obtained was checked for complexity by computing the fractal dimension. Furthermore, the Hurst exponent has been employed in order to study the correlation of damaged DNA. By analysing different samples it has been found that the damaged DNA sequences are exhibiting higher degree of complexity and less correlation compared to normal DNA sequences. This investigation confirms that this method can be used for diagnosis of skin cancer. The method discussed in this research is useful not only for diagnosis of skin cancer but can be applied for diagnosis and growth analysis of different types of cancers. PMID:26497203
A contact photo-cross-linking investigation of the active site of the 8-17 deoxyribozyme.
Liu, Yong; Sen, Dipankar
2008-09-12
The small RNA-cleaving 8-17 deoxyribozyme (DNAzyme) has been the subject of extensive mechanistic and structural investigation, including a number of recent single-molecule studies of its global folding. Little detailed insight exists, however, into this DNAzyme's active site; for instance, the identity of specific nucleotides that are proximal to or in contact with the scissile site in the substrate. Here, we report a systematic replacement of a number of bases within the magnesium-folded DNAzyme-substrate complex with thio- and halogen-substituted base analogues, which were then photochemically activated to generate contact cross-links within the complex. Mapping of the cross-links revealed a striking pattern of DNAzyme-substrate cross-links but an absence of significant intra-DNAzyme cross-links. Notably, the two nucleotides directly flanking the scissile phosphodiester cross-linked strongly with functionally important elements within the DNAzyme, the thymine of a G.T wobble base pair, a WCGR bulge loop, and a terminal AGC loop. Mutation of the wobble base pair to a G-C pair led to a significant folding instability of the DNAzyme-substrate complex. The cross-linking patterns obtained were used to generate a model for the DNAzyme's active site that had the substrate's scissile phosphodiester sandwiched between the DNAzyme's wobble thymine and its AGC and WCGR loops.
Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G
2017-07-25
We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected cells recover. Despite the importance of this process, the broader impact of bacterial nucleotides on the functioning of eukaryotic cells remains poorly defined. To address this, we genetically modified cells of the eukaryote Saccharomyces cerevisiae (baker's yeast) to produce three of these molecules (cdiAMP, cdiGMP, and ppGpp) and used the engineered strains as model systems to characterize the effects of the molecules on the cells. In addition to demonstrating that the nucleotides are each capable of adversely affecting yeast cell function and growth, we also identified the cellular functions important for mitigating the damage caused, suggesting possible modes of action. This study expands our understanding of the molecular interactions that can take place between bacterial and eukaryotic cells. Copyright © 2017 Hesketh et al.
Brief Overview of a Decade of Genome-Wide Association Studies on Primary Hypertension.
Azam, Afifah Binti; Azizan, Elena Aisha Binti
2018-01-01
Primary hypertension is widely believed to be a complex polygenic disorder with the manifestation influenced by the interactions of genomic and environmental factors making identification of susceptibility genes a major challenge. With major advancement in high-throughput genotyping technology, genome-wide association study (GWAS) has become a powerful tool for researchers studying genetically complex diseases. GWASs work through revealing links between DNA sequence variation and a disease or trait with biomedical importance. The human genome is a very long DNA sequence which consists of billions of nucleotides arranged in a unique way. A single base-pair change in the DNA sequence is known as a single nucleotide polymorphism (SNP). With the help of modern genotyping techniques such as chip-based genotyping arrays, thousands of SNPs can be genotyped easily. Large-scale GWASs, in which more than half a million of common SNPs are genotyped and analyzed for disease association in hundreds of thousands of cases and controls, have been broadly successful in identifying SNPs associated with heart diseases, diabetes, autoimmune diseases, and psychiatric disorders. It is however still debatable whether GWAS is the best approach for hypertension. The following is a brief overview on the outcomes of a decade of GWASs on primary hypertension.
Large Scale Single Nucleotide Polymorphism Study of PD Susceptibility
2006-03-01
familial PD, the results of intensive investigations of polymorphisms in dozens of genes related to sporadic, late onset, typical PD have not shown...association between classical, sporadic PD and 2386 SNPs in 23 genes implicated in the pathogenesis of PD; (2) construct haplotypes based on the SNP...derived from this study may be applied in other complex disorders for the identification of susceptibility genes , as well as in genome-wide SNP
Lippé, Roger; Miaczynska, Marta; Rybin, Vladimir; Runge, Anja; Zerial, Marino
2001-01-01
Rab GTPases are central elements of the vesicular transport machinery. An emerging view is that downstream effectors of these GTPases are multiprotein complexes that include nucleotide exchange factors to ensure coupling between GTPase activation and effector function. We have previously shown that Rab5, which regulates various steps of transport along the early endocytic pathway, is activated by a complex consisting of Rabex-5, a Rab5 nucleotide exchange factor, and the effector Rabaptin-5. We postulated that the physical association of these two proteins is necessary for their activity in Rab5-dependent endocytic membrane transport. To evaluate the functional implications of such complex formation, we have reconstituted it with the use of recombinant proteins and characterized its properties. First, we show that Rabaptin-5 increases the exchange activity of Rabex-5 on Rab5. Second, Rab5-dependent recruitment of Rabaptin-5 to early endosomes is completely dependent on its physical association with Rabex-5. Third, complex formation between Rabaptin-5 and Rabex-5 is essential for early endosome homotypic fusion. These results reveal a functional synergy between Rabaptin-5 and Rabex-5 in the complex and have implications for the function of analogous complexes for Rab and Rho GTPases. PMID:11452015
Role of promoter DNA sequence variations on the binding of EGR1 transcription factor.
Mikles, David C; Schuchardt, Brett J; Bhat, Vikas; McDonald, Caleb B; Farooq, Amjad
2014-05-01
In response to a wide variety of stimuli such as growth factors and hormones, EGR1 transcription factor is rapidly induced and immediately exerts downstream effects central to the maintenance of cellular homeostasis. Herein, our biophysical analysis reveals that DNA sequence variations within the target gene promoters tightly modulate the energetics of binding of EGR1 and that nucleotide substitutions at certain positions are much more detrimental to EGR1-DNA interaction than others. Importantly, the reduction in binding affinity poorly correlates with the loss of enthalpy and gain of entropy-a trend indicative of a complex interplay between underlying thermodynamic factors due to the differential role of water solvent upon nucleotide substitution. We also provide a rationale for the physical basis of the effect of nucleotide substitutions on the EGR1-DNA interaction at atomic level. Taken together, our study bears important implications on understanding the molecular determinants of a key protein-DNA interaction at the cross-roads of human health and disease. Copyright © 2014 Elsevier Inc. All rights reserved.
2011-01-01
Uranium adsorption–desorption on sediment samples collected from the Hanford 300-Area, Richland, WA varied extensively over a range of field-relevant chemical conditions, complicating assessment of possible differences in equilibrium adsorption properties. Adsorption equilibrium was achieved in 500–1000 h although dissolved uranium concentrations increased over thousands of hours owing to changes in aqueous chemical composition driven by sediment-water reactions. A nonelectrostatic surface complexation reaction, >SOH + UO22+ + 2CO32- = >SOUO2(CO3HCO3)2–, provided the best fit to experimental data for each sediment sample resulting in a range of conditional equilibrium constants (logKc) from 21.49 to 21.76. Potential differences in uranium adsorption properties could be assessed in plots based on the generalized mass-action expressions yielding linear trends displaced vertically by differences in logKc values. Using this approach, logKc values for seven sediment samples were not significantly different. However, a significant difference in adsorption properties between one sediment sample and the fines (<0.063 mm) of another could be demonstrated despite the fines requiring a different reaction stoichiometry. Estimates of logKc uncertainty were improved by capturing all data points within experimental errors. The mass-action expression plots demonstrate that applying models outside the range of conditions used in model calibration greatly increases potential errors. PMID:21923109
Stoliker, Deborah L; Kent, Douglas B; Zachara, John M
2011-10-15
Uranium adsorption-desorption on sediment samples collected from the Hanford 300-Area, Richland, WA varied extensively over a range of field-relevant chemical conditions, complicating assessment of possible differences in equilibrium adsorption properties. Adsorption equilibrium was achieved in 500-1000 h although dissolved uranium concentrations increased over thousands of hours owing to changes in aqueous chemical composition driven by sediment-water reactions. A nonelectrostatic surface complexation reaction, >SOH + UO₂²⁺ + 2CO₃²⁻ = >SOUO₂(CO₃HCO₃)²⁻, provided the best fit to experimental data for each sediment sample resulting in a range of conditional equilibrium constants (logK(c)) from 21.49 to 21.76. Potential differences in uranium adsorption properties could be assessed in plots based on the generalized mass-action expressions yielding linear trends displaced vertically by differences in logK(c) values. Using this approach, logK(c) values for seven sediment samples were not significantly different. However, a significant difference in adsorption properties between one sediment sample and the fines (< 0.063 mm) of another could be demonstrated despite the fines requiring a different reaction stoichiometry. Estimates of logK(c) uncertainty were improved by capturing all data points within experimental errors. The mass-action expression plots demonstrate that applying models outside the range of conditions used in model calibration greatly increases potential errors.
TargetCompare: A web interface to compare simultaneous miRNAs targets
Moreira, Fabiano Cordeiro; Dustan, Bruno; Hamoy, Igor G; Ribeiro-dos-Santos, André M; dos Santos, Ândrea Ribeiro
2014-01-01
MicroRNAs (miRNAs) are small non-coding nucleotide sequences between 17 and 25 nucleotides in length that primarily function in the regulation of gene expression. A since miRNA has thousand of predict targets in a complex, regulatory cell signaling network. Therefore, it is of interest to study multiple target genes simultaneously. Hence, we describe a web tool (developed using Java programming language and MySQL database server) to analyse multiple targets of pre-selected miRNAs. We cross validated the tool in eight most highly expressed miRNAs in the antrum region of stomach. This helped to identify 43 potential genes that are target of at least six of the referred miRNAs. The developed tool aims to reduce the randomness and increase the chance of selecting strong candidate target genes and miRNAs responsible for playing important roles in the studied tissue. Availability http://lghm.ufpa.br/targetcompare PMID:25352731
TargetCompare: A web interface to compare simultaneous miRNAs targets.
Moreira, Fabiano Cordeiro; Dustan, Bruno; Hamoy, Igor G; Ribeiro-Dos-Santos, André M; Dos Santos, Andrea Ribeiro
2014-01-01
MicroRNAs (miRNAs) are small non-coding nucleotide sequences between 17 and 25 nucleotides in length that primarily function in the regulation of gene expression. A since miRNA has thousand of predict targets in a complex, regulatory cell signaling network. Therefore, it is of interest to study multiple target genes simultaneously. Hence, we describe a web tool (developed using Java programming language and MySQL database server) to analyse multiple targets of pre-selected miRNAs. We cross validated the tool in eight most highly expressed miRNAs in the antrum region of stomach. This helped to identify 43 potential genes that are target of at least six of the referred miRNAs. The developed tool aims to reduce the randomness and increase the chance of selecting strong candidate target genes and miRNAs responsible for playing important roles in the studied tissue. http://lghm.ufpa.br/targetcompare.
Li, Zhoufang; Liu, Guangjie; Tong, Yin; Zhang, Meng; Xu, Ying; Qin, Li; Wang, Zhanhui; Chen, Xiaoping; He, Jiankui
2015-01-01
Profiling immune repertoires by high throughput sequencing enhances our understanding of immune system complexity and immune-related diseases in humans. Previously, cloning and Sanger sequencing identified limited numbers of T cell receptor (TCR) nucleotide sequences in rhesus monkeys, thus their full immune repertoire is unknown. We applied multiplex PCR and Illumina high throughput sequencing to study the TCRβ of rhesus monkeys. We identified 1.26 million TCRβ sequences corresponding to 643,570 unique TCRβ sequences and 270,557 unique complementarity-determining region 3 (CDR3) gene sequences. Precise measurements of CDR3 length distribution, CDR3 amino acid distribution, length distribution of N nucleotide of junctional region, and TCRV and TCRJ gene usage preferences were performed. A comprehensive profile of rhesus monkey immune repertoire might aid human infectious disease studies using rhesus monkeys. PMID:25961410
Ito, Jun; Herter, Thomas; Baidoo, Edward E K; Lao, Jeemeng; Vega-Sánchez, Miguel E; Michelle Smith-Moritz, A; Adams, Paul D; Keasling, Jay D; Usadel, Björn; Petzold, Christopher J; Heazlewood, Joshua L
2014-03-01
Understanding the intricate metabolic processes involved in plant cell wall biosynthesis is limited by difficulties in performing sensitive quantification of many involved compounds. Hydrophilic interaction liquid chromatography is a useful technique for the analysis of hydrophilic metabolites from complex biological extracts and forms the basis of this method to quantify plant cell wall precursors. A zwitterionic silica-based stationary phase has been used to separate hydrophilic nucleotide sugars involved in cell wall biosynthesis from milligram amounts of leaf tissue. A tandem mass spectrometry operating in selected reaction monitoring mode was used to quantify nucleotide sugars. This method was highly repeatable and quantified 12 nucleotide sugars at low femtomole quantities, with linear responses up to four orders of magnitude to several 100pmol. The method was also successfully applied to the analysis of purified leaf extracts from two model plant species with variations in their cell wall sugar compositions and indicated significant differences in the levels of 6 out of 12 nucleotide sugars. The plant nucleotide sugar extraction procedure was demonstrated to have good recovery rates with minimal matrix effects. The approach results in a significant improvement in sensitivity when applied to plant samples over currently employed techniques. Copyright © 2013 Elsevier Inc. All rights reserved.
Wu, Eugene Y.; Beese, Lorena S.
2011-01-01
To achieve accurate DNA synthesis, DNA polymerases must rapidly sample and discriminate against incorrect nucleotides. Here we report the crystal structure of a high fidelity DNA polymerase I bound to DNA primer-template caught in the act of binding a mismatched (dG:dTTP) nucleoside triphosphate. The polymerase adopts a conformation in between the previously established “open” and “closed” states. In this “ajar” conformation, the template base has moved into the insertion site but misaligns an incorrect nucleotide relative to the primer terminus. The displacement of a conserved active site tyrosine in the insertion site by the template base is accommodated by a distinctive kink in the polymerase O helix, resulting in a partially open ternary complex. We suggest that the ajar conformation allows the template to probe incoming nucleotides for complementarity before closure of the enzyme around the substrate. Based on solution fluorescence, kinetics, and crystallographic analyses of wild-type and mutant polymerases reported here, we present a three-state reaction pathway in which nucleotides either pass through this intermediate conformation to the closed conformation and catalysis or are misaligned within the intermediate, leading to destabilization of the closed conformation. PMID:21454515
Changes in miRNAs Signal High-Risk HPV Infections | Center for Cancer Research
microRNAs (miRNAs) are approximately 21 nucleotide long, non-coding RNAs that regulate the expression of certain proteins. As part of the RNA-induced silencing complex or RISC, miRNAs bind to complementary sequences in the 3’ untranslated regions of target messenger RNAs, blocking protein synthesis and sometimes leading to the destruction of the target RNA. Numerous studies
McKinney, Jeffrey; Guerrier-Takada, Cecilia; Wesolowski, Donna; Altman, Sidney
2001-01-01
Narrow spectrum antimicrobial activity has been designed to reduce the expression of two essential genes, one coding for the protein subunit of RNase P (C5 protein) and one for gyrase (gyrase A). In both cases, external guide sequences (EGS) have been designed to complex with either mRNA. Using the EGS technology, the level of microbial viability is reduced to less than 10% of the wild-type strain. The EGSs are additive when used together and depend on the number of nucleotides paired when attacking gyrase A mRNA. In the case of gyrase A, three nucleotides unpaired out of a 15-mer EGS still favor complete inhibition by the EGS but five unpaired nucleotides do not. PMID:11381134
Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.
Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donormore » ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.« less
Kelemen, Arpad; Vasilakos, Athanasios V; Liang, Yulan
2009-09-01
Comprehensive evaluation of common genetic variations through association of single-nucleotide polymorphism (SNP) structure with common complex disease in the genome-wide scale is currently a hot area in human genome research due to the recent development of the Human Genome Project and HapMap Project. Computational science, which includes computational intelligence (CI), has recently become the third method of scientific enquiry besides theory and experimentation. There have been fast growing interests in developing and applying CI in disease mapping using SNP and haplotype data. Some of the recent studies have demonstrated the promise and importance of CI for common complex diseases in genomic association study using SNP/haplotype data, especially for tackling challenges, such as gene-gene and gene-environment interactions, and the notorious "curse of dimensionality" problem. This review provides coverage of recent developments of CI approaches for complex diseases in genetic association study with SNP/haplotype data.
Progress of genome wide association study in domestic animals
2012-01-01
Domestic animals are invaluable resources for study of the molecular architecture of complex traits. Although the mapping of quantitative trait loci (QTL) responsible for economically important traits in domestic animals has achieved remarkable results in recent decades, not all of the genetic variation in the complex traits has been captured because of the low density of markers used in QTL mapping studies. The genome wide association study (GWAS), which utilizes high-density single-nucleotide polymorphism (SNP), provides a new way to tackle this issue. Encouraging achievements in dissection of the genetic mechanisms of complex diseases in humans have resulted from the use of GWAS. At present, GWAS has been applied to the field of domestic animal breeding and genetics, and some advances have been made. Many genes or markers that affect economic traits of interest in domestic animals have been identified. In this review, advances in the use of GWAS in domestic animals are described. PMID:22958308
1994-01-01
The small GTPase Rab1 is required for vesicular traffic from the ER to the cis-Golgi compartment, and for transport between the cis and medial compartments of the Golgi stack. In the present study, we examine the role of guanine nucleotide dissociation inhibitor (GDI) in regulating the function of Rab1 in the transport of vesicular stomatitis virus glycoprotein (VSV-G) in vitro. Incubation in the presence of excess GDI rapidly (t1/2 < 30 s) extracted Rab1 from membranes, inhibiting vesicle budding from the ER and sequential transport between the cis-, medial-, and trans-Golgi cisternae. These results demonstrate a direct role for GDI in the recycling of Rab proteins. Analysis of rat liver cytosol by gel filtration revealed that a major pool of Rab1 fractionates with a molecular mass of approximately 80 kD in the form of a GDI-Rab1 complex. When the GDI-Rab1 complex was depleted from cytosol by use of a Rab1-specific antibody, VSV-G failed to exit the ER. However, supplementation of depleted cytosol with a GDI-Rab1 complex prepared in vitro from recombinant forms of Rab1 and GDI efficiently restored export from the ER, and transport through the Golgi stack. These results provide evidence that a cytosolic GDI-Rab1 complex is required for the formation of non-clathrin-coated vesicles mediating transport through the secretory pathway. PMID:8089173
Verhoeven, Esther E. A.; van Kesteren, Marian; Turner, John J.; van der Marel, Gijs A.; van Boom, Jacques H.; Moolenaar, Geri F.; Goosen, Nora
2002-01-01
Nucleotide excision repair in Escherichia coli involves formation of the UvrB–DNA complex and subsequent DNA incisions on either site of the damage by UvrC. In this paper, we studied the incision of substrates with different damages in varying sequence contexts. We show that there is not always a correlation between the incision efficiency and the stability of the UvrB–DNA complex. Both stable and unstable UvrB–DNA complexes can be efficiently incised. However some lesions that give rise to stable UvrB–DNA complexes do result in a very low incision. We present evidence that this poor incision is due to sterical hindrance of the damage itself. In its C-terminal region UvrC contains two helix–hairpin–helix (HhH) motifs. Mutational analysis shows that these motifs constitute one functional unit, probably folded as one structural unit; the (HhH)2 domain. This (HhH)2 domain was previously shown to be important for the 5′ incision on a substrate containing a (cis-Pt)·GG adduct, but not for 3′ incision. Here we show that, mainly depending on the sequence context of the lesion, the (HhH)2 domain can be important for 3′ and/or 5′ incision. We propose that the (HhH)2 domain stabilises specific DNA structures required for the two incisions, thereby contributing to the flexibility of the UvrABC repair system. PMID:12034838
Martin, Eden R.; Lai, Eric H.; Gilbert, John R.; Rogala, Allison R.; Afshari, A. J.; Riley, John; Finch, K. L.; Stevens, J. F.; Livak, K. J.; Slotterbeck, Brandon D.; Slifer, Susan H.; Warren, Liling L.; Conneally, P. Michael; Schmechel, Donald E.; Purvis, Ian; Pericak-Vance, Margaret A.; Roses, Allen D.; Vance, Jeffery M.
2000-01-01
There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P⩽.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes. PMID:10869235
Martin, E R; Lai, E H; Gilbert, J R; Rogala, A R; Afshari, A J; Riley, J; Finch, K L; Stevens, J F; Livak, K J; Slotterbeck, B D; Slifer, S H; Warren, L L; Conneally, P M; Schmechel, D E; Purvis, I; Pericak-Vance, M A; Roses, A D; Vance, J M
2000-08-01
There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P=.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes.
Goudey, Benjamin; Abedini, Mani; Hopper, John L; Inouye, Michael; Makalic, Enes; Schmidt, Daniel F; Wagner, John; Zhou, Zeyu; Zobel, Justin; Reumann, Matthias
2015-01-01
Genome-wide association studies (GWAS) are a common approach for systematic discovery of single nucleotide polymorphisms (SNPs) which are associated with a given disease. Univariate analysis approaches commonly employed may miss important SNP associations that only appear through multivariate analysis in complex diseases. However, multivariate SNP analysis is currently limited by its inherent computational complexity. In this work, we present a computational framework that harnesses supercomputers. Based on our results, we estimate a three-way interaction analysis on 1.1 million SNP GWAS data requiring over 5.8 years on the full "Avoca" IBM Blue Gene/Q installation at the Victorian Life Sciences Computation Initiative. This is hundreds of times faster than estimates for other CPU based methods and four times faster than runtimes estimated for GPU methods, indicating how the improvement in the level of hardware applied to interaction analysis may alter the types of analysis that can be performed. Furthermore, the same analysis would take under 3 months on the currently largest IBM Blue Gene/Q supercomputer "Sequoia" at the Lawrence Livermore National Laboratory assuming linear scaling is maintained as our results suggest. Given that the implementation used in this study can be further optimised, this runtime means it is becoming feasible to carry out exhaustive analysis of higher order interaction studies on large modern GWAS.
Marq, Jean-Baptiste; Hausmann, Stéphane; Veillard, Nicolas; Kolakofsky, Daniel; Garcin, Dominique
2011-02-25
Arenavirus RNA genomes are initiated by a "prime and realign" mechanism, such that the initiating GTP is found as a single unpaired (overhanging) nucleotide when the complementary genome ends anneal to form double-stranded (ds) RNA panhandle structures. dsRNAs modeled on these structures do not induce interferon (IFN), as opposed to blunt-ended (5' ppp)dsRNA. This study examines whether these viral structures can also act as decoys, by trapping RIG-I in inactive dsRNA complexes. We examined the ability of various dsRNAs to activate the RIG-I ATPase (presumably a measure of helicase translocation on dsRNA) relative to their ability to induce IFN. We found that there is no simple relationship between these two properties, as if RIG-I can translocate on short dsRNAs without inducing IFN. Moreover, we found that (5' ppp)dsRNAs with a single unpaired 5' ppp-nucleotide can in fact competitively inhibit the ability of blunt-ended (5' ppp)dsRNAs to induce IFN when co-transfected into cells and that this inhibition is strongly dependent on the presence of the 5' ppp. In contrast, (5' ppp)dsRNAs with a single unpaired 5' ppp-nucleotide does not inhibit poly(I-C)-induced IFN activation, which is independent of the presence of a 5' ppp group.
Loop nucleotides control primary and mature miRNA function in target recognition and repression
Yue, Si-Biao; Deis Trujillo, Robin; Tang, Yujie; O'Gorman, William E
2011-01-01
MicroRNA (miRNA) genes produce three major RNA products; primary (pri-), precursor (pre-), and mature miRNAs. Each product includes sequences complementary to cognate targets, thus they all can in principle interact with the targets. In a recent study we showed that pri-miRNAs play a direct role in target recognition and repression in the absence of functional mature miRNAs. Here we examined the functional contribution of pri-miRNAs in target regulation when full-length functional miRNAs are present. We found that pri-let-7 loop nucleotides control the production of the 5′ end of mature miRNAs and modulate the activity of the miRNA gene. This insight enabled us to modulate biogenesis of functional mature miRNAs and dissect the causal relationships between mature miRNA biogenesis and target repression. We demonstrate that both pri- and mature miRNAs can contribute to target repression and that their contributions can be distinguished by the differences between the pri- and mature miRNAs' sensitivity to bind to the first seed nucleotide. Our results demonstrate that the regulatory information encoded in the pri-/pre-miRNA loop nucleotides controls the activities of pri-miRNAs and mature let-7 by influencing pri-miRNA and target complex formation and the fidelity of mature miRNA seed generation. PMID:22142974
Volatile anesthetics interfere with muscarinic receptor-g protein interactions in rat heart
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anthony, B.L.
The influence of halothane and enflurane (0.5-8%) on muscarinic receptor binding in rat atrium was studied using (/sup 3/H) methylscopolamine ((/sup 3/H)MS). Anesthetic-gas mixtures were blown over membrane suspensions for 20 min before and during the binding assays. Halothane and enflurane increased the affinity of cardiac muscarinic receptors for (/sup 3/H)MS by slowing the rate of dissociation. These anesthetics did not affect the affinity of the receptor for carbamylcholine, but significantly reduced the sensitivity of agonist binding to regulation by guanine nucleotides. For example, the fraction of receptors displaying high affinity agonist binding was decreased by a GTP analog frommore » 0.64 to 0.43 in the absence, but only to 0.52 in the presence of 2% halothane. The binding of a radiolabeled agonist, (/sup 3/H)oxotremorine-M, was reduced by 50% by halothane, while its sensitivity to guanine nucleotides was reduced by at least 100 fold. The diminution of the guanine nucleotide effect may reflect a stabilization of the receptor-G proteincomplex due to either a direct action on the receptor complex or to an alteration of the physical state of the membrane. It is also possible that the ability of the G protein to bind guanine nucleotides is adversely affected by anesthetic agents.« less
Direct evidence of an elongation factor-Tu/Ts·GTP·Aminoacyl-tRNA quaternary complex.
Burnett, Benjamin J; Altman, Roger B; Ferguson, Angelica; Wasserman, Michael R; Zhou, Zhou; Blanchard, Scott C
2014-08-22
During protein synthesis, elongation factor-Tu (EF-Tu) bound to GTP chaperones the entry of aminoacyl-tRNA (aa-tRNA) into actively translating ribosomes. In so doing, EF-Tu increases the rate and fidelity of the translation mechanism. Recent evidence suggests that EF-Ts, the guanosine nucleotide exchange factor for EF-Tu, directly accelerates both the formation and dissociation of the EF-Tu-GTP-Phe-tRNA(Phe) ternary complex (Burnett, B. J., Altman, R. B., Ferrao, R., Alejo, J. L., Kaur, N., Kanji, J., and Blanchard, S. C. (2013) J. Biol. Chem. 288, 13917-13928). A central feature of this model is the existence of a quaternary complex of EF-Tu/Ts·GTP·aa-tRNA(aa). Here, through comparative investigations of phenylalanyl, methionyl, and arginyl ternary complexes, and the development of a strategy to monitor their formation and decay using fluorescence resonance energy transfer, we reveal the generality of this newly described EF-Ts function and the first direct evidence of the transient quaternary complex species. These findings suggest that EF-Ts may regulate ternary complex abundance in the cell through mechanisms that are distinct from its guanosine nucleotide exchange factor functions. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
The rhodopsin-transducin complex houses two distinct rhodopsin molecules.
Jastrzebska, Beata; Ringler, Philippe; Palczewski, Krzysztof; Engel, Andreas
2013-05-01
Upon illumination the visual receptor rhodopsin (Rho) transitions to the activated form Rho(∗), which binds the heterotrimeric G protein, transducin (Gt) causing GDP to GTP exchange and Gt dissociation. Using succinylated concanavalin A (sConA) as a probe, we visualized native Rho dimers solubilized in 1mM n-dodecyl-β-d-maltoside (DDM) and Rho monomers in 5mM DDM. By nucleotide depletion and affinity chromatography together with crosslinking and size exclusion chromatography, we trapped and purified nucleotide-free Rho(∗)·Gt and sConA-Rho(∗)·Gt complexes kept in solution by either DDM or lauryl-maltose-neopentyl-glycol (LMNG). The 3 D envelope calculated from projections of negatively stained Rho(∗)·Gt-LMNG complexes accommodated two Rho molecules, one Gt heterotrimer and a detergent belt. Visualization of triple sConA-Rho(∗)·Gt complexes unequivocally demonstrated a pentameric assembly of the Rho(∗)·Gt complex in which the photoactivated Rho(∗) dimer serves as a platform for binding the Gt heterotrimer. Importantly, individual monomers of the Rho(∗) dimer in the heteropentameric complex exhibited different capabilities for regeneration with either 11-cis or 9-cis-retinal. Copyright © 2013 Elsevier Inc. All rights reserved.
Diab, Roudayna; Jordheim, Lars P; Degobert, Ghania; Peyrottes, Suzanne; Périgaud, Christian; Dumontet, Charles; Fessi, Hatem
2009-01-01
Bis(tbutyl-S-acyl-2-thioethyl)-cytidine monophosophate is a new cytotoxic mononucleotide prodrug which have been developed to reverse the cellular resistance to nucleoside analogues. Unfortunately, its in vivo utilisation was hampered by its poor water solubility, raising the need of a molecular vector capable to mask its physicochemical characteristics although without affecting its cytotoxic activity. Hydroxypropyl-beta-cyclodextrin was used to prepare the prodrug inclusion complexes, allowing it to be solubilized in water and hence to be used for in vitro and in vivo experiments. A molar ratio of the cyclodextrin: prodrug of 3 was sufficient to obtain complete solubilization of the prodrug. The inclusion complex was characterized by differential scanning calorimetry, which revealed the disappearance of the melting peak of the prodrug suggesting the formation of inclusion complex. Proton Nuclear Magnetic Resonance spectroscopy provided a definitive proof of the inclusion complex formation, which was evidenced by the large chemical shift displacements observed for protons located in the interior of the hydrophobic cyclodextrin cavity. The complex retained its cytotoxic activity as shown by in vitro cell survival assays on murine leukemia cells. These results provided a basis for potential therapeutic applications of co-formulation of this new nucleotide analogue with hydroxypropyl-beta-CD in cancer therapy.
Hale, Sarah J.; Lovell, Simon C.; de Keyzer, Jeanine; Stirling, Colin J.
2010-01-01
Kar2p, an essential Hsp70 chaperone in the endoplasmic reticulum of Saccharomyces cerevisiae, facilitates the transport and folding of nascent polypeptides within the endoplasmic reticulum lumen. The chaperone activity of Kar2p is regulated by its intrinsic ATPase activity that can be stimulated by two different nucleotide exchange factors, namely Sil1p and Lhs1p. Here, we demonstrate that the binding requirements for Lhs1p are complex, requiring both the nucleotide binding domain plus the linker domain of Kar2p. In contrast, the IIB domain of Kar2p is sufficient for binding of Sil1p, and point mutations within IIB specifically blocked Sil1p-dependent activation while remaining competent for activation by Lhs1p. Taken together, these results demonstrate that the interactions between Kar2p and its two nucleotide exchange factors can be functionally resolved and are thus mechanistically distinct. PMID:20430899
Molecular determinants of Cytochrome C oxidase IV mRNA axonal trafficking
Kar, Amar N.; Vargas, Jose Norberto S.; Chen, Cai-Yun; Kowalak, Jeffrey A; Gioio, Anthony E.; Kaplan, Barry B.
2017-01-01
In previous studies, we identified a putative 38-nucleotide stem-loop structure (zipcode) in the 3′ untranslated region of the cytochrome c oxidase subunit IV (COXIV) mRNA that was necessary and sufficient for the axonal localization of the message in primary superior cervical ganglion (SCG) neurons. However, little is known about the proteins that interact with the COXIV-zipcode and regulate the axonal trafficking and local translation of the COXIV message. To identify proteins involved in the axonal transport of the COXIV mRNA, we used the biotinylated 38-nucleotide COXIV RNA zipcode as bait in the affinity purification of COXIV zipcode binding proteins. Gel-shift assays of the biotinylated COXIV zipcode indicated that the putative stem-loop structure functions as a nucleation site for the formation of ribonucleoprotein complexes. Mass spectrometric analysis of the COXIV zipcode ribonucleoprotein complex led to the identification of a large number RNA binding proteins, including fused in sarcoma/translated in liposarcoma (FUS/TLS), and Y-box protein 1 (YB-1). Validation experiments, using western analyses, confirmed the presence of the candidate proteins in the COXIV zipcode affinity purified complexes obtained from SCG axons. Immunohistochemical studies show that FUS, and YB-1 are present in SCG axons. Importantly, RNA immunoprecipitation studies show that FUS, and YB-1 interact with endogenous axonal COXIV transcripts. siRNA-mediated downregulation of the candidate proteins FUS and YB-1 expression in the cell-bodies diminishes the levels of COXIV mRNA in the axon, suggesting functional roles for these proteins in the axonal trafficking of COXIV mRNA. PMID:28161363
Sorption characteristic of uranium(VI) ion onto K-feldspar.
Gao, Xiaoqing; Bi, Mingliang; Shi, Keliang; Chai, Zhifang; Wu, Wangsuo
2017-10-01
The effect of pH, contact time, temperature, ionic strength and initial U(VI) concentration on U(VI) sorption onto K-feldspar was investigated using batch techniques. The sorption kinetics was evaluated and the activation energy was obtained based on the rate constants at different temperature. Graphical correlations of sorption isotherm models have been evaluated and applied for U(VI) uptake by K-feldspar. Various thermodynamic parameters, such as, Gibb's free energy, entropy and enthalpy of the on-going sorption process have been calculated and the possible sorption mechanism of U(VI) was deduced. The results are expected to help better understand the migration of uranium in the host materials of granite. Copyright © 2017 Elsevier Ltd. All rights reserved.
Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase.
Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J
2011-01-21
In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.
Solution structure of an ATP-binding RNA aptamer reveals a novel fold.
Dieckmann, T; Suzuki, E; Nakamura, G K; Feigon, J
1996-01-01
In vitro selection has been used to isolate several RNA aptamers that bind specifically to biological cofactors. A well-characterized example in the ATP-binding RNA aptamer family, which contains a conserved 11-base loop opposite a bulged G and flanked by regions of double-stranded RNA. The nucleotides in the consensus sequence provide a binding pocket for ATP (or AMP), which binds with a Kd in the micromolar range. Here we present the three-dimensional solution structure of a 36-nucleotide ATP-binding RNA aptamer complexed with AMP, determined from NMR-derived distance and dihedral angle restraints. The conserved loop and bulged G form a novel compact, folded structure around the AMP. The backbone tracing of the loop nucleotides can be described by a Greek zeta (zeta). Consecutive loop nucleotides G, A, A form a U-turn at the bottom of the zeta, and interact with the AMP to form a structure similar to a GNRA tetraloop, with AMP standing in for the final A. Two asymmetric G. G base pairs close the stems flanking the internal loop. Mutated aptamers support the existence of the tertiary interactions within the consensus nucleotides and with the AMP found in the calculated structures. PMID:8756406
DOE Office of Scientific and Technical Information (OSTI.GOV)
Urano, Tomohiko; Inoue, Satoshi, E-mail: INOUE-GER@h.u-tokyo.ac.jp; Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655
Highlights: • Single-nucleotide polymorphisms (SNPs) associated with osteoporosis were identified. • SNPs mapped close to or within VDR and ESR1 are associated with bone mineral density. • WNT signaling pathway plays a pivotal role in regulating bone mineral density. • Genetic studies will be useful for identification of new therapeutic targets. - Abstract: Osteoporosis is a skeletal disease characterized by low bone mineral density (BMD) and microarchitectural deterioration of bone tissue, which increases susceptibility to fractures. BMD is a complex quantitative trait with normal distribution and seems to be genetically controlled (in 50–90% of the cases), according to studies onmore » twins and families. Over the last 20 years, candidate gene approach and genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with low BMD, osteoporosis, and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding nuclear receptors and WNT-β-catenin signaling proteins. Understanding the genetics of osteoporosis will help identify novel candidates for diagnostic and therapeutic targets.« less
Vav1: Friend and Foe of Cancer.
Guo, Fukun; Zheng, Yi
2017-12-01
A recent study shows that the protumorigenic guanine nucleotide exchange factor (GEF) Vav1 functions as a tumor suppressor in T cell acute lymphoblastic leukemia (T-ALL) through its ability to complex with the Cbl-b ubiquitin ligase and the intracellular domain of Notch1 (ICN1) and to promote ICN1 degradation. Vav1can act as a double-edged sword in tumorigenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Saeed, Isaam; Tang, Sen-Lin; Halgamuge, Saman K.
2012-01-01
An approach to infer the unknown microbial population structure within a metagenome is to cluster nucleotide sequences based on common patterns in base composition, otherwise referred to as binning. When functional roles are assigned to the identified populations, a deeper understanding of microbial communities can be attained, more so than gene-centric approaches that explore overall functionality. In this study, we propose an unsupervised, model-based binning method with two clustering tiers, which uses a novel transformation of the oligonucleotide frequency-derived error gradient and GC content to generate coarse groups at the first tier of clustering; and tetranucleotide frequency to refine these groups at the secondary clustering tier. The proposed method has a demonstrated improvement over PhyloPythia, S-GSOM, TACOA and TaxSOM on all three benchmarks that were used for evaluation in this study. The proposed method is then applied to a pyrosequenced metagenomic library of mud volcano sediment sampled in southwestern Taiwan, with the inferred population structure validated against complementary sequencing of 16S ribosomal RNA marker genes. Finally, the proposed method was further validated against four publicly available metagenomes, including a highly complex Antarctic whale-fall bone sample, which was previously assumed to be too complex for binning prior to functional analysis. PMID:22180538
Sequential structures provide insights into the fidelity of RNA replication.
Ferrer-Orta, Cristina; Arias, Armando; Pérez-Luque, Rosa; Escarmís, Cristina; Domingo, Esteban; Verdaguer, Nuria
2007-05-29
RNA virus replication is an error-prone event caused by the low fidelity of viral RNA-dependent RNA polymerases. Replication fidelity can be decreased further by the use of mutagenic ribonucleoside analogs to a point where viral genetic information can no longer be maintained. For foot-and-mouth disease virus, the antiviral analogs ribavirin and 5-fluorouracil have been shown to be mutagenic, contributing to virus extinction through lethal mutagenesis. Here, we report the x-ray structure of four elongation complexes of foot-and-mouth disease virus polymerase 3D obtained in presence of natural substrates, ATP and UTP, or mutagenic nucleotides, ribavirin triphosphate and 5-fluorouridine triphosphate with different RNAs as template-primer molecules. The ability of these complexes to synthesize RNA in crystals allowed us to capture different successive replication events and to define the critical amino acids involved in (i) the recognition and positioning of the incoming nucleotide or analog; (ii) the positioning of the acceptor base of the template strand; and (iii) the positioning of the 3'-OH group of the primer nucleotide during RNA replication. The structures identify key interactions involved in viral RNA replication and provide insights into the molecular basis of the low fidelity of viral RNA polymerases.
Crepin, Thibaut; Shalak, Vyacheslav F.; Yaremchuk, Anna D.; Vlasenko, Dmytro O.; McCarthy, Andrew; Negrutskii, Boris S.; Tukalo, Michail A.; El'skaya, Anna V.
2014-01-01
Eukaryotic elongation factor eEF1A transits between the GTP- and GDP-bound conformations during the ribosomal polypeptide chain elongation. eEF1A*GTP establishes a complex with the aminoacyl-tRNA in the A site of the 80S ribosome. Correct codon–anticodon recognition triggers GTP hydrolysis, with subsequent dissociation of eEF1A*GDP from the ribosome. The structures of both the ‘GTP’- and ‘GDP’-bound conformations of eEF1A are unknown. Thus, the eEF1A-related ribosomal mechanisms were anticipated only by analogy with the bacterial homolog EF-Tu. Here, we report the first crystal structure of the mammalian eEF1A2*GDP complex which indicates major differences in the organization of the nucleotide-binding domain and intramolecular movements of eEF1A compared to EF-Tu. Our results explain the nucleotide exchange mechanism in the mammalian eEF1A and suggest that the first step of eEF1A*GDP dissociation from the 80S ribosome is the rotation of the nucleotide-binding domain observed after GTP hydrolysis. PMID:25326326
Stervander, Martin; Illera, Juan Carlos; Kvist, Laura; Barbosa, Pedro; Keehnen, Naomi P; Pruisscher, Peter; Bensch, Staffan; Hansson, Bengt
2015-05-01
Isolated islands and their often unique biota continue to play key roles for understanding the importance of drift, genetic variation and adaptation in the process of population differentiation and speciation. One island system that has inspired and intrigued evolutionary biologists is the blue tit complex (Cyanistes spp.) in Europe and Africa, in particular the complex evolutionary history of the multiple genetically distinct taxa of the Canary Islands. Understanding Afrocanarian colonization events is of particular importance because of recent unconventional suggestions that these island populations acted as source of the widespread population in mainland Africa. We investigated the relationship between mainland and island blue tits using a combination of Sanger sequencing at a population level (20 loci; 12 500 nucleotides) and next-generation sequencing of single population representatives (>3 200 000 nucleotides), analysed in coalescence and phylogenetic frameworks. We found (i) that Afrocanarian blue tits are monophyletic and represent four major clades, (ii) that the blue tit complex has a continental origin and that the Canary Islands were colonized three times, (iii) that all island populations have low genetic variation, indicating low long-term effective population sizes and (iv) that populations on La Palma and in Libya represent relicts of an ancestral North African population. Further, demographic reconstructions revealed (v) that the Canary Islands, conforming to traditional views, hold sink populations, which have not served as source for back colonization of the African mainland. Our study demonstrates the importance of complete taxon sampling and an extensive multimarker study design to obtain robust phylogeographical inferences. © 2015 John Wiley & Sons Ltd.
Often Ignored Facts about the Control of the 2-Oxoglutarate Dehydrogenase Complex
ERIC Educational Resources Information Center
Strumilo, Slawomir
2005-01-01
Information about the control of the activity of the 2-oxoglutarate dehydrogenase complex (OGDHC), a key enzyme in the citric acid cycle, is not well covered in the biochemical education literature, especially as it concerns the allosteric regulation of OGDHC by adenine nucleotide and ortophosphate. From experimental work published during the last…
Genome-Wide Profiling of RNA–Protein Interactions Using CLIP-Seq
Stork, Cheryl; Zheng, Sika
2017-01-01
UV crosslinking immunoprecipitation (CLIP) is an increasingly popular technique to study protein–RNA interactions in tissues and cells. Whole cells or tissues are ultraviolet irradiated to generate a covalent bond between RNA and proteins that are in close contact. After partial RNase digestion, antibodies specific to an RNA binding protein (RBP) or a protein–epitope tag is then used to immunoprecipitate the protein–RNA complexes. After stringent washing and gel separation the RBP–RNA complex is excised. The RBP is protease digested to allow purification of the bound RNA. Reverse transcription of the RNA followed by high-throughput sequencing of the cDNA library is now often used to identify protein bound RNA on a genome-wide scale. UV irradiation can result in cDNA truncations and/or mutations at the crosslink sites, which complicates the alignment of the sequencing library to the reference genome and the identification of the crosslinking sites. Meanwhile, one or more amino acids of a crosslinked RBP can remain attached to its bound RNA due to incomplete digestion of the protein. As a result, reverse transcriptase may not read through the crosslink sites, and produce cDNA ending at the crosslinked nucleotide. This is harnessed by one variant of CLIP methods to identify crosslinking sites at a nucleotide resolution. This method, individual nucleotide resolution CLIP (iCLIP) circularizes cDNA to capture the truncated cDNA and also increases the efficiency of ligating sequencing adapters to the library. Here, we describe the detailed procedure of iCLIP. PMID:26965263
Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA
Gamache, Eric R.; Doh, Jung H.; Ritz, Justin; Laederach, Alain; Bellaousov, Stanislav; Mathews, David H.; Curcio, M. Joan
2017-01-01
The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5′ terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT). To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1), a 1-nucleotide interhelical loop and an 8-bp stem (S2) that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging. PMID:28445416
Vo, Uybach; Vajpai, Navratna; Embrey, Kevin J; Golovanov, Alexander P
2016-07-14
The cycling between GDP- and GTP- bound forms of the Ras protein is partly regulated by the binding of Sos. The structural/dynamic behavior of the complex formed between activated Sos and Ras at the point of the functional cycle where the nucleotide exchange is completed has not been described to date. Here we show that solution NMR spectra of H-Ras∙GTPγS mixed with a functional fragment of Sos (Sos(Cat)) at a 2:1 ratio are consistent with the formation of a rather dynamic assembly. H-Ras∙GTPγS binding was in fast exchange on the NMR timescale and retained a significant degree of molecular tumbling independent of Sos(Cat), while Sos(Cat) also tumbled largely independently of H-Ras. Estimates of apparent molecular weight from both NMR data and SEC-MALS revealed that, at most, only one H-Ras∙GTPγS molecule appears stably bound to Sos. The weak transient interaction between Sos and the second H-Ras∙GTPγS may provide a necessary mechanism for complex dissociation upon the completion of the native GDP → GTP exchange reaction, but also explains measurable GTP → GTP exchange activity of Sos routinely observed in in vitro assays that use fluorescently-labelled analogs of GTP. Overall, the data presents the first dynamic snapshot of Ras functional cycle as controlled by Sos.
c-Type Cytochrome-Dependent Formation of U(IV) Nanoparticles by Shewanella oneidensis
Marshall, Matthew J; Dohnalkova, Alice C; Kennedy, David W; Shi, Liang; Wang, Zheming; Boyanov, Maxim I; Lai, Barry; Kemner, Kenneth M; McLean, Jeffrey S; Reed, Samantha B; Culley, David E; Bailey, Vanessa L; Simonson, Cody J; Saffarini, Daad A; Romine, Margaret F; Zachara, John M
2006-01-01
Modern approaches for bioremediation of radionuclide contaminated environments are based on the ability of microorganisms to effectively catalyze changes in the oxidation states of metals that in turn influence their solubility. Although microbial metal reduction has been identified as an effective means for immobilizing highly-soluble uranium(VI) complexes in situ, the biomolecular mechanisms of U(VI) reduction are not well understood. Here, we show that c-type cytochromes of a dissimilatory metal-reducing bacterium, Shewanella oneidensis MR-1, are essential for the reduction of U(VI) and formation of extracelluar UO 2 nanoparticles. In particular, the outer membrane (OM) decaheme cytochrome MtrC (metal reduction), previously implicated in Mn(IV) and Fe(III) reduction, directly transferred electrons to U(VI). Additionally, deletions of mtrC and/or omcA significantly affected the in vivo U(VI) reduction rate relative to wild-type MR-1. Similar to the wild-type, the mutants accumulated UO 2 nanoparticles extracellularly to high densities in association with an extracellular polymeric substance (EPS). In wild-type cells, this UO 2-EPS matrix exhibited glycocalyx-like properties and contained multiple elements of the OM, polysaccharide, and heme-containing proteins. Using a novel combination of methods including synchrotron-based X-ray fluorescence microscopy and high-resolution immune-electron microscopy, we demonstrate a close association of the extracellular UO 2 nanoparticles with MtrC and OmcA (outer membrane cytochrome). This is the first study to our knowledge to directly localize the OM-associated cytochromes with EPS, which contains biogenic UO 2 nanoparticles. In the environment, such association of UO 2 nanoparticles with biopolymers may exert a strong influence on subsequent behavior including susceptibility to oxidation by O 2 or transport in soils and sediments. PMID:16875436
2015-01-01
Numerous kinetic, structural, and theoretical studies have established that DNA polymerases adjust their domain structures to enclose nucleotides in their active sites and then rearrange critical active site residues and substrates for catalysis, with the latter conformational change acting to kinetically limit the correct nucleotide incorporation rate. Additionally, structural studies have revealed a large conformational change between the apoprotein and the DNA–protein binary state for Y-family DNA polymerases. In previous studies [Xu, C., Maxwell, B. A., Brown, J. A., Zhang, L., and Suo, Z. (2009) PLoS Biol.7, e1000225], a real-time Förster resonance energy transfer (FRET) method was developed to monitor the global conformational transitions of DNA polymerase IV from Sulfolobus solfataricus (Dpo4), a prototype Y-family enzyme, during nucleotide binding and incorporation by measuring changes in distance between locations on the enzyme and the DNA substrate. To elucidate further details of the conformational transitions of Dpo4 during substrate binding and catalysis, in this study, the real-time FRET technique was used to monitor changes in distance between various pairs of locations in the protein itself. In addition to providing new insight into the conformational changes as revealed in previous studies, the results here show that the previously described conformational change between the apo and DNA-bound states of Dpo4 occurs in a mechanistic step distinct from initial formation or dissociation of the binary complex of Dpo4 and DNA. PMID:24568554
Blaikley, Elizabeth J; Tinline-Purvis, Helen; Kasparek, Torben R; Marguerat, Samuel; Sarkar, Sovan; Hulme, Lydia; Hussey, Sharon; Wee, Boon-Yu; Deegan, Rachel S; Walker, Carol A; Pai, Chen-Chun; Bähler, Jürg; Nakagawa, Takuro; Humphrey, Timothy C
2014-05-01
DNA double-strand breaks (DSBs) can cause chromosomal rearrangements and extensive loss of heterozygosity (LOH), hallmarks of cancer cells. Yet, how such events are normally suppressed is unclear. Here we identify roles for the DNA damage checkpoint pathway in facilitating homologous recombination (HR) repair and suppressing extensive LOH and chromosomal rearrangements in response to a DSB. Accordingly, deletion of Rad3(ATR), Rad26ATRIP, Crb2(53BP1) or Cdc25 overexpression leads to reduced HR and increased break-induced chromosome loss and rearrangements. We find the DNA damage checkpoint pathway facilitates HR, in part, by promoting break-induced Cdt2-dependent nucleotide synthesis. We also identify additional roles for Rad17, the 9-1-1 complex and Chk1 activation in facilitating break-induced extensive resection and chromosome loss, thereby suppressing extensive LOH. Loss of Rad17 or the 9-1-1 complex results in a striking increase in break-induced isochromosome formation and very low levels of chromosome loss, suggesting the 9-1-1 complex acts as a nuclease processivity factor to facilitate extensive resection. Further, our data suggest redundant roles for Rad3ATR and Exo1 in facilitating extensive resection. We propose that the DNA damage checkpoint pathway coordinates resection and nucleotide synthesis, thereby promoting efficient HR repair and genome stability. © The Author(s) 2014. Published by Oxford University Press.
Crystal structures of catalytic complexes of the oxidative DNA/RNA repair enzyme AlkB
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu,B.; Edstrom, W.; Benach, J.
2006-01-01
Nucleic acid damage by environmental and endogenous alkylation reagents creates lesions that are both mutagenic and cytotoxic, with the latter effect accounting for their widespread use in clinical cancer chemotherapy. Escherichia coliAlkB and the homologous human proteins ABH2 and ABH3 (refs 5, 7) promiscuously repair DNA and RNA bases damaged by SN2 alkylation reagents, which attach hydrocarbons to endocyclic ring nitrogen atoms (N1 of adenine and guanine and N3 of thymine and cytosine). Although the role of AlkB in DNA repair has long been established based on phenotypic studies, its exact biochemical activity was only elucidated recently after sequence profilemore » analysis revealed it to be a member of the Fe-oxoglutarate-dependent dioxygenase superfamily. These enzymes use an Fe(ii) cofactor and 2-oxoglutarate co-substrate to oxidize organic substrates. AlkB hydroxylates an alkylated nucleotide base to produce an unstable product that releases an aldehyde to regenerate the unmodified base. Here we have determined crystal structures of substrate and product complexes of E. coli AlkB at resolutions from 1.8 to 2.3 Angstroms. Whereas the Fe-2-oxoglutarate dioxygenase core matches that in other superfamily members, a unique subdomain holds a methylated trinucleotide substrate into the active site through contacts to the polynucleotide backbone. Amide hydrogen exchange studies and crystallographic analyses suggest that this substrate-binding 'lid' is conformationally flexible, which may enable docking of diverse alkylated nucleotide substrates in optimal catalytic geometry. Different crystal structures show open and closed states of a tunnel putatively gating O2 diffusion into the active site. Exposing crystals of the anaerobic Michaelis complex to air yields slow but substantial oxidation of 2-oxoglutarate that is inefficiently coupled to nucleotide oxidation. These observations suggest that protein dynamics modulate redox chemistry and that a hypothesized migration of the reactive oxy-ferryl ligand on the catalytic Fe ion may be impeded when the protein is constrained in the crystal lattice.« less
Comparative nucleotide diversity across North American and European populus species.
Ismail, Mohamed; Soolanayakanahally, Raju Y; Ingvarsson, Pär K; Guy, Robert D; Jansson, Stefan; Silim, Salim N; El-Kassaby, Yousry A
2012-06-01
Nucleotide polymorphisms in two North American balsam poplars (Populus trichocarpa Torr. & Gray and P. balsamifera L.; section Tacamahaca), and one Eurasian aspen (P. tremula L.; section Populus) were compared using nine loci involved in defense, stress response, photoperiodism, freezing tolerance, and housekeeping. Nucleotide diversity varied among species and was highest for P. tremula (θ(w) = 0.005, π(T) = 0.007) as compared to P. balsamifera (θ(w) = 0.004, π(T) = 0.005) or P. trichocarpa (θ(w) = 0.002, π(T) = 0.003). Across species, the defense and the stress response loci accounted for the majority of the observed level of nucleotide diversity. In general, the studied loci did not deviate from neutral expectation either at the individual locus (non-significant normalized Fay and Wu's H) or at the multi-locus level (non-significant HKA test). Using molecular clock analysis, section Tacamahaca probably shared a common ancestor with section Populus approximately 4.5 million year ago. Divergence between the two closely related balsam poplars was about 0.8 million years ago, a pattern consistent with an isolation-with-migration (IM) model. As expected, P. tremula showed a five-fold higher substitution rate (2 × 10(-8) substitution/site/year) compared to the North American species (0.4 × 10(-8) substitution/site/year), probably reflecting its complex demographic history. Linkage disequilibrium (LD) varied among species with a more rapid decay in the North American species (<400 bp) in comparison to P. tremula (≫400 bp). The similarities in nucleotide diversity pattern and LD decay of the two balsam poplar species likely reflects the recent time of their divergence.
Navarro, Freddy; Ramírez-Sarmiento, César A; Guixé, Victoria
2013-10-01
Pyridoxal 5'-phosphate is the active form of vitamin B6 and its deficiency is directly related with several human disorders, which make human pyridoxal kinase (hPLK) an important pharmacologic target. In spite of this, a carefully kinetic characterization of hPLK including the main species that regulates the enzymatic activity is at date missing. Here we analyse the catalytic and regulatory mechanisms of hPLK as a function of a precise determination of the species involved in metal-nucleotide equilibriums and describe new regulatory mechanisms for this enzyme. hPLK activity is supported by several metals, being Zn(2+) the most effective, although the magnitude of the effect observed is highly dependent on the relative concentrations of metal and nucleotide used. The true substrate for the reaction catalyzed by hPLK is the metal nucleotide complex, while ATP(4-) and HATP(3-) did not affect the activity. The enzyme presents substrate inhibition by both pyridoxal (PL) and ZnATP(2-), although the latter behaves as a weakly inhibitor. Our study also established, for the first time, a dual role for free Zn(2+); as an activator at low concentrations (19 μM optimal concentration) and as a potent inhibitor with a IC50 of 37 μM. These results highlighted the importance of an accurate estimation of the actual concentration of the species involved in metal-nucleotide equilibriums in order to obtain reliable values for the kinetic parameters, and for determine the true regulators of the PLK activity. They also help to explain the dissimilar kinetic parameters reported in the literature for this enzyme.
Park, Ji Hye
2018-01-01
Estimation of postmortem interval (PMI) is paramount in modern forensic investigation. After the disappearance of the early postmortem phenomena conventionally used to estimate PMI, entomologic evidence provides important indicators for PMI estimation. The age of the oldest fly larvae or pupae can be estimated to pinpoint the time of oviposition, which is considered the minimum PMI (PMImin). The development rate of insects is usually temperature dependent and species specific. Therefore, species identification is mandatory for PMImin estimation using entomological evidence. The classical morphological identification method cannot be applied when specimens are damaged or have not yet matured. To overcome this limitation, some investigators employ molecular identification using mitochondrial cytochrome c oxidase subunit I (COI) nucleotide sequences. The molecular identification method commonly uses Sanger's nucleotide sequencing and molecular phylogeny, which are complex and time consuming and constitute another obstacle for forensic investigators. In this study, instead of using conventional Sanger's nucleotide sequencing, single-nucleotide polymorphisms (SNPs) in the COI gene region, which are unique between fly species, were selected and targeted for single-base extension (SBE) technology. These SNPs were genotyped using a SNaPshot® kit. Eleven Calliphoridae and seven Sarcophagidae species were covered. To validate this genotyping, fly DNA samples (103 adults, 84 larvae, and 4 pupae) previously confirmed by DNA barcoding were used. This method worked quickly with minimal DNA, providing a potential alternative to conventional DNA barcoding. Consisting of only a few simple electropherogram peaks, the results were more straightforward compared with those of the conventional DNA barcoding produced by Sanger's nucleotide sequencing. PMID:29682531
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luciakova, Katarina, E-mail: katarina.luciakova@savba.sk; Kollarovic, Gabriel; Kretova, Miroslava
2011-08-05
Highlights: {yields} TGF-{beta} induces the formation of unique nuclear NF1/Smad4 complexes that repress expression of the ANT-2 gene. {yields} Repression is mediated through an NF1-dependent repressor element in the promoter. {yields} The formation of NF1/Smad4 complexes and the repression of ANT2 are prevented by inhibitors of p38 kinase and TGF-{beta} RI. {yields} NF1/Smad complexes implicate novel role for NF1 and Smad proteins in the regulation of growth. -- Abstract: We earlier reported the formation of a unique nuclear NF1/Smad complex in serum-restricted fibroblasts that acts as an NF1-dependent repressor of the human adenine nucleotide translocase-2 gene (ANT2) [K. Luciakova, G.more » Kollarovic, P. Barath, B.D. Nelson, Growth-dependent repression of human adenine nucleotide translocator-2 (ANT2) transcription: evidence for the participation of Smad and Sp family proteins in the NF1-dependent repressor complex, Biochem. J. 412 (2008) 123-130]. In the present study, we show that TGF-{beta}, like serum-restriction: (a) induces the formation of NF1/Smad repressor complexes, (b) increases binding of the complexes to the repressor elements (Go elements) in the ANT2 promoter, and (c) inhibits ANT2 expression. Repression of ANT2 by TGF-{beta} is eliminated by mutating the NF1 binding sites in the Go repressor elements. All of the above responses to TGF-{beta} are prevented by inhibitors of TGF-{beta} RI and MAPK p38. These inhibitors also prevent NF1/Smad4 repressor complex formation and repression of ANT2 expression in serum-restricted cells, suggesting that similar signaling pathways are initiated by TGF-{beta} and serum-restriction. The present finding that NF1/Smad4 repressor complexes are formed through TGF-{beta} signaling pathways suggests a new, but much broader, role for these complexes in the initiation or maintenance of the growth-inhibited state.« less
Evidence for conformational capture mechanism for damage recognition by NER protein XPC/Rad4.
NASA Astrophysics Data System (ADS)
Chakraborty, Sagnik; Steinbach, Peter J.; Paul, Debamita; Min, Jung-Hyun; Ansari, Anjum
Altered flexibility of damaged DNA sites is considered to play an important role in damage recognition by DNA repair proteins. Characterizing lesion-induced DNA dynamics has remained a challenge. We have combined ps-resolved fluorescence lifetime measurements with cytosine analog FRET pair uniquely sensitive to local unwinding/twisting to analyze DNA conformational distributions. This innovative approach maps out with unprecedented sensitivity the alternative conformations accessible to a series of DNA constructs containing 3-base-pair mismatch, suitable model lesions for the DNA repair protein xeroderma pigmentosum C (XPC) complex. XPC initiates eukaryotic nucleotide excision repair by recognizing various DNA lesions primarily through DNA deformability. Structural studies show that Rad4 (yeast ortholog of XPC) unwinds DNA at the lesion site and flips out two nucleotide pairs. Our results elucidate a broad range of conformations accessible to mismatched DNA even in the absence of the protein. Notably, the most severely distorted conformations share remarkable resemblance to the deformed conformation seen in the crystal structure of the Rad4-bound ``recognition'' complex supporting for the first time a possible ``conformational capture'' mechanism for damage recognition by XPC/Rad4. NSF Univ of Illinois-Chicago.
Joffret, Marie-Line; Jégouic, Sophie; Bessaud, Maël; Balanant, Jean; Tran, Coralie; Caro, Valerie; Holmblat, Barbara; Razafindratsimandresy, Richter; Reynes, Jean-Marc; Rakoto-Andrianarivelo, Mala; Delpeyroux, Francis
2012-05-01
Five cases of poliomyelitis due to type 2 or 3 recombinant vaccine-derived polioviruses (VDPVs) were reported in the Toliara province of Madagascar in 2005. We sequenced the genome of the VDPVs isolated from the patients and from 12 healthy children and characterized phenotypic aspects, including pathogenicity, in mice transgenic for the poliovirus receptor. We identified 6 highly complex mosaic recombinant lineages composed of sequences derived from different vaccine polioviruses and other species C human enteroviruses (HEV-Cs). Most had some recombinant genome features in common and contained nucleotide sequences closely related to certain cocirculating coxsackie A virus isolates. However, they differed in terms of their recombinant characteristics or nucleotide substitutions and phenotypic features. All VDPVs were neurovirulent in mice. This study confirms the genetic relationship between type 2 and 3 VDPVs, indicating that both types can be involved in a single outbreak of disease. Our results highlight the various ways in which a vaccine-derived poliovirus may become pathogenic in complex viral ecosystems, through frequent recombination events and mutations. Intertypic recombination between cocirculating HEV-Cs (including polioviruses) appears to be a common mechanism of genetic plasticity underlying transverse genetic variability.
Origins and Domestication of Cultivated Banana Inferred from Chloroplast and Nuclear Genes
Zhang, Cui; Wang, Xin-Feng; Shi, Feng-Xue; Chen, Wen-Na; Ge, Xue-Jun
2013-01-01
Background Cultivated bananas are large, vegetatively-propagated members of the genus Musa. More than 1,000 cultivars are grown worldwide and they are major economic and food resources in numerous developing countries. It has been suggested that cultivated bananas originated from the islands of Southeast Asia (ISEA) and have been developed through complex geodomestication pathways. However, the maternal and parental donors of most cultivars are unknown, and the pattern of nucleotide diversity in domesticated banana has not been fully resolved. Methodology/Principal Findings We studied the genetics of 16 cultivated and 18 wild Musa accessions using two single-copy nuclear (granule-bound starch synthase I, GBSS I, also known as Waxy, and alcohol dehydrogenase 1, Adh1) and two chloroplast (maturase K, matK, and the trnL-F gene cluster) genes. The results of phylogenetic analyses showed that all A-genome haplotypes of cultivated bananas were grouped together with those of ISEA subspecies of M. acuminata (A-genome). Similarly, the B- and S-genome haplotypes of cultivated bananas clustered with the wild species M. balbisiana (B-genome) and M. schizocarpa (S-genome), respectively. Notably, it has been shown that distinct haplotypes of each cultivar (A-genome group) were nested together to different ISEA subspecies M. acuminata. Analyses of nucleotide polymorphism in the Waxy and Adh1 genes revealed that, in comparison to the wild relatives, cultivated banana exhibited slightly lower nucleotide diversity both across all sites and specifically at silent sites. However, dramatically reduced nucleotide diversity was found at nonsynonymous sites for cultivated bananas. Conclusions/Significance Our study not only confirmed the origin of cultivated banana as arising from multiple intra- and inter-specific hybridization events, but also showed that cultivated banana may have not suffered a severe genetic bottleneck during the domestication process. Importantly, our findings suggested that multiple maternal origins and a reduction in nucleotide diversity at nonsynonymous sites are general attributes of cultivated bananas. PMID:24260405
Crystal Structure of a CRISPR RNA-guided Surveillance Complex Bound to a ssDNA Target
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mulepati, Sabin; Heroux, Annie; Bailey, Scott
In prokaryotes, RNA derived from type I and type III CRISPR loci direct large ribonucleoprotein complexes to destroy invading bacteriophage and plasmids. In Escherichia coli, this 405-kilodalton complex is called Cascade. We report the crystal structure of Cascade bound to a single-stranded DNA (ssDNA) target at a resolution of 3.03 angstroms. The structure reveals that the CRISPR RNA and target strands do not form a double helix but instead adopt an underwound ribbon-like structure. This noncanonical structure is facilitated by rotation of every sixth nucleotide out of the RNA-DNA hybrid and is stabilized by the highly interlocked organization of proteinmore » subunits. These studies provide insight into both the assembly and the activity of this complex and suggest a mechanism to enforce fidelity of target binding.« less
Crystal structure of a CRISPR RNA-guided surveillance complex bound to a ssDNA target
Mulepati, Sabin; Héroux, Annie; Bailey, Scott
2015-01-01
In prokaryotes, RNA derived from type I and type III CRISPR loci direct large ribonucleoprotein complexes to destroy invading bacteriophage and plasmids. In Escherichia coli, this 405-kDa complex is called Cascade. Here we report the 3.03Å crystal structure of Cascade bound to a single-stranded DNA target. The structure reveals that the CRISPR RNA and target strands do not form a double helix but instead adopt an underwound ribbon-like structure. This non-canonical structure is facilitated by rotation of every sixth nucleotide out of the RNA-DNA hybrid and is stabilized by the highly interlocked organization of protein subunits. These studies provide insight into both the assembly and the activity of this complex and suggest a mechanism to enforce fidelity of target binding. PMID:25123481
Smith, Jayden A; Collins, J Grant; Patterson, Bradley T; Keene, F Richard
2004-05-07
The binding of the three stereoisomers (DeltaDelta-, LambdaLambda- and DeltaLambda-) of the dinuclear ruthenium(II) complex [[Ru(Me2bpy)2]2(mu-bpm)]4+ [Me2bpy = 4,4'-dimethyl-2,2'-bipyridine; bpm = 2,2'-bipyrimidine] to a tridecanucleotide containing a single adenine bulge has been studied by 1H NMR spectroscopy. The addition of the DeltaDelta-isomer to d(CCGAGAATTCCGG)2 induced significant chemical shift changes for the base and sugar resonances of the residues at the bulge site (G3A4G5/C11C10), whereas small shifts were observed upon addition of the enantiomeric LambdaLambda-form. NOESY spectra of the tridecanucleotide bound with the DeltaDelta-isomer revealed intermolecular NOE's between the metal complex and the nucleotide residues at the bulge site, while only weak NOE's were observed to terminal residues to the LambdaLambda-form. Competitive binding studies were performed where both enantiomers were simultaneously added to the tridecanucleotide, and for all ratios of the two stereoisomers the DeltaDelta-isomer remained selectively bound at the bulge site with the LambdaLambda-enantiomer localised at the terminal regions of the tridecanucleotide. The meso-diastereoisomer (DeltaLambda) was found to bind to the tridecanucleotide with characteristics intermediate between the DeltaDelta- and LambdaLambda-enantiomers of the rac form. Two distinct sets of metal complex resonances were observed, with one set having essentially the same shift as the free metal complex, whilst the other set of resonances exhibited significant shifts. The NOE data indicated that the meso-diastereoisomer does not bind as selectively as the DeltaDelta-isomer, with NOE's observed to a greater number of nucleotide residues compared to the DeltaDelta-form. This study provides a rare example of total enantioselectivity in the binding of an inert transition metal complex to DNA, produced by the shape recognition of both ruthenium(II) centres.
Vergnano, Marta; Wan, Chris
2017-01-01
ABSTRACT We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. PMID:28743817
Dalman, Kerstin; Himmelstrand, Kajsa; Olson, Åke; Lind, Mårten; Brandström-Durling, Mikael; Stenlid, Jan
2013-01-01
The dense single nucleotide polymorphisms (SNP) panels needed for genome wide association (GWA) studies have hitherto been expensive to establish and use on non-model organisms. To overcome this, we used a next generation sequencing approach to both establish SNPs and to determine genotypes. We conducted a GWA study on a fungal species, analysing the virulence of Heterobasidion annosum s.s., a necrotrophic pathogen, on its hosts Picea abies and Pinus sylvestris. From a set of 33,018 single nucleotide polymorphisms (SNP) in 23 haploid isolates, twelve SNP markers distributed on seven contigs were associated with virulence (P<0.0001). Four of the contigs harbour known virulence genes from other fungal pathogens and the remaining three harbour novel candidate genes. Two contigs link closely to virulence regions recognized previously by QTL mapping in the congeneric hybrid H. irregulare × H. occidentale. Our study demonstrates the efficiency of GWA studies for dissecting important complex traits of small populations of non-model haploid organisms with small genomes. PMID:23341945
Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun
2015-01-01
Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.
Site-directed DNA crosslinking of large multisubunit protein-DNA complexes.
Persinger, Jim; Bartholomew, Blaine
2009-01-01
Several methods have been developed to site-specifically incorporate photoreactive nucleotide analogs into DNA for the purpose of identifying the proteins and their domains that are in contact with particular regions of DNA. The synthesis of several deoxynucleotide analogs that have a photoreactive group tethered to the nucleotide base and the incorporation of these analogs into DNA are described. In a second approach, oligonucleotide with a photoreactive group attached to the phosphate backbone is chemically synthesized. The photoreactive oligonucleotide is then enzymatically incorporated into DNA by annealing it to a complementary DNA template and extending with DNA polymerase. Both approaches have been effectively used to map protein-DNA interactions in large multisubunit complexes such as the eukaryotic transcription or ATP-dependent chromatin remodeling complexes. Not only do these techniques map the binding sites of the various subunits in these complexes, but when coupled with peptide mapping also determine the protein domain that is in close proximity to the different DNA sites. The strength of these techniques is the ability to scan a large number of potential sites by making combinations of different DNA probes and is facilitated by using an immobilized DNA template for synthesis.
Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R. Scott; Habu, Yoshiki; Ishikawa, Masayuki
2013-01-01
trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)–mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1–RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3′ cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3′ cleavage fragment. When the 3′ nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3′ cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1–RISC via the double-stranded RNA formed by the 3′-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1–RISC molecular surface, (ii) SGS3 protects the 3′ cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3′ fragment of TAS2 RNA is key to tasiRNA production. PMID:23417299
Kiselar, Janna G.; Mahaffy, Rachel; Pollard, Thomas D.; Almo, Steven C.; Chance, Mark R.
2007-01-01
Actin-related protein (Arp) 2/3 complex nucleates new branches in actin filaments playing a key role in controlling eukaryotic cell motility. This process is tightly regulated by activating factors: ATP and WASp-family proteins. However, the mechanism of activation remains largely hypothetical. We used radiolytic protein footprinting with mass spectrometry in solution to probe the effects of nucleotide- and WASp-binding on Arp2/3. These results represent two significant advances in such footprinting approaches. First, Arp2/3 is the most complex macromolecular assembly yet examined; second, only a few picomoles of Arp2/3 was required for individual experiments. In terms of structural biology of Arp 2/3, we find that ATP binding induces conformational changes within Arp2/3 complex in Arp3 (localized in peptide segments 5–18, 212–225, and 318–327) and Arp2 (within peptide segment 300–316). These data are consistent with nucleotide docking within the nucleotide clefts of the actin-related proteins promoting closure of the cleft of the Arp3 subunit. However, ATP binding does not induce conformational changes in the other Arp subunits. Arp2/3 complex binds to WASp within the C subdomain at residue Met 474 and within the A subdomain to Trp 500. Our data suggest a bivalent attachment of WASp to Arp3 (within peptides 162–191 and 318–329) and Arp2 (within peptides 66–80 and 87–97). WASp-dependent protections from oxidation within peptides 54–65 and 80–91 of Arp3 and in peptides 300–316 of Arp2 suggest domain rearrangements of Arp2 and Arp3 resulting in a closed conformational state consistent with an “actin-dimer” model for the active state. PMID:17251352
Wallace, Adam; Filbin, Megan E.; Veo, Bethany; McFarland, Craig; Stepinski, Janusz; Jankowska-Anyszka, Marzena; Darzynkiewicz, Edward; Davis, Richard E.
2010-01-01
Eukaryotic mRNA translation begins with recruitment of the 40S ribosome complex to the mRNA 5′ end through the eIF4F initiation complex binding to the 5′ m7G-mRNA cap. Spliced leader (SL) RNA trans splicing adds a trimethylguanosine (TMG) cap and a sequence, the SL, to the 5′ end of mRNAs. Efficient translation of TMG-capped mRNAs in nematodes requires the SL sequence. Here we define a core set of nucleotides and a stem-loop within the 22-nucleotide nematode SL that stimulate translation of mRNAs with a TMG cap. The structure and core nucleotides are conserved in other nematode SLs and correspond to regions of SL1 required for early Caenorhabditis elegans development. These SL elements do not facilitate translation of m7G-capped RNAs in nematodes or TMG-capped mRNAs in mammalian or plant translation systems. Similar stem-loop structures in phylogenetically diverse SLs are predicted. We show that the nematode eukaryotic translation initiation factor 4E/G (eIF4E/G) complex enables efficient translation of the TMG-SL RNAs in diverse in vitro translation systems. TMG-capped mRNA translation is determined by eIF4E/G interaction with the cap and the SL RNA, although the SL does not increase the affinity of eIF4E/G for capped RNA. These results suggest that the mRNA 5′ untranslated region (UTR) can play a positive and novel role in translation initiation through interaction with the eIF4E/G complex in nematodes and raise the issue of whether eIF4E/G-RNA interactions play a role in the translation of other eukaryotic mRNAs. PMID:20154140
Wallace, Adam; Filbin, Megan E; Veo, Bethany; McFarland, Craig; Stepinski, Janusz; Jankowska-Anyszka, Marzena; Darzynkiewicz, Edward; Davis, Richard E
2010-04-01
Eukaryotic mRNA translation begins with recruitment of the 40S ribosome complex to the mRNA 5' end through the eIF4F initiation complex binding to the 5' m(7)G-mRNA cap. Spliced leader (SL) RNA trans splicing adds a trimethylguanosine (TMG) cap and a sequence, the SL, to the 5' end of mRNAs. Efficient translation of TMG-capped mRNAs in nematodes requires the SL sequence. Here we define a core set of nucleotides and a stem-loop within the 22-nucleotide nematode SL that stimulate translation of mRNAs with a TMG cap. The structure and core nucleotides are conserved in other nematode SLs and correspond to regions of SL1 required for early Caenorhabditis elegans development. These SL elements do not facilitate translation of m(7)G-capped RNAs in nematodes or TMG-capped mRNAs in mammalian or plant translation systems. Similar stem-loop structures in phylogenetically diverse SLs are predicted. We show that the nematode eukaryotic translation initiation factor 4E/G (eIF4E/G) complex enables efficient translation of the TMG-SL RNAs in diverse in vitro translation systems. TMG-capped mRNA translation is determined by eIF4E/G interaction with the cap and the SL RNA, although the SL does not increase the affinity of eIF4E/G for capped RNA. These results suggest that the mRNA 5' untranslated region (UTR) can play a positive and novel role in translation initiation through interaction with the eIF4E/G complex in nematodes and raise the issue of whether eIF4E/G-RNA interactions play a role in the translation of other eukaryotic mRNAs.
Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R Scott; Habu, Yoshiki; Ishikawa, Masayuki
2013-03-05
trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)-mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1-RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3' cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3' cleavage fragment. When the 3' nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3' cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1-RISC via the double-stranded RNA formed by the 3'-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1-RISC molecular surface, (ii) SGS3 protects the 3' cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3' fragment of TAS2 RNA is key to tasiRNA production.
MSuPDA: A Memory Efficient Algorithm for Sequence Alignment.
Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon
2016-03-01
Space complexity is a million dollar question in DNA sequence alignments. In this regard, memory saving under pushdown automata can help to reduce the occupied spaces in computer memory. Our proposed process is that anchor seed (AS) will be selected from given data set of nucleotide base pairs for local sequence alignment. Quick splitting techniques will separate the AS from all the DNA genome segments. Selected AS will be placed to pushdown automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. AS from input unit will be matched with the DNA genome segments from stack of PDA. Match, mismatch and indel of nucleotides will be popped from the stack under the control unit of pushdown automata. During the POP operation on stack, it will free the memory cell occupied by the nucleotide base pair.
Sullivan, Sarah M; Holyoak, Todd
2007-09-04
The structures of the rat cytosolic isoform of phosphoenolpyruvate carboxykinase (PEPCK) reported in the PEPCK-Mn2+, -Mn2+-oxaloacetic acid (OAA), -Mn2+-OAA-Mn2+-guanosine-5'-diphosphate (GDP), and -Mn2+-Mn2+-guanosine-5'-tri-phosphate (GTP) complexes provide insight into the mechanism of phosphoryl transfer and decarboxylation mediated by this enzyme. OAA is observed to bind in a number of different orientations coordinating directly to the active site metal. The Mn2+-OAA and Mn2+-OAA-Mn2+GDP structures illustrate inner-sphere coordination of OAA to the manganese ion through the displacement of two of the three water molecules coordinated to the metal in the holo-enzyme by the C3 and C4 carbonyl oxygens. In the PEPCK-Mn2+-OAA complex, an alternate bound conformation of OAA is present. In this conformation, in addition to the previous interactions, the C1 carboxylate is directly coordinated to the active site Mn2+, displacing all of the waters coordinated to the metal in the holo-enzyme. In the PEPCK-Mn2+-GTP structure, the same water molecule displaced by the C1 carboxylate of OAA is displaced by one of the gamma-phosphate oxygens of the triphosphate nucleotide. The structures are consistent with a mechanism of direct in-line phosphoryl transfer, supported by the observed stereochemistry of the reaction. In the catalytically competent binding mode, the C1 carboxylate of OAA is sandwiched between R87 and R405 in an environment that would serve to facilitate decarboxylation. In the reverse reaction, these two arginines would form the CO2 binding site. Comparison of the Mn2+-OAA-Mn2+GDP and Mn2+-Mn2+GTP structures illustrates a marked difference in the bound conformations of the nucleotide substrates in which the GTP nucleotide is bound in a high-energy state resulting from the eclipsing of all three of the phosphoryl groups along the triphosphate chain. This contrasts a previously determined structure of PEPCK in complex with a triphosphate nucleotide analogue in which the analogue mirrors the conformation of GDP as opposed to GTP. Last, the structures illustrate a correlation between conformational changes in the P-loop, the nucleotide binding site, and the active site lid that are important for catalysis.
Isotope labeling for studying RNA by solid-state NMR spectroscopy.
Marchanka, Alexander; Kreutz, Christoph; Carlomagno, Teresa
2018-04-12
Nucleic acids play key roles in most biological processes, either in isolation or in complex with proteins. Often they are difficult targets for structural studies, due to their dynamic behavior and high molecular weight. Solid-state nuclear magnetic resonance spectroscopy (ssNMR) provides a unique opportunity to study large biomolecules in a non-crystalline state at atomic resolution. Application of ssNMR to RNA, however, is still at an early stage of development and presents considerable challenges due to broad resonances and poor dispersion. Isotope labeling, either as nucleotide-specific, atom-specific or segmental labeling, can resolve resonance overlaps and reduce the line width, thus allowing ssNMR studies of RNA domains as part of large biomolecules or complexes. In this review we discuss the methods for RNA production and purification as well as numerous approaches for isotope labeling of RNA. Furthermore, we give a few examples that emphasize the instrumental role of isotope labeling and ssNMR for studying RNA as part of large ribonucleoprotein complexes.
The Golgi localized bifunctional UDP-rhamnose/UDP-galactose transporter family of Arabidopsis
Rautengarten, Carsten; Ebert, Berit; Moreno, Ignacio; Temple, Henry; Herter, Thomas; Link, Bruce; Doñas-Cofré, Daniela; Moreno, Adrián; Saéz-Aguayo, Susana; Blanco, Francisca; Mortimer, Jennifer C.; Schultink, Alex; Reiter, Wolf-Dieter; Dupree, Paul; Pauly, Markus; Heazlewood, Joshua L.; Scheller, Henrik V.; Orellana, Ariel
2014-01-01
Plant cells are surrounded by a cell wall that plays a key role in plant growth, structural integrity, and defense. The cell wall is a complex and diverse structure that is mainly composed of polysaccharides. The majority of noncellulosic cell wall polysaccharides are produced in the Golgi apparatus from nucleotide sugars that are predominantly synthesized in the cytosol. The transport of these nucleotide sugars from the cytosol into the Golgi lumen is a critical process for cell wall biosynthesis and is mediated by a family of nucleotide sugar transporters (NSTs). Numerous studies have sought to characterize substrate-specific transport by NSTs; however, the availability of certain substrates and a lack of robust methods have proven problematic. Consequently, we have developed a novel approach that combines reconstitution of NSTs into liposomes and the subsequent assessment of nucleotide sugar uptake by mass spectrometry. To address the limitation of substrate availability, we also developed a two-step reaction for the enzymatic synthesis of UDP–l-rhamnose (Rha) by expressing the two active domains of the Arabidopsis UDP–l-Rha synthase. The liposome approach and the newly synthesized substrates were used to analyze a clade of Arabidopsis NSTs, resulting in the identification and characterization of six bifunctional UDP–l-Rha/UDP–d-galactose (Gal) transporters (URGTs). Further analysis of loss-of-function and overexpression plants for two of these URGTs supported their roles in the transport of UDP–l-Rha and UDP–d-Gal for matrix polysaccharide biosynthesis. PMID:25053812
NMR studies of two spliced leader RNAs using isotope labeling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lapham, J.; Crothers, D.M.
1994-12-01
Spliced leader RNAs are a class of RNA molecules (<200 nts) involved in the trans splicing of messenger RNA found in trypanosomes, nematodes, and other lower eukaryotes. The spliced leader RNA from the trypanosome Leptomonas Collosoma exists in two alternate structural forms with similar thermal stabilities. The 54 nucleotides on the 5{prime} end of the SL molecule is structurally independent from the 3{prime} half of the RNA, and displays the two structural forms. Furthermore, the favored of the two structures was shown to contain anomalous nuclease sensitivity and thermal stability features, which suggests that there may be tertiary interactions betweenmore » the splice site and other nucleotides in the 5{prime} end. Multidimensional NMR studies are underway to elucidate the structural elements present in the SL RNAs that give rise to their physical properties. Two spliced leader sequences have been studied. The first, the 54 nucleotides on the 5{prime} end of the L. Collosoma sequence, was selected because of earlier studies in our laboratory. The second sequence is the 5{prime} end of the trypanosome Crithidia Fasciculata, which was chosen because of its greater sequence homology to other SL sequences. Given the complexity of the NMR spectra for RNA molecules of this size, we have incorporated {sup 15}N/{sup 13}C-labeled nucleotides into the RNA. One of the techniques we have developed to simplify the spectra of these RNA molecules is isotope labeling of specific regions of the RNA. This has been especially helpful in assigning the secondary structure of molecules that may be able to adopt multiple conformations. Using this technique one can examine a part of the molecule without spectral interference from the unlabeled portion. We hope this approach will promote an avenue for studying the structure of larger RNAs in their native surroundings.« less
iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution
König, Julian; Zarnack, Kathi; Rot, Gregor; Curk, Tomaž; Kayikci, Melis; Zupan, Blaž; Turner, Daniel J.; Luscombe, Nicholas M.; Ule, Jernej
2010-01-01
In the nucleus of eukaryotic cells, nascent transcripts are associated with heterogeneous nuclear ribonucleoprotein (hnRNP) particles that are nucleated by hnRNP C. Despite their abundance however, it remained unclear whether these particles control pre-mRNA processing. Here, we developed individual-nucleotide resolution UV-cross-linking and immunoprecipitation (iCLIP) to study the role of hnRNP C in splicing regulation. iCLIP data demonstrate that hnRNP C recognizes uridine tracts with a defined long-range spacing consistent with hnRNP particle organization. hnRNP particles assemble on both introns and exons, but remain generally excluded from splice sites. Integration of transcriptome-wide iCLIP data and alternative splicing profiles into an ‘RNA map’ indicates how the positioning of hnRNP particles determines their effect on inclusion of alternative exons. The ability of high-resolution iCLIP data to provide insights into the mechanism of this regulation holds promise for studies of other higher-order ribonucleoprotein complexes. PMID:20601959
Zeraik, Ana E; Pereira, Humberto M; Santos, Yuri V; Brandão-Neto, José; Spoerner, Michael; Santos, Maiara S; Colnago, Luiz A; Garratt, Richard C; Araújo, Ana P U; DeMarco, Ricardo
2014-03-14
Septins are filament-forming GTP-binding proteins involved in important cellular events, such as cytokinesis, barrier formation, and membrane remodeling. Here, we present two crystal structures of the GTPase domain of a Schistosoma mansoni septin (SmSEPT10), one bound to GDP and the other to GTP. The structures have been solved at an unprecedented resolution for septins (1.93 and 2.1 Å, respectively), which has allowed for unambiguous structural assignment of regions previously poorly defined. Consequently, we provide a reliable model for functional interpretation and a solid foundation for future structural studies. Upon comparing the two complexes, we observe for the first time the phenomenon of a strand slippage in septins. Such slippage generates a front-back communication mechanism between the G and NC interfaces. These data provide a novel mechanistic framework for the influence of nucleotide binding to the GTPase domain, opening new possibilities for the study of the dynamics of septin filaments.
Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level
Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.
2012-01-01
Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804
Implication of SUMO E3 ligases in nucleotide excision repair.
Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji
2015-08-01
Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.
Mapping, fine mapping, and molecular dissection of quantitative trait Loci in domestic animals.
Georges, Michel
2007-01-01
Artificial selection has created myriad breeds of domestic animals, each characterized by unique phenotypes pertaining to behavior, morphology, physiology, and disease. Most domestic animal populations share features with isolated founder populations, making them well suited for positional cloning. Genome sequences are now available for most domestic species, and with them a panoply of tools including high-density single-nucleotide polymorphism panels. As a result, domestic animal populations are becoming invaluable resources for studying the molecular architecture of complex traits and of adaptation. Here we review recent progress and issues in the positional identification of genes underlying complex traits in domestic animals. As many phenotypes studied in animals are quantitative, we focus on mapping, fine mapping, and cloning of quantitative trait loci.
NASA Astrophysics Data System (ADS)
Feuillie, C.; Sverjensky, D. A.; Hazen, R. M.
2013-12-01
Large quantities of nucleic acids are found in natural environments, released after the death of an organism and subsequent cell lysis [1]. Nucleic acids are known to adsorb on mineral surfaces [2, 3, 4], which protect them from degradation, whether enzymatic [5, 6] or UV-mediated [7]. It may then contribute to the extracellular genetic pool available in soils to microorganisms for horizontal gene transfers [8]. In order to better understand the behaviour of extracellular nucleic acids in soils, we have investigated the interactions between nucleotides, 5'-GMP, 5'-CMP, 5'-AMP and 5'-UMP, and α-alumina as a model compound for Al in six-fold coordination in soil minerals. We carried out batch adsorption experiments over a wide range of pH, ionic strength and surface loading. Alumina adsorbs high amounts of nucleotides > 2 μmol/m2. In similar environmental conditions, swelling clays such as nontronite and montmorillonite adsorb less than 0.1 μmol/m2 if the total surface area is taken under consideration. However, if only the edges of clay particles are considered, the amount of nucleotides adsorbed reaches values between 1.2 and 2 μmol/m2 [9], similar to the alumina and consistent with ';oxide-like' surface sites on the edges of the clay particles. Surface complexation modeling enabled us to predict the speciation of the surface species on the alumina, as well as the stoichiometry and thermodynamic equilibrium constants for the adsorption of nucleotides. We used the extended triple-layer model (ETLM), that takes into account the electrical work linked to the desorption of chemisorbed water molecules during the formation of inner-sphere complexes. Two surface species are thought to form on the surface of corundum: a monodentate inner-sphere complex, dominant at pH < 7.5, and a bidentate outer-sphere complex, dominant at higher pH. Both complexes involve interactions between the negatively charged phosphate group and the positively charged surface of alumina. Our results provide a better understanding of how nucleic acids attach to mineral surfaces under varying environmental conditions in soil environments. Moreover, the predicted configuration of nucleotide surface species, bound via the phosphate group, could have implications for the abiotic formation and concentration of nucleic acids in the context of the origin of life. References : [1] Lorenz and Wackernagel (1987), Applied and environmental microbial., 2948-2952 [2] Ferris (2005), Reviews in mineralogy & geochemistry 59, 187-210 [3] Cleaves H.J. et al. (2011), Chemosphere 83, 1560-1567 [4] Arora & Kamaluddin (2009), Astrobiology 9, 165-171 [5] Cai et al. (2006), Environ. Sci. Technol. 40 (9), 2971-2976 [6] Franchi and Gallori (2005),Gene 346, 205-214 [7] Scappini et al. (2004), International Journal of Astrobiology 3(1), 17-19 [8] Levy-Booth et al. (2007), Soil Biol. Biochem. 39, 2977-2991. [9] Feuillie et al. (2013), Geochimica et Cosmochimica Acta (in press)
Jia, Xin; Fontaine, Benjamin M.; Strobel, Fred; Weinert, Emily E.
2014-01-01
A sensitive, versatile and economical method to extract and quantify cyclic nucleotide monophosphates (cNMPs) using LC-MS/MS, including both 3',5'-cNMPs and 2',3'-cNMPs, in mammalian tissues and cellular systems has been developed. Problems, such as matrix effects from complex biological samples, are addressed and have been optimized. This protocol allows for comparison of multiple cNMPs in the same system and was used to examine the relationship between tissue levels of cNMPs in a panel of rat organs. In addition, the study reports the first identification and quantification of 2',3'-cIMP. The developed method will allow for quantification of cNMPs levels in cells and tissues with varying disease states, which will provide insight into the role(s) and interplay of cNMP signalling pathways. PMID:25513747
Apicella, Coren L.; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T.; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars
2010-01-01
Background Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. Methodology/Principal Findings We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. Conclusion We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant. PMID:20585395
Jia, Xin; Fontaine, Benjamin M; Strobel, Fred; Weinert, Emily E
2014-12-12
A sensitive, versatile and economical method to extract and quantify cyclic nucleotide monophosphates (cNMPs) using LC-MS/MS, including both 3',5'-cNMPs and 2',3'-cNMPs, in mammalian tissues and cellular systems has been developed. Problems, such as matrix effects from complex biological samples, are addressed and have been optimized. This protocol allows for comparison of multiple cNMPs in the same system and was used to examine the relationship between tissue levels of cNMPs in a panel of rat organs. In addition, the study reports the first identification and quantification of 2',3'-cIMP. The developed method will allow for quantification of cNMPs levels in cells and tissues with varying disease states, which will provide insight into the role(s) and interplay of cNMP signalling pathways.
Apicella, Coren L; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars
2010-06-16
Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant.
Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine
2006-07-01
Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.
Low-energy collisionally activated dissociation of pentose-borate complexes
NASA Astrophysics Data System (ADS)
Pepi, Federico; Garzoli, Stefania; Tata, Alessandra; Giacomello, Pierluigi
2010-01-01
Pentose-borate 1:1 complexes were generated in the ESI source of a triple quadrupole and ion trap mass spectrometer by electrospray ionization of Na2B4O7 and pentose (arabinose, lyxose, ribose, xylose) 2:1 solution in CH3CN/H2O. The study of their low-energy collisionally activated dissociation (CAD) demonstrated that ribose and lyxose are preferentially complexed at the C2-C3 cis-diol function whereas arabinose and xylose are esterified at the C1-C2 hydroxyl groups. No evidence was found of the stronger affinity for ribose to borate. The ribose probiotic rule can be explained by considering its peculiar capability, among the investigated pentoses, to almost totally complex the borate anion at the C2-C3 hydroxyl group, thus enabling the subsequent stages of nucleotide assembly, such as phosphorylation and linkage to the nucleobases. Finally, the differences observed in the pentose-borate complex CAD spectra can be used for the mass spectrometric discrimination of isomeric pentoses in complex mixtures.
Rutvisuttinunt, Wiriya; Meyer, Peter R.; Scott, Walter A.
2008-01-01
Background Human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT) forms stable ternary complexes in which RT is bound tightly at fixed positions on the primer-template (P/T). We have probed downstream interactions between RT and the template strand in the complex containing the incoming dNTP (+1 dNTP•RT•P/T complex) and in the complex containing the pyrophosphate analog, foscarnet (foscarnet•RT•P/T complex). Methods and Results UV-induced cross-linking between RT and the DNA template strand was most efficient when a bromodeoxyuridine residue was placed in the +2 position (the first template position downstream from the incoming dNTP). Furthermore, formation of the +1 dNTP•RT•P/T complex on a biotin-containing template inhibited binding of streptavidin when biotin was in the +2 position on the template but not when the biotin was in the +3 position. Streptavidin pre-bound to a biotin residue in the template caused RT to stall two to three nucleotides upstream from the biotin residue. The downstream border of the complex formed by the stalled RT was mapped by digestion with exonuclease RecJF. UV-induced cross-linking of the complex formed by the pyrophosphate analog, foscarnet, with RT and P/T occurred preferentially with bromodeoxyuridine in the +1 position on the template in keeping with the location of RT one base upstream in the foscarnet•RT•P/T complex (i.e., in the pre-translocation position). Conclusions For +1 dNTP•RT•P/T and foscarnet•RT•P/T stable complexes, tight interactions were observed between RT and the first unpaired template nucleotide following the bound dNTP or the primer terminus, respectively. PMID:18974785
Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing
Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric
2017-01-01
AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457
Crepin, Thibaut; Shalak, Vyacheslav F; Yaremchuk, Anna D; Vlasenko, Dmytro O; McCarthy, Andrew; Negrutskii, Boris S; Tukalo, Michail A; El'skaya, Anna V
2014-11-10
Eukaryotic elongation factor eEF1A transits between the GTP- and GDP-bound conformations during the ribosomal polypeptide chain elongation. eEF1A*GTP establishes a complex with the aminoacyl-tRNA in the A site of the 80S ribosome. Correct codon-anticodon recognition triggers GTP hydrolysis, with subsequent dissociation of eEF1A*GDP from the ribosome. The structures of both the 'GTP'- and 'GDP'-bound conformations of eEF1A are unknown. Thus, the eEF1A-related ribosomal mechanisms were anticipated only by analogy with the bacterial homolog EF-Tu. Here, we report the first crystal structure of the mammalian eEF1A2*GDP complex which indicates major differences in the organization of the nucleotide-binding domain and intramolecular movements of eEF1A compared to EF-Tu. Our results explain the nucleotide exchange mechanism in the mammalian eEF1A and suggest that the first step of eEF1A*GDP dissociation from the 80S ribosome is the rotation of the nucleotide-binding domain observed after GTP hydrolysis. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Kuznetsov, N A; Kiryutin, A S; Kuznetsova, A A; Panov, M S; Barsukova, M O; Yurkovskaya, A V; Fedorova, O S
2017-04-01
Human alkyladenine DNA glycosylase (AAG) protects DNA from alkylated and deaminated purine lesions. AAG flips out the damaged nucleotide from the double helix of DNA and catalyzes the hydrolysis of the N-glycosidic bond to release the damaged base. To understand better, how the step of nucleotide eversion influences the overall catalytic process, we performed a pre-steady-state kinetic analysis of AAG interaction with specific DNA-substrates, 13-base pair duplexes containing in the 7th position 1-N6-ethenoadenine (εA), hypoxanthine (Hx), and the stable product analogue tetrahydrofuran (F). The combination of the fluorescence of tryptophan, 2-aminopurine, and 1-N6-ethenoadenine was used to record conformational changes of the enzyme and DNA during the processes of DNA lesion recognition, damaged base eversion, excision of the N-glycosidic bond, and product release. The thermal stability of the duplexes characterized by the temperature of melting, T m , and the rates of spontaneous opening of individual nucleotide base pairs were determined by NMR spectroscopy. The data show that the relative thermal stability of duplexes containing a particular base pair in position 7, (T m (F/T) < T m (εA/T) < T m (Hx/T) < T m (A/T)) correlates with the rate of reversible spontaneous opening of the base pair. However, in contrast to that, the catalytic lesion excision rate is two orders of magnitude higher for Hx-containing substrates than for substrates containing εA, proving that catalytic activity is not correlated with the stability of the damaged base pair. Our study reveals that the formation of the catalytically competent enzyme-substrate complex is not the bottleneck controlling the catalytic activity of AAG.
Tabler, M; Homann, M; Tzortzakaki, S; Sczakiel, G
1994-01-01
Trans-cleaving hammerhead ribozymes with long target-specific antisense sequences flanking the catalytic domain share some features with conventional antisense RNA and are therefore termed 'catalytic antisense RNAs'. Sequences 5' to the catalytic domain form helix I and sequences 3' to it form helix III when complexed with the target RNA. A catalytic antisense RNA of more than 400 nucleotides, and specific for the human immunodeficiency virus type 1 (HIV-1), was systematically truncated within the arm that constituted originally a helix I of 128 base pairs. The resulting ribozymes formed helices I of 13, 8, 5, 3, 2, 1 and 0 nucleotides, respectively, and a helix III of about 280 nucleotides. When their in vitro cleavage activity was compared with the original catalytic antisense RNA, it was found that a helix I of as little as three nucleotides was sufficient for full endonucleolytic activity. The catalytically active constructs inhibited HIV-1 replication about four-fold more effectively than the inactive ones when tested in human cells. A conventional hammerhead ribozyme having helices of just 8 nucleotides on either side failed to cleave the target RNA in vitro when tested under the conditions for catalytic antisense RNA. Cleavage activity could only be detected after heat-treatment of the ribozyme substrate mixture which indicates that hammerhead ribozymes with short arms do not associate as efficiently to the target RNA as catalytic antisense RNA. The requirement of just a three-nucleotide helix I allows simple PCR-based generation strategies for asymmetric hammerhead ribozymes. Advantages of an asymmetric design will be discussed. Images PMID:7937118
de Wet, Heidi; Proks, Peter
2015-10-01
Sulphonylureas stimulate insulin secretion from pancreatic β-cells primarily by closing ATP-sensitive K(+) channels in the β-cell plasma membrane. The mechanism of channel inhibition by these drugs is unusually complex. As direct inhibitors of channel activity, sulphonylureas act only as partial antagonists at therapeutic concentrations. However, they also exert an additional indirect inhibitory effect via modulation of nucleotide-dependent channel gating. In this review, we summarize current knowledge and recent advances in our understanding of the molecular mechanism of action of these drugs. © 2015 Authors; published by Portland Press Limited.
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes.
Taylor, Louis J; Strebel, Klaus
2017-01-07
Gene knockouts are a common tool used to study gene function in various organisms. However, designing gene knockouts is complicated in viruses, which frequently contain sequences that code for multiple overlapping genes. Designing mutants that can be traced by the creation of new or elimination of existing restriction sites further compounds the difficulty in experimental design of knockouts of overlapping genes. While software is available to rapidly identify restriction sites in a given nucleotide sequence, no existing software addresses experimental design of mutations involving multiple overlapping amino acid sequences in generating gene knockouts. Pyviko performed well on a test set of over 240,000 gene pairs collected from viral genomes deposited in the National Center for Biotechnology Information Nucleotide database, identifying a point mutation which added a premature stop codon within the first 20 codons of the target gene in 93.2% of all tested gene-overprinted gene pairs. This shows that Pyviko can be used successfully in a wide variety of contexts to facilitate the molecular cloning and study of viral overprinted genes. Pyviko is an extensible and intuitive Python tool for designing knockouts of overlapping genes. Freely available as both a Python package and a web-based interface ( http://louiejtaylor.github.io/pyViKO/ ), Pyviko simplifies the experimental design of gene knockouts in complex viruses with overlapping genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, S.I.; Wirth, D.F.
1988-06-01
The 5' ends of Leishmania mRNAs contain an identical 35-nucleotide sequence termed the spliced leader (SL) or 5' mini-exon. The SL sequence is at the 5' end of an 85-nucleotide primary transcript that contains a consensus eucaryotic 5' intron-exon splice junction immediately 3' to the SL. The SL is added to protein-coding genes immediately 3' to a consensus eucaryotic 3' intron-exon splice junction. The authors' previous work demonstrated possible intermediates in discontinuous mRNA processing that contain the 50 nucleotides of the SL primary transcript 3' to the SL, the SL intron sequence (SLIS). These RNAs have a 5' terminus atmore » the splice junction of the SL and the SLIS. The authors examined a Leishmania nuclear extract for these RNAs in ribonucleoprotein (RNP) particles. Density centrifugation analysis showed that the SL RNA is predominately in RNP complexes at 60S, while the SLIS-containing RNAs are in complexes at 40S. They also demonstrated that the SLIS can be released from polyadenylated RNA by incubation with a HeLa cell extract containing debranching enzymatic activity. These data suggested that Leishmania enriettii mRNAs are assembled by bimolecular or trans splicing as has been recently demonstrated for Trypanosoma brucei. Furthermore, they determined the partial sequence of the Leishmania U2 equivalent RNA and demonstrated that it cosediments with the SL RNA at 60S in a nuclear extract. These RNP particles may be analogous to so-called spliceosomes that have been demonstrated in other systems.« less
Kochanowski, N; Blanchard, F; Cacan, R; Chirat, F; Guedon, E; Marc, A; Goergen, J-L
2006-01-15
Analysis of intracellular nucleotide and nucleotide sugar contents is essential in studying protein glycosylation of mammalian cells. Nucleotides and nucleotide sugars are the donor substrates of glycosyltransferases, and nucleotides are involved in cellular energy metabolism and its regulation. A sensitive and reproducible ion-pair reverse-phase high-performance liquid chromatography (RP-HPLC) method has been developed, allowing the direct and simultaneous detection and quantification of some essential nucleotides and nucleotide sugars. After a perchloric acid extraction, 13 molecules (8 nucleotides and 5 nucleotide sugars) were separated, including activated sugars such as UDP-glucose, UDP-galactose, GDP-mannose, UDP-N-acetylglucosamine, and UDP-N-acetylgalactosamine. To validate the analytical parameters, the reproducibility, linearity of calibration curves, detection limits, and recovery were evaluated for standard mixtures and cell extracts. The developed method is capable of resolving picomolar quantities of nucleotides and nucleotide sugars in a single chromatographic run. The HPLC method was then applied to quantify intracellular levels of nucleotides and nucleotide sugars of Chinese hamster ovary (CHO) cells cultivated in a bioreactor batch process. Evolutions of the titers of nucleotides and nucleotide sugars during the batch process are discussed.
Ferrer-Orta, Cristina; de la Higuera, Ignacio; Caridi, Flavia; Sánchez-Aparicio, María Teresa; Moreno, Elena; Perales, Celia; Singh, Kamalendra; Sarafianos, Stefan G; Sobrino, Francisco; Domingo, Esteban; Verdaguer, Nuria
2015-07-01
The N-terminal region of the foot-and-mouth disease virus (FMDV) 3D polymerase contains the sequence MRKTKLAPT (residues 16 to 24) that acts as a nuclear localization signal. A previous study showed that substitutions K18E and K20E diminished the transport to the nucleus of 3D and 3CD and severely impaired virus infectivity. These residues have also been implicated in template binding, as seen in the crystal structures of different 3D-RNA elongation complexes. Here, we report the biochemical and structural characterization of different mutant polymerases harboring substitutions at residues 18 and 20, in particular, K18E, K18A, K20E, K20A, and the double mutant K18A K20A (KAKA). All mutant enzymes exhibit low RNA binding activity, low processivity, and alterations in nucleotide recognition, including increased incorporation of ribavirin monophosphate (RMP) relative to the incorporation of cognate nucleotides compared with the wild-type enzyme. The structural analysis shows an unprecedented flexibility of the 3D mutant polymerases, including both global rearrangements of the closed-hand architecture and local conformational changes at loop β9-α11 (within the polymerase motif B) and at the template-binding channel. Specifically, in 3D bound to RNA, both K18E and K20E induced the opening of new pockets in the template channel where the downstream templating nucleotide at position +2 binds. The comparisons of free and RNA-bound enzymes suggest that the structural rearrangements may occur in a concerted mode to regulate RNA replication, processivity, and fidelity. Thus, the N-terminal region of FMDV 3D that acts as a nuclear localization signal (NLS) and in template binding is also involved in nucleotide recognition and can affect the incorporation of nucleotide analogues. The study documents multifunctionality of a nuclear localization signal (NLS) located at the N-terminal region of the foot-and-mouth disease viral polymerase (3D). Amino acid substitutions at this polymerase region can impair the transport of 3D to the nucleus, reduce 3D binding to RNA, and alter the relative incorporation of standard nucleoside monophosphate versus ribavirin monophosphate. Structural data reveal that the conformational changes in this region, forming part of the template channel entry, would be involved in nucleotide discrimination. The results have implications for the understanding of viral polymerase function and for lethal mutagenesis mechanisms. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Ferrer-Orta, Cristina; de la Higuera, Ignacio; Caridi, Flavia; Sánchez-Aparicio, María Teresa; Moreno, Elena; Perales, Celia; Singh, Kamalendra; Sarafianos, Stefan G.; Sobrino, Francisco; Domingo, Esteban
2015-01-01
ABSTRACT The N-terminal region of the foot-and-mouth disease virus (FMDV) 3D polymerase contains the sequence MRKTKLAPT (residues 16 to 24) that acts as a nuclear localization signal. A previous study showed that substitutions K18E and K20E diminished the transport to the nucleus of 3D and 3CD and severely impaired virus infectivity. These residues have also been implicated in template binding, as seen in the crystal structures of different 3D-RNA elongation complexes. Here, we report the biochemical and structural characterization of different mutant polymerases harboring substitutions at residues 18 and 20, in particular, K18E, K18A, K20E, K20A, and the double mutant K18A K20A (KAKA). All mutant enzymes exhibit low RNA binding activity, low processivity, and alterations in nucleotide recognition, including increased incorporation of ribavirin monophosphate (RMP) relative to the incorporation of cognate nucleotides compared with the wild-type enzyme. The structural analysis shows an unprecedented flexibility of the 3D mutant polymerases, including both global rearrangements of the closed-hand architecture and local conformational changes at loop β9-α11 (within the polymerase motif B) and at the template-binding channel. Specifically, in 3D bound to RNA, both K18E and K20E induced the opening of new pockets in the template channel where the downstream templating nucleotide at position +2 binds. The comparisons of free and RNA-bound enzymes suggest that the structural rearrangements may occur in a concerted mode to regulate RNA replication, processivity, and fidelity. Thus, the N-terminal region of FMDV 3D that acts as a nuclear localization signal (NLS) and in template binding is also involved in nucleotide recognition and can affect the incorporation of nucleotide analogues. IMPORTANCE The study documents multifunctionality of a nuclear localization signal (NLS) located at the N-terminal region of the foot-and-mouth disease viral polymerase (3D). Amino acid substitutions at this polymerase region can impair the transport of 3D to the nucleus, reduce 3D binding to RNA, and alter the relative incorporation of standard nucleoside monophosphate versus ribavirin monophosphate. Structural data reveal that the conformational changes in this region, forming part of the template channel entry, would be involved in nucleotide discrimination. The results have implications for the understanding of viral polymerase function and for lethal mutagenesis mechanisms. PMID:25903341
Thurlow, D L; Ehresmann, C; Ehresmann, B
1983-01-01
Nucleotides in 16S rRNA which are required in unmodified form for specific recognition of ribosomal protein S8 from Escherichia coli were identified using a damage-selection experimental approach. Prior to complex formation with S8, 16S rRNA was treated under fully denaturing conditions with either diethyl pyrocarbonate or 25% hydrazine. Following separation of bound from unbound fragments of RNA, those associated with S8 were analyzed for their content of modified bases by treatment with aniline. Nucleotides found to be consistently unmodified in such fragments were located near the base of a stable helix (encompassing bases 581-656) or near the apex of the helix on the 3' proximal side. A minor S8 ribonucleoprotein particle was found to contain fragments which extended in the 3' direction to position 671. Images PMID:6356037
Coin, Frédéric; Frit, Philippe; Viollet, Benoit; Salles, Bernard; Egly, Jean-Marc
1998-01-01
DNA damage recognition by basal transcription factors follows different mechanisms. Using transcription-competition, nitrocellulose filter binding, and DNase I footprinting assays, we show that, although the general transcription factor TFIIH is able to target any kind of lesion which can be repaired by the nucleotide excision repair pathway, TATA binding protein (TBP)-TFIID is more selective in damage recognition. Only genotoxic agents which are able to induce kinked DNA structures similar to the one for the TATA box in its TBP complex are recognized. Indeed, DNase I footprinting patterns reveal that TBP protects equally 4 nucleotides upstream and 6 nucleotides downstream from the A-T (at position −29 of the noncoding strand) of the adenovirus major late promoter and from the G-G of a cisplatin-induced 1,2-d(GpG) cross-link. Together, our results may partially explain differences in transcription inhibition rates following DNA damage. PMID:9632775
Modular and configurable optimal sequence alignment software: Cola.
Zamani, Neda; Sundström, Görel; Höppner, Marc P; Grabherr, Manfred G
2014-01-01
The fundamental challenge in optimally aligning homologous sequences is to define a scoring scheme that best reflects the underlying biological processes. Maximising the overall number of matches in the alignment does not always reflect the patterns by which nucleotides mutate. Efficiently implemented algorithms that can be parameterised to accommodate more complex non-linear scoring schemes are thus desirable. We present Cola, alignment software that implements different optimal alignment algorithms, also allowing for scoring contiguous matches of nucleotides in a nonlinear manner. The latter places more emphasis on short, highly conserved motifs, and less on the surrounding nucleotides, which can be more diverged. To illustrate the differences, we report results from aligning 14,100 sequences from 3' untranslated regions of human genes to 25 of their mammalian counterparts, where we found that a nonlinear scoring scheme is more consistent than a linear scheme in detecting short, conserved motifs. Cola is freely available under LPGL from https://github.com/nedaz/cola.
MSuPDA: A memory efficient algorithm for sequence alignment.
Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon
2015-01-16
Space complexity is a million dollar question in DNA sequence alignments. In this regards, MSuPDA (Memory Saving under Pushdown Automata) can help to reduce the occupied spaces in computer memory. Our proposed process is that Anchor Seed (AS) will be selected from given data set of Nucleotides base pairs for local sequence alignment. Quick Splitting (QS) techniques will separate the Anchor Seed from all the DNA genome segments. Selected Anchor Seed will be placed to pushdown Automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. Anchor Seed from input unit will be matched with the DNA genome segments from stack of PDA. Whatever matches, mismatches or Indel, of Nucleotides will be POP from the stack under the control of control unit of Pushdown Automata. During the POP operation on stack it will free the memory cell occupied by the Nucleotide base pair.
Multi-scale coarse-graining for the study of assembly pathways in DNA-brick self-assembly.
Fonseca, Pedro; Romano, Flavio; Schreck, John S; Ouldridge, Thomas E; Doye, Jonathan P K; Louis, Ard A
2018-04-07
Inspired by recent successes using single-stranded DNA tiles to produce complex structures, we develop a two-step coarse-graining approach that uses detailed thermodynamic calculations with oxDNA, a nucleotide-based model of DNA, to parametrize a coarser kinetic model that can reach the time and length scales needed to study the assembly mechanisms of these structures. We test the model by performing a detailed study of the assembly pathways for a two-dimensional target structure made up of 334 unique strands each of which are 42 nucleotides long. Without adjustable parameters, the model reproduces a critical temperature for the formation of the assembly that is close to the temperature at which assembly first occurs in experiments. Furthermore, the model allows us to investigate in detail the nucleation barriers and the distribution of critical nucleus shapes for the assembly of a single target structure. The assembly intermediates are compact and highly connected (although not maximally so), and classical nucleation theory provides a good fit to the height and shape of the nucleation barrier at temperatures close to where assembly first occurs.
Phylogeny of the Genus Flavivirus
Kuno, Goro; Chang, Gwong-Jen J.; Tsuchiya, K. Richard; Karabatsos, Nick; Cropp, C. Bruce
1998-01-01
We undertook a comprehensive phylogenetic study to establish the genetic relationship among the viruses of the genus Flavivirus and to compare the classification based on molecular phylogeny with the existing serologic method. By using a combination of quantitative definitions (bootstrap support level and the pairwise nucleotide sequence identity), the viruses could be classified into clusters, clades, and species. Our phylogenetic study revealed for the first time that from the putative ancestor two branches, non-vector and vector-borne virus clusters, evolved and from the latter cluster emerged tick-borne and mosquito-borne virus clusters. Provided that the theory of arthropod association being an acquired trait was correct, pairwise nucleotide sequence identity among these three clusters provided supporting data for a possibility that the non-vector cluster evolved first, followed by the separation of tick-borne and mosquito-borne virus clusters in that order. Clades established in our study correlated significantly with existing antigenic complexes. We also resolved many of the past taxonomic problems by establishing phylogenetic relationships of the antigenically unclassified viruses with the well-established viruses and by identifying synonymous viruses. PMID:9420202
Phylogeny of the genus Flavivirus.
Kuno, G; Chang, G J; Tsuchiya, K R; Karabatsos, N; Cropp, C B
1998-01-01
We undertook a comprehensive phylogenetic study to establish the genetic relationship among the viruses of the genus Flavivirus and to compare the classification based on molecular phylogeny with the existing serologic method. By using a combination of quantitative definitions (bootstrap support level and the pairwise nucleotide sequence identity), the viruses could be classified into clusters, clades, and species. Our phylogenetic study revealed for the first time that from the putative ancestor two branches, non-vector and vector-borne virus clusters, evolved and from the latter cluster emerged tick-borne and mosquito-borne virus clusters. Provided that the theory of arthropod association being an acquired trait was correct, pairwise nucleotide sequence identity among these three clusters provided supporting data for a possibility that the non-vector cluster evolved first, followed by the separation of tick-borne and mosquito-borne virus clusters in that order. Clades established in our study correlated significantly with existing antigenic complexes. We also resolved many of the past taxonomic problems by establishing phylogenetic relationships of the antigenically unclassified viruses with the well-established viruses and by identifying synonymous viruses.
Multi-scale coarse-graining for the study of assembly pathways in DNA-brick self-assembly
NASA Astrophysics Data System (ADS)
Fonseca, Pedro; Romano, Flavio; Schreck, John S.; Ouldridge, Thomas E.; Doye, Jonathan P. K.; Louis, Ard A.
2018-04-01
Inspired by recent successes using single-stranded DNA tiles to produce complex structures, we develop a two-step coarse-graining approach that uses detailed thermodynamic calculations with oxDNA, a nucleotide-based model of DNA, to parametrize a coarser kinetic model that can reach the time and length scales needed to study the assembly mechanisms of these structures. We test the model by performing a detailed study of the assembly pathways for a two-dimensional target structure made up of 334 unique strands each of which are 42 nucleotides long. Without adjustable parameters, the model reproduces a critical temperature for the formation of the assembly that is close to the temperature at which assembly first occurs in experiments. Furthermore, the model allows us to investigate in detail the nucleation barriers and the distribution of critical nucleus shapes for the assembly of a single target structure. The assembly intermediates are compact and highly connected (although not maximally so), and classical nucleation theory provides a good fit to the height and shape of the nucleation barrier at temperatures close to where assembly first occurs.
Vo, Uybach; Vajpai, Navratna; Embrey, Kevin J.; Golovanov, Alexander P.
2016-01-01
The cycling between GDP- and GTP- bound forms of the Ras protein is partly regulated by the binding of Sos. The structural/dynamic behavior of the complex formed between activated Sos and Ras at the point of the functional cycle where the nucleotide exchange is completed has not been described to date. Here we show that solution NMR spectra of H-Ras∙GTPγS mixed with a functional fragment of Sos (SosCat) at a 2:1 ratio are consistent with the formation of a rather dynamic assembly. H-Ras∙GTPγS binding was in fast exchange on the NMR timescale and retained a significant degree of molecular tumbling independent of SosCat, while SosCat also tumbled largely independently of H-Ras. Estimates of apparent molecular weight from both NMR data and SEC-MALS revealed that, at most, only one H-Ras∙GTPγS molecule appears stably bound to Sos. The weak transient interaction between Sos and the second H-Ras∙GTPγS may provide a necessary mechanism for complex dissociation upon the completion of the native GDP → GTP exchange reaction, but also explains measurable GTP → GTP exchange activity of Sos routinely observed in in vitro assays that use fluorescently-labelled analogs of GTP. Overall, the data presents the first dynamic snapshot of Ras functional cycle as controlled by Sos. PMID:27412770
Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.
2014-01-01
Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795
Salmon, Jérôme; Nonnenmacher, Mathieu; Cazé, Sandrine; Flamant, Patricia; Croissant, Odile; Orth, Gérard; Breitburd, Françoise
2000-01-01
We previously reported the partial characterization of two cottontail rabbit papillomavirus (CRPV) subtypes with strikingly divergent E6 and E7 oncoproteins. We report now the complete nucleotide sequences of these subtypes, referred to as CRPVa4 (7,868 nucleotides) and CRPVb (7,867 nucleotides). The CRPVa4 and CRPVb genomes differed at 238 (3%) nucleotide positions, whereas CRPVa4 and the prototype CRPV differed by only 5 nucleotides. The most variable region (7% nucleotide divergence) included the long regulatory region (LRR) and the E6 and E7 genes. A mutation in the stop codon resulted in an 8-amino-acid-longer CRPVb E4 protein, and a nucleotide deletion reduced the coding capacity of the E5 gene from 101 to 25 amino acids. In domestic rabbits homozygous for a specific haplotype of the DRA and DQA genes of the major histocompatibility complex, warts induced by CRPVb DNA or a chimeric genome containing the CRPVb LRR/E6/E7 region showed an early regression, whereas warts induced by CRPVa4 or a chimeric genome containing the CRPVa4 LRR/E6/E7 region persisted and evolved into carcinomas. In contrast, most CRPVa, CRPVb, and chimeric CRPV DNA-induced warts showed no early regression in rabbits homozygous for another DRA-DQA haplotype. Little, if any, viral replication is usually observed in domestic rabbit warts. When warts induced by CRPVa and CRPVb virions and DNA were compared, the number of cells positive for viral DNA or capsid antigens was found to be greater by 1 order of magnitude for specimens induced by CRPVb. Thus, both sequence variation in the LRR/E6/E7 region and the genetic constitution of the host influence the expression of the oncogenic potential of CRPV. Furthermore, intratype variation may overcome to some extent the host restriction of CRPV replication in domestic rabbits. PMID:11044121
[The study of complex-formation of DNA with the antimicrobial drug decamethoxine].
Sorokin, V A; Blagoĭ, Iu P; Valeev, V A; Gladchenko, G O; Sukhodub, L F; Volianskiĭ, Iu L
1990-01-01
The interaction of effective antibacterial drug decametoxyn with natural DNA was studied by UV-spectroscopy. Decametoxyn shows a specificity to nucleotides: it decreases the cooperativity of melting and the thermal stability of DNA parts enriched by AT pairs. The characteristics of the helix-coil transition on the DNA parts enriched by GC-pairs are invariable. Interaction with AT-pairs results in their partial or complete melting at room temperature, followed by intermolecule aggregation. Interacting with phosphates decametoxyn manifests itself not as a dication but as two single-charged ions.
Timofeyeva, Nadezhda A.; Koval, Vladimir V.; Ishchenko, Alexander A.; Saparbaev, Murat K.; Fedorova, Olga S.
2011-01-01
Human apurinic/apyrimidinic endonuclease 1 (APE1) is a key enzyme in the base excision repair (BER) and nucleotide incision repair (NIR) pathways. We recently analyzed the conformational dynamics and kinetic mechanism of wild-type (wt) protein, in a stopped-flow fluorescence study. In this study, we investigated the mutant enzyme APE1K98A using the same approach. Lys98 was known to hydrogen bond to the carboxyl group of Asp70, a residue implicated in binding the divalent metal ion. Our data suggested that the conformational selection and induced fit occur during the enzyme action. We expanded upon the evidence that APE1 can pre-exist in two conformations. The isomerization of an enzyme-product complex in the BER process and the additional isomerization stage of enzyme-substrate complex in the NIR process were established for APE1K98A. These stages had not been registered for the wtAPE1. We found that the K98A substitution resulted in a 12-fold reduction of catalytic constant of 5′-phosphodiester bond hydrolysis in (3-hydroxytetrahydrofuran-2-yl)methyl phosphate (F, tetrahydrofuran) containing substrate, and in 200-fold reduction in 5,6-dihydrouridine (DHU) containing substrate. Thus, the K98A substitution influenced NIR more than BER. We demonstrated that the K98A mutation influenced the formation of primary unspecific enzyme-substrate complex in a complicated manner, depending on the Mg2+ concentration and pH. This mutation obstructed the induced fit of enzyme in the complex with undamaged DNA and F-containing DNA and appreciably decreased the stability of primary complex upon interaction of enzyme with DNA, containing the natural apurinic/apyrimidinic (AP) site. Furthermore, it significantly delayed the activation of the less active form of enzyme during NIR and slowed down the conformational conversion of the complex of enzyme with the cleavage product of DHU-substrate. Our data revealed that APE1 uses the same active site to catalyze the cleavage of DHU- and AP-substrates. PMID:21912662
Elengoe, Asita; Hamdan, Salehhuddin
2017-12-01
In this study, we explored the possibility of determining the synergistic interactions between nucleotide-binding domain (NBD) of Homo sapiens heat-shock 70 kDa protein (Hsp70) and E1A 32 kDa of adenovirus serotype 5 motif (PNLVP) in the efficiency of killing of tumor cells in cancer treatment. At present, the protein interaction between NBD and PNLVP motif is still unknown, but believed to enhance the rate of virus replication in tumor cells. Three mutant models (E229V, H225P and D230C) were built and simulated, and their interactions with PNLVP motif were studied. The PNLVP motif showed the binding energy and intermolecular energy values with the novel E229V mutant at -7.32 and -11.2 kcal/mol. The E229V mutant had the highest number of hydrogen bonds (7). Based on the root mean square deviation, root mean square fluctuation, hydrogen bonds, salt bridge, secondary structure, surface-accessible solvent area, potential energy and distance matrices analyses, it was proved that the E229V had the strongest and most stable interaction with the PNLVP motif among all the four protein-ligand complex structures. The knowledge of this protein-ligand complex model would help in designing Hsp70 structure-based drug for cancer therapy.
Nucleotide Excision Repair and Transcriptional Regulation: TFIIH and Beyond.
Compe, Emmanuel; Egly, Jean-Marc
2016-06-02
Transcription factor IIH (TFIIH) is a multiprotein complex involved in both transcription and DNA repair, revealing a striking functional link between these two processes. Some of its subunits also belong to complexes involved in other cellular processes, such as chromosome segregation and cell cycle regulation, emphasizing the multitasking capabilities of this factor. This review aims to depict the structure of TFIIH and to dissect the roles of its subunits in different cellular mechanisms. Our understanding of the biochemistry of TFIIH has greatly benefited from studies focused on diseases related to TFIIH mutations. We address the etiology of these disorders and underline the fact that TFIIH can be considered a promising target for therapeutic strategies.
The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.
2012-03-26
Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whethermore » Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.« less
A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif
Elengoe, Asita; Naser, Mohammed Abu; Hamdan, Salehhuddin
2015-01-01
Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD) of heat shock 70 kDa protein (PDB: 1HJO) with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD) simulation. Human DNA binding domain of p53 motif (SCMGGMNR) retrieved from UniProt (UniProtKB: P04637) was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy. PMID:26098630
A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif.
Elengoe, Asita; Naser, Mohammed Abu; Hamdan, Salehhuddin
2015-01-01
Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD) of heat shock 70 kDa protein (PDB: 1HJO) with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD) simulation. Human DNA binding domain of p53 motif (SCMGGMNR) retrieved from UniProt (UniProtKB: P04637) was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were -0.44 Kcal/mol and -9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.
Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Masaki, Shunpei; Nakayama, Hiroshi; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki
2009-11-01
We describe here a mass spectrometry (MS)-based analytical platform of RNA, which combines direct nano-flow reversed-phase liquid chromatography (RPLC) on a spray tip column and a high-resolution LTQ-Orbitrap mass spectrometer. Operating RPLC under a very low flow rate with volatile solvents and MS in the negative mode, we could estimate highly accurate mass values sufficient to predict the nucleotide composition of a approximately 21-nucleotide small interfering RNA, detect post-transcriptional modifications in yeast tRNA, and perform collision-induced dissociation/tandem MS-based structural analysis of nucleolytic fragments of RNA at a sub-femtomole level. Importantly, the method allowed the identification and chemical analysis of small RNAs in ribonucleoprotein (RNP) complex, such as the pre-spliceosomal RNP complex, which was pulled down from cultured cells with a tagged protein cofactor as bait. We have recently developed a unique genome-oriented database search engine, Ariadne, which allows tandem MS-based identification of RNAs in biological samples. Thus, the method presented here has broad potential for automated analysis of RNA; it complements conventional molecular biology-based techniques and is particularly suited for simultaneous analysis of the composition, structure, interaction, and dynamics of RNA and protein components in various cellular RNP complexes.
Crucial HSP70 co–chaperone complex unlocks metazoan protein disaggregation
Nillegoda, Nadinath B.; Kirstein, Janine; Szlachcic, Anna; Berynskyy, Mykhaylo; Stank, Antonia; Stengel, Florian; Arnsburg, Kristin; Gao, Xuechao; Scior, Annika; Aebersold, Ruedi; Guilbride, D. Lys; Wade, Rebecca C.; Morimoto, Richard I.; Mayer, Matthias P.; Bukau, Bernd
2016-01-01
Protein aggregates are the hallmark of stressed and ageing cells, and characterize several pathophysiological states1,2. Healthy metazoan cells effectively eliminate intracellular protein aggregates3,4, indicating that efficient disaggregation and/or degradation mechanisms exist. However, metazoans lack the key heat-shock protein disaggregase HSP100 of non-metazoan HSP70-dependent protein disaggregation systems5,6, and the human HSP70 system alone, even with the crucial HSP110 nucleotide exchange factor, has poor disaggregation activity in vitro4,7. This unresolved conundrum is central to protein quality control biology. Here we show that synergic cooperation between complexed J-protein co-chaperones of classes A and B unleashes highly efficient protein disaggregation activity in human and nematode HSP70 systems. Metazoan mixed-class J-protein complexes are transient, involve complementary charged regions conserved in the J-domains and carboxy-terminal domains of each J-protein class, and are flexible with respect to subunit composition. Complex formation allows J-proteins to initiate transient higher order chaperone structures involving HSP70 and interacting nucleotide exchange factors. A network of cooperative class A and B J-protein interactions therefore provides the metazoan HSP70 machinery with powerful, flexible, and finely regulatable disaggregase activity and a further level of regulation crucial for cellular protein quality control. PMID:26245380
High-throughput Screening Identification of Poliovirus RNA-dependent RNA Polymerase Inhibitors
Campagnola, Grace; Gong, Peng; Peersen, Olve B.
2011-01-01
Viral RNA-dependent RNA polymerase (RdRP) enzymes are essential for the replication of positive-strand RNA viruses and established targets for the development of selective antiviral therapeutics. In this work we have carried out a high-throughput screen of 154,267 compounds to identify poliovirus polymerase inhibitors using a fluorescence based RNA elongation assay. Screening and subsequent validation experiments using kinetic methods and RNA product analysis resulted in the identification of seven inhibitors that affect the RNA binding, initiation, or elongation activity of the polymerase. X-ray crystallography data show clear density for five of the compounds in the active site of the poliovirus polymerase elongation complex. The inhibitors occupy the NTP binding site by stacking on the priming nucleotide and interacting with the templating base, yet competition studies show fairly weak IC50 values in the low μM range. A comparison with nucleotide bound structures suggests that weak binding is likely due to the lack of a triphosphate group on the inhibitors. Consequently, the inhibitors are primarily effective at blocking polymerase initiation and do not effectively compete with NTP binding during processive elongation. These findings are discussed in the context of the polymerase elongation complex structure and allosteric control of the viral RdRP catalytic cycle. PMID:21722674
Approach for targeting Ras with small molecules that activate SOS-mediated nucleotide exchange.
Burns, Michael C; Sun, Qi; Daniels, R Nathan; Camper, DeMarco; Kennedy, J Phillip; Phan, Jason; Olejniczak, Edward T; Lee, Taekyu; Waterson, Alex G; Rossanese, Olivia W; Fesik, Stephen W
2014-03-04
Aberrant activation of the small GTPase Ras by oncogenic mutation or constitutively active upstream receptor tyrosine kinases results in the deregulation of cellular signals governing growth and survival in ∼30% of all human cancers. However, the discovery of potent inhibitors of Ras has been difficult to achieve. Here, we report the identification of small molecules that bind to a unique pocket on the Ras:Son of Sevenless (SOS):Ras complex, increase the rate of SOS-catalyzed nucleotide exchange in vitro, and modulate Ras signaling pathways in cells. X-ray crystallography of Ras:SOS:Ras in complex with these molecules reveals that the compounds bind in a hydrophobic pocket in the CDC25 domain of SOS adjacent to the Switch II region of Ras. The structure-activity relationships exhibited by these compounds can be rationalized on the basis of multiple X-ray cocrystal structures. Mutational analyses confirmed the functional relevance of this binding site and showed it to be essential for compound activity. These molecules increase Ras-GTP levels and disrupt MAPK and PI3K signaling in cells at low micromolar concentrations. These small molecules represent tools to study the acute activation of Ras and highlight a pocket on SOS that may be exploited to modulate Ras signaling.
Dolot, Rafał; Kaczmarek, Renata; Sęda, Aleksandra; Krakowiak, Agnieszka; Baraniak, Janina; Nawrot, Barbara
2016-06-01
Histidine triad nucleotide-binding protein 1 (HINT1) represents the most ancient and widespread branch in the histidine triad proteins superfamily. HINT1 plays an important role in various biological processes, and it has been found in many species. Here, we report the first structure (at a 2.34Å resolution) of a complex of human HINT1 with a non-hydrolyzable analog of an Ap4A dinucleotide, containing bis-phosphorothioated glycerol mimicking a polyphosphate chain, obtained from a primitive monoclinic space group P21 crystal. In addition, the apo form of hHINT1 at the space group P21 refined to 1.92Å is reported for comparative studies. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Banin, A.; Lawless, J. G.; Mazzurco, J.; Church, F. M.; Margulies, L.; Orenberg, J. B.
1985-01-01
The interaction of 5-prime-AMP with montmorillonite saturated with various ratios of two metals found ubiquitously on the surface of earth, that is, iron and calcium, is investigated. Adsorption and desorption of the nucleotide were studied in the pH range of 2-12 at three levels of addition: 0.080, 0.268 and 0.803 mmole 5-prime-AMP per gram of clay. Two desorption stages were employed - H2O wash and NaOH extraction (pH = 12.0). 5-prime-AMP was preferentially adsorbed on the Fe-containing clays relative to the Ca clay. The nucleotide was fully recovered by the two desorption stages, mostly by the NaOH extraction. The evidence at hand indicates that 5-prime-AMP reaction with clay is affected by electrostatic interactions involving both attraction and repulsion forces. Some specific adsorption, possibly the result of covalent bonding and complex formation with the adsorbed ion, cannot be ruled out for iron but does not appear to operate for calcium. Changes in pH cause varying degrees of attaction and repulsion of 5-prime-AMP and may have been operating on the primitive earth, leading to sequences of adsorption and release of this biomolecule.
Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G
2017-07-19
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
NASA Astrophysics Data System (ADS)
Chui, Tin Ki
This thesis described the development of a new type of branched peptidomimetics using a class of previously reported triazole-containing peptidomimetics as the structural motif. The propensity of these new branched peptiomimetics in being an organogelator, forming supramolecular assemblies and recognizing anions and biomolecules was investigated. The quest began with the preparation of two different series of branched peptidomimetics, namely 69-K-aa3 (aa = V or L) and 70-B-aa3. The former series made use of the flexible L-lysine (K) as the branching unit while the latter series was composed of the relatively rigid 3,5-diminobenzoate (B). In each series, the peptidomimetic arms were composed of solely valine (V) or leucine (L). The effects of the identity of the amino acids and the branching units on the gelation and self-assembling properties of these branched bis(tripeptidomimetic)s were investigated. The 69-K-aa3 series was found to exhibit poor solubility in common organic solvents yet it was able to form strong and stable gels in aromatic solvents. The 70-B-aa3 series, on the other hand, was a poor organogelator despite its excellent solubility. Morphological studies using scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed the ability of the former to form a hyperbranched 3D network whereas the latter was only capable of forming isolated spherical lumps. Nevertheless, the latter displayed the ability in forming supramolecular polymers as shown from viscometric studies. Solution-to-gel transition temperature measurement of the gels formed by the 69-K-aa3 series and association constants determination by 1H NMR titration experiments for the supramolecular polymerization of the 70-B-aa3 series both suggested that peptidomimetic arms comprised of valine performed better than those made up of leucine in terms of association strength, and such a difference was attributed to the bulkier nature of the leucine side chain. In order to obtain a clearer picture on the mode of association of these two series of branched peptidomimetics, the length of the tripeptidomimetic arms was truncated to a dipeptide, and the amino acid, valine, was used for further studies. Both the two new candidates, 88-K-V2 and 89-B-V2, were shown to dimerize in chloroform as shown from vapor pressure osmometry (VPO) studies. 1H NMR titration experiments indicated a better dimerization strength for the latter candidate due to the intermolecular pi-pi interactions offered by its benzene ring in addition to the intermolecular hydrogen bonding by the amides and triazole units. H/D exchange and 2D NMR experiments, and molecular modeling revealed that 88-K-V2 dimerized through the formation of antiparallel beta-strands whereas formation of parallel beta-strands took place in 89-B-V2. Compound 88-K-V2 was found to form 1:1 complexes with chloride (Ka 640 M-1) and monobasic diethyl phosphate (DEP) ion (Ka 810 M-1) in chloroform. Interestingly, 89-B-V 2 was shown to form the usual 1:1 complex with the former ion (Ka 970 M-1) while forming an unexpected 2:1 complex with the latter with positive cooperativity. It was observed that both the amides and triazole protons were involved in anion-binding. In the 88-K-V2-DEP complex, the host formed a helix-like structure that wrapped around the anion located at the center of the complex as determined by 2D NMR and molecular modeling studies. Finally, further structural modification of 88-K-V2 gave a water-soluble nucleotide-binding tweezer 93-K-R2·4TFA . This tweezer consisted of four arginines (R), two triazole units, two pyrene probes and a small hydrophilic ethanolamine tail. Fluorescence study showed that this tweezer was able to form 1:1 complexes with different nucleotides in water with similar binding strength regardless of the number of phosphate groups present in the nucleotides. Moleular modeling suggested that such a charge-independent binding behavior was due to the similar number of hydrogen bonds involved in the binding between the nucleotide phosphate moiety and the tweezer amides, triazole protons and guanidinium groups. In summary, this thesis reported a new class of branched peptidomimetics that were constructed from conventional peptide and non-classical triazole linkages. The resulting peptidomimetics exhibited very rich supramolecular chemistry, ranging from gel formation, self-association, host.guest complexation and anion recognition. All these properties were due to the presence of multiple hydrogen bonding units in the form of amide and triazole units along the tweezer backbone. Through hydrogen bonding interaction with various guest molecules, the multiple-arm architecture could fold itself into a complementary conformation that could bind to the guest molecules in a much more efficient manner.
The structural changes of T7 RNA polymerase from transcription initiation to elongation
Steitz, Thomas A
2010-01-01
Summary The structures of T7 RNA polymerase (T7 RNAP) captured in the initiation and elongation phases of transcription, as well as an intermediate stage provide insights into how this RNA polymerase protein can initiate RNA synthesis and synthesize 7 to 10 nucleotides of RNA while remaining bound to the DNA promoter site. Recently, the structures of T7 RNAP bound to it promoter DNA along with either a 7 nucleotide or 8 nucleotide transcript show an elongated product site resulting from a 40° or 45° rotation of the promoter and domain that binds it. The different functional properties of the initiation and elongation phases of transcription are illuminated from structures of the initiation and elongation complexes. Structural insights into the translocation of the product transcript of RNAP, its separation of the downstream duplex DNA and its removal of the transcript from the heteroduplex are provided by the structures of several states of nucleotide incorporation. A conformational change in the “fingers” domain that results from the binding or dissociation of incoming NTP or PPi appears to be associated with the state of translocation of T7 RNAP. PMID:19811903
Complexity: an internet resource for analysis of DNA sequence complexity
Orlov, Y. L.; Potapov, V. N.
2004-01-01
The search for DNA regions with low complexity is one of the pivotal tasks of modern structural analysis of complete genomes. The low complexity may be preconditioned by strong inequality in nucleotide content (biased composition), by tandem or dispersed repeats or by palindrome-hairpin structures, as well as by a combination of all these factors. Several numerical measures of textual complexity, including combinatorial and linguistic ones, together with complexity estimation using a modified Lempel–Ziv algorithm, have been implemented in a software tool called ‘Complexity’ (http://wwwmgs.bionet.nsc.ru/mgs/programs/low_complexity/). The software enables a user to search for low-complexity regions in long sequences, e.g. complete bacterial genomes or eukaryotic chromosomes. In addition, it estimates the complexity of groups of aligned sequences. PMID:15215465
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.
Rapid screening for nuclear genes mutations in isolated respiratory chain complex I defects.
Pagniez-Mammeri, Hélène; Lombes, Anne; Brivet, Michèle; Ogier-de Baulny, Hélène; Landrieu, Pierre; Legrand, Alain; Slama, Abdelhamid
2009-04-01
Complex I or reduced nicotinamide adenine dinucleotide (NADH): ubiquinone oxydoreductase deficiency is the most common cause of respiratory chain defects. Molecular bases of complex I deficiencies are rarely identified because of the dual genetic origin of this multi-enzymatic complex (nuclear DNA and mitochondrial DNA) and the lack of phenotype-genotype correlation. We used a rapid method to screen patients with isolated complex I deficiencies for nuclear genes mutations by Surveyor nuclease digestion of cDNAs. Eight complex I nuclear genes, among the most frequently mutated (NDUFS1, NDUFS2, NDUFS3, NDUFS4, NDUFS7, NDUFS8, NDUFV1 and NDUFV2), were studied in 22 cDNA fragments spanning their coding sequences in 8 patients with a biochemically proved complex I deficiency. Single nucleotide polymorphisms and missense mutations were detected in 18.7% of the cDNA fragments by Surveyor nuclease treatment. Molecular defects were detected in 3 patients. Surveyor nuclease screening is a reliable method for genotyping nuclear complex I deficiencies, easy to interpret, and limits the number of sequence reactions. Its use will enhance the possibility of prenatal diagnosis and help us for a better understanding of complex I molecular defects.
Plasma-induced grafting of acrylic acid on bentonite for the removal of U(VI) from aqueous solution
NASA Astrophysics Data System (ADS)
Hongshan, ZHU; Shengxia, DUAN; Lei, CHEN; Ahmed, ALSAEDI; Tasawar, HAYAT; Jiaxing, LI
2017-11-01
Fabrication of reusable adsorbents with satisfactory adsorption capacity and using environment-friendly preparation processes is required for the environment-related applications. In this study, acrylic acid (AA) was grafted onto bentonite (BT) to generate an AA-graft-BT (AA-g-BT) composite using a plasma-induced grafting technique considered to be an environment-friendly method. The as-prepared composite was characterized by scanning electron microscopy, x-ray powder diffraction, thermal gravity analysis, Fourier transform infrared spectroscopy and Barrett-Emmett-Teller analysis, demonstrating the successful grafting of AA onto BT. In addition, the removal of uranium(VI) (U(VI)) from contaminated aqueous solutions was examined using the as-prepared composite. The influencing factors, including contact time, pH value, ionic strength, temperature, and initial concentration, for the removal of U(VI) were investigated by batch experiments. The experimental process fitted best with the pseudo-second-order kinetic and the Langmuir models. Moreover, thermodynamic investigation revealed a spontaneous and endothermic process. Compared with previous adsorbents, AA-g-BT has potential practical applications in treating U(VI)-contaminated solutions.
Mitrasinovic, Petar M
2006-03-01
RNA structure can be viewed as both a construct composed of various structural motifs and a flexible polymer that is substantially influenced by its environment. In this light, the present paper represents an attempt to reconcile the two standpoints. By using the 3D structures both of four (16S and 23S) portions of unbound 50S, H50S, and T30S ribosomal subunits and of 38 large ribonucleoligand complexes as the starting point, the behavior, which is induced by ligand binding, of 73 hairpin triloops with closing g-c and c-g base pairs was investigated using root-mean-square deviation (RMSD) approach and pseudotorsional (eta,theta) convention at the nucleotide-by-nucleotide level. Triloops were annotated in accordance with a recent proposal of geometric nomenclature. A simple measure for the determination of the strain of a triloop is introduced. It is believed that a possible classification of the interior triloops, based on the 2D eta-theta unique path, will aid to conceive their local behavior upon ligand binding. All rRNA residues in contact with ligands as well as regions of considerable conformational changes upon complex formation were identified. The analysis offers the answer to: how proximal to and how far from the actual ligand-binding sites the structural changes occur?
Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'yaminova, A G; Frolova, L Iu; Stahl, J; Karpova, G G
2008-01-01
Protein S3 fragments were determined that crosslink to modified mRNA analogues in positions +5 to +12 relative to the first nucleotide in the P-site binding codon in model complexes mimicking states of ribosomes at the elongation and translation termination steps. The mRNA analogues contained a Phe codon UUU/UUC at the 5'-termini that could predetermine the position of the tRNA(Phe) on the ribosome by the location of P-site binding and perfluorophenylazidobenzoyl group at a nucleotide in various positions 3' of the UUU/UUC codon. The crosslinked S3 protein was isolated from 80S ribosomal complexes irradiated with mild UV light and subjected to cyanogen bromide-induced cleavage at methionine residues with subsequent identification of the crosslinked oligopeptides. An analysis of the positions of modified oligopeptides resulting from the cleavage showed that, in dependence on the positions of modified nucleotides in the mRNA analogue, the crosslinking sites were found in the N-terminal half of the protein (fragment 2-127) and/or in the C-terminal fragment 190-236; the latter reflects a new peculiarity in the structure of the mRNA binding center in the ribosome, unknown to date. The results of crosslinking did not depend on the type of A-site codon or on the presence of translation termination factor eRF1.
Lacasse, Michael J; Douglas, Colin D; Zamble, Deborah B
2016-12-13
[NiFe]-hydrogenase enzymes catalyze the reversible reduction of protons to molecular hydrogen and serve as a vital component of the metabolism of many pathogens. The synthesis of the bimetallic catalytic center requires a suite of accessory proteins, and the penultimate step, nickel insertion, is facilitated by the metallochaperones HypA and HypB. In Escherichia coli, nickel moves from a site in the GTPase domain of HypB to HypA in a process accelerated by GDP. To determine how the transfer of nickel is controlled, the impacts of HypA and nucleotides on the properties of HypB were examined. Integral to this work was His2Gln HypA, a mutant with attenuated nickel affinity that does not support hydrogenase production in E. coli. This mutation inhibits the translocation of nickel from HypB. H2Q-HypA does not modulate the apparent metal affinity of HypB, but the stoichiometry and stability of the HypB-nickel complex are modulated by the nucleotide. Furthermore, the HypA-HypB interaction was detected by gel filtration chromatography if HypB was loaded with GDP, but not a GTP analogue, and the protein complex dissociated upon binding of nickel to His2 of HypA. In contrast, a nucleotide does not modulate the binding of zinc to HypB, and loading zinc into the GTPase domain of HypB inhibits formation of the complex with HypA. These results demonstrate that GTP hydrolysis controls both metal binding and protein-protein interactions, conferring selective and directional nickel transfer during [NiFe]-hydrogenase biosynthesis.
Zimmerman, Matthew D.; Proudfoot, Michael; Yakunin, Alexander; Minor, Wladek
2008-01-01
Summary HD-domain phosphohydrolases have nucleotidase and phosphodiesterase activities and play important roles in the metabolism of nucleotides and in signaling. We present three 2.1 Å resolution crystal structures (one in the free state and two complexed with natural substrates) of a HD-domain phosphohydrolase, the E. coli 5′-nucleotidase YfbR. The free-state structure of YfbR contains a large cavity accommodating the metal-coordinating HD motif (H33, H68, D69, and D137) and other conserved residues (R18, E72, and D77). Alanine scanning mutagenesis confirms that these residues are important for activity. Two structures of the catalytically inactive mutant E72A complexed with Co2+ and either TMP or dAMP disclose the novel binding mode of deoxyribonucleotides in the active site. Residue R18 stabilizes the phosphate on the Co2+, and residue D77 forms a strong hydrogen bond critical for binding the ribose. The indole side chain of W19 is located close to the 2′-carbon atom of the deoxyribose moiety and is proposed to act as the selectivity switch for deoxyribonucleotide, which is supported by comparison to YfdR, another 5′-nucleotidase in E. coli. The nucleotide bases of both dAMP and TMP make no specific hydrogen bonds with the protein, explaining the lack of nucleotide base selectivity. The YfbR E72A substrate complex structures also suggest a plausible single-step nucleophilic substitution mechanism. This is the first proposed molecular mechanism for a HD-domain phosphohydrolase based directly on substrate-bound crystal structures. PMID:18353368
Troyer, Lyndsay D; Tang, Yuanzhi; Borch, Thomas
2014-12-16
Uranium (U) and arsenic (As) often occur together naturally and, as a result, can be co-contaminants at sites of uranium mining and processing, yet few studies have examined the simultaneous redox dynamics of U and As. This study examines the influence of arsenate (As(V)) on the reduction of uranyl (U(VI)) by the redox-active mineral mackinawite (FeS). As(V) was added to systems containing 47 or 470 μM U(VI) at concentrations ranging from 0 to 640 μM. In the absence of As(V), U was completely removed from solution and fully reduced to nano-uraninite (nano-UO2). While the addition of As(V) did not reduce U uptake, at As(V) concentrations above 320 μM, the reduction of U(VI) was limited due to the formation of a trögerite-like uranyl arsenate precipitate. The presence of U also significantly inhibited As(V) reduction. While less U(VI) reduction to nano-UO2 may take place in systems with high As(V) concentrations, formation of trögerite-like mineral phases may be an acceptable reclamation end point due to their high stability under oxic conditions.
2006-11-01
The Internet architecture was designed w/o a “theory” • Many academic theorists said it would never work • Recent “emergent” theories are wildly...architecture was designed w/o a “theory” • Many academic theorists said it would never work • Recent “emergent” theories are wildly wrong (there have...Co-factors Fatty acids Sug ars Nucleotides Amino A cids Catabolism Polymerization and complex assembly Proteins P r e c u r s o r s Autocatalytic
[Identification and polymorphism of pectinase genes PGU in the Saccharomyces bayanus complex].
Shalamitskiy, M Yu; Naumov, G I
2016-05-01
Pectinase (endo-polygalacturonase) is the key enzyme splitting plant pectin. The corresponding single gene PGU1 is documented for the yeast S. cerevisiae. On the basis of phylogenetic analysis of the PGU nucleotide sequence available in the GenBank, a family of divergent PGU genes is found in the species complex S. bayanus: S. bayanus var. uvarum, S. eubayanus, and hybrid taxon S. pastorianus. The PGU genes have different chromosome localization.
Jiang, Rui ; Yang, Hua ; Zhou, Linqi ; Kuo, C.-C. Jay ; Sun, Fengzhu ; Chen, Ting
2007-01-01
The increasing demand for the identification of genetic variation responsible for common diseases has translated into a need for sophisticated methods for effectively prioritizing mutations occurring in disease-associated genetic regions. In this article, we prioritize candidate nonsynonymous single-nucleotide polymorphisms (nsSNPs) through a bioinformatics approach that takes advantages of a set of improved numeric features derived from protein-sequence information and a new statistical learning model called “multiple selection rule voting” (MSRV). The sequence-based features can maximize the scope of applications of our approach, and the MSRV model can capture subtle characteristics of individual mutations. Systematic validation of the approach demonstrates that this approach is capable of prioritizing causal mutations for both simple monogenic diseases and complex polygenic diseases. Further studies of familial Alzheimer diseases and diabetes show that the approach can enrich mutations underlying these polygenic diseases among the top of candidate mutations. Application of this approach to unclassified mutations suggests that there are 10 suspicious mutations likely to cause diseases, and there is strong support for this in the literature. PMID:17668383
Silla, Toomas; Kepp, Katrin; Tai, E Shyong; Goh, Liang; Davila, Sonia; Catela Ivkovic, Tina; Calin, George A; Voorhoeve, P Mathijs
2014-01-01
Ultra-conserved genes or elements (UCGs/UCEs) in the human genome are extreme examples of conservation. We characterized natural variations in 2884 UCEs and UCGs in two distinct populations; Singaporean Chinese (n = 280) and Italian (n = 501) by using a pooled sample, targeted capture, sequencing approach. We identify, with high confidence, in these regions the abundance of rare SNVs (MAF<0.5%) of which 75% is not present in dbSNP137. UCEs association studies for complex human traits can use this information to model expected background variation and thus necessary power for association studies. By combining our data with 1000 Genome Project data, we show in three independent datasets that prevalent UCE variants (MAF>5%) are more often found in relatively less-conserved nucleotides within UCEs, compared to rare variants. Moreover, prevalent variants are less likely to overlap transcription factor binding site. Using SNPfold we found no significant influence of RNA secondary structure on UCE conservation. All together, these results suggest UCEs are not under selective pressure as a stretch of DNA but are under differential evolutionary pressure on the single nucleotide level.
Natural variations in OsγTMT contribute to diversity of the α-tocopherol content in rice.
Wang, Xiao-Qiang; Yoon, Min-Young; He, Qiang; Kim, Tae-Sung; Tong, Wei; Choi, Bu-Woong; Lee, Young-Sang; Park, Yong-Jin
2015-12-01
Tocopherols and tocotrienols, collectively known as tocochromanols, are lipid-soluble molecules that belong to the group of vitamin E compounds. Among them, α-tocopherol (αΤ) is one of the antioxidants with diverse functions and benefits for humans and animals. Thus, understanding the genetic basis of these traits would be valuable to improve nutritional quality by breeding in rice. Genome-wide association study (GWAS) has emerged as a powerful strategy for identifying genes or quantitative trait loci (QTL) underlying complex traits in plants. To discover the genes or QTLs underlying the naturally occurring variations of αΤ content in rice, we performed GWAS using 1.44 million high-quality single-nucleotide polymorphisms acquired from re-sequencing of 137 accessions from a diverse rice core collection. Thirteen candidate genes were found across 2-year phenotypic data, among which gamma-tocopherol methyltransferase (OsγTMT) was identified as the major factor responsible for the αΤ content among rice accessions. Nucleotide variations in the coding region of OsγTMT were significantly associated with the αΤ content variations, while nucleotide polymorphisms in the promoter region of OsγTMT also could partly demonstrate the correlation with αΤ content variations, according to our RNA expression analyses. This study provides useful information for genetic factors underlying αΤ content variations in rice, which will significantly contribute the research on αΤ biosynthesis mechanisms and αΤ improvement of rice.
Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay
2016-08-01
The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Sala, Adrien; Shoaib, Muhammad; Anufrieva, Olga; Mutharasu, Gnanavel; Jahan Hoque, Rawnak; Yli-Harja, Olli; Kandhavelu, Meenakshisundaram
2015-05-01
In E. coli, promoter closed and open complexes are key steps in transcription initiation, where magnesium-dependent RNA polymerase catalyzes RNA synthesis. However, the exact mechanism of initiation remains to be fully elucidated. Here, using single mRNA detection and dual reporter studies, we show that increased intracellular magnesium concentration affects Plac initiation complex formation resulting in a highly dynamic process over the cell growth phases. Mg2+ regulates transcription transition, which modulates bimodality of mRNA distribution in the exponential phase. We reveal that Mg2+ regulates the size and frequency of the mRNA burst by changing the open complex duration. Moreover, increasing magnesium concentration leads to higher intrinsic and extrinsic noise in the exponential phase. RNAP-Mg2+ interaction simulation reveals critical movements creating a shorter contact distance between aspartic acid residues and Nucleotide Triphosphate residues and increasing electrostatic charges in the active site. Our findings provide unique biophysical insights into the balanced mechanism of genetic determinants and magnesium ion in transcription initiation regulation during cell growth.
Wang, Lu-Yong; Fasulo, D
2006-01-01
Genome-wide association study for complex diseases will generate massive amount of single nucleotide polymorphisms (SNPs) data. Univariate statistical test (i.e. Fisher exact test) was used to single out non-associated SNPs. However, the disease-susceptible SNPs may have little marginal effects in population and are unlikely to retain after the univariate tests. Also, model-based methods are impractical for large-scale dataset. Moreover, genetic heterogeneity makes the traditional methods harder to identify the genetic causes of diseases. A more recent random forest method provides a more robust method for screening the SNPs in thousands scale. However, for more large-scale data, i.e., Affymetrix Human Mapping 100K GeneChip data, a faster screening method is required to screening SNPs in whole-genome large scale association analysis with genetic heterogeneity. We propose a boosting-based method for rapid screening in large-scale analysis of complex traits in the presence of genetic heterogeneity. It provides a relatively fast and fairly good tool for screening and limiting the candidate SNPs for further more complex computational modeling task.
NASA Astrophysics Data System (ADS)
Islam, Saidul; Bučar, Dejan-Krešimir; Powner, Matthew W.
2017-06-01
A central problem for the prebiotic synthesis of biological amino acids and nucleotides is to avoid the concomitant synthesis of undesired or irrelevant by-products. Additionally, multistep pathways require mechanisms that enable the sequential addition of reactants and purification of intermediates that are consistent with reasonable geochemical scenarios. Here, we show that 2-aminothiazole reacts selectively with two- and three-carbon sugars (glycolaldehyde and glyceraldehyde, respectively), which results in their accumulation and purification as stable crystalline aminals. This permits ribonucleotide synthesis, even from complex sugar mixtures. Remarkably, aminal formation also overcomes the thermodynamically favoured isomerization of glyceraldehyde into dihydroxyacetone because only the aminal of glyceraldehyde separates from the equilibrating mixture. Finally, we show that aminal formation provides a novel pathway to amino acids that avoids the synthesis of the non-proteinogenic α,α-disubstituted analogues. The common physicochemical mechanism that controls the proteinogenic amino acid and ribonucleotide assembly from prebiotic mixtures suggests that these essential classes of metabolite had a unified chemical origin.
Alignment of RNA molecules: Binding energy and statistical properties of random sequences
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valba, O. V., E-mail: valbaolga@gmail.com; Nechaev, S. K., E-mail: sergei.nechaev@gmail.com; Tamm, M. V., E-mail: thumm.m@gmail.com
2012-02-15
A new statistical approach to the problem of pairwise alignment of RNA sequences is proposed. The problem is analyzed for a pair of interacting polymers forming an RNA-like hierarchical cloverleaf structures. An alignment is characterized by the numbers of matches, mismatches, and gaps. A weight function is assigned to each alignment; this function is interpreted as a free energy taking into account both direct monomer-monomer interactions and a combinatorial contribution due to formation of various cloverleaf secondary structures. The binding free energy is determined for a pair of RNA molecules. Statistical properties are discussed, including fluctuations of the binding energymore » between a pair of RNA molecules and loop length distribution in a complex. Based on an analysis of the free energy per nucleotide pair complexes of random RNAs as a function of the number of nucleotide types c, a hypothesis is put forward about the exclusivity of the alphabet c = 4 used by nature.« less
Structure of yeast Argonaute with guide RNA
Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.
2012-01-01
The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195
Invariant U2 snRNA nucleotides form a stem loop to recognize the intron early in splicing
Perriman, Rhonda; Ares, Manuel
2010-01-01
U2 snRNA-intron branchpoint pairing is a critical step in pre-mRNA recognition by the splicing apparatus, but the mechanism by which these two RNAs engage each other is unknown. Here we identify a new U2 snRNA structure, the branchpoint interaction stem-loop (BSL), that presents the U2 nucleotides that will contact the intron. We provide evidence that the BSL forms prior to interaction with the intron, and is disrupted by the DExD/H protein Prp5p during engagement of the snRNA with the intron. In vitro splicing complex assembly in a BSL-destabilized mutant extract suggests that the BSL is required at a previously unrecognized step between commitment complex and prespliceosome formation. The extreme evolutionary conservation of the BSL suggests it represents an ancient structural solution to the problem of intron branchpoint recognition by dynamic RNA elements that must serve multiple functions at other times during splicing. PMID:20471947
Kammenga, Jan E; Doroszuk, Agnieszka; Riksen, Joost A. G; Hazendonk, Esther; Spiridon, Laurentiu; Petrescu, Andrei-Jose; Tijsterman, Marcel; Plasterk, Ronald H. A; Bakker, Jaap
2007-01-01
Ectotherms rely for their body heat on surrounding temperatures. A key question in biology is why most ectotherms mature at a larger size at lower temperatures, a phenomenon known as the temperature–size rule. Since temperature affects virtually all processes in a living organism, current theories to explain this phenomenon are diverse and complex and assert often from opposing assumptions. Although widely studied, the molecular genetic control of the temperature–size rule is unknown. We found that the Caenorhabditis elegans wild-type N2 complied with the temperature–size rule, whereas wild-type CB4856 defied it. Using a candidate gene approach based on an N2 × CB4856 recombinant inbred panel in combination with mutant analysis, complementation, and transgenic studies, we show that a single nucleotide polymorphism in tra-3 leads to mutation F96L in the encoded calpain-like protease. This mutation attenuates the ability of CB4856 to grow larger at low temperature. Homology modelling predicts that F96L reduces TRA-3 activity by destabilizing the DII-A domain. The data show that size adaptation of ectotherms to temperature changes may be less complex than previously thought because a subtle wild-type polymorphism modulates the temperature responsiveness of body size. These findings provide a novel step toward the molecular understanding of the temperature–size rule, which has puzzled biologists for decades. PMID:17335351
Fowler, Jason D.; Brown, Jessica A.; Kvaratskhelia, Mamuka; Suo, Zucai
2009-01-01
SUMMARY Crystallographic studies of the C-terminal, DNA polymerase β-like domain of human DNA polymerase lambda (fPolλ) suggested that the catalytic cycle might not involve a large protein domain rearrangement as observed with several replicative DNA polymerases and DNA polymerase β. To examine solution-phase protein conformation changes in fPolλ, which also contains a breast cancer susceptibility gene 1 C-terminal domain and a Proline-rich domain at its N-terminus, we used a mass spectrometry - based protein footprinting approach. In parallel experiments, surface accessibility maps for Arg residues were compared for the free fPolλ versus the binary complex of enzyme•gapped DNA and the ternary complex of enzyme•gapped DNA•dNTP. These experiments suggested that fPolλ does not undergo major conformational changes during the catalysis in the solution phase. Furthermore, the mass spectrometry-based protein footprinting experiments revealed that active site residue R386 was shielded from the surface only in the presence of both a gapped DNA substrate and an incoming nucleotide dNTP. Site-directed mutagenesis and pre-steady state kinetic studies confirmed the importance of R386 for the enzyme activity, and indicated the key role for its guanidino group in stabilizing the negative charges of an incoming nucleotide and the leaving pyrophosphate product. We suggest that such interactions could be shared by and important for catalytic functions of other DNA polymerases. PMID:19467241
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rechkoblit, Olga; Delaney, James C.; Essigmann, John M.
DNA is susceptible to alkylation damage by a number of environmental agents that modify the Watson-Crick edge of the bases. Such lesions, if not repaired, may be bypassed by Y-family DNA polymerases. The bypass polymerase Dpo4 is strongly inhibited by 1-methylguanine (m1G) and 3-methylcytosine (m3C), with nucleotide incorporation opposite these lesions being predominantly mutagenic. Further, extension after insertion of both correct and incorrect bases, introduces additional base substitution and deletion errors. Crystal structures of the Dpo4 ternary extension complexes with correct and mismatched 3'-terminal primer bases opposite the lesions reveal that both m1G and m3C remain positioned within the DNAmore » template/primer helix. However, both correct and incorrect pairing partners exhibit pronounced primer terminal nucleotide distortion, being primarily evicted from the DNA helix when opposite m1G or misaligned when pairing with m3C. Our studies provide insights into mechanisms related to hindered and mutagenic bypass of methylated lesions and models associated with damage recognition by repair demethylases.« less
García-Márquez, Adrián; Gijsbers, Abril; de la Mora, Eugenio; Sánchez-Puig, Nuria
2015-01-01
Ribosome biogenesis is orchestrated by the action of several accessory factors that provide time and directionality to the process. One such accessory factor is the GTPase EFL1 involved in the cytoplasmic maturation of the ribosomal 60S subunit. EFL1 and SBDS, the protein mutated in the Shwachman-Diamond syndrome (SBDS), release the anti-association factor eIF6 from the surface of the ribosomal subunit 60S. Here we report a kinetic analysis of fluorescent guanine nucleotides binding to EFL1 alone and in the presence of SBDS using fluorescence stopped-flow spectroscopy. Binding kinetics of EFL1 to both GDP and GTP suggests a two-step mechanism with an initial binding event followed by a conformational change of the complex. Furthermore, the same behavior was observed in the presence of the SBDS protein irrespective of the guanine nucleotide evaluated. The affinity of EFL1 for GTP is 10-fold lower than that calculated for GDP. Association of EFL1 to SBDS did not modify the affinity for GTP but dramatically decreased that for GDP by increasing the dissociation rate of the nucleotide. Thus, SBDS acts as a guanine nucleotide exchange factor (GEF) for EFL1 promoting its activation by the release of GDP. Finally, fluorescence anisotropy measurements showed that the S143L mutation present in the Shwachman-Diamond syndrome altered a surface epitope for EFL1 and largely decreased the affinity for it. These results suggest that loss of interaction between these proteins due to mutations in the disease consequently prevents the nucleotide exchange regulation the SBDS exerts on EFL1. PMID:25991726
Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M
2008-08-19
Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.
Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M
2008-01-01
Background Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required. PMID:18710585
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, H.; Ogo, Seiji; Fish, R.H.
Molecular recognition, via non-covalent processes such as hydrogen bonding, {pi}-{pi}, and hydrophobic interactions, is an important biological phenomenon for guests, such as drugs, proteins, and other important biological molecules with, for example, host DNA/RNA. We have studied a novel molecular recognition process using guests that encompass aromatic and aliphatic amino acids [L-alanine, L-glutamine (L-Gln), L-histidine, L-isoleucine(L-Ile), L-leucine(L-Leu), L-phenylalanine(L-Phe), L-proline, L-tryptophan(L-Trp), L-valine(L-Val)], substituted aromatic carboxylic acids o-, m-, p-aminobenzoic acids (G1-3), benzoic acid (G4), phenylacetic acid (G5), p-methoxyphenylacetic acid (G6), o-methyoxybenozoic acid (G9), o-nitrobenzoic acid (G10), and aliphatic carboxylic acids [cyclohexylacetic acid (G7), 1-adamantanecarboxylic acid (G8)] with supramolecular, bioorganometallic hosts, ({eta}{supmore » 5}-pentamethylcyclopentadienyl)rhodium (Cp{sup *}Rh)-nucleobase, nucleoside, and nucleotide cyclic trimer complexes in aqueous solution at pH 7, utilizing {sup 1}H NMR, NOE, and molecular modeling techniques, and, as well, determining association constants (K{sub a}) and free energies of complexation ({Delta}{degree}G). The host-guest complexation occurs predominantly via non-covalent {pi}-{pi}, hydrophobic, and possible subtle H-bonding interactions, with steric, electronic, and molecular conformational parameters as important criteria. 8 refs., 6 figs., 3 tabs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fukumoto, Yasunori, E-mail: fukumoto@faculty.chiba-u.jp; Ikeuchi, Masayoshi; Nakayama, Yuji
ATR-dependent DNA damage checkpoint is the major DNA damage checkpoint against UV irradiation and DNA replication stress. The Rad17–RFC and Rad9–Rad1–Hus1 (9–1–1) complexes interact with each other to contribute to ATR signaling, however, the precise regulatory mechanism of the interaction has not been established. Here, we identified a conserved sequence motif, KYxxL, in the AAA+ domain of Rad17 protein, and demonstrated that this motif is essential for the interaction with the 9–1–1 complex. We also show that UV-induced Rad17 phosphorylation is increased in the Rad17 KYxxL mutants. These data indicate that the interaction with the 9–1–1 complex is not required formore » Rad17 protein to be an efficient substrate for the UV-induced phosphorylation. Our data also raise the possibility that the 9–1–1 complex plays a negative regulatory role in the Rad17 phosphorylation. We also show that the nucleotide-binding activity of Rad17 is required for its nuclear localization. - Highlights: • We have identified a conserved KYxxL motif in Rad17 protein. • The KYxxL motif is crucial for the interaction with the 9–1–1 complex. • The KYxxL motif is dispensable or inhibitory for UV-induced Rad17 phosphorylation. • Nucleotide binding of Rad17 is required for its nuclear localization.« less
Dansault, Anouk; David, Gabriel; Schwartz, Claire; Jaliffa, Carolina; Vieira, Véronique; de la Houssaye, Guillaume; Bigot, Karine; Catin, Françise; Tattu, Laurent; Chopin, Catherine; Halimi, Philippe; Roche, Olivier; Van Regemorter, Nicole; Munier, Francis; Schorderet, Daniel; Dufier, Jean-Louis; Marsac, Cécile; Ricquier, Daniel; Menasche, Maurice; Penfornis, Alfred; Abitbol, Marc
2007-04-02
The PAX6 gene was first described as a candidate for human aniridia. However, PAX6 expression is not restricted to the eye and it appears to be crucial for brain development. We studied PAX6 mutations in a large spectrum of patients who presented with aniridia phenotypes, Peters' anomaly, and anterior segment malformations associated or not with neurological anomalies. Patients and related families were ophthalmologically phenotyped, and in some cases neurologically and endocrinologically examined. We screened the PAX6 gene by direct sequencing in three groups of patients: those affected by aniridia; those with diverse ocular manifestations; and those with Peters' anomaly. Two mutations were investigated by generating crystallographic representations of the amino acid changes. Three novel heterozygous mutations affecting three unrelated families were identified: the g.572T>C nucleotide change, located in exon 5, and corresponding to the Leucine 46 Proline amino-acid mutation (L46P); the g.655A>G nucleotide change, located in exon 6, and corresponding to the Serine 74 Glycine amino-acid mutation (S74G); and the nucleotide deletion 579delG del, located in exon 6, which induces a frameshift mutation leading to a stop codon (V48fsX53). The L46P mutation was identified in affected patients presenting bilateral microphthalmia, cataracts, and nystagmus. The S74G mutation was found in a large family that had congenital ocular abnormalities, diverse neurological manifestations, and variable cognitive impairments. The 579delG deletion (V48fsX53) caused in the affected members of the same family bilateral aniridia associated with congenital cataract, foveal hypolasia, and nystagmus. We also detected a novel intronic nucleotide change, IVS2+9G>A (very likely a mutation) in an apparently isolated patient affected by a complex ocular phenotype, characterized primarily by a bilateral microphthalmia. Whether this nucleotide change is indeed pathogenic remains to be demonstrated. Two previously known heterozygous mutations of the PAX6 gene sequence were also detected in patients affected by aniridia: a de novo previously known nucleotide change, g.972C>T (Q179X), in exon 8, leading to a stop codon and a heterozygous g.555C>A (C40X) recurrent nonsense mutation in exon 5. No mutations were found in patients with Peters' anomaly. We identified three mutations associated with aniridia phenotypes (Q179X, C40X, and V48fsX53). The three other mutations reported here cause non-aniridia ocular phenotypes associated in some cases with neurological anomalies. The IVS2+9G>A nucleotide change was detected in a patient with a microphthalmia phenotype. The L46P mutation was detected in a family with microphthalmia, cataract, and nystagmus. This mutation is located in the DNA-binding paired-domain and the crystallographic representations of this mutation show that this mutation may affect the helix-turn-helix motif, and as a consequence the DNA-binding properties of the resulting mutated protein. Ser74 is located in the PAX6 PD linker region, essential for DNA recognition and DNA binding, and the side chain of the Ser74 contributes to DNA recognition by the linker domain through direct contacts. Crystallographic representations show that the S74G mutation results in no side chain and therefore perturbs the DNA-binding properties of PAX6. This study highlights the severity and diversity of the consequences of PAX6 mutations that appeared to result from the complexity of the PAX6 gene structure, and the numerous possibilities for DNA binding. This study emphasizes the fact that neurodevelopmental abnormalities may be caused by PAX6 mutations. The neuro-developmental abnormalities caused by PAX6 mutations are probably still overlooked in the current clinical examinations performed throughout the world in patients affected by PAX6 mutations.
Dansault, Anouk; David, Gabriel; Schwartz, Claire; Jaliffa, Carolina; Vieira, Véronique; de la Houssaye, Guillaume; Bigot, Karine; Catin, Françise; Tattu, Laurent; Chopin, Catherine; Halimi, Philippe; Roche, Olivier; Van Regemorter, Nicole; Munier, Francis; Schorderet, Daniel; Dufier, Jean-Louis; Marsac, Cécile; Ricquier, Daniel; Menasche, Maurice; Penfornis, Alfred
2007-01-01
Purpose The PAX6 gene was first described as a candidate for human aniridia. However, PAX6 expression is not restricted to the eye and it appears to be crucial for brain development. We studied PAX6 mutations in a large spectrum of patients who presented with aniridia phenotypes, Peters' anomaly, and anterior segment malformations associated or not with neurological anomalies. Methods Patients and related families were ophthalmologically phenotyped, and in some cases neurologically and endocrinologically examined. We screened the PAX6 gene by direct sequencing in three groups of patients: those affected by aniridia; those with diverse ocular manifestations; and those with Peters' anomaly. Two mutations were investigated by generating crystallographic representations of the amino acid changes. Results Three novel heterozygous mutations affecting three unrelated families were identified: the g.572T>C nucleotide change, located in exon 5, and corresponding to the Leucine 46 Proline amino-acid mutation (L46P); the g.655A>G nucleotide change, located in exon 6, and corresponding to the Serine 74 Glycine amino-acid mutation (S74G); and the nucleotide deletion 579delG del, located in exon 6, which induces a frameshift mutation leading to a stop codon (V48fsX53). The L46P mutation was identified in affected patients presenting bilateral microphthalmia, cataracts, and nystagmus. The S74G mutation was found in a large family that had congenital ocular abnormalities, diverse neurological manifestations, and variable cognitive impairments. The 579delG deletion (V48fsX53) caused in the affected members of the same family bilateral aniridia associated with congenital cataract, foveal hypolasia, and nystagmus. We also detected a novel intronic nucleotide change, IVS2+9G>A (very likely a mutation) in an apparently isolated patient affected by a complex ocular phenotype, characterized primarily by a bilateral microphthalmia. Whether this nucleotide change is indeed pathogenic remains to be demonstrated. Two previously known heterozygous mutations of the PAX6 gene sequence were also detected in patients affected by aniridia: a de novo previously known nucleotide change, g.972C>T (Q179X), in exon 8, leading to a stop codon and a heterozygous g.555C>A (C40X) recurrent nonsense mutation in exon 5. No mutations were found in patients with Peters' anomaly. Conclusions We identified three mutations associated with aniridia phenotypes (Q179X, C40X, and V48fsX53). The three other mutations reported here cause non-aniridia ocular phenotypes associated in some cases with neurological anomalies. The IVS2+9G>A nucleotide change was detected in a patient with a microphthalmia phenotype. The L46P mutation was detected in a family with microphthalmia, cataract, and nystagmus. This mutation is located in the DNA-binding paired-domain and the crystallographic representations of this mutation show that this mutation may affect the helix-turn-helix motif, and as a consequence the DNA-binding properties of the resulting mutated protein. Ser74 is located in the PAX6 PD linker region, essential for DNA recognition and DNA binding, and the side chain of the Ser74 contributes to DNA recognition by the linker domain through direct contacts. Crystallographic representations show that the S74G mutation results in no side chain and therefore perturbs the DNA-binding properties of PAX6. This study highlights the severity and diversity of the consequences of PAX6 mutations that appeared to result from the complexity of the PAX6 gene structure, and the numerous possibilities for DNA binding. This study emphasizes the fact that neurodevelopmental abnormalities may be caused by PAX6 mutations. The neuro-developmental abnormalities caused by PAX6 mutations are probably still overlooked in the current clinical examinations performed throughout the world in patients affected by PAX6 mutations. PMID:17417613
Balón, M; Muñoz, M A; Carmona, C; Guardado, P; Galán, M
1999-07-19
Fluorescence binding studies of harmane to the elemental components of the nucleic acids were undertaken to investigate the origin of the interaction between the drug and DNA. Most of the tested substrates have been found to induce hypochromism in the absorption spectrum of harmane and to quench its fluorescence. The quenching process induced by the nucleobases and their nucleosides is mainly due to the formation of ground state 1:1 complexes. However, in the case of the mononucleotides a dynamic quenching component is also observed. This quenching component is likely due to the excited state interaction of harmane with the phosphate group of the nucleotides. UV-vis spectral changes and quenching measurements have been used to quantify the ground state association constants of the complexes and the quenching rate constants.
Uptake and release of metal ions by transferrin and interaction with receptor 1.
El Hage Chahine, Jean-Michel; Hémadi, Miryana; Ha-Duong, Nguyêt-Thanh
2012-03-01
For a metal to follow the iron acquisition pathway, four conditions are required: 1-complex formation with transferrin; 2-interaction with receptor 1; 3-metal release in the endosome; and 4-metal transport to cytosol. This review deals with the mechanisms of aluminum(III), cobalt(III), uranium(VI), gallium(III) and bismuth(III) uptake by transferrin and interaction with receptor 1. The interaction of the metal-loaded transferrin with receptor 1 takes place in one or two steps: a very fast first step (μs to ms) between the C-lobe and the helical domain of the receptor, and a second slow step (2-6h) between the N-lobe and the protease-like domain. In transferrin loaded with metals other than iron, the dissociation constants for the interaction of the C-lobe with TFR are in a comparable range of magnitudes 10 to 0.5μM, whereas those of the interaction of the N-lobe are several orders of magnitudes lower or not detected. Endocytosis occurs in minutes, which implies a possible internalization of the metal-loaded transferrin with only the C-lobe interacting with the receptor. A competition with iron is possible and implies that metal internalization is more related to kinetics than thermodynamics. As for metal release in the endosome, it is faster than the recycling time of transferrin, which implies its possible liberation in the cell. This article is part of a Special Issue entitled Transferrins: Molecular mechanisms of iron transport and disorders. Copyright © 2011 Elsevier B.V. All rights reserved.
Methods for Estimating Adsorbed Uranium(VI) and Distribution Coefficients of Contaminated Sediments
Kohler, M.; Curtis, G.P.; Meece, D.E.; Davis, J.A.
2004-01-01
Assessing the quantity of U(VI) that participates in sorption/desorption processes in a contaminated aquifer is an important task when investigating U migration behavior. U-contaminated aquifer sediments were obtained from 16 different locations at a former U mill tailings site at Naturita, CO (U.S.A.) and were extracted with an artificial groundwater, a high pH sodium bicarbonate solution, hydroxylamine hydrochloride solution, and concentrated nitric acid. With an isotopic exchange method, both a KD value for the specific experimental conditions as well as the total exchangeable mass of U(VI) was determined. Except for one sample, KD values determined by isotopic exchange with U-contaminated sediments that were in equilibrium with atmospheric CO2 agreed within a factor of 2 with KD values predicted from a nonelectrostatic surface complexation model (NEM) developed from U(VI) adsorption experiments with uncontaminated sediments. The labile fraction of U(VI) and U extracted by the bicarbonate solution were highly correlated (r2 = 0.997), with a slope of 0.96 ?? 0.01. The proximity of the slope to one suggests that both methods likely access the same reservoir of U(VI) associated with the sediments. The results indicate that the bicarbonate extraction method is useful for estimating the mass of labile U(VI) in sediments that do not contain U(IV). In-situ KD values calculated from the measured labile U(VI) and the dissolved U(VI) in the Naturita alluvial aquifer agreed within a factor of 3 with in-situ K D values predicted with the NEM and groundwater chemistry at each well.
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Roxo, V M M S; Pereira, N F; Pavoni, D P; Lin, M-T; Hansen, J A; de O Poersch, C; Filho, A Marquart; Petzl-Erler, M L
2003-11-01
The purpose of this study was to analyze the possible influence of the TNF and LTA loci polymorphisms on the susceptibility/resistance to endemic pemphigus foliaceus, also named fogo selvagem (FS), an autoimmune disease characterized by blisters due to acantholysis of the superficial-most epidermal cells. Autoantibodies, mainly of the IgG4 subclass, are directed against a desmosomal glycoprotein known as desmoglein 1. FS shares clinical, histological and immunological features with nonendemic pemphigus foliaceus. Most residents of the endemic regions do not develop the disease, and familial clustering has been documented, suggesting that host factors play a role in susceptibility. In fact, strong positive and negative associations with HLA class II genes have been reported. The TNF and LTA genes are located in the class III region of the Human Major Histocompatibility Complex. Their location, the function of their products, which are cytokines and pluripotent immunomodulators, as well as their genetic variability make them candidate genes for complex diseases with an altered immune response. A total of 162 patients and 191 controls were enrolled in this study. No significant associations were found with any one of the three LTA single nucleotide polymorphisms (SNP) analyzed (at nucleotides 249, 365, 720), nor with the TNF SNP located at positions -863 and -308. The frequency of allele TNF*238A was slightly decreased in patients (OR = 0.45). In conclusion, the results of this study indicate that genetic variability of the TNF and LTA genes does not play a major role in susceptibility/resistance to pemphigus foliaceus.
Molecular structure of human KATP in complex with ATP and ADP
Lee, Kenneth Pak Kin
2017-01-01
In many excitable cells, KATP channels respond to intracellular adenosine nucleotides: ATP inhibits while ADP activates. We present two structures of the human pancreatic KATP channel, containing the ABC transporter SUR1 and the inward-rectifier K+ channel Kir6.2, in the presence of Mg2+ and nucleotides. These structures, referred to as quatrefoil and propeller forms, were determined by single-particle cryo-EM at 3.9 Å and 5.6 Å, respectively. In both forms, ATP occupies the inhibitory site in Kir6.2. The nucleotide-binding domains of SUR1 are dimerized with Mg2+-ATP in the degenerate site and Mg2+-ADP in the consensus site. A lasso extension forms an interface between SUR1 and Kir6.2 adjacent to the ATP site in the propeller form and is disrupted in the quatrefoil form. These structures support the role of SUR1 as an ADP sensor and highlight the lasso extension as a key regulatory element in ADP’s ability to override ATP inhibition. PMID:29286281
Probing Gαi1 Protein Activation at Single Amino Acid Resolution
Sun, Dawei; Maeda, Shoji; Matkovic, Milos; Mendieta, Sandro; Mayer, Daniel; Dawson, Roger; Schertler, Gebhard F.X.; Madan Babu, M.; Veprintsev, Dmitry B.
2016-01-01
We present comprehensive single amino acid resolution maps of the residues stabilising the human Gαi1 subunit in nucleotide- and receptor-bound states. We generated these maps by measuring the effects of alanine mutations on the stability of Gαi1 and of the rhodopsin-Gαi1 complex. We identified stabilization clusters in the GTPase and helical domains responsible for structural integrity and the conformational changes associated with activation. In activation cluster I, helices α1 and α5 pack against strands β1-3 to stabilize the nucleotide-bound states. In the receptor-bound state, these interactions are replaced by interactions between α5 and strands β4-6. Key residues in this cluster are Y320, crucial for the stabilization of the receptor-bound state, and F336, which stabilizes nucleotide-bound states. Destabilization of helix α1, caused by rearrangement of this activation cluster, leads to the weakening of the inter-domain interface and release of GDP. PMID:26258638
Dixit, R; Trivedi, P K; Nath, P; Sane, P V
1999-09-01
Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.
Real-time observation of the initiation of RNA polymerase II transcription.
Fazal, Furqan M; Meng, Cong A; Murakami, Kenji; Kornberg, Roger D; Block, Steven M
2015-09-10
Biochemical and structural studies have shown that the initiation of RNA polymerase II transcription proceeds in the following stages: assembly of the polymerase with general transcription factors and promoter DNA in a 'closed' preinitiation complex (PIC); unwinding of about 15 base pairs of the promoter DNA to form an 'open' complex; scanning downstream to a transcription start site; synthesis of a short transcript, thought to be about 10 nucleotides long; and promoter escape. Here we have assembled a 32-protein, 1.5-megadalton PIC derived from Saccharomyces cerevisiae, and observe subsequent initiation processes in real time with optical tweezers. Contrary to expectation, scanning driven by the transcription factor IIH involved the rapid opening of an extended transcription bubble, averaging 85 base pairs, accompanied by the synthesis of a transcript up to the entire length of the extended bubble, followed by promoter escape. PICs that failed to achieve promoter escape nevertheless formed open complexes and extended bubbles, which collapsed back to closed or open complexes, resulting in repeated futile scanning.
Analysis of genetic diversity using SNP markers in oat
USDA-ARS?s Scientific Manuscript database
A large-scale single nucleotide polymorphism (SNP) discovery was carried out in cultivated oat using Roche 454 sequencing methods. DNA sequences were generated from cDNAs originating from a panel of 20 diverse oat cultivars, and from Diversity Array Technology (DArT) genomic complexity reductions fr...
Improving the goat long-read assembly with optical mapping
USDA-ARS?s Scientific Manuscript database
Reference genome assemblies provide important context in genetics by standardizing the order of genes and providing a universal set of coordinates for individual nucleotides. Often due to the high complexity of genic regions and higher copy number of genes involved in immune function, immunity-relat...
Structural and functional impacts of copy number variations on the cattle genome
USDA-ARS?s Scientific Manuscript database
Although there have been significant advances in resolving the pattern and nature of single nucleotide polymorphisms (SNPs), similar realizations for larger, more complex forms of genetic variation have just emerged. Several recent publications reveal that copy number variations (CNVs) are common an...
Masutani, C; Sugasawa, K; Yanagisawa, J; Sonoyama, T; Ui, M; Enomoto, T; Takio, K; Tanaka, K; van der Spek, P J; Bootsma, D
1994-01-01
Complementation group C of xeroderma pigmentosum (XP) represents one of the most common forms of this cancer-prone DNA repair syndrome. The primary defect is located in the subpathway of the nucleotide excision repair system, dealing with the removal of lesions from the non-transcribing sequences ('genome-overall' repair). Here we report the purification to homogeneity and subsequent cDNA cloning of a repair complex by in vitro complementation of the XP-C defect in a cell-free repair system containing UV-damaged SV40 minichromosomes. The complex has a high affinity for ssDNA and consists of two tightly associated proteins of 125 and 58 kDa. The 125 kDa subunit is an N-terminally extended version of previously reported XPCC gene product which is thought to represent the human homologue of the Saccharomyces cerevisiae repair gene RAD4. The 58 kDa species turned out to be a human homologue of yeast RAD23. Unexpectedly, a second human counterpart of RAD23 was identified. All RAD23 derivatives share a ubiquitin-like N-terminus. The nature of the XP-C defect implies that the complex exerts a unique function in the genome-overall repair pathway which is important for prevention of skin cancer. Images PMID:8168482
Campeotto, Ivan; Zhang, Yong; Mladenov, Miroslav G.; Freemont, Paul S.; Gründling, Angelika
2015-01-01
Signaling nucleotides are integral parts of signal transduction systems allowing bacteria to cope with and rapidly respond to changes in the environment. The Staphylococcus aureus PII-like signal transduction protein PstA was recently identified as a cyclic diadenylate monophosphate (c-di-AMP)-binding protein. Here, we present the crystal structures of the apo- and c-di-AMP-bound PstA protein, which is trimeric in solution as well as in the crystals. The structures combined with detailed bioinformatics analysis revealed that the protein belongs to a new family of proteins with a similar core fold but with distinct features to classical PII proteins, which usually function in nitrogen metabolism pathways in bacteria. The complex structure revealed three identical c-di-AMP-binding sites per trimer with each binding site at a monomer-monomer interface. Although distinctly different from other cyclic-di-nucleotide-binding sites, as the half-binding sites are not symmetrical, the complex structure also highlighted common features for c-di-AMP-binding sites. A comparison between the apo and complex structures revealed a series of conformational changes that result in the ordering of two anti-parallel β-strands that protrude from each monomer and allowed us to propose a mechanism on how the PstA protein functions as a signaling transduction protein. PMID:25505271
Bar-Peled, Maor; Urbanowicz, Breeanna R.; O’Neill, Malcolm A.
2012-01-01
There is compelling evidence showing that the structurally complex pectic polysaccharide rhamnogalacturonan II (RG-II) exists in the primary cell wall as a borate cross-linked dimer and that this dimer is required for the assembly of a functional wall and for normal plant growth and development. The results of several studies have also established that RG-II structure and cross-linking is conserved in vascular plants and that RG-II likely appeared early in the evolution of land plants. Two features that distinguish RG-II from other plant polysaccharides are that RG-II is composed of 13 different glycoses linked to each other by up to 22 different glycosidic linkages and that RG-II is the only polysaccharide known to contain both apiose and aceric acid. Thus, one key event in land plant evolution was the emergence of genes encoding nucleotide sugar biosynthetic enzymes that generate the activated forms of apiose and aceric acid required for RG-II synthesis. Many of the genes involved in the generation of the nucleotide sugars used for RG-II synthesis have been functionally characterized. By contrast, only one glycosyltransferase involved in the assembly of RG-II has been identified. Here we provide an overview of the formation of the activated sugars required for RG-II synthesis and point to the possible cellular and metabolic processes that could be involved in assembling and controlling the formation of a borate cross-linked RG-II molecule. We discuss how nucleotide sugar synthesis is compartmentalized and how this may control the flux of precursors to facilitate and regulate the formation of RG-II. PMID:22639675
González, Carolina; Tabernero, David; Cortese, Maria Francesca; Gregori, Josep; Casillas, Rosario; Riveiro-Barciela, Mar; Godoy, Cristina; Sopena, Sara; Rando, Ariadna; Yll, Marçal; Lopez-Martinez, Rosa; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco
2018-05-21
To detect hyper-conserved regions in the hepatitis B virus (HBV) X gene ( HBX ) 5' region that could be candidates for gene therapy. The study included 27 chronic hepatitis B treatment-naive patients in various clinical stages (from chronic infection to cirrhosis and hepatocellular carcinoma, both HBeAg-negative and HBeAg-positive), and infected with HBV genotypes A-F and H. In a serum sample from each patient with viremia > 3.5 log IU/mL, the HBX 5' end region [nucleotide (nt) 1255-1611] was PCR-amplified and submitted to next-generation sequencing (NGS). We assessed genotype variants by phylogenetic analysis, and evaluated conservation of this region by calculating the information content of each nucleotide position in a multiple alignment of all unique sequences (haplotypes) obtained by NGS. Conservation at the HBx protein amino acid (aa) level was also analyzed. NGS yielded 1333069 sequences from the 27 samples, with a median of 4578 sequences/sample (2487-9279, IQR 2817). In 14/27 patients (51.8%), phylogenetic analysis of viral nucleotide haplotypes showed a complex mixture of genotypic variants. Analysis of the information content in the haplotype multiple alignments detected 2 hyper-conserved nucleotide regions, one in the HBX upstream non-coding region (nt 1255-1286) and the other in the 5' end coding region (nt 1519-1603). This last region coded for a conserved amino acid region (aa 63-76) that partially overlaps a Kunitz-like domain. Two hyper-conserved regions detected in the HBX 5' end may be of value for targeted gene therapy, regardless of the patients' clinical stage or HBV genotype.
Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.
Ermert, Susanne; Marx, Andreas; Hacker, Stephan M
2017-04-01
Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.
Structure and function of nucleotide sugar transporters: Current progress.
Hadley, Barbara; Maggioni, Andrea; Ashikov, Angel; Day, Christopher J; Haselhorst, Thomas; Tiralongo, Joe
2014-06-01
The proteomes of eukaryotes, bacteria and archaea are highly diverse due, in part, to the complex post-translational modification of protein glycosylation. The diversity of glycosylation in eukaryotes is reliant on nucleotide sugar transporters to translocate specific nucleotide sugars that are synthesised in the cytosol and nucleus, into the endoplasmic reticulum and Golgi apparatus where glycosylation reactions occur. Thirty years of research utilising multidisciplinary approaches has contributed to our current understanding of NST function and structure. In this review, the structure and function, with reference to various disease states, of several NSTs including the UDP-galactose, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine, GDP-fucose, UDP-N-acetylglucosamine/UDP-glucose/GDP-mannose and CMP-sialic acid transporters will be described. Little is known regarding the exact structure of NSTs due to difficulties associated with crystallising membrane proteins. To date, no three-dimensional structure of any NST has been elucidated. What is known is based on computer predictions, mutagenesis experiments, epitope-tagging studies, in-vitro assays and phylogenetic analysis. In this regard the best-characterised NST to date is the CMP-sialic acid transporter (CST). Therefore in this review we will provide the current state-of-play with respect to the structure-function relationship of the (CST). In particular we have summarised work performed by a number groups detailing the affect of various mutations on CST transport activity, efficiency, and substrate specificity.
Khrustaleva, A M; Klovach, N V; Vedischeva, E V; Seeb, J E
2015-10-01
The variability of 45 single nucleotide polymorphism loci (SNP) was studied in sockeye salmon from the Kamchatka River basin and four lake-river systems of the west coast of the Bering Sea. Based on the genetic differentiation estimates for the largest sockeye salmon populations of Eastern Kamchatka and Chukotka, the examined samples were combined into two regional groups represented by the population of the Kamchatka River drainage, which included numerous local subpopulations and seasonal races, and the northern population grouping from the rivers of Olutorsko-Navarinsky raion, wherein the sockeye salmon from Maynypilginskaya Lake-River system was relatively isolated. Considerable divergence was observed between the island (Sarannoe Lake, Bering Island) and continental populations. Genetic heterogeneity was revealed and groups of early- and late-maturing individuals were isolated in the sample of late-run sockeye salmon from Kamchatka River. In Apuka River, subdivision of the spawning run into two genetically distinct spatial and temporal groupings was also observed. The results suggest that the differentiation of sockeye salmon samples by single nucleotide substitution frequencies was largely due to differences in the direction and strength of local selection at some loci in the population complexes and intrapopulation groupings from the examined river basins of Eastern Kamchatka, Chukotka, and Commander Islands.
Rauch, Jennifer N; Gestwicki, Jason E
2014-01-17
Proteins with Bcl2-associated anthanogene (BAG) domains act as nucleotide exchange factors (NEFs) for the molecular chaperone heat shock protein 70 (Hsp70). There are six BAG family NEFs in humans, and each is thought to link Hsp70 to a distinct cellular pathway. However, little is known about how the NEFs compete for binding to Hsp70 or how they might differentially shape its biochemical activities. Toward these questions, we measured the binding of human Hsp72 (HSPA1A) to BAG1, BAG2, BAG3, and the unrelated NEF Hsp105. These studies revealed a clear hierarchy of affinities: BAG3 > BAG1 > Hsp105 ≫ BAG2. All of the NEFs competed for binding to Hsp70, and their relative affinity values predicted their potency in nucleotide and peptide release assays. Finally, we combined the Hsp70-NEF pairs with cochaperones of the J protein family (DnaJA1, DnaJA2, DnaJB1, and DnaJB4) to generate 16 permutations. The activity of the combinations in ATPase and luciferase refolding assays were dependent on the identity and stoichiometry of both the J protein and NEF so that some combinations were potent chaperones, whereas others were inactive. Given the number and diversity of cochaperones in mammals, it is likely that combinatorial assembly could generate a large number of distinct permutations.
A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor
Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.
2009-01-01
Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548
Modeling ligand recognition at the P2Y12 receptor in light of X-ray structural information
NASA Astrophysics Data System (ADS)
Paoletta, Silvia; Sabbadin, Davide; von Kügelgen, Ivar; Hinz, Sonja; Katritch, Vsevolod; Hoffmann, Kristina; Abdelrahman, Aliaa; Straßburger, Jens; Baqi, Younis; Zhao, Qiang; Stevens, Raymond C.; Moro, Stefano; Müller, Christa E.; Jacobson, Kenneth A.
2015-08-01
The G protein-coupled P2Y12 receptor (P2Y12R) is an important antithrombotic target and of great interest for pharmaceutical discovery. Its recently solved, highly divergent crystallographic structures in complex either with nucleotides (full or partial agonist) or with a nonnucleotide antagonist raise the question of which structure is more useful to understand ligand recognition. Therefore, we performed extensive molecular modeling studies based on these structures and mutagenesis, to predict the binding modes of major classes of P2Y12R ligands previously reported. Various nucleotide derivatives docked readily to the agonist-bound P2Y12R, but uncharged nucleotide-like antagonist ticagrelor required a hybrid receptor resembling the agonist-bound P2Y12R except for the top portion of TM6. Supervised molecular dynamics (SuMD) of ticagrelor binding indicated interactions with the extracellular regions of P2Y12R, defining possible meta-binding sites. Ureas, sulfonylureas, sulfonamides, anthraquinones and glutamic acid piperazines docked readily to the antagonist-bound P2Y12R. Docking dinucleotides at both agonist- and antagonist-bound structures suggested interactions with two P2Y12R pockets. Thus, our structure-based approach consistently rationalized the main structure-activity relationships within each ligand class, giving useful information for designing improved ligands.
Routine Discovery of Complex Genetic Models using Genetic Algorithms
Moore, Jason H.; Hahn, Lance W.; Ritchie, Marylyn D.; Thornton, Tricia A.; White, Bill C.
2010-01-01
Simulation studies are useful in various disciplines for a number of reasons including the development and evaluation of new computational and statistical methods. This is particularly true in human genetics and genetic epidemiology where new analytical methods are needed for the detection and characterization of disease susceptibility genes whose effects are complex, nonlinear, and partially or solely dependent on the effects of other genes (i.e. epistasis or gene-gene interaction). Despite this need, the development of complex genetic models that can be used to simulate data is not always intuitive. In fact, only a few such models have been published. We have previously developed a genetic algorithm approach to discovering complex genetic models in which two single nucleotide polymorphisms (SNPs) influence disease risk solely through nonlinear interactions. In this paper, we extend this approach for the discovery of high-order epistasis models involving three to five SNPs. We demonstrate that the genetic algorithm is capable of routinely discovering interesting high-order epistasis models in which each SNP influences risk of disease only through interactions with the other SNPs in the model. This study opens the door for routine simulation of complex gene-gene interactions among SNPs for the development and evaluation of new statistical and computational approaches for identifying common, complex multifactorial disease susceptibility genes. PMID:20948983
Shahraki, Somaye; Mansouri-Torshizi, Hassan; Sori Nezami, Ziba; Ghahghaei, Arezou; Yaghoubi, Fatemeh; Divsalar, Adeleh; Saboury, Ali-Akbar; H. Shirazi, Farshad
2014-01-01
In depth interaction studies between calf thymus deoxyribonucleic acid (CT-DNA) and a series of four structurally relative palladium(II) complexes [Pd(en)(HB)](NO3)2 (a-d), where en is ethylenediamine and heterocyclic base (HB) is 2,2'-bipyridine (bpy, a); 1,10-phenanthroline (phen, b); dipyridoquinoxaline (dpq, c) and dipyridophenazine (dppz, d) (Figure 1), were performed. These studies have been investigated by utilizing the electronic absorption spectroscopy, fluorescence spectra and ethidium bromide (EBr) displacement and gel filtration techniques. a-d complexes cooperatively bind and denature the DNA at low concentrations. Their concentration at midpoint of transition, L1/2, follows the order a >> b > c > d. Also the g, the number of binding sites per 1000 nucleotides, follows the order a >> b ~ c > d. EBr and Scatchard experiments for a-d complexes suggest efficient intercalative binding affinity to CT-DNA giving the order: d > c > b > a. Several binding and thermodynamic parameters are also described. The biological activity of these cationic and water soluble palladium complexes were tested against chronic myelogenous leukemia cell line, K562. b, c and d complexes show cytotoxic concentration (Cc50) values much lower than cisplatin. PMID:25587317
Origin of the RNA world: The fate of nucleobases in warm little ponds
Pudritz, Ralph E.; Semenov, Dmitry A.; Henning, Thomas K.
2017-01-01
Before the origin of simple cellular life, the building blocks of RNA (nucleotides) had to form and polymerize in favorable environments on early Earth. At this time, meteorites and interplanetary dust particles delivered organics such as nucleobases (the characteristic molecules of nucleotides) to warm little ponds whose wet–dry cycles promoted rapid polymerization. We build a comprehensive numerical model for the evolution of nucleobases in warm little ponds leading to the emergence of the first nucleotides and RNA. We couple Earth’s early evolution with complex prebiotic chemistry in these environments. We find that RNA polymers must have emerged very quickly after the deposition of meteorites (less than a few years). Their constituent nucleobases were primarily meteoritic in origin and not from interplanetary dust particles. Ponds appeared as continents rose out of the early global ocean, but this increasing availability of “targets” for meteorites was offset by declining meteorite bombardment rates. Moreover, the rapid losses of nucleobases to pond seepage during wet periods, and to UV photodissociation during dry periods, mean that the synthesis of nucleotides and their polymerization into RNA occurred in just one to a few wet–dry cycles. Under these conditions, RNA polymers likely appeared before 4.17 billion years ago. PMID:28973920
Quantitative Analysis of Guanine Nucleotide Exchange Factors (GEFs) as Enzymes
Randazzo, Paul A; Jian, Xiaoying; Chen, Pei-Wen; Zhai, Peng; Soubias, Olivier; Northup, John K
2014-01-01
The proteins that possess guanine nucleotide exchange factor (GEF) activity, which include about ~800 G protein coupled receptors (GPCRs),1 15 Arf GEFs,2 81 Rho GEFs,3 8 Ras GEFs,4 and others for other families of GTPases,5 catalyze the exchange of GTP for GDP on all regulatory guanine nucleotide binding proteins. Despite their importance as catalysts, relatively few exchange factors (we are aware of only eight for ras superfamily members) have been rigorously characterized kinetically.5–13 In some cases, kinetic analysis has been simplistic leading to erroneous conclusions about mechanism (as discussed in a recent review14). In this paper, we compare two approaches for determining the kinetic properties of exchange factors: (i) examining individual equilibria, and; (ii) analyzing the exchange factors as enzymes. Each approach, when thoughtfully used,14,15 provides important mechanistic information about the exchange factors. The analysis as enzymes is described in further detail. With the focus on the production of the biologically relevant guanine nucleotide binding protein complexed with GTP (G•GTP), we believe it is conceptually simpler to connect the kinetic properties to cellular effects. Further, the experiments are often more tractable than those used to analyze the equilibrium system and, therefore, more widely accessible to scientists interested in the function of exchange factors. PMID:25332840
Origin of the RNA world: The fate of nucleobases in warm little ponds.
Pearce, Ben K D; Pudritz, Ralph E; Semenov, Dmitry A; Henning, Thomas K
2017-10-24
Before the origin of simple cellular life, the building blocks of RNA (nucleotides) had to form and polymerize in favorable environments on early Earth. At this time, meteorites and interplanetary dust particles delivered organics such as nucleobases (the characteristic molecules of nucleotides) to warm little ponds whose wet-dry cycles promoted rapid polymerization. We build a comprehensive numerical model for the evolution of nucleobases in warm little ponds leading to the emergence of the first nucleotides and RNA. We couple Earth's early evolution with complex prebiotic chemistry in these environments. We find that RNA polymers must have emerged very quickly after the deposition of meteorites (less than a few years). Their constituent nucleobases were primarily meteoritic in origin and not from interplanetary dust particles. Ponds appeared as continents rose out of the early global ocean, but this increasing availability of "targets" for meteorites was offset by declining meteorite bombardment rates. Moreover, the rapid losses of nucleobases to pond seepage during wet periods, and to UV photodissociation during dry periods, mean that the synthesis of nucleotides and their polymerization into RNA occurred in just one to a few wet-dry cycles. Under these conditions, RNA polymers likely appeared before 4.17 billion years ago.
Florea, Mara; Nau, Werner M
2010-03-07
A supramolecular tandem assay for direct continuous monitoring of nucleotide triphosphate-dependent enzymes such as potato apyrase is described. The underlying principle of the assay relies on the use of anion-receptor macrocycles in combination with fluorescent dyes as reporter pairs. A combinatorial approach was used to identify two complementary reporter pairs, i.e. an amino-gamma-cyclodextrin with 2-anilinonaphtalene-6-sulfonate (ANS) as dye (fluorescence enhancement factor of 17 upon complexation) and a polycationic cyclophane with 8-hydroxy-1,3,6-pyrene trisulfonate (HPTS) as dye (fluorescence decrease by a factor of more than 2000), which allow the kinetic monitoring of potato apyrase activity at different ATP concentration ranges (microM and mM) with different types of photophysical responses (switch-ON and switch-OFF). Competitive fluorescence titrations revealed a differential binding of ATP (strongest competitor) versus ADP and AMP, which constitutes the prerequisite for monitoring enzymatic conversions (dephosphorylation or phosphorylation) involving nucleotides. The assay was tested for different enzyme and substrate concentrations and exploited for the screening of activating additives, namely divalent transition metal ions (Ni(2+), Mg(2+), Mn(2+), and Ca(2+)). The transferability of the assay could be demonstrated by monitoring the dephosphorylation of other nucleotide triphosphates (GTP, TTP, and CTP).
Cyclic Nucleotide Phosphodiesterases: important signaling modulators and therapeutic targets
Ahmad, Faiyaz; Murata, Taku; Simizu, Kasumi; Degerman, Eva; Maurice, Donald; Manganiello, Vincent
2014-01-01
By catalyzing hydrolysis of cAMP and cGMP, cyclic nucleotide phosphodiesterases are critical regulators of their intracellular concentrations and their biological effects. Since these intracellular second messengers control many cellular homeostatic processes, dysregulation of their signals and signaling pathways initiate or modulate pathophysiological pathways related to various disease states, including erectile dysfunction, pulmonary hypertension, acute refractory cardiac failure, intermittent claudication, chronic obstructive pulmonary disease, and psoriasis. Alterations in expression of PDEs and PDE-gene mutations (especially mutations in PDE6, PDE8B, PDE11A and PDE4) have been implicated in various diseases and cancer pathologies. PDEs also play important role in formation and function of multi-molecular signaling/regulatory complexes called signalosomes. At specific intracellular locations, individual PDEs, together with pathway-specific signaling molecules, regulators, and effectors, are incorporated into specific signalosomes, where they facilitate and regulate compartmentalization of cyclic nucleotide signaling pathways and specific cellular functions. Currently, only a limited number of PDE inhibitors (PDE3, PDE4, PDE5 inhibitors) are used in clinical practice. Future paths to novel drug discovery include the crystal structure-based design approach, which has resulted in generation of more effective family-selective inhibitors, as well as burgeoning development of strategies to alter compartmentalized cyclic nucleotide signaling pathways by selectively targeting individual PDEs and their signalosome partners. PMID:25056711
FamLBL: detecting rare haplotype disease association based on common SNPs using case-parent triads.
Wang, Meng; Lin, Shili
2014-09-15
In recent years, there has been an increasing interest in using common single-nucleotide polymorphisms (SNPs) amassed in genome-wide association studies to investigate rare haplotype effects on complex diseases. Evidence has suggested that rare haplotypes may tag rare causal single-nucleotide variants, making SNP-based rare haplotype analysis not only cost effective, but also more valuable for detecting causal variants. Although a number of methods for detecting rare haplotype association have been proposed in recent years, they are population based and thus susceptible to population stratification. We propose family-triad-based logistic Bayesian Lasso (famLBL) for estimating effects of haplotypes on complex diseases using SNP data. By choosing appropriate prior distribution, effect sizes of unassociated haplotypes can be shrunk toward zero, allowing for more precise estimation of associated haplotypes, especially those that are rare, thereby achieving greater detection power. We evaluate famLBL using simulation to gauge its type I error and power. Compared with its population counterpart, LBL, highlights famLBL's robustness property in the presence of population substructure. Further investigation by comparing famLBL with Family-Based Association Test (FBAT) reveals its advantage for detecting rare haplotype association. famLBL is implemented as an R-package available at http://www.stat.osu.edu/∼statgen/SOFTWARE/LBL/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Molecular variation and distribution of Anopheles fluviatilis (Diptera: Culicidae) complex in Iran.
Naddaf, Saied Reza; Razavi, Mohammad Reza; Bahramali, Golnaz
2010-09-01
Anopheles fluviatilis James (Diptera: Culicidae) is one of the known malaria vectors in south and southeastern Iran. Earlier ITS2 sequences analysis of specimens from Iran demonstrated only a single genotype that was identical to species Y in India, which is also the same as species T. We identified 2 haplotypes in the An. fluviatilis populations of Iran based on differences in nucleotide sequences of D3 domain of the 28S locus of ribosomal DNA (rDNA). Comparison of sequence data from 44 Iranian specimens with those publicly available in the Genbank database showed that all of the 28S-D3 sequences from Kazeroun and Khesht regions in Fars Province were identical to the database entry representing species U in India. In other regions, all the individuals showed heterozygosity at the single nucleotide position, which identifies species U and T. It is argued that the 2 species may co-occur in some regions and hybridize; however, the heterozygosity in the 28S-D3 locus was not reflected in ITS2 sequences and this locus for all individuals was identical to species T. This study shows that in a newly diverged species, like members of An. fluviatilis complex, a single molecular marker may not be sufficiently discriminatory to identify all the taxa over a vast geographical area. In addition, other molecular markers may provide more reliable information for species discrimination.
Vijayalakshmi, Kunduchi P; Mohan, Neetha; Ajitha, Manjaly J; Suresh, Cherumuttathu H
2011-07-21
Six water molecules have been used for microsolvation to outline a hydrogen bonded network around complexes of ethylene epoxide with nucleotide bases adenine (EAw), guanine (EGw) and cytosine (ECw). These models have been developed with the MPWB1K-PCM/6-311++G(3df,2p)//MPWB1K/6-31+G(d,p) level of DFT method and calculated S(N)2 type ring opening of the epoxide due to amino group of the nucleotide bases, viz. the N6 position of adenine, N2 position of guanine and N4 position of cytosine. Activation energy (E(act)) for the ring opening was found to be 28.06, 28.64, and 28.37 kcal mol(-1) respectively for EAw, EGw and ECw. If water molecules were not used, the reactions occurred at considerably high value of E(act), viz. 53.51 kcal mol(-1) for EA, 55.76 kcal mol(-1) for EG and 56.93 kcal mol(-1) for EC. The ring opening led to accumulation of negative charge on the developing alkoxide moiety and the water molecules around the charge localized regions showed strong hydrogen bond interactions to provide stability to the intermediate systems EAw-1, EGw-1 and ECw-1. This led to an easy migration of a proton from an activated water molecule to the alkoxide moiety to generate a hydroxide. Almost simultaneously, a proton transfer chain reaction occurred through the hydrogen bonded network of water molecules and resulted in the rupture of one of the N-H bonds of the quaternized amino group. The highest value of E(act) for the proton transfer step of the reaction was 2.17 kcal mol(-1) for EAw, 2.93 kcal mol(-1) for EGw and 0.02 kcal mol(-1) for ECw. Further, the overall reaction was exothermic by 17.99, 22.49 and 13.18 kcal mol(-1) for EAw, EGw and ECw, respectively, suggesting that the reaction is irreversible. Based on geometric features of the epoxide-nucleotide base complexes and the energetics, the highest reactivity is assigned for adenine followed by cytosine and guanine. Epoxide-mediated damage of DNA is reported in the literature and the present results suggest that hydrated DNA bases become highly S(N)2 active on epoxide systems and the occurrence of such reactions can inflict permanent damage to the DNA.
Changes in miRNAs Signal High-Risk HPV Infections | Center for Cancer Research
microRNAs (miRNAs) are approximately 21 nucleotide long, non-coding RNAs that regulate the expression of certain proteins. As part of the RNA-induced silencing complex or RISC, miRNAs bind to complementary sequences in the 3’ untranslated regions of target messenger RNAs, blocking protein synthesis and sometimes leading to the destruction of the target RNA. Numerous studies have shown that the levels of cellular miRNAs can be altered in diseased tissues, and these changes potentially could be used for diagnosis or disease monitoring.
Genotyping-by-sequencing in three octoploid cultivated strawberry families
USDA-ARS?s Scientific Manuscript database
With the goal of evaluating genotyping-by-sequencing (GBS) in a species with a complex octoploid genome, GBS was used to survey genome-wide single-nucleotide polymorphisms (SNPs) in three biparental strawberry (Fragaria ×ananassa) populations. GBS sequence data were aligned to the F. vesca ‘Fvb’ ref...
Elucidating bonding preferences in tetrakis(imido)uranate(VI) dianions
NASA Astrophysics Data System (ADS)
Anderson, Nickolas H.; Xie, Jing; Ray, Debmalya; Zeller, Matthias; Gagliardi, Laura; Bart, Suzanne C.
2017-09-01
Actinyl species, [AnO2]2+, are well-known derivatives of the f-block because of their natural occurrence and essential roles in the nuclear fuel cycle. Along with their nitrogen analogues, [An(NR)2]2+, actinyls are characterized by their two strong trans-An-element multiple bonds, a consequence of the inverse trans influence. We report that these robust bonds can be weakened significantly by increasing the number of multiple bonds to uranium, as demonstrated by a family of uranium(VI) dianions bearing four U-N multiple bonds, [M]2[U(NR)4] (M = Li, Na, K, Rb, Cs). Their geometry is dictated by cation coordination and sterics rather than by electronic factors. Multiple bond weakening by the addition of strong π donors has the potential for applications in the processing of high-valent actinyls, commonly found in environmental pollutants and spent nuclear fuels.
NASA Astrophysics Data System (ADS)
Ortega, Ryan A.; Barham, Whitney J.; Kumar, Bharat; Tikhomirov, Oleg; McFadden, Ian D.; Yull, Fiona E.; Giorgio, Todd D.
2014-12-01
Tumor associated macrophages (TAMs) can modify the tumor microenvironment to create a pro-tumor niche. Manipulation of the TAM phenotype is a novel, potential therapeutic approach to engage anti-cancer immunity. siRNA is a molecular tool for knockdown of specific mRNAs that is tunable in both strength and duration. The use of siRNA to reprogram TAMs to adopt an immunogenic, anti-tumor phenotype is an attractive alternative to ablation of this cell population. One current difficulty with this approach is that TAMs are difficult to specifically target and transfect. We report here successful utilization of novel mannosylated polymer nanoparticles (MnNP) that are capable of escaping the endosomal compartment to deliver siRNA to TAMs in vitro and in vivo. Transfection with MnNP-siRNA complexes did not significantly decrease TAM cell membrane integrity in culture, nor did it create adverse kidney or liver function in mice, even at repeated doses of 5 mg kg-1. Furthermore, MnNP effectively delivers labeled nucleotides to TAMs in mice with primary mammary tumors. We also confirmed TAM targeting in the solid tumors disseminated throughout the peritoneum of ovarian tumor bearing mice following injection of fluorescently labeled MnNP-nucleotide complexes into the peritoneum. Finally, we show enhanced uptake of MnNP in lung metastasis associated macrophages compared to untargeted particles when using an intubation delivery method. In summary, we have shown that MnNP specifically and effectively deliver siRNA to TAMs in vivo.
Crea, Francesco; De Stefano, Concetta; Foti, Claudia; Lando, Gabriele; Milea, Demetrio; Sammartano, Silvio
2016-01-01
Alkali metal ions play very important roles in all biological systems, some of them are essential for life. Their concentration depends on several physiological factors and is very variable. For example, sodium concentrations in human fluids vary from quite low (e.g., 8.2 mmol dm(-3) in mature maternal milk) to high values (0.14 mol dm(-3) in blood plasma). While many data on the concentration of Na(+) and K(+) in various fluids are available, the information on other alkali metal cations is scarce. Since many vital functions depend on the network of interactions occurring in various biofluids, this chapter reviews their complex formation with phosphates, nucleotides, amino acids, and related ligands of biological relevance. Literature data on this topic are quite rare if compared to other cations. Generally, the stability of alkali metal ion complexes of organic and inorganic ligands is rather low (usually log K < 2) and depends on the charge of the ligand, owing to the ionic nature of the interactions. At the same time, the size of the cation is an important factor that influences the stability: very often, but not always (e.g., for sulfate), it follows the trend Li(+) > Na(+) > K(+) > Rb(+) > Cs(+). For example, for citrate it is: log K ML = 0.88, 0.80, 0.48, 0.38, and 0.13 at 25 °C and infinite dilution. Some considerations are made on the main aspects related to the difficulties in the determination of weak complexes. The importance of the alkali metal ion complexes was also studied in the light of modelling natural fluids and in the use of these cations as probes for different processes. Some empirical relationships are proposed for the dependence of the stability constants of Na(+) complexes on the ligand charge, as well as for correlations among log K values of NaL, KL or LiL species (L = generic ligand).
Applications of adenine nucleotide measurements in oceanography
NASA Technical Reports Server (NTRS)
Holm-Hansen, O.; Hodson, R.; Azam, F.
1975-01-01
The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.
Suzuki, Tomonori; Nagano, Thomas; Niwa, Koichi; Uchino, Masataka; Tomizawa, Motohiro; Sagane, Yoshimasa; Watanabe, Toshihiro
2017-01-01
A non-toxigenic mutant of the toxigenic serotype C Clostridium botulinum strain Stockholm (C-St), C-N71, does not produce the botulinum neurotoxin (BoNT). However, the original strain C-St produces botulinum toxin complex, in which BoNT is associated with non-toxic non-hemagglutinin (NTNHA) and three hemagglutinin proteins (HA-70, HA-33, and HA-17). Therefore, in this study, we aimed to elucidate the effects of bont gene knockout on the formation of the "toxin complex." Nucleotide sequence analysis revealed that a premature stop codon was introduced in the bont gene, whereas other genes were not affected by this mutation. Moreover, we successfully purified the "toxin complex" produced by C-N71. The "toxin complex" was identified as a mixture of NTNHA/HA-70/HA-17/HA-33 complexes with intact NTNHA or C-terminally truncated NTNHA, without BoNT. These results indicated that knockout of the bont gene does not affect the formation of the "toxin complex." Since the botulinum toxin complex has been shown to play an important role in oral toxin transport in the human and animal body, a non-neurotoxic "toxin complex" of C-N71 may be valuable for the development of an oral drug delivery system.
Self-organized, highly luminescent CdSe nanorod-DNA complexes.
Artemyev, Mikhail; Kisiel, Dmitry; Abmiotko, Sergey; Antipina, Maria N; Khomutov, Gennady B; Kislov, Vladimir V; Rakhnyanskaya, Anna A
2004-09-01
DNA molecules are useful building blocks and nanotemplates for controllable fabrication of various bioinorganic nanostructures due to their unique physical-chemical properties and recognition capabilities and the synthetic availability of desired nucleotide sequences and length. We have synthesized novel DNA complexes with positively charged, highly luminescent CdSe nanorods that can be self-organized into filamentary, netlike, or spheroidal nanostructures. DNA-CdSe-nanorod filaments possess strongly linearly polarized photoluminescence due to the unidirectional orientation of nanorods along the filaments. Copyright 2004 American Chemical Society
Free amino acids and 5'-nucleotides in Finnish forest mushrooms.
Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo
2018-05-01
Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.
Andrew, Angeline S; Karagas, Margaret R; Hamilton, Joshua W
2003-04-10
Arsenic is well established as a human carcinogen, but its precise mechanism of action remains unknown. Arsenic does not directly damage DNA, but may act as a carcinogen through inhibition of DNA repair mechanisms, leading indirectly to increased mutations from other DNA damaging agents. The molecular mechanism underlying arsenic inhibition of nucleotide excision repair after UV irradiation (Hartwig et al., Carcinogenesis 1997;18:399-405) is unknown, but could be due to decreased expression of critical genes involved in nucleotide excision repair of damaged DNA. This hypothesis was tested by analyzing expression of repair genes and arsenic exposure in a subset of 16 individuals enrolled in a population based case-control study investigating arsenic exposure and cancer risk in New Hampshire. Toenail arsenic levels were inversely correlated with expression of critical members of the nucleotide excision repair complex, ERCC1 (r(2) = 0.82, p < 0.0001), XPF (r(2) = 0.56, p < 0.002), and XPB (r(2) = 0.75, p < 0.0001). The internal dose marker, toenail arsenic level, was more strongly associated with changes in expression of these genes than drinking water arsenic concentration. Our findings, based on human exposure to arsenic in a US population, show an association between biomarkers of arsenic exposure and expression of DNA repair genes. Although our findings need verification in a larger study group, they are consistent with the hypothesis that inhibition of DNA repair capacity is a potential mechanism for the co-carcinogenic activity of arsenic. Copyright 2003 Wiley-Liss, Inc.
Anirudhan, T S; Divya, L; Suchithra, P S
2009-01-01
This study investigated the feasibility of using a new adsorbent prepared from coconut coir pith, CP (a coir industry-based lignocellulosic residue), for the removal of uranium [U(VI)] from aqueous solutions. The adsorbent (PGCP-COOH) having a carboxylate functional group at the chain end was synthesized by grafting poly(hydroxyethylmethacrylate) onto CP using potassium peroxydisulphate-sodium thiosulphite as a redox initiator and in the presence of N,N'-methylenebisacrylamide as a crosslinking agent. IR spectroscopy results confirm the graft copolymer formation and carboxylate functionalization. XRD studies confirm the decrease of crystallinity in PGCP-COOH compared to CP, and it favors the protrusion of the functional group into the aqueous medium. The thermal stability of the samples was studied using thermogravimetry (TG). Surface charge density of the samples as a function of pH was determined using potentiometric titration. The ability of PGCP-COOH to remove U(VI) from aqueous solutions was assessed using a batch adsorption technique. The maximum adsorption capacity was observed at the pH range 4.0-6.0. Maximum removal of 99.2% was observed for an initial concentration of 25mg/L at pH 6.0 and an adsorbent dose of 2g/L. Equilibrium was achieved in approximately 3h. The experimental kinetic data were analyzed using a first-order kinetic model. The temperature dependence indicates an endothermic process. U(VI) adsorption was found to decrease with an increase in ionic strength due to the formation of outer-sphere surface complexes on PGCP-COOH. Equilibrium data were best modeled by the Langmuir isotherm. The thermodynamic parameters such as DeltaG(0), DeltaH(0) and DeltaS(0) were derived to predict the nature of adsorption. Adsorption experiments were also conducted using a commercial cation exchanger, Ceralite IRC-50, with carboxylate functionality for comparison. Utility of the adsorbent was tested by removing U(VI) from simulated nuclear industry wastewater. Adsorbed U(VI) ions were desorbed effectively (about 96.2+/-3.3%) by 0.1M HCl. The adsorbent was suitable for repeated use (more than four cycles) without any noticeable loss of capacity.
Sugiyama, Shigeru; Nomura, Yusuke; Sakamoto, Taiichi; Kitatani, Tomoya; Kobayashi, Asako; Miyakawa, Shin; Takahashi, Yoshinori; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Nakamura, Yoshikazu; Matsumura, Hiroyoshi
2008-01-01
Aptamers, which are folded DNA or RNA molecules, bind to target molecules with high affinity and specificity. An RNA aptamer specific for the Fc fragment of human immunoglobulin G (IgG) has recently been identified and it has been demonstrated that an optimized 24-nucleotide RNA aptamer binds to the Fc fragment of human IgG and not to other species. In order to clarify the structural basis of the high specificity of the RNA aptamer, it was crystallized in complex with the Fc fragment of human IgG1. Preliminary X-ray diffraction studies revealed that the crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 83.7, b = 107.2, c = 79.0 Å. A data set has been collected to 2.2 Å resolution. PMID:18931441
Palmer, RHC; Brick, L; Nugent, NR; Bidwell, LC; McGeary, JE; Knopik, VS; Keller, MC
2014-01-01
Background and Aims Twin and family studies suggest that genetic influences are shared across substances of abuse. However, despite evidence of heritability, genome-wide association and candidate gene studies have indicated numerous markers of limited effects, suggesting that much of the heritability remains missing. We estimated (1) the aggregate effect of common single nucleotide polymorphisms (SNPs) on multiple indicators of comorbid drug problems that are typically employed across community and population-based samples, and (2) the genetic covariance across these measures. Participants 2596 unrelated subjects from the “Study of Addiction: Genetics and Environment” provided information on alcohol, tobacco, cocaine, cannabis, and other illicit substance dependence. Phenotypic measures included: (1) a factor score based on DSM-IV drug dependence diagnoses (DD), (2) a factor score based on problem use (PU; i.e., 1+ DSM-IV symptoms), and (3) dependence vulnerability (DV; a ratio of DSM-IV symptoms to the number of substances used). Findings Univariate and bivariate Genome-wide complex trait analyses of this selected sample indicated that common SNPs explained 25-36% of the variance across measures, with DD and DV having the largest effects [h2SNP (CI)=0.36 (0.11-0.62) and 0.33(0.07-0.58), respectively; PU = 0.25 (-0.01-0.51)]. Genetic effects were shared across the three phenotypic measures of comorbid drug problems (rSNP; rDD-PU = 0.92 (0.76-1.00), rDD-DV = 0.97 (0.87-1.00), and rPU-DV = 0.96 (0.82-1.00)). Conclusion At least 20% of the variance in the generalized vulnerability to substance dependence is attributable to common single nucleotide polymorphisms. The additive effect of common single nucleotide polymorphisms is shared across important indicators of comorbid drug problems. PMID:25424661
Azab, Hassan A; Hussein, Belal H M; El-Falouji, Abdullah I
2012-03-01
Eu(III)-9-acridinecarboxylate (9-ACA) complex was synthesized and characterized by elemental analysis, conductivity measurement, IR spectroscopy, thermal analysis, mass spectroscopy, (1)H-NMR, fluorescence and ultraviolet spectra. The results indicated that the composition of this complex is [Eu(III)-(9-ACA)(2)(NCS)(C(2)H(5)OH)(2)] 2.5 H(2)O and the oxygen of the carbonyl group coordinated to Eu(III). The interaction between the complex with nucleotides guanosine 5'- monophosphate (5'-GMP), adenosine 5'-diphosphates (5'-ADP), inosine (5'-IMP) and CT-DNA was studied by fluorescence spectroscopy. The fluorescence intensity of Eu(III)-9-acridinecarboxylate complex was enhanced with the addition of CT-DNA. The effect of pH values on the fluorescence intensity of Eu(III) complex was investigated. Under experimental conditions, the linear range was 9-50 ng mL(-1) for calf thymus DNA (CT- DNA) and the corresponding detection limit was 5 ng mL(-1). The results showed that Eu(III)-(9-ACA)(2) complex binds to CT-DNA with stability constant of 2.41 × 10(4) M.
Fast Oxidation Processes in a Naturally Reduced Aquifer Zone Caused by Dissolved Oxygen
NASA Astrophysics Data System (ADS)
Davis, J. A.; Jemison, N. E.; Williams, K. H.; Hobson, C.; Bush, R. P.
2014-12-01
The occurrence of naturally reduced zones is quite common in alluvial aquifers in the western U.S.A. due to the burial of woody debris in flood plains. The naturally reduced zones are heterogeneously dispersed in such aquifers and are characterized by high concentrations of organic carbon and reduced phases, including iron sulfides and reduced forms of metals, including uranium(IV). The persistence of high concentrations of dissolved uranium(VI) at uranium-contaminated aquifers on the Colorado Plateau has been attributed to slow oxidation of insoluble uranium(IV) mineral phases that are found in association with these natural reducing zones, although there is little understanding of the relative importance of various potential oxidants. Three field experiments were conducted within an alluvial aquifer adjacent to the Colorado River near Rifle, CO wherein groundwater associated with naturally reduced zones was pumped into a gas-impermeable tank, mixed with a conservative tracer (Br-), bubbled with a gas phase composed of 97% O2 and 3% CO2, and then returned to the subsurface in the same well from which it was withdrawn. Within minutes of re-injection of the oxygenated groundwater, dissolved uranium(VI) concentrations increased from less than 1 μM to greater than 2.5 μM, demonstrating that oxygen can be an important oxidant for uranium in these field systems if supplied to the naturally reduced zones. Small concentrations of nitrate were also observed in the previously nitrate-free groundwater, and Fe(II) decreased to the detection limit. These results contrast with other laboratory and field results in which oxygen was introduced to systems containing high concentrations of mackinawite (FeS) rather than the more crystalline iron sulfides found in aged, naturally reduced zones. The flux of oxygen to the naturally reduced zones in the alluvial aquifers occurs mainly through interactions between groundwater and gas phases at the water table, and seasonal variations of the water table at the Rifle, CO site may play an important role in introducing oxygen into the system. Although oxygen was introduced directly to the naturally reduced zones in these experiments, delivery of oxidants to the system may normally be controlled by other oxidative pathways in which oxygen plays an indirect role.
NASA Astrophysics Data System (ADS)
Davis, J. A.; Smith, R. L.; Bohlke, J. K.; Jemison, N.; Xiang, H.; Repert, D. A.; Yuan, X.; Williams, K. H.
2015-12-01
The occurrence of naturally reduced zones is common in alluvial aquifers in the western U.S.A. due to the burial of woody debris in flood plains. Such reduced zones are usually heterogeneously dispersed in these aquifers and characterized by high concentrations of organic carbon, reduced mineral phases, and reduced forms of metals, including uranium(IV). The persistence of high concentrations of dissolved uranium(VI) at uranium-contaminated aquifers on the Colorado Plateau has been attributed to slow oxidation of insoluble uranium(IV) mineral phases found in association with these reducing zones, although there is little understanding of the relative importance of various potential oxidants. Four field experiments were conducted within an alluvial aquifer adjacent to the Colorado River near Rifle, CO, wherein groundwater associated with the naturally reduced zones was pumped into a gas-impermeable tank, mixed with a conservative tracer (Br-), bubbled with a gas phase composed of 97% O2 and 3% CO2, and then returned to the subsurface in the same well from which it was withdrawn. Within minutes of re-injection of the oxygenated groundwater, dissolved uranium(VI) concentrations increased from less than 1 μM to greater than 2.5 μM, demonstrating that oxygen can be an important oxidant for uranium in such field systems if supplied to the naturally reduced zones. Dissolved Fe(II) concentrations decreased to the detection limit, but increases in sulfate could not be detected due to high background concentrations. Changes in nitrogen species concentrations were variable. The results contrast with other laboratory and field results in which oxygen was introduced to systems containing high concentrations of mackinawite (FeS), rather than the more crystalline iron sulfides found in aged, naturally reduced zones. The flux of oxygen to the naturally reduced zones in the alluvial aquifers occurs mainly through interactions between groundwater and gas phases at the water table. Seasonal variations of the water table at the Rifle, CO site may play an important role in introducing oxygen into the system. Although oxygen was introduced directly to the naturally reduced zones in these experiments, delivery of oxidants to the system may also be controlled by other oxidative pathways in which oxygen plays an indirect role.
NASA Astrophysics Data System (ADS)
Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.
2008-08-01
Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early Mars) where demands on gene activity are low. In addition, the comparative study of the Methanococcoides burtonii cold shock domain sequence has provided further support for the correlation between multitasking capacity and fractal dimension.
Walkowiak, Sean; Rowland, Owen; Rodrigue, Nicolas; Subramaniam, Rajagopal
2016-12-09
The Fusarium graminearum species complex is composed of many distinct fungal species that cause several diseases in economically important crops, including Fusarium Head Blight of wheat. Despite being closely related, these species and individuals within species have distinct phenotypic differences in toxin production and pathogenicity, with some isolates reported as non-pathogenic on certain hosts. In this report, we compare genomes and gene content of six new isolates from the species complex, including the first available genomes of F. asiaticum and F. meridionale, with four other genomes reported in previous studies. A comparison of genome structure and gene content revealed a 93-99% overlap across all ten genomes. We identified more than 700 k base pairs (kb) of single nucleotide polymorphisms (SNPs), insertions, and deletions (indels) within common regions of the genome, which validated the species and genetic populations reported within species. We constructed a non-redundant pan gene list containing 15,297 genes from the ten genomes and among them 1827 genes or 12% were absent in at least one genome. These genes were co-localized in telomeric regions and select regions within chromosomes with a corresponding increase in SNPs and indels. Many are also predicted to encode for proteins involved in secondary metabolism and other functions associated with disease. Genes that were common between isolates contained high levels of nucleotide variation and may be pseudogenes, allelic, or under diversifying selection. The genomic resources we have contributed will be useful for the identification of genes that contribute to the phenotypic variation and niche specialization that have been reported among members of the F. graminearum species complex.
Rick, M E; Krizek, D M
1996-04-01
A patient with type 2N ("Normandy" variant) von Willebrand's disease is described. Her von Willebrand factor level was borderline low, while her factor VIII was markedly decreased to 7%. Her plasma von Willebrand factor demonstrated a decreased ability to complex with factor VIII in vitro, binding less than 10% when compared to normal plasma von Willebrand factor. The factor VIII released into the circulation after the patient received DDAVP had a shortened survival in vivo. Nucleotide sequence analysis revealed a T-to-A transition at nucleotide 2451 on both alleles. This transition results in a substitution of Gln for His at amino acid 54 in the mature subunit of von Willebrand factor.
DEAD-box Helicases as Integrators of RNA, Nucleotide and Protein Binding
Putnam, Andrea A.
2013-01-01
DEAD-box helicases perform diverse cellular functions in virtually all steps of RNA metabolism from Bacteria to Humans. Although DEAD-box helicases share a highly conserved core domain, the enzymes catalyze a wide range of biochemical reactions. In addition to the well established RNA unwinding and corresponding ATPase activities, DEAD-box helicases promote duplex formation and displace proteins from RNA. They can also function as assembly platforms for larger ribonucleoprotein complexes, and as metabolite sensors. This review aims to provide a perspective on the diverse biochemical features of DEAD-box helicases and connections to structural information. We discuss these data in the context of a model that views the enzymes as integrators of RNA, nucleotide, and protein binding. PMID:23416748
Escalante-Santiago, David; Feria-Romero, Iris Angélica; Ribas-Aparicio, Rosa María; Rayo-Mares, Dario; Fagiolino, Pietro; Vázquez, Marta; Escamilla-Núñez, Consuelo; Grijalva-Otero, Israel; López-García, Miguel Angel; Orozco-Suárez, Sandra
2014-01-01
Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1/ABCB1 and MRP2/ABCC2 in patients with antiepileptic-drugs resistant epilepsy (ADR) is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with ADR and patients with good response (CTR) to antiepileptic drugs (AEDs) in a rigorously selected population. We analyzed 22 samples In Material and Methods, from drug-resistant patients with epilepsy and 7 samples from patients with good response to AEDs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA) and rs2032582 (AT and AG) were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT) and 66744T > A (TG) were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy (ADR) used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with ADR.
Escalante-Santiago, David; Feria-Romero, Iris Angélica; Ribas-Aparicio, Rosa María; Rayo-Mares, Dario; Fagiolino, Pietro; Vázquez, Marta; Escamilla-Núñez, Consuelo; Grijalva-Otero, Israel; López-García, Miguel Angel; Orozco-Suárez, Sandra
2014-01-01
Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1/ABCB1 and MRP2/ABCC2 in patients with antiepileptic-drugs resistant epilepsy (ADR) is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with ADR and patients with good response (CTR) to antiepileptic drugs (AEDs) in a rigorously selected population. We analyzed 22 samples In Material and Methods, from drug-resistant patients with epilepsy and 7 samples from patients with good response to AEDs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA) and rs2032582 (AT and AG) were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT) and 66744T > A (TG) were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy (ADR) used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with ADR. PMID:25346718
The DNA damage response (DDR) is a highly regulated signal transduction network that orchestrates the temporal and spatial organization of protein complexes required to repair (or tolerate) DNA damage (e.g., nucleotide excision repair, base excision repair, homologous recombination, non-homologous end joining, post-replication repair).
USDA-ARS?s Scientific Manuscript database
Polarized growth of pollen tubes is a critical step for successful reproduction in angiosperms and is controlled by ROP GTPases. Spatiotemporal activation of ROP (Rho GTPases of plants) necessitates a complex and sophisticated regulatory system, in which guanine nucleotide exchange factors (RopGEFs)...
ERIC Educational Resources Information Center
Qiu, Shuhao
2015-01-01
In order to investigate the complexity of mutations, a computational approach named Genome Evolution by Matrix Algorithms ("GEMA") has been implemented. GEMA models genomic changes, taking into account hundreds of mutations within each individual in a population. By modeling of entire human chromosomes, GEMA precisely mimics real…
2010-10-01
5 Results ...to disease prognosis and in determining the course of treatment for the patient (2) . Breast cancer is a highly heterogeneous and complex disease...progression is a challenge. Introduction of high density single nucleotide polymorphism (SNP) genotyping arrays has helped not only for whole genome
Association genetics in Pinus taeda L. I. wood property traits
Santiago C. Gonzalez-Martinez; Nicholas C. Wheeler; Elhan Ersoz; C. Dana Nelson; David B. Neale
2007-01-01
Genetic association is a powerful method for dissecting complex adaptive traits due to (i) fine-scale mapping resulting from historical recombination, (ii) wide coverage of phenotypic and genotypic variation within a single experiment, and (iii) the simultaneous discovery of loci and alleles. In this article, genetic association among single nucleotide polymorphisms (...
Ma, Xiao-Juan; Shang, Li; Zhang, Wei-Min; Wang, Ming-Rong; Zhan, Qi-Min
2016-04-10
Cellular response to DNA damage, including ionizing radiation (IR) and UV radiation, is critical for the maintenance of genomic fidelity. Defects of DNA repair often result in genomic instability and malignant cell transformation. Centrosomal protein Nlp (ninein-like protein) has been characterized as an important cell cycle regulator that is required for proper mitotic progression. In this study, we demonstrate that Nlp is able to improve nucleotide excision repair (NER) activity and protects cells against UV radiation. Upon exposure of cells to UVC, Nlp is translocated into the nucleus. The C-terminus (1030-1382) of Nlp is necessary and sufficient for its nuclear import. Upon UVC radiation, Nlp interacts with XPA and ERCC1, and enhances their association. Interestingly, down-regulated expression of Nlp is found to be associated with human skin cancers, indicating that dysregulated Nlp might be related to the development of human skin cancers. Taken together, this study identifies mitotic protein Nlp as a new and important member of NER pathway and thus provides novel insights into understanding of regulatory machinery involved in NER. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin
2011-05-01
Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.
Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre
2011-01-01
Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816
Moore, Michael; Zhang, Chaolin; Gantman, Emily Conn; Mele, Aldo; Darnell, Jennifer C.; Darnell, Robert B.
2014-01-01
Summary Identifying sites where RNA binding proteins (RNABPs) interact with target RNAs opens the door to understanding the vast complexity of RNA regulation. UV-crosslinking and immunoprecipitation (CLIP) is a transformative technology in which RNAs purified from in vivo cross-linked RNA-protein complexes are sequenced to reveal footprints of RNABP:RNA contacts. CLIP combined with high throughput sequencing (HITS-CLIP) is a generalizable strategy to produce transcriptome-wide RNA binding maps with higher accuracy and resolution than standard RNA immunoprecipitation (RIP) profiling or purely computational approaches. Applying CLIP to Argonaute proteins has expanded the utility of this approach to mapping binding sites for microRNAs and other small regulatory RNAs. Finally, recent advances in data analysis take advantage of crosslinked-induced mutation sites (CIMS) to refine RNA-binding maps to single-nucleotide resolution. Once IP conditions are established, HITS-CLIP takes approximately eight days to prepare RNA for sequencing. Established pipelines for data analysis, including for CIMS, take 3-4 days. PMID:24407355
Chakraborty, Anirban; Tapryal, Nisha; Venkova, Tatiana; Horikoshi, Nobuo; Pandita, Raj K.; Sarker, Altaf H.; Sarkar, Partha S.; Pandita, Tej K.; Hazra, Tapas K.
2016-01-01
DNA double-strand breaks (DSBs) leading to loss of nucleotides in the transcribed region can be lethal. Classical non-homologous end-joining (C-NHEJ) is the dominant pathway for DSB repair (DSBR) in adult mammalian cells. Here we report that during such DSBR, mammalian C-NHEJ proteins form a multiprotein complex with RNA polymerase II and preferentially associate with the transcribed genes after DSB induction. Depletion of C-NHEJ factors significantly abrogates DSBR in transcribed but not in non-transcribed genes. We hypothesized that nascent RNA can serve as a template for restoring the missing sequences, thus allowing error-free DSBR. We indeed found pre-mRNA in the C-NHEJ complex. Finally, when a DSB-containing plasmid with several nucleotides deleted within the E. coli lacZ gene was allowed time to repair in lacZ-expressing mammalian cells, a functional lacZ plasmid could be recovered from control but not C-NHEJ factor-depleted cells, providing important mechanistic insights into C-NHEJ-mediated error-free DSBR of the transcribed genome. PMID:27703167
Wolbachia infection complexity among insects in the tropical rice-field community.
Kittayapong, P; Jamnongluk, W; Thipaksorn, A; Milne, J R; Sindhusake, C
2003-04-01
Wolbachia are a group of intracellular bacteria that cause reproductive alterations in their arthropod hosts. Widely discordant host and Wolbachia phylogenies indicate that horizontal transmission of these bacteria among species sometimes occurs. A likely means of horizontal transfer is through the feeding relations of organisms within communities. Feeding interactions among insects within the rice-field insect community have been well documented in the past. Here, we present the results of a polymerase chain reaction-based survey and phylogenetic analysis of Wolbachia strains in the rice-field insect community of Thailand. Our field survey indicated that 49 of 209 (23.4%) rice-field insect species were infected with Wolbachia. Of the 49 infected species, 27 were members of two feeding complexes: (i) a group of 13 hoppers preyed on by 2 mirid species and parasitized by a fly species, and (ii) 2 lepidopteran pests parasitized by 9 wasp species. Wolbachia strains found in three hoppers, Recilia dorsalis, Nephotettix malayanus and Nisia nervosa, the two mirid predators, Cyrtorhinus lividipennis and Tytthus chinensis, and the fly parasitoid, Tomosvaryella subvirescens, were all in the same Wolbachia clade. In the second complex, the two lepidopteran pests, Cnaphalocrocis medinalis and Scirpophaga incertulas, were both infected with Wolbachia from the same clade, as was the parasitoid Tropobracon schoenobii. However, none of the other infected parasitoid species in this feeding complex was infected by Wolbachia from this clade. Mean (+/- SD) genetic distance of Wolbachia wsp sequences among interacting species pairs of the hopper feeding complex (0.118 +/- 0.091 nucleotide sequence differences), but not for the other two complexes, was significantly smaller than that between noninteracting species pairs (0.162 +/- 0.079 nucleotide sequence differences). Our results suggest that some feeding complexes, such as the hopper complex described here, could be an important means by which Wolbachia spreads among species within arthropod communities.
Interaction of 4.1G and cGMP-gated channels in rod photoreceptor outer segments.
Cheng, Christiana L; Molday, Robert S
2013-12-15
In photoreceptors, the assembly of signaling molecules into macromolecular complexes is important for phototransduction and maintaining the structural integrity of rod outer segments (ROSs). However, the molecular composition and formation of these complexes are poorly understood. Using immunoprecipitation and mass spectrometry, 4.1G was identified as a new interacting partner for the cyclic-nucleotide gated (CNG) channels in ROSs. 4.1G is a widely expressed multifunctional protein that plays a role in the assembly and stability of membrane protein complexes. Multiple splice variants of 4.1G were cloned from bovine retina. A smaller splice variant of 4.1G selectively interacted with CNG channels not associated with peripherin-2-CNG channel complex. A combination of truncation studies and domain-binding assays demonstrated that CNG channels selectively interacted with 4.1G through their FERM and CTD domains. Using immunofluorescence, labeling of 4.1G was seen to be punctate and partially colocalized with CNG channels in the ROS. Our studies indicate that 4.1G interacts with a subset of CNG channels in the ROS and implicate this protein-protein interaction in organizing the spatial arrangement of CNG channels in the plasma membrane of outer segments.
Genetic variation of the RASGRF1 regulatory region affects human hippocampus-dependent memory
Barman, Adriana; Assmann, Anne; Richter, Sylvia; Soch, Joram; Schütze, Hartmut; Wüstenberg, Torsten; Deibele, Anna; Klein, Marieke; Richter, Anni; Behnisch, Gusalija; Düzel, Emrah; Zenker, Martin; Seidenbecher, Constanze I.; Schott, Björn H.
2014-01-01
The guanine nucleotide exchange factor RASGRF1 is an important regulator of intracellular signaling and neural plasticity in the brain. RASGRF1-deficient mice exhibit a complex phenotype with learning deficits and ocular abnormalities. Also in humans, a genome-wide association study has identified the single nucleotide polymorphism (SNP) rs8027411 in the putative transcription regulatory region of RASGRF1 as a risk variant of myopia. Here we aimed to assess whether, in line with the RASGRF1 knockout mouse phenotype, rs8027411 might also be associated with human memory function. We performed computer-based neuropsychological learning experiments in two independent cohorts of young, healthy participants. Tests included the Verbal Learning and Memory Test (VLMT) and the logical memory section of the Wechsler Memory Scale (WMS). Two sub-cohorts additionally participated in functional magnetic resonance imaging (fMRI) studies of hippocampus function. 119 participants performed a novelty encoding task that had previously been shown to engage the hippocampus, and 63 subjects participated in a reward-related memory encoding study. RASGRF1 rs8027411 genotype was indeed associated with memory performance in an allele dosage-dependent manner, with carriers of the T allele (i.e., the myopia risk allele) showing better memory performance in the early encoding phase of the VLMT and in the recall phase of the WMS logical memory section. In fMRI, T allele carriers exhibited increased hippocampal activation during presentation of novel images and during encoding of pictures associated with monetary reward. Taken together, our results provide evidence for a role of the RASGRF1 gene locus in hippocampus-dependent memory and, along with the previous association with myopia, point toward pleitropic effects of RASGRF1 genetic variations on complex neural function in humans. PMID:24808846
Wojtuszkiewicz, Anna; Barcelos, Ana; Dubbelman, Boas; De Abreu, Ronney; Brouwer, Connie; Bökkerink, Jos P; de Haas, Valerie; de Groot-Kruseman, Hester; Jansen, Gerrit; Kaspers, Gertjan L; Cloos, Jacqueline; Peters, G J
2014-01-01
Pediatric acute lymphoblastic leukemia (ALL) is treated with combination chemotherapy including mercaptopurine (6MP) as an important component. Upon its uptake, 6MP undergoes a complex metabolism involving many enzymes and active products. The prognostic value of all the factors engaged in this pathway still remains unclear. This study attempted to determine which components of 6MP metabolism in leukemic blasts and red blood cells are important for 6MP's sensitivity and toxicity. In addition, changes in the enzymatic activities and metabolite levels during the treatment were analyzed. In a cohort (N=236) of pediatric ALL patients enrolled in the Dutch ALL-9 protocol, we studied the enzymes inosine-5'-monophosphate dehydrogenase (IMPDH), thiopurine S-methyltransferase (TPMT), hypoxanthine guanine phosphoribosyl transferase (HGPRT), and purine nucleoside phosphorylase (PNP) as well as thioguanine nucleotides (TGN) and methylthioinosine nucleotides (meTINs). Activities of selected enzymes and levels of 6MP derivatives were measured at various time points during the course of therapy. The data obtained and the toxicity related parameters available for these patients were correlated with each other. We found several interesting relations, including high concentrations of two active forms of 6MP--TGN and meTIN--showing a trend toward association with better in vitro antileukemic effect of 6MP. High concentrations of TGN and elevated activity of HGPRT were found to be significantly associated with grade III/IV leucopenia. However, a lot of data of enzymatic activities and metabolite concentrations as well as clinical toxicity were missing, thereby limiting the number of assessed relations. Therefore, although a complex study of 6MP metabolism in ALL patients is feasible, it warrants more robust and strict data collection in order to be able to draw more reliable conclusions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Frye, Jeremiah J.; Klenchin, Vadim A.; Bagshaw, Clive R.
2010-09-22
The active site of myosin contains a group of highly conserved amino acid residues whose roles in nucleotide hydrolysis and energy transduction might appear to be obvious from the initial structural and kinetic analyses but become less clear on deeper investigation. One such residue is Ser236 (Dictyostelium discoideum myosin II numbering) which was proposed to be involved in a hydrogen transfer network during {gamma}-phosphate hydrolysis of ATP, which would imply a critical function in ATP hydrolysis and motility. The S236A mutant protein shows a comparatively small decrease in hydrolytic activity and motility, and thus this residue does not appear tomore » be essential. To understand better the contribution of Ser236 to the function of myosin, structural and kinetic studies have been performed on the S236A mutant protein. The structures of the D. discoideum motor domain (S1dC) S236A mutant protein in complex with magnesium pyrophosphate, MgAMPPNP, and MgADP{center_dot}vanadate have been determined. In contrast to the previous structure of wild-type S1dC, the S236A{center_dot}MgAMPPNP complex crystallized in the closed state. Furthermore, transient-state kinetics showed a 4-fold reduction of the nucleotide release step, suggesting that the mutation stabilizes a closed active site. The structures show that a water molecule approximately adopts the location of the missing hydroxyl of Ser236 in the magnesium pyrophosphate and MgAMPPNP structures. This study suggests that the S236A mutant myosin proceeds via a different structural mechanism than wild-type myosin, where the alternate mechanism is able to maintain near normal transient-state kinetic values.« less
Brown, Judith K; Ur-Rehman, Muhammad Zia; Avelar, Sofia; Chingandu, N; Hameed, Usman; Haider, Saleem; Ilyas, Muhammad
2017-09-15
At least five begomoviral species that cause leaf curl disease of cotton have emerged recently in Asia and Africa, reducing fiber quality and yield. The potential for the spread of these viruses to other cotton-vegetable growing regions throughout the world is extensive, owing to routine, global transport of alternative hosts of the leaf curl viruses, especially ornamentals. The research reported here describes the design and validation of polymerase chain reaction (PCR) primers undertaken to facilitate molecular detection of the two most-prevalent leaf curl-associated begomovirus-betasatellite complexes in the Indian Subcontinent and Africa, the Cotton leaf curl Kokhran virus-Burewala strain and Cotton leaf curl Gezira virus, endemic to Asia and Africa, respectively. Ongoing genomic diversification of these begomoviral-satellite complexes was evident based on nucleotide sequence alignments, and analysis of single nucleotide polymorphisms, both factors that created new challenges for primer design. The additional requirement for species and strain-specific, and betasatellite-specific primer design, imposes further constraints on primer design and validation due to the large number of related species and strains extant in 'core leaf curl virus complex', now with expanded distribution in south Asia, the Pacific region, and Africa-Arabian Peninsula that have relatively highly conserved coding and non-coding regions, which precludes much of the genome-betasatellite sequence when selecting primer 'targets'. Here, PCR primers were successfully designed and validated for detection of cloned viral genomes and betasatellites for representative 'core leaf curl' strains and species, distant relatives, and total DNA isolated from selected plant species. The application of molecular diagnostics to screen plant imports prior to export or release from ports of entry is expected to greatly reduce the likelihood of exotic leaf curl virus introductions that could dramatically affect the production of cotton as well as vegetable and ornamental crop hosts. Copyright © 2017 Elsevier B.V. All rights reserved.
Simultaneous determination of nucleotide sugars with ion-pair reversed-phase HPLC.
Nakajima, Kazuki; Kitazume, Shinobu; Angata, Takashi; Fujinawa, Reiko; Ohtsubo, Kazuaki; Miyoshi, Eiji; Taniguchi, Naoyuki
2010-07-01
Nucleotide sugars are important in determining cell surface glycoprotein glycosylation, which can modulate cellular properties such as growth and arrest. We have developed a conventional HPLC method for simultaneous determination of nucleotide sugars. A mixture of nucleotide sugars (CMP-NeuAc, UDP-Gal, UDP-Glc, UDP-GalNAc, UDP-GlcNAc, GDP-Man, GDP-Fuc and UDP-GlcUA) and relevant nucleotides were perfectly separated in an optimized ion-pair reversed-phase mode using Inertsil ODS-4 and ODS-3 columns. The newly developed method enabled us to determine the nucleotide sugars in cellular extracts from 1 x 10(6) cells in a single run. We applied this method to characterize nucleotide sugar levels in breast and pancreatic cancer cell lines and revealed that the abundance of UDP-GlcNAc, UDP-GalNAc, UDP-GlcUA and GDP-Fuc were a cell-type-specific feature. To determine the physiological significance of changes in nucleotide sugar levels, we analyzed their changes by glucose deprivation and found that the determination of nucleotide sugar levels provided us with valuable information with respect to studying the overview of cellular glycosylation status.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Simonetti, Angelita; Marzi, Stefano; Fabbretti, Attilio
2013-06-01
The crystal structures of the eubacterial translation initiation factor 2 in apo form and with bound GDP and GTP reveal conformational changes upon nucleotide binding and hydrolysis, notably of the catalytically important histidine in the switch II region. Translation initiation factor 2 (IF2) is involved in the early steps of bacterial protein synthesis. It promotes the stabilization of the initiator tRNA on the 30S initiation complex (IC) and triggers GTP hydrolysis upon ribosomal subunit joining. While the structure of an archaeal homologue (a/eIF5B) is known, there are significant sequence and functional differences in eubacterial IF2, while the trimeric eukaryotic IF2more » is completely unrelated. Here, the crystal structure of the apo IF2 protein core from Thermus thermophilus has been determined by MAD phasing and the structures of GTP and GDP complexes were also obtained. The IF2–GTP complex was trapped by soaking with GTP in the cryoprotectant. The structures revealed conformational changes of the protein upon nucleotide binding, in particular in the P-loop region, which extend to the functionally relevant switch II region. The latter carries a catalytically important and conserved histidine residue which is observed in different conformations in the GTP and GDP complexes. Overall, this work provides the first crystal structure of a eubacterial IF2 and suggests that activation of GTP hydrolysis may occur by a conformational repositioning of the histidine residue.« less
How important are rare variants in common disease?
Saint Pierre, Aude; Génin, Emmanuelle
2014-09-01
Genome-wide association studies have uncovered hundreds of common genetic variants involved in complex diseases. However, for most complex diseases, these common genetic variants only marginally contribute to disease susceptibility. It is now argued that rare variants located in different genes could in fact play a more important role in disease susceptibility than common variants. These rare genetic variants were not captured by genome-wide association studies using single nucleotide polymorphism-chips but with the advent of next-generation sequencing technologies, they have become detectable. It is now possible to study their contribution to common disease by resequencing samples of cases and controls or by using new genotyping exome arrays that cover rare alleles. In this review, we address the question of the contribution of rare variants in common disease by taking the examples of different diseases for which some resequencing studies have already been performed, and by summarizing the results of simulation studies conducted so far to investigate the genetic architecture of complex traits in human. So far, empirical data have not allowed the exclusion of many models except the most extreme ones involving only a small number of rare variants with large effects contributing to complex disease. To unravel the genetic architecture of complex disease, case-control data will not be sufficient, and alternative study designs need to be proposed together with methodological developments. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Biological nanopore MspA for DNA sequencing
NASA Astrophysics Data System (ADS)
Manrao, Elizabeth A.
Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.
Koit, Andre; Ounpuu, Lyudmila; Klepinin, Aleksandr; Chekulayev, Vladimir; Timohhina, Natalja; Tepp, Kersti; Puurand, Marju; Truu, Laura; Heck, Karoliina; Valvere, Vahur; Guzun, Rita
2017-01-01
We conducted quantitative cellular respiration analysis on samples taken from human breast cancer (HBC) and human colorectal cancer (HCC) patients. Respiratory capacity is not lost as a result of tumor formation and even though, functionally, complex I in HCC was found to be suppressed, it was not evident on the protein level. Additionally, metabolic control analysis was used to quantify the role of components of mitochondrial interactosome. The main rate-controlling steps in HBC are complex IV and adenine nucleotide transporter, but in HCC, complexes I and III. Our kinetic measurements confirmed previous studies that respiratory chain complexes I and III in HBC and HCC can be assembled into supercomplexes with a possible partial addition from the complex IV pool. Therefore, the kinetic method can be a useful addition in studying supercomplexes in cell lines or human samples. In addition, when results from culture cells were compared to those from clinical samples, clear differences were present, but we also detected two different types of mitochondria within clinical HBC samples, possibly linked to two-compartment metabolism. Taken together, our data show that mitochondrial respiration and regulation of mitochondrial membrane permeability have substantial differences between these two cancer types when compared to each other to their adjacent healthy tissue or to respective cell cultures. PMID:28781720
Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene.
Yang, Ming; Yang, Bin; Yan, Xueming; Ouyang, Jing; Zeng, Weihong; Ai, Huashui; Ren, Jun; Huang, Lusheng
2012-07-13
MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD) within this gene in Chinese indigenous breeds and Western commercial breeds. A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb) in Western commercial breeds. The significant positive Tajima'D, and Fu and Li's D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Chinese and Western breeds have similar nucleotide diversity but evolve divergently in the MUC4 region. Western breeds exhibited unusual low LD extent at the MUC4 locus, reflecting the complexity of nucleotide variability of pig genome. The finding suggests that high density (e.g. 1SNP/10 kb) markers are required to capture the underlying causal variants at such regions.
Data compression and genomes: a two-dimensional life domain map.
Menconi, Giulia; Benci, Vieri; Buiatti, Marcello
2008-07-21
We define the complexity of DNA sequences as the information content per nucleotide, calculated by means of some Lempel-Ziv data compression algorithm. It is possible to use the statistics of the complexity values of the functional regions of different complete genomes to distinguish among genomes of different domains of life (Archaea, Bacteria and Eukarya). We shall focus on the distribution function of the complexity of non-coding regions. We show that the three domains may be plotted in separate regions within the two-dimensional space where the axes are the skewness coefficient and the curtosis coefficient of the aforementioned distribution. Preliminary results on 15 genomes are introduced.
Binding of DNA hairpins to an assembler-strand as part of a primordial translation device
NASA Astrophysics Data System (ADS)
Baumann, Ulrich
1987-09-01
A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kirouac, Kevin N.; Ling, Hong; UWO)
Human DNA polymerase iota (pol iota) is a unique member of Y-family polymerases, which preferentially misincorporates nucleotides opposite thymines (T) and halts replication at T bases. The structural basis of the high error rates remains elusive. We present three crystal structures of pol complexed with DNA containing a thymine base, paired with correct or incorrect incoming nucleotides. A narrowed active site supports a pyrimidine to pyrimidine mismatch and excludes Watson-Crick base pairing by pol. The template thymine remains in an anti conformation irrespective of incoming nucleotides. Incoming ddATP adopts a syn conformation with reduced base stacking, whereas incorrect dGTP andmore » dTTP maintain anti conformations with normal base stacking. Further stabilization of dGTP by H-bonding with Gln59 of the finger domain explains the preferential T to G mismatch. A template 'U-turn' is stabilized by pol and the methyl group of the thymine template, revealing the structural basis of T stalling. Our structural and domain-swapping experiments indicate that the finger domain is responsible for pol's high error rates on pyrimidines and determines the incorporation specificity.« less
Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai
2013-08-01
To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.
Tamarkin-Ben-Harush, Ana; Vasseur, Jean-Jacques; Debart, Françoise; Ulitsky, Igor; Dikstein, Rivka
2017-02-08
Transcription start-site (TSS) selection and alternative promoter (AP) usage contribute to gene expression complexity but little is known about their impact on translation. Here we performed TSS mapping of the translatome following energy stress. Assessing the contribution of cap-proximal TSS nucleotides, we found dramatic effect on translation only upon stress. As eIF4E levels were reduced, we determined its binding to capped-RNAs with different initiating nucleotides and found the lowest affinity to 5'cytidine in correlation with the translational stress-response. In addition, the number of differentially translated APs was elevated following stress. These include novel glucose starvation-induced downstream transcripts for the translation regulators eIF4A and Pabp, which are also translationally-induced despite general translational inhibition. The resultant eIF4A protein is N-terminally truncated and acts as eIF4A inhibitor. The induced Pabp isoform has shorter 5'UTR removing an auto-inhibitory element. Our findings uncovered several levels of coordination of transcription and translation responses to energy stress.
Partial DNA-guided Cas9 enables genome editing with reduced off-target activity
Yin, Hao; Song, Chun-Qing; Suresh, Sneha; Kwan, Suet-Yan; Wu, Qiongqiong; Walsh, Stephen; Ding, Junmei; Bogorad, Roman L; Zhu, Lihua Julie; Wolfe, Scot A; Koteliansky, Victor; Xue, Wen; Langer, Robert; Anderson, Daniel G
2018-01-01
CRISPR–Cas9 is a versatile RNA-guided genome editing tool. Here we demonstrate that partial replacement of RNA nucleotides with DNA nucleotides in CRISPR RNA (crRNA) enables efficient gene editing in human cells. This strategy of partial DNA replacement retains on-target activity when used with both crRNA and sgRNA, as well as with multiple guide sequences. Partial DNA replacement also works for crRNA of Cpf1, another CRISPR system. We find that partial DNA replacement in the guide sequence significantly reduces off-target genome editing through focused analysis of off-target cleavage, measurement of mismatch tolerance and genome-wide profiling of off-target sites. Using the structure of the Cas9–sgRNA complex as a guide, the majority of the 3′ end of crRNA can be replaced with DNA nucleotide, and the 5 - and 3′-DNA-replaced crRNA enables efficient genome editing. Cas9 guided by a DNA–RNA chimera may provide a generalized strategy to reduce both the cost and the off-target genome editing in human cells. PMID:29377001
Iron from haemoglobin and haemin modulates nucleotide hydrolysis in Trichomonas vaginalis.
Vieira, Patrícia de Brum; Silva, Nícolas Luiz Feijó; Kist, Luiza Wilges; Oliveira, Giovanna Medeiros Tavares de; Bogo, Maurício Reis; Carli, Geraldo Atillio de; Macedo, Alexandre José; Tasca, Tiana
2015-04-01
Extracellular ATP may act as a danger signalling molecule, inducing inflammation and immune responses in infection sites. The ectonucleotidases NTPDase and ecto-5'-nucleotidase are enzymes that modulate extracellular nucleotide levels; these enzymes have been previously characterised in Trichomonas vaginalis. Iron plays an important role in the complex trichomonal pathogenesis. Herein, the effects of iron on growth, nucleotide hydrolysis and NTPDase gene expression in T. vaginalis isolates from female and male patients were evaluated. Iron from different sources sustained T. vaginalis growth. Importantly, iron from haemoglobin (HB) and haemin (HM) enhanced NTPDase activity in isolates from female patients and conversely reduced the enzyme activity in isolates from male patients. Iron treatments could not alter the NTPDase transcript levels in T. vaginalis. Furthermore, our results reveal a distinct ATP, ADP and AMP hydrolysis profile between isolates from female and male patients influenced by iron from HB and HM. Our data indicate the participation of NTPDase and ecto-5'-nucleotidase in the establishment of trichomonas infection through ATP degradation and adenosine production influenced by iron.
Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures.
Kirillova, Svetlana; Carugo, Oliviero
2011-10-19
Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs.
Mechanism of mismatch recognition revealed by human MutSβ bound to unpaired DNA loops
Gupta, Shikha; Gellert, Martin; Yang, Wei
2011-01-01
DNA mismatch repair corrects replication errors, thus reducing mutation rates and microsatellite instability. Genetic defects in this pathway cause Lynch Syndrome and various cancers in humans. Binding of a mispaired or unpaired base by bacterial MutS and eukaryotic MutSα is well characterized. We report here crystal structures of human MutSβ complexed with DNA containing insertion-deletion loops (IDL) of 2, 3, 4, or 6 unpaired nucleotides. In contrast to eukaryotic MutSα and bacterial MutS, which bind the base of a mismatched nucleotide, MutSβ binds three phosphates in an IDL. DNA is severely bent at the IDL; unpaired bases are flipped out into the major groove and partially exposed to solvent. A normal downstream basepair can become unpaired; thereby a single unpaired base can be converted to an IDL of 2 nucleotides and recognized by MutSβ. The C-terminal dimerization domains form an integral part of the MutS structure and coordinate asymmetrical ATP hydrolysis by Msh2 and Msh3 with mismatch binding to signal for repair. PMID:22179786
Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures
2011-01-01
Background Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. Results A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. Conclusions The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs. PMID:22011380
Worrell, V E; Nagle, D P
1990-01-01
The enzymes involved in the purine interconversion pathway of wild-type and purine analog-resistant strains of Methanobacterium thermoautotrophicum Marburg were assayed by radiometric and spectrophotometric methods. Wild-type cells incorporated labeled adenine, guanine, and hypoxanthine, whereas mutant strains varied in their ability to incorporate these bases. Adenine, guanine, hypoxanthine, and xanthine were activated by phosphoribosyltransferase activities present in wild-type cell extracts. Some mutant strains simultaneously lost the ability to convert both guanine and hypoxanthine to the respective nucleotide, suggesting that the same enzyme activates both bases. Adenosine, guanosine, and inosine phosphorylase activities were detected for the conversion of base to nucleoside. Adenine deaminase activity was detected at low levels. Guanine deaminase activity was not detected. Nucleoside kinase activities for the conversion of adenosine, guanosine, and inosine to the respective nucleotides were detected by a new assay. The nucleotide-interconverting enzymes AMP deaminase, succinyl-AMP synthetase, succinyl-AMP lyase, IMP dehydrogenase, and GMP synthetase were present in extracts; GMP reductase was not detected. The results indicate that this autotrophic methanogen has a complex system for the utilization of exogenous purines. PMID:2345148
Lee, Kang-Hoon; Lee, Young-Kwan; Kwon, Deug-Nam; Chiu, Sophia; Chew, Victoria; Rah, Hyungchul; Kujawski, Gregory; Melhem, Ramzi; Hsu, Karen; Chung, Cecilia; Greenhalgh, David G; Cho, Kiho
2011-06-01
Approximately 2% of the human genome is reported to be occupied by genes. Various forms of repetitive elements (REs), both characterized and uncharacterized, are presumed to make up the vast majority of the rest of the genomes of human and other species. In conjunction with a comprehensive annotation of genes, information regarding components of genome biology, such as gene polymorphisms, non-coding RNAs, and certain REs, is found in human genome databases. However, the genome-wide profile of unique RE arrangements formed by different groups of REs has not been fully characterized yet. In this study, the entire human genome was subjected to an unbiased RE survey to establish a whole-genome profile of REs and their arrangements. Due to the limitation in query size within the bl2seq alignment program (National Center for Biotechnology Information [NCBI]) utilized for the RE survey, the entire NCBI reference human genome was fragmented into 6206 units of 0.5M nucleotides. A number of RE arrangements with varying complexities and patterns were identified throughout the genome. Each chromosome had unique profiles of RE arrangements and density, and high levels of RE density were measured near the centromere regions. Subsequently, 175 complex RE arrangements, which were selected throughout the genome, were subjected to a comparison analysis using five different human genome sequences. Interestingly, three of the five human genome databases shared the exactly same arrangement patterns and sequences for all 175 RE arrangement regions (a total of 12,765,625 nucleotides). The findings from this study demonstrate that a substantial fraction of REs in the human genome are clustered into various forms of ordered structures. Further investigations are needed to examine whether some of these ordered RE arrangements contribute to the human pathobiology as a functional genome unit. Copyright © 2011 Elsevier Inc. All rights reserved.
Effect of pH on uranium(VI) biosorption and biomineralization by Saccharomyces cerevisiae.
Zheng, X Y; Shen, Y H; Wang, X Y; Wang, T S
2018-07-01
Biosorption of radionuclides by microorganisms is a promising and effective method for the remediation of contaminated areas. pH is the most important factor during uranium biosorption by Saccharomyces cerevisiae because the pH value not only affects the biosorption rate but also affects the precipitation structure. This study investigated the effect of pH on uranium (VI) biosorption and biomineralization by S. cerevisiae. Cells have the ability to buffer the solution to neutral, allowing the biosorption system to reach an optimal level regardless of the initial pH value. This occurs because there is a release of phosphate and ammonium ions during the interaction between cells and uranium. The uranyl and phosphate ions formed nano-particles, which is chernikovite H 2 (UO 2 ) 2 (PO 4 ) 2 ·8H 2 O (PDF #08-0296), on cell surface under the initial acidic conditions. However, under the initial alkaline conditions, the uranyl, phosphate and ammonium ions formed a large amount of scale-like precipitation, which is uramphite (NH 4 )(UO 2 )PO 4 ·3H 2 O (PDF #42-0384), evenly over on cell surface. Copyright © 2018 Elsevier Ltd. All rights reserved.
Synthesis and characterization of an N-(2-hydroxyethyl)-ethylenediaminetriacetic acid resin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lai, Yuet Fan
1977-10-01
A chelating ion-exchange resin with N-(2-hydroxyethyl)ethylene-diaminetriacetic acid (HEDTA) used as the ligand chemically bonded to XAD-4 by an ester linkage, HEDTA-4, was synthesized. It is stable under normal experimental conditions with the liquid chromatograph. The structure of the resin was confirmed by an infrared spectrum, and by potentiometric titrations. The capacity of the resin was also obtained by potentiometric titration and by a nitrogen analysis. The resin was used to pack a column of 5 mm internal diameter and 5 cm long. The effect of pH on the retention of different metal ions on the resin was studied. It wasmore » found that the resin was most selective for chromium(III), copper(II), lead(II), mercury(II), uranium(VI), zirconium(IV) and zinc(II) at a pH of less than 3. Furthermore, the resin proves to be functioning with a chelating mechanism rather than ion-exchange, and it can concentrate trace metal ions in the presence of a large excess of calcium and magnesium. This makes the resin potentially useful for purifying and analyzing drinking water.« less
Polovov, Ilya B; Volkovich, Vladimir A; Charnock, John M; Kralj, Brett; Lewin, Robert G; Kinoshita, Hajime; May, Iain; Sharrad, Clint A
2008-09-01
Soluble uranium chloride species, in the oxidation states of III+, IV+, V+, and VI+, have been chemically generated in high-temperature alkali chloride melts. These reactions were monitored by in situ electronic absorption spectroscopy. In situ X-ray absorption spectroscopy of uranium(VI) in a molten LiCl-KCl eutectic was used to determine the immediate coordination environment about the uranium. The dominant species in the melt was [UO 2Cl 4] (2-). Further analysis of the extended X-ray absorption fine structure data and Raman spectroscopy of the melts quenched back to room temperature indicated the possibility of ordering beyond the first coordination sphere of [UO 2Cl 4] (2-). The electrolytic generation of uranium(III) in a molten LiCl-KCl eutectic was also investigated. Anodic dissolution of uranium metal was found to be more efficient at producing uranium(III) in high-temperature melts than the cathodic reduction of uranium(IV). These high-temperature electrolytic processes were studied by in situ electronic absorption spectroelectrochemistry, and we have also developed in situ X-ray absorption spectroelectrochemistry techniques to probe both the uranium oxidation state and the uranium coordination environment in these melts.
Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen
2017-04-01
In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.
O'Keeffe, Mary G; Thorne, Peter R; Housley, Gary D; Robson, Simon C; Vlajkovic, Srdjan M
2012-01-01
A complex extracellular nucleotide signalling system acting on P2 receptors is involved in regulation of cochlear function in the mammalian inner ear. Ectonucleoside triphosphate diphosphohydrolases (E-NTPDases) are ectonucleotidases that regulate P2 receptor signalling pathways in mammalian tissues by hydrolysing extracellular nucleotides to the respective nucleosides. All enzymes from the CD39/ENTPD family (NTPDase1-8) are expressed in the adult rat cochlea, but their expression and distribution in the vestibular end organ is unknown. This report demonstrates selective expression of NTPDase6 by rat vestibular hair cells. Hair cells transducing both angular acceleration (crista ampullaris) and static head position (maculae of the utricle and saccule) exhibited strong immunolabelling with a bias towards the sensory pole and in particular, the hair cell bundle. NTPDase6 is an intracellular enzyme that can be released in a soluble form from cell cultures and shows an enzymatic preference for nucleoside 5'-diphosphates, such as guanosine 5'-diphosphate (GDP) and uridine 5'-diphosphate (UDP). The main function of NTPDase6 may be the regulation of nucleotide levels in cellular organelles by regulating the conversion of nucleotides to nucleosides. NTPDase6 immunolocalisation in the vestibular end organ could be linked to the regulation of P2 receptor signalling and sensory transduction, including maintenance of vestibular hair bundles.
Shapiro, A D; Pfeffer, S R
1995-05-12
Rab9 is a Ras-like GTPase required for the transport of mannose 6-phosphate receptors between late endosomes and the trans Golgi network. Rab9 occurs in the cytosol as a complex with GDP dissociation inhibitor (GDI), which we have shown delivers prenyl Rab9 to late endosomes in a functional form. We report here basal rate constants for guanine nucleotide dissociation and GTP hydrolysis for prenyl Rab9. Both rate constants were influenced in part by the hydrophobic environment of the prenyl group. Guanine nucleotide dissociation and GTP hydrolysis rates were lower in the presence of lipid; detergent stimulated intrinsic nucleotide exchange. GDI-alpha inhibited GDP dissociation from prenyl Rab9 by 2.4-fold. GDI-alpha associated with prenyl Rab9 with a KD of 60 nM in 0.1% Lubrol and 23 nM in 0.02% Lubrol. In 0.1% Lubrol, GDI-alpha inhibited GDP dissociation half maximally at 72 +/- 18 nM, consistent with the KD determinations. These data suggest that GDI-alpha associates with prenyl Rab9 with a KD of < or = 23 nM under physiological conditions. Finally, a previously uncharacterized minor form of GDI-alpha inhibited GDP dissociation from prenyl Rab9 by 1.9-fold and bound prenyl Rab9 with a KD of 67 nM in 0.1% Lubrol.
Burns, Michael C; Howes, Jennifer E; Sun, Qi; Little, Andrew J; Camper, DeMarco V; Abbott, Jason R; Phan, Jason; Lee, Taekyu; Waterson, Alex G; Rossanese, Olivia W; Fesik, Stephen W
2018-05-01
K-RAS is mutated in approximately 30% of human cancers, resulting in increased RAS signaling and tumor growth. Thus, RAS is a highly validated therapeutic target, especially in tumors of the pancreas, lung and colon. Although directly targeting RAS has proven to be challenging, it may be possible to target other proteins involved in RAS signaling, such as the guanine nucleotide exchange factor Son of Sevenless (SOS). We have previously reported on the discovery of small molecules that bind to SOS1, activate SOS-mediated nucleotide exchange on RAS, and paradoxically inhibit ERK phosphorylation (Burns et al., PNAS, 2014). Here, we describe the discovery of additional, structurally diverse small molecules that also bind to SOS1 in the same pocket and elicit similar biological effects. We tested >160,000 compounds in a fluorescence-based assay to assess their effects on SOS-mediated nucleotide exchange. X-Ray structures revealed that these small molecules bind to the CDC25 domain of SOS1. Compounds that elicited high levels of nucleotide exchange activity in vitro increased RAS-GTP levels in cells, and inhibited phospho ERK levels at higher treatment concentrations. The identification of structurally diverse SOS1 binding ligands may assist in the discovery of new molecules designed to target RAS-driven tumors. Copyright © 2018 Elsevier Inc. All rights reserved.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
NASA Astrophysics Data System (ADS)
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Demonstration of a Specific Escherichia coli SecY–Signal Peptide Interaction†
Wang, Ligong; Miller, Alexander; Rusch, Sharyn L.; Kendall, Debra A.
2011-01-01
Protein translocation in Escherichia coli is initiated by the interaction of a preprotein with the membrane translocase composed of a motor protein, SecA ATPase, and a membrane-embedded channel, the SecYEG complex. The extent to which the signal peptide region of the preprotein plays a role in SecYEG interactions is unclear, in part because studies in this area typically employ the entire preprotein. Using a synthetic signal peptide harboring a photoaffinity label in its hydrophobic core, we examined this interaction with SecYEG in a detergent micellar environment. The signal peptide was found to specifically bind SecY in a saturable manner and at levels comparable to those that stimulate SecA ATPase activity. Chemical and proteolytic cleavage of cross-linked SecY and analysis of the signal peptide adducts indicate that the binding was primarily to regions of the protein containing transmembrane domains seven and two. The signal peptide–SecY interaction was affected by the presence of SecA and nucleotides in a manner consistent with the transfer of signal peptide to SecY upon nucleotide hydrolysis at SecA. PMID:15476412
Larsen, Jesper; Soldanova, Katerina; Aziz, Maliha; Contente-Cuomo, Tania; Petersen, Andreas; Vandendriessche, Stien; Jiménez, Judy N.; Mammina, Caterina; van Belkum, Alex; Salmenlinna, Saara; Laurent, Frederic; Skov, Robert L.; Larsen, Anders R.; Andersen, Paal S.; Price, Lance B.
2013-01-01
Staphylococcus aureus clonal complex 398 (CC398) isolates cluster into two distinct phylogenetic clades based on single-nucleotide polymorphisms (SNPs) revealing a basal human clade and a more derived livestock clade. The scn and tet(M) genes are strongly associated with the human and the livestock clade, respectively, due to loss and acquisition of mobile genetic elements. We present canonical single-nucleotide polymorphism (canSNP) assays that differentiate the two major host-associated S. aureus CC398 clades and a duplex PCR assay for detection of scn and tet(M). The canSNP assays correctly placed 88 S. aureus CC398 isolates from a reference collection into the human and livestock clades and the duplex PCR assay correctly identified scn and tet(M). The assays were successfully applied to a geographically diverse collection of 272 human S. aureus CC398 isolates. The simple assays described here generate signals comparable to a whole-genome phylogeny for major clade assignment and are easily integrated into S. aureus CC398 surveillance programs and epidemiological studies. PMID:24244535
Electrical detection and quantification of single and mixed DNA nucleotides in suspension
NASA Astrophysics Data System (ADS)
Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah
2016-09-01
High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.
Co-circulation of a novel phlebovirus and Massilia virus in sandflies, Portugal.
Amaro, Fátima; Zé-Zé, Líbia; Alves, Maria J; Börstler, Jessica; Clos, Joachim; Lorenzen, Stephan; Becker, Stefanie Christine; Schmidt-Chanasit, Jonas; Cadar, Daniel
2015-10-24
In Portugal, entomological surveys to detect phleboviruses in their natural vectors have not been performed so far. Thus, the aims of the present study were to detect, isolate and characterize phleboviruses in sandfly populations of Portugal. From May to October 2007-2008, 896 female sandflies were trapped in Arrábida region, located on the southwest coast of Portugal. Phlebovirus RNA was detected by using a pan-phlebovirus RT-PCR in 4 out of 34 Phlebotomus perniciosus pools. Direct sequencing of the amplicons showed that 2 samples exhibited 72 % nucleotide identity with Arbia virus, and two showed 96 % nucleotide identity with Massilia virus. The Arbia-like virus (named Alcube virus) was isolated in cell culture and complete genomic sequences of one Alcube and two Massila viruses were determined using next-generation sequencing technology. Phylogenetic analysis demonstrated that Alcube virus clustered with members of the Salehabad virus species complex. Within this clade, Alcube virus forms a monophyletic lineage with the Arbia, Salehabad and Adana viruses sharing a common ancestor. Arbia virus has been identified as the most closely related virus with 20-28 % nucleotide and 10-27 % amino acid divergences depending on the analysed segment. We have provided genetic evidence for the circulation of a novel phlebovirus species named Alcube virus in Ph. perniciosus and co-circulation of Massilia virus, in Arrábida region, southwest of Portugal. Further epidemiological investigations and surveillance for sandfly-borne phleboviruses in Portugal are needed to elucidate their medical importance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meissner, Torsten B.; Department of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02215; Li, Amy
Highlights: Black-Right-Pointing-Pointer NLRC5 requires an intact NLS for its function as MHC class I transactivator. Black-Right-Pointing-Pointer Nuclear presence of NLRC5 is required for MHC class I induction. Black-Right-Pointing-Pointer Nucleotide-binding controls nuclear import and transactivation activity of NLRC5. -- Abstract: Major histocompatibility complex (MHC) class I and class II are crucial for the function of the human adaptive immune system. A member of the NLR (nucleotide-binding domain, leucine-rich repeat) protein family, NLRC5, has recently been identified as a transcriptional regulator of MHC class I and related genes. While a 'master regulator' of MHC class II genes, CIITA, has long been known,more » NLRC5 specifically associates with and transactivates the proximal promoters of MHC class I genes. In this study, we analyzed the molecular requirements of NLRC5 nuclear import and transactivation activity. We show that NLRC5-mediated MHC class I gene induction requires an intact nuclear localization signal and nuclear distribution of NLRC5. In addition, we find that the nucleotide-binding domain (NBD) of NLRC5 is critical not only for nuclear translocation but also for the transactivation of MHC class I genes. Changing the cellular localization of NLRC5 is likely to immediately impact MHC class I expression as well as MHC class I-mediated antigen presentation. NLRC5 may thus provide a promising target for the modulation of MHC class I antigen presentation, especially in the setting of transplant medicine.« less
de Kloet, E; de Kloet, S R
2004-12-01
A study was made of the phylogenetic relationships between fifteen complete nucleotide sequences as well as 43 nucleotide sequences of the putative coat protein gene of different strains belonging to the virus species Beak and feather disease virus obtained from 39 individuals of 16 psittacine species. The species included among others, cockatoos ( Cacatuini), African grey parrots ( Psittacus erithacus) and peach-faced lovebirds ( Agapornis roseicollis), which were infected at different geographical locations, within and outside Australia, the native origin of the virus. The derived amino acid sequences of the putative coat protein were highly diverse, with differences between some strains amounting to 50 of the 250 amino acids. Phylogenetic analysis demonstrated that the putative coat gene sequences form six clusters which show a varying degree of psittacine species specificity. Most, but not all strains infecting African grey parrots formed a single cluster as did the strains infecting the cockatoos. Strains infecting the lovebirds clustered with those infecting such Australasian species as Eclectus roratus, Psittacula kramerii and Psephotus haematogaster. Although individual birds included in this study were, where studied, often infected by closely related strains, infection by highly diverged trains was also detected. The possible relationship between BFD viral strains and clinical disease signs is discussed.
Smola, Matthew J.; Rice, Greggory M.; Busan, Steven; Siegfried, Nathan A.; Weeks, Kevin M.
2016-01-01
SHAPE chemistries exploit small electrophilic reagents that react with the 2′-hydroxyl group to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues based on the ability of reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as for simple model RNAs. This protocol describes the experimental steps, implemented over three days, required to perform SHAPE probing and construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. These steps include RNA folding and SHAPE structure probing, mutational profiling by reverse transcription, library construction, and sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots, and provides useful troubleshooting information, often within an hour. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures, and visualize probable and alternative helices, often in under a day. We illustrate these algorithms with the E. coli thiamine pyrophosphate riboswitch, E. coli 16S rRNA, and HIV-1 genomic RNAs. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles, and entire transcriptomes. The straightforward MaP strategy greatly expands the number, length, and complexity of analyzable RNA structures. PMID:26426499