Purification and molecular cloning of aspartic proteinases from the stomach of adult Japanese fire belly newts, Cynops pyrrhogaster.

PubMed

Nagasawa, Tatsuki; Sano, Kaori; Kawaguchi, Mari; Kobayashi, Ken-Ichiro; Yasumasu, Shigeki; Inokuchi, Tomofumi

2016-04-01

Six aspartic proteinase precursors, a pro-cathepsin E (ProCatE) and five pepsinogens (Pgs), were purified from the stomach of adult newts (Cynops pyrrhogaster). On sodium dodecylsulfate-polyacrylamide gel electrophoresis, the molecular weights of the Pgs and active enzymes were 37-38 kDa and 31-34 kDa, respectively. The purified ProCatE was a dimer whose subunits were connected by a disulphide bond. cDNA cloning by polymerase chain reaction and subsequent phylogenetic analysis revealed that three of the purified Pgs were classified as PgA and the remaining two were classified as PgBC belonging to C-type Pg. Our results suggest that PgBC is one of the major constituents of acid protease in the urodele stomach. We hypothesize that PgBC is an amphibian-specific Pg that diverged during its evolutional lineage. PgBC was purified and characterized for the first time. The purified urodele pepsin A was completely inhibited by equal molar units of pepstatin A. Conversely, the urodele pepsin BC had low sensitivity to pepstatin A. In acidic condition, the activation rates of newt pepsin A and BC were similar to those of mammalian pepsin A and C1, respectively. Our results suggest that the enzymological characters that distinguish A- and C-type pepsins appear to be conserved in mammals and amphibians. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Immunocytochemical characterisation of ensheathing glia in the olfactory and vomeronasal systems of Ambystoma mexicanum (Caudata: Ambystomatidae).

PubMed

Lazzari, Maurizio; Bettini, Simone; Franceschini, Valeria

2016-03-01

The olfactory and vomeronasal systems of vertebrates are characterised by neurogenesis occurring throughout life. The regenerative ability of olfactory receptor neurons relies on specific glial cells, the olfactory and vomeronasal axon-surrounding cells. Numerous studies have examined mammalian olfactory ensheathing cells which are considered potential candidates for spinal cord injury repair using cell-based therapy. With regard to non-mammalian vertebrates, limited information is available on these glial cells in fish, and there is no information on them in terrestrial anamniotes, the amphibians. In the present research, we studied the immunocytochemical characteristics of axon-surrounding cells in Ambystoma mexicanum. Urodeles have relatively simple olfactory and vomeronasal systems, and represent a good model for studying ensheathing cells in extant representatives of basal tetrapods. Sections from the decalcified heads of A. mexicanum were immunocytochemically processed for the detection of proteins used in research on mammalian olfactory-ensheathing cells. S100, GFAP and NCAM were clearly observed. p75NTR, Gal-1 and PSA-NCAM showed weak staining. No vimentin immunopositivity was observed. The corresponding areas of the olfactory and vomeronasal pathways displayed the same staining characteristics, with the exception of Gal-1, p75NTR and PSA-NCAM in the mucosae. The degree of marker expression was not uniform throughout the sensory pathways. In contrast to fish, both olfactory and vomeronasal nerves displayed uniform staining intensity. This study showed that some markers for mammalian and fish-ensheathing glia are also applicable in urodeles. The olfactory systems of vertebrates show similarities, and also clear dissimilarities. Further investigations are required to ascertain the functional significance of these regional and interspecific differences.

Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.

PubMed

Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K

2010-12-01

Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.

The p53 breast cancer tissue biomarker in Indian women

PubMed Central

Patil, Vinayak W; Tayade, Mukund B; Pingale, Sangeeta A; Dalvi, Shubhangi M; Rajekar, Rajesh B; Deshmukh, Hemkant M; Patil, Shital D; Singhai, Rajeev

2011-01-01

Background Combination chemotherapy is highly effective in locally advanced breast cancer. A negative expression of biomarker p53 indicates a higher chance of responding to this regimen. Patients’ p53 status may be used as a biological cancer marker to identify those who would benefit from more aggressive treatments. Aims The role of p53 in modulating apoptosis has suggested that it may affect the efficacy of anticancer agents. p53 alterations in 80 patients with locally advanced breast cancer IIIB undergoing neoadjuvant chemotherapy were prospectively evaluated. Materials and methods Patients received three cycles of paclitaxel (175 mg/m2) and doxorubicin (60 mg/m2) every 21 days. Tumor sections were analyzed before treatment for altered patterns of p53 expression, using immunohistochemistry and DNA sequencing. Results An overall response rate of 83.5% was obtained, including 15.1% complete pathological responses. The regimen was well tolerated with 17.7% grade 2/3 nausea and 12.8% grade 3/4 leukopenia. There was a statistically significant correlation between response and expression of p53. Of 25 patients who obtained a complete clinical response, only two were classified as p53-positive (P = 0.004, χ2). Of 11 patients who obtained a complete pathological remission, one was positive (P = 0.099, χ2). Conclusion Immunohistochemical (IHC) analysis has been shown to be a prognostic factor for patients with breast cancer in India. Paclitaxel is one of the most promising anticancer agents for the therapy of breast cancer, where it has also shown activity in tumors resistant to doxorubicin. PMID:24367177

SAR405838: An optimized inhibitor of MDM2-p53 interaction that induces complete and durable tumor regression

DOE PAGES

Wang, Shaomeng; Sun, Wei; Zhao, Yujun; ...

2014-08-21

Blocking the MDM2-p53 protein-protein interaction has long been considered to offer a broad cancer therapeutic strategy, despite the potential risks of selecting tumors harboring p53 mutations that escape MDM2 control. In this study, we report a novel small molecule inhibitor of the MDM2-p53 interaction, SAR405838 (MI-77301) that has been advanced into Phase I clinical trials. SAR405838 binds to MDM2 with K i = 0.88 nM and has high specificity over other proteins. A co-crystal structure of the SAR405838:MDM2 complex shows that in addition to mimicking three key p53 amino acid residues, the inhibitor captures additional interactions not observed in themore » p53-MDM2 complex and induces refolding of the short, unstructured MDM2 N-terminal region to achieve its high affinity. SAR405838 effectively activates wild-type p53 in vitro and in xenograft tumor tissue of leukemia and solid tumors, leading to p53-dependent cell cycle arrest and/or apoptosis. At well-tolerated dose schedules, SAR405838 achieves either durable tumor regression or complete tumor growth inhibition in mouse xenograft models of SJSA-1 osteosarcoma, RS4;11 acute leukemia, LNCaP prostate cancer and HCT-116 colon cancer. Remarkably, a single oral dose of SAR405838 is sufficient to achieve complete tumor regression in the SJSA-1 model. Mechanistically, robust transcriptional up-regulation of PUMA induced by SAR405838 results in strong apoptosis in tumor tissue, leading to complete tumor regression. Lastly, our findings provide a preclinical basis upon which to evaluate SAR405838 as a therapeutic agent in patients whose tumors retain wild-type p53.« less

Relationship between cold pressor pain-sensitivity and sleep quality in opioid-dependent males on methadone treatment

PubMed Central

Lee, Chee Siong; Tan, Soo Choon; Mohamad, Nasir; Lee, Yeong Yeh; Ismail, Rusli

2015-01-01

Aim. Poor sleep quality due to pain has been reported among opioid-dependent male patients on methadone maintenance therapy (MMT) but objective pain data are lacking. This study aimed to investigate the rate of pain-sensitivity using cold pressor test (CPT) and the relationship between pain-sensitivity and sleep quality in this population. Methods. A total of 168 male participants were included into the study. Objective pain-tolerance was evaluated at 0 h and at 24 h after the first CPT. Malay version of the Pittsburgh Sleep Quality Index (PSQI) and the subjective opiate withdrawal scale (SOWS) questionnaires were administered to evaluate the quality of sleep and withdrawal symptoms, respectively. Results. The mean age of study participants was 37.22 (SD 6.20) years old. Mean daily methadone dose was 76.64 (SD 37.63) mg/day, mean global PSQI score was 5.47 (SD 2.74) and mean averaged SOWS score was 5.43 (SD 6.91). The averaged pain-tolerance time ranged from 7 to 300 s with a mean time of 32.16 (SE 2.72) s, slightly below the cut-off score of 37.53 s. More specifically, 78.6% (n = 132) of participants were identified as pain-sensitive (averaged pain-tolerance time ≤37.53 s), and 36 (21.4%) participants were pain-tolerant (averaged pain-tolerance time >37.53 s). The pain-sensitive group reported poorer sleep quality with mean (SD) PSQI of 5.78 (2.80) compared with the pain-tolerant group with mean (SD) PSQI of 4.31 (2.18) (p = 0.005). With analysis of covariance, pain-sensitive group was found to have higher global PSQI scores (adjusted mean 5.76, 95% CI 5.29; 6.22) than pain-tolerant participants (adjusted mean 4.42, 95% CI 3.52; 5.32) (p = 0.010). Conclusions. Majority of opioid-dependent male patients on methadone treatment are pain-sensitive with CPT. Poor sleep quality is associated with cold pressor pain-sensitivity. Pain and sleep complaints in this male population should not be overlooked. PMID:25870765

Functional diversity of voltage-sensing phosphatases in two urodele amphibians.

PubMed

Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi

2014-07-16

Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

A comparison between the minimal model and the glucose clamp in the assessment of insulin sensitivity across the spectrum of glucose tolerance. Insulin Resistance Atherosclerosis Study.

PubMed

Saad, M F; Anderson, R L; Laws, A; Watanabe, R M; Kades, W W; Chen, Y D; Sands, R E; Pei, D; Savage, P J; Bergman, R N

1994-09-01

An insulin-modified frequently sampled intravenous glucose tolerance test (FSIGTT) with minimal model analysis was compared with the glucose clamp in 11 subjects with normal glucose tolerance (NGT), 20 with impaired glucose tolerance (IGT), and 24 with non-insulin-dependent diabetes mellitus (NIDDM). The insulin sensitivity index (SI) was calculated from FSIGTT using 22- and 12-sample protocols (SI(22) and SI(12), respectively). Insulin sensitivity from the clamp was expressed as SI(clamp) and SIP(clamp). Minimal model parameters were similar when calculated with SI(22) and SI(12). SI could not be distinguished from 0 in approximately 50% of diabetic patients with either protocol. SI(22) correlated significantly with SI(clamp) in the whole group (r = 0.62), and in the NGT (r = 0.53), IGT (r = 0.48), and NIDDM (r = 0.41) groups (P < 0.05 for each). SI(12) correlated significantly with SI(clamp) in the whole group (r = 0.55, P < 0.001) and in the NGT (r = 0.53, P = 0.046) and IGT (r = 0.58, P = 0.008) but not NIDDM (r = 0.30, P = 0.085) groups. When SI(22), SI(clamp), and SIP(clamp) were expressed in the same units, SI(22) was 66 +/- 5% (mean +/- SE) and 50 +/- 8% lower than SI(clamp) and SIP(clamp), respectively. Thus, minimal model analysis of the insulin-modified FSIGTT provides estimates of insulin sensitivity that correlate significantly with those from the glucose clamp. The correlation was weaker, however, in NIDDM. The insulin-modified FSIGTT can be used as a simple test for assessment of insulin sensitivity in population studies involving nondiabetic subjects. Additional studies are needed before using this test routinely in patients with NIDDM.

Epimorphic regeneration approach to tissue replacement in adult mammals

USDA-ARS?s Scientific Manuscript database

Urodeles and fetal mammals are capable of impressive epimorphic regeneration in a variety of tissues, whereas the typical default response to injury in adult mammals consists of inflammation and scar tissue formation. One component of epimorphic regeneration is the recruitment of resident progenitor...

Incomplete antibodies and immunoglobulin characterization in adult urodeles, Pleurodeles waltlii Michah. and Triturus alpestris Laur.

PubMed Central

Tournefier, A

1975-01-01

Humoral immunoglobulin synthesis has been studied in two adult urodeles, Pleurodeles waltlii Michah. and Triturus alpestris Laur. following SRBC immunization. The specific antibody response is detected after a long period of immunization and is due exclusively to 'incomplete' antibodies which are unable to induce agglutination. The antibody titre is essentially dependent on the number of stimulations rather than on the dose or nature of the antigen (papainized or normal erythrocytes). Antibodies are detected in only 50 per cent of the immunized animals, 50 per cent never respond. This suggests that the latter group does not possess the genetic equipment (Ir genes) to recognize the antigenic determinants and to synthesize the corresponding antibodies. The sedimentation coefficient of the synthesized immunoglobulins was investigated by sucrose density gradient centrifugation and their characterization was carried out by starch and polyacrylamide gel electrophoresis. With this peculiar antigen even after a booster injection, only one class of immunoglobulin, an 18-2S IgM could be detected. PMID:49296

Mechanisms of urodele limb regeneration

PubMed Central

2017-01-01

Abstract This review explores the historical and current state of our knowledge about urodele limb regeneration. Topics discussed are (1) blastema formation by the proteolytic histolysis of limb tissues to release resident stem cells and mononucleate cells that undergo dedifferentiation, cell cycle entry and accumulation under the apical epidermal cap. (2) The origin, phenotypic memory, and positional memory of blastema cells. (3) The role played by macrophages in the early events of regeneration. (4) The role of neural and AEC factors and interaction between blastema cells in mitosis and distalization. (5) Models of pattern formation based on the results of axial reversal experiments, experiments on the regeneration of half and double half limbs, and experiments using retinoic acid to alter positional identity of blastema cells. (6) Possible mechanisms of distalization during normal and intercalary regeneration. (7) Is pattern formation is a self‐organizing property of the blastema or dictated by chemical signals from adjacent tissues? (8) What is the future for regenerating a human limb? PMID:29299322

Studies of Ribonucleotide Reductase in Crucian Carp—An Oxygen Dependent Enzyme in an Anoxia Tolerant Vertebrate

PubMed Central

Sandvik, Guro K.; Tomter, Ane B.; Bergan, Jonas; Zoppellaro, Giorgio; Barra, Anne-Laure; Røhr, Åsmund K.; Kolberg, Matthias; Ellefsen, Stian

2012-01-01

The enzyme ribonucleotide reductase (RNR) catalyzes the conversion of ribonucleotides to deoxyribonucleotides, the precursors for DNA. RNR requires a thiyl radical to activate the substrate. In RNR of eukaryotes (class Ia RNR), this radical originates from a tyrosyl radical formed in reaction with oxygen (O2) and a ferrous di-iron center in RNR. The crucian carp (Carassius carassius) is one of very few vertebrates that can tolerate several months completely without oxygen (anoxia), a trait that enables this fish to survive under the ice in small ponds that become anoxic during the winter. Previous studies have found indications of cell division in this fish after 7 days of anoxia. This appears nearly impossible, as DNA synthesis requires the production of new deoxyribonucleotides and therefore active RNR. We have here characterized RNR in crucian carp, to search for adaptations to anoxia. We report the full-length sequences of two paralogs of each of the RNR subunits (R1i, R1ii, R2i, R2ii, p53R2i and p53R2ii), obtained by cloning and sequencing. The mRNA levels of these subunits were measured with quantitative PCR and were generally well maintained in hypoxia and anoxia in heart and brain. We also report maintained or increased mRNA levels of the cell division markers proliferating cell nuclear antigen (PCNA), brain derived neurotrophic factor (BDNF) and Ki67 in anoxic hearts and brains. Electron paramagnetic resonance (EPR) measurements on in vitro expressed crucian carp R2 and p53R2 proteins gave spectra similar to mammalian RNRs, including previously unpublished human and mouse p53R2 EPR spectra. However, the radicals in crucian carp RNR small subunits, especially in the p53R2ii subunit, were very stable at 0°C. A long half-life of the tyrosyl radical during wintertime anoxia could allow for continued cell division in crucian carp. PMID:22916159

Predominant role of DNA polymerase eta and p53-dependent translesion synthesis in the survival of ultraviolet-irradiated human cells.

PubMed

Lerner, Leticia K; Francisco, Guilherme; Soltys, Daniela T; Rocha, Clarissa R R; Quinet, Annabel; Vessoni, Alexandre T; Castro, Ligia P; David, Taynah I P; Bustos, Silvina O; Strauss, Bryan E; Gottifredi, Vanesa; Stary, Anne; Sarasin, Alain; Chammas, Roger; Menck, Carlos F M

2017-02-17

Genome lesions trigger biological responses that help cells manage damaged DNA, improving cell survival. Pol eta is a translesion synthesis (TLS) polymerase that bypasses lesions that block replicative polymerases, avoiding continued stalling of replication forks, which could lead to cell death. p53 also plays an important role in preventing cell death after ultraviolet (UV) light exposure. Intriguingly, we show that p53 does so by favoring translesion DNA synthesis by pol eta. In fact, the p53-dependent induction of pol eta in normal and DNA repair-deficient XP-C human cells after UV exposure has a protective effect on cell survival after challenging UV exposures, which was absent in p53- and Pol H-silenced cells. Viability increase was associated with improved elongation of nascent DNA, indicating the protective effect was due to more efficient lesion bypass by pol eta. This protection was observed in cells proficient or deficient in nucleotide excision repair, suggesting that, from a cell survival perspective, proper bypass of DNA damage can be as relevant as removal. These results indicate p53 controls the induction of pol eta in DNA damaged human cells, resulting in improved TLS and enhancing cell tolerance to DNA damage, which parallels SOS responses in bacteria. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

40 CFR Table E-2 to Subpart E of... - Spectral Energy Distribution and Permitted Tolerance for Conducting Radiative Tests

Code of Federal Regulations, 2010 CFR

2010-07-01

... Permitted Tolerance for Conducting Radiative Tests E Table E-2 to Subpart E of Part 53 Protection of... Reference Methods and Class I and Class II Equivalent Methods for PM2.5 or PM10â2.5 Pt. 53, Subpt. E, Table E-2 Table E-2 to Subpart E of Part 53—Spectral Energy Distribution and Permitted Tolerance for...

Prospective study of the factors associated with poor tolerance to ambulatory colonoscopy under conscious sedation.

PubMed

Grilo-Bensusan, Israel; Herrera Martín, Pablo; Jiménez-Mesa, Remedios; Aguado Álvarez, Valle

2018-04-01

conscious sedation with benzodiazepines and opiates for colonoscopy is a widespread clinical practice. to determine the patient's tolerance to colonoscopy and identify the factors associated with lower tolerance. a prospective, single-center, descriptive study of patients undergoing ambulatory colonoscopy under conscious sedation. The pain was assessed using a visual analogue scale with a score of 0 to 100 and also qualitatively. three hundred patients with a median age of 54 years completed the study (p25-75: 45-64); 138 were men (46%). Tolerance was good in 273 cases (91%). The median value of tolerance was 13 (p25-p75: 4-33). Pain was considered as mild in 215 (71.7%), moderate in 57 (19%) and intense in 28 (9.3%). In the univariate study, greater pain was associated with females, anxiety, the indication for the procedure, the length of time and difficulty of the examination, and the doses of sedatives. In the multivariate study, both the indication (OR 2.92, 95% CI = 1.03-8.2, p < 0.05) and the difficulty of the examination (OR 4.68, 95% CI = 1.6-13.6, p < 0.01) were significant. Complications were found in 16 patients (5.3%), although all of them were insignificant. tolerance of patients undergoing ambulatory colonoscopy under conscious sedation is good in most cases and complications are infrequent and minor. A worse tolerance to the test is associated with women patients, individuals with anxiety prior to colonoscopy, indication, difficult and longer exploration and lower doses of sedatives.

Proliferation zones in the axolotl brain and regeneration of the telencephalon

PubMed Central

2013-01-01

Background Although the brains of lower vertebrates are known to exhibit somewhat limited regeneration after incisional or stab wounds, the Urodele brain exhibits extensive regeneration after massive tissue removal. Discovering whether and how neural progenitor cells that reside in the ventricular zones of Urodeles proliferate to mediate tissue repair in response to injury may produce novel leads for regenerative strategies. Here we show that endogenous neural progenitor cells resident to the ventricular zone of Urodeles spontaneously proliferate, producing progeny that migrate throughout the telencephalon before terminally differentiating into neurons. These progenitor cells appear to be responsible for telencephalon regeneration after tissue removal and their activity may be up-regulated by injury through an olfactory cue. Results There is extensive proliferation of endogenous neural progenitor cells throughout the ventricular zone of the adult axolotl brain. The highest levels are observed in the telencephalon, especially the dorsolateral aspect, and cerebellum. Lower levels are observed in the mesencephalon and rhombencephalon. New cells produced in the ventricular zone migrate laterally, dorsally and ventrally into the surrounding neuronal layer. After migrating from the ventricular zone, the new cells primarily express markers of neuronal differentiative fates. Large-scale telencephalic tissue removal stimulates progenitor cell proliferation in the ventricular zone of the damaged region, followed by proliferation in the tissue that surrounds the healing edges of the wound until the telencephalon has completed regeneration. The proliferative stimulus appears to reside in the olfactory system, because telencephalic regeneration does not occur in the brains of olfactory bulbectomized animals in which the damaged neural tissue simply heals over. Conclusion There is a continual generation of neuronal cells from neural progenitor cells located within the ventricular zone of the axolotl brain. Variable rates of proliferation were detected across brain regions. These neural progenitor cells appear to mediate telencephalic tissue regeneration through an injury-induced olfactory cue. Identification of this cue is our future goal. PMID:23327114

Proliferation zones in the axolotl brain and regeneration of the telencephalon.

PubMed

Maden, Malcolm; Manwell, Laurie A; Ormerod, Brandi K

2013-01-17

Although the brains of lower vertebrates are known to exhibit somewhat limited regeneration after incisional or stab wounds, the Urodele brain exhibits extensive regeneration after massive tissue removal. Discovering whether and how neural progenitor cells that reside in the ventricular zones of Urodeles proliferate to mediate tissue repair in response to injury may produce novel leads for regenerative strategies. Here we show that endogenous neural progenitor cells resident to the ventricular zone of Urodeles spontaneously proliferate, producing progeny that migrate throughout the telencephalon before terminally differentiating into neurons. These progenitor cells appear to be responsible for telencephalon regeneration after tissue removal and their activity may be up-regulated by injury through an olfactory cue. There is extensive proliferation of endogenous neural progenitor cells throughout the ventricular zone of the adult axolotl brain. The highest levels are observed in the telencephalon, especially the dorsolateral aspect, and cerebellum. Lower levels are observed in the mesencephalon and rhombencephalon. New cells produced in the ventricular zone migrate laterally, dorsally and ventrally into the surrounding neuronal layer. After migrating from the ventricular zone, the new cells primarily express markers of neuronal differentiative fates. Large-scale telencephalic tissue removal stimulates progenitor cell proliferation in the ventricular zone of the damaged region, followed by proliferation in the tissue that surrounds the healing edges of the wound until the telencephalon has completed regeneration. The proliferative stimulus appears to reside in the olfactory system, because telencephalic regeneration does not occur in the brains of olfactory bulbectomized animals in which the damaged neural tissue simply heals over. There is a continual generation of neuronal cells from neural progenitor cells located within the ventricular zone of the axolotl brain. Variable rates of proliferation were detected across brain regions. These neural progenitor cells appear to mediate telencephalic tissue regeneration through an injury-induced olfactory cue. Identification of this cue is our future goal.

Expanding Water/Base Tolerant Frustrated Lewis Pair Chemistry to Alkylamines Enables Broad Scope Reductive Aminations

PubMed Central

Fasano, Valerio

2017-01-01

Abstract Lower Lewis acidity boranes demonstrate greater tolerance to combinations of water/strong Brønsted bases than B(C6F5)3, this enables Si−H bond activation by a frustrated Lewis pair (FLP) mechanism to proceed in the presence of H2O/alkylamines. Specifically, BPh3 has improved water tolerance in the presence of alkylamines as the Brønsted acidic adduct H2O–BPh3 does not undergo irreversible deprotonation with aliphatic amines in contrast to H2O–B(C6F5)3. Therefore BPh3 is a catalyst for the reductive amination of aldehydes and ketones with alkylamines using silanes as reductants. A range of amines inaccessible using B(C6F5)3 as catalyst, were accessible by reductive amination catalysed by BPh3 via an operationally simple methodology requiring no purification of BPh3 or reagents/solvent. BPh3 has a complementary reductive amination scope to B(C6F5)3 with the former not an effective catalyst for the reductive amination of arylamines, while the latter is not an effective catalyst for the reductive amination of alkylamines. This disparity is due to the different pK a values of the water–borane adducts and the greater susceptibility of BPh3 species towards protodeboronation. An understanding of the deactivation processes occurring using B(C6F5)3 and BPh3 as reductive amination catalysts led to the identification of a third triarylborane, B(3,5‐Cl2C6H3)3, that has a broader substrate scope being able to catalyse the reductive amination of both aryl and alkyl amines with carbonyls. PMID:27977048

DIETARY BAKED EGG ACCELERATES RESOLUTION OF EGG ALLERGY IN CHILDREN

PubMed Central

Leonard, Stephanie A.; Sampson, Hugh A.; Sicherer, Scott H.; Noone, Sally; Moshier, Erin L.; Godbold, James; Nowak-Wȩgrzyn, Anna

2012-01-01

Background Baked egg is tolerated by a majority of egg-allergic children. Objective To characterize immunologic changes associated with ingestion of baked egg and evaluate the role that baked egg diets plays in the development of tolerance to regular egg. Methods Egg-allergic subjects who tolerated baked egg challenge incorporated baked egg into their diet. Immunologic parameters were measured at follow-up visits. A comparison group strictly avoiding egg was used to evaluate the natural history of the development of tolerance. Results Of the 79 subjects in the intent-to-treat group followed for a median of 37.8 months, 89% now tolerate baked egg and 53% now tolerate regular egg. Of 23 initial baked egg-reactive subjects, 14 (61%) subsequently tolerated baked egg and 6 (26%) now tolerate regular egg. Within the initially baked egg-reactive group, subjects with persistent reactivity to baked egg had higher median baseline egg white (EW)-specific IgE levels (13.5 kUA/L) than those who subsequently tolerated baked egg (4.4 kUA/L; P=0.04) and regular egg (3.1 kUA/L, P=0.05). In subjects ingesting baked egg, EW-induced SPT wheal diameter and EW-, ovalbumin-, and ovomucoid-specific IgE levels decreased significantly, while ovalbumin- and ovomucoid-specific IgG4 levels increased significantly. Subjects in the per-protocol group were 14.6 times more likely to develop regular egg tolerance than subjects in the comparison group (P < 0.0001), and they developed tolerance earlier (median 50.0 versus 78.7 months; P<0.0001). Conclusion Initiation of a baked egg diet accelerates the development of regular egg tolerance compared to strict avoidance. Higher serum EW-specific IgE level is associated with persistent baked and regular egg reactivity, while initial baked egg reactivity is not. PMID:22846751

Dietary baked egg accelerates resolution of egg allergy in children.

PubMed

Leonard, Stephanie A; Sampson, Hugh A; Sicherer, Scott H; Noone, Sally; Moshier, Erin L; Godbold, James; Nowak-Węgrzyn, Anna

2012-08-01

Baked egg is tolerated by a majority of egg-allergic children. To characterize immunologic changes associated with ingestion of baked egg and evaluate the role that baked egg diets play in the development of tolerance to regular egg. Egg-allergic subjects who tolerated baked egg challenge incorporated baked egg into their diet. Immunologic parameters were measured at follow-up visits. A comparison group strictly avoiding egg was used to evaluate the natural history of the development of tolerance. Of the 79 subjects in the intent-to-treat group followed for a median of 37.8 months, 89% now tolerate baked egg and 53% now tolerate regular egg. Of 23 initially baked egg-reactive subjects, 14 (61%) subsequently tolerated baked egg and 6 (26%) now tolerate regular egg. Within the initially baked egg-reactive group, subjects with persistent reactivity to baked egg had higher median baseline egg white (EW)-specific IgE levels (13.5 kU(A)/L) than those who subsequently tolerated baked egg (4.4 kU(A)/L; P= .04) and regular egg (3.1 kU(A)/L; P= .05). In subjects ingesting baked egg, EW-induced skin prick test wheal diameter and EW-, ovalbumin-, and ovomucoid-specific IgE levels decreased significantly, while ovalbumin- and ovomucoid-specific IgG(4) levels increased significantly. Subjects in the per-protocol group were 14.6 times more likely than subjects in the comparison group (P< .0001) to develop regular egg tolerance, and they developed tolerance earlier (median 50.0 vs 78.7 months; P< .0001). Initiation of a baked egg diet accelerates the development of regular egg tolerance compared with strict avoidance. Higher serum EW-specific IgE level is associated with persistent baked and regular egg reactivity, while initial baked egg reactivity is not. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

The Absence of CYP3A5*3 Is a Protective Factor to Anticonvulsants Hypersensitivity Reactions: A Case-Control Study in Brazilian Subjects

PubMed Central

dos Santos, Bernardo; Talib, Leda Leme; Yamaguti, Célia; Rodrigues, Helcio; Gattaz, Wagner Farid; Kalil, Jorge

2015-01-01

Although aromatic anticonvulsants are usually well tolerated, they can cause cutaneous adverse drug reactions in up to 10% of patients. The clinical manifestations of the antiepileptics-induced hypersensitivity reactions (AHR) vary from mild skin rashes to severe cutaneous drug adverse reactions which are related to high mortality and significant morbidity. Genetic polymorphisms in cytochrome P450 genes are associated with altered enzymatic activity and may contribute to the risk of AHR. Here we present a case-control study in which we genotyped SNPs of CYP2C19, 2C9 and 3A5 of 55 individuals with varying severities of AHR, 83 tolerant, and 366 healthy control subjects from São Paulo, Brazil. Clinical characterization was based on standardized scoring systems and drug patch test. All in vivo investigation followed the ENDA (European Network of Drug Allergy) recommendations. Genotype was determined by real time PCR using peripheral blood DNA as a template. Of all 504 subjects, 65% were females, 45% self-identified as Afro-American, 38% as Caucasian and 17% as having non-African mixed ascendancy. Amongst 55 subjects with AHR, 44 had severe cutaneous drug adverse reactions. Of the 46 drug patch tests performed, 29 (63%) were positive. We found a strong association between the absence of CYP3A5*3 and tolerant subjects when compared to AHR (p = 0.0002, OR = 5.28 [CI95% 2.09–14.84]). None of our groups presented positive association with CYP2C19 and 2C9 polymorphisms, however, both SNPs contributed to separation of cases and tolerants in a Classification and Regression Tree. Our findings indicate that drug metabolism genes can contribute in the tolerability of antiepileptics. CYP3A5*3 is the most prevalent CYP3A5 allele associated with reduced enzymatic function. The current study provides evidence that normal CYP3A5 activity might be a protective factor to aromatic antiepileptics-induced hypersensitivity reactions in Brazilian subjects. PMID:26291084

The Absence of CYP3A5*3 Is a Protective Factor to Anticonvulsants Hypersensitivity Reactions: A Case-Control Study in Brazilian Subjects.

PubMed

Tanno, Luciana Kase; Kerr, Daniel Shikanai; dos Santos, Bernardo; Talib, Leda Leme; Yamaguti, Célia; Rodrigues, Helcio; Gattaz, Wagner Farid; Kalil, Jorge

2015-01-01

Although aromatic anticonvulsants are usually well tolerated, they can cause cutaneous adverse drug reactions in up to 10% of patients. The clinical manifestations of the antiepileptics-induced hypersensitivity reactions (AHR) vary from mild skin rashes to severe cutaneous drug adverse reactions which are related to high mortality and significant morbidity. Genetic polymorphisms in cytochrome P450 genes are associated with altered enzymatic activity and may contribute to the risk of AHR. Here we present a case-control study in which we genotyped SNPs of CYP2C19, 2C9 and 3A5 of 55 individuals with varying severities of AHR, 83 tolerant, and 366 healthy control subjects from São Paulo, Brazil. Clinical characterization was based on standardized scoring systems and drug patch test. All in vivo investigation followed the ENDA (European Network of Drug Allergy) recommendations. Genotype was determined by real time PCR using peripheral blood DNA as a template. Of all 504 subjects, 65% were females, 45% self-identified as Afro-American, 38% as Caucasian and 17% as having non-African mixed ascendancy. Amongst 55 subjects with AHR, 44 had severe cutaneous drug adverse reactions. Of the 46 drug patch tests performed, 29 (63%) were positive. We found a strong association between the absence of CYP3A5*3 and tolerant subjects when compared to AHR (p = 0.0002, OR = 5.28 [CI95% 2.09-14.84]). None of our groups presented positive association with CYP2C19 and 2C9 polymorphisms, however, both SNPs contributed to separation of cases and tolerants in a Classification and Regression Tree. Our findings indicate that drug metabolism genes can contribute in the tolerability of antiepileptics. CYP3A5*3 is the most prevalent CYP3A5 allele associated with reduced enzymatic function. The current study provides evidence that normal CYP3A5 activity might be a protective factor to aromatic antiepileptics-induced hypersensitivity reactions in Brazilian subjects.

Efficacy and tolerability of fimasartan, a new angiotensin receptor blocker, compared with losartan (50/100 mg): a 12-week, phase III, multicenter, prospective, randomized, double-blind, parallel-group, dose escalation clinical trial with an optional 12-week extension phase in adult Korean patients with mild-to-moderate hypertension.

PubMed

Lee, Sang Eun; Kim, Yong-Jin; Lee, Hae-Young; Yang, Han-Mo; Park, Chang-Gyu; Kim, Jae-Joong; Kim, Soon-Kil; Rhee, Moo-Yong; Oh, Byung-Hee

2012-03-01

Angiotensin receptor blockers (ARBs) is an effective and well tolerated first-line antihypertensive drug. Fimasartan is a newly developed ARB that has not been compared with other ARBs with regard to its efficacy and tolerability. The goal of this study was to determine the noninferiority of fimasartan to losartan with regard to its efficacy and tolerability in adult Korean patients with mild-to-moderate hypertension. This was a randomized, multicenter, double-blind, parallel group, dose escalation, Phase III, noninferiority clinical trial. Patients aged 18 to 70 years with mild-to-moderate hypertension were randomized to receive either fimasartan 60/120 mg daily or losartan 50/100 mg daily with optional titration. Antihypertensive efficacy and tolerability were evaluated for 12 weeks. The primary end point was noninferiority of improvement in mean siDBP from baseline to week 12 for fimasartan compared with losartan. The incidence and severity of adverse events (AEs) and adverse drug reactions (ADRs) were evaluated to assess their tolerability. In addition, some patients whose blood pressure reached goal levels participated in a 24-week extension study for additional assessment of tolerability and efficacy. Five hundred six patients were randomly allocated to receive fimasartan (n = 256) or losartan (n = 250). There was no significant difference in baseline demographic characteristics between the 2 treatment groups (fimasartan-treated group-mean age, 53.96 [8.79] years; mean weight, 70.58 [11.73] kg; male, 68.02%; losartan-treated group-mean age, 53.58 [9.61] years; mean weight, 69.80 [11.08] kg; male, 70.17%). At week 12, siDBP was significantly decreased from baseline in both groups (-11.26 [7.53] mm Hg in the fimasartan group and -8.56 [7.72] mm Hg in the losartan group [P < 0.0001]). The between-group difference was 2.70 mm Hg (P = 0.0002), and the lower limit of the 2-sided 95% CI (1.27 mm Hg) was higher than the prespecified noninferiority margin (-2.5 mm Hg). The incidence of ADRs were 7.84% and 10.40% in the fimasartan and losartan groups, respectively (χ(2) test, P = 0.3181). The efficacy of fimasartan was maintained over 24 weeks, and its tolerability was comparable with losartan in the extension study. In this study with eligible adult Korean patients who had mild-to-moderate hypertension, the reduction of siDBP after 12 weeks of treatment with fimasartan 60/120 mg was noninferior to that of losartan 50/100 mg. By post hoc comparison, between-group differences in siDBP were significant in favor of fimasartan, suggesting superiority to losartan. There was no statistically significant difference in tolerability between the groups. This efficacy and tolerability were maintained throughout the additional 12-week extension study. Copyright © 2012 Elsevier HS Journals, Inc. All rights reserved.

LASP-04: Tolerance Evaluation of Experimental Compound in Kras/p53 Pancreatic Ductal Adenocarcinoma (PDAC) Mice | Frederick National Laboratory for Cancer Research

Cancer.gov

The Laboratory Animal Sciences Program will breed 18 KPC animals with the intent of generating a cohort of 12 animals with confirmed tumor-load matching the following enrollment criteria:female mice are considered eligible for enrollment when u

Hormone and Cytokine Responses to Repeated Endotoxin Exposures-No Evidence of Endotoxin Tolerance After 5 Weeks in Humans.

PubMed

Rittig, Nikolaj; Thomsen, Henrik H; Bach, Ermina; Jørgensen, Jens Otto L; Møller, Niels

2015-07-01

Endotoxin administrations are used in experimental models of inflammatory disease. Short-term endotoxin tolerance in response to repeated endotoxin exposure is well known, but the duration of endotoxin tolerance in humans remains unknown. The main purpose of this study was to test whether endotoxin tolerance is present in vivo when separating endotoxin exposures with more than 5 weeks, a time span often used between individual investigations in clinical experimental studies. Seventeen healthy young men were exposed twice to Escherichia coli endotoxin. The inflammatory response was calculated as area under the curve between the first and second endotoxin exposures for heart rate, mean arterial blood pressure, temperature, cortisol, tumor necrosis factor α, and interleukin (IL)-1β, IL-6, and IL-10. The median interval between exposures was 90 days (range, 37-244). The ratio between the inflammatory responses during the second and the first endotoxin exposures was 0.89 ± 0.09 (P = 0.28) for tumor necrosis factor α, 0.96 ± 0.07 (P = 0.53) for IL-1β, 0.97 ± 0.11 (P = 0.78) for IL-6, 1.30 ± 0.18 (P = 0.12) for IL-10, and 0.92 ± 0.04 (P = 0.10) for cortisol. Our data do not show evidence of in vivo tolerance to repeated endotoxin exposure when administrations are separated with at least 5 weeks. This observation is important in the planning and interpretation of future experimental endotoxin studies.

Selected Alkylating Agents Can Overcome Drug Tolerance of G0-like Tumor Cells and Eradicate BRCA1-Deficient Mammary Tumors in Mice.

PubMed

Pajic, Marina; Blatter, Sohvi; Guyader, Charlotte; Gonggrijp, Maaike; Kersbergen, Ariena; Küçükosmanoğlu, Aslι; Sol, Wendy; Drost, Rinske; Jonkers, Jos; Borst, Piet; Rottenberg, Sven

2017-11-15

Purpose: We aimed to characterize and target drug-tolerant BRCA1-deficient tumor cells that cause residual disease and subsequent tumor relapse. Experimental Design: We studied responses to various mono- and bifunctional alkylating agents in a genetically engineered mouse model for BRCA1/p53 -mutant breast cancer. Because of the large intragenic deletion of the Brca1 gene, no restoration of BRCA1 function is possible, and therefore, no BRCA1-dependent acquired resistance occurs. To characterize the cell-cycle stage from which Brca1 -/- ;p53 -/- mammary tumors arise after cisplatin treatment, we introduced the fluorescent ubiquitination-based cell-cycle indicator (FUCCI) construct into the tumor cells. Results: Despite repeated sensitivity to the MTD of platinum drugs, the Brca1 -mutated mammary tumors are not eradicated, not even by a frequent dosing schedule. We show that relapse comes from single-nucleated cells delaying entry into the S-phase. Such slowly cycling cells, which are present within the drug-naïve tumors, are enriched in tumor remnants. Using the FUCCI construct, we identified nonfluorescent G 0 -like cells as the population most tolerant to platinum drugs. Intriguingly, these cells are more sensitive to the DNA-crosslinking agent nimustine, resulting in an increased number of multinucleated cells that lack clonogenicity. This is consistent with our in vivo finding that the nimustine MTD, among several alkylating agents, is the most effective in eradicating Brca1 -mutated mouse mammary tumors. Conclusions: Our data show that targeting G 0 -like cells is crucial for the eradication of BRCA1/p53-deficient tumor cells. This can be achieved with selected alkylating agents such as nimustine. Clin Cancer Res; 23(22); 7020-33. ©2017 AACR . ©2017 American Association for Cancer Research.

Mind-Body Skills Training to Improve Distress Tolerance in Medical Students: A Pilot Study.

PubMed

Kraemer, Kristen M; Luberto, Christina M; O'Bryan, Emily M; Mysinger, Erica; Cotton, Sian

2016-01-01

Medical students face rigorous and stressful work environments, resulting in high rates of psychological distress. However, there has been a dearth of empirical work aimed at modifying risk factors for psychopathology among this at-risk group. Distress tolerance, defined as the ability to withstand emotional distress, is one factor that may be important in promoting psychological well-being in medical students. Thus, the aim of the current mixed-methods study was (a) to describe changes in facets of distress tolerance (i.e., emotional tolerance, absorption, appraisal, regulation) for medical students who completed a mind-body skills training group, and a no-intervention control group of students; (b) to examine the relationship between changes in psychological variables and changes in distress tolerance; and (c) to report students' perceptions of the mind-body group, with an emphasis on how the group may have affected personal and professional functioning due to improvements in distress tolerance. The mind-body program was an 11-week, 2-hour skills training group that focused on introducing, practicing, and processing mind-body skills such as biofeedback, guided imagery, relaxation, several forms of meditation (e.g., mindfulness), breathing exercises, and autogenic training. Participants were 52 first- and second-year medical students (62.7% female, Mage = 23.45, SD = 1.51) who participated in a mind-body group or a no-intervention control group and completed self-report measures before and after the 11-week period. Students in the mind-body group showed a modest improvement in all distress tolerance subscales over time (ΔM = .42-.53, p = .01-.03, d = .44-.53), whereas the control group showed less consistent changes across most subscales (ΔM = .11-.42, p = .10-.65, d = .01-.42). Students in the mind-body group qualitatively reported an improved ability to tolerate affective distress. Overall, improvements in psychological symptoms were associated with improvements in distress tolerance in the mind-body group but not in the control group. These preliminary findings provide support for the notion that improving distress tolerance through mind-body skills training might serve to protect medical students from becoming functionally impaired by psychological distress. Thus, implementing mind-body skills training into medical school education may help to improve the psychological well-being of medical students. Future studies utilizing more methodologically rigorous designs are warranted.

Locomotion pattern and trunk musculoskeletal architecture among Urodela.

PubMed

Omura, Ayano; Ejima, Ken-Ichiro; Honda, Kazuya; Anzai, Wataru; Taguchi, Yuki; Koyabu, Daisuke; Endo, Hideki

2015-04-01

We comparatively examined the trunk musculature and prezygapophyseal angle of mid-trunk vertebra in eight urodele species with different locomotive modes (aquatic Siren intermedia , Amphiuma tridactylum , Necturus maculosus and Andrias japonicus ; semi-aquatic Cynops pyrrhogaster, Cynops ensicauda ; and terrestrial Hynobius nigrescens , Hynobius lichenatus and Ambystoma tigrinum ). We found that the more terrestrial species were characterized by larger dorsal and abdominal muscle weight ratios compared with those of the more aquatic species, whereas muscle ratios of the lateral hypaxial musculature were larger in the more aquatic species. The lateral hypaxial muscles were thicker in the more aquatic species, whereas the M. rectus abdominis was more differentiated in the more terrestrial species. Our results suggest that larger lateral hypaxial muscles function for lateral bending during underwater locomotion in aquatic species. Larger dorsalis and abdominal muscles facilitate resistance against sagittal extension of the trunk, stabilization and support of the ventral contour line against gravity in terrestrial species. The more aquatic species possessed a more horizontal prezygapophyseal angle for more flexible lateral locomotion. In contrast, the more terrestrial species have an increasingly vertical prezygapophyseal angle to provide stronger column support against gravity. Thus, we conclude trunk structure in urodeles differs clearly according to their locomotive modes.

Modeling and controlling the two-phase dynamics of the p53 network: a Boolean network approach

NASA Astrophysics Data System (ADS)

Lin, Guo-Qiang; Ao, Bin; Chen, Jia-Wei; Wang, Wen-Xu; Di, Zeng-Ru

2014-12-01

Although much empirical evidence has demonstrated that p53 plays a key role in tumor suppression, the dynamics and function of the regulatory network centered on p53 have not yet been fully understood. Here, we develop a Boolean network model to reproduce the two-phase dynamics of the p53 network in response to DNA damage. In particular, we map the fates of cells into two types of Boolean attractors, and we find that the apoptosis attractor does not exist for minor DNA damage, reflecting that the cell is reparable. As the amount of DNA damage increases, the basin of the repair attractor shrinks, accompanied by the rising of the apoptosis attractor and the expansion of its basin, indicating that the cell becomes more irreparable with more DNA damage. For severe DNA damage, the repair attractor vanishes, and the apoptosis attractor dominates the state space, accounting for the exclusive fate of death. Based on the Boolean network model, we explore the significance of links, in terms of the sensitivity of the two-phase dynamics, to perturbing the weights of links and removing them. We find that the links are either critical or ordinary, rather than redundant. This implies that the p53 network is irreducible, but tolerant of small mutations at some ordinary links, and this can be interpreted with evolutionary theory. We further devised practical control schemes for steering the system into the apoptosis attractor in the presence of DNA damage by pinning the state of a single node or perturbing the weight of a single link. Our approach offers insights into understanding and controlling the p53 network, which is of paramount importance for medical treatment and genetic engineering.

Sponge Sampling with Fluorescent In Situ Hybridization as a Screening Tool for the Early Detection of Esophageal Cancer.

PubMed

Haisley, Kelly R; Dolan, James P; Olson, Susan B; Toledo-Valdovinos, Sergio A; Hart, Kyle D; Bakis, Gene; Enestvedt, Brintha K; Hunter, John G

2017-02-01

Sponge cytology is a novel screening tool for esophageal cancer but has been unable to be validated for widespread use. Our aim was to apply fluorescent in situ hybridization to sponge cytology samples in order to evaluate the safety and efficacy of this modality in screening for esophageal cancer. At a single, multidisciplinary, NCI-designated cancer center, patients completed sponge cytology sampling prior to upper endoscopy. Samples were analyzed by p53 fluorescent in situ hybridization, and results were compared to the endoscopic diagnosis. Fifty patients were enrolled (96 % Caucasian, 68 % male, median age of 67). All patients successfully swallowed the capsule. No complications (string breakage, bleeding, mucosal injury) occurred. Endoscopy revealed that 38 % had normal esophageal mucosa and 62 % had an esophageal mucosal abnormality. In total, six samples demonstrated p53 loss (94 % specificity for any abnormality). The sensitivity of the p53 fluorescent in situ hybridization probe was13.3 % for any abnormality, 10 % for intestinal metaplasia, and 0 % for dysplasia or esophageal cancer. Esophageal sponge cytology is a promising, safe, and tolerable method for collecting esophageal cell samples. However, our data suggest that p53 fluorescent in situ hybridization does not improve the sensitivity for detecting cancer in these samples.

Long-term lifestyle intervention with optimized high-intensity interval training improves body composition, cardiometabolic risk, and exercise parameters in patients with abdominal obesity.

PubMed

Gremeaux, Vincent; Drigny, Joffrey; Nigam, Anil; Juneau, Martin; Guilbeault, Valérie; Latour, Elise; Gayda, Mathieu

2012-11-01

The aim of this study was to study the impact of a combined long-term lifestyle and high-intensity interval training intervention on body composition, cardiometabolic risk, and exercise tolerance in overweight and obese subjects. Sixty-two overweight and obese subjects (53.3 ± 9.7 yrs; mean body mass index, 35.8 ± 5 kg/m(2)) were retrospectively identified at their entry into a 9-mo program consisting of individualized nutritional counselling, optimized high-intensity interval exercise, and resistance training two to three times a week. Anthropometric measurements, cardiometabolic risk factors, and exercise tolerance were measured at baseline and program completion. Adherence rate was 97%, and no adverse events occurred with high-intensity interval exercise training. Exercise training was associated with a weekly energy expenditure of 1582 ± 284 kcal. Clinically and statistically significant improvements were observed for body mass (-5.3 ± 5.2 kg), body mass index (-1.9 ± 1.9 kg/m(2)), waist circumference (-5.8 ± 5.4 cm), and maximal exercise capacity (+1.26 ± 0.84 metabolic equivalents) (P < 0.0001 for all parameters). Total fat mass and trunk fat mass, lipid profile, and triglyceride/high-density lipoprotein ratio were also significantly improved (P < 0.0001). At program completion, the prevalence of metabolic syndrome was reduced by 32.5% (P < 0.05). Independent predictors of being a responder to body mass and waist circumference loss were baseline body mass index and resting metabolic rate; those for body mass index decrease were baseline waist circumference and triglyceride/high-density lipoprotein cholesterol ratio. A long-term lifestyle intervention with optimized high-intensity interval exercise improves body composition, cardiometabolic risk, and exercise tolerance in obese subjects. This intervention seems safe, efficient, and well tolerated and could improve adherence to exercise training in this population.

Analysis of the expression and function of Wnt-5a and Wnt-5b in developing and regenerating axolotl (Ambystoma mexicanum) limbs.

PubMed

Ghosh, Sukla; Roy, Stéphane; Séguin, Carl; Bryant, Susan V; Gardiner, David M

2008-05-01

Urodele amphibians are unique adult vertebrates because they are able to regenerate body parts after amputation. Studies of urodele limb regeneration, the key model system for vertebrate regeneration, have led to an understanding of the origin of blastema cells and the importance of positional interactions between blastema cells in the control of growth and pattern formation. Progress is now being made in the identification of the signaling pathways that regulate dedifferentiation, blastema morphogenesis, growth and pattern formation. Members of the Wnt family of secreted proteins are expressed in developing and regenerating limbs, and have the potential to control growth, pattern formation and differentiation. We have studied the expression of two non-canonical Wnt genes, Wnt-5a and Wnt-5b. We report that they are expressed in equivalent patterns during limb development and limb regeneration in the axolotl (Ambystoma mexicanum), and during limb development in other tetrapods, implying conservation of function. Our analysis of the effects of ectopic Wnt-5a expression is consistent with the hypothesis that canonical Wnt signaling functions during the early stages of regeneration to control the dedifferentiation of stump cells giving rise to the regeneration-competent cells of the blastema.

Marsh frogs, Pelophylax ridibundus, determine migratory direction by magnetic field.

PubMed

Shakhparonov, Vladimir V; Ogurtsov, Sergei V

2017-01-01

Orientation by magnetic cues appears to be adaptive during animal migrations. Whereas the magnetic orientation in birds, mammals, and urodele amphibians is being investigated intensively, the data about anurans are still scarce. This study tests whether marsh frogs could determine migratory direction between the breeding pond and the wintering site by magnetic cues in the laboratory. Adult frogs (N = 32) were individually tested in the T-maze 127 cm long inside the three-axis Helmholtz coil system (diameter 3 m). The arms of the maze were positioned parallel to the natural migratory route of this population when measured in accordance with magnetic field. The frogs were tested under two-motivational conditions mediated by temperature/light regime: the breeding migratory state and the wintering state. The frogs' choice in a T-maze was evident only when analyzed in accordance with the direction of the magnetic field: they moved along the migratory route to the breeding pond and followed the reversion of the horizontal component of the magnetic field. This preference has been detected in both sexes only in the breeding migratory state. This suggests that adult ranid frogs can obtain directional information from the Earth's magnetic field as was shown earlier in urodeles and anuran larvae.

FGF and BMP derived from dorsal root ganglia regulate blastema induction in limb regeneration in Ambystoma mexicanum.

PubMed

Satoh, Akira; Makanae, Aki; Nishimoto, Yurie; Mitogawa, Kazumasa

2016-09-01

Urodele amphibians have a remarkable organ regeneration ability that is regulated by neural inputs. The identification of these neural inputs has been a challenge. Recently, Fibroblast growth factor (Fgf) and Bone morphogenic protein (Bmp) were shown to substitute for nerve functions in limb and tail regeneration in urodele amphibians. However, direct evidence of Fgf and Bmp being secreted from nerve endings and regulating regeneration has not yet been shown. Thus, it remained uncertain whether they were the nerve factors responsible for successful limb regeneration. To gather experimental evidence, the technical difficulties involved in the usage of axolotls had to be overcome. We achieved this by modifying the electroporation method. When Fgf8-AcGFP or Bmp7-AcGFP was electroporated into the axolotl dorsal root ganglia (DRG), GFP signals were detectable in the regenerating limb region. This suggested that Fgf8 and Bmp7 synthesized in neural cells in the DRG were delivered to the limbs through the long axons. Further knockdown experiments with double-stranded RNA interference resulted in impaired limb regeneration ability. These results strongly suggest that Fgf and Bmp are the major neural inputs that control the organ regeneration ability. Copyright © 2016 Elsevier Inc. All rights reserved.

IKK is a therapeutic target in KRAS-Induced lung cancer with disrupted p53 activity.

PubMed

Bassères, Daniela S; Ebbs, Aaron; Cogswell, Patricia C; Baldwin, Albert S

2014-04-01

Activating mutations in KRAS are prevalent in cancer, but therapies targeted to oncogenic RAS have been ineffective to date. These results argue that targeting downstream effectors of RAS will be an alternative route for blocking RAS-driven oncogenic pathways. We and others have shown that oncogenic RAS activates the NF-κB transcription factor pathway and that KRAS-induced lung tumorigenesis is suppressed by expression of a degradation-resistant form of the IκBα inhibitor or by genetic deletion of IKKβ or the RELA/p65 subunit of NF-κB. Here, genetic and pharmacological approaches were utilized to inactivate IKK in human primary lung epithelial cells transformed by KRAS, as well as KRAS mutant lung cancer cell lines. Administration of the highly specific IKKβ inhibitor Compound A (CmpdA) led to NF-κB inhibition in different KRAS mutant lung cells and siRNA-mediated knockdown of IKKα or IKKβ reduced activity of the NF-κB canonical pathway. Next, we determined that both IKKα and IKKβ contribute to oncogenic properties of KRAS mutant lung cells, particularly when p53 activity is disrupted. Based on these results, CmpdA was tested for potential therapeutic intervention in the Kras-induced lung cancer mouse model (LSL-Kras (G12D)) combined with loss of p53 (LSL-Kras (G12D)/p53 (fl/fl)). CmpdA treatment was well tolerated and mice treated with this IKKβ inhibitor presented smaller and lower grade tumors than mice treated with placebo. Additionally, IKKβ inhibition reduced inflammation and angiogenesis. These results support the concept of targeting IKK as a therapeutic approach for oncogenic RAS-driven tumors with altered p53 activity.

Prediction of pain in orthodontic patients based on preoperative pain assessment

PubMed Central

Zheng, Baoyu; Ren, Manman; Lin, Feiou; Yao, Linjie

2016-01-01

Aim To investigate whether pretreatment assessment of experimental pain can predict the level of pain after archwire placement. Methods One hundred and twenty-one general university students seeking orthodontic treatment were enrolled in this study. A cold pressor test was performed to estimate the pain tolerance of subjects before treatment. Self-reported pain intensity was calculated using a 10 cm visual analog scale during the 7 days after treatment. The relationship between pain tolerance and orthodontic pain was analyzed using Spearman’s correlation analysis. Results The maximum mean level of pain intensity occurred at 24 hours after bonding (53.31±16.13) and fell to normal levels at day 7. Spearman’s correlation analysis found a moderate positive association between preoperative pain tolerance and self-reported pain after archwire placement (P<0.01). There was no significant difference in pain intensity between male and female patients at any time point (P>0.05). Conclusion A simple and noninvasive preoperative sensory test (the cold pressor test) was useful in predicting the risk of developing unbearable pain in patients after archwire placement. Self-reported pain after archwire placement decreased as individual pain tolerance increased. PMID:27042019

Introgression of wild alleles into the tetraploid peanut crop to improve water use efficiency, earliness and yield.

PubMed

Dutra, Wellison F; Guerra, Yrlânia L; Ramos, Jean P C; Fernandes, Pedro D; Silva, Carliane R C; Bertioli, David J; Leal-Bertioli, Soraya C M; Santos, Roseane C

2018-01-01

The introduction of genes from wild species is a practice little adopted by breeders for the improvement of commercial crops, although it represents an excellent opportunity to enrich the genetic basis and create new cultivars. In peanut, this practice is being increasingly adopted. In this study we present results of introgression of wild alleles from the wild species Arachis duranensis and A. batizocoi improving photosynthetic traits and yield in a set of lines derived from the cross of an induced allotetraploid and cultivated peanut with selection under water stress. The assays were carried out in greenhouse and field focusing on physiological and agronomic traits. A multivariate model (UPGMA) was adopted in order to classify drought tolerant lines. Several lines showed improved levels of tolerance, with values similar to or greater than the tolerant control. Two BC1F6 lines (53 P4 and 96 P9) were highlighted for good drought-related traits, earliness and pod yield, having better phenotypic profile to the drought tolerant elite commercial cultivar BR1. These lines are good candidates for the creation of peanut cultivars suitable for production in semiarid environments.

Fluoride-sensitivity of growth and acid production of oral Actinomyces: comparison with oral Streptococcus.

PubMed

Kawashima, Junko; Nakajo, Kazuko; Washio, Jumpei; Mayanagi, Gen; Shimauchi, Hidetoshi; Takahashi, Nobuhiro

2013-12-01

Actinomyces are predominant oral bacteria; however, their cariogenic potential in terms of acid production and fluoride sensitivity has not been elucidated in detail and compared with that of other caries-associated oral bacteria, such as Streptococcus. Therefore, this study aimed to elucidate and compare the acid production and growth of Actinomyces and Streptococcus in the presence of bicarbonate and fluoride to mimic conditions in the oral cavity. Acid production from glucose was measured by pH-stat at pH 5.5 and 7.0 under anaerobic conditions. Growth rate was assessed by optical density in anaerobic culture. Although Actinomyces produced acid at a lower rate than did Streptococcus, their acid production was more tolerant of fluoride (IDacid production 50 = 110-170 ppm at pH 7.0 and 10-13 ppm at pH 5.5) than that of Streptococcus (IDacid production 50 = 36-53 ppm at pH 7.0 and 6.3-6.5 ppm at pH 5.5). Bicarbonate increased acid production by Actinomyces with prominent succinate production and enhanced their fluoride tolerance (IDacid production 50 = 220-320 ppm at pH 7.0 and 33-52 ppm at pH 5.5). Bicarbonate had no effect on these variables in Streptococcus. In addition, although the growth rate of Actinomyces was lower than that of Streptococcus, Actinomyces growth was more tolerant of fluoride (IDgrowth 50 = 130-160 ppm) than was that of Streptococcus (IDgrowth 50 = 27-36 ppm). These results indicate that oral Actinomyces are more tolerant of fluoride than oral Streptococcus, and bicarbonate enhances the fluoride tolerance of oral Actinomyces. Because of the limited number of species tested here, further study is needed to generalize these findings to the genus level. © 2013 The Societies and Wiley Publishing Asia Pty Ltd.

Uranium (U)-Tolerant Bacterial Diversity from U Ore Deposit of Domiasiat in North-East India and Its Prospective Utilisation in Bioremediation

PubMed Central

Kumar, Rakshak; Nongkhlaw, Macmillan; Acharya, Celin; Joshi, Santa Ram

2013-01-01

Uranium (U)-tolerant aerobic chemo-heterotrophic bacteria were isolated from the sub-surface soils of U-rich deposits in Domiasiat, North East India. The bacterial community explored at molecular level by amplified ribosomal DNA restriction analysis (ARDRA) resulted in 51 distinct phylotypes. Bacterial community assemblages at the U mining site with the concentration of U ranging from 20 to 100 ppm, were found to be most diverse. Representative bacteria analysed by 16S rRNA gene sequencing were affiliated to Firmicutes (51%), Gammaproteobacteria (26%), Actinobacteria (11%), Bacteroidetes (10%) and Betaproteobacteria (2%). Representative strains removed more than 90% and 53% of U from 100 μM and 2 mM uranyl nitrate solutions, respectively, at pH 3.5 within 10 min of exposure and the activity was retained until 24 h. Overall, 76% of characterized isolates possessed phosphatase enzyme and 53% had PIB-type ATPase genes. This study generated baseline information on the diverse indigenous U-tolerant bacteria which could serve as an indicator to estimate the environmental impact expected to be caused by mining in the future. Also, these natural isolates efficient in uranium binding and harbouring phosphatase enzyme and metal-transporting genes could possibly play a vital role in the bioremediation of metal-/radionuclide-contaminated environments. PMID:23080407

The Pleurodele, an animal model for space biology studies

NASA Astrophysics Data System (ADS)

Gualandris, L.; Grinfeld, S.; Foulquier, F.; Kan, P.; Duprat, A. M.

Pleurodeles waltl, an Urodele amphibian is proposed as a model for space biology studies. Our laboratory is developing three types of experiments in space using this animal: 1) in vivo fertilization and development (``FERTILE'' project); 2) influence of microgravity and space radiation on the organization and preservation of spacialized structures in the neurons and muscle cells (in vitro; ``CELIMENE'' PROJECT); 3) influence of microgravity on tissue regeneration (muscle, bone, epidermis and spinal cord).

[Study of Flexible Doses of Paliperidone ER in Pacients with Schizophrenia who Have Undergone Inefficient Treatment with other Antipsychotics].

PubMed

Córdoba, Rodrigo; Cano, Juan Fernando; Arango-Dávila, César Augusto; Miranda, Carlos; Holguín, Jorge; Fernández, Darío; Márquez, Miguel; Lupo, Christian; Gargoloff, Pedro; Petracca, Gustavo; Lucchetti, César

2012-06-01

Extended-release (ER) paliperidone is an innovative atypical antipsychotic that allows minimal peak-to-through fluctuations with once-daily dosing. To evaluate effectiveness, safety and tolerability of flexible, once-daily doses of paliperidone ER (3-12 mg/day) in patients with schizophrenia from Argentina and Colombia who had previously failed treatment with other antipsychotic agents. The authors conducted a 6-month, open-label, prospective and multicentric study. Effectiveness was assessed with Positive and Negative Syndrome Scale (PANSS) and Personal and Social Performance scale (PSP). Other measures of effectiveness, safety and tolerability, were also conducted. Paliperidone ER 3-12 mg/day improved Positive and Negative Syndrome Scale (PANSS) total scores (primary endpoint) from baseline to study end (p < 0,001). In the PANSS total score, the mean change from baseline (83, 9 units) to end point (53,7 units) was significant (p < 0,001). Flexible doses of paliperidone ER demonstrated a ≥20% reduction in the PANSS total score (p<0.001) in almost two-thirds of patients. PSP mean change from baseline (52 units) to end point (85 units) was significant (p < 0,001). Secondary effectiveness assessments, as well as safety and tolerability measures, demonstrated favourable results throughout the study. Flexible doses of paliperidone ER over 6 months were effective, safe and well tolerated in patients with schizophrenia from Argentina and Colombia. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

A Nonrandomized, Phase II Study of Sequential Irinotecan and Flavopiridol in Patients With Advanced Hepatocellular Carcinoma

PubMed Central

Ang, Celina; O'Reilly, Eileen M.; Carvajal, Richard D.; Capanu, Marinela; Gonen, Mithat; Doyle, Laurence; Ghossein, Ronald; Schwartz, Lawrence; Jacobs, Gria; Ma, Jennifer; Schwartz, Gary K.

2012-01-01

ABSTRACT BACKGROUND: Flavopiridol, a Cdk inhibitor, potentiates irinotecan-induced apoptosis. In a phase I trial of sequential irinotecan and flavopiridol, 2 patients with advanced hepatocellular carcinoma (HCC) had stable disease (SD) for ≥14 months. We thus studied the sequential combination of irinotecan and flavopiridol in patients with HCC. METHODS: Patients with advanced HCC naïve to systemic therapy, Child-Pugh ≤B8, and Karnofsky performance score (KPS) ≥70% received 100 mg/m2 irinotecan followed 7 hours later by flavopiridol 60 mg/m2 weekly for 4 of 6 weeks. The primary end point was an improvement in progression-free survival at 4 months (PFS-4) from 33% to 54%, using a Simon's two-stage design. Tumors were stained for p53. RESULTS: Only 16 patients in the first stage were enrolled: median age, 64 years; median KPS, 80%; Child-Pugh A, 87.5%; and stage III/IV, 25%/75%. The primary end point was not met; PFS-4 was 20%, leading to early termination of the study. Ten patients were evaluable for response: 1 had SD >1 year and 9 had disease progression. Grade 3 fatigue, dehydration, diarrhea, neutropenia with or without fever, lymphopenia, anemia, hyperbilirubinemia, and transaminitis occurred in ≥10% of the patients. Of the 9 patients who progressed, 5 had mutant p53 and 4 had wild-type p53. The patient with stable disease had wild-type p53. CONCLUSION: Sequential irinotecan and flavopiridol are ineffective and poorly tolerated in patients with advanced HCC. Despite our limited assessments, it is possible that the presence of wild-type p53 is necessary but not sufficient to predict response in HCC. PMID:23293699

Keeping mammalian mutation load in check: regulation of the activity of error-prone DNA polymerases by p53 and p21.

PubMed

Livneh, Zvi

2006-09-01

To overcome DNA lesions that block replication the cell employs translesion DNA synthesis (TLS) polymerases, a group of low fidelity DNA polymerases that have the capacity to bypass a wide range of DNA lesions. This TLS process is also termed error-prone repair, due to its inherent mutagenic nature. We have recently shown that the tumor suppressor p53 and the cell cycle inhibitor p21 are global regulators of TLS. When these proteins are missing or nonfunctional, TLS gets out of control: its extent increases to very high levels, and its fidelity decreases, causing an overall increase in mutation load. This may be explained by the loss of selectivity in the bypass of specific DNA lesions by their cognate specialized polymerases, such that lesion bypass continues to a maximum, regardless of the price paid in increased mutations. The p53 and p21 proteins are also required for efficient UV light-induced monoubiquitination of PCNA, which is consistent with a model in which this modification of PCNA is necessary but not sufficient for the normal activity of TLS. This regulation suggests that TLS evolved in mammals as a system that balances gain in survival with a tolerable mutational cost, and that disturbing this balance causes a potentially harmful increase in mutations, which might play a role in carcinogenesis.

Engineering transcription factors to improve tolerance against alkane biofuels in Saccharomyces cerevisiae.

PubMed

Ling, Hua; Pratomo Juwono, Nina Kurniasih; Teo, Wei Suong; Liu, Ruirui; Leong, Susanna Su Jan; Chang, Matthew Wook

2015-01-01

Biologically produced alkanes can be used as 'drop in' to existing transportation infrastructure as alkanes are important components of gasoline and jet fuels. Despite the reported microbial production of alkanes, the toxicity of alkanes to microbial hosts could pose a bottleneck for high productivity. In this study, we aimed to improve the tolerance of Saccharomyces cerevisiae, a model eukaryotic host of industrial significance, to alkane biofuels. To increase alkane tolerance in S. cerevisiae, we sought to exploit the pleiotropic drug resistance (Pdr) transcription factors Pdr1p and Pdr3p, which are master regulators of genes with pleiotropic drug resistance elements (PDREs)-containing upstream sequences. Wild-type and site-mutated Pdr1p and Pdr3p were expressed in S. cerevisiae BY4741 pdr1Δ pdr3Δ (BYL13). The point mutations of PDR1 (F815S) and PDR3 (Y276H) in BYL13 resulted in the highest tolerance to C10 alkane, and the expression of wild-type PDR3 in BYL13 led to the highest tolerance to C11 alkane. To identify and verify the correlation between the Pdr transcription factors and tolerance improvement, we analyzed the expression patterns of genes regulated by the Pdr transcription factors in the most tolerant strains against C10 and C11 alkanes. Quantitative PCR results showed that the Pdr transcription factors differentially regulated genes associated with multi-drug resistance, stress responses, and membrane modifications, suggesting different extents of intracellular alkane levels, reactive oxygen species (ROS) production and membrane integrity. We further showed that (i) the expression of Pdr1mt1 + Pdr3mt reduced intracellular C10 alkane by 67 % and ROS by 53 %, and significantly alleviated membrane damage; and (ii) the expression of the Pdr3wt reduced intracellular C11 alkane by 72 % and ROS by 21 %. Alkane transport assays also revealed that the reduction of alkane accumulation was due to higher export (C10 and C11 alkanes) and lower import (C11 alkane). We improved yeast's tolerance to alkane biofuels by modulating the expression of the wild-type and site-mutated Pdr1p and Pdr3p, and extensively identified the correlation between Pdr transcription factors and tolerance improvement by analyzing gene patterns, alkane transport, ROS, and membrane integrity. These findings provide valuable insights into manipulating transcription factors in yeast for improved alkane tolerance and productivity.

An increased rectal maximum tolerable volume and long anal canal are associated with poor short-term response to biofeedback therapy for patients with anismus with decreased bowel frequency and normal colonic transit time.

PubMed

Rhee, P L; Choi, M S; Kim, Y H; Son, H J; Kim, J J; Koh, K C; Paik, S W; Rhee, J C; Choi, K W

2000-10-01

Biofeedback is an effective therapy for a majority of patients with anismus. However, a significant proportion of patients still failed to respond to biofeedback, and little has been known about the factors that predict response to biofeedback. We evaluated the factors associated with poor response to biofeedback. Biofeedback therapy was offered to 45 patients with anismus with decreased bowel frequency (less than three times per week) and normal colonic transit time. Any differences in demographics, symptoms, and parameters of anorectal physiologic tests were sought between responders (in whom bowel frequency increased up to three times or more per week after biofeedback) and nonresponders (in whom bowel frequency remained less than three times per week). Thirty-one patients (68.9 percent) responded to biofeedback and 14 patients (31.1 percent) did not. Anal canal length was longer in nonresponders than in responders (4.53 +/- 0.5 vs. 4.08 +/- 0.56 cm; P = 0.02), and rectal maximum tolerable volume was larger in nonresponders than in responders. (361 +/- 87 vs. 302 +/- 69 ml; P = 0.02). Anal canal length and rectal maximum tolerable volume showed significant differences between responders and nonresponders on multivariate analysis (P = 0.027 and P = 0.034, respectively). This study showed that a long anal canal and increased rectal maximum tolerable volume are associated with poor short-term response to biofeedback for patients with anismus with decreased bowel frequency and normal colonic transit time.

Pharmacogenetic approach to losartan in Marfan patients: a starting point to improve dosing regimen?

PubMed

Falvella, Felicia Stefania; Marelli, Susan; Cheli, Stefania; Montanelli, Stefano; Viecca, Federico; Salvi, Lucia; Ferrara, Alfio; Clementi, Emilio; Trifirò, Giuliana; Pini, Alessandro

2016-09-01

Losartan is under evaluation for managing Marfan patients with aortic root dilatation. Cytochrome P450 (CYP) enzymes convert losartan to E3174 active metabolite. The aim of this study is to describe the distribution of CYP2C9*2, CYP2C9*3, CYP3A4*22 and CYP3A5*3 defective alleles, according to losartan tolerance in paediatric Marfan patients. We genotyped 53 paediatric Marfan patients treated with losartan. The rate of aortic root dilatation was evaluated using the delta z-score variation. Differences in tolerated losartan daily doses with respect to CYP metabolic classes were assessed through the Kruskal-Wallis test. The losartan daily dose spans from 0.16 to 2.50 mg/kg (median 1.10 mg/kg). As we expect from the pharmacokinetics pathway, we observe highest tolerated dose in CYP2C9 poor metabolisers (median 1.50 mg/kg, interquartile range 1.08-1.67 mg/kg); however, this difference is not statistically significant. The optimal dose of angiotensin receptor blocker is not known, and no data are available about losartan pharmacogenetic profile in Marfan syndrome; we have proposed a strategy to tackle this issue based on evaluating the major genetic polymorphisms involved in the losartan conversion into active carboxylic acid metabolite. Further studies are needed to support the use of genetic polymorphisms as predictors of the right dose of losartan.

The nervus terminalis in larval and adult Xenopus laevis.

PubMed

Hofmann, M H; Meyer, D L

1989-09-25

Nervus terminalis (nt) projections were studied by HRP injections into one nostril in adult Xenopus and in Xenopus tadpoles. Central nt targets are: medial septum, preoptic nucleus, nucleus of the anterior commissure, and hypothalamus (mainly ipsilaterally). In Xenopus tadpoles, additional fibers reach the ipsilateral dorsal thalamus and the mesencephalic tegmentum, bilaterally; furthermore, hypothalamic projections are bilateral. Xenopus tadpole nt connections resemble those of adult urodeles more closely than the projections of frogs. However, Xenopus tadpoles lack nt innervation of the medial septum.

Embryological evidence for a possible polyphyletic origin of the recent amphibians.

PubMed

Nieuwkoop, P D; Sutasurya, L A

1976-02-01

The markedly different mode of mesoderm formation in anuran and urodelan amphibians (which is related to the early double-layered nature of the anuran blastula wall in contrast to its single-layered nature in the urodeles), but particularly the fundamentally different place and mode of origin of the primordial germ cells in the two groups of amphibians, strongly pleads in favour of a very ancient bifurcation in the phylogenetic history of the two groups, even suggesting a polyphyletic origin from different ancestral fishes.

The long-term effect of uranium and pH on the community composition of an artificial consortium.

PubMed

Brzoska, Ryann M; Bollmann, Annette

2016-01-01

In the environment, microorganisms are living in diverse communities, which are impacted by the prevailing environmental conditions. Here, we present a study investigating the effect of low pH and elevated uranium concentration on the dynamics of an artificial microbial consortium. The members (Caulobacter sp. OR37, Asinibacterium sp. OR53, Ralstonia sp. OR214 and Rhodanobacter sp. OR444) were isolated from a uranium contaminated and acidic subsurface sediment. In pure culture, Ralstonia sp. OR214 had the highest growth rate at neutral and low pH and only Caulobacter sp. OR37 and Asinibacterium sp. OR53 grew in the presence uranium. The four strains were mixed in equal ratios, incubated at neutral and low pH and in the presence uranium and transferred to fresh medium once per week for 30 weeks. After 30 weeks, Ralstonia sp. OR214 was dominant at low and neutral pH and Caulobacter sp. OR37 and Asinibacterium sp. OR53 were dominant in the presence of uranium. After 12 weeks, the cultures were also transferred to new conditions to access the response of the consortia to changing conditions. The transfers showed an irreversible effect of uranium, but not of low pH on the consortia. Overall, the strains initially tolerant to the respective conditions persisted over time in high abundances in the consortia. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

In-feed use of heavy metal micronutrients in U.S. swine production systems and its role in persistence of multidrug-resistant salmonellae.

PubMed

Medardus, Julius J; Molla, Bayleyegn Z; Nicol, Matthew; Morrow, W Morgan; Rajala-Schultz, Paivi J; Kazwala, Rudovick; Gebreyes, Wondwossen A

2014-04-01

The study aimed to characterize the role of heavy metal micronutrients in swine feed in emergence of heavy-metal-tolerant and multidrug-resistant Salmonella organisms. We conducted a longitudinal study in 36 swine barns over a 2-year period. The feed and fecal levels of Cu(2+) and Zn(2+) were measured. Salmonella was isolated at early and late finishing. MICs of copper sulfate and zinc chloride were measured using agar dilution. Antimicrobial susceptibility was tested using the Kirby-Bauer method, and 283 isolates were serotyped. We amplified pcoA and czcD genes that encode Cu(2+) and Zn(2+) tolerance, respectively. Of the 283 isolates, 113 (48%) showed Cu(2+) tolerance at 24 mM and 164 (58%) showed Zn(2+) tolerance at 8 mM. In multivariate analysis, serotype and source of isolates were significantly associated with Cu(2+) tolerance (P < 0.001). Fecal isolates were more likely to be Cu(2+) tolerant than those of feed origin (odds ratio [OR], 27.0; 95% confidence interval [CI], 2.8 to 250; P = 0.0042) or environmental origin (OR, 5.8), implying the significance of gastrointestinal selective pressure. Salmonella enterica serotypes Typhimurium and Heidelberg, highly significant for public health, had higher odds of having >20 mM MICs of Cu(2+) than did "other" serotypes. More than 60% of Salmonella isolates with resistance type (R-type) AmStTeKm (32 of 53) carried pcoA; only 5% with R-type AmClStSuTe carried this gene. czcD gene carriage was significantly associated with a higher Zn(2+) MIC (P < 0.05). The odds of having a high Zn(2+) MIC (≥8 mM) were 14.66 times higher in isolates with R-type AmClStSuTe than in those with R-type AmStTeKm (P < 0.05). The findings demonstrate strong association between heavy metal tolerance and antimicrobial resistance, particularly among Salmonella serotypes important in public health.

In-Feed Use of Heavy Metal Micronutrients in U.S. Swine Production Systems and Its Role in Persistence of Multidrug-Resistant Salmonellae

PubMed Central

Medardus, Julius J.; Molla, Bayleyegn Z.; Nicol, Matthew; Morrow, W. Morgan; Rajala-Schultz, Paivi J.; Kazwala, Rudovick

2014-01-01

The study aimed to characterize the role of heavy metal micronutrients in swine feed in emergence of heavy-metal-tolerant and multidrug-resistant Salmonella organisms. We conducted a longitudinal study in 36 swine barns over a 2-year period. The feed and fecal levels of Cu2+ and Zn2+ were measured. Salmonella was isolated at early and late finishing. MICs of copper sulfate and zinc chloride were measured using agar dilution. Antimicrobial susceptibility was tested using the Kirby-Bauer method, and 283 isolates were serotyped. We amplified pcoA and czcD genes that encode Cu2+ and Zn2+ tolerance, respectively. Of the 283 isolates, 113 (48%) showed Cu2+ tolerance at 24 mM and 164 (58%) showed Zn2+ tolerance at 8 mM. In multivariate analysis, serotype and source of isolates were significantly associated with Cu2+ tolerance (P < 0.001). Fecal isolates were more likely to be Cu2+ tolerant than those of feed origin (odds ratio [OR], 27.0; 95% confidence interval [CI], 2.8 to 250; P = 0.0042) or environmental origin (OR, 5.8), implying the significance of gastrointestinal selective pressure. Salmonella enterica serotypes Typhimurium and Heidelberg, highly significant for public health, had higher odds of having >20 mM MICs of Cu2+ than did “other” serotypes. More than 60% of Salmonella isolates with resistance type (R-type) AmStTeKm (32 of 53) carried pcoA; only 5% with R-type AmClStSuTe carried this gene. czcD gene carriage was significantly associated with a higher Zn2+ MIC (P < 0.05). The odds of having a high Zn2+ MIC (≥8 mM) were 14.66 times higher in isolates with R-type AmClStSuTe than in those with R-type AmStTeKm (P < 0.05). The findings demonstrate strong association between heavy metal tolerance and antimicrobial resistance, particularly among Salmonella serotypes important in public health. PMID:24487542

Thresholds for short-term acid and aluminum impacts on Atlantic salmon smolts

USGS Publications Warehouse

McCormick, Stephen D.; Lerner, Darrren T.; Regish, Amy M.; O'Dea, Michael F.; Monette, Michelle Y.

2012-01-01

Although the negative effects of acid and aluminum (Al) on smolt development have been known for some time, the thresholds for impact of short-term exposure of several days that may occur during episodic acidification have not been systematically examined. In order to determine the levels of acid and Al that impact juvenile Atlantic salmon, smolts and yolk-sac larvae were exposed to three pH levels (6.0, 5.7, and 5.3) and four added Al levels (0, 40, 80 and 175 μg/L total Al) for 48 h. Following this treatment, 10 smolts were sampled in freshwater and another 10 were subjected to a 24 h seawater challenge (35 ppt). Survival of yolk-sac larvae was > 96% in all acid and Al treatments. All smolts died within 48 h at pH 5.3, 175 μg L− 1 Al. There were some mortalities in freshwater at pH 5.3, 80 μg L− 1 Al and pH 5.7, 175 μg L− 1 Al, and further mortalities when these fish were transferred to seawater. Mortalities in these groups were associated with decreased plasma chloride in freshwater and higher plasma chloride in seawater, indicating that these smolts had lost seawater tolerance. Gill Na+/K+-ATPase (NKA) activity decreased at pH 5.7, 175 μg L− 1 Al in freshwater, and further decreases were observed at more moderate pH and Al exposures after transfer to seawater. Hematocrit and plasma glucose were the most sensitive physiological responses, increasing at all Al treatments at pH 5.7 and 5.3 in freshwater. There was no detectable increase in gill Al levels at pH 6.0 with added Al, whereas substantial increases in gill Al were observed in all added Al groups at pH 5.7 and 5.3. Our results demonstrate a critical interaction between acid and Al in their effects on smolts, and that episodic acidification events will negatively impact smolt survival in freshwater and after seawater entry.

Proinflammatory and prothrombotic state in subjects with different glucose tolerance status before cardiovascular disease.

PubMed

Isordia-Salas, Irma; Galván-Plata, María Eugenia; Leaños-Miranda, Alfredo; Aguilar-Sosa, Eberth; Anaya-Gómez, Francisco; Majluf-Cruz, Abraham; Santiago-Germán, David

2014-01-01

Inflammation has been associated with insulin resistance, type 2 diabetes mellitus (T2DM), and atherothrombosis. To determine differences in levels of proinflammatory and prothrombotic markers such as high sensitivity C-reactive protein (hs-CRP) and fibrinogen in subjects with normal glucose tolerance (NGT), prediabetes, and T2DM and to establish their relationship with other cardiovascular risk factors before clinical manifestations of cardiovascular disease. We conducted a nonrandomized, cross-sectional assay in a hospital at México City. The levels of hs-CRP and fibrinogen were measured and compared according to glucose tolerance status. We enrolled 1047 individuals and they were distributed into NGT n = 473, pre-DM n = 250, and T2DM n = 216. There was a statistical difference between NGT and T2DM groups for fibrinogen (P = 0.01) and hs-CRP (P = 0.05). Fibrinogen and hs-CRP showed a significant positive correlation coefficient (r = 0.53, P<0.0001). In a multiple stepwise regression analysis, the variability in fibrinogen levels was explained by age, HbA1c, and hs-CRP (adjusted R² = 0.31, P<0.0001), and for hs-CRP it was explained by BMI and fibrinogen (adjusted R² = 0.33, P<0.0001). Inflammation and prothrombotic state are present in people with T2DM lacking cardiovascular disease. Fibrinogen and Hs-CRP are positively correlated. Fibrinogen and hs-CRP concentrations are predominantly determined by BMI rather than glucose levels.

Proinflammatory and Prothrombotic State in Subjects with Different Glucose Tolerance Status before Cardiovascular Disease

PubMed Central

Isordia-Salas, Irma; Galván-Plata, María Eugenia; Leaños-Miranda, Alfredo; Aguilar-Sosa, Eberth; Anaya-Gómez, Francisco; Majluf-Cruz, Abraham; Santiago-Germán, David

2014-01-01

Background. Inflammation has been associated with insulin resistance, type 2 diabetes mellitus (T2DM), and atherothrombosis. Aim. To determine differences in levels of proinflammatory and prothrombotic markers such as high sensitivity C-reactive protein (hs-CRP) and fibrinogen in subjects with normal glucose tolerance (NGT), prediabetes, and T2DM and to establish their relationship with other cardiovascular risk factors before clinical manifestations of cardiovascular disease. Methods. We conducted a nonrandomized, cross-sectional assay in a hospital at México City. The levels of hs-CRP and fibrinogen were measured and compared according to glucose tolerance status. Results. We enrolled 1047 individuals and they were distributed into NGT n = 473, pre-DM n = 250, and T2DM n = 216. There was a statistical difference between NGT and T2DM groups for fibrinogen (P = 0.01) and hs-CRP (P = 0.05). Fibrinogen and hs-CRP showed a significant positive correlation coefficient (r = 0.53, P<0.0001). In a multiple stepwise regression analysis, the variability in fibrinogen levels was explained by age, HbA1c, and hs-CRP (adjusted R 2 = 0.31, P<0.0001), and for hs-CRP it was explained by BMI and fibrinogen (adjusted R 2 = 0.33, P<0.0001). Conclusion. Inflammation and prothrombotic state are present in people with T2DM lacking cardiovascular disease. Fibrinogen and Hs-CRP are positively correlated. Fibrinogen and hs-CRP concentrations are predominantly determined by BMI rather than glucose levels. PMID:24772446

Electron-irradiated two-terminal, monolithic InP/Ga0.47In0.53As tandem solar cells and annealing of radiation damage

NASA Technical Reports Server (NTRS)

Cotal, H. L.; Walters, Robert J.; Summers, Geoffrey P.; Messenger, Scott R.

1994-01-01

Radiation damage results from two-terminal monolithic InP/Ga(0.47)In(0.53)As tandem solar cells subject to 1 MeV electron irradiation are presented. Efficiencies greater than 22 percent have been measured by the National Renewable Energy Laboratory from 2x2 sq cm cells at 1 sun, AMO (25 C). The short circuit current density, open circuit voltage and fill factor are found to tolerate the same amount of radiation at low fluences. At high fluence levels, slight differences are observed. Decreasing the base amount of radiation at the Ga(0.47)In(0.53)As bottomcell improved the radiation resistance of J(sub sc) dramatically. This is turn, extended the series current flow through the subcell substantially up to a fluence of 3x10(exp 15) cm(exp -2) compared to 3x10(exp 14) cm(exp -2), as observed previously. The degradation of the maximum power output form tandem device is comparable to that from shallow homojunction (SHJ) InP solar cells, and the mechanism responsible for such degradation is explained in terms of the radiation response of the component cells. Annealing studies revealed that the recovery of the tandem cell response is dictated by the annealing characteristics exhibited by SHJ InP solar cells.

Genomic analysis of wig-1 pathways.

PubMed

Sedaghat, Yalda; Mazur, Curt; Sabripour, Mahyar; Hung, Gene; Monia, Brett P

2012-01-01

Wig-1 is a transcription factor regulated by p53 that can interact with hnRNP A2/B1, RNA Helicase A, and dsRNAs, which plays an important role in RNA and protein stabilization. in vitro studies have shown that wig-1 binds p53 mRNA and stabilizes it by protecting it from deadenylation. Furthermore, p53 has been implicated as a causal factor in neurodegenerative diseases based in part on its selective regulatory function on gene expression, including genes which, in turn, also possess regulatory functions on gene expression. In this study we focused on the wig-1 transcription factor as a downstream p53 regulated gene and characterized the effects of wig-1 down regulation on gene expression in mouse liver and brain. Antisense oligonucleotides (ASOs) were identified that specifically target mouse wig-1 mRNA and produce a dose-dependent reduction in wig-1 mRNA levels in cell culture. These wig-1 ASOs produced marked reductions in wig-1 levels in liver following intraperitoneal administration and in brain tissue following ASO administration through a single striatal bolus injection in FVB and BACHD mice. Wig-1 suppression was well tolerated and resulted in the reduction of mutant Htt protein levels in BACHD mouse brain but had no effect on normal Htt protein levels nor p53 mRNA or protein levels. Expression microarray analysis was employed to determine the effects of wig-1 suppression on genome-wide expression in mouse liver and brain. Reduction of wig-1 caused both down regulation and up regulation of several genes, and a number of wig-1 regulated genes were identified that potentially links wig-1 various signaling pathways and diseases. Antisense oligonucleotides can effectively reduce wig-1 levels in mouse liver and brain, which results in specific changes in gene expression for pathways relevant to both the nervous system and cancer.

Phase 1 trial of ALT-801, an interleukin-2/T cell receptor fusion protein targeting p53 (aa264-272)/HLA-A*0201 complex, in patients with advanced malignancies

PubMed Central

Fishman, Mayer N.; Thompson, John A.; Pennock, Gregory K.; Gonzalez, Rene; Diez, Luz M.; Daud, Adil I.; Weber, Jeffery S.; Huang, Bee Y.; Tang, Shamay; Rhode, Peter R.; Wong, Hing C.

2014-01-01

Purpose ALT-801 is a bifunctional fusion protein comprising interleukin-2 (IL-2) linked to a soluble, single-chain T cell receptor domain that recognizes a peptide epitope (aa264-272) of the human p53 antigen displayed on cancer cells in the context of HLA-A*0201 (p53+/HLA-A*0201). We evaluated the safety, pharmacokinetics and pharmacodynamics of ALT-801 in p53+/HLA-A*0201 patients with metastatic malignancies. Experimental Design p53+/HLA-A*0201 patients were treated with ALT-801 on a schedule of 4 daily 15-minute intravenous infusions, then 10 days rest and 4 more daily infusions. Cohorts of patients were treated at 0.015, 0.040, and 0.080 mg/kg/dose. Results Four, sixteen, and six patients were treated at the 0.015, 0.04 and 0.08 mg/kg cohorts, respectively. Two dose limiting toxicities (a grade 4 transient thrombocytopenia and a myocardial infarction) in the 0.08 mg/kg cohort established the maximum tolerated dose (MTD) at 0.04 mg/kg. Patients treated at the MTD experienced toxicities similar to those associated with high-dose IL-2 but of lesser severity. The serum half-life of ALT-801 was 4 hours and ALT-801 serum recovery was as expected based on the dose administered. ALT-801 treatment induced an increase of serum interferon-γ but not tumor necrosis factor-α. Response assessment showed 10 subjects with stable disease at at least 11 weeks, and in one who had melanoma metastasis, there is an ongoing complete absence of identifiable disease after resection of radiographically identified lesions. Conclusion This first-in-man study defines an ALT-801 regimen that can be administered safely and is associated with immunological changes of potential antitumor relevance. PMID:21994418

Genomic Analysis of wig-1 Pathways

PubMed Central

Sedaghat, Yalda; Mazur, Curt; Sabripour, Mahyar; Hung, Gene; Monia, Brett P.

2012-01-01

Background Wig-1 is a transcription factor regulated by p53 that can interact with hnRNP A2/B1, RNA Helicase A, and dsRNAs, which plays an important role in RNA and protein stabilization. in vitro studies have shown that wig-1 binds p53 mRNA and stabilizes it by protecting it from deadenylation. Furthermore, p53 has been implicated as a causal factor in neurodegenerative diseases based in part on its selective regulatory function on gene expression, including genes which, in turn, also possess regulatory functions on gene expression. In this study we focused on the wig-1 transcription factor as a downstream p53 regulated gene and characterized the effects of wig-1 down regulation on gene expression in mouse liver and brain. Methods and Results Antisense oligonucleotides (ASOs) were identified that specifically target mouse wig-1 mRNA and produce a dose-dependent reduction in wig-1 mRNA levels in cell culture. These wig-1 ASOs produced marked reductions in wig-1 levels in liver following intraperitoneal administration and in brain tissue following ASO administration through a single striatal bolus injection in FVB and BACHD mice. Wig-1 suppression was well tolerated and resulted in the reduction of mutant Htt protein levels in BACHD mouse brain but had no effect on normal Htt protein levels nor p53 mRNA or protein levels. Expression microarray analysis was employed to determine the effects of wig-1 suppression on genome-wide expression in mouse liver and brain. Reduction of wig-1 caused both down regulation and up regulation of several genes, and a number of wig-1 regulated genes were identified that potentially links wig-1 various signaling pathways and diseases. Conclusion Antisense oligonucleotides can effectively reduce wig-1 levels in mouse liver and brain, which results in specific changes in gene expression for pathways relevant to both the nervous system and cancer. PMID:22347364

Evolution of predetermined germ cells in vertebrate embryos: implications for macroevolution.

PubMed

Johnson, Andrew D; Drum, Matthew; Bachvarova, Rosemary F; Masi, Thomas; White, Mary E; Crother, Brian I

2003-01-01

The germ line is established in animal embryos with the formation of primordial germ cells (PGCs), which give rise to gametes. Therefore, the need to form PGCs can act as a developmental constraint by inhibiting the evolution of embryonic patterning mechanisms that compromise their development. Conversely, events that stabilize the PGCs may liberate these constraints. Two modes of germ cell determination exist in animal embryos: (a) either PGCs are predetermined by the inheritance of germ cell determinants (germ plasm) or (b) PGCs are formed by inducing signals secreted by embryonic tissues (i.e., regulative determination). Surprisingly, among the major extant amphibian lineages, one mechanism is found in urodeles and the other in anurans. In anuran amphibians PGCs are predetermined by germ plasm; in urodele amphibians PGCs are formed by inducing signals. To determine which mechanism is ancestral to the tetrapod lineage and to understand the pattern of inheritance in higher vertebrates, we used a phylogenetic approach to analyze basic morphological processes in both groups and correlated these with mechanisms of germ cell determination. Our results indicate that regulative germ cell determination is a property of embryos retaining ancestral embryological processes, whereas predetermined germ cells are found in embryos with derived morphological traits. These correlations suggest that regulative germ cell formation is an important developmental constraint in vertebrate embryos, acting before the highly conserved pharyngula stage. Moreover, our analysis suggests that germ plasm has evolved independently in several lineages of vertebrate embryos.

Characteristics of two novel cold- and salt-tolerant ammonia-oxidizing bacteria from Liaohe Estuarine Wetland.

PubMed

Huang, Xiao; Bai, Jie; Li, Kui-Ran; Zhao, Yang-Guo; Tian, Wei-Jun; Dang, Jia-Jia

2017-01-15

To achieve a better contaminant removal efficiency in a low-temperature and high-salt environment, two novel strains of cold- and salt-tolerant ammonia-oxidizing bacteria (AOB), i.e., Ochrobactrum sp. (HXN-1) and Aquamicrobium sp. (HXN-2), were isolated from the surface sediment of Liaohe Estuarine Wetland (LEW), China. The optimization of initial ammonia nitrogen concentration, pH, carbon-nitrogen ratio, and petroleum hydrocarbons (PHCs) to improve the ammonia-oxidation capacity of the two bacterial strains was studied. Both bacterial strains showed a high ammonia nitrogen removal rate of over 80% under a high salinity of 10‰. Even at a temperature as low as 15°C, HXN-1 and HXN-2 could achieve an ammonia nitrogen removal rate of 53% and 62%, respectively. The cold- and salt-tolerant AOB in this study demonstrated a high potential for ammonia nitrogen removal from LEW. Copyright © 2016 Elsevier Ltd. All rights reserved.

Amphibian tail regeneration in space: effect on the pigmentation of the blastema

NASA Astrophysics Data System (ADS)

Grinfeld, S.; Foulquier, F.; Mitashov, V.; Bruchlinskaia, N.; Duprat, A. M.

In Urodele amphibians, the tail regenerates after section. This regeneration, including tissues as different as bone (vertebrae), muscle, epidermis and central nervous system (spinal cord), was studied in adult Pleurodeles sent aboard the russian satellite Bion 10 and compared with tail regeneration in synchronous controls. Spinal cord, muscle and cartilage regeneration occurred in space animals as in synchronous controls. One of the most important differences between the two groups was the pigmentation of the blastemas: it was shown in laboratory, to be not due to a difference in light intensity.

Efficacy and Tolerability of Two Different Kinds of Titration of Paroxetine Hydrocloride Solution: an Observational Study.

PubMed

Ielmini, Marta; Poloni, Nicola; Caselli, Ivano; Bianchi, Lucia; Diurni, Marcello; Vender, Simone; Callegari, Camilla

2018-03-13

Depressive disorders are expected to be the second highest cause of morbidity in the world until few years. Moreover, patients with depression frequently show many side effects and low compliance to therapy. To find a more tolerated and more efficacy therapy is a growing need. This observational study investigates the efficacy, safety and tolerability of paroxetine hydrochloride comparing slow versus standard titration in a population affected by Depressive Disoders (according to DSM 5). 186 outpatients were assessed throught the following scales: Hamilton Depression Rating Scale (HDRS) for depression and World Health Organization Quality of Life Scale Bref for the perceived quality of life (WHOQOL BREF). Treatment-emerged Adverse Events (TEAEs) were recorded throught self-reports. Statystical analysys was performed by GraphPad Prism Version 5.1. The efficacy of paroxetine was confirmed in both titrations by the number of clinical remitters (HDRS ≤ 7 at 12 weeks for 53% of the standard titration group and 58% of the slow titration group), without differences. About safety and tolerability there were more frequent TEAEs among the standard titration group (p < 0.01). Comparing WHOQOL BREF between the two groups at the recruitment and at the twelth week emerged a statistically significant difference (p = 0.003), with highest scores reached in slow titration group. Although the short observation period is an evident limit, this study is consistent to the literature about the efficacy of both titrations of paroxetine to improve depression and shows promising results about the increased tolerability of paroxetine slow titration.

Evolutionary Genetics of Hypoxia Tolerance in Cetaceans during Diving

PubMed Central

Tian, Ran; Wang, Zhengfei; Niu, Xu; Zhou, Kaiya; Xu, Shixia; Yang, Guang

2016-01-01

Hypoxia was a major challenge faced by cetaceans during the course of secondary aquatic adaptation. Although physiological traits of hypoxia tolerance in cetaceans have been well characterized, the underlying molecular mechanisms remain unknown. We investigated the sequences of 17 hypoxia-tolerance-related genes in representative cetaceans to provide a comprehensive insight into the genetic basis of hypoxia tolerance in these animals. Genes involved in carrying and transporting oxygen in the blood and muscle (hemoglobin-α and β, myoglobin), and genes involved in the regulation of vasoconstriction (endothelin-1, -2, and -3; endothelin receptor type A and B; adrenergic receptor α-1D; and arginine vasopressin) appear to have undergone adaptive evolution, evidence for positive selection on their particular sites, and radical physiochemical property changes of selected condons. Interestingly, “long-diving” cetaceans had relatively higher ω (dN/dS) values than “short-diving” cetaceans for the hemoglobin β gene, indicating divergent selective pressure presented in cetacean lineages with different diving abilities. Additionally, parallel positive selection or amino acid changes (ADRA1D: P50A, A53G, AVPR1B: I/V270T) among animals exposed to different hypoxia habitats reflect functional convergence or similar genetic mechanisms of hypoxia tolerance. In summary, positive selection, divergent selective pressures, and parallel evolution at the molecular level provided some new insights into the genetic adaptation of hypoxia tolerance. PMID:26912402

Tolerability and efficacy of newly developed penile injection of cross-linked dextran and polymethylmethacrylate mixture on penile enhancement: 6 months follow-up.

PubMed

Yang, D Y; Lee, W K; Kim, S C

2013-05-01

Cross-linked dextran and polymethylmethacrylate mixture (Lipen-10) is newly developed tissue filler. The purpose of this study was to evaluate tolerability and efficacy of Lipen-10 on penile enhancement. Twenty adult males were included in this study. Lipen-10 was injected into the subcutaneous tissue of the penile shaft. The penile girth and length were measured in the flaccid state, before and 1, 3 and 6 months after the injection. The circumference increased by 3.7±1.2 cm (50.8%, P<0.0001) at penile base, 4.2±0.9 cm (59.0%, P<0.001) at mid-shaft, and 3.8±1.0 cm (53.2%, P<0.0001) at distal shaft and the length increased by 2.3±1.4 cm (63.2%, P<0.001). There was, however, no significant difference between 3 and 6 months post-treatment in girth and length (P-values: 0.796, 0.498, 0.600 and 0.084 for penile base, mid- and distal-shaft and length, respectively). The complications were only one mild asymmetry of penile shape and one 5-mm-sized nodule in the injected site. There were no clinically significant adverse events in all subjects. Penile injection of Lipen-10 led to a significant increase in penile size, showed a good durability and was well-tolerated, without serious adverse events. These results suggest that penile injection of Lipen-10 may be a new effective method for penile enhancement.

40 CFR 180.1084 - Monocarbamide dihydrogen sulfate; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2010 CFR

2010-07-01

... RESIDUES IN FOOD Exemptions From Tolerances § 180.1084 Monocarbamide dihydrogen sulfate; exemption from the... when used as a herbicide or desiccant in or on all raw agricultural commodities. [53 FR 12152, Apr. 13...

40 CFR 180.1084 - Monocarbamide dihydrogen sulfate; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2011 CFR

2011-07-01

... RESIDUES IN FOOD Exemptions From Tolerances § 180.1084 Monocarbamide dihydrogen sulfate; exemption from the... when used as a herbicide or desiccant in or on all raw agricultural commodities. [53 FR 12152, Apr. 13...

Doxycycline potentiates antitumor effect of cyclophosphamide in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chhipa, Rishi Raj; Singh, Sandeep; Surve, Sachin V.

2005-02-01

Cyclophosphamide (CPA) is a widely used chemotherapeutic drug in neoplasias. It is a DNA and protein alkylating agent that has a broad spectrum of activity against variety of neoplasms including breast cancer. The therapeutic effectiveness of CPA is limited by the high-dose hematopoietic, renal, and cardiac toxicity that accompanies the systemic distribution of liver-derived activated drug metabolites. The present study examines the potential of combining well-tolerated antibiotic doxycycline (DOX) with CPA and understanding the mechanism of cell killing. Interestingly, we found that DOX significantly enhances the tumor regression activity of CPA on xenograft mice model bearing MCF-7 cells. DOX alsomore » potentiates MCF-7 cell killing by CPA in vitro. In presence of DOX (3 {mu}g/ml), the IC{sub 50} value of CPA decreased significantly from 10 to 2.5 mM. Additional analyses indicate that the tumor suppressor p53 and p53-regulated proapoptotic Bax were upregulated in vivo and in vitro following CPA treatment in combination with DOX, suggesting that upregulation of p53 may contribute to the enhancement of antitumor effect of CPA by DOX. Furthermore, downregulation of antiapoptotic Bcl-2 was observed in animals treated with CPA and CPA plus DOX when compared to untreated or DOX-treated groups. Our results raise the possibility that this combination chemotherapeutic regimen may lead to additional improvements in treatment of breast cancer.« less

Real-world results of ibrutinib in patients with relapsed or refractory chronic lymphocytic leukemia: data from 95 consecutive patients treated in a compassionate use program. A study from the Swedish Chronic Lymphocytic Leukemia Group

PubMed Central

Winqvist, Maria; Asklid, Anna; Andersson, PO; Karlsson, Karin; Karlsson, Claes; Lauri, Birgitta; Lundin, Jeanette; Mattsson, Mattias; Norin, Stefan; Sandstedt, Anna; Hansson, Lotta; Österborg, Anders

2016-01-01

Ibrutinib, a Bruton’s tyrosine kinase inhibitor is approved for relapsed/refractory and del(17p)/TP53 mutated chronic lymphocytic leukemia. Discrepancies between clinical trials and routine health-care are commonly observed in oncology. Herein we report real-world results for 95 poor prognosis Swedish patients treated with ibrutinib in a compassionate use program. Ninety-five consecutive patients (93 chronic lymphocytic leukemia, 2 small lymphocytic leukemia) were included in the study between May 2014 and May 2015. The median age was 69 years. 63% had del(17p)/TP53 mutation, 65% had Rai stage III/IV, 28% had lymphadenopathy ≥10cm. Patients received ibrutinib 420 mg once daily until progression. At a median follow-up of 10.2 months, the overall response rate was 84% (consistent among subgroups) and 77% remained progression-free. Progression-free survival and overall survival were significantly shorter in patients with del(17p)/TP53 mutation (P=0.017 and P=0.027, log-rank test); no other factor was significant in Cox proportional regression hazards model. Ibrutinib was well tolerated. Hematomas occurred in 46% of patients without any major bleeding. Seven patients had Richter’s transformation. This real-world analysis on consecutive chronic lymphocytic leukemia patients from a well-defined geographical region shows the efficacy and safety of ibrutinib to be similar to that of pivotal trials. Yet, del(17p)/TP53 mutation remains a therapeutic challenge. Since not more than half of our patients would have qualified for the pivotal ibrutinib trial (RESONATE), our study emphasizes that real-world results should be carefully considered in future with regards to new agents and new indications in chronic lymphocytic leukemia. PMID:27198718

Real-world results of ibrutinib in patients with relapsed or refractory chronic lymphocytic leukemia: data from 95 consecutive patients treated in a compassionate use program. A study from the Swedish Chronic Lymphocytic Leukemia Group.

PubMed

Winqvist, Maria; Asklid, Anna; Andersson, P O; Karlsson, Karin; Karlsson, Claes; Lauri, Birgitta; Lundin, Jeanette; Mattsson, Mattias; Norin, Stefan; Sandstedt, Anna; Hansson, Lotta; Österborg, Anders

2016-12-01

Ibrutinib, a Bruton's tyrosine kinase inhibitor is approved for relapsed/refractory and del(17p)/TP53 mutated chronic lymphocytic leukemia. Discrepancies between clinical trials and routine health-care are commonly observed in oncology. Herein we report real-world results for 95 poor prognosis Swedish patients treated with ibrutinib in a compassionate use program. Ninety-five consecutive patients (93 chronic lymphocytic leukemia, 2 small lymphocytic leukemia) were included in the study between May 2014 and May 2015. The median age was 69 years. 63% had del(17p)/TP53 mutation, 65% had Rai stage III/IV, 28% had lymphadenopathy ≥10cm. Patients received ibrutinib 420 mg once daily until progression. At a median follow-up of 10.2 months, the overall response rate was 84% (consistent among subgroups) and 77% remained progression-free. Progression-free survival and overall survival were significantly shorter in patients with del(17p)/TP53 mutation (P=0.017 and P=0.027, log-rank test); no other factor was significant in Cox proportional regression hazards model. Ibrutinib was well tolerated. Hematomas occurred in 46% of patients without any major bleeding. Seven patients had Richter's transformation. This real-world analysis on consecutive chronic lymphocytic leukemia patients from a well-defined geographical region shows the efficacy and safety of ibrutinib to be similar to that of pivotal trials. Yet, del(17p)/TP53 mutation remains a therapeutic challenge. Since not more than half of our patients would have qualified for the pivotal ibrutinib trial (RESONATE), our study emphasizes that real-world results should be carefully considered in future with regards to new agents and new indications in chronic lymphocytic leukemia. Copyright© Ferrata Storti Foundation.

Oral contraceptive plus antiandrogen therapy and cardiometabolic risk in polycystic ovary syndrome.

PubMed

Harmanci, Ayla; Cinar, Nese; Bayraktar, Miyase; Yildiz, Bulent Okan

2013-01-01

Oral contraceptives alone or in combination with antiandrogens are commonly used in the treatment for polycystic ovary syndrome (PCOS). We aimed to determine the effects of ethinyl estradiol/drospirenone (EE-DRSP) plus spironolactone therapy on inflammation and cardiometabolic risk in PCOS. Prospective cohort study. Twenty-three lean, normal glucose-tolerant patients with PCOS and 23 age- and body mass index (BMI)-matched healthy control women. Androgens, high-sensitivity C-reactive protein (hsCRP), homocysteine, lipids, fasting insulin, and glucose levels during a standard 75-g, 2-h oral glucose tolerance test were measured. Patients with PCOS were evaluated before and after receiving EE-DRSP (3 mg/30 μg) plus spironolactone (100 mg/day) for 6 months. Healthy controls were evaluated at baseline only. hsCRP, homocysteine, lipids, insulin and glucose levels were similar between patient and control groups at baseline. EE-DRSP plus spironolactone increased hsCRP and homocysteine levels in patients with PCOS (0.50 ± 0.28 vs 1.5 ± 1.3 mg/l, P < 0.05 and 13.1 ± 5.2 vs 17.6 ± 5.3 μm, P < 0.05, respectively). BMI, waist-to-hip ratio, LDL, HDL cholesterol and triglycerides, and glucose tolerance did not change. Modified Ferriman-Gallwey hirsutism scores, testosterone levels and free androgen index improved (9.1 ± 4.2 vs 6.2 ± 3.4, P = 0.001; 80.6 ± 31.1 47.8 ± 20.3 ng/dl, P < 0.05; and 10.5 ± 7.4 vs 1.1 ± 0.8, P < 0.001, respectively). EE-DRSP plus spironolactone therapy in 6 months improves androgen excess in lean PCOS women without any adverse effects on adiposity, glucose tolerance status or lipid profile. However, this combination increases hsCRP and homocysteine levels. © 2012 Blackwell Publishing Ltd.

Association between HLA-B Alleles and Carbamazepine-Induced Maculopapular Exanthema and Severe Cutaneous Reactions in Thai Patients

PubMed Central

Chaichan, Chonlawat; Nakkrut, Thapanat; Satapornpong, Patompong; Jaruthamsophon, Kanoot; Jantararoungtong, Thawinee; Koomdee, Napatrupron; Sririttha, Suthida; Medhasi, Sadeep; Oo-Puthinan, Sarawut; Rerkpattanapipat, Ticha; Klaewsongkram, Jettanong; Rerknimitr, Pawinee; Tuchinda, Papapit; Chularojanamontri, Leena; Tovanabutra, Napatra; Puangpetch, Apichaya

2018-01-01

The HLA-B∗15:02 allele has been reported to have a strong association with carbamazepine-induced Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN) in Thai patients. The HLA-B alleles associated with carbamazepine-induced maculopapular exanthema (MPE) and the drug reaction with eosinophilia and systemic symptoms (DRESS) among the Thai population have never been reported. The aim of the present study was to carry out an analysis of the involvement of HLA-B alleles in carbamazepine-induced cutaneous adverse drug reactions (cADRs) in the Thai population. A case-control study was performed by genotyping the HLA-B alleles of Thai carbamazepine-induced hypersensitivity reaction patients (17 MPE, 16 SJS/TEN, and 5 DRESS) and 271 carbamazepine-tolerant controls. We also recruited 470 healthy Thai candidate subjects who had not taken carbamazepine. HLA-B∗15:02 showed a significant association with carbamazepine-induced MPE (P = 0.0022, odds ratio (OR) (95% confidence interval [CI]) = 7.27 (2.04–25.97)) and carbamazepine-induced SJS/TEN (P = 4.46 × 10−13; OR (95% CI) = 70.91(19.67–255.65)) when compared with carbamazepine-tolerant controls. Carbamazepine-induced SJS/TEN also showed an association with HLA-B∗15:21 allele (P = 0.013; OR (95% CI) = 9.54 (1.61–56.57)) when compared with carbamazepine-tolerant controls. HLA-B∗58:01 allele was significantly related to carbamazepine-induced MPE (P = 0.007; OR (95% CI) = 4.73 (1.53–14.66)) and DRESS (P = 0.0315; OR (95% CI) = 7.55 (1.20–47.58)) when compared with carbamazepine-tolerant controls. These alleles may serve as markers to predict carbamazepine-induced cADRs in the Thai population. PMID:29546073

Hair cell regeneration in sensory epithelia from the inner ear of a urodele amphibian.

PubMed

Taylor, Ruth R; Forge, Andrew

2005-03-28

The capacity of urodele amphibians to regenerate a variety of body parts is providing insight into mechanisms of tissue regeneration in vertebrates. In this study the ability of the newt, Notophthalmus viridescens, to regenerate inner ear hair cells in vitro was examined. Intact otic capsules were maintained in organotypic culture. Incubation in 2 mM gentamicin for 48 hours resulted in ablation of all hair cells from the saccular maculae. Thus, any hair cell recovery was not due to repair of damaged hair cells. Immature hair cells were subsequently observed at approximately 12 days posttreatment. Their number increased over the following 7-14 days to reach approximately 30% of the normal number. Following incubation of damaged tissue with bromodeoxyuridine (BrdU), labeled nuclei were confined strictly within regions of hair cell loss, indicating that supporting cells entered S-phase. Double labeling of tissue with two different hair cell markers and three different antibodies to BrdU in various combinations, however, all showed that the nuclei of cells that labeled with hair cell markers did not label for BrdU. This suggested that the new hair cells were not derived from those cells that had undergone mitosis. When mitosis was blocked with aphidicolin, new hair cells were still generated. The results suggest that direct phenotypic conversion of supporting cells into hair cells without an intervening mitotic event is a major mechanism of hair cell regeneration in the newt. A similar mechanism has been proposed for the hair cell recovery phenomenon observed in the vestibular organs of mammals. Copyright 2005 Wiley-Liss, Inc.

Impact of the lay-off length on +Gz tolerance.

PubMed

Mikuliszyn, Romuald; Kowalski, Wieslaw; Kowalczuk, Krzysztof

2002-07-01

There are many factors affecting pilots' +Gz-tolerance. Recently, attention of the aviation community has been focused on lay-off and it's impact on +Gz-tolerance. Pilots of the Polish Air Force (PAF) have dealt with that problem for several years now. The aim of the study was to provide insight on how lay-off periods with different duration impact +Gz-tolerance. 95 male jet pilots from the PAF participated in the study. Every one had at least two weeks lay-off period (non-medical reasons). Subjects were divided into four groups according to the length of lay-off period (2-4 weeks; 5-13 weeks; 14-26 weeks; 27-154 weeks), All pilots were subjected to a centrifuge exposure in GOR (0.1 G/s) or ROR (1.0 G/s) profiles, depending on the pre-lay-off exposure. Post-lay-off exposures were carried out directly after lay-off. 18 jet pilots without any lay-off constituted the control group. The difference between pre- and post-lay-off G-tolerance limit (-0,93 +/- 0,53) was statistically significant (p<0.01) only for one group, where lay-off period ranged between two and four weeks. No statistically significant differences were found where influence of other factors like total and yearly flight hours, heart rate gain (AHR) or physical activity measured as maximal oxygen intake were considered. 2-4 weeks of lay-off period decreases +Gz tolerance is statistically significant manner. Subsequent increase of lay-off period does not result in mean tolerance changes for group, however in certain individuals critical decrement of +Gz tolerance occurs. Total and last year flying hours, physical fitness does not modify impact of lay-off period on +Gz tolerance.

A Placebo-Controlled Study on the Effects of the Glucagon-Like Peptide-1 Mimetic, Exenatide, on Insulin Secretion, Body Composition and Adipokines in Obese, Client-Owned Cats

PubMed Central

Hoelmkjaer, Kirsten M.; Wewer Albrechtsen, Nicolai J.; Holst, Jens J.; Cronin, Anna M.; Nielsen, Dorte H.; Mandrup-Poulsen, Thomas; Bjornvad, Charlotte R.

2016-01-01

Glucagon-like Peptide-1 mimetics increase insulin secretion and reduces body weight in humans. In lean, healthy cats, short-term treatment has produced similar results, whereas the effect in obese cats or with extended duration of treatment is unknown. Here, prolonged (12 weeks) treatment with the Glucagon-like Peptide-1 mimetic, exenatide, was evaluated in 12 obese, but otherwise healthy, client-owned cats. Cats were randomized to exenatide (1.0 μg/kg) or placebo treatment twice daily for 12 weeks. The primary endpoint was changes in insulin concentration; the secondary endpoints were glucose homeostasis, body weight, body composition as measured by dual-energy x-ray absorptiometry and overall safety. An intravenous glucose tolerance test (1 g/kg body weight) was conducted at week 0 and week 12. Exenatide did not change the insulin concentration, plasma glucose concentration or glucose tolerance (P>0.05 for all). Exenatide tended to reduce body weight on continued normal feeding. Median relative weight loss after 12 weeks was 5.1% (range 1.7 to 8.4%) in the exenatide group versus 3.2% (range -5.3 to 5.7%) in the placebo group (P = 0.10). Body composition and adipokine levels were unaffected by exenatide (P>0.05). Twelve weeks of exenatide was well-tolerated, with only two cases of mild, self-limiting gastrointestinal signs and a single case of mild hypoglycemia. The long-term insulinotropic effect of exenatide appeared less pronounced in obese cats compared to previous short-term studies in lean cats. Further investigations are required to fully elucidate the effect on insulin secretion, glucose tolerance and body weight in obese cats. PMID:27136422

An assessment of residents’ and fellows’ personal finance literacy: an unmet medical education need

PubMed Central

White, Andrew J.; Hiller, Katherine M.; Amini, Richard; Jeffe, Donna B.

2017-01-01

Objectives This study aimed to assess residents’ and fellows’ knowledge of finance principles that may affect their personal financial health. Methods A cross-sectional, anonymous, web-based survey was administered to a convenience sample of residents and fellows at two academic medical centers.  Respondents answered 20 questions on personal finance and 28 questions about their own financial planning, attitudes, and debt. Questions regarding satisfaction with one’s financial condition and investment-risk tolerance used a 10-point Likert scale (1=lowest, 10=highest).  Of 2,010 trainees, 422 (21%) responded (median age 30 years; interquartile range, 28-33).   Results The mean quiz score was 52.0% (SD = 19.1). Of 299 (71%) respondents with student loan debt, 144 (48%) owed over $200,000.  Many respondents had other debt, including 86 (21%) with credit card debt. Of 262 respondents with retirement savings, 142 (52%) had saved less than $25,000. Respondents’ mean satisfaction with their current personal financial condition was 4.8 (SD = 2.5) and investment-risk tolerance was 5.3 (SD = 2.3). Indebted trainees reported lower satisfaction than trainees without debt (4.4 vs. 6.2, F (1,419) = 41.57, p < .001).   Knowledge was moderately correlated with investment-risk tolerance (r=0.41, p < .001), and weakly correlated with satisfaction with financial status (r=0.23, p < .001). Conclusions Residents and fellows had low financial literacy and investment-risk tolerance, high debt, and deficits in their financial preparedness.  Adding personal financial education to the medical education curriculum would benefit trainees.  Providing education in areas such as budgeting, estate planning, investment strategies, and retirement planning early in training can offer significant long-term benefits. PMID:28557777

An assessment of residents' and fellows' personal finance literacy: an unmet medical education need.

PubMed

Ahmad, Fahd A; White, Andrew J; Hiller, Katherine M; Amini, Richard; Jeffe, Donna B

2017-05-29

This study aimed to assess residents' and fellows' knowledge of finance principles that may affect their personal financial health. A cross-sectional, anonymous, web-based survey was administered to a convenience sample of residents and fellows at two academic medical centers.  Respondents answered 20 questions on personal finance and 28 questions about their own financial planning, attitudes, and debt. Questions regarding satisfaction with one's financial condition and investment-risk tolerance used a 10-point Likert scale (1=lowest, 10=highest).  Of 2,010 trainees, 422 (21%) responded (median age 30 years; interquartile range, 28-33). The mean quiz score was 52.0% (SD = 19.1). Of 299 (71%) respondents with student loan debt, 144 (48%) owed over $200,000.  Many respondents had other debt, including 86 (21%) with credit card debt. Of 262 respondents with retirement savings, 142 (52%) had saved less than $25,000. Respondents' mean satisfaction with their current personal financial condition was 4.8 (SD = 2.5) and investment-risk tolerance was 5.3 (SD = 2.3). Indebted trainees reported lower satisfaction than trainees without debt (4.4 vs. 6.2, F (1,419) = 41.57, p < .001).   Knowledge was moderately correlated with investment-risk tolerance (r=0.41, p < .001), and weakly correlated with satisfaction with financial status (r=0.23, p < .001). Residents and fellows had low financial literacy and investment-risk tolerance, high debt, and deficits in their financial preparedness.  Adding personal financial education to the medical education curriculum would benefit trainees.  Providing education in areas such as budgeting, estate planning, investment strategies, and retirement planning early in training can offer significant long-term benefits.

Tolerance to early human milk feeding is not compromised by indomethacin in preterm infants with persistent ductus arteriosus.

PubMed

Bellander, M; Ley, D; Polberger, S; Hellström-Westas, L

2003-09-01

Early human milk feeding is beneficial for gut and brain development. Persistent ductus arteriosus (PDA) and indomethacin may compromise enteral function in preterm infants. For many years enteral milk feedings have continued in preterm infants receiving indomethacin for PDA. The aim of this study was to investigate whether this strategy is efficient in terms of risks and tolerance to early enteral feeding. This retrospective study included 64 inborn infants of <29 wk gestational age (GA), 32 infants who received indomethacin for symptomatic PDA (case infants) and 32 matched controls. Case infants had a mean (SD) GA of 26.3 wk (1.3) and body weight 839 g (203) versus controls GA 26.4 wk (1.2) and body weight 896 g (213) (p = 0.82 and 0.27, respectively). Case infants had higher respiratory morbidity; 90.6% versus 50% of controls needed mechanical ventilation (p = 0.000). Case infants received human milk from a median (range) age of 4.0 h (1.5-27.5), and controls from 5.3 h (2.0-38.0) (p = 0.092). The first dose of indomethacin was given at a mean age of 1.7 d (1.0). There were no differences between the two groups in feeding volumes or gastric residuals on days 1 to 7. Mean (SD) feeding volume on day 7 was 64 ml/kg (31) in case infants and 76 ml/kg (30) in controls (p = 0.23). Four infants developed necrotizing enterocolitis: two case infants and two controls (p = 1.00). Early enteral feeding with human milk, starting within the first hours of life, seems to be as well tolerated in preterm infants treated with indomethacin for PDA as in their matched controls.

Improved glucose tolerance and insulin sensitivity after electrical stimulation-assisted cycling in people with spinal cord injury.

PubMed

Jeon, J Y; Weiss, C B; Steadward, R D; Ryan, E; Burnham, R S; Bell, G; Chilibeck, P; Wheeler, G D

2002-03-01

Longitudinal training. The purpose was to determine the effect of electrical stimulation (ES)-assisted cycling (30 min/day, 3 days/week for 8 weeks) on glucose tolerance and insulin sensitivity in people with spinal cord injury (SCI). The Steadward Centre, Alberta, Canada. Seven participants with motor complete SCI (five males and two females aged 30 to 53 years, injured 3-40 years, C5-T10) underwent 2-h oral glucose tolerance tests (OGTT, n=7) and hyperglycaemic clamp tests (n=3) before and after 8 weeks of training with ES-assisted cycling. Results indicated that subjects' glucose level were significantly lower at 2 h OGTT following 8 weeks of training (122.4+/-10 vs 139.9+/-16, P=0.014). Two-hour hyperglycaemic clamps tests showed improvement in all three people for glucose utilisation and in two of three people for insulin sensitivity. These results suggested that exercise with ES-assisted cycling is beneficial for the prevention and treatment of Type 2 diabetes mellitus in people with SCI. Supported by Alberta Paraplegic Foundation, Therapeutic Alliance.

[Significance of 2-hour blood glucose after standardized steamed bread meal in diabetic screening].

PubMed

Liu, Yongquan; Tian, Hui; Fang, Fusheng; Xiao, Haiying; Lu, Yanhui; Shao, Yinghong; Li, Chunlin

2014-05-13

To explore the significance of 2-hour blood glucose after standardized steamed bread meal (SB-2 hBG) in diabetic screening. A retrospective study was conducted for diabetic screening data of annual check-up at PLA General Hospital from May 1996 to June 2002. And 100 g standardized steamed bread meal test was performed for non-diabetic subjects. Those subjects with SB-2 h BG ≥ 7.2 mmol/L underwent a 75 g oral glucose tolerance test (OGTT) within 2 weeks to determine whether the diagnosis of diabetes mellitus (DM) could be established (WHO, 1985, 1999, Diagnostic Criteria for Diabetes). By extracting the data for 7 consecutive years, we analyzed the significance and the cut-off point of SB-2 hBG in the diagnosis of DM and investigated the changes of blood glucose curves in different glucose tolerance status after different glucose loading tests. A total of 3 343 subjects with complete information were recruited. There were 3 101 males and 242 females with an age range of 40-94 years. According to the results of OGTT, 429 (12.8%) subjects were diagnosed as DM, 1 405 (42.1%) were diagnosed as impaired glucose regulation (IGR) and 1 509(45.1%) had normal glucose tolerance (NGT).With a deterioration of glucose tolerance status, the difference between SB-2 hBG and OGTT-2 hBG increased gradually in 3 group (P < 0.01), namely the NGT group 1.7 (0.8-2.8) mmol/L, IGR group -0.4 (-1.2-0.6) mmol/L, DM group -2.7(-3.8-1.1) mmol/L. The cut-off points of FBG for the diagnosis of IGR and DM were 5.3 (sensitivity of 46.2%, specificity of 68.5%) and 5.6 (sensitivity of 57.4%, specificity of 76.4%) mmol/L respectively. The cut-off points of SB-2 h BG were 8.2 mmol/L for the diagnosis of IGR (sensitivity of 63.8%, specificity of 59.9%) and 9.2 mmol/L for the diagnosis of DM (sensitivity of 66.4%, specificity of 76.4%).If the cut-off point of SB-2 h BG was set at 7.2 mmol/L, the diagnostic specificity became quite low.However, at 11.1 mmol/L, the sensitivity was 31.5% and the specificity 95.7% for the diagnosis of DM. The coincidences of cut-off points of FBG and SB-2 hBG for the diagnosis of IGR and DM were equal (P > 0.05).When the cut-off point of SB-2 h BG was set at 7.8 mmol/L, the sensitivity was 77.4% and the specificity 41.8% for the diagnosis of IGR. And it was much better than FBG at 5.6 mmol/L (P < 0.01). With a deterioration of glucose tolerance, the difference between SB-2 hBG and OGTT-2 hBG increases gradually. Compared to the diagnostic criteria of OGTT, the optimal cut-off points for the diagnosis of IGR and DM were 5.3 vs 5.6 mmol/L for FBG and 8.2 vs 9.2 mmol/L for SB-2 hBG respectively.For diabetic screening in middle-aged and elders, the cut-off points of FBG at 5.3 mmol/L and SB-2 hBG at 7.8 mmol/L are indicators for further OGTT.

I(f) current inhibitor ivabradine in patients with idiopathic dilated cardiomyopathy: Impact on the exercise tolerance and quality of life.

PubMed

Abdel-Salam, Zainab; Rayan, Mona; Saleh, Ayman; Abdel-Barr, Mohamed G; Hussain, Mohamed; Nammas, Wail

2015-01-01

Evidence supported a beneficial effect of ivabradine on clinical outcome of patients with systolic heart failure, and a sinus heart rate (HR) ≥ 70 bpm. We explored the effect of ivabradine, vs. placebo, added to evidence-based treatment on exercise tolerance and quality of life in patients with idiopathic dilated cardiomyopathy. We enrolled 43 consecutive patients with dilated cardiomyopathy of no apparent cause, a left ventricular ejection fraction (LVEF) < 40%, New York Heart Association class ≥ II, sinus HR ≥ 70 bpm, and background evidence-based anti-failure medications. Ischemic heart disease was ruled out. Patients were randomized (1:1) to receive ivabradine or placebo. Ivabradine was titrated up gradually till 7.5 mg twice daily, or a HR < 60 bpm, and continued for 3 months. Symptom-limited exercise tolerance test was performed, and quality of life was assessed by the Minnesota Living With Heart Failure Questionnaire at 0, and 3 months. Forty-three patients were randomized to ivabradine (n = 20), or placebo (n = 23). Mean age was 50.8 ± 14.5 years (53.5% males). Mean HR was 85 ± 12 bpm, and mean LVEF was 32 ± 6%. Mean dose of carvedilol was 31.2% of the target dose. Baseline HR, blood pressure, exercise tolerance, Minnesota questionnaire score, and left ventricular systolic function were comparable between the two groups (p > 0.05 for all). At 3 months, mean dose of ivabradine was 6.8 mg bid. Ivabradine-treated patients had a lower HR, and improved left ventricular dimensions and systolic function, versus placebo-treated ones (p < 0.05 for all). HR dropped by a mean of 14 bpm in the ivabradine group, corrected for placebo. Both exercise tolerance, and Minnesota questionnaire score were better in the ivabradine group (p < 0.05 both). Ivabradine was well-tolerated. In symptomatic patients with idiopathic dilated cardiomyopathy, the addition of ivabradine, vs. placebo, to evidence-based treatment, reduced HR, and improved functional capacity, at short-term follow-up.

Ventricular Repolarization Adaptation to Abrupt Changes in Heart Rate after Microgravity Simulation by 5-Day Head-Down Bed Rest

NASA Astrophysics Data System (ADS)

Bolea, J.; Almeida, R.; Pueyo, E.; Laguna, P.; Caiani, E. G.

2013-02-01

Microgravity exposure for long periods of time leads to body deconditioning and it increases the risk of experiencing life-threatening arrhythmias. The study of ventricular repolarization dependence on heart rate has been used to stratify patients according to their arrhythmic risk. The QTp adaptation to HR changes is characterized by M90 (90% of the adaptation). The QTp=HR , after compensation for the adaptation lag, is modeled using a set of regression functions (a , kind of slope of relationship). Subjects with lower orthostatic tolerance time showed a non significant decrease in the adaptation lag (M90 from 148 to 108 beats), which may be due to an extra deconditioning in the sympathovagal response. Nevertheless an increase in the QTp=HR adaptation lag (M90 from 108 to 117 beats with a p = 0.06) and a significant reduction in the slope (a from 0.53 to 0.35 with a p < 0.005), which in previous studies have been correlated with an increased arrhytimic risk, were observed for subjects with higher orthostatic tolerance time.

Early changes in plasma glucagon and growth hormone response to oral glucose in experimental hyperthyroidism.

PubMed

Tosi, F; Moghetti, P; Castello, R; Negri, C; Bonora, E; Muggeo, M

1996-08-01

The mechanisms underlying deterioration of glucose tolerance associated with hyperthyroidism are not completely understood. Increases in glucagon and growth hormone (GH) secretion have been previously found in hyperthyroid subjects, and could play a crucial role in this phenomenon. However, studies have not yet established the time sequence of changes in plasma glucose on the one hand and glucagon and GH on the other. To assess the early effects of thyroid hormone excess on glucose tolerance and plasma concentrations of the main glucoregulatory hormones, 12 nondiabetic euthyroid subjects underwent an oral glucose tolerance test (OGTT) before and after triiodothyronine ([T3] 120 micrograms/d) was administered for 10 days. Plasma levels of glucose, insulin, glucagon, and GH were determined at fasting and after the glucose load. T3 administration caused a marked increase in serum T3 (8.8 +/- 0.6 v 2.0 +/- 0.1 nmol/L), with clinical and biochemical signs of thyrotoxicosis. During the treatment, plasma glucose significantly increased both at fasting and after the glucose load (basal, 5.3 +/- 0.1 v 4.9 +/- 0.2 mmol/L, P < .05; area under the curve [AUC] for OGTT, 7.7 +/- 0.3 v 6.7 +/- 0.4 mmol/L min, P < .01) without any change in plasma insulin levels. After T3 administration, plasma glucagon levels were lower than at baseline (basal, 92 +/- 7 v 148 +/- 35 ng/L; AUC, 74 +/- 6 v 98 +/- 16 ng/L.min, P < .05), showing an appropriate reduction by the increased glucose levels. Conversely, plasma GH showed impaired suppression by hyperglycemia (AUC, 1.2 +/- 0.3 v 0.7 +/- 0.2 microgram/L.min, P < .05). In conclusion, thyroid hormone excess rapidly impairs glucose tolerance. Altered secretion of GH is an early event in thyrotoxicosis accompanying the onset of hyperglycemia, whereas plasma glucagon is appropriately suppressed by the increased plasma glucose levels. Thus, GH but not glucagon may contribute to the early hyperglycemic effect of thyrotoxicosis.

40 CFR 180.420 - Fluridone; tolerances for residues.

Code of Federal Regulations, 2010 CFR

2010-07-01

... (free and bound) of the herbicide fluridone (1-methyl-3-phenyl-5-[3-trifluoromethyl)phenyl]-4(1H)-5-[3... established for residues of the herbicide fluridone in the following raw agricultural commodities: Commodity... following irrigated crops and crop groupings for residues of the herbicide fluridone resulting from use of...

Targeted Apoptosis of Senescent Cells Restores Tissue Homeostasis in Response to Chemotoxicity and Aging.

PubMed

Baar, Marjolein P; Brandt, Renata M C; Putavet, Diana A; Klein, Julian D D; Derks, Kasper W J; Bourgeois, Benjamin R M; Stryeck, Sarah; Rijksen, Yvonne; van Willigenburg, Hester; Feijtel, Danny A; van der Pluijm, Ingrid; Essers, Jeroen; van Cappellen, Wiggert A; van IJcken, Wilfred F; Houtsmuller, Adriaan B; Pothof, Joris; de Bruin, Ron W F; Madl, Tobias; Hoeijmakers, Jan H J; Campisi, Judith; de Keizer, Peter L J

2017-03-23

The accumulation of irreparable cellular damage restricts healthspan after acute stress or natural aging. Senescent cells are thought to impair tissue function, and their genetic clearance can delay features of aging. Identifying how senescent cells avoid apoptosis allows for the prospective design of anti-senescence compounds to address whether homeostasis can also be restored. Here, we identify FOXO4 as a pivot in senescent cell viability. We designed a FOXO4 peptide that perturbs the FOXO4 interaction with p53. In senescent cells, this selectively causes p53 nuclear exclusion and cell-intrinsic apoptosis. Under conditions where it was well tolerated in vivo, this FOXO4 peptide neutralized doxorubicin-induced chemotoxicity. Moreover, it restored fitness, fur density, and renal function in both fast aging Xpd TTD/TTD and naturally aged mice. Thus, therapeutic targeting of senescent cells is feasible under conditions where loss of health has already occurred, and in doing so tissue homeostasis can effectively be restored. Copyright © 2017 Elsevier Inc. All rights reserved.

Low doses of allergen and probiotic supplementation separately or in combination alleviate allergic reactions to cow β-lactoglobulin in mice.

PubMed

Thang, Cin L; Boye, Joyce I; Zhao, Xin

2013-02-01

Probiotic supplementation and oral tolerance induction can reduce certain types of food allergy. The objectives of this study were to investigate the allergy-reducing effects of probiotics (VSL#3) and/or oral tolerance induction via low doses of an allergen supplementation in β-lactoglobulin (BLG)-sensitized mice. Three-week-old, male BALB/c mice were divided into 6 groups (n = 8/group): sham-sensitized negative control (CTL-), BLG-sensitized positive control (CTL+), oral tolerance-induced and BLG-sensitized group (OT), probiotic-supplemented OT group (OTP), probiotic-supplemented CTL- (PRO), and probiotic-supplemented and BLG-sensitized (PROC) groups. Mice were i.p. sensitized with BLG and alum and then orally challenged with BLG. Immunological responses were assessed by monitoring hypersensitivity scores and measuring levels of BLG-specific serum Igs, total serum IgE and fecal IgA, and cytokines from serum and spleen lysates. Hypersensitivity scores were significantly lower in the PROC (2.00 ± 0.53), OT (0.75 ± 0.46), and OTP mice (1.00 ± 0.53) than in the CTL+ mice (2.63 ± 0.52) as were BLG-specific serum IgE concentrations (34.3 ± 10, 0.442 ± 0.36, 3.54 ± 3.5, and 78.5 ± 8.7 μg/L for PROC, OT, OTP, and CTL+, respectively). Our results suggest that supplementation of VSL#3 suppressed the allergic reaction mainly through increased intestinal secretary IgA (sIgA) in PROC mice, and oral tolerance offered allergen-specific protective effects to BLG-induced allergy, probably through CD4+CD25+ regulatory T cell-mediated active suppression. In OTP mice, probiotics did not induce a further reduction of hypersensitivity score compared with OT mice but may provide additional protection to unforeseen nonspecific challenges through increased intestinal sIgA.

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

PubMed

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

Homology of the cranial vault in birds: new insights based on embryonic fate-mapping and character analysis

NASA Astrophysics Data System (ADS)

Maddin, Hillary C.; Piekarski, Nadine; Sefton, Elizabeth M.; Hanken, James

2016-08-01

Bones of the cranial vault appear to be highly conserved among tetrapod vertebrates. Moreover, bones identified with the same name are assumed to be evolutionarily homologous. However, recent developmental studies reveal a key difference in the embryonic origin of cranial vault bones between representatives of two amniote lineages, mammals and birds, thereby challenging this view. In the mouse, the frontal is derived from cranial neural crest (CNC) but the parietal is derived from mesoderm, placing the CNC-mesoderm boundary at the suture between these bones. In the chicken, this boundary is located within the frontal. This difference and related data have led several recent authors to suggest that bones of the avian cranial vault are misidentified and should be renamed. To elucidate this apparent conflict, we fate-mapped CNC and mesoderm in axolotl to reveal the contributions of these two embryonic cell populations to the cranial vault in a urodele amphibian. The CNC-mesoderm boundary in axolotl is located between the frontal and parietal bones, as in the mouse but unlike the chicken. If, however, the avian frontal is regarded instead as a fused frontal and parietal (i.e. frontoparietal) and the parietal as a postparietal, then the cranial vault of birds becomes developmentally and topologically congruent with those of urodeles and mammals. This alternative hypothesis of cranial vault homology is also phylogenetically consistent with data from the tetrapod fossil record, where frontal, parietal and postparietal bones are present in stem lineages of all extant taxa, including birds. It further implies that a postparietal may be present in most non-avian archosaurs, but fused to the parietal or supraoccipital as in many extant mammals.

Pleurodeles waltl, amphibian, Urodele, is a suitable biological model for embryological and physiological space experiments on a vertebrate

NASA Astrophysics Data System (ADS)

Gualandris-Parisot, L.; Husson, D.; Foulquier, F.; Kan, P.; Davet, J.; Aimar, C.; Dournon, C.; Duprat, A. M.

2001-01-01

Pleurodeles waltl (amphibian, Urodele) is an appropriate biological model for space experiments on a vertebrate. One reason for interest in this animal concerns the study of the effects of absence of gravity on embryonic development. First, after mating (on Earth) the females retain live, functional sperm in their cloacum for up to 5 months, allowing normal in vivo fertilisation after hormonal stimulation. Second, their development is slow, which allows analyses of all the key stages of ontogenesis from the oocyte to swimming tailbud embryos or larvae. We have performed detailed studies and analyses of the effects of weightlessness on amphibian Pleurodeles embryos, fertilised and allowed to develop until the swimming larvae stage. These experiments were performed in space during three missions on the MIR-station: FERTILE I, FERTILE II and NEUROGENESIS respectively in 1996, 1998 and 1999. We show that in microgravity abnormalities appeared at specific stages of development compared to 1g-centrifuge control embryos and 1g-ground control embryos. In this report we describe abnormalities occurring in the central nervous system. These modifications occur during the neurulation process (delay in the closure of the neural tube and failure of closure of this tube in the cephalic area) and at the early tailbud stage (microcephaly observed in 40% of the microgravity-embryos). However, if acephalic and microcephalic embryos are not taken into account, these abnormalities did not disturb further morphological, biochemical and functional development and the embryos were able to regulate and a majority of normal hatching and swimming larvae were obtained in weightlessness with a developmental time-course equivalent to that of 1g-centrifuge control embryos (on the MIR station) and 1g-ground control embryos.

Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response

PubMed Central

Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C

2014-01-01

In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

Endoscopic evaluation of the gastro-duodenal tolerance of short-term analgesic treatment with 25 mg diclofenac-K liquid capsules.

PubMed

Hawkey, C; Burnett, I; Gold, M S; Garsed, K; Stevenson, D; Mannath, J; Norman, A; Shepherd, V; Subramanian, V; Johnston, R D; Brown, M

2012-04-01

Diclofenac-potassium (diclofenac--K) 25 mg liquid capsule is absorbed more quickly than the tablet formulation. It offers potential for rapid pain relief, but may alter gastro-duodenal tolerability. To evaluate the gastro-duodenal tolerance of diclofenac-K 25 mg liquid capsules vs. diclofenac-K 12.5 mg tablets, acetylsalicylic acid (ASA) 500 mg tablets and ibuprofen 200 mg liquid capsules. In an endoscopist-blinded, randomised, parallel-group study, volunteers received 15 doses of diclofenac-K 25 mg liquid capsules (n = 36), diclofenac-K 2 × 12.5 mg tablets (n = 36), ibuprofen 2 × 200 mg liquid capsules (n = 24) or ASA 2 × 500 mg tablets (n = 36) over 5 days. The primary outcome was the incidence of erosive gastro-duodenal lesions at Day 6. Secondary outcomes included modified Lanza score and change in gastric mucosal prostaglandin synthesis. The lowest incidence of erosive gastro-duodenal lesions was with diclofenac-K liquid capsules (53%), compared to 61% with diclofenac-K tablets (P = 0.52), 75% with ibuprofen (P = 0.08) and 94% with ASA (P = 0.001). Results were similar for the Lanza scores, although diclofenac-K liquid capsules were significantly superior to ibuprofen liquid capsules (P = 0.04). Diclofenac-K liquid capsules inhibited prostaglandin synthesis by 52% compared to 64% for diclofenac-K tablets (P = 0.10), 50% for ibuprofen (P = 0.85) and 79% for ASA (P = 0.002). With respect to safety, adverse events were most frequent in the ASA group, predominantly gastrointestinal events. Mucosal injury with diclofenac-K liquid 25 mg liquid capsules was similar to diclofenac-K 25 mg tablets, significantly lower than ASA 1 g tablets and showed some superiority over ibuprofen 400 mg liquid capsules (EudraCT Number 2009-011278-14). © 2012 Blackwell Publishing Ltd.

Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo

2011-01-01

Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less

Alterations in pain response are partially reversed by methylphenidate (Ritalin) in adults with attention deficit hyperactivity disorder (ADHD).

PubMed

Treister, Roi; Eisenberg, Elon; Demeter, Naor; Pud, Dorit

2015-01-01

Attention deficit hyperactivity disorder (ADHD) is characterized by dysregulation of sensory processing and neurobiology of dopamine. Although cumulative evidence suggests that dopamine is involved in pain processing, pain perception in ADHD subjects and the effect of dopamine agonists such as methylphenidate (MP, Ritalin) on it have rarely been studied. The aims of this study were to (1) psychophysically assess sensitivity to pain in ADHD subjects as compared to controls and (2) examine the effects of MP on pain response in ADHD subjects. Thirty subjects with ADHD and 30 age- and gender-matched controls participated in a preliminary trial. Pain threshold, intensity, and tolerance in response to cold pain stimulation were measured for both groups (ADHD with no treatment). In addition, the ADHD group was reassessed following a single dose of MP treatment. The ADHD subjects "without MP" in comparison with controls displayed significantly shorter cold pain threshold (2.8 ± 2.1 vs. 5.8 ± 2.5 seconds, respectively, P < 0.001) and cold tolerance (21.8 ± 22.3 vs. 62.8 ± 59.8 seconds, respectively P < 0.001). No differences in pain intensities between the groups were found. Following MP treatment, both cold threshold and tolerance in the ADHD subjects increased significantly compared to those with no treatment (3.6 ± 2.5 seconds, P = 0.011, and 46.4 ± 53.3 seconds, P < 0.001, respectively). These results suggest that adults with ADHD are more sensitive to pain compared with controls and that MP may exert antinociceptive properties in these subjects. Randomized, controlled trials are warranted to verify these findings. © 2013 World Institute of Pain.

Four base recognition by triplex-forming oligonucleotides at physiological pH

PubMed Central

Rusling, David A.; Powers, Vicki E. C.; Ranasinghe, Rohan T.; Wang, Yang; Osborne, Sadie D.; Brown, Tom; Fox, Keith R.

2005-01-01

We have achieved recognition of all 4 bp by triple helix formation at physiological pH, using triplex-forming oligonucleotides that contain four different synthetic nucleotides. BAU [2′-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine] recognizes AT base pairs with high affinity, MeP (3-methyl-2 aminopyridine) binds to GC at higher pHs than cytosine, while APP (6-(3-aminopropyl)-7-methyl-3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one) and S [N-(4-(3-acetamidophenyl)thiazol-2-yl-acetamide)] bind to CG and TA base pairs, respectively. Fluorescence melting and DNase I footprinting demonstrate successful triplex formation at a 19mer oligopurine sequence that contains two CG and two TA interruptions. The complexes are pH dependent, but are still stable at pH 7.0. BAU, MeP and APP retain considerable selectivity, and single base pair changes opposite these residues cause a large reduction in affinity. In contrast, S is less selective and tolerates CG pairs as well as TA. PMID:15911633

Mechanism of p53-Dependent Apoptosis and its Role in Breast Cancer Therapy

DTIC Science & Technology

1999-07-01

inducibly express p53 as previously described (Chen et a!., 1996). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A62-91)-l, -5, and -6 cells...1994) was used as template, ( a ) Levels of p53, p21 and actin in p53-3 and p53(gln22-ser23/A62-91)-2 and -14 cells were assayed by Western blot...CGG TAC CCC TGT CAT CTT CTG TC; and reverse primer C393 as used for generating p53(A62-91). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A74

Reactivation of wild-type and mutant p53 by tryptophanolderived oxazoloisoindolinone SLMP53-1, a novel anticancer small-molecule

PubMed Central

Soares, Joana; Raimundo, Liliana; Pereira, Nuno A.L.; Monteiro, Ângelo; Gomes, Sara; Bessa, Cláudia; Pereira, Clara; Queiroz, Glória; Bisio, Alessandra; Fernandes, João; Gomes, Célia; Reis, Flávio; Gonçalves, Jorge; Inga, Alberto; Santos, Maria M.M.; Saraiva, Lucília

2016-01-01

Restoration of the p53 pathway, namely by reactivation of mutant (mut) p53, represents a valuable anticancer strategy. Herein, we report the identification of the enantiopure tryptophanol-derived oxazoloisoindolinone SLMP53-1 as a novel reactivator of wild-type (wt) and mut p53, using a yeast-based screening strategy. SLMP53-1 has a p53-dependent anti-proliferative activity in human wt and mut p53R280K-expressing tumor cells. Additionally, SLMP53-1 enhances p53 transcriptional activity and restores wt-like DNA binding ability to mut p53R280K. In wt/mut p53-expressing tumor cells, SLMP53-1 triggers p53 transcription-dependent and mitochondrial apoptotic pathways involving BAX, and wt/mut p53 mitochondrial translocation. SLMP53-1 inhibits the migration of wt/mut p53-expressing tumor cells, and it shows promising p53-dependent synergistic effects with conventional chemotherapeutics. In xenograft mice models, SLMP53-1 inhibits the growth of wt/mut p53-expressing tumors, but not of p53-null tumors, without apparent toxicity. Collectively, besides the potential use of SLMP53-1 as anticancer drug, the tryptophanol-derived oxazoloisoindolinone scaffold represents a promissing starting point for the development of effective p53-reactivating drugs. PMID:26735173

Randomised clinical trial: mixed soluble/insoluble fibre vs. psyllium for chronic constipation.

PubMed

Erdogan, A; Rao, S S C; Thiruvaiyaru, D; Lee, Y Y; Coss Adame, E; Valestin, J; O'Banion, M

2016-07-01

Fibre supplements are useful, but whether a plum-derived mixed fibre that contains both soluble and insoluble fibre improves constipation is unknown. To investigate the efficacy and tolerability of mixed soluble/insoluble fibre vs. psyllium in a randomized double-blind controlled trial. Constipated patients (Rome III) received mixed fibre or psyllium, 5 g b.d., for 4 weeks. Daily symptoms and stool habit were assessed using stool diary. Subjects with ≥1 complete spontaneous bowel movement/week above baseline for ≥2/4 weeks were considered responders. Secondary outcome measures included stool consistency, bowel satisfaction, straining, gas, bloating, taste, dissolvability and quality of life (QoL). Seventy-two subjects (mixed fibre = 40; psyllium = 32) were enrolled and two from psyllium group withdrew. The mean complete spontaneous bowel movement/week increased with both mixed fibre (P < 0.0001) and psyllium (P = 0.0002) without group difference. There were 30 (75%) responders with mixed fibre and 24 (75%) with psyllium (P = 0.9). Stool consistency increased (P = 0.04), straining (P = 0.006) and bloating scores decreased (P = 0.02) without group differences. Significantly more patients reported improvement in flatulence (53% vs. 25%, P = 0.01) and felt that mixed fibre dissolved better (P = 0.02) compared to psyllium. QoL improved (P = 0.0125) with both treatments without group differences. Mixed fibre and psyllium were equally efficacious in improving constipation and QoL. Mixed fibre was more effective in relieving flatulence, bloating and dissolved better. Mixed fibre is effective and well tolerated. © 2016 John Wiley & Sons Ltd.

Anti-apoptotic response during anoxia and recovery in a freeze-tolerant wood frog (Rana sylvatica)

PubMed Central

Gerber, Victoria E.M.; Wijenayake, Sanoji

2016-01-01

The common wood frog, Rana sylvatica, utilizes freeze tolerance as a means of winter survival. Concealed beneath a layer of leaf litter and blanketed by snow, these frogs withstand subzero temperatures by allowing approximately 65–70% of total body water to freeze. Freezing is generally considered to be an ischemic event in which the blood oxygen supply is impeded and may lead to low levels of ATP production and exposure to oxidative stress. Therefore, it is as important to selectively upregulate cytoprotective mechanisms such as the heat shock protein (HSP) response and expression of antioxidants as it is to shut down majority of ATP consuming processes in the cell. The objective of this study was to investigate another probable cytoprotective mechanism, anti-apoptosis during oxygen deprivation and recovery in the anoxia tolerant wood frog. In particular, relative protein expression levels of two important apoptotic regulator proteins, Bax and p-p53 (S46), and five anti-apoptotic/pro-survival proteins, Bcl-2, p-Bcl-2 (S70), Bcl-xL, x-IAP, and c-IAP in response to normoxic, 24 Hr anoxic exposure, and 4 Hr recovery stages were assessed in the liver and skeletal muscle using western immunoblotting. The results suggest a tissue-specific regulation of the anti-apoptotic pathway in the wood frog, where both liver and skeletal muscle shows an overall decrease in apoptosis and an increase in cell survival. This type of cytoprotective mechanism could be aimed at preserving the existing cellular components during long-term anoxia and oxygen recovery phases in the wood frog. PMID:27042393

Functional repair of p53 mutation in colorectal cancer cells using trans-splicing.

PubMed

He, Xingxing; Liao, Jiazhi; Liu, Fang; Yan, Junwei; Yan, Jingjun; Shang, Haitao; Dou, Qian; Chang, Ying; Lin, Jusheng; Song, Yuhu

2015-02-10

Mutation in the p53 gene is arguably the most frequent type of gene-specific alterations in human cancers. Current p53-based gene therapy contains the administration of wt-p53 or the suppression of mutant p53 expression in p53-defective cancer cells. . We hypothesized that trans-splicing could be exploited as a tool for the correction of mutant p53 transcripts in p53-mutated human colorectal cancer (CRC) cells. In this study, the plasmids encoding p53 pre-trans-splicing molecules (PTM) were transfected into human CRC cells carrying p53 mutation. The plasmids carrying p53-PTM repaired mutant p53 transcripts in p53-mutated CRC cells, which resulted in a reduction in mutant p53 transcripts and an induction of wt-p53 simultaneously. Intratumoral administration of adenovirus vectors carrying p53 trans-splicing cassettes suppressed the growth of tumor xenografts. Repair of mutant p53 transcripts by trans-splicing induced cell-cycle arrest and apoptosis in p53-defective colorectal cancer cells in vitro and in vivo. In conclusion, the present study demonstrated for the first time that trans-splicing was exploited as a strategy for the repair of mutant p53 transcripts, which revealed that trans-splicing would be developed as a new therapeutic approach for human colorectal cancers carrying p53 mutation.

TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell death by modulating p73 transcriptional activity.

PubMed

Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J

2005-12-08

TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.

The roles of p53R2 in cancer progression based on the new function of mutant p53 and cytoplasmic p21.

PubMed

Yousefi, Bahman; Rahmati, Mohammad; Ahmadi, Yasin

2014-03-18

Although the deregulated expression of p53R2, a p53-inducible protein and homologue of the R2 subunit of ribonucleotide reductase, has been detected in several human cancers, p53R2 roles in cancer progression and malignancy still remains controversial. In this article, we present a viable hypothesis about the roles of p53R2 in cancer progression and therapy resistance based on the roles of cytoplasmic p21 and mutant p53. Since p53R2 can up-regulate p21 and p21, it in turn has a dual role in cell cycle. Hence, p53R2 can play a dual role in cell cycle progression. In addition, because p53 is the main regulator of p53R2, the mutant p53 may induce the expression of p53R2 in some cancer cells based on the "keep of function" phenomenon. Therefore, depending on the locations of p21 and the new abilities of mutant p53, p53R2 has dual role in cell cycle progression. Since the DNA damaging therapies induce p53R2 expression through the induction of p53, p53R2 can be the main therapy resistance mediator in cancers with cytoplasmic p21. Copyright © 2014 Elsevier Inc. All rights reserved.

Nasopharyngeal airway stenting devices for obstructive sleep apnoea: a systematic review and meta-analysis.

PubMed

Kumar, A R; Guilleminault, C; Certal, V; Li, D; Capasso, R; Camacho, M

2015-01-01

To systematically review outcomes of adults with obstructive sleep apnoea treated with nasopharyngeal airway stenting devices. Medline, Scopus, Web of Science and the Cochrane Library databases were searched, and data on device use and tolerability, sleepiness, oxygen saturation, apnoea index, apnoea-hypopnoea index, and sleep quality were collected. Of 573 potential studies, 29 were retrieved for detailed evaluation and 16 met the study criteria. Polysomnography data for patients treated with nasal trumpets as an isolated therapy were pooled for meta-analysis. The mean apnoea index ± standard deviation, for 53 patients, decreased from 32.4 ± 15.9 to 9.0 ± 7.2 episodes per hour (p < 0.00001). The mean apnoea-hypopnoea index, for 193 patients, decreased from 44.1 ± 18.9 to 22.7 ± 19.3 episodes per hour (p < 0.00001). The mean lowest oxygen saturation, for 193 patients, increased from 66.5 ± 14.2 to 75.5 ± 13.9 per cent (p < 0.00001). Some studies have demonstrated limited effectiveness and low tolerability of nasopharyngeal airway stenting devices, while other studies have shown a significant benefit in treating obstructive sleep apnoea, with a high level of patient acceptance. Nasal trumpets have been successful in decreasing airway obstruction in the short term.

Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome

PubMed Central

Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.

2014-01-01

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269

Curcumin causes superoxide anion production and p53-independent apoptosis in human colon cancer cells.

PubMed

Watson, Jane L; Hill, Richard; Yaffe, Paul B; Greenshields, Anna; Walsh, Mark; Lee, Patrick W; Giacomantonio, Carman A; Hoskin, David W

2010-11-01

Curcumin from the rhizome of theCurcuma longa plant has chemopreventative activity and inhibits the growth of neoplastic cells. Since p53 has been suggested to be important for anticancer activity by curcumin, we investigated curcumin-induced cytotoxicity in cultures of p53(+/+) and p53(-/-) HCT-116 colon cancer cells, as well as mutant p53 HT-29 colon cancer cells. Curcumin killed wild-type p53 HCT-116 cells and mutant p53 HT-29 cells in a dose- and time-dependent manner. In addition, curcumin-treated p53(+/+) HCT-116 cells and mutant p53 HT-29 cells showed upregulation of total and activated p53, as well as increased expression of p53-regulated p21, PUMA (p53 upregulated modulator of apoptosis), and Bax; however, an equivalent cytotoxic effect by curcumin was observed in p53(+/+) and p53(-/-) HCT-116 cells, demonstrating that curcumin-induced cytotoxicity was independent of p53 status. Similar results were obtained when the cytotoxic effect of curcumin was assessed in wild-type p53 HCT-116 cells after siRNA-mediated p53 knockdown. Chromatin condensation, poly (ADP-ribose) polymerase-1 cleavage and reduced pro-caspase-3 levels in curcumin-treated p53(+/+) and p53(-/-) HCT-116 cells suggested that curcumin caused apoptosis. In addition, exposure to curcumin resulted in superoxide anion production and phosphorylation of oxidative stress proteins in p53(+/+) and p53(-/-) HCT-116 cells. Collectively, our results indicate that, despite p53 upregulation and activation, curcumin-induced apoptosis in colon cancer cells was independent of p53 status and involved oxidative stress. Curcumin may therefore have therapeutic potential in the management of colon cancer, especially in tumorsthatare resistant to conventional chemotherapydue todefects inp53 expression or function. 2010 Elsevier Ireland Ltd. All rights reserved.

Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status

PubMed Central

Mirjolet, J-F; Barberi-Heyob, M; Didelot, C; Peyrat, J-P; Abecassis, J; Millon, R; Merlin, J-L

2000-01-01

p53 tumour-suppressor gene is involved in cell growth control, arrest and apoptosis. Nevertheless cell cycle arrest and apoptosis induction can be observed in p53-defective cells after exposure to DNA-damaging agents such as 5-fluorouracil (5-FU) suggesting the importance of alternative pathways via p53-independent mechanisms. In order to establish relationship between p53 status, cell cycle arrest, Bcl-2/Bax regulation and 5-FU sensitivity, we examined p53 mRNA and protein expression and p53 protein functionality in wild-type (wt) and mutant (mt) p53 cell lines. p53 mRNA and p53 protein expression were determined before and after exposure to equitoxic 5-FU concentration in six human carcinoma cell lines differing in p53 status and displaying marked differences in 5-FU sensitivity, with IC 50 values ranging from 0.2–22.6 mM. 5-FU induced a rise in p53 mRNA expression in mt p53 cell lines and in human papilloma virus positive wt p53 cell line, whereas significant decrease in p53 mRNA expression was found in wt p53 cell line. Whatever p53 status, 5-FU altered p53 transcriptional and translational regulation leading to up-regulation of p53 protein. In relation with p53 functionality, but independently of p53 mutational status, after exposure to 5-FU equitoxic concentration, all cell lines were able to arrest in G1. No relationship was evidenced between G1 accumulation ability and 5-FU sensitivity. Moreover, after 5-FU exposure, Bax and Bcl-2 proteins regulation was under p53 protein control and a statistically significant relationship (r= 0.880,P= 0.0097) was observed between Bcl-2/Bax ratio and 5-FU sensitivity. In conclusion, whatever p53 status, Bcl-2 or Bax induction and Bcl-2/Bax protein ratio were correlated to 5-FU sensitivity. © 2000 Cancer Research Campaign PMID:11044365

[Interaction between p53 and MDM2 in human lung cancer cells].

PubMed

Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J

2014-01-01

The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo  or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) -  mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and MDM2 positive. In 46 (34%) cases, elevation of p53 was combined with MDM2 negative expression. Other tumor samples were either negative for both proteins (71/ 52%), or p53 negative and MDM2 positive in 10 (7%) tumor samples. Absence of p53 staining in most studies indicates absence of p53 mutation, and on the contrary, positive expression of p53 is a sign of p53 mutations with loss of function. In our study, 34% of cases with extensively high level of p53 without increased level of MDM2 were identified. We suppose that these are tumors with inactivating mutations that stabilize p53. On the other hand, tumors with high level of stabilized wildtype p53 protein and simultaneously with increased MDM2 staining (9 samples/7%) represent group with functional p53. In this group of patients, we could expect better prognosis with regard to function of p53 protein.

Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.

PubMed

Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I

2013-04-16

Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.

Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy

PubMed Central

Shchors, Ksenya; Persson, Anders I.; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S.; Hanahan, Douglas; Weiss, William A.; Evan, Gerard I.

2013-01-01

Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRasV12 mouse model crossed into the p53ERTAM background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ERTAM allele. The p53ERTAM protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRasV12;p53+/KI mice abrogate the p53 pathway by mutating p19ARF/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ERTAM allele. By contrast, gliomas arising in GFAP-HRasV12;p53KI/KI mice develop in the absence of functional p53. Such tumors retain a functional p19ARF/MDM2-signaling pathway, and restoration of p53ERTAM allele triggers p53-tumor–suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14ARF/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRasV12;p53KI/KI animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ERTAM activity mitigated the selective pressure to inactivate the p19ARF/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance. PMID:23542378

Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

PubMed

Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

2014-07-01

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38

PubMed Central

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-01-01

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

PubMed

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-07-10

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

Heterogeneous distribution of P53 immunoreactivity in human lung adenocarcinoma correlates with MDM2 protein expression, rather than with P53 gene mutation.

PubMed

Koga, T; Hashimoto, S; Sugio, K; Yoshino, I; Nakagawa, K; Yonemitsu, Y; Sugimachi, K; Sueishi, K

2001-07-20

Although the tumor suppressor p53 protein (P53) immunoreactivity and its gene (p53) mutation were reported to be significant prognostic indicators for human lung adenocarcinomas, little is known regarding the relationship between the heterogeneous distribution of P53 and its genetic status in each tumor focus and the clinicopathological significance. To determine how P53 is heterogeneously stabilized in patients, we compared P53 expression to both the p53 allelic mutation in exon 2 approximately 9 by polymerase chain reaction-single strand conformation polymorphism using microdissected DNA fractions, and the immunohistochemical MDM2 expression. Of the 48 positive to P53 in 118 lung adenocarcinomas examined, 10 with heterogeneous P53 expression were closely examined. The higher P53 expression foci in 7 of 10 cases were less differentiated, histologically in respective cases, and were frequently associated with fibrous stroma. Two had genetic mutations in exon 7 of the p53 gene in both the high and low P53 expression foci of cancer tissue indicating no apparent correlation between heterogeneous P53 expression and the occurrence of gene mutation. Immunohistochemical expression of MDM2 was significantly lower in high P53 expression areas (p < 0.05, the mean labeling indices of high and low P53 expression areas being 4.2 +/- 5.4% and 13.6 +/- 12.2%, respectively). In addition, among all the 118 cases examined, MDM2 expression was significantly suppressed in cases of p53 gene mutation, simultaneously with P53 overexpression, as compared with cases without both the p53 mutation and expression (p < 0.001). These findings suggest that the heterogeneous stabilization of P53 in human lung adenocarcinomas could be partly due to suppressed MDM2 expression. The overexpression of non-mutated P53 may afford a protective mechanism in human lung adenocarcinomas. Copyright 2001 Wiley-Liss, Inc.

LQFM030 reduced Ehrlich ascites tumor cell proliferation and VEGF levels.

PubMed

da Mota, Mariana Flavia; de Carvalho, Flávio Silva; de Ávila, Renato Ivan; de Ávila, Paulo Henrique Marcelino; Cortez, Alane Pereira; Menegatti, Ricardo; Sabino, José Ricardo; Dos Santos, Thais Rosa Marques; Gomes, Sandro Antônio; da Cunha, Luiz Carlos; Valadares, Marize Campos

2018-05-15

This study reports the biological properties of LQFM030 in vivo, a molecular simplification of the compound nutlin-1. Ehrlich ascites tumor (EAT)-bearing mice were treated intraperitoneally with LQFM030 (50, 75 or 150mg/kg) for 10days to determine changes in ascites tumor volume, body weight, cytotoxicity and angiogenesis. Moreover, flow cytometric expression of p53 and p21 proteins and caspase-3/7, -8 and -9 activation were investigated in EAT cells from mice treated. Acute oral systemic toxicity potential of LQFM030 in mice was also investigated using an alternative method. Treatment of EAT-bearing mice with LQFM030 resulted in a marked decline in tumor cell proliferation and the vascular endothelial growth factor (VEGF) levels along with enhanced survival of the mice. Apoptotic tumor cell death was detected through p53 and p21 modulation and increase of caspase-3/7, -8 and -9 activity. LQFM030 also showed orally well tolerated, being classified in the UN GHS category 5 (LD 50 >2000-5000mg/Kg). LQFM030 seems to be a promising antitumor candidate for combinatory therapy with typical cytotoxic compounds, reducing the toxicity burden while allowing a superior anticancer activity. Moreover, these data also open new perspectives for LQFM030 as an antiangiogenic agent for treatment of diseases involving VEGF overexpression. Copyright © 2017. Published by Elsevier Inc.

Observational study on the palatability and tolerability of oral prednisolone and oral dexamethasone in children in Saudi Arabia and the UK.

PubMed

Aljebab, Fahad; Alanazi, Mofadhi; Choonara, Imti; Conroy, Sharon

2018-01-01

Short-course oral corticosteroids are routinely used to treat acute asthma and croup. We evaluated their tolerability and palatability in Saudi Arabian (SA) and UK children. Prospective observational/interview study (3 months in each country). Palatability was evaluated using a 5-point facial Hedonicscale and tolerability by direct questioning of patient/parents. In SA, of 122 patients (2-10 years) recruited, 52 received prednisolone base tablets, 37 prednisolone sodium phosphate syrup and 33 received dexamethasone elixir. In the UK, of 133 patients (2-16 years), 38 received prednisolone base tablets (mainly crushed and dispersed), 42 prednisolone sodium phosphate soluble tablets and 53 received dexamethasone sodium phosphate oral solution.In both countries, dexamethasone had the highest palatability scores (SA mean: 1.97; UK mean: 3) and prednisolone base tablets had the lowest (SA mean: 1.12; UK mean: 1.39). Palatability scores improved for all formulations of prednisolone with each subsequent daily dose.In SA, prednisolone base tablets were associated with more nausea (24vs7 patients) and vomiting (5vs0 patients) than sodium phosphate syrup (p=0.008 and p=0.073, respectively). In the UK, vomiting occurred more frequently with prednisolone base (8 patients) than sodium phosphate soluble tablets (2 patients) (p=0.041).In both centres, dexamethasone was associated with less side effects. Vomiting (1vs0 patients), nausea (7vs3 patients) and abdominal pain (10vs8 patients) occurred more with dexamethasone sodium phosphate solution than dexamethasone elixir. Dexamethasone sodium phosphate solution was the most palatable preparation. Prednisolone base tablets were rated least palatable and were least well tolerated. Palatability scores improved with each dose taken. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Heterogeneous Contribution of Insulin Sensitivity and Secretion Defects to Gestational Diabetes Mellitus

PubMed Central

Powe, Camille E.; Allard, Catherine; Battista, Marie-Claude; Doyon, Myriam; Bouchard, Luigi; Ecker, Jeffrey L.; Perron, Patrice; Florez, Jose C.; Thadhani, Ravi

2016-01-01

OBJECTIVE To characterize physiologic subtypes of gestational diabetes mellitus (GDM). RESEARCH DESIGN AND METHODS Insulin sensitivity and secretion were estimated in 809 women at 24–30 weeks' gestation, using oral glucose tolerance test–based indices. In women with GDM (8.3%), defects in insulin sensitivity or secretion were defined below the 25th percentile in women with normal glucose tolerance (NGT). GDM subtypes were defined based on the defect(s) present. RESULTS Relative to women with NGT, women with predominant insulin sensitivity defects (51% of GDM) had higher BMI and fasting glucose, larger infants (birth weight z score 0.57 [−0.01 to 1.37] vs. 0.03 [−0.53 to 0.52], P = 0.001), and greater risk of GDM-associated adverse outcomes (57.6 vs. 28.2%, P = 0.003); differences were independent of BMI. Women with predominant insulin secretion defects (30% of GDM) had BMI, fasting glucose, infant birth weights, and risk of adverse outcomes similar to those in women with NGT. CONCLUSIONS Heterogeneity of physiologic processes underlying hyperglycemia exists among women with GDM. GDM with impaired insulin sensitivity confers a greater risk of adverse outcomes. PMID:27208340

TRIM25 has a dual function in the p53/Mdm2 circuit.

PubMed

Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C

2015-11-12

P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context.

Serum p53 antibody as a potential tumor marker in extrahepatic cholangiocarcinoma.

PubMed

Okada, Rei; Shimada, Hideaki; Otsuka, Yuichiro; Tsuchiya, Masaru; Ishii, Jun; Katagiri, Toshio; Maeda, Tetsuya; Kubota, Yoshihisa; Nemoto, Tetsuo; Kaneko, Hironori

2017-12-01

Only a few studies have evaluated the clinicopathological significance of the p53 protein expression and s-p53-Abs level in patients with cholangiocarcinoma. We therefore analyzed the clinicopathological and prognostic significance of s-p53-Abs in patients with extrahepatic cholangiocarcinoma. We prospectively evaluated s-p53-Abs levels before and after surgery in 61 patients with extrahepatic cholangiocarcinoma to determine the relationship between clinicopathological factors and the prognostic significance of s-p53-Abs. Among a total of 61 primary extrahepatic cholangiocarcinoma cases, 23% were positive for s-p53-Abs. Combination of s-p53-Abs with the conventional serum markers carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9) significantly increased the rate of positive extrahepatic cholangiocarcinoma cases (57% for CEA and/or CA19-9 vs. 75% for CEA and/or CA19-9 and/or s-p53-Abs, P = 0.035). There were no significant differences in clinicopathological factors between the p53-seropositive and p53-seronegative patients. An immunohistochemical analysis showed the presence of significant associations between the intensity (P = 0.003) and extent (P = 0.001) of p53 immunoreactivity and p53-seropositivitly. Although s-p53-Abs was not a significant prognostic factor for the survival in either univariate or multivariate analyses, p53 immunoreactivity was independently associated with a poor survival. Among patients positive for s-p53-Abs before surgery, the s-p53-Abs levels were reduced after surgery in most. These findings suggested that s-p53-Abs might be associated with p53 immunoreactivity. In addition, s-p53-Abs may be useful for a diagnosis, but was not useful for predicting tumor recurrence or the survival. This study was registered as UMIN000014530.

Construct Validity and Reliability of the Tolerance Scale among Iranian College Students

ERIC Educational Resources Information Center

Ersanli, Ercümend; Mameghani, Shiva Saeighi

2016-01-01

In the present study, the Tolerance Scale developed by Ersanli (2014) was adapted to the Iranian culture, and its validity and reliability were investigated in the case of Iranian college students. The participants consisted of 552 Iranian college students (62% male, M = 20.84, S.D.: 1.53) selected using the convenience sampling method. The sample…

The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

PubMed Central

2010-01-01

Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1) are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development. PMID:21138557

Accelerated Methotrexate, Vinblastine, Doxorubicin, and Cisplatin Is Safe, Effective, and Efficient Neoadjuvant Treatment for Muscle-Invasive Bladder Cancer: Results of a Multicenter Phase II Study With Molecular Correlates of Response and Toxicity

PubMed Central

Plimack, Elizabeth R.; Hoffman-Censits, Jean H.; Viterbo, Rosalia; Trabulsi, Edouard J.; Ross, Eric A.; Greenberg, Richard E.; Chen, David Y.T.; Lallas, Costas D.; Wong, Yu-Ning; Lin, Jianqing; Kutikov, Alexander; Dotan, Efrat; Brennan, Timothy A.; Palma, Norma; Dulaimi, Essel; Mehrazin, Reza; Boorjian, Stephen A.; Kelly, William Kevin; Uzzo, Robert G.; Hudes, Gary R.

2014-01-01

Purpose Neoadjuvant cisplatin-based chemotherapy is standard of care for muscle-invasive bladder cancer (MIBC); however, it is infrequently adopted in practice because of concerns regarding toxicity and delay to cystectomy. We hypothesized that three cycles of neoadjuvant accelerated methotrexate, vinblastine, doxorubicin, and cisplatin (AMVAC) would be safe, shorten the time to surgery, and yield similar pathologic complete response (pT0) rates compared with historical controls. Patients and Methods Patients with cT2-T4a and N0-N1 MIBC were eligible and received three cycles of AMVAC with pegfilgrastim followed by radical cystectomy with lymph node dissection. The primary end point was pT0 rate. Telomere length (TL) and p53 mutation status were correlated with response and toxicity. Results Forty-four patients were accrued; 60% had stage III to IV disease; median age was 64 years. Forty patients were evaluable for response, with 15 (38%; 95% CI, 23% to 53%) showing pT0 at cystectomy, meeting the primary end point of the study. Another six patients (14%) were downstaged to non–muscle invasive disease. Most (82%) experienced only grade 1 to 2 treatment-related toxicities. There were no grade 3 or 4 renal toxicities and no treatment-related deaths. One patient developed metastases and thus did not undergo cystectomy; all others (n = 43) proceeded to cystectomy within 8 weeks after last chemotherapy administration. Median time from start of chemotherapy to cystectomy was 9.7 weeks. TL and p53 mutation did not predict response or toxicity. Conclusion AMVAC is well tolerated and results in similar pT0 rates with 6 weeks of treatment compared with standard 12-week regimens. Further analysis is ongoing to ascertain whether molecular alterations in tumor samples can predict response to chemotherapy. PMID:24821881

A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53

PubMed Central

Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena

2016-01-01

p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407

The critical role of catalase in prooxidant and antioxidant function of p53

PubMed Central

Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

2013-01-01

The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

Local rhamnosoft, ceramides and L-isoleucine in atopic eczema: a randomized, placebo controlled trial

PubMed Central

Marseglia, Alessia; Licari, Amelia; Agostinis, Fabio; Barcella, Antonio; Bonamonte, Domenico; Puviani, Mario; Milani, Massimo; Marseglia, GianLuigi

2014-01-01

Background A non-steroidal, anti-inflammatory moisturizing cream containing rhamnosoft, ceramides, and L-isoleucine (ILE) (pro-AMP cream) has been recently developed for the specific treatment of atopic eczema (AE) of the face. In this trial, we evaluated the clinical efficacy and tolerability of pro-AMP cream in the treatment of facial AE in children in comparison with an emollient cream. Methods In a randomized, prospective, assessor-blinded, parallel groups (2:1) controlled trial, 107 children (72 allocated to pro-AMP cream and 35 allocated to control group) with mild-to-moderate chronic AE of the face were enrolled. Treatments were applied twice daily for a 6-week period. Facial Eczema Severity Score (ESS) was evaluated at baseline, week 3, and week 6, by an assessor unaware of treatment allocation. Investigator's Global Assessment (IGA) score was assessed at week 3 and at week 6. Tolerability was evaluated at week 3 and at week 6 using a 4-point score (from 0: low tolerability to 3: very good tolerability). Results At baseline ESS, mean (SD) was 6.1 (2.4) in the pro-AMP cream group and 5.3 (3) in the control group. In the pro-AMP group, in comparison with baseline, ESS was significantly reduced to 2.5 (−59%) after 3 wks and to 1.0 (−84%) at week 6 (p = 0.0001). In the control group, ESS was reduced to 3 (−42%) at week 2 and to 2.6 (−50%) at week 6. At week 6, ESS in pro-AMP cream was significantly lower than the control group (1.0 vs. 2.6; p = 0.001). Both products were well tolerated. Conclusion Pro-AMP cream has shown to be effective in the treatment of mild-to-moderate chronic lesion of AE of the face. Clinical efficacy was greater in comparison with an emollient cream. (Clinical trial Registry: NTR4084). PMID:24750568

A dual role of p53 in the control of autophagy.

PubMed

Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

2008-08-01

Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

The Prognostic Impact of p53 Expression on Sporadic Colorectal Cancer Is Dependent on p21 Status.

PubMed

Kruschewski, Martin; Mueller, Kathrin; Lipka, Sybille; Budczies, Jan; Noske, Aurelia; Buhr, Heinz Johannes; Elezkurtaj, Sefer

2011-03-11

The prognostic value of p53 and p21 expression in colorectal cancer is still under debate. We hypothesize that the prognostic impact of p53 expression is dependent on p21 status. The expression of p53 and p21 was immunohistochemically investigated in a prospective cohort of 116 patients with UICC stage II and III sporadic colorectal cancer. The results were correlated with overall and recurrence-free survival. The mean observation period was 51.8 ± 2.5 months. Expression of p53 was observed in 72 tumors (63%). Overall survival was significantly better in patients with p53-positive carcinomas than in those without p53 expression (p = 0.048). No differences were found in recurrence-free survival (p = 0.161). The p53+/p21- combination was seen in 68% (n = 49), the p53+/p21+ combination in 32% (n = 23). Patients with p53+/p21- carcinomas had significantly better overall and recurrence-free survival than those with p53+/p21+ (p < 0.0001 resp. p = 0.003). Our data suggest that the prognostic impact of p53 expression on sporadic colorectal cancer is dependent on p21 status.

Negative feedback regulation of wild-type p53 biosynthesis.

PubMed Central

Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W

1995-01-01

When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087

40 CFR 180.202 - p-Chlorophenoxyacetic acid; tolerances for residues.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 24 2014-07-01 2014-07-01 false p-Chlorophenoxyacetic acid; tolerances... Tolerances § 180.202 p-Chlorophenoxyacetic acid; tolerances for residues. (a) General. A tolerance is established for the combined residues of the plant regulator p-chlorophenoxyacetic acid and its metabolite p...

40 CFR 180.202 - p-Chlorophenoxyacetic acid; tolerances for residues.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 25 2013-07-01 2013-07-01 false p-Chlorophenoxyacetic acid; tolerances... Tolerances § 180.202 p-Chlorophenoxyacetic acid; tolerances for residues. (a) General. A tolerance is established for the combined residues of the plant regulator p-chlorophenoxyacetic acid and its metabolite p...

40 CFR 180.202 - p-Chlorophenoxyacetic acid; tolerances for residues.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 25 2012-07-01 2012-07-01 false p-Chlorophenoxyacetic acid; tolerances... Tolerances § 180.202 p-Chlorophenoxyacetic acid; tolerances for residues. (a) General. A tolerance is established for the combined residues of the plant regulator p-chlorophenoxyacetic acid and its metabolite p...

Combined radiation and p53 gene therapy of malignant glioma cells.

PubMed

Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

1999-01-01

More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We conclude that responses to p53 gene therapy are variable among gliomas and most likely depend upon both cellular p53 status and as yet ill-defined downstream pathways involving activation of cell cycle regulatory and apoptotic genes.

The Isoforms of the p53 Protein

PubMed Central

Khoury, Marie P.; Bourdon, Jean-Christophe

2010-01-01

p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206

Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min

Highlights: {yields} The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. {yields} GSN interacts with transactivation- and DNA binding domains of p53. {yields} GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. {yields} GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate thatmore » GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.« less

The absence of p53 during Human Cytomegalovirus infection leads to decreased UL53 expression, disrupting UL50 localization to the inner nuclear membrane, and thereby inhibiting capsid nuclear egress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuan, Man I; O’Dowd, John M.; Fortunato, Elizabeth

Our electron microscopy study (Kuan et al., 2016) found HCMV nuclear capsid egress was significantly reduced in p53 knockout cells (p53KOs), correlating with inhibited formation of infoldings of the inner nuclear membrane (IINMs). Molecular examination of these phenomena has found p53KOs expressed UL97 and phosphorylated lamins, however the lamina failed to remodel. The nuclear egress complex (NEC) protein UL50 was expressed in almost all cells. UL50 re-localized to the inner nuclear membrane (INM) in ~90% of wt cells, but only ~35% of p53KOs. UL53 expression was significantly reduced in p53KOs, and cells lacking UL50 nuclear staining, expressed no UL53. Re-introductionmore » of p53 into p53KOs largely recovered UL53 positivity and UL50 nuclear re-localization. Nuclear rim located UL50/53 puncta, which co-localized with the major capsid protein, were largely absent in p53KOs. We believe these puncta were IINMs. In the absence of p53, UL53 expression was inhibited, disrupting formation of the NEC/IINMs, and reducing functional virion secretion. -- Highlights: •Phosphorylated nuclear lamins were inefficiently remodeled in p53KO cells. •p53KO cells expressed UL50, but it was not efficiently targeted to the nuclear rim. •UL53 was not expressed in the large majority of p53KO cells. •Cells failing to express UL53 did not localize UL50 to the nucleus. •NEC puncta/infoldings of the inner nuclear membrane were scarce in p53KO cells.« less

Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.

PubMed

Suppiah, Aravind; Greenman, John

2013-08-07

Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.

Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

PubMed

Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

2012-04-01

Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

Indices of benthic community tolerance in contaminated Great Lakes sediments: Relations with sediment contaminant concentrations, sediment toxicity, and the sediment quality triad

USGS Publications Warehouse

Wildhaber, M.L.; Schmitt, C.J.

1998-01-01

We evaluated the toxic-units model developed by Wildhaber and Schmitt (1996) as a predictor of indices of mean tolerance to pollution (i.e., Lenat, 1993; Hilsenhoff, 1987) and other benthic community indices from Great Lakes sediments containing complex mixtures of environmental contaminants (e.g., polychlorinated biphenyls – PCBs, polycyclic aromatic hydrocarbons – PAHs, pesticides, chlorinated dioxins, and metals). Sediment toxic units were defined as the ratio of the estimated pore-water concentration of a contaminant to its chronic toxicity as estimated by U.S. Environmental Protection Agency Ambient Water Quality Criteria (AWQC) or other applicable standard. The total hazard of a sediment to aquatic life was assessed by summing toxic units for all contaminants quantified. Among the benthic community metrics evaluated, total toxic units were most closely correlated with Lenat's (1993) and Hilsenhoff's (1987) indices of community tolerance (TL and TH, respectively); toxic units accounted for 42% TL and 53% TH of variability in community tolerance as measured by Ponar grabs. In contrast, taxonomic richness and Shannon-Wiener diversity were not correlated (P > 0.05) with toxic units. Substitution of order- or family-level identifications for lowest possible (mostly genus- or species-) level identifications in the calculation of TL and TH indices weakened the relationships with toxic units. Tolerance values based on order- and family-level identifications of benthos for artificial substrate samples were more strongly correlated with toxic units than tolerance values for benthos from Ponar grabs. The ability of the toxic-units model to predict the other two components (i.e., laboratory-measured sediment toxicity and benthic community composition) of the Sediment Quality Triad (SQT) may obviate the need for the SQT in some situations.

Addition of interferon-α to the p53-SLP® vaccine results in increased production of interferon-γ in vaccinated colorectal cancer patients: a phase I/II clinical trial.

PubMed

Zeestraten, Eliane C M; Speetjens, Frank M; Welters, Marij J P; Saadatmand, Sepideh; Stynenbosch, Linda F M; Jongen, Rogier; Kapiteijn, Ellen; Gelderblom, Hans; Nijman, Hans W; Valentijn, A Rob P M; Oostendorp, Jaap; Fathers, Lorraine M; Drijfhout, Jan W; van de Velde, Cornelis J H; Kuppen, Peter J K; van der Burg, Sjoerd H; Melief, Cornelis J M

2013-04-01

We previously established safety and immunogenicity of a p53 synthetic long peptides (p53-SLP®) vaccine. In the current trial, we investigated whether combination of interferon-alpha (IFN-α) with p53-SLP® is both safe and able to improve the induced p53-specific IFN-γ response. Eleven colorectal cancer patients successfully treated for metastatic disease were enrolled in this study. Of these, nine patients completed follow-up after two injections with p53-SLP® together with IFN-α. Safety and p53-specific immune responses were determined before and after vaccination. Furthermore, cryopreserved PBMCs were compared head-to-head to cryopreserved PBMCs obtained in our previous trial with p53-SLP® only. Toxicity of p53-SLP® vaccination in combination with IFN-α was limited to Grade 1 or 2, with predominantly small ongoing swellings at the vaccination site. All patients harbored p53-specific T cells after vaccination and most patients showed p53-specific antibodies. Compared to the previous trial, addition of IFN-α significantly improved the frequency of p53-specific T cells in IFN-γ ELISPOT. Moreover, in this trial, p53-specific T cells were detectable in blood samples of all patients in a direct ex vivo multiparameter flowcytometric assay, opposed to only 2 of 10 patients vaccinated with p53-SLP® only. Finally, patients in this trial displayed a broader p53-specific immunoglobulin-G response, indicating an overall better p53-specific T-helper response. Our study shows that p53-SLP® vaccination combined with IFN-α injection is safe and capable of inducing p53-specific immunity. When compared to a similar trial with p53-SLP® vaccination alone the combination was found to induce significantly more IFN-γ producing p53-specific T cells. Copyright © 2012 UICC.

Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype.

PubMed

Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

2015-01-01

A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.

Expressions of p53 and p21 in primary gastric lymphomas.

PubMed Central

Go, J. H.; Yang, W. I.

2001-01-01

The p21 overexpression is thought to be a consequence of the p53 induced activation of the p21 gene. The immunohistochemical evaluation of p53 and p21 can be a valuable means of assessing the functional status of the p53 gene product. We examined the overexpression of p21 and p53 proteins in primary gastric lymphomas and the correlation with prognosis. A total of 32 cases of gastric lymphomas was classified into low-grade lymphomas of mucosa-associated lymphoid tissue type (n=16) and high-grade B-cell lymphomas (n=16). In low-grade lymphomas, only one case showed p53 positivity and all cases were p21-negative. In high-grade lymphomas, seven cases were p53+/p21- (44%), one case was p53+/p21+ (6%), and eight cases were p53-/p21- (50%). The p53+/p21- cases had a much lower percentage of patients sustaining a continuous complete remission state (3/7, 43%) compared with other cases (6/7, 86%). From these results, we concluded that p21 expression is rare in primary gastric lymphomas. Therefore, p53-positive lymphomas can be assumed as having p53 mutation. And combined studies of p53 and p21 may be used as a prognostic indicator in primary gastric high-grade lymphomas. PMID:11748353

p73 coordinates with Δ133p53 to promote DNA double-strand break repair.

PubMed

Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun

2018-03-06

Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.

A protein folding molecular imaging biosensor monitors the effects of drugs that restore mutant p53 structure and its downstream function in glioblastoma cells

PubMed Central

Paulmurugan, Ramasamy; Afjei, Rayhaneh; Sekar, Thillai V.; Babikir, Husam A.; Massoud, Tarik F.

2018-01-01

Misfolding mutations in the DNA-binding domain of p53 alter its conformation, affecting the efficiency with which it binds to chromatin to regulate target gene expression and cell cycle checkpoint functions in many cancers, including glioblastoma. Small molecule drugs that recover misfolded p53 structure and function may improve chemotherapy by activating p53-mediated senescence. We constructed and optimized a split Renilla luciferase (RLUC) complementation molecular biosensor (NRLUC-p53-CRLUC) to determine small molecule-meditated folding changes in p53 protein. After initial evaluation of the biosensor in three different cells lines, we engineered endogenously p53P98L mutant (i.e. not affecting the DNA-binding domain) Ln229 glioblastoma cells, to express the biosensor containing one of four different p53 proteins: p53wt, p53Y220C, p53G245S and p53R282W. We evaluated the consequent phenotypic changes in these four variant cells as well as the parental cells after exposure to PhiKan083 and SCH529074, drugs previously reported to activate mutant p53 folding. Specifically, we measured induced RLUC complementation and consequent therapeutic response. Upon stable transduction with the p53 biosensors, we demonstrated that these originally p53P98L Ln229 cells had acquired p53 cellular phenotypes representative of each p53 protein expressed within the biosensor fusion protein. In these engineered variants we found a differential drug response when treated with doxorubicin and temozolomide, either independently or in combination with PhiKan083 or SCH529074. We thus developed a molecular imaging complementation biosensor that mimics endogenous p53 function for use in future applications to screen novel or repurposed drugs that counter the effects of misfolding mutations responsible for oncogenic structural changes in p53. PMID:29765555

Inactivation of p53 by Human T-Cell Lymphotropic Virus Type 1 Tax Requires Activation of the NF-κB Pathway and Is Dependent on p53 Phosphorylation

PubMed Central

Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.

2000-01-01

p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327

p53 Restoration in Induction and Maintenance of Senescence: Differential Effects in Premalignant and Malignant Tumor Cells

PubMed Central

Harajly, Mohamad; Zalzali, Hasan; Nawaz, Zafar; Ghayad, Sandra E.; Ghamloush, Farah; Basma, Hussein; Zainedin, Samiha; Rabeh, Wissam; Jabbour, Mark; Tawil, Ayman; Badro, Danielle A.; Evan, Gerard I.

2015-01-01

The restoration of p53 has been suggested as a therapeutic approach in tumors. However, the timing of p53 restoration in relation to its efficacy during tumor progression still is unclear. We now show that the restoration of p53 in murine premalignant proliferating pineal lesions resulted in cellular senescence, while p53 restoration in invasive pineal tumors did not. The effectiveness of p53 restoration was not dependent on p19Arf expression but showed an inverse correlation with Mdm2 expression. In tumor cells, p53 restoration became effective when paired with either DNA-damaging therapy or with nutlin, an inhibitor of p53-Mdm2 interaction. Interestingly, the inactivation of p53 after senescence resulted in reentry into the cell cycle and rapid tumor progression. The evaluation of a panel of human supratentorial primitive neuroectodermal tumors (sPNET) showed low activity of the p53 pathway. Together, these data suggest that the restoration of the p53 pathway has different effects in premalignant versus invasive pineal tumors, and that p53 activation needs to be continually sustained, as reversion from senescence occurs rapidly with aggressive tumor growth when p53 is lost again. Finally, p53 restoration approaches may be worth exploring in sPNET, where the p53 gene is intact but the pathway is inactive in the majority of examined tumors. PMID:26598601

Comparing Tolerability and Efficacy of Generic versus Brand Alendronate: A Randomized Clinical Study in Postmenopausal Women with a Recent Fracture

PubMed Central

van den Bergh, Joop P. W.; Bouts, Marian E.; van der Veer, Eveline; van der Velde, Robert Y.; Janssen, Marcel J. W.; Geusens, Piet P.; Winkens, Bjorn; Oldenhof, Nico J. J.; van Geel, Tineke A. C. M.

2013-01-01

Introduction An increasing number of generic alendronate formulations have become available. Although expected to have the same tolerability and efficacy, head-to head comparison of generic and brand alendronate was never performed. Therefore, we compared the tolerability and efficacy of generic and brand alendronate. Methods In a randomized double-blinded single centre cross-over study in 37 postmenopausal women (mean age 65.4±6.4 years) with osteoporosis were treated with generic and branded alendronate during 24 (2x12) weeks. Tolerance was evaluated by the Gastro intestinal Symptom Rating Scale (GSRS) and self-reported side effects. Efficacy was assessed by serum bone turnover markers, carboxy terminal telopeptide (CTX) and procollagen type I N-terminal propeptide (PINP). No wash out period was allowed (ethical reasons). Because of possible carry over effect only data of the first 12 weeks were analyzed using linear mixed models. Results There were no significant differences in overall tolerance (GSRS) between treatment groups. However, for subscale abdominal pain, patients using generic had a significantly higher mean GSRS score at week 4 (estimated mean difference (B): 0.40; 95%CI: 0.05 to 0.74, p = 0.024). The level of bone turnover markers significantly decreased over 12 weeks of follow-up for generic and branded alendronate (p < 0.001). Mean level of CTX was significantly lower with branded at week 4 (B: 121.3; 95%CI: 52.0 to 190.5), but not at week 12 (B: 53.6; 95%CI:-3.7 to 110.9). No significant differences were found for PINP at week 4 or 12. Conclusions Bone turnover markers were significantly reduced with branded and generic alendronate. With branded, CTX was significantly lower at 4 weeks. Generic caused significantly higher abdominal pain scores in the first 4 weeks of treatment. Therefore, generic alendronate may not have the same tolerability and efficacy as branded alendronate in the first weeks after starting treatment in patients with a recent fracture. Trial Registration Dutch Trial Register NTR number 1867 http://www.trialregister.nl/trialreg/admin/rctview.asp?TC=1867 PMID:24205135

Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnb1.

PubMed

Fang, Ling; Du, William W; Lyu, Juanjuan; Dong, Jun; Zhang, Chao; Yang, Weining; He, Alina; Kwok, Yat Sze Sheila; Ma, Jian; Wu, Nan; Li, Feiya; Awan, Faryal Mehwish; He, Chengyan; Yang, Bing L; Peng, Chun; MacKay, Helen J; Yee, Albert J; Yang, Burton B

2018-05-23

TP53 mutations occur in many different types of cancers that produce mutant p53 proteins. The mutant p53 proteins have lost wild-type p53 activity and gained new functions that contribute to malignant tumor progression. Different p53 mutations create distinct profiles in loss of wild-type p53 activity and gain of functions. Targeting the consequences generated by the great number of p53 mutations would be extremely complex. Therefore, in this study we used a workaround and took advantage of the fact that mutant p53 cannot bind H2AX. Using this, we developed a new approach to repress the acquisition of mutant p53 functions. We show here that the delivery of a circular RNA circ-Ccnb1 inhibited the function of three p53 mutations. By microarray analysis and real-time PCR, we detected decreased circ-Ccnb1 expression levels in patients bearing breast carcinoma. Ectopic delivery of circ-Ccnb1 inhibited tumor growth and extended mouse viability. Using proteomics, we found that circ-Ccnb1 precipitated p53 in p53 wild-type cells, but instead precipitated Bclaf1 in p53 mutant cells. Further experiments showed that H2AX serves as a bridge, linking the interaction of circ-Ccnb1 and wild-type p53, thus allowing Bclaf1 to bind Bcl2 resulting in cell survival. In the p53 mutant cells, circ-Ccnb1 formed a complex with H2AX and Bclaf1, resulting in the induction of cell death. We found that this occurred in three p53 mutations. These results shed light on the possible development of new approaches to inhibit the malignancy of p53 mutations.

Human Cytomegalovirus nuclear egress and secondary envelopment are negatively affected in the absence of cellular p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila

2016-10-15

Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, withmore » a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.« less

Knockdown of p53 suppresses Nanog expression in embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia

2014-01-10

Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less

Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

PubMed Central

Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo

2015-01-01

ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine gammaherpesvirus 68 induces the activation of tumor suppressor p53. p53 activation was dependent on the DNA damage response kinase ataxia telangiectasia mutated. Although active early after infection, p53 became dominantly inhibited as the infection cycle progressed. Viral inhibition of p53 was mediated by the murine gammaherpesvirus 68 homologs of muSOX and mLANA. The inhibition of the p53 pathway enabled infected cells to evade p53-mediated cell death responses. These data demonstrate that a gammaherpesvirus encodes multiple proteins to limit p53-mediated responses to productive viral infection, which likely benefits acute viral replication and the establishment of chronic infection. PMID:26676792

Clinical utility of anti-p53 auto-antibody: Systematic review and focus on colorectal cancer

PubMed Central

Suppiah, Aravind; Greenman, John

2013-01-01

Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance. PMID:23922463

Mechanisms that enhance sustainability of p53 pulses.

PubMed

Kim, Jae Kyoung; Jackson, Trachette L

2013-01-01

The tumor suppressor p53 protein shows various dynamic responses depending on the types and extent of cellular stresses. In particular, in response to DNA damage induced by γ-irradiation, cells generate a series of p53 pulses. Recent research has shown the importance of sustaining repeated p53 pulses for recovery from DNA damage. However, far too little attention has been paid to understanding how cells can sustain p53 pulses given the complexities of genetic heterogeneity and intrinsic noise. Here, we explore potential molecular mechanisms that enhance the sustainability of p53 pulses by developing a new mathematical model of the p53 regulatory system. This model can reproduce many experimental results that describe the dynamics of p53 pulses. By simulating the model both deterministically and stochastically, we found three potential mechanisms that improve the sustainability of p53 pulses: 1) the recently identified positive feedback loop between p53 and Rorα allows cells to sustain p53 pulses with high amplitude over a wide range of conditions, 2) intrinsic noise can often prevent the dampening of p53 pulses even after mutations, and 3) coupling of p53 pulses in neighboring cells via cytochrome-c significantly reduces the chance of failure in sustaining p53 pulses in the presence of heterogeneity among cells. Finally, in light of these results, we propose testable experiments that can reveal important mechanisms underlying p53 dynamics.

The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

PubMed Central

Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

2013-01-01

The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function

PubMed Central

Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.

2011-01-01

The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

HIPK2 modulates p53 activity towards pro-apoptotic transcription.

PubMed

Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella

2009-10-14

Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation, by stimulating on one hand co-recruitment of p300 and p53Lys382 on apoptotic promoters and on the other hand by inhibiting Sirt1 deacetylase activity. We attempted to reactivate p53 apoptotic transcriptional activity by rescuing both Ser46 and Lys382 modification in response to drug. Our data propose combination strategies for the treatment of tumors with dysfunctional p53 and/or HIPK2 that include classical chemotherapy with pharmacological or natural agents such as Sirt1-deacetylase inhibitors or zinc, respectively.

Better management of wheat allergy using a very low-dose food challenge: A retrospective study.

PubMed

Okada, Yu; Yanagida, Noriyuki; Sato, Sakura; Ebisawa, Motohiro

2016-01-01

Low-dose reactive wheat-allergic children are at a high risk of a positive oral food challenge (OFC). The present study aimed to evaluate whether the results of a very low-dose (VL) OFC would contribute to better wheat allergy management in this population. We retrospectively reviewed wheat-allergic subjects who underwent a VL OFC with 2 g of udon noodles (equivalent to 53 mg of wheat protein) and had a previous allergic reaction to <15 g of udon noodles (equivalent to 400 mg of wheat protein) within 2 years before the OFC. Subjects who passed the OFC were defined as VL tolerant; those who failed were considered VL reactive. In VL tolerant subjects, the dose was increased to 15 g of udon noodles either during an OFC in our hospital or gradually at home. Of the 57 included subjects (median age, 2.9 years; range, 1.0-11.8 years), 32 (56%) were VL tolerant and 25 (44%) were VL reactive. Most reactions during the OFC could be treated with an antihistamine and/or a nebulized β2 agonist. VL tolerant subjects consumed 2 g of udon noodles or a seasoning containing wheat. Within a year after the OFC, 18 VL tolerant subjects (56%), but no VL reactive subjects, were able to consume 15 g of udon noodles (p < 0.001). A VL OFC can shift the management of some low-dose reactive wheat-allergic children from complete avoidance to partial wheat intake. Copyright © 2015 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

An adaptive molecular timer in p53-meidated cell fate decision

NASA Astrophysics Data System (ADS)

Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.

PubMed

Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald

2013-04-17

The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.

UBE4B targets phosphorylated p53 at serines 15 and 392 for degradation

PubMed Central

Du, Cheng; Wu, Hong; Leng, Roger P.

2016-01-01

Phosphorylation of p53 is a key mechanism responsible for the activation of its tumor suppressor functions in response to various stresses. In unstressed cells, p53 is rapidly turned over and is maintained at a low basal level. After DNA damage or other forms of cellular stress, the p53 level increases, and the protein becomes metabolically stable. However, the mechanism of phosphorylated p53 regulation is unclear. In this study, we studied the kinetics of UBE4B, Hdm2, Pirh2, Cop1 and CHIP induction in response to p53 activation. We show that UBE4B coimmunoprecipitates with phosphorylated p53 at serines 15 and 392. Notably, the affinity between UBE4B and Hdm2 is greatly decreased after DNA damage. Furthermore, we observe that UBE4B promotes endogenous phospho-p53(S15) and phospho-p53(S392) degradation in response to IR. We demonstrate that UBE4B and Hdm2 repress p53S15A, p53S392A, and p53-2A(S15A, S392A) functions, including p53-dependent transactivation and growth inhibition. Overall, our results reveal that UBE4B plays an important role in regulating phosphorylated p53 following DNA damage. PMID:26673821

A randomised trial of salsalate for insulin resistance and cardiovascular risk factors in persons with abnormal glucose tolerance

PubMed Central

Goldfine, A. B.; Conlin, P. R.; Halperin, F.; Koska, J.; Permana, P.; Schwenke, D.; Shoelson, S. E.

2016-01-01

Aims/hypothesis Chronic sub-acute inflammation contributes to the pathogenesis of type 2 diabetes mellitus and cardiovascular disease. High doses of salicylate reduce inflammation, glucose and triacylglycerols, and may improve insulin sensitivity, suggesting therapeutic potential in impaired fasting glucose and/or impaired glucose tolerance. This trial aimed to evaluate the effect of salsalate vs placebo on insulin resistance and glycaemia in impaired fasting glucose and/or impaired glucose tolerance. Methods We conducted a 12 week, two-centre, randomised, placebo-controlled study to evaluate the effect of salsalate (up to 4 g/day) vs placebo on systemic glucose disposal. Secondary objectives included treatment effects on glycaemia, inflammation and cardiovascular risk factors. Seventy-eight participants with impaired fasting glucose and/or impaired glucose tolerance from two VA healthcare systems were enrolled. Randomisation assignment was provided by the coordinating center directly to site pharmacists, and participants and research staff were blinded to treatment assignment. Results Seventy-one individuals were randomised to placebo (n = 36) or salsalate (n = 35). Glucose disposal did not change in either group (salsalate 1% [95% CI −39%, 56%]; placebo 6% [95% CI −20%, 61%], p = 0.3 for placebo vs salsalate). Fasting glucose was reduced by 6% during the study by salsalate (p = 0.006) but did not change with placebo. Declines in glucose were accompanied by declines in fasting C-peptide with salsalate. Insulin clearance was reduced with salsalate. In the salsalate group, triacylglycerol levels were lower by 25% (p = 0.01) and adiponectin increased by 53% (p = 0.02) at the end of the study. Blood pressure, endothelial function and other inflammation markers did not differ between groups. Adipose tissue nuclear factor κB (NF-κB) activity declined in the salsalate group compared with placebo (−16% vs 42%, p = 0.005), but was not correlated with metabolic improvements. The frequency of tinnitus was low but tended to be higher with salsalate therapy (n =4 vs n =2). Conclusions/interpretation In summary, salsalate therapy was well tolerated, lowered fasting glucose, increased adiponectin and reduced adipose tissue NF-κB activity. These changes were not related to changes in peripheral insulin sensitivity, suggesting additional mechanisms for metabolic improvement. Trial registration ClinicalTrials.gov NCT00330733 Funding Office of Research and Development, Medical Research Service, Department of Veterans Affairs and NIH K24 DK63214 PMID:23370525

A tryptophanol-derived oxazolopiperidone lactam is cytotoxic against tumors via inhibition of p53 interaction with murine double minute proteins.

PubMed

Soares, Joana; Raimundo, Liliana; Pereira, Nuno A L; dos Santos, Daniel J V A; Pérez, Maria; Queiroz, Glória; Leão, Mariana; Santos, Maria M M; Saraiva, Lucília

2015-01-01

Inactivation of the p53 tumor suppressor protein by interaction with murine double minute (MDM) proteins, MDM2 and MDMX, is a common event in human tumors expressing wild-type p53. In these tumors, the simultaneous inhibition of these interactions with MDMs, for a full p53 reactivation, represents a promising anticancer strategy. Herein, we report the identification of a dual inhibitor of the p53 interaction with MDM2 and MDMX, the (S)-tryptophanol derivative OXAZ-1, from the screening of a small library of enantiopure tryptophanol-derived oxazolopiperidone lactams, using a yeast-based assay. With human colon adenocarcinoma HCT116 cell lines expressing wild-type p53 (HCT116 p53(+/+)) and its p53-null isogenic derivative (HCT116 p53(-/-)), it was shown that OXAZ-1 induced a p53-dependent tumor growth-inhibitory effect. In fact, OXAZ-1 induced p53 stabilization, up-regulated p53 transcription targets, such as MDM2, MDMX, p21, Puma and Bax, and led to PARP cleavage, in p53(+/+), but not in p53(-/-), HCT116 cells. In addition, similar tumor cytotoxic effects were observed for OXAZ-1 against MDMX-overexpressing breast adenocarcinoma MCF-7 tumor cells, commonly described as highly resistant to MDM2-only inhibitors. In HCT116 p53(+/+) cells, the disruption of the p53 interaction with MDMs by OXAZ-1 was further confirmed by co-immunoprecipitation. It was also shown that OXAZ-1 potently triggered a p53-dependent mitochondria-mediated apoptosis, characterized by reactive oxygen species generation, mitochondrial membrane potential dissipation, Bax translocation to mitochondria, and cytochrome c release, and exhibited a p53-dependent synergistic effect with conventional chemotherapeutic drugs. Collectively, in this work, a novel selective activator of the p53 pathway is reported with promising antitumor properties to be explored either alone or combined with conventional chemotherapeutic drugs. Moreover, OXAZ-1 may represent a promising starting scaffold to search for new dual inhibitors of the p53-MDMs interaction. Copyright © 2015 Elsevier Ltd. All rights reserved.

Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

PubMed Central

Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

2012-01-01

During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

Pregabalin for painful HIV neuropathy

PubMed Central

Simpson, D. M.; Schifitto, G.; Clifford, D. B.; Murphy, T. K.; Durso-De Cruz, E.; Glue, P.; Whalen, E.; Emir, B.; Scott, G. N.; Freeman, R.

2010-01-01

Objective: Pregabalin is effective in several neuropathic pain syndromes. This trial evaluated its efficacy, safety, and tolerability for treatment of painful HIV-associated neuropathy. Methods: This randomized, double-blind, placebo-controlled, parallel-group trial included a 2-week double-blind dose-adjustment (150–600 mg/day BID) phase, a 12-week double-blind maintenance phase, and an optional 3-month open label extension phase. The primary efficacy measure was the mean Numeric Pain Rating Scale (NPRS) score, an 11-point numeric rating scale. Secondary measures included Patient Global Impression of Change (PGIC) and sleep measurements. Results: Baseline mean NPRS score was 6.93 for patients randomized to pregabalin (n = 151) and 6.72 for those to placebo (n = 151). Pregabalin average daily dosage (SD) was 385.7 (160.3) mg/d. At endpoint, pregabalin and placebo showed substantial reductions in mean NPRS score from baseline: −2.88 vs −2.63, p = 0.3941. Pregabalin had greater improvements in NPRS score relative to placebo at weeks 1 (−1.14 vs −0.69, p = 0.0131) and 2 (−1.92 vs −1.43, p = 0.0393), and at weeks 7 (−3.22 vs −2.53 p = 0.0307) and 8 (−3.33 vs −2.53, p = 0.0156). At all other time points, differences between groups were not significant. Sleep measurements and 7-item PGIC did not differ among treatment groups; however, collapsed PGIC scores showed 82.8% of pregabalin and 66.7% of placebo patients rated themselves in 1 of the 3 “improved” categories (p = 0.0077). Somnolence and dizziness were the most common adverse events with pregabalin. Conclusions: Pregabalin was well-tolerated, but not superior to placebo in the treatment of painful HIV neuropathy. Factors predicting analgesic response in HIV neuropathy warrant additional research. Classification of Evidence: This Class II trial showed that pregabalin is not more effective than placebo in treatment of painful HIV neuropathy. GLOSSARY AE = adverse events; ANCOVA = analysis of covariance; ARF = activity region finder; ARV = antiretroviral; GPS = Gracely Pain Scale; HADS = Hospital Anxiety and Depression Scale; HIV-DSP = HIV-associated distal sensory polyneuropathy; LOCF = last observation carried forward; mBPI-sf = modified Brief Pain Inventory–short form; NPRS = Numeric Pain Rating Scale; NPSI = Neuropathic Pain Symptom Inventory; NRS = Numeric Rating Scale; PGIC = Patient Global Impression of Change; VAS = visual analog scale. PMID:20124207

Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.

PubMed Central

el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.

1997-01-01

We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405

Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

PubMed Central

Stegh, Alexander H.

2012-01-01

Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

Mutant p53 protein localized in the cytoplasm inhibits autophagy.

PubMed

Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

2008-10-01

The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

Suppression of p53 Activity through the Cooperative Action of Ski and Histone Deacetylase SIRT1*

PubMed Central

Inoue, Yasumichi; Iemura, Shun-ichiro; Natsume, Tohru; Miyazawa, Keiji; Imamura, Takeshi

2011-01-01

Ski was originally identified as an oncogene based on the fact that Ski overexpression transformed chicken and quail embryo fibroblasts. Consistent with these proposed oncogenic roles, Ski is overexpressed in various human tumors. However, whether and how Ski functions in mammalian tumorigenesis has not been fully investigated. Here, we show that Ski interacts with p53 and attenuates the biological functions of p53. Ski overexpression attenuated p53-dependent transactivation, whereas Ski knockdown enhanced the transcriptional activity of p53. Interestingly, Ski bound to the histone deacetylase SIRT1 and stabilized p53-SIRT1 interaction to promote p53 deacetylation, which subsequently decreased the DNA binding activity of p53. Consistent with the ability of Ski to inactivate p53, overexpressing Ski desensitized cells to genotoxic drugs and Nutlin-3, a small-molecule antagonist of Mdm2 that stabilizes p53 and activates the p53 pathway, whereas knocking down Ski increased the cellular sensitivity to these agents. These results indicate that Ski negatively regulates p53 and suggest that the p53-Ski-SIRT1 axis is an attractive target for cancer therapy. PMID:21149449

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity

PubMed Central

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

PubMed

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

TP53 Mutation Status of Tubo-ovarian and Peritoneal High-grade Serous Carcinoma with a Wild-type p53 Immunostaining Pattern.

PubMed

Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo

2017-12-01

Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

PubMed

Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

2017-08-01

p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

PubMed Central

Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

2008-01-01

Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

The association between brain-derived neurotrophic factor and central pulse pressure after an oral glucose tolerance test.

PubMed

Lee, I-Te; Chen, Chen-Huan; Wang, Jun-Sing; Fu, Chia-Po; Lee, Wen-Jane; Liang, Kae-Woei; Lin, Shih-Yi; Sheu, Wayne Huey-Herng

2018-01-01

Arterial stiffening blunts postprandial vasodilatation. We hypothesized that brain-derived neurotrophic factor (BDNF) may modulate postprandial central pulse pressure, a surrogate marker for arterial stiffening. A total of 82 non-diabetic subjects received a 75-g oral glucose tolerance test (OGTT) after overnight fasting. Serum BDNF concentrations were determined at 0, 30, and 120min to calculate the area under the curve (AUC). Brachial and central blood pressures were measured using a noninvasive central blood pressure monitor before blood withdrawals at 0 and 120min. With the median AUC of BDNF of 45(ng/ml)∗h as the cutoff value, the central pulse pressure after glucose intake was significantly higher in the subjects with a low BDNF than in those with a high BDNF (63±16 vs. 53±11mmHg, P=0.003), while the brachial pulse pressure was not significantly different between the 2 groups (P=0.099). In a multivariate linear regression model, a lower AUC of BDNF was an independent predictor of a higher central pulse pressure after oral glucose intake (linear regression coefficient-0.202, 95% confidence interval-0.340 to -0.065, P=0.004). After oral glucose challenge, a lower serum BDNF response is significantly associated with a higher central pulse pressure. Copyright © 2017 Elsevier B.V. All rights reserved.

A stapled p53 helix overcomes HDMX-mediated suppression of p53.

PubMed

Bernal, Federico; Wade, Mark; Godes, Marina; Davis, Tina N; Whitehead, David G; Kung, Andrew L; Wahl, Geoffrey M; Walensky, Loren D

2010-11-16

Cancer cells neutralize p53 by deletion, mutation, proteasomal degradation, or sequestration to achieve a pathologic survival advantage. Targeting the E3 ubiquitin ligase HDM2 can lead to a therapeutic surge in p53 levels. However, the efficacy of HDM2 inhibition can be compromised by overexpression of HDMX, an HDM2 homolog that binds and sequesters p53. Here, we report that a stapled p53 helix preferentially targets HDMX, blocks the formation of inhibitory p53-HDMX complexes, induces p53-dependent transcriptional upregulation, and thereby overcomes HDMX-mediated cancer resistance in vitro and in vivo. Importantly, our analysis of p53 interaction dynamics provides a blueprint for reactivating the p53 pathway in cancer by matching HDM2, HDMX, or dual inhibitors to the appropriate cellular context. Copyright © 2010 Elsevier Inc. All rights reserved.

MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.

PubMed

Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M

2018-04-17

The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.

Mutation at p53 serine 389 does not rescue the embryonic lethality in mdm2 or mdm4 null mice.

PubMed

Iwakuma, Tomoo; Parant, John M; Fasulo, Mark; Zwart, Edwin; Jacks, Tyler; de Vries, Annemieke; Lozano, Guillermina

2004-10-07

Mdm2 and its homolog Mdm4 inhibit the function of the tumor suppressor p53. Targeted disruption of either mdm2 or mdm4 genes in mice results in embryonic lethality that is completely rescued by concomitant deletion of p53, suggesting that deletion of negative regulators of p53 results in a constitutively active p53. Thus, these mouse models offer a unique in vivo system to assay the functional significance of different p53 modifications. Phosphorylation of serine 389 in murine p53 occurs specifically after ultraviolet-light-induced DNA damage, and phosphorylation of this site enhances p53 activity both in vitro and in vivo. Recently, mice with a serine to alanine substitution at serine 389 (p53S389A) in the endogenous p53 locus were generated. To examine the in vivo significance of serine 389 phosphorylation during embryogenesis, we crossed these mutant mice to mice lacking mdm2 or mdm4. The p53S389A allele did not alter the embryonic lethality of mdm2 or mdm4. Additional crosses to assay the effect of one p53S389A allele with a p53 null allele also did not rescue the lethal phenotypes. In conclusion, the phenotypes due to loss of mdm2 or mdm4 were not even partially rescued by p53S389A, suggesting that p53S389A is functionally wild type during embryogenesis.

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting

Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53more » status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.« less

EFFICACY OF SERVO-CONTROLLED SPLANCHNIC VENOUS COMPRESSION IN THE TREATMENT OF ORTHOSTATIC HYPOTENSION. A RANDOMIZED COMPARISON WITH MIDODRINE

PubMed Central

Okamoto, Luis E.; Diedrich, André; Baudenbacher, Franz J.; Harder, René; Whitfield, Jonathan S.; Iqbal, Fahad; Gamboa, Alfredo; Shibao, Cyndya A.; Black, Bonnie K.; Raj, Satish R.; Robertson, David; Biaggioni, Italo

2016-01-01

Splanchnic venous pooling is a major hemodynamic determinant of orthostatic hypotension (OH), but is not specifically targeted by pressor agents, the mainstay of treatment. We developed an automated inflatable abdominal binder that provides sustained servo-controlled venous compression (40 mmHg) and can be activated only on standing. We tested the efficacy of this device against placebo and compared it to midodrine in nineteen autonomic failure patients randomized to receive either placebo, midodrine (2.5–10 mg) or placebo combined with binder on separate days in a single-blind, crossover study. Systolic blood pressure (SBP) was measured seated and standing before and 1-hour post-medication; the binder was inflated immediately before standing. Only midodrine increased seated SBP (31±5 vs. 9±4 placebo and 7±5 binder, P=0.003); whereas orthostatic tolerance (defined as area under the curve of upright SBP [AUCSBP]) improved similarly with binder and midodrine (AUCSBP, 195±35 and 197±41 vs. 19±38 mmHg*min for placebo, P=0.003). Orthostatic symptom burden decreased with the binder (from 21.9±3.6 to 16.3±3.1, P=0.032) and midodrine (from 25.6±3.4 to 14.2±3.3, P<0.001), but not with placebo (from 19.6±3.5 to 20.1±3.3, P=0.756). We also compared the combination of midodrine and binder, with midodrine alone. The combination produced a greater increase in orthostatic tolerance (AUCSBP, 326±65 vs. 140±53 mmHg*min for midodrine alone, P=0.028, n=21), and decreased orthostatic symptoms (from 21.8±3.2 to 12.9±2.9, P<0.001). In conclusion, servo-controlled abdominal venous compression with an automated inflatable binder is as effective as midodrine, the standard of care, in the management of OH. Combining both therapies produces greater improvement in orthostatic tolerance. PMID:27271310

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

PubMed

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

PubMed Central

Polato, Federica; Rusconi, Paolo

2014-01-01

Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

Regulation of autophagy by cytoplasmic p53.

PubMed

Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2008-06-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

Enhanced radiosensitivity of malignant glioma cells after adenoviral p53 transduction.

PubMed

Broaddus, W C; Liu, Y; Steele, L L; Gillies, G T; Lin, P S; Loudon, W G; Valerie, K; Schmidt-Ullrich, R K; Fillmore, H L

1999-12-01

The goal of this study was to determine whether adenoviral vector-mediated expression of human wildtype p53 can enhance the radiosensitivity of malignant glioma cells that express native wild-type p53. The p53 gene is thought to function abnormally in the majority of malignant gliomas, although it has been demonstrated to be mutated in only approximately 30%. This has led to studies in which adenoviral transduction with wild-type human p53 has been investigated in an attempt to slow tumor cell growth. Recent studies suggest that reconstitution of wild-type p53 can render cells more susceptible to radiation-mediated death, primarily by p53-mediated apoptosis. Rat RT2 glioma cells were analyzed for native p53 status by reverse transcriptase-polymerase chain reaction and sequence analysis and for p53 expression by Western blot analysis. Clonogenic survival and the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assay were used to characterize RT2 cell radiosensitivity and apoptosis, respectively, with and without prior transduction with p53-containing and control adenoviral vectors. Animal survival length was monitored after intracerebral implantation with transduced and nontransduced RT2 cells, with and without cranial radiation. The RT2 cells were demonstrated to express native rat wild-type p53 and to markedly overexpress human p53 following adenoviral p53 transduction. The combination of p53 transduction followed by radiation resulted in marked decreases in RT2 cell survival and increases in apoptosis at radiation doses from 2 to 6 Gy. Animals receiving cranial radiation after intracerebral implantation with RT2 cells previously transduced with p53 survived significantly longer than control animals (p<0.01). The ability to enhance the radiosensitivity of malignant glioma cells that express wild-type p53 by using adenoviral transduction to induce overexpression of p53 offers hope for this approach as a therapeutic strategy, not only in human gliomas that express mutant p53, but also in those that express wild-type p53.

[Reduced intensity conditioning allogeneic hematopoietic stem cell transplantation in chronic lymphocytic leukemia (CLL) patients with the aberration of p53 gene].

PubMed

Wang, Li; Miao, Kourong; Fan, Lei; Xu, Ji; Wu, Hanxin; Li, Jianyong; Xu, Wei

2016-04-01

To investigate the effectiveness and safety of reduced intensity conditioning allogeneic hematopoietic stem cell transplantation (RIC allo-HSCT) in ultra high risk chronic lymphocytic leukemia (CLL) patients with the deletion of p53 to deepen the understanding of allo-HSCT in the treatment of CLL. In this retrospective study, a total of 4 ultra high risk CLL patients with the deletion of p53 in our center between July 2012 and Jan 2014 were enrolled. The RIC regimen was administered and the hematopoietic reconstitution, transplantation related mortality (TRM), overall survival (OS), progress free survival (PFS) were evaluated. We registered 4 patients with the median age of 56 years (49-61 years), including 3 males and 1 female. The median mononuclear cells (MNC) and CD34(+) cells were 6.54 (2.85-14.7) × 10(8)/kg (recipient body weight) and 5.81 (2.85-7.79) × 10(6)/kg (recipient body weight), respectively. The median time of the neutrophil recovery was 11 days (range of 9-12 days), and the median time of the platelet recovery 5.5 days (range of 0-11 days). Three patients (75%) attained a full donor chimerism at day 28 after transplantation and one (25%) got a mixed chimerism of donor and recipient. During the follow-up at a median time of 26.5 months (range of 21-39 months), 2 (50%) patients developed acute graft versus host disease (aGVHD) grade I and 2 (50%) patients got CMV infection. One patient got herpes zoster virus and EB virus infections. No transplantation related mortality was found in the 4 patients. One patient who was in partial response status progressed 5 months after transplantation, and the other 3 patients remained in durable remission after allo-HSCT. These results suggested that RIC allo-HSCT showed durable remission, good tolerance and acceptable toxicity, which could be a better option for the treatment of ultra high risk CLL patients with the deletion of p53 and was worth to be investigated and applied widely in future.

Lung tumors with distinct p53 mutations respond similarly to p53 targeted therapy but exhibit genotype-specific statin sensitivity

PubMed Central

Turrell, Frances K.; Kerr, Emma M.; Gao, Meiling; Thorpe, Hannah; Doherty, Gary J.; Cridge, Jake; Shorthouse, David; Speed, Alyson; Samarajiwa, Shamith; Hall, Benjamin A.; Griffiths, Meryl; Martins, Carla P.

2017-01-01

Lung adenocarcinoma accounts for ∼40% of lung cancers, the leading cause of cancer-related death worldwide, and current therapies provide only limited survival benefit. Approximately half of lung adenocarcinomas harbor mutations in TP53 (p53), making these mutants appealing targets for lung cancer therapy. As mutant p53 remains untargetable, mutant p53-dependent phenotypes represent alternative targeting opportunities, but the prevalence and therapeutic relevance of such effects (gain of function and dominant-negative activity) in lung adenocarcinoma are unclear. Through transcriptional and functional analysis of murine KrasG12D-p53null, -p53R172H (conformational), and -p53R270H (contact) mutant lung tumors, we identified genotype-independent and genotype-dependent therapeutic sensitivities. Unexpectedly, we found that wild-type p53 exerts a dominant tumor-suppressive effect on mutant tumors, as all genotypes were similarly sensitive to its restoration in vivo. These data show that the potential of p53 targeted therapies is comparable across all p53-deficient genotypes and may explain the high incidence of p53 loss of heterozygosity in mutant tumors. In contrast, mutant p53 gain of function and their associated vulnerabilities can vary according to mutation type. Notably, we identified a p53R270H-specific sensitivity to simvastatin in lung tumors, and the transcriptional signature that underlies this sensitivity was also present in human lung tumors, indicating that this therapeutic approach may be clinically relevant. PMID:28790158

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

The impact of p53 on the early stage replication of retrovirus.

PubMed

Kinnetz, Michaela; Alghamdi, Faris; Racz, Michael; Hu, Wenwei; Shi, Binshan

2017-08-09

The function of p53 in cancer biology has been studied extensively, but its role in anti-retrovirus infection has been elusive for many years. The restriction of retrovirus early stage replication by p53 was investigated in this study. VSV-G pseudotyped retrovirus with GFP reporter gene was used to infect both HCT116 p53 +/+ cells and its isogenic p53 knockout HCT116 p53 -/- cells. The infection was detected by flow cytometry. Reverse transcription products were quantified by real time PCR. Mutation analysis was performed after 1-LTR cycle and 2-LTR cycle DNA were amplified and PCR products were sequenced. Transcription and translation of cyclin-dependent kinase inhibitor 1 (p21 Cip1 ) and SAM domain and HD domain-containing protein 1 (SAMHD1) were analyzed by TaqMan PCR and Western blot experiments. siRNA experiment was applied to study the role of p53 downstream gene p21 Cip1 in the restriction of retrovirus infection. It was found that the block of retrovirus infection in non-cycling cells was significantly attenuated in HCT116 p53 -/- cells when compared to HCT116 p53 +/+ cells. It was found that both late reverse transcription products and viral 2-LTR cycle DNA were significantly increased in infected non-cycling HCT116 p53 -/- cells. Furthermore, the mutation frequency detected in 1-LTR DNA from HCT116 p53 +/+ cells were significantly decreased in comparison to HCT116 p53 -/- cells. A higher number of insertion and deletion mutations were detected in the joint region of 2-LTR cycle DNA in infected p53 +/+ cells. Cell cycle analysis showed retrovirus infection promoted host cell replication. Higher levels of mRNA and protein of p21 Cip1 were found in HCT116 p53 +/+ cells in comparison to the HCT116 p53 -/- cells. Furthermore, knockdown of p21 Cip1 in non-cycling HCT116 p53 +/+ cells significantly increased the infection. The results of this study showed that p53 is an important restriction factor that interferes with retrovirus infection in its early stage of replication. Our results suggested that p53 mediates the inhibition of retrovirus infection in non-cycling cells through it downstream gene p21 Cip1 , and p53 also functions to influence formation of 1-LTR cycle and 2-LTR cycle DNA.

MicroRNAs as Key Effectors in the p53 Network.

PubMed

Goeman, Frauke; Strano, Sabrina; Blandino, Giovanni

2017-01-01

The guardian of the genome p53 is embedded in a fine-spun network of MicroRNAs. p53 is able to activate or repress directly the transcription of MicroRNAs that are participating in the tumor-suppressive mission of p53. On the other hand, the expression of p53 is under tight control of MicroRNAs that are either targeting directly p53 or factors that are modifying its protein level or activity. Although the most important function of p53 is suggested to be transcriptional regulation, there are several nontranscriptional functions described. One of those regards the modulation of MicroRNA biogenesis. Wild-type p53 is increasing the maturation of selected MicroRNAs from the primary transcript to the precursor MiRNA by interacting with the Microprocessor complex. Furthermore, p53 is modulating the mRNA accessibility for certain MicroRNAs by association with the RISC complex and transcriptional regulation of RNA-binding proteins. In this way p53 is able to remodel the MiRNA-mRNA interaction network. As wild-type p53 is employing MicroRNAs to suppress cancer development, gain-of-function mutant p53 proteins use MicroRNAs to confer oncogenic properties like chemoresistance and the ability to drive metastasis. Like its wild-type counterpart mutant p53 is able to regulate MicroRNAs transcriptionally and posttranscriptionally. Mutant p53 affects the MiRNA processing at two cleavage steps through interfering with the Microprocessor complex and by downregulating Dicer and KSRP, a modulator of MiRNA biogenesis. Thus, MicroRNAs are essential components in the p53 pathway, contributing substantially to combat or enhance tumor development depending on the wild-type or mutant p53 context. © 2017 Elsevier Inc. All rights reserved.

Evolution of p53 transactivation specificity through the lens of a yeast-based functional assay.

PubMed

Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

2015-01-01

Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective.

Role of p53 in silibinin-mediated inhibition of ultraviolet B radiation-induced DNA damage, inflammation and skin carcinogenesis.

PubMed

Rigby, Cynthia M; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K; Dhar, Deepanshi; Orlicky, David J; Agarwal, Chapla; Agarwal, Rajesh

2017-01-01

Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53 +/- ) and p53 knockout (p53 -/- ) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53 +/+ mice, p53 +/- mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53 +/+ mice but silibinin' protective efficacy was significantly compromised in p53 +/- mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53 -/- mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53 +/+ mice while its efficacy was partially compromised in p53 -/- mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Role of p53 in silibinin-mediated inhibition of ultraviolet B radiation-induced DNA damage, inflammation and skin carcinogenesis

PubMed Central

Rigby, Cynthia M.; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K.; Dhar, Deepanshi; Orlicky, David J.; Agarwal, Chapla; Agarwal, Rajesh

2017-01-01

Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53+/−) and p53 knockout (p53−/−) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53+/+ mice, p53+/− mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53+/+ mice but silibinin’ protective efficacy was significantly compromised in p53+/− mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53−/− mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53+/+ mice while its efficacy was partially compromised in p53−/− mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. PMID:27729375

Evolution of p53 Transactivation Specificity through the Lens of a Yeast-Based Functional Assay

PubMed Central

Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

2015-01-01

Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429

Substrate phosphorylation and feedback regulation in JFK-promoted p53 destabilization.

PubMed

Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

2011-02-11

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G(1) arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation.

Substrate Phosphorylation and Feedback Regulation in JFK-promoted p53 Destabilization*

PubMed Central

Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

2011-01-01

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G1 arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation. PMID:21127074

Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas.

PubMed

La Perle, K M; Jhiang, S M; Capen, C C

2000-08-01

Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53-/- mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53-/- mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53-/- mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/- mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/- mice

Battle against cancer: an everlasting saga of p53.

PubMed

Hao, Qian; Cho, William C

2014-12-01

Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

Functional activation of mutant p53V172F by platinum analogs in cisplatin-resistant human tumor cells is dependent on serine-20 phosphorylation

PubMed Central

Xie, Xiaolei; He, Guangan; Siddik, Zahid H.

2017-01-01

Dysfunctionality of the p53 tumor suppressor is a major cause of therapeutic drug resistance in cancer. Recently we reported that mutant, but otherwise functional, p53V172F was inactivated in cisplatin-resistant 2780CP/Cl-16 and 2780CP/Cl-24 human ovarian tumor cells by increased recruitment of the inhibitor MDM4. The current study demonstrates that, unlike cisplatin, platinum analogs oxaliplatin and DACH-diacetato-dichloro-Pt(IV) (DAP), strongly stabilize and activate p53V172F in resistant cells, as indicated by prolonged p53 half-life and transactivation of targets p21 (CDKN1A) and MDM2. This increase in MDM2 reduced MDM4 levels in cell lysates as well as the p53 immunocomplex and prevented reversion of p53 to the inactive p53-MDM2-MDM4 bound state. Phosphorylation of p53 at Ser15 was demonstrated by all three drugs in sensitive A2780 and corresponding resistant 2780CP/Cl-16 and 2780CP/Cl-24 cell lines. However, cisplatin induced Ser20 phosphorylation in A2780 cells only, but not in resistant cells; in contrast, both DAP and oxaliplatin induced this phosphorylation in all three cell lines. The inference that Ser20 phosphorylation is more important for p53 activation was confirmed by ectopic expression of a phosphomimetic (S20D) mutant p53 that displayed reduced binding, relative to wild-type p53, to both MDM2 and MDM4 in p53-knockout A2780 cells. In consonance, temporal studies demonstrated drug-induced Ser15 phosphorylation coincided with p53 stabilization, whereas Ser20 phosphorylation coincided with p53 transactivation. Implications Cisplatin fails to activate the pathway involved in phosphorylating mutant p53V172F at Ser20 in resistant cells, but this phosphorylation is restored by oxaliplatin and DAP that reactivates p53 function and circumvents cisplatin resistance. PMID:28031409

Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

PubMed Central

Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

2009-01-01

Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

Postexercise rehydration: potassium-rich drinks versus water and a sports drink.

PubMed

Pérez-Idárraga, Alexandra; Aragón-Vargas, Luis Fernando

2014-10-01

Fluid retention, thirst quenching, tolerance, and palatability of different drinks were assessed. On 4 different days, 12 healthy, physically active volunteers (24.4 ± 3.2 years old, 74.75 ± 11.36 kg body mass (mean ± S.D)), were dehydrated to 2.10% ± 0.24% body mass by exercising in an environmental chamber (32.0 ± 0.4 °C dry bulb, 53.8 ± 5.2% relative humidity). Each day they drank 1 of 4 beverages in random order: fresh coconut water (FCW), bottled water (W), sports drink (SD), or potassium-rich drink (NEW); volume was 120% of weight loss. Urine was collected and perceptions self-reported for 3 h. Urine output was higher (p < 0.05) for W (894 ± 178 mL) than SD (605 ± 297 mL) and NEW (599 ± 254 mL). FCW (686 ± 250 mL) was not different from any other drink (p > 0.05). Fluid retention was higher for SD than W (68.2% ± 13.0% vs. 51.3% ± 12.6%, p = 0.013), but not for FCW and NEW (62.5% ± 15.4% and 65.9% ± 15.4%, p > 0.05). All beverages were palatable and well tolerated; none maintained a positive net fluid balance after 3 h, but deficit was greater in W versus SD (p = 0.001). FCW scored higher for sweetness (p = 0.03). Thirst increased immediately after exercise but returned to baseline after drinking a small volume (p < 0.0005). In conclusion, additional potassium in FCW and NEW did not result in additional rehydration benefits over those already found in a conventional sports drink with sodium.

The impact of p53 protein core domain structural alteration on ovarian cancer survival.

PubMed

Rose, Stephen L; Robertson, Andrew D; Goodheart, Michael J; Smith, Brian J; DeYoung, Barry R; Buller, Richard E

2003-09-15

Although survival with a p53 missense mutation is highly variable, p53-null mutation is an independent adverse prognostic factor for advanced stage ovarian cancer. By evaluating ovarian cancer survival based upon a structure function analysis of the p53 protein, we tested the hypothesis that not all missense mutations are equivalent. The p53 gene was sequenced from 267 consecutive ovarian cancers. The effect of individual missense mutations on p53 structure was analyzed using the International Agency for Research on Cancer p53 Mutational Database, which specifies the effects of p53 mutations on p53 core domain structure. Mutations in the p53 core domain were classified as either explained or not explained in structural or functional terms by their predicted effects on protein folding, protein-DNA contacts, or mutation in highly conserved residues. Null mutations were classified by their mechanism of origin. Mutations were sequenced from 125 tumors. Effects of 62 of the 82 missense mutations (76%) could be explained by alterations in the p53 protein. Twenty-three (28%) of the explained mutations occurred in highly conserved regions of the p53 core protein. Twenty-two nonsense point mutations and 21 frameshift null mutations were sequenced. Survival was independent of missense mutation type and mechanism of null mutation. The hypothesis that not all missense mutations are equivalent is, therefore, rejected. Furthermore, p53 core domain structural alteration secondary to missense point mutation is not functionally equivalent to a p53-null mutation. The poor prognosis associated with p53-null mutation is independent of the mutation mechanism.

CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

PubMed

He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

2016-01-01

The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

PubMed

Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

2014-06-14

The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway

PubMed Central

2014-01-01

Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies. PMID:24927749

Stabilization and activation of p53 are regulated independently by different phosphorylation events

PubMed Central

Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

1998-01-01

Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

The curcumin analog HO-3867 selectively kills cancer cells by converting mutant p53 protein to transcriptionally active wildtype p53.

PubMed

Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan

2018-03-23

p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

p53 genes function to restrain mobile elements

PubMed Central

Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

2016-01-01

Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

Cytoplasmic sequestration of the tumor suppressor p53 by a heat shock protein 70 family member, mortalin, in human colorectal adenocarcinoma cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gestl, Erin E., E-mail: egestl@wcupa.edu; Anne Boettger, S., E-mail: aboettger@wcupa.edu

2012-06-29

Highlights: Black-Right-Pointing-Pointer Eight human colorectal cell lines were evaluated for p53 and mortalin localization. Black-Right-Pointing-Pointer Six cell lines displayed cytoplasmic sequestration of the tumor suppressor p53. Black-Right-Pointing-Pointer Direct interaction between mortalin and p53 was shown in five cell lines. Black-Right-Pointing-Pointer Cell lines positive for p53 sequestration yielded elevated p53 expression levels. Black-Right-Pointing-Pointer This study yields the first evidence of cytoplasmic sequestration p53 by mortalin. -- Abstract: While it is known that cytoplasmic retention of p53 occurs in many solid tumors, the mechanisms responsible for this retention have not been positively identified. Since heatshock proteins like mortalin have been associated withmore » p53 inactivation in other tumors, the current study sought to characterize this potential interaction in never before examined colorectal adenocarcinoma cell lines. Six cell lines, one with 3 different fractions, were examined to determine expression of p53 and mortalin and characterize their cellular localization. Most of these cell lines displayed punctate p53 and mortalin localization in the cell cytoplasm with the exception of HCT-8 and HCT116 379.2 cells, where p53 was not detected. Nuclear p53 was only observed in HCT-116 40-16, LS123, and HT-29 cell lines. Mortalin was only localized in the cytoplasm in all cell lines. Co-immunoprecipitation and immunohistochemistry revealed that p53 and mortalin were bound and co-localized in the cytoplasmic fraction of four cell lines, HCT-116 (40-16 and 386; parental and heterozygous fractions respectively of the same cell line), HT-29, LS123 and LoVo, implying that p53 nuclear function is limited in those cell lines by being restricted to the cytoplasm. Mortalin gene expression levels were higher than gene expression levels of p53 in all cell lines. Cell lines with cytoplasmic sequestration of p53, however, also displayed elevated p53 gene expression levels compared to cell lines without p53 sequestration. Our data reveal the characteristic cytoplasmic sequestration of p53 by the heat shock protein mortalin in human colorectal adenocarcinoma cell lines, as is the case for other cancers, such as glioblastomas and hepatocellular carcinomas.« less

Insights into wild-type and mutant p53 functions provided by genetically engineered mice.

PubMed

Donehower, Lawrence A

2014-06-01

Recent whole-exome sequencing studies of numerous human cancers have now conclusively shown that the TP53 tumor-suppressor gene is the most frequently mutated gene in human cancers. Despite extensive studies of the TP53 gene and its encoded protein (p53), our understanding of how TP53 mutations contribute to cancer initiation and progression remain incomplete. Genetically engineered mice with germline or inducible Trp53 somatic mutations have provided important insights into the mechanisms by which different types of p53 mutation influence cancer development. Trp53 germline mutations that alter specific p53 structural domains or posttranslation modification sites have benefitted our understanding of wild-type p53 functions in a whole organism context. Moreover, genetic approaches to reestablish functional wild-type p53 to p53-deficient tissues and tumors have increased our understanding of the therapeutic potential of restoring functional p53 signaling to cancers. This review outlines many of the key insights provided by the various categories of Trp53 mutant mice that have been generated by multiple genetic engineering approaches. © 2014 WILEY PERIODICALS, INC.

p53 Specifically Binds Triplex DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

2016-01-01

Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

Molecular dynamics simulation of S100B protein to explore ligand blockage of the interaction with p53 protein

NASA Astrophysics Data System (ADS)

Zhou, Zhigang; Li, Yumin

2009-10-01

As a tumor suppressor, p53 plays an important role in cancer suppression. The biological function of p53 as a tumor suppressor is disabled when it binds to S100B. Developing the ligands to block the S100B-p53 interaction has been proposed as one of the most important approaches to the development of anti-cancer agents. We screened a small compound library against the binding interface of S100B and p53 to identify potential compounds to interfere with the interaction. The ligand-binding effect on the S100B-p53 interaction was explored by molecular dynamics at the atomic level. The results show that the ligand bound between S100B and p53 propels the two proteins apart by about 2 Å compared to the unligated S100B-p53 complex. The binding affinity of S100B and p53 decreases by 8.5-14.6 kcal/mol after a ligand binds to the interface from the original unligated state of the S100B-p53 complex. Ligand-binding interferes with the interaction of S100B and p53. Such interference could impact the association of S100B and p53, which would free more p53 protein from the pairing with S100B and restore the biological function of p53 as a tumor suppressor. The analysis of the binding mode and ligand structural features would facilitate our effort to identify and design ligands to block S100B-p53 interaction effectively. The results from the work suggest that developing ligands targeting the interface of S100B and p53 could be a promising approach to recover the normal function of p53 as a tumor suppressor.

Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

PubMed

De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

2017-05-01

Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

PubMed Central

Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

2015-01-01

Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

Accumulation of p53 in infectious mononucleosis tissues.

PubMed

Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L

2000-11-01

Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company

Heat Tolerances of Salmonella, Cronobacter sakazakii, and Pediococcus acidilactici Inoculated into Galactooligosaccharide.

PubMed

Bang, Jihyun; Choi, Moonkak; Jeong, Haeseok; Lee, Sangseob; Kim, Yoonbin; Ryu, Jee-Hoon; Kim, Hoikyung

2017-07-01

Food-grade galactooligosaccharide (GOS) with low water activity (a w of ca. 0.7) is used as an ingredient in various foods. We evaluated heat tolerances of Salmonella, Cronobacter sakazakii, and Pediococcus acidilactici at temperatures (70 to 85°C) used during the saturation process of GOS by comparing decimal reduction time (D-values) and thermal resistance constants (z-values). To determine the D- and z-values, GOS containing Salmonella (5.1 to 5.8 log CFU/g) or C. sakazakii (5.3 to 5.9 log CFU/g) was heat treated at 70, 77.5, or 85°C for up to 40, 25, or 15 s, respectively, and GOS containing P. acidilactici (6.1 to 6.5 log CFU/g) was heat treated at 70, 77.5, or 85°C for up to 150, 75, or 40 s, respectively. The D-values were calculated using a linear model for heating time versus microbial population for each bacterium. When the D-values for Salmonella, C. sakazakii, and P. acidilactici in GOS were compared, the thermal resistance of all bacteria decreased as the temperature increased. Among the three bacteria, P. acidilactici had higher D-values than did Salmonella and C. sakazakii. The z-values of Salmonella, C. sakazakii, and P. acidilactici were 30.10, 33.18, and 13.04°C, respectively. Overall order of thermal resistance was P. acidilactici > Salmonella ≈ C. sakazakii. These results will be useful for selecting appropriate heat treatment conditions for the decontamination of pathogenic microorganisms during GOS manufacturing.

Activation of Pax7-Positive Cells in a Non-Contractile Tissue Contributes to Regeneration of Myogenic Tissues in the Electric Fish S. macrurus

PubMed Central

Weber, Christopher M.; Martindale, Mark Q.; Tapscott, Stephen J.; Unguez, Graciela A.

2012-01-01

The ability to regenerate tissues is shared across many metazoan taxa, yet the type and extent to which multiple cellular mechanisms come into play can differ across species. For example, urodele amphibians can completely regenerate all lost tissues, including skeletal muscles after limb amputation. This remarkable ability of urodeles to restore entire limbs has been largely linked to a dedifferentiation-dependent mechanism of regeneration. However, whether cell dedifferentiation is the fundamental factor that triggers a robust regeneration capacity, and whether the loss or inhibition of this process explains the limited regeneration potential in other vertebrates is not known. Here, we studied the cellular mechanisms underlying the repetitive regeneration of myogenic tissues in the electric fish S. macrurus. Our in vivo microinjection studies of high molecular weight cell lineage tracers into single identified adult myogenic cells (muscle or noncontractile muscle-derived electrocytes) revealed no fragmentation or cellularization proximal to the amputation plane. In contrast, ultrastructural and immunolabeling studies verified the presence of myogenic stem cells that express the satellite cell marker Pax7 in mature muscle fibers and electrocytes of S. macrurus. These data provide the first example of Pax-7 positive muscle stem cells localized within a non-contractile electrogenic tissue. Moreover, upon amputation, Pax-7 positive cells underwent a robust replication and were detected exclusively in regions that give rise to myogenic cells and dorsal spinal cord components revealing a regeneration process in S. macrurus that is dependent on the activation of myogenic stem cells for the renewal of both skeletal muscle and the muscle-derived electric organ. These data are consistent with the emergent concept in vertebrate regeneration that different tissues provide a distinct progenitor cell population to the regeneration blastema, and these progenitor cells subsequently restore the original tissue. PMID:22685526

Regional distribution of calretinin and calbindin-D28k expression in the brain of the urodele amphibian Pleurodeles waltl during embryonic and larval development.

PubMed

Joven, Alberto; Morona, Ruth; Moreno, Nerea; González, Agustín

2013-07-01

The sequence of appearance of calretinin and calbindin-D28k immunoreactive (CRir and CBir, respectively) cells and fibers has been studied in the brain of the urodele amphibian Pleurodeles waltl. Embryonic, larval and juvenile stages were studied. The early expression and the dynamics of the distribution of CBir and CRir structures have been used as markers for developmental aspects of distinct neuronal populations, highlighting the accurate extent of many regions in the developing brain, not observed on the basis of cytoarchitecture alone. CR and, to a lesser extent, CB are expressed early in the central nervous system and show a progressively increasing expression from the embryonic stages throughout the larval life and, in general, the labeled structures in the developing brain retain their ability to express these proteins in the adult brain. The onset of CRir cells primarily served to follow the development of the olfactory bulbs, subpallium, thalamus, alar hypothalamus, mesencephalic tegmentum, and distinct cell populations in the rhombencephalic reticular formation. CBir cells highlighted the development of, among others, the pallidum, hypothalamus, dorsal habenula, midbrain tegmentum, cerebellum, and central gray of the rostral rhombencephalon. However, it was the relative and mostly segregated distribution of both proteins in distinct cell populations which evidenced the developing regionalization of the brain. The results have shown the usefulness in neuroanatomy of the analysis during development of the onset of CBir and CRir structures, but the comparison with previous data has shown extensive variability across vertebrate classes. Therefore, one should be cautious when comparing possible homologue structures across species only on the basis of the expression of these proteins, due to the variation of the content of calcium-binding proteins observed in well-established homologous regions in the brain of different vertebrates.

Microgravity can activate signals urging cells to S-phase entry during tissue and organ regeneration in Urodele amphibians exposed to real and simulated microgravity

NASA Astrophysics Data System (ADS)

Grigoryan, E.; Anton, H.-J.; Mitashov, V.

Regenerative response following local injury or tissue removal in urodele amphibians is dependent on cell cycle entry of cells sources for regeneration in the remaining tissue. In a number of our experiments performed aboard biosatellites in orbital flights and fast rotated clinostat we found enhanced proliferative activity and, as a result, regeneration quicker than that in controls. In each investigated case an activity of cell proliferation evaluated by 3H-thymidine radioautography and BrdU assay at the early stages of lens, retina, forelimb and tail regeneration in newts was about 1,2-1,7 fold higher both under conditions of real and physiological weightlessness as compared with controls. Faster S-phase entry under conditions of micro- g was demonstrated by cycling multipotent cells as well as by differentiated postmitotic cells both participated in regeneration. Important, that cycling cells outside areas of regeneration were also found as displayed faster cellular growth. In our papers (1,2,3,4) we offered some hypothesis that could explain mechanisms of low g stimulating effect upon cell growth in regeneration in Urodela. In particular, changes in expression of some growth factors and their receptors, as well as the synthesis of specific range of generalized stress proteins (AGSPs) were proposed. However, in fact, molecular mechanisms of micro- g effect upon cell proliferation are mediated by changes on organismic level induced by micro- g environment. Some of them which are able to trigger off signaling changes on the cellular level that, in turn, evoke cells to grow faster would be represented in our report. 1. Mitashov V. et al. Adv. Space Res. 1996. 17 (6/7): 241-255 2. Anton H.-J. et al. Adv. Space Res. 1996. 17 (6/7): 55-65 3. Grigoryan E. et al. Adv. Space Res. 1998. 22 (2): 293-301 4. Grigoryan E. et al. Adv. Space Res. 2002. 30 (4): 757-764

A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis

PubMed Central

Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A

2015-01-01

Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829

Short post-infusion scalp cooling time in the prevention of docetaxel-induced alopecia.

PubMed

van den Hurk, C J G; Breed, W P M; Nortier, J W R

2012-12-01

The patient impact of chemotherapy-induced alopecia (CIA) is high. Scalp cooling is applied to reduce CIA. The potential optimum post-infusion cooling times (PICTs) are currently unknown. Scalp cooling was applied in 53 patients receiving docetaxel chemotherapy with 90-min PICT (observational part). Also 15 non-scalp-cooled patients were included. If hair preservation was observed in >80 % of the patients, randomisation between 45 and 90-min PICT was planned. Patients reported tolerance of scalp cooling and use of head covering. Observational study: 81 % of scalp-cooled patients did not require head covering versus 27 % of non-scalp-cooled patients. Randomised study: 79 % of 38 patients with 90-min PICT did not need head covering versus 95 % of 38 patients with 45-min PICT (p = 0.04). Scalp cooling was very well tolerated (visual analogue scale = 79). A 45-min PICT can be recommended in 3-weekly docetaxel regimens with a dose of 75 or 100 mg/m(2), administered in 60 min. The shorter PICT is a major advantage in time investment for patients. Patients (women and men) who receive docetaxel, except combined with doxorubicin and cyclophosphamide (taxotere, adriamycin and cyclophosphamide (TAC)) should be informed about the protective effect and high tolerability of scalp cooling in avoiding CIA.

Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F₀-ATP synthase

PubMed Central

Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

2013-01-01

We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169

Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F0-ATP synthase.

PubMed

Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

2013-09-01

We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.

ROS-dependent activation of JNK converts p53 into an efficient inhibitor of oncogenes leading to robust apoptosis

PubMed Central

Shi, Y; Nikulenkov, F; Zawacka-Pankau, J; Li, H; Gabdoulline, R; Xu, J; Eriksson, S; Hedström, E; Issaeva, N; Kel, A; Arnér, E S J; Selivanova, G

2014-01-01

Rescue of the p53 tumor suppressor is an attractive cancer therapy approach. However, pharmacologically activated p53 can induce diverse responses ranging from cell death to growth arrest and DNA repair, which limits the efficient application of p53-reactivating drugs in clinic. Elucidation of the molecular mechanisms defining the biological outcome upon p53 activation remains a grand challenge in the p53 field. Here, we report that concurrent pharmacological activation of p53 and inhibition of thioredoxin reductase followed by generation of reactive oxygen species (ROS), result in the synthetic lethality in cancer cells. ROS promote the activation of c-Jun N-terminal kinase (JNK) and DNA damage response, which establishes a positive feedback loop with p53. This converts the p53-induced growth arrest/senescence to apoptosis. We identified several survival oncogenes inhibited by p53 in JNK-dependent manner, including Mcl1, PI3K, eIF4E, as well as p53 inhibitors Wip1 and MdmX. Further, we show that Wip1 is one of the crucial executors downstream of JNK whose ablation confers the enhanced and sustained p53 transcriptional response contributing to cell death. Our study provides novel insights for manipulating p53 response in a controlled way. Further, our results may enable new pharmacological strategy to exploit abnormally high ROS level, often linked with higher aggressiveness in cancer, to selectively kill cancer cells upon pharmacological reactivation of p53. PMID:24413150

Reciprocal inhibition of p53 and nuclear factor-kappaB transcriptional activities determines cell survival or death in neurons.

PubMed

Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef

2003-09-17

The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.

Low-level overexpression of p53 promotes warfarin-induced calcification of porcine aortic valve interstitial cells by activating Slug gene transcription.

PubMed

Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei

2018-03-09

The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Transcriptional analysis of immune-related gene expression in p53-deficient mice with increased susceptibility to influenza A virus infection.

PubMed

Yan, Wenjun; Wei, Jianchao; Deng, Xufang; Shi, Zixue; Zhu, Zixiang; Shao, Donghua; Li, Beibei; Wang, Shaohui; Tong, Guangzhi; Ma, Zhiyong

2015-08-18

p53 is a tumor suppressor that contributes to the host immune response against viral infections in addition to its well-established protective role against cancer development. In response to influenza A virus (IAV) infection, p53 is activated and plays an essential role in inhibiting IAV replication. As a transcription factor, p53 regulates the expression of a range of downstream responsive genes either directly or indirectly in response to viral infection. We compared the expression profiles of immune-related genes between IAV-infected wild-type p53 (p53WT) and p53-deficient (p53KO) mice to gain an insight into the basis of p53-mediated antiviral response. p53KO and p53WT mice were infected with influenza A/Puerto Rico/8/1934 (PR8) strain. Clinical symptoms and body weight changes were monitored daily. Lung specimens of IAV-infected mice were collected for analysis of virus titers and gene expression profiles. The difference in immune-related gene expression levels between IAV-infected p53KO and p53WT mice was comparatively determined using microarray analysis and confirmed by quantitative real-time reverse transcription polymerase chain reaction. p53KO mice showed an increased susceptibility to IAV infection compared to p53WT mice. Microarray analysis of gene expression profiles in the lungs of IAV-infected mice indicated that the increased susceptibility was associated with significantly changed expression levels in a range of immune-related genes in IAV-infected p53KO mice. A significantly attenuated expression of Ifng (encoding interferon (IFN)-gamma), Irf7 (encoding IFN regulator factor 7), and antiviral genes, such as Mx2 and Eif2ak2 (encoding PKR), were observed in IAV-infected p53KO mice, suggesting an impaired IFN-mediated immune response against IAV infection in the absence of p53. In addition, dysregulated expression levels of proinflammatory cytokines and chemokines, such as Ccl2 (encoding MCP-1), Cxcl9, Cxcl10 (encoding IP-10), and Tnf, were detected in IAV-infected p53KO mice during early IAV infection, reflecting an aberrant inflammatory response. Lack of p53 resulted in the impaired expression of genes involved in IFN signaling and the dysregulated expression of cytokine and chemokine genes in IAV-infected mice, suggesting an essential role of p53 in the regulation of antiviral and inflammatory responses during IAV infection.

Mdm-2 binding and TAF(II)31 recruitment is regulated by hydrogen bond disruption between the p53 residues Thr18 and Asp21.

PubMed

Jabbur, James R; Tabor, Amy D; Cheng, Xiaodong; Wang, Hua; Uesugi, Motonari; Lozano, Guillermina; Zhang, Wei

2002-10-10

Analyses of five wild-type p53 containing cell lines revealed lineage specific differences in phosphorylation of Thr18 after treatment with ionizing (IR) or ultraviolet (UV) radiation. Importantly, Thr18 phosphorylation correlated with induction of the p53 downstream targets p21(Waf1/Cip1) (p21) and Mdm-2, suggesting a transactivation enhancing role. Thr18 phosphorylation has been shown to abolish side-chain hydrogen bonding between Thr18 and Asp21, an interaction necessary for stabilizing alpha-helical conformation within the transactivation domain. Mutagenesis-derived hydrogen bond disruption attenuated the interaction of p53 with the transactivation repressor Mdm-2 but had no direct effect on the interaction of p53 with the basal transcription factor TAF(II)31. However, prior incubation of p53 mutants with Mdm-2 modulated TAF(II)31 interaction with p53, suggesting Mdm-2 blocks the accessibility of p53 to TAF(II)31. Consistently, p53-null cells transfected with hydrogen bond disrupting p53 mutants demonstrated enhanced endogenous p21 expression, whereas p53/Mdm-2-double null cells exhibited no discernible differences in p21 expression. We conclude disruption of intramolecular hydrogen bonding between Thr18 and Asp21 enhances p53 transactivation by modulating Mdm-2 binding, facilitating TAF(II)31 recruitment.

Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: Implications for therapy

PubMed Central

Tovar, Christian; Rosinski, James; Filipovic, Zoran; Higgins, Brian; Kolinsky, Kenneth; Hilton, Holly; Zhao, Xiaolan; Vu, Binh T.; Qing, Weiguo; Packman, Kathryn; Myklebost, Ola; Heimbrook, David C.; Vassilev, Lyubomir T.

2006-01-01

The p53 tumor suppressor retains its wild-type conformation and transcriptional activity in half of all human tumors, and its activation may offer a therapeutic benefit. However, p53 function could be compromised by defective signaling in the p53 pathway. Using a small-molecule MDM2 antagonist, nutlin-3, to probe downstream p53 signaling we find that the cell-cycle arrest function of the p53 pathway is preserved in multiple tumor-derived cell lines expressing wild-type p53, but many have a reduced ability to undergo p53-dependent apoptosis. Gene array analysis revealed attenuated expression of multiple apoptosis-related genes. Cancer cells with mdm2 gene amplification were most sensitive to nutlin-3 in vitro and in vivo, suggesting that MDM2 overexpression may be the only abnormality in the p53 pathway of these cells. Nutlin-3 also showed good efficacy against tumors with normal MDM2 expression, suggesting that many of the patients with wild-type p53 tumors may benefit from antagonists of the p53–MDM2 interaction. PMID:16443686

β-Catenin C-terminal signals suppress p53 and are essential for artery formation

PubMed Central

Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.

2016-01-01

Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

PubMed

Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

2010-05-01

Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

PubMed

Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

2018-05-18

The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

A new invertebrate member of the p53 gene family is developmentally expressed and responds to polychlorinated biphenyls.

PubMed Central

Jessen-Eller, Kathryn; Kreiling, Jill A; Begley, Gail S; Steele, Marjorie E; Walker, Charles W; Stephens, Raymond E; Reinisch, Carol L

2002-01-01

The cell-cycle checkpoint protein p53 both directs terminal differentiation and protects embryos from DNA damage. To study invertebrate p53 during early development, we identified three differentially expressed p53 family members (p53, p97, p120) in the surf clam, Spisula solidissima. In these mollusks, p53 and p97 occur in both embryonic and adult tissue, whereas p120 is exclusively embryonic. We sequenced, cloned, and characterized p120 cDNA. The predicted protein, p120, resembles p53 across all evolutionarily conserved regions and contains a C-terminal extension with a sterile alpha motif (SAM) as in p63 and p73. These vertebrate forms of p53 are required for normal inflammatory, epithelial, and neuronal development. Unlike clam p53 and p97, p120 mRNA and protein levels are temporally expressed in embryos, with mRNA levels decreasing with increasing p120 protein (R(2) = 0.97). Highest surf clam p120 mRNA levels coincide with the onset of neuronal growth. In earlier work we have shown that neuronal development is altered by exposure to polychlorinated biphenyls (PCBs), a neurotoxic environmental contaminant. In this study we show that PCBs differentially affect expression of the three surf clam p53 family members. p120 mRNA and protein are reduced the most and earliest in development, p97 protein shows a smaller and later reduction, and p53 protein levels do not change. For the first time we report that unlike p53 and p97, p120 is specifically embryonic and expressed in a time-dependent manner. Furthermore, p120 responds to PCBs by 48 hr when PCB-induced suppression of the serotonergic nervous system occurs. PMID:11940455

The prognostic value of p53 positive in colorectal cancer: A retrospective cohort study.

PubMed

Wang, Peng; Liang, Jianwei; Wang, Zheng; Hou, Huirong; Shi, Lei; Zhou, Zhixiang

2017-05-01

This retrospective cohort study aimed to discuss the prognostic value of p53 positive in colorectal cancer. A total of 124 consecutive patients diagnosed with colorectal cancer were evaluated at the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College from 1 January 2009 to 31 December 2010. The expression of p53 in colorectal cancer was examined by immunohistochemistry. Based on the expression levels of p53, the 124 patients were divided into a p53 positive group and a p53 negative group. In this study, 72 patients were in the p53 positive group and 52 in the p53 negative group. The two groups were well balanced in gender, age, body mass index, American Society of Anesthesiologists scores, and number of lymph nodes harvested. p53 positive was associated with carcinoembryonic antigen ≥5 ng/mL ( p = 0.036), gross type ( p = 0.037), degree of tumor differentiation ( p = 0.026), pathological tumor stage ( p = 0.019), pathological node stage ( p = 0.004), pathological tumor-node-metastasis stage ( p = 0.017), nerve invasion ( p = 0.008), and vessel invasion ( p = 0.018). Tumor site, tumor size, and pathological pattern were not significantly different between these two groups. Disease-free survival and overall survival in the p53 positive group were significantly shorter than the p53 negative group ( p = 0.021 and 0.025, respectively). Colorectal cancer patients with p53 positive tended to be related to a higher degree of malignancy, advanced tumor-node-metastasis stage, and shorter disease-free survival and overall survival. p53 positive was independently an unfavorable prognostic marker for colorectal cancer patients.

Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

PubMed

Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

2016-09-06

The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

Andrographolide induces degradation of mutant p53 via activation of Hsp70.

PubMed

Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

2018-05-22

The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

Mutant p53 establishes targetable tumor dependency by promoting unscheduled replication

PubMed Central

Singh, Shilpa; Vaughan, Catherine A.; Frum, Rebecca A.; Grossman, Steven R.; Deb, Sumitra

2017-01-01

Gain-of-function (GOF) p53 mutations are observed frequently in most intractable human cancers and establish dependency for tumor maintenance and progression. While some of the genes induced by GOF p53 have been implicated in more rapid cell proliferation compared with p53-null cancer cells, the mechanism for dependency of tumor growth on mutant p53 is unknown. This report reveals a therapeutically targetable mechanism for GOF p53 dependency. We have shown that GOF p53 increases DNA replication origin firing, stabilizes replication forks, and promotes micronuclei formation, thus facilitating the proliferation of cells with genomic abnormalities. In contrast, absence or depletion of GOF p53 leads to decreased origin firing and a higher frequency of fork collapse in isogenic cells, explaining their poorer proliferation rate. Following genome-wide analyses utilizing ChIP-Seq and RNA-Seq, GOF p53–induced origin firing, micronuclei formation, and fork protection were traced to the ability of GOF p53 to transactivate cyclin A and CHK1. Highlighting the therapeutic potential of CHK1’s role in GOF p53 dependency, experiments in cell culture and mouse xenografts demonstrated that inhibition of CHK1 selectively blocked proliferation of cells and tumors expressing GOF p53. Our data suggest the possibility that checkpoint inhibitors could efficiently and selectively target cancers expressing GOF p53 alleles. PMID:28394262

Loss of p53 Promotes Anaplasia and Local Invasion in ret/PTC1-Induced Thyroid Carcinomas

PubMed Central

La Perle, Krista M. D.; Jhiang, Sissy M.; Capen, Charles C.

2000-01-01

Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53−/− mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53−/− mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53−/− mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/− mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/− mice ≤28 weeks of age or p53−/− mice ≤ 17 weeks of age; however, an older (170-day-old) male p53−/− mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas. PMID:10934169

The putative oncotarget CSN5 controls a transcription-uncorrelated p53-mediated autophagy implicated in cancer cell survival under curcumin treatment.

PubMed

Zhang, Qing-Yu; Jin, Rui; Zhang, Xian; Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong

2016-10-25

Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53-/- cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin.

Mdm2 is required for survival of hematopoietic stem cells/progenitors via dampening of ROS-induced p53 activity

USDA-ARS?s Scientific Manuscript database

Mdm2 is an E3 ubiquitin ligase that targets p53 for degradation. p53(515C) (encoding p53R172P) is a hypomorphic allele of p53 that rescues the embryonic lethality of Mdm2(-/-) mice. Mdm2(-/-) p53(515C/515C) mice, however, die by postnatal day 13 resulting from hematopoietic failure. Hematopoietic st...

High-fibre enteral feeding results in improved anthropometrics and favourable gastrointestinal tolerance in malnourished children with growth failure.

PubMed

Kansu, Aydan; Durmaz Ugurcan, Ozlem; Arslan, Duran; Unalp, Aycan; Celtik, Coskun; Sarıoglu, Aysugul Alptekin

2018-06-01

The practical value of using fibre-enriched enteral feeding regimens to rehabilitate malnourished children remains inconclusive. This study determined the usage patterns, gastrointestinal tolerance, anthropometrics and safety of high-fibre enteral feeding in malnourished children with growth failure. This Turkish observational study between February 2013 and June 2015 comprised 345 paediatric patients from 17 centres with malnutrition-related growth failure, with a weight and height of <2 SD percentiles for their age. Changes in anthropometrics, gastrointestinal symptoms, defecation habits and safety data relating to adverse events were analysed during the six-month follow-up period. Most subjects (99.7%) were supplemented with enteral feeding. The absolute difference and 95% confidence interval values for the Z scores of height for age, weight for age, weight for height and body mass index for height increased significantly in four months to six months to 0.21 (0.09-0.32), 0.61 (0.51-0.70), 0.81 (0.56-1.06) and 0.70 (0.53-0.86), respectively (p < 0.001 for each). The percentage of patients with normal defecation frequency significantly increased from 70.3% to 92.8% at the four months to six months visit (p = 0.004). Adverse events occurred in 15 (4.3%) of patients. Using a six-month high-fibre enteral feeding was associated with favourable outcomes in anthropometrics, appetite, gastrointestinal tolerance and safety in malnourished children. ©2018 The Authors. Acta Paediatrica published by John Wiley & Sons Ltd on behalf of Foundation Acta Paediatrica.

The small molecule 2-phenylethynesulfonamide induces covalent modification of p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jamil, Sarwat; Hojabrpour, Payman; Duronio, Vincent

p53 is a tumor suppressor protein which is either lost or inactivated in a large majority of tumors. The small molecule 2-phenylethynesulfonamide (PES) was originally identified as the inhibitor of p53 effects on the mitochondrial death pathway. In this report we demonstrate that p53 protein from PES-treated cells was detected in reduced mobility bands between molecular weights 95–220 kDa. Resolution of p53 aggregates on urea gel was unable to reduce the high molecular weight p53 aggregates, which were shown to be primarily located in the nucleus. Therefore, our data suggest that PES exerts its effects through covalent cross-linking and nuclear retentionmore » of p53. - Highlights: • p53 protein is in high molecular weight complexes in the nucleus of PES-treated cells. • PES is a drug that inhibits pro-apoptotic p53 action at the mitochondria. • We propose that PES action involves cross-linking and nuclear retention of p53.« less

Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17

PubMed Central

Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.

2012-01-01

Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468

Therapeutic targeting of the p53 pathway in cancer stem cells

PubMed Central

Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.

2013-01-01

Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602

Regulation of autophagy by cytoplasmic p53

PubMed Central

Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2009-01-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141

Recognition of Local DNA Structures by p53 Protein

PubMed Central

Brázda, Václav; Coufal, Jan

2017-01-01

p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

Transcriptional inhibition of p21{sup WAF1/CIP1} gene (CDKN1) expression by survivin is at least partially p53-dependent: Evidence for survivin acting as a transcription factor or co-factor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Lei; Pre-Doctoral Chinese Fellowship Student, Second West China Hospital, Sichuan University, Sichuan; Ling, Xiang

2012-05-04

Highlights: Black-Right-Pointing-Pointer Survivin inhibits the expression of p21 protein, mRNA and promoter activity. Black-Right-Pointing-Pointer Survivin neutralizes p53-induced p21 expression and promoter activity. Black-Right-Pointing-Pointer Survivin physically interacts with p53 in cancer cells. Black-Right-Pointing-Pointer Genetic silencing of endogenous survivin upregulates p21 in p53 wild type cancer cells. Black-Right-Pointing-Pointer Both p53 and survivin interacts on the two p53-binding sites in the p21 promoter. -- Abstract: Growing evidence suggests a role for the antiapoptotic protein survivin in promotion of cancer cell G1/S transition and proliferation. However, the underlying mechanism is unclear. Further, although upregulation of p21{sup WAF1/CIP1} by p53 plays an important role inmore » p53-mediated cell G1 arrests in response to various distresses, it is unknown whether survivin plays a role in the regulation of p21{sup WAF1/CIP1} expression. Here, we report that exogenous expression of survivin in p53-wild type MCF-7 breast cancer cells inhibits the expression of p21{sup WAF1/CIP1} protein, mRNA and promoter activity, while the survivin C84A mutant and antisense failed to do so. Cotransfection experiments in the p53 mutant H1650 lung cancer cell line showed that survivin neutralizes p53-induced p21{sup WAF1/CIP1} expression and promoter activity. Importantly, genetically silencing of endogenous survivin using lentiviral survivin shRNA also enhances endogenous p21 in p53 wild type cancer cells, suggesting the physiological relevance of the fining. We further demonstrated that both p53 and survivin interacts on the two p53-binding sites in the p21{sup WAF1/CIP1} promoter (-2313 to -2212; -1452 to -1310), and survivin physically interacts with p53 in cancer cells. Together, we propose that survivin may act as a transcription factor or cofactor to interact with p53 on the p21{sup WAF1/CIP1} promoter leading to the inhibition of p21{sup WAF1/CIP1} expression at least in part by neutralizing p53-mediated transcriptional activation of the p21 gene.« less

The transcription factor p53: Not a repressor, solely an activator

PubMed Central

Fischer, Martin; Steiner, Lydia; Engeland, Kurt

2014-01-01

The predominant function of the tumor suppressor p53 is transcriptional regulation. It is generally accepted that p53-dependent transcriptional activation occurs by binding to a specific recognition site in promoters of target genes. Additionally, several models for p53-dependent transcriptional repression have been postulated. Here, we evaluate these models based on a computational meta-analysis of genome-wide data. Surprisingly, several major models of p53-dependent gene regulation are implausible. Meta-analysis of large-scale data is unable to confirm reports on directly repressed p53 target genes and falsifies models of direct repression. This notion is supported by experimental re-analysis of representative genes reported as directly repressed by p53. Therefore, p53 is not a direct repressor of transcription, but solely activates its target genes. Moreover, models based on interference of p53 with activating transcription factors as well as models based on the function of ncRNAs are also not supported by the meta-analysis. As an alternative to models of direct repression, the meta-analysis leads to the conclusion that p53 represses transcription indirectly by activation of the p53-p21-DREAM/RB pathway. PMID:25486564

Chaperone-mediated autophagy degrades mutant p53

PubMed Central

Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

2013-01-01

Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

PubMed

Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

2009-06-17

P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

p53-dependent p21-mediated growth arrest pre-empts and protects HCT116 cells from PUMA-mediated apoptosis induced by EGCG

PubMed Central

Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L

2010-01-01

The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544

Stimulation of autophagy by the p53 target gene Sestrin2.

PubMed

Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

2009-05-15

The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

Aciculatin Induces p53-Dependent Apoptosis via MDM2 Depletion in Human Cancer Cells In Vitro and In Vivo

PubMed Central

Lai, Chin-Yu; Tsai, An-Chi; Chen, Mei-Chuan; Chang, Li-Hsun; Sun, Hui-Lung; Chang, Ya-Ling; Chen, Chien-Chih

2012-01-01

Aciculatin, a natural compound extracted from the medicinal herb Chrysopogon aciculatus, shows potent anti-cancer potency. This study is the first to prove that aciculatin induces cell death in human cancer cells and HCT116 mouse xenografts due to G1 arrest and subsequent apoptosis. The primary reason for cell cycle arrest and cell death was p53 accumulation followed by increased p21 level, dephosphorylation of Rb protein, PUMA expression, and induction of apoptotic signals such as cleavage of caspase-9, caspase-3, and PARP. We demonstrated that p53 allele-null (−/−) (p53-KO) HCT116 cells were more resistant to aciculatin than cells with wild-type p53 (+/+). The same result was achieved by knocking down p53 with siRNA in p53 wild-type cells, indicating that p53 plays a crucial role in aciculatin-induced apoptosis. Although DNA damage is the most common event leading to p53 activation, we found only weak evidence of DNA damage after aciculatin treatment. Interestingly, the aciculatin-induced downregulation of MDM2, an important negative regulator of p53, contributed to p53 accumulation. The anti-cancer activity and importance of p53 after aciculatin treatment were also confirmed in the HCT116 xenograft models. Collectively, these results indicate that aciculatin treatment induces cell cycle arrest and apoptosis via inhibition of MDM2 expression, thereby inducing p53 accumulation without significant DNA damage and genome toxicity. PMID:22912688

Friend or Foe: MicroRNAs in the p53 network.

PubMed

Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

2018-04-10

The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

Screening of medicinal plant phytochemicals as natural antagonists of p53-MDM2 interaction to reactivate p53 functioning.

PubMed

Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq

2017-10-01

In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.

Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.

PubMed

Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K

2005-01-20

Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.

p53-Mdm2 interaction inhibitors as novel nongenotoxic anticancer agents.

PubMed

Nayak, Surendra Kumar; Khatik, Gopal L; Narang, Rakesh; Monga, Vikramdeep; Chopra, Harish Kumar

2017-06-23

Cancer is a major global health problem with high mortality rate. Most of clinically used anticancer agents induce apoptosis through genotoxic stress at various stages of cell cycle and activation of p53. Acting as a tumor suppressor p53 plays a vital role in preventing tumor development. Tumor suppressor function of p53 is effectively antagonized by its direct interaction with murine double minute 2 (Mdm2) proteins via multiple mechanisms. Thus, p53-Mdm2 interaction has been found to be an important target for the development of novel anticancer agents. Currently, nutlin, spirooxindole, isoquilinone and piperidinone analogues inhibiting p53-Mdm2 interaction are found to be promising in the treatment of cancer. The current review focused to scrutinize the structural aspects of p53-Mdm2 interaction inhibitors. The present study provides a detailed collection of published information on different classes of inhibitors of p53-Mdm2 interaction as potential anticancer agents. The review highlighted the structural aspects of various reported p53-Mdm2 inhibitor for optimization. In the last few years, different classes of inhibitors of p53-Mdm2 have been designed and developed, and seven such compounds are being evaluated in clinical trials as new anticancer drugs. Further, to explore the role of p53 protein as a potential target for anticancer drug development, in this review, the mechanism of Mdm2 mediated inactivation of p53 and recent developments on p53-Mdm2 interactions inhibitors are discussed. Agents designed to block the p53-Mdm2 interaction may have a therapeutic potential for treatment of a subset of human cancers retaining wild-type p53. We review herein the recent advances in the design and development of potent small molecules as p53-Mdm2 inhibitors. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53

PubMed Central

Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez-Ramos, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Pol, Scott Vande; Podjarny, Alberto; Travé, Gilles; Zanier, Katia

2015-01-01

Summary The p53 pro-apoptotic tumor suppressor is mutated or functionally altered in most cancers. In epithelial tumors induced by “high-risk” mucosal Human Papillomaviruses (hrm-HPVs), including human cervical carcinoma and a growing number of head-and-neck cancers 1, p53 is degraded by the viral oncoprotein E6 2. In this process, E6 binds to a short LxxLL consensus sequence within the cellular ubiquitin ligase E6AP 3. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 4. Neither E6 nor E6AP are separately able to recruit p53 3,5, and the precise mode of assembly of E6, E6AP and p53 is unknown. Here, we solved the crystal structure of a ternary complex comprising full-length HPV16 E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumor suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against HPV-mediated oncogenesis. PMID:26789255

p53 activation by Ni(II) is a HIF-1α independent response causing caspases 9/3-mediated apoptosis in human lung cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, Victor C.; Morse, Jessica L.; Zhitkovich, Anatoly, E-mail: anatoly_zhitkovich@brown.edu

2013-06-15

Hypoxia mimic nickel(II) is a human respiratory carcinogen with a suspected epigenetic mode of action. We examined whether Ni(II) elicits a toxicologically significant activation of the tumor suppressor p53, which is typically associated with genotoxic responses. We found that treatments of H460 human lung epithelial cells with NiCl{sub 2} caused activating phosphorylation at p53-Ser15, accumulation of p53 protein and depletion of its inhibitor MDM4 (HDMX). Confirming the activation of p53, its knockdown suppressed the ability of Ni(II) to upregulate MDM2 and p21 (CDKN1A). Unlike DNA damage, induction of GADD45A by Ni(II) was p53-independent. Ni(II) also increased p53-Ser15 phosphorylation and p21more » expression in normal human lung fibroblasts. Although Ni(II)-induced stabilization of HIF-1α occurred earlier, it had no effect on p53 accumulation and Ser15 phosphorylation. Ni(II)-treated H460 cells showed no evidence of necrosis and their apoptosis and clonogenic death were suppressed by p53 knockdown. The apoptotic role of p53 involved a transcription-dependent program triggering the initiator caspase 9 and its downstream executioner caspase 3. Two most prominently upregulated proapoptotic genes by Ni(II) were PUMA and NOXA but only PUMA induction required p53. Knockdown of p53 also led to derepression of antiapoptotic MCL1 in Ni(II)-treated cells. Overall, our results indicate that p53 plays a major role in apoptotic death of human lung cells by Ni(II). Chronic exposure to Ni(II) may promote selection of resistant cells with inactivated p53, providing an explanation for the origin of p53 mutations by this epigenetic carcinogen. - Highlights: • Ni(II) is a strong activator of the transcription factor p53. • Apoptosis is a principal form of death by Ni(II) in human lung epithelial cells. • Ni(II)-activated p53 triggers caspases 9/3-mediated apoptotic program. • NOXA and PUMA are two main proapoptotic genes induced by Ni(II). • HIF-1α and p53 are independent stress responses to hypoxia-mimicking Ni(II)« less

Jmjd5 functions as a regulator of p53 signaling during mouse embryogenesis.

PubMed

Ishimura, Akihiko; Terashima, Minoru; Tange, Shoichiro; Suzuki, Takeshi

2016-03-01

Genetic studies have shown that aberrant activation of p53 signaling leads to embryonic lethality. Maintenance of a fine balance of the p53 protein level is critical for normal development. Previously, we have reported that Jmjd5, a member of the Jumonji C (JmjC) family, regulates embryonic cell proliferation through the control of Cdkn1a expression. Since Cdkn1a is the representative p53-regulated gene, we have examined whether the expression of other p53 target genes is coincidentally upregulated with Cdkn1a in Jmjd5-deficient embryos. The expression of a subset of p53-regulated genes was increased in both Jmjd5 hypomorphic mouse embryonic fibroblasts (MEFs) and Jmjd5-deficient embryos at embryonic day 8.25 without the induced expression of Trp53. Intercrossing of Jmjd5-deficient mice with Trp53 knockout mice showed that the growth defect of Jmjd5 mutant cells was significantly recovered under a Trp53 null genetic background. Chromatin immunoprecipitation analysis in Jmjd5 hypomorphic MEFs indicated the increased recruitment of p53 at several p53 target gene loci, such as Cdkn1a, Pmaip1, and Mdm2. These results suggest that Jmjd5 is involved in the transcriptional regulation of a subset of p53-regulated genes, possibly through the control of p53 recruitment at the gene loci. In Jmjd5-deficient embryos, the enhanced recruitment of p53 might result in the abnormal activation of p53 signaling leading to embryonic lethality.

Okadaic acid mediates p53 hyperphosphorylation and growth arrest in cells with wild-type p53 but increases aberrant mitoses in cells with non-functional p53.

PubMed

Milczarek, G J; Chen, W; Gupta, A; Martinez, J D; Bowden, G T

1999-06-01

The protein phosphatase inhibitor and tumor promoting agent okadaic acid (OA), has been shown previously to induce hyperphosphorylation of p53 protein, which in turn correlated with increased transactivation or apoptotic function. However, how the tumor promotion effects of OA relate to p53 tumor supressor function (or dysfunction) remain unclear. Rat embryonic fibroblasts harboring a temperature-sensitive mouse p53 transgene were treated with 50 nM doses of OA. At the wild-type permissive temperature this treatment resulted in: (i) the hyperphosphorylation of sites within tryptic peptides of the transactivation domain of p53; (ii) an increase in p53 affinity for a p21(waf1) promotor oligonucleotide; (iii) an increase in cellular steady state levels of p21(waf1) message; (iv) a G2/M cell cycle blockage in addition to the G1/S arrest previously associated with p53; and (v) no increased incidence of apoptosis. On the other hand, OA treatment at the mutated p53 permissive temperature resulted in a relatively high incidence of aberrant mitosis with no upregulation of p21(waf1) message. These results suggest that while wild-type p53 blocks the proliferative effects of OA through p21(waf1)-mediated growth arrest, cells with non-functional p53 cannot arrest and suffer relatively high levels of OA-mediated aberrant mitoses.

A SENSITIVE IMMUNOFLUORESCENCE ASSAY FOR DETECTION OF P53 PROTEIN ACCUMULATION IN SPUTUM

EPA Science Inventory

p53 mutations are common genetic alterations in lung cancers and usually result in p53 protein accumulation in tumor cells. Sputum is noninvasive to collect and ideal for screening p53 abnormalities. This study was to determine the feasibility of detecting p53 protein accumulatio...

Development of Yeast as an In Vivo Test Tube to Characterize a Broad Spectrum of p53 Mutations Associated with Breast Cancer

DTIC Science & Technology

2002-10-01

there is a mutation in the p53 gene itself (4, 5). Interestingly, -80% of p53 mutations are missense changes that lead to single amino acid...substitutions, a feature that distinguishes p53 from other tumor suppressor genes (e.g., APC, NF1, BRCAJ) (6). The incidence of p53 mutations and the types of...intronic promoter is contained within the human mutation hotspot maps of p53: correlation with p53 protein structural and mdm2 gene . Nucleic Acids Res

Immunohistochemical analysis of P53 protein in odontogenic cysts

PubMed Central

Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

2010-01-01

The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

Rescue of p53 function by small-molecule RITA in cervical carcinoma by blocking E6-mediated degradation.

PubMed

Zhao, Carolyn Ying; Szekely, Laszlo; Bao, Wenjie; Selivanova, Galina

2010-04-15

Proteasomal degradation of p53 by human papilloma virus (HPV) E6 oncoprotein plays a pivotal role in the survival of cervical carcinoma cells. Abrogation of HPV-E6-dependent p53 destruction can therefore be a good strategy to combat cervical carcinomas. Here, we show that a small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) is able to induce the accumulation of p53 and rescue its tumor suppressor function in cells containing high-risk HPV16 and HPV18 by inhibiting HPV-E6-mediated proteasomal degradation. RITA blocks p53 ubiquitination by preventing p53 interaction with E6-associated protein, required for HPV-E6-mediated degradation. RITA activates the transcription of proapoptotic p53 targets Noxa, PUMA, and BAX, and repressed the expression of pro-proliferative factors CyclinB1, CDC2, and CDC25C, resulting in p53-dependent apoptosis and cell cycle arrest. Importantly, RITA showed substantial suppression of cervical carcinoma xenografts in vivo. These results provide a proof of principle for the treatment of cervical cancer in a p53-dependent manner by using small molecules that target p53. (c)2010 AACR.

Changes in p53 expression in mouse fibroblasts can modify motility and extracellular matrix organization.

PubMed

Alexandrova, A; Ivanov, A; Chumakov, P; Kopnin, B; Vasiliev, J

2000-11-23

Effects of p53 expression on cell morphology and motility were studied using the derivatives of p53-null 10(1) mouse fibroblasts with tetracycline-regulated expression of exogenous human p53. Induction of p53 expression was accompanied by significant decrease in extracellular matrix (fibronectin) and reduction of matrix fibrils, diminution of the number and size of focal contacts, decrease of cell areas, establishment of more elongated cell shape and alterations of actin cytoskeleton (actin bundles became thinner, their number and size decreased). Expression of His175 and Gln22/ Ser23 p53 mutants caused no such effects. To study the influence of p53 expression on cell motility we used wound technique and videomicroscopy observation of single living cells. It was found that induction of p53 expression led to increase of lamellar activity of cell edge. However, in spite of enhanced lamellar activity p53-expressing cells migrated to shorter distance and filled the narrow wound in longer time as compared with their p53-null counterparts. Possible mechanisms of the influence of p53 expression on cell morphology and motility are discussed.

Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.

PubMed

Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel

2016-04-12

p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia.

p53 adenoviral vector (Ad-CMV-p53) induced prostatic growth inhibition of primary cultures of human prostate and an experimental rat model.

PubMed

Shirakawa, T; Gotoh, A; Gardner, T A; Kao, C; Zhang, Z J; Matsubara, S; Wada, Y; Hinata, N; Fujisawa, M; Hanioka, K; Matsuo, M; Kamidono, S

2000-01-01

Benign prostatic hyperplasia (BPH) is the most common proliferative disease affecting men. Numerous minimally invasive technologies are being developed or are currently in use to obviate the need for transurethral surgery. The goal of the present study was to develop a novel molecular based approach for the treatment of BPH using recombinant p53 adenoviral vector. The over-expression of wt-p53 can cause cell apoptosis or cell growth arrest, thus preventing the uncontrolled cell proliferation underlying BPH pathophysiology. Ad-CMV-p53, a replication-deficient recombinant adenovirus containing cytomegalovirus promoter driving p53 gene, was used. Human prostate stromal (PS) cells were evaluated for apoptosis (TUNEL assay), mRNA levels of key cell cycle regulators influencing apoptosis (p-53, Bax and Bcl-2) using quantitative RT-PCR and cytotoxicity after Ad-CMV-p53. Ad-CMV-p53 was unilaterally injected into rat ventral prostates and growth inhibition was measured by prostate weight 3 weeks after injection. In vitro exposure to Ad-CMV-p53 significantly inhibited the proliferation of PS cells, induced mRNA over-expression of both wt-p53 and Bax, and increased the proportion of apoptotic cells. A 30% decrease in average prostate weight was demonstrated in rodents after Ad-CMV-p53 injection. The results suggest that further investigation of molecular gene therapy with recombinant wt-p53 adenovirus for the treatment of BPH is warranted.

Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.

PubMed

Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J

2006-04-01

p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.

The putative oncotarget CSN5 controls a transcription-uncorrelated p53-mediated autophagy implicated in cancer cell survival under curcumin treatment

PubMed Central

Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong

2016-01-01

Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53−/− cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin. PMID:27626169

Expression of C-terminal deleted p53 isoforms in neuroblastoma

PubMed Central

Goldschneider, David; Horvilleur, Emilie; Plassa, Louis-François; Guillaud-Bataille, Marine; Million, Karine; Wittmer-Dupret, Evelyne; Danglot, Gisèle; de Thé, Hughes; Bénard, Jean; May, Evelyne; Douc-Rasy, Sétha

2006-01-01

The tumor suppressor gene, p53, is rarely mutated in neuroblastomas (NB) at the time of diagnosis, but its dysfunction could result from a nonfunctional conformation or cytoplasmic sequestration of the wild-type p53 protein. However, p53 mutation, when it occurs, is found in NB tumors with drug resistance acquired over the course of chemotherapy. As yet, no study has been devoted to the function of the specific p53 mutants identified in NB cells. This study includes characterization and functional analysis of p53 expressed in eight cell lines: three wild-type cell lines and five cell lines harboring mutations. We identified two transcription-inactive p53 variants truncated in the C-terminus, one of which corresponded to the p53β isoform recently identified in normal tissue by Bourdon et al. [J. C. Bourdon, K. Fernandes, F. Murray-Zmijewski, G. Liu, A. Diot, D. P. Xirodimas, M. K. Saville and D. P. Lane (2005) Genes Dev., 19, 2122–2137]. Our results show, for the first time, that the p53β isoform is the only p53 species to be endogenously expressed in the human NB cell line SK-N-AS, suggesting that the C-terminus truncated p53 isoforms may play an important role in NB tumor development. PMID:17028100

p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin

2008-01-25

S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53{sup wt}) or being p(HCT-116 p53{sup -/-}), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53{sup -/-} xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53{sup wt}more » cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53{sup wt} cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75{sup NTR}, p53 and Bax.« less

Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

PubMed Central

2010-01-01

Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19Arf and nutlin-3. Conclusions To the best of our knowledge, this is the first study to apply both p19Arf and nutlin-3 for the stimulation of p53 activity. These results support the notion that a p53 responsive vector may prove to be an interesting gene transfer tool, especially when combined with p53-activating agents, for the treatment of tumors that retain wild-type p53. PMID:20569441

Missense mutations located in structural p53 DNA-binding motifs are associated with extremely poor survival in chronic lymphocytic leukemia.

PubMed

Trbusek, Martin; Smardova, Jana; Malcikova, Jitka; Sebejova, Ludmila; Dobes, Petr; Svitakova, Miluse; Vranova, Vladimira; Mraz, Marek; Francova, Hana Skuhrova; Doubek, Michael; Brychtova, Yvona; Kuglik, Petr; Pospisilova, Sarka; Mayer, Jiri

2011-07-01

There is a distinct connection between TP53 defects and poor prognosis in chronic lymphocytic leukemia (CLL). It remains unclear whether patients harboring TP53 mutations represent a homogenous prognostic group. We evaluated the survival of patients with CLL and p53 defects identified at our institution by p53 yeast functional assay and complementary interphase fluorescence in situ hybridization analysis detecting del(17p) from 2003 to 2010. A defect of the TP53 gene was identified in 100 of 550 patients. p53 mutations were strongly associated with the deletion of 17p and the unmutated IgVH locus (both P < .001). Survival assessed from the time of abnormality detection was significantly reduced in patients with both missense (P < .001) and nonmissense p53 mutations (P = .004). In addition, patients harboring missense mutation located in p53 DNA-binding motifs (DBMs), structurally well-defined parts of the DNA-binding domain, manifested a clearly shorter median survival (12 months) compared with patients having missense mutations outside DBMs (41 months; P = .002) or nonmissense alterations (36 months; P = .005). The difference in survival was similar in the analysis limited to patients harboring mutation accompanied by del(17p) and was also confirmed in a subgroup harboring TP53 defect at diagnosis. The patients with p53 DBMs mutation (at diagnosis) also manifested a short median time to first therapy (TTFT; 1 month). The substantially worse survival and the short TTFT suggest a strong mutated p53 gain-of-function phenotype in patients with CLL with DBMs mutations. The impact of p53 DBMs mutations on prognosis and response to therapy should be analyzed in investigative clinical trials.

p53-upregulated-modulator-of-apoptosis (PUMA) deficiency affects food intake but does not impact on body weight or glucose homeostasis in diet-induced obesity.

PubMed Central

Litwak, Sara A.; Loh, Kim; Stanley, William J.; Pappas, Evan G.; Wali, Jibran A.; Selck, Claudia; Strasser, Andreas; Thomas, Helen E.; Gurzov, Esteban N.

2016-01-01

BCL-2 proteins have been implicated in the control of glucose homeostasis and metabolism in different cell types. Thus, the aim of this study was to determine the role of the pro-apoptotic BH3-only protein, p53-upregulated-modulator-of-apoptosis (PUMA), in metabolic changes mediated by diet-induced obesity, using PUMA deficient mice. At 10 weeks of age, knockout and wild type mice either continued consuming a low fat chow diet (6% fat), or were fed with a high fat diet (23% fat) for 14–17 weeks. We measured body composition, glucose and insulin tolerance, insulin response in peripheral tissues, energy expenditure, oxygen consumption, and respiratory exchange ratio in vivo. All these parameters were indistinguishable between wild type and knockout mice on chow diet and were modified equally by diet-induced obesity. Interestingly, we observed decreased food intake and ambulatory capacity of PUMA knockout mice on high fat diet. This was associated with increased adipocyte size and fasted leptin concentration in the blood. Our findings suggest that although PUMA is dispensable for glucose homeostasis in lean and obese mice, it can affect leptin levels and food intake during obesity. PMID:27033313

p53-upregulated-modulator-of-apoptosis (PUMA) deficiency affects food intake but does not impact on body weight or glucose homeostasis in diet-induced obesity.

PubMed

Litwak, Sara A; Loh, Kim; Stanley, William J; Pappas, Evan G; Wali, Jibran A; Selck, Claudia; Strasser, Andreas; Thomas, Helen E; Gurzov, Esteban N

2016-04-01

BCL-2 proteins have been implicated in the control of glucose homeostasis and metabolism in different cell types. Thus, the aim of this study was to determine the role of the pro-apoptotic BH3-only protein, p53-upregulated-modulator-of-apoptosis (PUMA), in metabolic changes mediated by diet-induced obesity, using PUMA deficient mice. At 10 weeks of age, knockout and wild type mice either continued consuming a low fat chow diet (6% fat), or were fed with a high fat diet (23% fat) for 14-17 weeks. We measured body composition, glucose and insulin tolerance, insulin response in peripheral tissues, energy expenditure, oxygen consumption, and respiratory exchange ratio in vivo. All these parameters were indistinguishable between wild type and knockout mice on chow diet and were modified equally by diet-induced obesity. Interestingly, we observed decreased food intake and ambulatory capacity of PUMA knockout mice on high fat diet. This was associated with increased adipocyte size and fasted leptin concentration in the blood. Our findings suggest that although PUMA is dispensable for glucose homeostasis in lean and obese mice, it can affect leptin levels and food intake during obesity.

Co-expression of p53 and MDM2 in human atherosclerosis: implications for the regulation of cellularity of atherosclerotic lesions.

PubMed

Ihling, C; Haendeler, J; Menzel, G; Hess, R D; Fraedrich, G; Schaefer, H E; Zeiher, A M

1998-07-01

Atherosclerosis is a fibroproliferative disease of the arterial intima. It was recently found that wild-type p53 (wt p53) accumulates in human atherosclerotic tissue. Wt p53 is a cell cycle regulator involved in DNA repair, DNA synthesis, cell differentiation, and apoptosis and might therefore make an important contribution to the cellularity of atherosclerotic plaques. The product of the MDM2 gene is a nuclear protein which forms a complex with p53, thereby inhibiting the negative regulatory effects of wt p53 on cell cycle progression. In order to address a potential role of the interaction of p53 with MDM2 for the regulation of cellularity in atherosclerotic tissue, 22 carotid atheromatous plaques from patients undergoing endarterectomy were studied to determine the presence of p53 immunoreactivity (IR), MDM2 IR, cell proliferation as evidenced by MIB1/Ki-67 IR and DNA fragmentation by in situ terminal transferase-mediated dUTP 3' end labelling (TUNEL), as a marker for apoptosis. p53 IR localized to areas with evidence of chronic inflammation (22/22) and was observed in virtually all cell types in 68.79 +/- 7.51 per cent of the nuclei. p53 staining in the control tissue from human internal mammary arteries was present in 0.2 +/- 0.29 per cent of the cells (P < or = 0.002). MDM2 IR was present in all cases (22/22) in macrophages and smooth muscle cells (SMCs) in 60.53 +/- 8.32 per cent of the nuclei (controls: 0.8 +/- 0.65 per cent, P < or = 0.002) and co-localized with p53 IR as shown by examination of adjacent sections and by double immunofluorescence labelling. Importantly, co-immunoprecipitation and western blot analysis revealed that p53 and MDM2 were physically associated, indicating that MDM2-p53 complex formation takes place in vivo in human atherosclerotic tissue. Positive TUNEL staining and MIB1/Ki-67 IR present in 3.01 +/- 1.27 per cent of the nuclei (controls: 0 per cent, P < or = 0.002) localized to the same plaque compartments as p53 IR and MDM2 IR. Thus, the fate of cells with p53 accumulation may depend on the interaction and the stoichiometry of the p53 and MDM2 proteins. Cells were indeed found with strong p53 accumulation and nuclear morphology typical for apoptosis and there were a few MIB1/Ki-67-positive cells with co-expression of MDM2, indicating a possible role for MDM2 in reversing the negative regulatory effects of p53 for cell cycle progression. The nuclear co-localization of p53 IR with MDM2 IR and the co-immunoprecipitation assay indicate the presence of p53-MDM2 complex formation in vivo in human atherosclerotic tissue. The destiny of individual p53 and MDM2-co-expressing cells either to undergo p53-dependent apoptosis or to re-enter the cycle of cell proliferation may depend on the relative ratios of the two proteins. p53 and MDM2 may therefore play an important role in regulating cellularity and inflammatory activity in human atherosclerotic plaques.

[Application of PLA Method for Detection of p53/p63/p73 Complexes in Situ in Tumour Cells and Tumour Tissue].

PubMed

Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B

2017-01-01

PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I - LO1413. The authors declare they have no potential conflicts of interest concerning drugs, products, or services used in the study. The Editorial Board declares that the manuscript met the ICMJE recommendation for biomedical papers.Submitted: 13. 3. 2017Accepted: 26. 3. 2017.

Physiological, molecular, and cellular mechanisms of impaired seawater tolerance following exposure of Atlantic salmon, Salmo salar, smolts to acid and aluminum

USGS Publications Warehouse

Monette, M.Y.; Yada, T.; Matey, V.; McCormick, S.D.

2010-01-01

We examined the physiological, molecular, and cellular mechanisms of impaired ion regulation in Atlantic salmon, Salmo salar, smolts following acute acid and aluminum (Al) exposure. Smolts were exposed to: control (pH 6.5, 3.4??gl-1 Al), acid and low Al (LAl: pH 5.4, 11??gl-1 Al), acid and moderate Al (MAl: pH 5.3, 42??gl-1 Al), and acid and high Al (HAl: pH 5.4, 56??gl-1 Al) for two and six days. At each time-point, smolts were sampled directly from freshwater treatment tanks and after a 24h seawater challenge. Exposure to acid/MAl and acid/HAl led to accumulation of gill Al, substantial alterations in gill morphology, reduced gill Na+/K+-ATPase (NKA) activity, and impaired ion regulation in both freshwater and seawater. Exposure to acid/MAl for six days also led to a decrease in gill mRNA expression of the apical Cl- channel (cystic fibrosis transmembrane conductance regulator I), increased apoptosis upon seawater exposure, an increase in the surface expression of mitochondria-rich cells (MRCs) within the filament epithelium of the gill, but reduced abundance of gill NKA-positive MRCs. By contrast, smolts exposed to acid and the lowest Al concentration exhibited minor gill Al accumulation, slight morphological modifications in the gill, and impaired seawater tolerance in the absence of a detectable effect on freshwater ion regulation. These impacts were accompanied by decreased cell proliferation, a slight increase in the surface expression of MRCs within the filament epithelium, but no impact on gill apoptosis or total MRC abundance was observed. However, MRCs in the gills of smolts exposed to acid/LAl exhibited morphological alterations including decreased size, staining intensity, and shape factor. We demonstrate that the seawater tolerance of Atlantic salmon smolts is extremely sensitive to acute exposure to acid and low levels of Al, and that the mechanisms underlying this depend on the time-course and severity of Al exposure. We propose that when smolts are exposed to acid and moderate to high Al concentrations, impaired seawater tolerance results from extensive gill Al accumulation, damage to the epithelium, reduced MRC and transport protein abundance, and a synergistic stimulation of apoptosis in the gill upon seawater exposure. When smolts are exposed to acid and low levels of Al, loss of seawater tolerance appears to be independent of these mechanisms and may result instead from a shift in the phenotype of MRCs present in the gill epithelium. ?? 2010 Elsevier B.V..

p53 suppresses hyper-recombination by modulating BRCA1 function

PubMed Central

Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N.; Feng, Zhihui

2015-01-01

Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level. PMID:26162908

Synergistic Effects between Doped Nitrogen and Phosphorus in Metal-Free Cathode for Zinc-Air Battery from Covalent Organic Frameworks Coated CNT.

PubMed

Li, Zhongtao; Zhao, Weinan; Yin, Changzhi; Wei, Liangqin; Wu, Wenting; Hu, Zhenpeng; Wu, Mingbo

2017-12-27

A covalent organic framework that is composed of hexachlorocyclotriphosphazene and dicyanamide has been coated on CNT to prepare metal-free oxygen reduction reaction catalyst through thermal polymerization of the Zn-air battery cathode. The N,P-codoped nanohybrids have highly porous structure and active synergistic effect between graphitic-N and -P, which promoted the electrocatalytic performance. The electrocatalysts exhibits remarkable half-wave potential (-0.162 V), high current density (6.1 mA/cm -2 ), good stability (83%), and excellent methanol tolerance for ORR in alkaline solution. Furthermore, the N,P-codoped nanohybrids were used as an air electrode for fabrication of a high performance Zn-air battery. The battery achieves a high open-circuit potential (1.53 V) and peak power density (0.255 W cm -2 ). Moreover, the effect of N,P codoping on the conjugate carbon system and the synergistic effect between graphitic-N and P have been calculated through density functional theory calculations, which are essentially in agreement with experimental data.

Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma initiation and maintenance.

PubMed

Walia, Mannu K; Ho, Patricia Mw; Taylor, Scott; Ng, Alvin Jm; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew Cw; Martin, T John; Walkley, Carl R

2016-04-12

Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS.

Suppression of p53-inducible gene 3 is significant for glioblastoma progression and predicts poor patient prognosis.

PubMed

Quan, Jishu; Li, Yong; Jin, Meihua; Chen, Dunfu; Yin, Xuezhe; Jin, Ming

2017-03-01

Glioblastoma is the most malignant and invasive brain tumor with extremely poor prognosis. p53-inducible gene 3, a downstream molecule of the tumor suppressor p53, has been found involved in apoptosis and oxidative stress response. However, the functions of p53-inducible gene 3(PIG3) in cancer are far from clear including glioblastoma. In this study, we found that p53-inducible gene 3 expression was suppressed in glioblastoma tissues compared with normal tissues. And the expression of p53-inducible gene 3 was significantly associated with the World Health Organization grade. Patients with high p53-inducible gene 3 expression have a significantly longer median survival time (15 months) than those with low p53-inducible gene 3 expression (8 months). According to Cox regression analysis, p53-inducible gene 3 was an independent prognostic factor with multivariate hazard ratio of 0.578 (95% confidence interval, 0.352-0.947; p = 0.030) for overall survival. Additionally, gain and loss of function experiments showed that knockdown of p53-inducible gene 3 significantly increased the proliferation and invasion ability of glioblastoma cells while overexpression of p53-inducible gene 3 inhibited the proliferation and invasion ability. The results of in vivo glioblastoma models further confirmed that p53-inducible gene 3 suppression promoted glioblastoma progression. Altogether, our data suggest that high expression of p53-inducible gene 3 is significant for glioblastoma inhibition and p53-inducible gene 3 independently indicates good prognosis in patients, which might be a novel prognostic biomarker or potential therapeutic target in glioblastoma.

Mutant p53 expression in fallopian tube epithelium drives cell migration.

PubMed

Quartuccio, Suzanne M; Karthikeyan, Subbulakshmi; Eddie, Sharon L; Lantvit, Daniel D; Ó hAinmhire, Eoghainín; Modi, Dimple A; Wei, Jian-Jun; Burdette, Joanna E

2015-10-01

Ovarian cancer is the fifth leading cause of cancer death among US women. Evidence supports the hypothesis that high-grade serous ovarian cancers (HGSC) may originate in the distal end of the fallopian tube. Although a heterogeneous disease, 96% of HGSC contain mutations in p53. In addition, the "p53 signature," or overexpression of p53 protein (usually associated with mutation), is a potential precursor lesion of fallopian tube derived HGSC suggesting an essential role for p53 mutation in early serous tumorigenesis. To further clarify p53-mutation dependent effects on cells, murine oviductal epithelial cells (MOE) were stably transfected with a construct encoding for the R273H DNA binding domain mutation in p53, the most common mutation in HGSC. Mutation in p53 was not sufficient to transform MOE cells but did significantly increase cell migration. A similar p53 mutation in murine ovarian surface epithelium (MOSE), another potential progenitor cell for serous cancer, was not sufficient to transform the cells nor change migration suggesting tissue specific effects of p53 mutation. Microarray data confirmed expression changes of pro-migratory genes in p53(R273H) MOE compared to parental cells, which could be reversed by suppressing Slug expression. Combining p53(R273H) with KRAS(G12V) activation caused transformation of MOE into high-grade sarcomatoid carcinoma when xenografted into nude mice. Elucidating the specific role of p53(R273H) in the fallopian tube will improve understanding of changes at the earliest stage of transformation. This information can help develop chemopreventative strategies to prevent the accumulation of additional mutations and reverse progression of the "p53 signature" thereby, improving survival rates. © 2015 UICC.

MicroRNA-125b is a novel negative regulator of p53.

PubMed

Le, Minh T N; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F; Lim, Bing

2009-04-01

The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3' untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with gamma-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response.

MicroRNA-125b is a novel negative regulator of p53

PubMed Central

Le, Minh T.N.; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F.; Lim, Bing

2009-01-01

The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3′ untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with γ-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response. PMID:19293287

Aggregation-primed molten globule conformers of the p53 core domain provide potential tools for studying p53C aggregation in cancer.

PubMed

Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L

2018-05-31

The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Both germ line and somatic genetics of the p53 pathway affect ovarian cancer incidence and survival.

PubMed

Bartel, Frank; Jung, Juliane; Böhnke, Anja; Gradhand, Elise; Zeng, Katharina; Thomssen, Christoph; Hauptmann, Steffen

2008-01-01

Although p53 is one of the most studied genes/proteins in ovarian carcinomas, the predictive value of p53 alterations is still ambiguous. We performed analyses of the TP53 mutational status and its protein expression using immunohistochemistry. Moreover, the single nucleotide polymorphism SNP309 in the P2 promoter of the MDM2 gene was investigated. We correlated the results with age of onset and outcome from 107 patients with ovarian carcinoma. In our study, we identified a large group of patients with p53 overexpression despite having a wild-type gene (49% of all patients with wild-type TP53). This was associated with a significantly shortened overall survival time (P = 0.019). Patients with p53 alterations (especially those with overexpression of wild-type TP53) were also more refractory to chemotherapy compared with patients with normal p53 (P = 0.027). The G-allele of SNP309 is associated with an earlier age of onset in patients with estrogen receptor-overexpressing FIGO stage III disease (P = 0.048). In contrast, in patients with FIGO stage III disease, a weakened p53 pathway (either the G-allele of SNP309 or a TP53 mutation) was correlated with increased overall survival compared with patients whose tumors were wild-type for both TP53 and SNP309 (P = 0.0035). Our study provides evidence that both germ line and somatic alterations of the p53 pathway influence the incidence and survival of ovarian carcinoma, and it underscores the importance of assessing the functionality of p53 in order to predict the sensitivity of platinum-based chemotherapies and patient outcome.

p53-dependent cell death/apoptosis is required for a productive adenovirus infection.

PubMed

Hall, A R; Dix, B R; O'Carroll, S J; Braithwaite, A W

1998-09-01

The p53 tumor suppressor protein binds to both cellular and viral proteins, which influence its biological activity. One such protein is the large E1b tumor antigen (E1b58kDa) from adenoviruses (Ads), which abrogates the ability of p53 to transactivate various promoters. This inactivation of p53 function is believed to be the mechanism by which E1b58kDa contributes to the cell transformation process. Although the p53-E1b58kDa complex occurs during infection and is conserved among different serotypes, there are limited data demonstrating that it has a role in virus replication. However, loss of p53 expression occurs after adenovirus infection of human cells and an E1b58kDa deletion mutant (Onyx-015, also called dl 1520) selectively replicates in p53-defective cells. These (and other) data indicate a plausible hypothesis is that loss of p53 function may be conducive to efficient adenovirus replication. However, wild-type (wt) Ad5 grows more efficiently in cells expressing a wt p53 protein. These studies indicate that the hypothesis may be an oversimplification. Here, we show that cells expressing wt p53, as well as p53-defective cells, allow adenovirus replication, but only cells expressing wt p53 show evidence of virus-induced cytopathic effect. This correlates with the ability of adenovirus to induce cell death. Our data indicate that p53 plays a necessary part in mediating cellular destruction to allow a productive adenovirus infection. In contrast, p53-deficient cells are less sensitive to the cytolytic effects of adenovirus and as such raise questions about the use of E1b58kDa-deficient adenoviruses in tumor therapy.

Age-Related Susceptibility to Apoptosis in Human Retinal Pigment Epithelial Cells Is Triggered by Disruption of p53–Mdm2 Association

PubMed Central

Bhattacharya, Sujoy; Chaum, Edward; Johnson, Dianna A.; Johnson, Leonard R.

2012-01-01

Purpose. Relatively little is known about the contribution of p53/Mdm2 pathway in apoptosis of retinal pigment epithelial (RPE) cells or its possible link to dysfunction of aging RPE or to related blinding disorders such as age-related macular degeneration (AMD). Methods. Age-associated changes in p53 activation were evaluated in primary RPE cultures from human donor eyes of various ages. Apoptosis was evaluated by activation of caspases and DNA fragmentation. Gene-specific small interfering RNA was used to knock down expression of p53. Results. We observed that the basal rate of p53-dependent apoptosis increased in an age-dependent manner in human RPE. The age-dependent increase in apoptosis was linked to alterations in several aspects of the p53 pathway. p53 phosphorylation Ser15 was increased through the stimulation of ATM-Ser1981. p53 acetylation Lys379 was increased through the inhibition of SIRT1/2. These two posttranslational modifications of p53 blocked the sequestration of p53 by Mdm2, thus resulting in an increase in free p53 and of p53 stimulation of apoptosis through increased expression of PUMA (p53 upregulated modulator of apoptosis) and activation of caspase-3. Aged RPE also had reduced expression of antiapoptotic Bcl-2, which contributed to the increase in apoptosis. Of particular interest in these studies was that pharmacologic treatments to block p53 phosphorylation, acetylation, or expression were able to protect RPE cells from apoptosis. Conclusions. Our studies suggest that aging in the RPE leads to alterations of specific checkpoints in the apoptotic pathway, which may represent important molecular targets for the treatment of RPE-related aging disorders such as AMD. PMID:23139272

Selective activation of p53-mediated tumour suppression in high-grade tumours.

PubMed

Junttila, Melissa R; Karnezis, Anthony N; Garcia, Daniel; Madriles, Francesc; Kortlever, Roderik M; Rostker, Fanya; Brown Swigart, Lamorna; Pham, David M; Seo, Youngho; Evan, Gerard I; Martins, Carla P

2010-11-25

Non-small cell lung carcinoma (NSCLC) is the leading cause of cancer-related death worldwide, with an overall 5-year survival rate of only 10-15%. Deregulation of the Ras pathway is a frequent hallmark of NSCLC, often through mutations that directly activate Kras. p53 is also frequently inactivated in NSCLC and, because oncogenic Ras can be a potent trigger of p53 (ref. 3), it seems likely that oncogenic Ras signalling has a major and persistent role in driving the selection against p53. Hence, pharmacological restoration of p53 is an appealing therapeutic strategy for treating this disease. Here we model the probable therapeutic impact of p53 restoration in a spontaneously evolving mouse model of NSCLC initiated by sporadic oncogenic activation of endogenous Kras. Surprisingly, p53 restoration failed to induce significant regression of established tumours, although it did result in a significant decrease in the relative proportion of high-grade tumours. This is due to selective activation of p53 only in the more aggressive tumour cells within each tumour. Such selective activation of p53 correlates with marked upregulation in Ras signal intensity and induction of the oncogenic signalling sensor p19(ARF)( )(ref. 6). Our data indicate that p53-mediated tumour suppression is triggered only when oncogenic Ras signal flux exceeds a critical threshold. Importantly, the failure of low-level oncogenic Kras to engage p53 reveals inherent limits in the capacity of p53 to restrain early tumour evolution and in the efficacy of therapeutic p53 restoration to eradicate cancers.

The rapid destabilization of p53 mRNA in immortal chicken embryo fibroblast cells.

PubMed

Kim, H; You, S; Foster, L K; Farris, J; Foster, D N

2001-08-23

The steady-state levels of p53 mRNA were dramatically lower in immortal chicken embryo fibroblast (CEF) cell lines compared to primary CEF cells. In the presence of cycloheximide (CHX), the steady-state levels of p53 mRNA markedly increased in immortal CEF cell lines, similar to levels found in primary cells. The de novo synthetic rates of p53 mRNA were relatively similar in primary and immortal cells grown in the presence or absence of CHX. Destabilization of p53 mRNA was observed in the nuclei of immortal, but not primary, CEF cells. The half-life of p53 mRNA in primary cells was found to be a relatively long 23 h compared to only 3 h in immortal cells. The expression of transfected p53 cDNA was inhibited in immortal cells, but restored upon CHX treatment. The 5'-region of the p53 mRNA was shown to be involved in the rapid p53 mRNA destabilization in immortal cells by expression analysis of 5'- and 3'-deleted p53 cDNAs as well as fusion mRNA constructs of N-terminal p53 and N-terminal deleted LacZ genes. Together, it is suggestive that the downregulation of p53 mRNA in immortal CEF cells occurs through a post-transcriptional destabilizing mechanism.

Anti-p53 antibodies in sera from patients with chronic obstructive pulmonary disease can predate a diagnosis of cancer.

PubMed

Trivers, G E; De Benedetti, V M; Cawley, H L; Caron, G; Harrington, A M; Bennett, W P; Jett, J R; Colby, T V; Tazelaar, H; Pairolero, P; Miller, R D; Harris, C C

1996-10-01

Serum anti-p53 antibodies (p53-Abs) may be surrogate markers for both p53 alterations and preclinical cancer. Ancillary to a prospective trial to abate progressive development of clinical stages of chronic obstructive pulmonary disease, we conducted a retrospective, nested case-control study. Twenty-three cases were diagnosed with cancer during the trial. Enzyme immunoassay, immunoblotting, and immunoprecipitation were used to detect p53-Abs in serum, immunohistochemistry (IHC) to detect p53 accumulation, and single-strand conformation polymorphism and DNA sequencing to detect p53 mutations in tumor samples. p53-Abs were detected by three types of assays in five (23%) of the cancer patients, 80% of whom had detectable p53-Abs before diagnosis: 2 lung cancers (7 and 6 months before), 1 prostate cancer (11 months), and 1 breast cancer (5 months). Four Ab-positive patients had IHC-positive tumors. Two of 4 Ab-positive patients and 2 of 14 Ab-negative had p53 missense mutations or base pair deletion and IHC-positive tumors. The 44 noncancer COPD controls, matched with the cancer cases for age, gender, and smoking habits, were negative for p53-Abs. These results indicate that p53-Abs may facilitate the early diagnosis of cancer in a subset of smokers with chronic obstructive pulmonary disease who are at an increased cancer risk.

Zn(II)-curc targets p53 in thyroid cancer cells.

PubMed

Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella

2015-10-01

TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.

Release of targeted p53 from the mitochondrion as an early signal during mitochondrial dysfunction

EPA Science Inventory

Increased accumulation of p53 tumor suppressor protein is an early response to low-level stressors. To investigate the fate of mitochondrial-sequestered p53, mouse embryonic fibroblast cells (MEFs) on a p53-deficient genetic background were transfected with p53-EGFP fusion protei...

The nucleolus directly regulates p53 export and degradation.

PubMed

Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

2011-09-05

The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

Immunohistochemical status of p53, MDM2, bcl2, bax, and ER in invasive ductal breast carcinoma in Tunisian patients.

PubMed

Baccouche, Sami; Daoud, Jamel; Frikha, Mounir; Mokdad-Gargouri, Raja; Gargouri, Ali; Jlidi, Rachid

2003-12-01

TP53 gene alterations have been associated with sporadic breast cancer. To assess the role of p53 in invasive ductal carcinoma (IDC) of the breast among Tunisian patients, p53 protein status was studied by immuno-histochemical analysis. The p53 protein was expressed in 41 of 70 (58%) tumors. Study of the status of its target gene expression showed that MDM2 was overexpressed in 43 tumors (61%), bcl2 in 29 (41%), and bax in only 9 (12%). Estrogen receptor (ER) was detected in 38 tumor tissues (54%). The accumulated p53 was significantly associated with MDM2-positive, bcl2-negative, and ER-negative tumors (P = 0.024, P = 0.000027, and P = 0.000008, respectively), whereas with bax the correlaton was not significant. Bcl2 immunostaining displayed a positive correlation with ER (P = 0.001). A significantly higher fraction of p53-positive cells was observed in ER-negative SBRII-SBRIII tumors than in ER-positive SBRI-SBRII tumors (P = 0.000066). bcl2-positive tumors were significantly correlated with ER-positive/SBRI-SBRII tumors (P = 0.007), but negatively correlated with p53/bax (P = 0000004). MDM2 immunostaining displayed the same phenotype as p53 in the correlation with bcl2 and ER (P = 0.003), strengthened by significant associations between MDM2-positive/p53-positive and bcl2-negative or ER-negative, respectively (P = 0.00005 and P = 0.000001, respectively). MDM2-positive cells were significantly correlated with the p53-positive/bax-negative phenotype (P = 0.04). These results suggest that p53 accumulated in these tumor tissues is associated with bad prognostic markers (ER-negative, SBRIII) of IDC. MDM2 overexpression might be responsible for the accumulated p53 value in IDC. Regulation of the apoptotic process is involved in IDC; bcl2 is associated with a good prognostic marker (ER-positive and SBRI-II), whereas the regulation of bax is complex and does not necessarily correlate with the overexpression of p53.

Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finlay, C.A.; Hinds, P.W.; Tan, T.H.

1988-02-01

The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less

MicroRNA-145 is regulated by DNA methylation and p53 gene mutation in prostate cancer

PubMed Central

Suh, Seong O.; Chen, Yi; Zaman, Mohd Saif; Hirata, Hiroshi; Yamamura, Soichiro; Shahryari, Varahram; Liu, Jan; Tabatabai, Z.Laura; Kakar, Sanjay; Deng, Guoren; Tanaka, Yuichiro; Dahiya, Rajvir

2011-01-01

MiR-145 is downregulated in various cancers including prostate cancer. However, the underlying mechanisms of miR-145 downregulation are not fully understood. Here, we reported that miR-145 was silenced through DNA hypermethylation and p53 mutation status in laser capture microdissected (LCM) prostate cancer and matched adjacent normal tissues. In 22 of 27 (81%) prostate tissues, miR-145 was significantly downregulated in the cancer compared with the normal tissues. Further studies on miR-145 downregulation mechanism showed that miR-145 is methylated at the promoter region in both prostate cancer tissues and 50 different types of cancer cell lines. In seven cancer cell lines with miR-145 hypermethylation, 5-aza-2′-deoxycytidine treatment dramatically induced miR-145 expression. Interestingly, we also found a significant correlation between miR-145 expression and the status of p53 gene in both LCM prostate tissues and 47 cancer cell lines. In 29 cell lines with mutant p53, miR-145 levels were downregulated in 28 lines (97%), whereas in 18 cell lines with wild-type p53 (WT p53), miR-145 levels were downregulated in only 6 lines (33%, P < 0.001). Electrophoretic mobility shift assay showed that p53 binds to the p53 response element upstream of miR-145, but the binding was inhibited by hypermethylation. To further confirm that p53 binding to miR-145 could regulate miR-145 expression, we transfected WT p53 and MUT p53 into PC-3 cells and found that miR-145 is upregulated by WT p53 but not with MUTp53. The apoptotic cells are increased after WT p53 transfection. In summary, this is the first report documenting that downregulation of miR-145 is through DNA methylation and p53 mutation pathways in prostate cancer. PMID:21349819

Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Zhendong, E-mail: zdyu@hotmail.com; Wang, Hao; Zhang, Libin

CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrugmore » system.« less

40 CFR 180.1141 - Sodium p-nitrophenolate; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Sodium p-nitrophenolate; exemption... FOOD Exemptions From Tolerances § 180.1141 Sodium p-nitrophenolate; exemption from the requirement of a tolerance. The biochemical sodium p-nitrophenolate is exempted from the requirement of a tolerance when used...

40 CFR 180.1141 - Sodium p-nitrophenolate; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Sodium p-nitrophenolate; exemption... FOOD Exemptions From Tolerances § 180.1141 Sodium p-nitrophenolate; exemption from the requirement of a tolerance. The biochemical sodium p-nitrophenolate is exempted from the requirement of a tolerance when used...

40 CFR 180.1141 - Sodium p-nitrophenolate; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Sodium p-nitrophenolate; exemption... FOOD Exemptions From Tolerances § 180.1141 Sodium p-nitrophenolate; exemption from the requirement of a tolerance. The biochemical sodium p-nitrophenolate is exempted from the requirement of a tolerance when used...

40 CFR 180.1141 - Sodium p-nitrophenolate; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Sodium p-nitrophenolate; exemption... FOOD Exemptions From Tolerances § 180.1141 Sodium p-nitrophenolate; exemption from the requirement of a tolerance. The biochemical sodium p-nitrophenolate is exempted from the requirement of a tolerance when used...

40 CFR 180.1141 - Sodium p-nitrophenolate; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Sodium p-nitrophenolate; exemption... FOOD Exemptions From Tolerances § 180.1141 Sodium p-nitrophenolate; exemption from the requirement of a tolerance. The biochemical sodium p-nitrophenolate is exempted from the requirement of a tolerance when used...

Efficacy and safety of CT-P13 (biosimilar infliximab) in patients with rheumatoid arthritis: comparison between switching from reference infliximab to CT-P13 and continuing CT-P13 in the PLANETRA extension study

PubMed Central

Yoo, Dae Hyun; Prodanovic, Nenad; Jaworski, Janusz; Miranda, Pedro; Ramiterre, Edgar; Lanzon, Allan; Baranauskaite, Asta; Wiland, Piotr; Abud-Mendoza, Carlos; Oparanov, Boycho; Smiyan, Svitlana; Kim, HoUng; Lee, Sang Joon; Kim, SuYeon; Park, Won

2017-01-01

Objectives To assess the efficacy and safety of switching from the infliximab reference product (RP; Remicade) to its biosimilar CT-P13 (Remsima, Inflectra) or continuing CT-P13 in patients with rheumatoid arthritis (RA) for an additional six infusions. Methods This open-label extension study recruited patients with RA who had completed the 54-week, randomised, parallel-group study comparing CT-P13 with RP (PLANETRA; NCT01217086). CT-P13 (3 mg/kg) was administered intravenously every 8 weeks from weeks 62 to 102. All patients received concomitant methotrexate. Endpoints included American College of Rheumatology 20% (ACR20) response, ACR50, ACR70, immunogenicity and safety. Data were analysed for patients who received CT-P13 for 102 weeks (maintenance group) and for those who received RP for 54 weeks and then switched to CT-P13 (switch group). Results Overall, 302 of 455 patients who completed the PLANETRA study enrolled into the extension. Of these, 158 had received CT-P13 (maintenance group) and 144 RP (switch group). Response rates at week 102 for maintenance versus switch groups, respectively, were 71.7% vs 71.8% for ACR20, 48.0% vs 51.4% for ACR50 and 24.3% vs 26.1% for ACR70. The proportion of patients with antidrug antibodies was comparable between groups (week 102: 40.3% vs 44.8%, respectively). Treatment-emergent adverse events occurred in similar proportions of patients in the two groups during the extension study (53.5% and 53.8%, respectively). Conclusions Comparable efficacy and tolerability were observed in patients who switched from RP to its biosimilar CT-P13 for an additional year and in those who had long-term CT-P13 treatment for 2 years. Trial registration number NCT01571219; Results. PMID:27130908

Lack of dependence on p53 for DNA double strand break repair of episomal vectors in human lymphoblasts

NASA Technical Reports Server (NTRS)

Kohli, M.; Jorgensen, T. J.

1999-01-01

The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.

Clinical and pathologic relevance of p53 index in canine osseous tumors.

PubMed

Loukopoulos, P; Thornton, J R; Robinson, W F

2003-05-01

The clinicopathologic value of the immunohistochemical (IHC) expression of p53 protein was evaluated in 167 canine osseous tumors. p53 staining frequency and intensity in tumor cells was expressed as a p53 index. p53 index was significantly higher in osteosarcomas than in other sarcomas, chondrosarcoma, multilobular tumor of bone, and tumors initially misdiagnosed as osteosarcomas as well as in appendicular versus axial and in distal versus proximal osteosarcomas. A strong correlation is demonstrated between the p53 index and a range of clinicopathologic parameters in osteosarcoma, including the tumor site, histologic grade and score, mitotic index, degree of tumor necrosis, and pleomorphism. Chondroblastic osteosarcomas had significantly higher and telangiectatic osteosarcomas significantly lower p53 index than did osteosarcomas belonging to other histopathologic subtypes, a fact that tends to reinforce the perception of these osteosarcomas as distinct clinicopathologic entities. Entire males had higher p53 index than did neutered males. p53 index was higher in Rottweilers than in Great Danes and Terriers, confirming breed susceptibilities to osteosarcoma. p53 index showed no association with age, primary or secondary site status, or the presence of metastases or other tumor types. Biopsy samples had a higher p53 index than did postmortem samples, either because of differences in sample processing or the possibility that p53 overexpression is more evident at the earlier stages of osteosarcoma pathogenesis, presumably represented by the biopsy material. IHC examination for p53 and the derived index has the potential to be used as an additional diagnostic tool and prognostic indicator for osseous tumors.

Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT.

PubMed

Leszczynska, Katarzyna B; Foskolou, Iosifina P; Abraham, Aswin G; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N; O'Neill, Eric E; Buffa, Francesca M; Hammond, Ester M

2015-06-01

Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage-induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain-containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors.

Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

PubMed Central

Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

2015-01-01

Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX

PubMed Central

Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

2011-01-01

Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 – HdmX and Wip1, leading to efficient elimination of tumour cells. PMID:21546907

Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX.

PubMed

Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

2011-11-01

Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 - HdmX and Wip1, leading to efficient elimination of tumour cells.

TRIM65 negatively regulates p53 through ubiquitination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yang; Ma, Chengyuan; Zhou, Tong

2016-04-22

Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediatedmore » degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.« less

The Transcription Factor p53 Influences Microglial Activation Phenotype

PubMed Central

Jayadev, Suman; Nesser, Nicole K.; Hopkins, Stephanie; Myers, Scott J.; Case, Amanda; Lee, Rona J.; Seaburg, Luke A.; Uo, Takuma; Murphy, Sean P.; Morrison, Richard S.; Garden, Gwenn A.

2011-01-01

Several neurodegenerative diseases are influenced by the innate immune response in the central nervous system (CNS). Microglia, have pro-inflammatory and subsequently neurotoxic actions as well as anti-inflammatory functions that promote recovery and repair. Very little is known about the transcriptional control of these specific microglial behaviors. We have previously shown that in HIV associated neurocognitive disorders (HAND), the transcription factor p53 accumulates in microglia and that microglial p53 expression is required for the in vitro neurotoxicity of the HIV coat glycoprotein gp120. These findings suggested a novel function for p53 in regulating microglial activation. Here we report that in the absence of p53, microglia demonstrate a blunted response to interferon-γ, failing to increase expression of genes associated with classical macrophage activation or secrete pro-inflammatory cytokines. Microarray analysis of global gene expression profiles revealed increased expression of genes associated with anti-inflammatory functions, phagocytosis and tissue repair in p53 knockout (p53−/−) microglia compared with those cultured from strain matched p53 expressing (p53+/+) mice. We further observed that p53−/− microglia demonstrate increased phagocytic activity in vitro and expression of markers for alternative macrophage activation both in vitro and in vivo. In HAND brain tissue, the alternative activation marker CD163 was expressed in a separate subset of microglia than those demonstrating p53 accumulation. These data suggest that p53 influences microglial behavior, supporting the adoption of a pro-inflammatory phenotype, while p53 deficiency promotes phagocytosis and gene expression associated with alternative activation and anti-inflammatory functions. PMID:21598312

Preeclampsia Is Associated with Alterations in the p53-Pathway in Villous Trophoblast

PubMed Central

Sharp, Andrew N.; Heazell, Alexander E. P.; Baczyk, Dora; Dunk, Caroline E.; Lacey, Helen A.; Jones, Carolyn J. P.; Perkins, Jonathan E.; Kingdom, John C. P.; Baker, Philip N.; Crocker, Ian P.

2014-01-01

Background Preeclampsia (PE) is characterized by exaggerated apoptosis of the villous trophoblast of placental villi. Since p53 is a critical regulator of apoptosis we hypothesized that excessive apoptosis in PE is mediated by abnormal expression of proteins participating in the p53 pathway and that modulation of the p53 pathway alters trophoblast apoptosis in vitro. Methods Fresh placental villous tissue was collected from normal pregnancies and pregnancies complicated by PE; Western blotting and real-time PCR were performed on tissue lysate for protein and mRNA expression of p53 and downstream effector proteins, p21, Bax and caspases 3 and 8. To further assess the ability of p53 to modulate apoptosis within trophoblast, BeWo cells and placental villous tissue were exposed to the p53-activator, Nutlin-3, alone or in combination with the p53-inhibitor, Pifithrin-α (PFT- α). Equally, Mdm2 was knocked-down with siRNA. Results Protein expression of p53, p21 and Bax was significantly increased in pregnancies complicated by PE. Conversely, Mdm2 protein levels were significantly depleted in PE; immunohistochemistry showed these changes to be confined to trophoblast. Reduction in the negative feedback of p53 by Mdm2, using siRNA and Nutlin-3, caused an imbalance between p53 and Mdm2 that triggered apoptosis in term villous explants. In the case of Nutlin, this was attenuated by Pifithrin-α. Conclusions These data illustrate the potential for an imbalance in p53 and Mdm2 expression to promote excessive apoptosis in villous trophoblast. The upstream regulation of p53 and Mdm2, with regard to exaggerated apoptosis and autophagy in PE, merits further investigation. PMID:24498154

Preeclampsia is associated with alterations in the p53-pathway in villous trophoblast.

PubMed

Sharp, Andrew N; Heazell, Alexander E P; Baczyk, Dora; Dunk, Caroline E; Lacey, Helen A; Jones, Carolyn J P; Perkins, Jonathan E; Kingdom, John C P; Baker, Philip N; Crocker, Ian P

2014-01-01

Preeclampsia (PE) is characterized by exaggerated apoptosis of the villous trophoblast of placental villi. Since p53 is a critical regulator of apoptosis we hypothesized that excessive apoptosis in PE is mediated by abnormal expression of proteins participating in the p53 pathway and that modulation of the p53 pathway alters trophoblast apoptosis in vitro. Fresh placental villous tissue was collected from normal pregnancies and pregnancies complicated by PE; Western blotting and real-time PCR were performed on tissue lysate for protein and mRNA expression of p53 and downstream effector proteins, p21, Bax and caspases 3 and 8. To further assess the ability of p53 to modulate apoptosis within trophoblast, BeWo cells and placental villous tissue were exposed to the p53-activator, Nutlin-3, alone or in combination with the p53-inhibitor, Pifithrin-α (PFT-α). Equally, Mdm2 was knocked-down with siRNA. Protein expression of p53, p21 and Bax was significantly increased in pregnancies complicated by PE. Conversely, Mdm2 protein levels were significantly depleted in PE; immunohistochemistry showed these changes to be confined to trophoblast. Reduction in the negative feedback of p53 by Mdm2, using siRNA and Nutlin-3, caused an imbalance between p53 and Mdm2 that triggered apoptosis in term villous explants. In the case of Nutlin, this was attenuated by Pifithrin-α. These data illustrate the potential for an imbalance in p53 and Mdm2 expression to promote excessive apoptosis in villous trophoblast. The upstream regulation of p53 and Mdm2, with regard to exaggerated apoptosis and autophagy in PE, merits further investigation.

Hypoxia induces p53 accumulation in the S-phase and accumulation of hypophosphorylated retinoblastoma protein in all cell cycle phases of human melanoma cells.

PubMed Central

Danielsen, T.; Hvidsten, M.; Stokke, T.; Solberg, K.; Rofstad, E. K.

1998-01-01

Hypoxia has been shown to induce accumulation of p53 and of hypophosphorylated retinoblastoma protein (pRb) in tumour cells. In this study, the cell cycle dependence of p53 accumulation and pRb hypophosphorylation in four human melanoma cell lines that are wild type for p53 was investigated using two-parameter flow cytometry measurements of p53 or pRb protein content and DNA content. The hypoxia-induced increase in p53 protein was higher in S-phase than in G1 and G2 phases in all cell lines. The accumulation of p53 in S-phase during hypoxia was not related to hypoxia-induced apoptosis or substantial cell cycle specific cell inactivation during the first 24 h of reoxygenation. pRb was hypophosphorylated in all cell cycle phases by hypoxia treatment. The results did not support a direct link between p53 and pRb during hypoxia because p53 was induced in a cell cycle-specific manner, whereas no cell cycle-dependent differences in pRb hypophosphorylation were detected. Only a fraction of the cell populations (0.60+/-0.10) showed hypophosphorylated pRb. Thus, pRb is probably not the only mediator of the hypoxia-induced cell cycle block seen in all cells and all cell cycle phases. Moreover, the cell cycle-dependent induction of p53 by hypoxia suggests that the primary function of p53 accumulation during hypoxia is other than to arrest the cells. Images Figure 4 Figure 7 PMID:9862563

MDM4 is a key therapeutic target in cutaneous melanoma

PubMed Central

Gembarska, Agnieszka; Luciani, Flavie; Fedele, Clare; Russell, Elisabeth A; Dewaele, Michael; Villar, Stéphanie; Zwolinska, Aleksandra; Haupt, Sue; de Lange, Job; Yip, Dana; Goydos, James; Haigh, Jody J; Haupt, Ygal; Larue, Lionel; Jochemsen, Aart; Shi, Hubing; Moriceau, Gatien; Lo, Roger S; Ghanem, Ghanem; Shackleton, Mark; Bernal, Federico; Marine, Jean-Christophe

2013-01-01

The inactivation of the p53 tumor suppressor pathway, which often occurs through mutations in TP53 (encoding tumor protein 53) is a common step in human cancer. However, in melanoma—a highly chemotherapy-resistant disease—TP53 mutations are rare, raising the possibility that this cancer uses alternative ways to overcome p53-mediated tumor suppression. Here we show that Mdm4 p53 binding protein homolog (MDM4), a negative regulator of p53, is upregulated in a substantial proportion (∼65%) of stage I–IV human melanomas and that melanocyte-specific Mdm4 overexpression enhanced tumorigenesis in a mouse model of melanoma induced by the oncogene Nras. MDM4 promotes the survival of human metastatic melanoma by antagonizing p53 proapoptotic function. Notably, inhibition of the MDM4-p53 interaction restored p53 function in melanoma cells, resulting in increased sensitivity to cytotoxic chemotherapy and to inhibitors of the BRAF (V600E) oncogene. Our results identify MDM4 as a key determinant of impaired p53 function in human melanoma and designate MDM4 as a promising target for antimelanoma combination therapy. PMID:22820643

Constant p53 Pathway Inactivation in a Large Series of Soft Tissue Sarcomas with Complex Genetics

PubMed Central

Pérot, Gaëlle; Chibon, Frédéric; Montero, Audrey; Lagarde, Pauline; de Thé, Hugues; Terrier, Philippe; Guillou, Louis; Ranchère, Dominique; Coindre, Jean-Michel; Aurias, Alain

2010-01-01

Alterations of the p53 pathway are among the most frequent aberrations observed in human cancers. We have performed an exhaustive analysis of TP53, p14, p15, and p16 status in a large series of 143 soft tissue sarcomas, rare tumors accounting for around 1% of all adult cancers, with complex genetics. For this purpose, we performed genomic studies, combining sequencing, copy number assessment, and expression analyses. TP53 mutations and deletions are more frequent in leiomyosarcomas than in undifferentiated pleomorphic sarcomas. Moreover, 50% of leiomyosarcomas present TP53 biallelic inactivation, whereas most undifferentiated pleomorphic sarcomas retain one wild-type TP53 allele (87.2%). The spectrum of mutations between these two groups of sarcomas is different, particularly with a higher rate of complex mutations in undifferentiated pleomorphic sarcomas. Most tumors without TP53 alteration exhibit a deletion of p14 and/or lack of mRNA expression, suggesting that p14 loss could be an alternative genotype for direct TP53 inactivation. Nevertheless, the fact that even in tumors altered for TP53, we could not detect p14 protein suggests that other p14 functions, independent of p53, could be implicated in sarcoma oncogenesis. In addition, both p15 and p16 are frequently codeleted or transcriptionally co-inhibited with p14, essentially in tumors with two wild-type TP53 alleles. Conversely, in TP53-altered tumors, p15 and p16 are well expressed, a feature not incompatible with an oncogenic process. PMID:20884963

CDIP, a novel pro-apoptotic gene, regulates TNFalpha-mediated apoptosis in a p53-dependent manner.

PubMed

Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W

2007-07-25

We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-alpha expression tightly correlates with CDIP expression, and that inhibition of TNF-alpha signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-alpha is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-alpha impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 --> CDIP --> TNF-alpha apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy.

JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation

PubMed Central

Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng

2009-01-01

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types—MDM2, Pirh2, and COP1—and the HECT-domain type—ARF-BP1—have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G1 phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation. PMID:19509332

JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation.

PubMed

Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng

2009-06-23

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types--MDM2, Pirh2, and COP1--and the HECT-domain type--ARF-BP1--have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G(1) phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation.

miR-300 promotes proliferation and EMT-mediated colorectal cancer migration and invasion by targeting p53.

PubMed

Wang, Lin; Yu, Peiwu

2016-12-01

p53 mutations in tumors can induce the loss of wild-type tumor-suppressing p53 function, which results in the increase in proliferation, migration and invasion ability in cancer cells. Studies have shown that the expression of p53 is regulated by several microRNAs (miRNAs). In the present study, we found that miR-300 and p53 were significantly increased in colorectal cancer (CRC) tissues when compared with levels noted in adjacent colorectal tissues. Both miR-300 and p53 were significantly correlated with lymphatic metastasis and TNM stage. Both miR-300 and p53 promoted CRC cell (SW480 and HT29) proliferation, migration, and invasion, respectively, in vitro. In addition, we found that miR-300 is a direct positive regulator of p53 through binding to the binding site in the 3'UTR of the p53 gene in human CRC cells. Moreover, both miR-300 and p53 induced CRC cell epithelial‑mesenchymal transition (EMT) respectively. Taken together, we demonstrated that miR-300 promoted proliferation and EMT-mediated CRC migration and invasion by targeting p53. These findings provide a new theoretical basis and potential therapeutic targets, and thus lays the foundation for exploring the pathogenesis of CRC.

Distinguishing Low-Risk Luminal A Breast Cancer Subtypes with Ki-67 and p53 Is More Predictive of Long-Term Survival

PubMed Central

Lee, Se Kyung; Bae, Soo Youn; Lee, Jun Ho; Lee, Hyun-Chul; Yi, Hawoo; Kil, Won Ho; Lee, Jeong Eon; Kim, Seok Won; Nam, Seok Jin

2015-01-01

Overexpression of p53 is the most frequent genetic alteration in breast cancer. Recently, many studies have shown that the expression of mutant p53 differs for each subtype of breast cancer and is associated with different prognoses. In this study, we aimed to determine the suitable cut-off value to predict the clinical outcome of p53 overexpression and its usefulness as a prognostic factor in each subtype of breast cancer, especially in luminal A breast cancer. Approval was granted by the Institutional Review Board of Samsung Medical Center. We analyzed a total of 7,739 patients who were surgically treated for invasive breast cancer at Samsung Medical Center between Dec 1995 and Apr 2013. Luminal A subtype was defined as ER&PR + and HER2- and was further subclassified according to Ki-67 and p53 expression as follows: luminal A (Ki-67-,p53-), luminal A (Ki-67+, p53-), luminal A (Ki-67 -, p53+) and luminal A (Ki-67+, p53+). Low-risk luminal A subtype was defined as negative for both Ki-67 and p53 (luminal A [ki-67-, p53-]), and others subtypes were considered to be high-risk luminal A breast cancer. A cut-off value of 10% for p53 was a good predictor of clinical outcome in all patients and luminal A breast cancer patients. The prognostic role of p53 overexpression for OS and DFS was only significant in luminal A subtype. The combination of p53 and Ki-67 has been shown to have the best predictive power as calculated by the area under curve (AUC), especially for long-term overall survival. In this study, we have shown that overexpression of p53 and Ki-67 could be used to discriminate low-risk luminal A subtype in breast cancer. Therefore, using the combination of p53 and Ki-67 expression in discriminating low-risk luminal A breast cancer may improve the prognostic power and provide the greatest clinical utility. PMID:26241661

Expression screening using a Medaka cDNA library identifies evolutionarily conserved regulators of the p53/Mdm2 pathway.

PubMed

Zhang, Ping; Kratz, Anne Sophie; Salama, Mohammed; Elabd, Seham; Heinrich, Thorsten; Wittbrodt, Joachim; Blattner, Christine; Davidson, Gary

2015-10-08

The p53 tumor suppressor protein is mainly regulated by alterations in the half-life of the protein, resulting in significant differences in p53 protein levels in cells. The major regulator of this process is Mdm2, which ubiquitinates p53 and targets it for proteasomal degradation. This process can be enhanced or reduced by proteins that associate with p53 or Mdm2 and several proteins have been identified with such an activity. Furthermore, additional ubiquitin ligases for p53 have been identified in recent years. Nevertheless, our understanding of how p53 abundance and Mdm2 activity are regulated remains incomplete. Here we describe a cell culture based overexpression screen to identify evolutionarily conserved regulators of the p53/Mdm2 circuit. The results from this large-scale screening method will contribute to a better understanding of the regulation of these important proteins. Expression screening was based on co-transfection of H1299 cells with pools of cDNA's from a Medaka library together with p53, Mdm2 and, as internal control, Ror2. After cell lysis, SDS-PAGE/WB analysis was used to detect alterations in these proteins. More than one hundred hits that altered the abundance of either p53, Mdm2, or both were identified in the primary screen. Subscreening of the library pools that were identified in the primary screen identified several potential novel regulators of p53 and/or Mdm2. We also tested whether the human orthologues of the Medaka genes regulate p53 and/or Mdm2 abundance. All human orthologues regulated p53 and/or Mdm2 abundance in the same manner as the proteins from Medaka, which underscores the suitability of this screening methodology for the identification of new modifiers of p53 and Mdm2. Despite enormous efforts in the last two decades, many unknown regulators for p53 and Mdm2 abundance are predicted to exist. This cross-species approach to identify evolutionarily conserved regulators demonstrates that our Medaka unigene cDNA library represents a powerful tool to screen for these novel regulators of the p53/Mdm2 pathway.

Synthesis of cytochrome C oxidase 2: a p53-dependent metabolic regulator that promotes respiratory function and protects glioma and colon cancer cells from hypoxia-induced cell death.

PubMed

Wanka, C; Brucker, D P; Bähr, O; Ronellenfitsch, M; Weller, M; Steinbach, J P; Rieger, J

2012-08-16

P53 has an important role in the processing of starvation signals. P53-dependent molecular mediators of the Warburg effect reduce glucose consumption and promote mitochondrial function. We therefore hypothesized that the retention of wild-type p53 characteristic of primary glioblastomas limits metabolic demands induced by deregulated signal transduction in the presence of hypoxia and nutrient depletion. Here we report that short hairpin RNA-mediated gene suppression of wild-type p53 or ectopic expression of mutant temperature-sensitive dominant-negative p53(V135A) increased glucose consumption and lactate production, decreased oxygen consumption and enhanced hypoxia-induced cell death in p53 wild-type human glioblastoma cells. Similarly, genetic knockout of p53 in HCT116 colon carcinoma cells resulted in reduced respiration and hypersensitivity towards hypoxia-induced cell death. Further, wild-type p53 gene silencing reduced the expression of synthesis of cytochrome c oxidase 2 (SCO2), an effector necessary for respiratory chain function. An SCO2 transgene reverted the metabolic phenotype and restored resistance towards hypoxia in p53-depleted and p53 mutant glioma cells in a rotenone-sensitive manner, demonstrating that this effect was dependent on intact oxidative phosphorylation. Supplementation with methyl-pyruvate, a mitochondrial substrate, rescued p53 wild-type but not p53 mutant cells from hypoxic cell death, demonstrating a p53-mediated selective aptitude to metabolize mitochondrial substrates. Further, SCO2 gene silencing in p53 wild-type glioma cells sensitized these cells towards hypoxia. Finally, lentiviral gene suppression of SCO2 significantly enhanced tumor necrosis in a subcutaneous HCT116 xenograft tumor model, compatible with impaired energy metabolism in these cells. These findings demonstrate that glioma and colon cancer cells with p53 wild-type status can skew the Warburg effect and thereby reduce their vulnerability towards tumor hypoxia in an SCO2-dependent manner. Targeting SCO2 may therefore represent a valuable strategy to enhance sensitivity towards hypoxia and may complement strategies targeting glucose metabolism.

Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

PubMed

Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

2012-01-01

The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM.

Inhibition of NAMPT pathway by FK866 activates the function of p53 in HEK293T cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thakur, Basant Kumar, E-mail: thakur.basant@mh-hannover.de; Department of Molecular Hematopoiesis, Hannover Medical School, Carl Neuberg Str-1, 30625 Hannover; Dittrich, Tino

2012-08-03

Highlights: Black-Right-Pointing-Pointer In 293T cells, p53 is considered to be inactive due to its interaction with the large T-antigen. Black-Right-Pointing-Pointer Acetylation of p53 at lysine 382 is important for its functional activation. Black-Right-Pointing-Pointer First evidence to document the presence of a functional p53 in 293T cells. Black-Right-Pointing-Pointer Inhibition of NAMPT/SIRT pathway by FK866 in 293T cells increases the functional activity of p53. Black-Right-Pointing-Pointer This activation of p53 involves reversible acetylation of p53 at lysine 382. -- Abstract: Inactivation of p53 protein by endogenous and exogenous carcinogens is involved in the pathogenesis of different human malignancies. In cancer associated with SV-40more » DNA tumor virus, p53 is considered to be non-functional mainly due to its interaction with the large T-antigen. Using the 293T cell line (HEK293 cells transformed with large T antigen) as a model, we provide evidence that p53 is one of the critical downstream targets involved in FK866-mediated killing of 293T cells. A reduced rate of apoptosis and an increased number of cells in S-phase was accompanied after knockdown of p53 in these cells. Inhibition of NAMPT by FK866, or inhibition of SIRT by nicotinamide decreased proliferation and triggered death of 293T cells involving the p53 acetylation pathway. Additionally, knockdown of p53 attenuated the effect of FK866 on cell proliferation, apoptosis, and cell cycle arrest. The data presented here shed light on two important facts: (1) that p53 in 293T cells is active in the presence of FK866, an inhibitor of NAMPT pathway; (2) the apoptosis induced by FK866 in 293T cells is associated with increased acetylation of p53 at Lys382, which is required for the functional activity of p53.« less

Targeting p53 via JNK Pathway: A Novel Role of RITA for Apoptotic Signaling in Multiple Myeloma

PubMed Central

Saha, Manujendra N.; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D.; Qiu, Lugui; Chang, Hong

2012-01-01

The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM. PMID:22276160

Distinguishing Low-Risk Luminal A Breast Cancer Subtypes with Ki-67 and p53 Is More Predictive of Long-Term Survival.

PubMed

Lee, Se Kyung; Bae, Soo Youn; Lee, Jun Ho; Lee, Hyun-Chul; Yi, Hawoo; Kil, Won Ho; Lee, Jeong Eon; Kim, Seok Won; Nam, Seok Jin

2015-01-01

Overexpression of p53 is the most frequent genetic alteration in breast cancer. Recently, many studies have shown that the expression of mutant p53 differs for each subtype of breast cancer and is associated with different prognoses. In this study, we aimed to determine the suitable cut-off value to predict the clinical outcome of p53 overexpression and its usefulness as a prognostic factor in each subtype of breast cancer, especially in luminal A breast cancer. Approval was granted by the Institutional Review Board of Samsung Medical Center. We analyzed a total of 7,739 patients who were surgically treated for invasive breast cancer at Samsung Medical Center between Dec 1995 and Apr 2013. Luminal A subtype was defined as ER&PR + and HER2- and was further subclassified according to Ki-67 and p53 expression as follows: luminal A (Ki-67-,p53-), luminal A (Ki-67+, p53-), luminal A (Ki-67 -, p53+) and luminal A (Ki-67+, p53+). Low-risk luminal A subtype was defined as negative for both Ki-67 and p53 (luminal A [ki-67-, p53-]), and others subtypes were considered to be high-risk luminal A breast cancer. A cut-off value of 10% for p53 was a good predictor of clinical outcome in all patients and luminal A breast cancer patients. The prognostic role of p53 overexpression for OS and DFS was only significant in luminal A subtype. The combination of p53 and Ki-67 has been shown to have the best predictive power as calculated by the area under curve (AUC), especially for long-term overall survival. In this study, we have shown that overexpression of p53 and Ki-67 could be used to discriminate low-risk luminal A subtype in breast cancer. Therefore, using the combination of p53 and Ki-67 expression in discriminating low-risk luminal A breast cancer may improve the prognostic power and provide the greatest clinical utility.

Glucose tolerance: hypothesis testing on Malaysian diabetic community.

PubMed

Gillani, Syed Wasif; Sari, Yelly Oktavia; Sulaiman, Syed Azhar Syed; Baig, Mirza R

2014-01-01

Our study objective was to evaluate glucose tolerance and effecting factors among diabetes patients' with home care program (PHCP) in Malaysian community. A 24-week longitudinal quasi-experimental -single blind - pre/post-test study design was used to assess the effectiveness of a diabetes education program to enhance self-care practices. An attrition rate of 25% implied longitudinal design of the study in the calculation of sample size. Hence the sample size of the study was 106 subjects (53 cases and 53 focus group). The level of significance was set at 0.05. Ethical clearance had been made prior to conducting this study. Of the 109 subjects who met the study-entry criteria, 3 subjects declined to participate due to lack of time and interest. No significant parameters were revealed in the demographic and clinical characteristics of participants who completed the study. Focus group showed significant reduction in HbA1c value with mean 1.1% as compared to cases with a mean 0.06%. Similarly, hypothesis on self-care management suggest significantly improved practices among focus group [M=2.94, SD=2.25] for case group M=0.47, SD=1.36; t[127.64]=-8.23, p≤0.001] with moderate effect size [eta squared=0.06]. Total physical activity was defined as the combination of non-leisure and leisure activities. There was a statistically significant difference for increase in total physical levels between the focus [M=14.01, SD=6.41] and case groups [13.21, SD=5.22; t[148.04]=-3.15, p=0.002] with no difference in the non-leisure activity [p=0.43]. As for the case group, there was no significant difference in SMBG practices from baseline [M=0.70, SD=1.35] to follow-up [M=0.47, SD=1.36, t[72]=0.97, P=0.34] and no relationship was found between the number of blood glucose tests done with demographic or clinical variables. This study offered improved self-care practices and physical activity after PHCP but with problematic dietary care. This might be due to social and cultural habits among Malaysian population.

Simulation-Based Validation of the p53 Transcriptional Activity with Hybrid Functional Petri Net.

PubMed

Doi, Atsushi; Nagasaki, Masao; Matsuno, Hiroshi; Miyano, Satoru

2011-01-01

MDM2 and p19ARF are essential proteins in cancer pathways forming a complex with protein p53 to control the transcriptional activity of protein p53. It is confirmed that protein p53 loses its transcriptional activity by forming the functional dimer with protein MDM2. However, it is still unclear that protein p53 keeps its transcriptional activity when it forms the trimer with proteins MDM2 and p19ARF. We have observed mutual behaviors among genes p53, MDM2, p19ARF and their products on a computational model with hybrid functional Petri net (HFPN) which is constructed based on information described in the literature. The simulation results suggested that protein p53 should have the transcriptional activity in the forms of the trimer of proteins p53, MDM2, and p19ARF. This paper also discusses the advantages of HFPN based modeling method in terms of pathway description for simulations.

DIBENZO[A,L]PYRENE INDUCTION OF ERYTHROCYTE MICRONUCLEI IN A/J AND P53-DEFICIENT MICE

EPA Science Inventory

DIBENZO[a,l]PYRENE INDUCTION OF ERYTHROCYTE MICRONUCLEI IN AlJ AND P53-DEFICIENT MICE

Male A/J and C57Bl/6 background p53+/+, p53+/- and p53-/- mice were treated with dibenzo[a,l]pyrene (DB[a,l]P), and micronucleus (MN) frequencies were measured in erythrocytes from bone ...

The metallothionein gene from the white shrimp Litopenaeus vannamei: characterization and expression in response to hypoxia.

PubMed

Felix-Portillo, Monserrath; Martinez-Quintana, José A; Peregrino-Uriarte, Alma B; Yepiz-Plascencia, Gloria

2014-10-01

Aquatic animals encounter variation in oxygen tension that leads to the accumulation of reactive oxygen species (ROS) that can harm the organisms. Under these circumstances some organisms have evolved to tolerate hypoxia. In mammals, metallothioneins (MTs) protect against hypoxia-generated ROS. Here we report the MT gene from the shrimp Litopenaeus vannamei (LvMT). LvMT is differentially expressed in hemocytes, intestine, gills, pleopods, heart, hepatopancreas and muscle, with the highest levels in hepatopancreas and heart. LvMT mRNA increases during hypoxia in hepatopancreas and gills after 3 h at 1.5 mg L(-1) dissolved oxygen (DO). This gene structure resembles the homologs from invertebrates and vertebrates possessing three exons, two introns and response elements for metal response transcription factor 1 (MTF-1), hypoxia-inducible factor 1 (HIF-1) and p53 in the promoter region. During hypoxia, HIF-1/MTF-1 might participate inducing MT to contribute towards the tolerance to ROS toxicity. MT importance in aquatic organisms may include also ROS-detoxifying processes. Copyright © 2014 Elsevier Ltd. All rights reserved.

Relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation in chronic lymphocytic leukemia.

PubMed

Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R

2002-08-15

Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.

Inhibition of Mdm2 Sensitizes Human Retinal Pigment Epithelial Cells to Apoptosis

PubMed Central

Ray, Ramesh M.; Chaum, Edward; Johnson, Dianna A.; Johnson, Leonard R.

2011-01-01

Purpose. Because recent studies indicate that blocking the interaction between p53 and Mdm2 results in the nongenotoxic activation of p53, the authors sought to investigate whether the inhibition of p53-Mdm2 binding activates p53 and sensitizes human retinal epithelial cells to apoptosis. Methods. Apoptosis was evaluated by the activation of caspases and DNA fragmentation assays. The Mdm2 antagonist Nutlin-3 was used to dissociate p53 from Mdm2 and, thus, to increase p53 activity. Knockdown of p53 expression was accomplished by using p53 siRNA. Results. ARPE-19 and primary RPE cells expressed high levels of the antiapoptotic proteins Bcl-2 and Bcl-xL. Exposure of these cells to camptothecin (CPT) or TNF-α/ cycloheximide (CHX) failed to induce apoptosis. In contrast, treatment with the Mdm2 antagonist Nutlin-3 in the absence of CPT or TNF-α/CHX increased apoptosis. Activation of p53 in response to Nutlin-3 also increased levels of Noxa, p53-upregulated modulator of apoptosis (PUMA), and Siva-1, decreased expression of Bcl-2 and Bcl-xL, and simultaneously increased caspases-9 and -3 activities and DNA fragmentation. Knockdown of p53 decreased the basal expression of p21Cip1 and Bcl-2, inhibited the Nutlin-3–induced upregulation of Siva-1 and PUMA expression, and consequently inhibited caspase-3 activation. Conclusions. These results indicate that the normally available pool of intracellular p53 is predominantly engaged in the regulation of cell cycle checkpoints by p21Cip1 and does not trigger apoptosis in response to DNA-damaging agents. However, the blockage of p53 binding to Mdm2 frees a pool of p53 that is sufficient, even in the absence of DNA-damaging agents, to increase the expression of proapoptotic targets and to override the resistance of RPE cells to apoptosis. PMID:21345989

Human T-cell leukemia virus type-1-encoded protein HBZ represses p53 function by inhibiting the acetyltransferase activity of p300/CBP and HBO1

PubMed Central

Hoang, Kimson; Ankney, John A.; Nguyen, Stephanie T.; Rushing, Amanda W.; Polakowski, Nicholas; Miotto, Benoit; Lemasson, Isabelle

2016-01-01

Adult T-cell leukemia (ATL) is an often fatal malignancy caused by infection with the complex retrovirus, human T-cell Leukemia Virus, type 1 (HTLV-1). In ATL patient samples, the tumor suppressor, p53, is infrequently mutated; however, it has been shown to be inactivated by the viral protein, Tax. Here, we show that another HTLV-1 protein, HBZ, represses p53 activity. In HCT116 p53+/+ cells treated with the DNA-damaging agent, etoposide, HBZ reduced p53-mediated activation of p21/CDKN1A and GADD45A expression, which was associated with a delay in G2 phase-arrest. These effects were attributed to direct inhibition of the histone acetyltransferase (HAT) activity of p300/CBP by HBZ, causing a reduction in p53 acetylation, which has be linked to decreased p53 activity. In addition, HBZ bound to, and inhibited the HAT activity of HBO1. Although HBO1 did not acetylate p53, it acted as a coactivator for p53 at the p21/CDKN1A promoter. Therefore, through interactions with two separate HAT proteins, HBZ impairs the ability of p53 to activate transcription. This mechanism may explain how p53 activity is restricted in ATL cells that do not express Tax due to modifications of the HTLV-1 provirus, which accounts for a majority of patient samples. PMID:26625199

Surgery for lung cancer: age alone is not a contraindication.

PubMed

Jack, C I; Lye, M; Lesley, F; Wilson, G; Donnelly, R J; Hind, C R

1997-10-01

A retrospective analysis of the clinical features, operative procedures, postoperative complications and subsequent survival of 70 (50 male) elderly patients undergoing surgery for lung cancer compared with 74 (53 male) younger patients treated at the same hospital during the same period was performed, to determine if elderly people with lung cancer are less likely to benefit from and/or tolerate surgery. The elderly group had to wait longer for operation (p = 0.001) and were more likely to have pre-existing disease (p = 0.019). In contrast, they had fewer recognised postoperative complications (p = 0.032) and there was no difference between the two groups in perioperative mortality and subsequent survival. Surgical treatment of localised lung cancer represents the best chance for cure and this study suggests that age should not be a consideration in the decision to operate or not. The patient's general state of health should be assessed and management decisions based on individual status rather than on age.

pH Tolerance in Freshwater Bacterioplankton: Trait Variation of the Community as Measured by Leucine Incorporation

PubMed Central

Kritzberg, Emma

2015-01-01

pH is an important factor determining bacterial community composition in soil and water. We have directly determined the community tolerance (trait variation) to pH in communities from 22 lakes and streams ranging in pH from 4 to 9 using a growth-based method not relying on distinguishing between individual populations. The pH in the water samples was altered to up to 16 pH values, covering in situ pH ± 2.5 U, and the tolerance was assessed by measuring bacterial growth (Leu incorporation) instantaneously after pH adjustment. The resulting unimodal response curves, reflecting community tolerance to pH, were well modeled with a double logistic equation (mean R2 = 0.97). The optimal pH for growth (pHopt) among the bacterial communities was closely correlated with in situ pH, with a slope (0.89 ± 0.099) close to unity. The pH interval, in which growth was ≥90% of that at pHopt, was 1.1 to 3 pH units wide (mean 2.0 pH units). Tolerance response curves of communities originating from circum-neutral pH were symmetrical, whereas in high-pH (8.9) and especially in low-pH (<5.5) waters, asymmetric tolerance curves were found. In low-pH waters, decreasing pH was more detrimental for bacterial growth than increasing pH, with a tendency for the opposite for high-pH waters. A pH tolerance index, using the ratio of growth at only two pH values (pH 4 and 8), was closely related to pHopt (R2 = 0.83), allowing for easy determination of pH tolerance during rapid changes in pH. PMID:26276108

Phosphorylation of p53 modifies sensitivity to ionizing radiation.

PubMed

Okaichi, Kumio; Nose, Kanako; Kotake, Takako; Izumi, Nanaka; Kudo, Takashi

2011-06-01

Phosphorylation is an important modification involved in the control of p53 activity. We examined the relationship between p53 phosphorylation and cell radiosensitivity. We prepared H1299 cells (p53-null) with various mutations of p53 at three sites (serine 15, 20 and 46) and examined the radiosensitivity of the cells. In three mutant forms of p53--S15A, S20A and S46A--serine was converted to alanine at these sites to prevent phosphorylation, and in two other mutant forms, S15D and S20D, serine was converted to aspartic acid to mimic phosphorylation. H1299 cells were more radioresistant than cells with wild-type p53. Cells with the S15A and S46A mutant forms of p53 were radiosensitive, whereas those with the S15D, S20A and S20D forms showed medium radiosensitivity. Thus the sensitivity of cells to ionizing radiation varies according to the site of phosphorylation of p53.

A Polymorphic p53 Response Element in KIT Ligand Influences Cancer Risk and Has Undergone Natural Selection

PubMed Central

Zeron-Medina, Jorge; Wang, Xuting; Repapi, Emmanouela; Campbell, Michelle R.; Su, Dan; Castro-Giner, Francesc; Davies, Benjamin; Peterse, Elisabeth F.P.; Sacilotto, Natalia; Walker, Graeme J.; Terzian, Tamara; Tomlinson, Ian P.; Box, Neil F.; Meinshausen, Nicolai; De Val, Sarah; Bell, Douglas A.; Bond, Gareth L.

2014-01-01

SUMMARY The ability of p53 to regulate transcription is crucial for tumor suppression and implies that inherited polymorphisms in functional p53-binding sites could influence cancer. Here, we identify a polymorphic p53 responsive element and demonstrate its influence on cancer risk using genome-wide data sets of cancer susceptibility loci, genetic variation, p53 occupancy, and p53-binding sites. We uncover a single-nucleotide polymorphism (SNP) in a functional p53-binding site and establish its influence on the ability of p53 to bind to and regulate transcription of the KITLG gene. The SNP resides in KITLG and associates with one of the largest risks identified among cancer genome-wide association studies. We establish that the SNP has undergone positive selection throughout evolution, signifying a selective benefit, but go on to show that similar SNPs are rare in the genome due to negative selection, indicating that polymorphisms in p53-binding sites are primarily detrimental to humans. PMID:24120139

p53 downregulates the Fanconi anaemia DNA repair pathway

PubMed Central

Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

2016-01-01

Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104

p53 downregulates the Fanconi anaemia DNA repair pathway.

PubMed

Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

2016-04-01

Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential

PubMed Central

Arsic, Nikola; Gadea, Gilles; Lagerqvist, E. Louise; Busson, Muriel; Cahuzac, Nathalie; Brock, Carsten; Hollande, Frederic; Gire, Veronique; Pannequin, Julie; Roux, Pierre

2015-01-01

Summary Cancer stem cells (CSC) are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform. PMID:25754205

Downregulation of VRK1 by p53 in Response to DNA Damage Is Mediated by the Autophagic Pathway

PubMed Central

Valbuena, Alberto; Castro-Obregón, Susana; Lazo, Pedro A.

2011-01-01

Human VRK1 induces a stabilization and accumulation of p53 by specific phosphorylation in Thr18. This p53 accumulation is reversed by its downregulation mediated by Hdm2, requiring a dephosphorylated p53 and therefore also needs the removal of VRK1 as stabilizer. This process requires export of VRK1 to the cytosol and is inhibited by leptomycin B. We have identified that downregulation of VRK1 protein levels requires DRAM expression, a p53-induced gene. DRAM is located in the endosomal-lysosomal compartment. Induction of DNA damage by UV, IR, etoposide and doxorubicin stabilizes p53 and induces DRAM expression, followed by VRK1 downregulation and a reduction in p53 Thr18 phosphorylation. DRAM expression is induced by wild-type p53, but not by common human p53 mutants, R175H, R248W and R273H. Overexpression of DRAM induces VRK1 downregulation and the opposite effect was observed by its knockdown. LC3 and p62 were also downregulated, like VRK1, in response to UV-induced DNA damage. The implication of the autophagic pathway was confirmed by its requirement for Beclin1. We propose a model with a double regulatory loop in response to DNA damage, the accumulated p53 is removed by induction of Hdm2 and degradation in the proteasome, and the p53-stabilizer VRK1 is eliminated by the induction of DRAM that leads to its lysosomal degradation in the autophagic pathway, and thus permitting p53 degradation by Hdm2. This VRK1 downregulation is necessary to modulate the block in cell cycle progression induced by p53 as part of its DNA damage response. PMID:21386980

Initiation of autoimmunity to the p53 tumor suppressor protein by complexes of p53 and SV40 large T antigen

PubMed Central

1994-01-01

Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have implications for understanding the pathogenesis of ANAs in SLE. In particular, our results imply that autoimmunity can be initiated by a "hit and run" mechanism in which the binding of a viral antigen to a self protein triggers an immune response that subsequently can be perpetuated by self antigen. PMID:8145041

Metabolic responses with endothelin antagonism in a model of insulin resistance.

PubMed

Berthiaume, Nathalie; Wessale, Jerry L; Opgenorth, Terry J; Zinker, Bradley A

2005-06-01

Atrasentan, an endothelin antagonist, would have beneficial effects on metabolic responses in a model of insulin resistance. Zucker lean or fatty rats were maintained either on regular (lean and fatty control, n = 12) or atrasentan-treated water (5 mg/kg/d, fatty atrasentan, n = 13) for 6 weeks. There was no significant difference in water intake and body weight with the atrasentan-treated group compared with fatty controls. Although atrasentan had no effect on 3-hour fasting glucose levels, it reduced fasting insulin levels between weeks 2 and 4 of treatment by 53% (fatty control vs fatty atrasentan, P < .01). Atrasentan decreased the incremental area under the plasma glucose response curve ( Delta AUC) after a nutritionally complete meal tolerance test (MTT), by 28% in the atrasentan-treated group compared with fatty controls ( P < .05), and decreased the MTT-induced insulin Delta AUC by 63% in treated animals compared with the fatty control group ( P < .01). In addition, atrasentan significantly decreased the MTT-induced glucose-insulin index Delta AUC by 58% in treated rats compared with fatty controls ( P < .01). In summary, in the Zucker fatty rat, atrasentan significantly reduces (1) 3-hour fasting insulin levels at 4 weeks, (2) glucose and insulin MTT-induced Delta AUCs, and (3) the MTT-induced glucose-insulin index Delta AUC. These results demonstrate an improvement in hyperinsulinemia as well as in glucose tolerance and insulin sensitivity with chronic endothelin antagonism in a model of insulin resistance and suggest that chronic endothelin antagonism may have benefits in the treatment of insulin resistance and/or diabetes.

Suppression of gain-of-function mutant p53 with metabolic inhibitors reduces tumor growth in vivo

PubMed Central

Jung, Chae Lim; Mun, Hyemin; Jo, Se-Young; Oh, Ju-Hee; Lee, ChuHee; Choi, Eun-Kyung; Jang, Se Jin; Suh, Young-Ah

2016-01-01

Mutation of p53 occasionally results in a gain of function, which promotes tumor growth. We asked whether destabilizing the gain-of-function protein would kill tumor cells. Downregulation of the gene reduced cell proliferation in p53-mutant cells, but not in p53-null cells, indicating that the former depended on the mutant protein for survival. Moreover, phenformin and 2-deoxyglucose suppressed cell growth and simultaneously destabilized mutant p53. The AMPK pathway, MAPK pathway, chaperone proteins and ubiquitination all contributed to this process. Interestingly, phenformin and 2-deoxyglucose also reduced tumor growth in syngeneic mice harboring the p53 mutation. Thus, destabilizing mutant p53 protein in order to kill cells exhibiting “oncogene addiction” could be a promising strategy for combatting p53 mutant tumors. PMID:27765910

Suppression of gain-of-function mutant p53 with metabolic inhibitors reduces tumor growth in vivo.

PubMed

Jung, Chae Lim; Mun, Hyemin; Jo, Se-Young; Oh, Ju-Hee; Lee, ChuHee; Choi, Eun-Kyung; Jang, Se Jin; Suh, Young-Ah

2016-11-22

Mutation of p53 occasionally results in a gain of function, which promotes tumor growth. We asked whether destabilizing the gain-of-function protein would kill tumor cells. Downregulation of the gene reduced cell proliferation in p53-mutant cells, but not in p53-null cells, indicating that the former depended on the mutant protein for survival. Moreover, phenformin and 2-deoxyglucose suppressed cell growth and simultaneously destabilized mutant p53. The AMPK pathway, MAPK pathway, chaperone proteins and ubiquitination all contributed to this process. Interestingly, phenformin and 2-deoxyglucose also reduced tumor growth in syngeneic mice harboring the p53 mutation. Thus, destabilizing mutant p53 protein in order to kill cells exhibiting "oncogene addiction" could be a promising strategy for combatting p53 mutant tumors.

PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage

PubMed Central

Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

2012-01-01

p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments. PMID:23235459

PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

PubMed

Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

2012-12-13

p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

Involvement of stromal p53 in tumor-stroma interactions

PubMed Central

Bar, Jair; Moskovits, Neta; Oren, Moshe

2009-01-01

p53 is a major tumor-suppressor gene, inactivated by mutations in about half of all human cancer cases, and probably incapacitated by other means in most other cases. Most research regarding the role of p53 in cancer has focused on its ability to elicit apoptosis or growth arrest of cells that are prone to become malignant owing to DNA damage or oncogene activation, i.e. cell-autonomous activities of p53. However, p53 activation within a cell can also exert a variety of effects upon neighboring cells, through secreted factors and paracrine and endocrine mechanisms. Of note, p53 within cancer stromal cells can inhibit tumor growth and malignant progression. Cancer cells that evolve under this inhibitory influence acquire mechanisms to silence stromal p53, either by direct inhibition of p53 within stromal cells, or through pressure for selection of stromal cells with compromised p53 function. Hence, activation of stromal p53 by chemotherapy or radiotherapy might be part of the mechanisms by which these treatments cause cancer regression. However, in certain circumstances, activation of stromal p53 by cytotoxic anti-cancer agents might actually promote treatment resistance, probably through stromal p53-mediated growth arrest of the cancer cells or through protection of the tumor vasculature. Better understanding of the underlying molecular mechanisms is thus required. Hopefully, this will allow their manipulation towards better inhibition of cancer initiation, progression and metastasis. PMID:19914385

p53 isoform Δ133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming.

PubMed

Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun

2016-11-22

Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.

Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma initiation and maintenance

PubMed Central

Walia, Mannu K; Ho, Patricia MW; Taylor, Scott; Ng, Alvin JM; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew CW; Martin, T John; Walkley, Carl R

2016-01-01

Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS. DOI: http://dx.doi.org/10.7554/eLife.13446.001 PMID:27070462

Thymidilate synthase and p53 primary tumour expression as predictive factors for advanced colorectal cancer patients.

PubMed

Paradiso, A; Simone, G; Petroni, S; Leone, B; Vallejo, C; Lacava, J; Romero, A; Machiavelli, M; De Lena, M; Allegra, C J; Johnston, P G

2000-02-01

The purpose of this work was to analyse the ability of p53 and thymidilate synthase (TS) primary tumour expression to retrospectively predict clinical response to chemotherapy and long-term prognosis in patients with advanced colorectal cancers homogeneously treated by methotrexate (MTX)-modulated-5-fluorouracil (5-FU-FA). A total of 108 advanced colorectal cancer patients entered the present retrospective study. Immunohistochemical p53 (pAb 1801 mAb) and TS (TS106 mAb) expression on formalin-fixed paraffin-embedded primary tumour specimens was related to probability of clinical response to chemotherapy, time to progression and overall survival. p53 was expressed in 53/108 (49%) tumours, while 54/108 (50%) showed TS immunostaining. No relationship was demonstrated between p53 positivity and clinical response to chemotherapy (objective response (OR): 20% vs 23%, in p53+ and p53- cases respectively) or overall survival. Percent of OR was significantly higher in TS-negative with respect to TS-positive tumours (30% vs 15% respectively; P < 0.04); simultaneous analysis of TS and p53 indicated 7% OR for p53-positive/TS-positive tumours vs 46% for p53-positive/TS-negative tumours (P < 0.03). Logistic regression analysis confirmed a significant association between TS tumour status and clinical response to chemotherapy (hazard ratio (HR): 2.91; 95% confidence interval (CI) 8.34-1.01; two-sided P < 0.05). A multivariate analysis of overall survival showed that only a small number of metastatic sites was statistically relevant (HR 1.89; 95% CI 2.85-1.26; two-sided P < 0.03). Our study suggests that immunohistochemical expression of p53 and TS could assist the clinician in predicting response of colorectal cancer patients to modulated MTX-5-FU therapy.

Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

PubMed

Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

2015-10-01

The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

Main and interactive effects of a nonclinical panic attack history and distress tolerance in relation to PTSD symptom severity.

PubMed

Marshall-Berenz, Erin C; Vujanovic, Anka A; Zvolensky, Michael J

2011-03-01

The current study investigated the main and interactive effects of a nonclinical panic attack history and distress tolerance in relation to PTSD symptoms. The sample consisted of 91 adults (62.6% women; M(age)=23.45, SD=9.56) who met DSM-IV criteria for trauma exposure, 53.8% of whom met criteria for a recent (past 2 years) history of nonclinical panic attacks. Results indicated that distress tolerance, as measured by the Distress Tolerance Scale (Simons & Gaher, 2005), was significantly related to all PTSD symptom clusters, and a nonclinical panic attack history was significantly related to PTSD re-experiencing and hyperarousal symptoms. The interaction of a nonclinical panic attack history and distress tolerance significantly predicted unique variance in only PTSD hyperarousal symptoms. Implications and future directions are discussed for the role of nonclinical panic attacks and distress tolerance in PTSD symptom expression. Copyright © 2010 Elsevier Ltd. All rights reserved.

Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.

PubMed

Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen

2017-10-15

Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and DNA damage-mediated cellular stresses. This seems to be the first report that p53 activates a viral oncogene; therefore, the discovery would be interesting to a broad readership from the fields of oncology to virology. Copyright © 2017 American Society for Microbiology.

Mutant human tumor suppressor p53 modulates the activation of mitogen-activated protein kinase and nuclear factor-kappaB, but not c-Jun N-terminal kinase and activated protein-1.

PubMed

Gulati, Anthony P; Yang, Yang-Ming; Harter, David; Mukhopadhyay, Asok; Aggarwal, Bharat B; Aggarwal, Bharat A; Benzil, Deborah L; Whysner, John; Albino, Anthony P; Murali, Raj; Jhanwar-Uniyal, Meena

2006-01-01

The roles of the mitogen-activated kinase protein (MAPK) pathway, nuclear factor-kappa B (NF-kappaB), and activator protein-1 (AP-1) in cellular responses to growth factors and mitogen are well established. However, the manner by which these proliferative pathways are affected by the tumor suppressor protein p53 is not fully understood. We report here the results of an investigation of the status of p53 on two human melanoma cell lines with wild-type p53 (SK-Mel-186) or mutant p53 (SK-Mel-110). The basal levels of the activated extracellular-signal regulated kinases 1 and 2 (ERK1/2) were high in cells with wild-type p53, but low in cells with mutant p53. The 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced activation of ERK1/2 through the phosphorylation of threonine and tyrosine at 202 and 204, respectively, was demonstrated in both cell lines, however, in a discrete manner. TPA-induced activation of ERK1/2 was sustained in wild-type p53 cells, while only a transient activation was seen in mutant p53 cells. Inhibition of MAPK kinase (MEK), an upstream kinase, by U0126, blocked TPA-induced activation of ERK1/2 in wild-type p53 cells and in mutant p53 cells. Treatment of wild-type p53 (SK-Mel 186) cells with small interfering RNA (siRNA) of p53 displayed a transient induction of activation of ERK1/2 following TPA treatment, indicating that p53 has a role in the regulation of the activation of ERK1/2. NF-kappaB activity decreased significantly in cells with wild-type p53, while enhanced NF-kappaB activity was evident in cells with mutant p53. The expression of either wild-type or mutant p53 had a similar effect on TPA-induced Jun N-terminal kinase (JNK) activation, indicating specificity for the ERK pathway. Similarly, AP-1 binding activity showed a transient variation in both cell lines after TPA treatment but with different kinetics. These observations suggest that both wild-type and mutant p53 can modulate the activation pathways for ERK1/2, and NF-kappaB distinctively, while modulating the pathways of JNK and AP-1 similarly. These differences may influence cellular processes such as proliferation, differentiation, and apoptosis. 2005 Wiley-Liss, Inc.

Oncogenic c-Myc-induced lymphomagenesis is inhibited non-redundantly by the p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways

PubMed Central

Meng, X; Carlson, NR; Dong, J; Zhang, Y

2016-01-01

The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly similar paces with median survival around 10 and 11 weeks, respectively, compared to 20 weeks for Eμ-myc transgenic mice. Because p19Arf can inhibit ribosomal biogenesis through its interaction with nucleophosmin (NPM/B23), RNA helicase DDX5 and RNA polymerase I transcription termination factor (TTF-I), it has been speculated that the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 pathways might be a single p19Arf–RP–Mdm2–p53 pathway, in which p19Arf activates p53 by inhibiting RP biosynthesis; thus, p19Arf deletion or Mdm2C305F mutation would result in similar consequences. Here, we generated mice with concurrent p19Arf deletion and Mdm2C305F mutation and investigated the compound mice for tumorigenesis in the absence and the presence of oncogenic c-Myc overexpression. In the absence of Eμ-myc transgene, the Mdm2C305F mutation did not elicit spontaneous tumors in mice, nor did it accelerate spontaneous tumors in mice with p19Arf deletion. In the presence of Eμ-myc transgene, however, Mdm2C305F mutation significantly accelerated p19Arf deletion-induced lymphomagenesis and promoted rapid metastasis. We found that when p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways are independently disrupted, oncogenic c-Myc-induced p53 stabilization and activation is only partially attenuated. When both pathways are concurrently disrupted, however, c-Myc-induced p53 stabilization and activation are essentially obliterated. Thus, the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 are non-redundant pathways possessing similar capabilities to activate p53 upon c-Myc overexpression. PMID:25823025

Residues in the alternative reading frame tumor suppressor that influence its stability and p53-independent activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tommaso, Anne di; Hagen, Jussara; Tompkins, Van

2009-04-15

The Alternative Reading Frame (ARF) protein suppresses tumorigenesis through p53-dependent and p53-independent pathways. Most of ARF's anti-proliferative activity is conferred by sequences in its first exon. Previous work showed specific amino acid changes occurred in that region during primate evolution, so we programmed those changes into human p14ARF to assay their functional impact. Two human p14ARF residues (Ala{sup 14} and Thr{sup 31}) were found to destabilize the protein while two others (Val{sup 24} and Ala{sup 41}) promoted more efficient p53 stabilization and activation. Despite those effects, all modified p14ARF forms displayed robust p53-dependent anti-proliferative activity demonstrating there are no significantmore » biological differences in p53-mediated growth suppression associated with simian versus human p14ARF residues. In contrast, p53-independent p14ARF function was considerably altered by several residue changes. Val{sup 24} was required for p53-independent growth suppression whereas multiple residues (Val{sup 24}, Thr{sup 31}, Ala{sup 41} and His{sup 60}) enabled p14ARF to block or reverse the inherent chromosomal instability of p53-null MEFs. Together, these data pinpoint specific residues outside of established p14ARF functional domains that influence its expression and signaling activities. Most intriguingly, this work reveals a novel and direct role for p14ARF in the p53-independent maintenance of genomic stability.« less

10 years of prophylaxis with nebulized liposomal amphotericin B and the changing epidemiology of Aspergillus spp. infection in lung transplantation.

PubMed

Peghin, Maddalena; Monforte, Victor; Martin-Gomez, Maria-Teresa; Ruiz-Camps, Isabel; Berastegui, Cristina; Saez, Berta; Riera, Jordi; Ussetti, Piedad; Solé, Juan; Gavaldá, Joan; Roman, Antonio

2016-01-01

The aim of this study was to assess the outcome and tolerability of prophylactic nebulized liposomal amphotericin B (n-LAB) in lung transplant recipients (LTR) and the changing epidemiology of Aspergillus spp. infection and colonization. We performed an observational study including consecutive LTR recipients (2003-2013) undergoing n-LAB prophylaxis lifetime. A total of 412 patients were included (mean postoperative follow-up 2.56 years; IQR 1.01-4.65). Fifty-three (12.8%) patients developed 59 Aspergillus spp. infections, and 22 invasive aspergillosis (overall incidence 5.3%). Since 2009, person-time incidence rates of Aspergillus spp. colonization and infection decreased (2003-2008, 0.19; 2009-2014, 0.09; P = 0.0007), but species with reduced susceptibility or resistance to amphotericin significantly increased (2003-2008, 38.1% vs 2009-2014, 58.1%; P = 0.039). Chronic lung allograft dysfunction (CLAD) was associated with Aspergillus spp. colonization and infection (HR 24.4, 95% CI 14.28-41.97; P = 0.00). Only 2.9% of patients presented adverse effects, and 1.7% required discontinuation. Long-term administration of prophylaxis with n-LAB has proved to be tolerable and can be used for preventing Aspergillus spp. infection in LTR. Over the last years, the incidence of Aspergillus spp. colonization and infection has decreased, but species with reduced amphotericin susceptibility or resistance are emerging. CLAD is associated with Aspergillus spp. colonization and infection. © 2015 Steunstichting ESOT.

Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma.

PubMed

Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne-Marie; Brenton, James D

2016-10-01

TP53 mutations are ubiquitous in high-grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low-grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged-amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain-of-function (GOF or nonsynonymous), loss-of-function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low-grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of mutation to 96%.

Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma

PubMed Central

Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne‐Marie

2016-01-01

Abstract TP53 mutations are ubiquitous in high‐grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low‐grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged‐amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain‐of‐function (GOF or nonsynonymous), loss‐of‐function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low‐grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of mutation to 96%. PMID:27840695

Rigor of cell fate decision by variable p53 pulses and roles of cooperative gene expression by p53

PubMed Central

Murakami, Yohei; Takada, Shoji

2012-01-01

Upon DNA damage, the cell fate decision between survival and apoptosis is largely regulated by p53-related networks. Recent experiments found a series of discrete p53 pulses in individual cells, which led to the hypothesis that the cell fate decision upon DNA damage is controlled by counting the number of p53 pulses. Under this hypothesis, Sun et al. (2009) modeled the Bax activation switch in the apoptosis signal transduction pathway that can rigorously “count” the number of uniform p53 pulses. Based on experimental evidence, here we use variable p53 pulses with Sun et al.’s model to investigate how the variability in p53 pulses affects the rigor of the cell fate decision by the pulse number. Our calculations showed that the experimentally anticipated variability in the pulse sizes reduces the rigor of the cell fate decision. In addition, we tested the roles of the cooperativity in PUMA expression by p53, finding that lower cooperativity is plausible for more rigorous cell fate decision. This is because the variability in the p53 pulse height is more amplified in PUMA expressions with more cooperative cases. PMID:27857606

Crocidolite asbestos causes an induction of p53 and apoptosis in cultured A-549 lung carcinoma cells.

PubMed

Pääkkö, P; Rämet, M; Vähäkangas, K; Korpela, N; Soini, Y; Turunen, S; Jaworska, M; Gillissen, A

1998-01-01

A number of genotoxic chemicals and agents, such as benzo(a)pyrene and ultraviolet light, are able to induce nuclear accumulation of p53 protein. Usually, this response is transient and a consequence of stabilization of the wild-type p53 protein. After withdrawal of the exposure, the amount of p53 protein returns to a normal level within hours or a few days. We have studied the p53 response to the exposure of crocidolite asbestos in A-549 lung carcinoma cells using three different methods, i.e., p53 immunohistochemistry, Western blotting and metabolic labelling followed by p53 immunoprecipitation. With these techniques we demonstrate a dose-dependent p53 nuclear response to crocidolite exposure. The half-life of p53 protein in A-549 lung carcinoma cells cultured in serum-free media increased from 30 up to 80 min, and the protein reacted with a wild-type specific antibody suggesting that it was in a wild-type conformation. In situ 3'-end labelling of A-549 cells demonstrated a dose-dependent increase in apoptotic activity. Our data support the idea that increased apoptotic activity, induced by crocidolite, is mediated by p53.

Cross Talk between PML and p53 during Poliovirus Infection: Implications for Antiviral Defense

PubMed Central

Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K.

2006-01-01

PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation. PMID:16912307

Cross talk between PML and p53 during poliovirus infection: implications for antiviral defense.

PubMed

Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K

2006-09-01

PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation.

p53 sequence analysis predicts treatment response and outcome of patients with esophageal carcinoma.

PubMed

Ribeiro, U; Finkelstein, S D; Safatle-Ribeiro, A V; Landreneau, R J; Clarke, M R; Bakker, A; Swalsky, P A; Gooding, W E; Posner, M C

1998-07-01

The ability to predict biologic behavior and treatment responsiveness would be a valuable asset in the multimodality approach to esophageal carcinoma. The authors examined whether alterations of the p53 gene correlate with clinicopathologic parameters, response to preoperative chemotherapy/radiotherapy, and outcome in patients with esophageal carcinoma. METHODS. Histopathologic/genetic analysis of p53 was performed on formalin fixed, paraffin embedded tissues. Tissue sections were stained immunohistochemically for p53 protein followed by topographic genotyping comprised of polymerase chain reaction amplification and direct sequencing of p53 exons 5-8. All patients received induction chemotherapy (5-fluorouracil, cisplatin, and alpha-interferon) and concurrent external beam radiotherapy (4500 centigrays) followed by resection. p53 analysis performed on 42 tumors from patients with potentially resectable esophageal carcinoma revealed 25 of the 42 tumors (59.5%) to be p53 immunopositive; however, only 17 of the 42 tumors (40.5%) were proven to contain p53 point mutational damage in exons 8 (n=5), 5 (n=5), 7 (n=4), and 6 (n=3). Eight cases were weakly immunopositive and had no genotype mutation suggesting hyperexpression of normal wild-type p53. Genotyping also identified two immunonegative cases with deletion-type mutations (exons 5 and 6). Tissue samples collected before and after chemotherapy/radiotherapy exhibited fidelity in p53 mutational genotype in all cases. The presence of a p53 point mutation positively correlated with pTNM stage (P=0.003) and residual disease in the resected specimen (P=0.01). Moreover, survival of patients with p53 mutations was significantly lower than that of patients without mutations (overall survival of 21.6 months vs. 40 months; P=0.0038; and disease free survival of 14.1 months vs. 38 months; P=0.0004). Histopathologic/genetic analysis is a better determinant of p53 mutational damage than immunohistochemistry alone and can be used as a prognostic marker for esophageal carcinoma. p53 genotyping may define a subset of patients who respond to chemotherapy/radiotherapy and may predict who potentially benefits from multimodality therapy.

p53 elevation in human cells halt SV40 infection by inhibiting T-ag expression

PubMed Central

Drayman, Nir; Ben-nun-Shaul, Orly; Butin-Israeli, Veronika; Srivastava, Rohit; Rubinstein, Ariel M.; Mock, Caroline S.; Elyada, Ela; Ben-Neriah, Yinon; Lahav, Galit; Oppenheim, Ariella

2016-01-01

SV40 large T-antigen (T-ag) has been known for decades to inactivate the tumor suppressor p53 by sequestration and additional mechanisms. Our present study revealed that the struggle between p53 and T-ag begins very early in the infection cycle. We found that p53 is activated early after SV40 infection and defends the host against the infection. Using live cell imaging and single cell analyses we found that p53 dynamics are variable among individual cells, with only a subset of cells activating p53 immediately after SV40 infection. This cell-to-cell variabilty had clear consequences on the outcome of the infection. None of the cells with elevated p53 at the beginning of the infection proceeded to express T-ag, suggesting a p53-dependent decision between abortive and productive infection. In addition, we show that artificial elevation of p53 levels prior to the infection reduces infection efficiency, supporting a role for p53 in defending against SV40. We further found that the p53-mediated host defense mechanism against SV40 is not facilitated by apoptosis nor via interferon-stimulated genes. Instead p53 binds to the viral DNA at the T-ag promoter region, prevents its transcriptional activation by Sp1, and halts the progress of the infection. These findings shed new light on the long studied struggle between SV40 T-ag and p53, as developed during virus-host coevolution. Our studies indicate that the fate of SV40 infection is determined as soon as the viral DNA enters the nucleus, before the onset of viral gene expression. PMID:27462916

Myc, Aurora Kinase-A, and mutant p53R172H co-operate in a mouse model of metastatic skin carcinoma

PubMed Central

Torchia, Enrique C.; Caulin, Carlos; Acin, Sergio; Terzian, Tamara; Kubick, Bradley J.; Box, Neil F.; Roop, Dennis R.

2015-01-01

Clinical observations, as well as data obtained from the analysis of genetically engineered mouse models, firmly established the gain-of-function (GOF) properties of certain p53 mutations. However, little is known about the underlying mechanisms. We have used two independent microarray platforms to perform a comprehensive and global analysis of tumors arising in a model of metastatic skin cancer progression, which compares the consequences of a GOF p53R172H mutant vs. p53 deficiency. DNA profiling revealed a higher level of genomic instability in GOF vs. loss-of-function (LOF) p53 squamous cell carcinomas (SCCs). Moreover, GOF p53 SCCs showed preferential amplification of Myc with a corresponding increase in its expression and deregulation of Aurora Kinase-A. Fluorescent in situ hybridization confirmed amplification of Myc in primary GOF p53 SCCs and its retention in metastatic tumors. We also identified by RNA profiling distinct gene expression profiles in GOF p53 tumors, which included enriched integrin and Rho signaling, independent of tumor stage. Thus, the progression of GOF p53 papillomas to carcinoma was marked by the acquisition of epithelial to mesenchymal transition and metastatic signatures. In contrast, LOF p53 tumors showed enrichment of genes associated with cancer proliferation and chromosomal instability. Collectively, these observations suggest that genomic instability plays a prominent role in the early stages of GOF p53 tumor progression (i.e., papillomas), while it is implicated at a later stage in LOF p53 tumors (i.e., SCCs). This model will allow us to identify specific targets in mutant p53 SCCs, which may lead to the development of new therapeutic agents for the treatment of metastatic SCCs. PMID:21963848

The large-scale placebo-controlled beta-blocker studies in systolic heart failure revisited: results from CIBIS-II, COPERNICUS and SENIORS-SHF compared with stratified subsets from MERIT-HF.

PubMed

Wikstrand, J; Wedel, H; Castagno, D; McMurray, J J V

2014-02-01

The four pivotal beta-blocker trials in heart failure (HF) had different inclusion criteria, making comparison difficult without patient stratifying. The aim of this study was to compare, in similar patients, the effects of bisoprolol, metoprolol controlled release/extended release (CR/XL), carvedilol and nebivolol on (i) total mortality, (ii) all-cause mortality or hospitalization due to cardiovascular causes (time to first event), (iii) all-cause mortality or hospitalization because of HF and (iv) tolerability, defined as discontinuation of randomized treatment. We compared stratified (s ) subsets in MERIT-HF with patients in CIBIS-II [New York Heart Association (NYHA) class III/IV and ejection fraction (EF) ≤ 35%] and COPERNICUS (NYHA III/IV and EF <25%) and in patients with systolic HF in SENIORS-SHF (age ≥ 70 years and EF ≤ 35%). The annual mortality rates in the placebo and beta-blocker arms were: (i) CIBIS-II (n = 2647), 13.2% vs. 8.8% (relative risk reduction 34%, 95% CI: 19-46, P < 0.0001) and MERIT-HFs (n = 2002), 14.8% vs. 8.6% (relative risk reduction 42%, 95% CI: 24-56, P < 0.0001); (ii) COPERNICUS (n = 2289), 19.7% vs. 12.8% (relative risk reduction 35%, 95% CI: 19-48, P = 0.0014) and MERIT-HFs (n = 795), 19.1% vs. 11.7% (relative risk reduction 39%; 95% CI: 11-58, P = 0.0086); (iii) SENIORS-SHF (n = 1359), 11.3% vs. 9.7% (relative risk reduction 16%, NS) and MERIT-HFs (n = 985), 14.8% vs. 10.1% (relative risk reduction 32%, 95% CI: 2-53, P = 0.038). The effects on the other outcomes assessed were similar. Analyses indicated fewer discontinuations from randomized treatment on beta-blockers compared with placebo in COPERNICUS and the MERIT-HFs subsets. The efficacy and tolerability of bisoprolol, carvedilol and metoprolol CR/XL are similar in patients with systolic HF, irrespective of NYHA class or ejection fraction. Nebivolol is less effective and not better tolerated. © 2013 The Association for the Publication of the Journal of Internal Medicine.

Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

PubMed

Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

2016-04-01

P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Prognostic and predictive value of TP53 mutations in node-positive breast cancer patients treated with anthracycline- or anthracycline/taxane-based adjuvant therapy: results from the BIG 02-98 phase III trial

PubMed Central

2012-01-01

Abstract Introduction Pre-clinical data suggest p53-dependent anthracycline-induced apoptosis and p53-independent taxane activity. However, dedicated clinical research has not defined a predictive role for TP53 gene mutations. The aim of the current study was to retrospectively explore the prognosis and predictive values of TP53 somatic mutations in the BIG 02-98 randomized phase III trial in which women with node-positive breast cancer were treated with adjuvant doxorubicin-based chemotherapy with or without docetaxel. Methods The prognostic and predictive values of TP53 were analyzed in tumor samples by gene sequencing within exons 5 to 8. Patients were classified according to p53 protein status predicted from TP53 gene sequence, as wild-type (no TP53 variation or TP53 variations which are predicted not to modify p53 protein sequence) or mutant (p53 nonsynonymous mutations). Mutations were subcategorized according to missense or truncating mutations. Survival analyses were performed using the Kaplan-Meier method and log-rank test. Cox-regression analysis was used to identify independent predictors of outcome. Results TP53 gene status was determined for 18% (520 of 2887) of the women enrolled in BIG 02-98. TP53 gene variations were found in 17% (90 of 520). Nonsynonymous p53 mutations, found in 16.3% (85 of 520), were associated with older age, ductal morphology, higher grade and hormone-receptor negativity. Of the nonsynonymous mutations, 12.3% (64 of 520) were missense and 3.6% were truncating (19 of 520). Only truncating mutations showed significant independent prognostic value, with an increased recurrence risk compared to patients with non-modified p53 protein (hazard ratio = 3.21, 95% confidence interval = 1.740 to 5.935, P = 0.0002). p53 status had no significant predictive value for response to docetaxel. Conclusions p53 truncating mutations were uncommon but associated with poor prognosis. No significant predictive role for p53 status was detected. Trial registration ClinicalTrials.gov NCT00174655 PMID:22551440

Relationships between p53 mutation, HPV status and outcome in oropharyngeal squamous cell carcinoma.

PubMed

Hong, Angela; Zhang, Xiaoying; Jones, Deanna; Veillard, Anne-Sophie; Zhang, Mei; Martin, Andrew; Lyons, J Guy; Lee, C Soon; Rose, Barbara

2016-02-01

This study aimed to examine the rate and type of p53 mutation in oropharyngeal cancer (OSCC). Relationships were sought between human papillomavirus (HPV) status and p53 mutation. The role of p53 mutation as a prognostic factor independent of HPV status and as a modifier of the effect of HPV on outcomes was also examined. The HPV status of 202 cases was determined by HPV DNA by RT-PCR and p16 immunohistochemistry. P53 mutation in exon 5-8 was determined by pyrosequencing. Findings were correlated with known clinicopathological factors and outcomes. 48% of the cases were HPV positive and they were significantly less likely to have a p53 mutation than HPV-negative OSCCs (25.8% vs 46.7%, p=0.0021). Mutation was most common in exon 5. Among patients with HPV-positive OSCC, there was no significant difference in p53 mutation by smoking status (22.2% for never smokers and 30.8% for current or ex-smokers). Patients with p53 mutant OSCC had significantly worse overall survival (p=0.01). There was no statistical evidence that p53 mutation modified the effect of HPV status on outcomes. In the multivariate analysis, positive HPV status remained the strongest predictor of outcomes. p53 mutation status was not a significant predictor of outcome after adjusting for age, gender, T stage, N stage and HPV status. In summary, HPV-positive OSCC are less likely to have mutant p53 than HPV-negative OSCC. Our study did not show any evidence that p53 mutation could modify the effect of HPV status on outcomes. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

PubMed

Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

2016-07-02

Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

Stabilisation of p53 enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation.

PubMed

Pan, D; Pan, L-Z; Hill, R; Marcato, P; Shmulevitz, M; Vassilev, L T; Lee, P W K

2011-09-27

Naturally oncolytic reovirus preferentially kills cancer cells, making it a promising cancer therapeutic. Mutations in tumour suppressor p53 are prevalent in cancers, yet the role of p53 in reovirus oncolysis is relatively unexplored. Human cancer cell lines were exposed to Nutlin-3a, reovirus or a combination of the two and cells were processed for reovirus titration, western blot, real-time PCR and apoptosis assay using Annexin V and 7-AAD staining. Confocal microscopy was used to determine translocation of the NF-κB p65 subunit. We show that despite similar reovirus replication in p53(+/+) and p53(-/-) cells, stabilisation of p53 by Nutlin-3a significantly enhanced reovirus-induced apoptosis and hence virus release and dissemination while having no direct effect on virus replication. Enhanced apoptosis by Nutlin-3a was not observed in p53(-/-) or p53 knockdown cells; however, increased expression of Bax and p21 are required. Moreover, elevated NF-κB activation in reovirus-infected cells following Nutlin-3a treatment was necessary for enhanced reovirus-induced apoptosis, as synergistic cytotoxicity was overcome by specific NF-κB inhibitors. Nutlin-3a treatment enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation, and combination of reovirus and Nutlin-3a might represent an improved therapy against cancers harbouring wild-type p53.

EBNA3C regulates p53 through induction of Aurora kinase B

PubMed Central

Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.

2015-01-01

In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

Accumulation of p53 is associated with tumour progression in cutaneous lesions of renal allograft recipients.

PubMed Central

Stark, L. A.; Arends, M. J.; McLaren, K. M.; Benton, E. C.; Shahidullah, H.; Hunter, J. A.; Bird, C. C.

1994-01-01

Renal allograft recipients suffer from a markedly increased susceptibility to premalignant and malignant cutaneous lesions. Although various aetiological factors have been implicated, little is known of the associated genetic events. In this study we initially employed immunocytochemical techniques to investigate the prevalence and localisation of accumulated p53 in over 200 cutaneous biopsies (including 56 squamous cell carcinomas) from renal allograft recipients and immunocompetent controls. In renal allograft recipients accumulated p53 was present in 24% of uninvolved skin samples, 14% of viral warts, 41% of premalignant keratoses, 65% of intraepidermal carcinomas and 56% of squamous cell carcinomas [squamous cell carcinoma and intraepidermal carcinoma differed significantly from uninvolved skin (P < 0.005) and viral warts (P < 0.01)]. A similar trend was revealed in immunocompetent patients (an older, chronically sun-exposed population) but with lower prevalence of p53 immunoreactivity: 25% of uninvolved skin samples, 0% of viral warts, 25% of keratoses, 53% of intraepidermal carcinomas and 53% of squamous cell carcinomas. These differences were not statistically significant. Morphologically, p53 immunoreactivity strongly associated with areas of epidermal dysplasia and the abundance of staining correlated positively with the severity of dysplasia. These data suggest that p53 plays a role in skin carcinogenesis and is associated with progression towards the invasive state. No correlation was observed between accumulated p53 and the presence of human papillomavirus (HPV) DNA in any of the lesions. Single-strand conformational polymorphism analysis (exons 5-8) was used to determine the frequency of mutated p53 in 28 malignancies with varying degrees of immunopositivity. p53 mutations were found in 5/9 (56%) malignancies with p53 staining in > 50% of cells, reducing to 1/6 (17%) where 10-50% of cells were positively stained and none where < 10% of cells were stained. These data imply that factors other than p53 gene mutation play a part in accumulation of p53 in skin cancers. Images Figure 2 Figure 3 PMID:7917913

Identification of p53 unbound to T-antigen in human cells transformed by simian virus 40 T-antigen.

PubMed

O'Neill, F J; Hu, Y; Chen, T; Carney, H

1997-02-27

In several clones of SV40-transformed human cells, we investigated the relative amounts of large T-Antigen (T-Ag) and p53 proteins, both unbound and associated within complexes, with the goal of identifying changes associated with transformation and immortalization. Cells were transformed by wild type (wt) T-Ag, a functionally temperature sensitive T-Ag (tsA58) and other T-Ag variants. Western analysis showed that while most of the T-Ag was ultimately bound by p53, most of the p53 remained unbound to T-Ag. Unbound p53 remained in the supernatant after a T-Ag immunoprecipitation and p53 was present in two to fourfold excess of T-Ag. In one transformant there was five to tenfold more p53 than T-Ag. p53 was present in transformants in amounts at least 200-fold greater than in untransformed human cells. In wt and variant T-Ag transformants, including those generated with tsA58 T-Ag, large amounts of unbound p53 were present in both pre-crisis and immortal cells and when the cells were grown at permissive or non-permissive temperatures. We also found that in transformants produced by tsA58, an SV40/JCV chimeric T-Ag and other variants, T-Ag appeared to form a complex with p53 slowly perhaps because one or both proteins matured slowly. The presence in transformed human cells of large amounts of unbound p53 and in excess of T-Ag suggests that sequestration of p53 by T-Ag, resulting from complex formation, is required neither for morphological transformation nor immortalization of human cells. Rather, these results support the proposal that high levels of p53, the T-Ag/p53 complexes, or other biochemical event(s), lead to transformation and immortalization of human cells by T-Ag.

Adaptation of cancer cells from different entities to the MDM2 inhibitor nutlin-3 results in the emergence of p53-mutated multi-drug-resistant cancer cells

PubMed Central

Michaelis, M; Rothweiler, F; Barth, S; Cinatl, J; van Rikxoort, M; Löschmann, N; Voges, Y; Breitling, R; von Deimling, A; Rödel, F; Weber, K; Fehse, B; Mack, E; Stiewe, T; Doerr, H W; Speidel, D; Cinatl, J

2011-01-01

Six p53 wild-type cancer cell lines from infrequently p53-mutated entities (neuroblastoma, rhabdomyosarcoma, and melanoma) were continuously exposed to increasing concentrations of the murine double minute 2 inhibitor nutlin-3, resulting in the emergence of nutlin-3-resistant, p53-mutated sublines displaying a multi-drug resistance phenotype. Only 2 out of 28 sublines adapted to various cytotoxic drugs harboured p53 mutations. Nutlin-3-adapted UKF-NB-3 cells (UKF-NB-3rNutlin10 μM, harbouring a G245C mutation) were also radiation resistant. Analysis of UKF-NB-3 and UKF-NB-3rNutlin10 μM cells by RNA interference experiments and lentiviral transduction of wild-type p53 into p53-mutated UKF-NB-3rNutlin10 μM cells revealed that the loss of p53 function contributes to the multi-drug resistance of UKF-NB-3rNutlin10 μM cells. Bioinformatics PANTHER pathway analysis based on microarray measurements of mRNA abundance indicated a substantial overlap in the signalling pathways differentially regulated between UKF-NB-3rNutlin10 μM and UKF-NB-3 and between UKF-NB-3 and its cisplatin-, doxorubicin-, or vincristine-resistant sublines. Repeated nutlin-3 adaptation of neuroblastoma cells resulted in sublines harbouring various p53 mutations with high frequency. A p53 wild-type single cell-derived UKF-NB-3 clone was adapted to nutlin-3 in independent experiments. Eight out of ten resulting sublines were p53-mutated harbouring six different p53 mutations. This indicates that nutlin-3 induces de novo p53 mutations not initially present in the original cell population. Therefore, nutlin-3-treated cancer patients should be carefully monitored for the emergence of p53-mutated, multi-drug-resistant cells. PMID:22170099

Apoptotic actions of p53 require transcriptional activation of PUMA and do not involve a direct mitochondrial/cytoplasmic site of action in postnatal cortical neurons.

PubMed

Uo, Takuma; Kinoshita, Yoshito; Morrison, Richard S

2007-11-07

Recent studies in non-neuronal cells have shown that the tumor suppressor p53 can promote cell death through a transcription-independent mechanism involving its direct action with a subset of Bcl-2 family member proteins in the cytosol and at the mitochondria. In cultured cortical neurons, however, we could not find evidence supporting a significant contribution of the cytosolic/mitochondrial p53 pathway, and available evidence instead corroborated the requirement for the transcriptional activity of p53. When directly targeted to the cytosol/mitochondria, wild-type p53 lost its apoptosis-inducing activity in neurons but not in non-neuronal cells. The N-terminal p53 fragment (transactivation and proline-rich domains), which induces apoptosis in non-neuronal cells via the cytosolic/mitochondrial pathway, displayed no apoptogenic activity in neurons. In neuronal apoptosis induced by camptothecin or an MDM2 (murine double minute 2) inhibitor, nutlin-3, endogenous p53 protein did not accumulate in the cytosol/mitochondria, and transcriptional inhibition after p53 induction effectively blocked cell death. In addition, overexpression of a dominant-negative form of p53 (R273H) completely suppressed induction of proapoptotic p53 target genes and cell death. PUMA (p53-upregulated modulator of apoptosis) was one such gene induced by camptothecin, and its overexpression was sufficient to induce Bax (Bcl-2-associated X protein)-dependent neuronal death, whereas Noxa was not apoptogenic. These results collectively demonstrate that, in contrast to non-neuronal cells, the apoptotic activity of p53 in postnatal cortical neurons does not rely on its direct action at the cytosol/mitochondria but is exclusively mediated through its transcription-dependent functions. The uniqueness of p53-mediated apoptotic signaling in postnatal cortical neurons was further illustrated by the dispensable function of the proline-rich domain of p53.

p73 Protein Expression Correlates With Radiation-Induced Apoptosis in the Lack of p53 Response to Radiation Therapy for Cervical Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wakatsuki, Masaru; Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba; Ohno, Tatsuya

2008-03-15

Purpose: p73 belongs to the p53 tumor suppressor family of genes and can inhibit cell growth in a p53-like manner by inducing apoptosis or cell cycle arrest. Here, we investigated whether p73 could compensate for impaired p53 function in apoptosis induced by radiation therapy (RT) for cervical cancer. Methods and Materials: Sixty-eight patients with squamous cell carcinoma of the cervix who received definitive RT combined with (n = 37) or without (n = 31) cisplatin were investigated. Biopsy specimens were excised from the cervical tumor before RT and after 9 Gy. Results: Mean apoptosis index (AI) was 0.93% before RTmore » and 1.97% after 9 Gy with a significant increase (p < 0.001). For all patients, there was a significant correlation between p73 expression positivity after 9 Gy and AI ratio (AI after 9 Gy/AI before RT) (p = 0.021). Forty-one patients were regarded as the p53-responding group according to the expression of p53 after 9 Gy, whereas the remaining 27 patients were regarded as the p53-nonresponding group. A significant correlation between p73 expression after 9 Gy and AI ratio was observed in the p53-non-responding group (p < 0.001) but not in the p53-responding group (p = 0.940). Conclusion: Our results suggest that p73 plays an important role in compensating for the lack of p53 function in radiation-induced apoptosis of cervical cancer.« less

Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

PubMed Central

Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

2005-01-01

p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

CDIP, a novel pro-apoptotic gene, regulates TNFα-mediated apoptosis in a p53-dependent manner

PubMed Central

Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W

2007-01-01

We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-α expression tightly correlates with CDIP expression, and that inhibition of TNF-α signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-α is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-α impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 → CDIP → TNF-α apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy. PMID:17599062

Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

PubMed

Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

2015-07-16

p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

Replication of damaged DNA in vitro is blocked by p53

PubMed Central

Zhou, Jianmin; Prives, Carol

2003-01-01

The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

Transcriptional repression of epithelial cell adhesion molecule (EpCAM) contributes to p53 control of breast cancer invasion

PubMed Central

Sankpal, NV; Willman, MW; Fleming, TP; Mayfield, J; Gillanders, WE

2014-01-01

p53 is a tumor suppressor gene with well-characterized roles in cell cycle regulation, apoptosis and the maintenance of genome stability. Recent evidence suggests that p53 may also contribute to the regulation of migration and invasion. Epithelial cell adhesion molecule (EpCAM) is a transmembrane glycoprotein that is overexpressed in the majority of human epithelial carcinomas, including breast and colorectal carcinomas. We demonstrate by chromatin immunoprecipitation assays that p53 interacts with a candidate p53 binding site within the EpCAM gene. p53-mediated transcriptional repression of EpCAM was confirmed in gain-of-function, and loss-of-function experimental systems. Induction of wildtype p53 was associated with a significant dose-dependent decrease in EpCAM expression; conversely, specific ablation of p53 was associated with a significant increase in EpCAM expression. At the functional level, specific ablation of p53 expression is associated with increased breast cancer invasion, and this effect is abrogated by concomitant specific ablation of EpCAM expression. Taken together, these biochemical and functional data are the first demonstration that (1) wildtype p53 protein binds to a response element within the EpCAM gene and negatively regulates EpCAM expression, and (2) transcriptional repression of EpCAM contributes to p53 control of breast cancer invasion. PMID:19141643

Disruption of p53 function sensitizes breast cancer MCF-7 cells to cisplatin and pentoxifylline.

PubMed

Fan, S; Smith, M L; Rivet, D J; Duba, D; Zhan, Q; Kohn, K W; Fornace, A J; O'Connor, P M

1995-04-15

The possibility that appropriately designed chemotherapy could act selectively against p53-defective tumor cells was explored in MCF-7 human breast cancer cells. These cells were chosen because they have normal p53 function but are representative of a tumor cell type that does not readily undergo p53-dependent apoptosis. Two sublines (MCF-7/E6 and MCF-7/mu-p53) were established in which p53 function was disrupted by transfection with either the human papillomavirus type-16 E6 gene or a dominant-negative mutant p53 gene. p53 function in MCF-7/E6 and MCF-7/mu-p53 cells was defective relative to control cells in that there were no increases in p53 or p21Waf1/Cip1 protein levels and no G1 arrest following exposure to ionizing radiation. Survival assays showed that p53 disruption sensitized MCF-7 cells to cisplatin (CDDP) but not to several other DNA-damaging agents. CDDP sensitization was not limited to MCF-7 cells since p53 disruption in human colon carcinoma RKO cells also enhanced sensitivity to CDDP. Contrary to the other DNA-damaging agents tested, CDDP-induced DNA lesions are repaired extensively by nucleotide excision, and in agreement with a defect in this process, MCF-7/E6 and MCF-7/mu-p53 cells exhibited a reduced ability to repair a CDDP-damaged chloramphenicol acetyltransferase-reporter plasmid transfected into the cells. Therefore, we attributed the increased CDDP sensitivity of MCF-7 cells with disrupted p53 to defects in G1 checkpoint control, nucleotide excision repair, or both. The G2 checkpoint inhibitor pentoxifylline exhibited synergism with CDDP in killing MCF-7/E6 cells but did not affect sensitivity of the control cells. Moreover, pentoxifylline inhibited G2 checkpoint function to a greater extent in MCF-7/E6 than in the parental cells. These results suggested that, in the absence of p53 function, cancer cells are more vulnerable to G2 checkpoint abrogators. Our results show that a combination of CDDP and pentoxifylline is capable of synergistic and preferential killing of p53-defective tumor cells that do not readily undergo apoptosis.

Cytochrome P450 monooxygenase CYP53 family in fungi: comparative structural and evolutionary analysis and its role as a common alternative anti-fungal drug target.

PubMed

Jawallapersand, Poojah; Mashele, Samson Sitheni; Kovačič, Lidija; Stojan, Jure; Komel, Radovan; Pakala, Suresh Babu; Kraševec, Nada; Syed, Khajamohiddin

2014-01-01

Cytochrome P450 monooxygenases (CYPs/P450s) are heme-thiolate proteins whose role as a drug target against pathogenic microbes has been explored because of their stereo- and regio-specific oxidation activity. We aimed to assess the CYP53 family's role as a common alternative drug target against animal (including human) and plant pathogenic fungi and its role in fungal-mediated wood degradation. Genome-wide analysis of fungal species revealed the presence of CYP53 members in ascomycetes and basidiomycetes. Basidiomycetes had a higher number of CYP53 members in their genomes than ascomycetes. Only two CYP53 subfamilies were found in ascomycetes and six subfamilies in basidiomycetes, suggesting that during the divergence of phyla ascomycetes lost CYP53 P450s. According to phylogenetic and gene-structure analysis, enrichment of CYP53 P450s in basidiomycetes occurred due to the extensive duplication of CYP53 P450s in their genomes. Numerous amino acids (103) were found to be conserved in the ascomycetes CYP53 P450s, against only seven in basidiomycetes CYP53 P450s. 3D-modelling and active-site cavity mapping data revealed that the ascomycetes CYP53 P450s have a highly conserved protein structure whereby 78% amino acids in the active-site cavity were found to be conserved. Because of this rigid nature of ascomycetes CYP53 P450s' active site cavity, any inhibitor directed against this P450 family can serve as a common anti-fungal drug target, particularly toward pathogenic ascomycetes. The dynamic nature of basidiomycetes CYP53 P450s at a gene and protein level indicates that these P450s are destined to acquire novel functions. Functional analysis of CYP53 P450s strongly supported our hypothesis that the ascomycetes CYP53 P450s ability is limited for detoxification of toxic molecules, whereas basidiomycetes CYP53 P450s play an additional role, i.e. involvement in degradation of wood and its derived components. This study is the first report on genome-wide comparative structural (gene and protein structure-level) and evolutionary analysis of a fungal P450 family.

Alterations of mitochondrial biogenesis in chronic lymphocytic leukemia cells with loss of p53

PubMed Central

Ogasawara, Marcia A.; Liu, Jinyun; Pelicano, Helene; Hammoudi, Naima; Croce, Carlo M.; Keating, Michael J.; Huang, Peng

2016-01-01

Deletion of chromosome 17p with a loss of p53 is an unfavorable cytogenetic change in chronic lymphocytic leukemia (CLL) with poor clinical outcome. Since p53 affects mitochondrial function and integrity, we examined possible mitochondrial changes in CLL mice with TCL1-Tg/p53−/− and TCL1-Tg/p53+/+ genotypes and in primary leukemia cells from CLL patients with or without 17p-deletion. Although the expression of mitochondrial COX1, ND2, and ND6 decreased in p53−/−CLL cells, there was an increase in mitochondrial biogenesis as evidenced by higher mitochondrial mass and mtDNA copy number associated with an elevated expression of TFAM and PGC-1α. Surprisingly, the overall mitochondrial respiratory activity and maximum reserved capacity increased in p53−/− CLL cells. Our study suggests that leukemia cells lacking p53 seem able to maintain respiratory function by compensatory increase in mitochondrial biogenesis. PMID:27650502

The oncoprotein gankyrin binds to MDM2/HDM2, enhancing ubiquitylation and degradation of p53.

PubMed

Higashitsuji, Hiroaki; Higashitsuji, Hisako; Itoh, Katsuhiko; Sakurai, Toshiharu; Nagao, Toshikazu; Sumitomo, Yasuhiko; Sumitomo, Haruhiko; Masuda, Tomoko; Dawson, Simon; Shimada, Yutaka; Mayer, R John; Fujita, Jun

2005-07-01

Gankyrin is an ankyrin repeat oncoprotein commonly overexpressed in hepatocellular carcinomas. Gankyrin interacts with the S6 proteasomal ATPase and accelerates the degradation of the tumor suppressor Rb. We show here that gankyrin has an antiapoptotic activity in cells exposed to DNA damaging agents. Downregulation of gankyrin induces apoptosis in cells with wild-type p53. In vitro and in vivo experiments revealed that gankyrin binds to Mdm2, facilitating p53-Mdm2 binding, and increases ubiquitylation and degradation of p53. Gankyrin also enhances Mdm2 autoubiquitylation in the absence of p53. Downregulation of gankyrin reduced amounts of Mdm2 and p53 associated with the 26S proteasome. Thus, gankyrin is a cofactor that increases the activities of Mdm2 on p53 and probably targets polyubiquitylated p53 into the 26S proteasome.

PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence

PubMed Central

Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues

2015-01-01

Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction. PMID:26578773

PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence.

PubMed

Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues

2015-11-17

Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction.

Effects of ramipril and rosiglitazone on cardiovascular and renal outcomes in people with impaired glucose tolerance or impaired fasting glucose: results of the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) trial.

PubMed

Dagenais, G R; Gerstein, H C; Holman, R; Budaj, A; Escalante, A; Hedner, T; Keltai, M; Lonn, E; McFarlane, S; McQueen, M; Teo, K; Sheridan, P; Bosch, J; Pogue, J; Yusuf, S

2008-05-01

Impaired glucose tolerance (IGT) and/or impaired fasting glucose (IFG) are risk factors for diabetes, cardiovascular disease (CVD), and kidney disease. We determined the effects of ramipril and rosiglitazone on combined and individual CVD and renal outcomes in people with IGT and/or IFG in the Diabetes REduction Assessment With ramipril and rosiglitazone Medication (DREAM) trial. A total of 5,269 people aged >or=30 years, with IGT and/or IFG without known CVD or renal insufficiency, were randomized to 15 mg/day ramipril versus placebo and 8 mg/day rosiglitazone versus placebo. A composite cardiorenal outcome and its CVD and renal components were assessed during the 3-year follow-up. Compared with placebo, neither ramipril (15.7% [412 of 2,623] vs. 16.0% [424 of 2,646]; hazard ratio [HR] 0.98 [95% CI 0.84-1.13]; P = 0.75) nor rosiglitazone (15.0% [394 of 2,635] vs. 16.8% [442 of 2,634]; 0.87 [0.75-1.01]; P = 0.07) reduced the risk of the cardiorenal composite outcome. Ramipril had no impact on the CVD and renal components. Rosiglitazone increased heart failure (0.53 vs. 0.08%; HR 7.04 [95% CI 1.60-31.0]; P = 0.01) but reduced the risk of the renal component (0.80 [0.68-0.93]; P = 0.005); prevention of diabetes was independently associated with prevention of the renal component (P < 0.001). Ramipril did not alter the cardiorenal outcome or its components. Rosiglitazone, which reduced diabetes, also reduced the development of renal disease but not the cardiorenal outcome and increased the risk of heart failure.

A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif

PubMed Central

Elengoe, Asita; Naser, Mohammed Abu; Hamdan, Salehhuddin

2015-01-01

Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD) of heat shock 70 kDa protein (PDB: 1HJO) with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD) simulation. Human DNA binding domain of p53 motif (SCMGGMNR) retrieved from UniProt (UniProtKB: P04637) was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy. PMID:26098630

A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif.

PubMed

Elengoe, Asita; Naser, Mohammed Abu; Hamdan, Salehhuddin

2015-01-01

Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD) of heat shock 70 kDa protein (PDB: 1HJO) with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD) simulation. Human DNA binding domain of p53 motif (SCMGGMNR) retrieved from UniProt (UniProtKB: P04637) was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were -0.44 Kcal/mol and -9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

Management of chronic lymphocytic leukemia.

PubMed

Stilgenbauer, Stephan; Furman, Richard R; Zent, Clive S

2015-01-01

Chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL) is usually diagnosed in asymptomatic patients with early-stage disease. The standard management approach is careful observation, irrespective of risk factors unless patients meet the International Workshop on CLL (IWCLL) criteria for "active disease," which requires treatment. The initial standard therapy for most patients combines an anti-CD20 antibody (such as rituximab, ofatumumab, or obinutuzumab) with chemotherapy (fludarabine/cyclophosphamide [FC], bendamustine, or chlorambucil) depending on multiple factors including the physical fitness of the patient. However, patients with very high-risk CLL because of a 17p13 deletion (17p-) with or without mutation of TP53 (17p-/TP53mut) have poor responses to chemoimmunotherapy and require alternative treatment regimens containing B-cell receptor (BCR) signaling pathway inhibitors. The BCR signaling pathway inhibitors (ibrutinib targeting Bruton's tyrosine kinase [BTK] and idelalisib targeting phosphatidyl-inositol 3-kinase delta [PI3K-delta], respectively) are currently approved for the treatment of relapsed/refractory CLL and all patients with 17p- (ibrutinib), and in combination with rituximab for relapsed/refractory patients (idelalisib). These agents offer great efficacy, even in chemotherapy refractory CLL, with increased tolerability, safety, and survival. Ongoing studies aim to determine the best therapy combinations with the goal of achieving long-term disease control and the possibility of developing a curative regimen for some patients. CLL is associated with a wide range of infectious, autoimmune, and malignant complications. These complications result in considerable morbidity and mortality that can be minimized by early detection and aggressive management. This active monitoring requires ongoing patient education, provider vigilance, and a team approach to patient care.

Detection of genotoxic and non-genotoxic carcinogens in Xpc{sup −/−}p53{sup +/−} mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Melis, Joost P.M.; Leiden University Medical Center, Department of Toxicogenetics, Leiden; Speksnijder, Ewoud N.

2013-01-15

An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed themore » Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Highlights: ► The Xpc*p53 mouse model is able to identify genotoxic and non-genotoxic carcinogens. ► Time, animals and cost can be significantly reduced compared to the 2-year bioassay. ► Xpc*p53 mice are more advantageous for carcinogen identification than Xpa*p53 mice. ► Xpc*p53 mice exhibit a wild type response upon exposure to genotoxicants.« less

Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wan, Chunhua; Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu; Ma, Xa

2014-12-15

Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleavedmore » PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly activated in Mn-exposed brain cells. • p53 translocates into mitochondria following Mn exposure. • p53 causes mitochondrial deficit via transcription-dependent and -independent actions. • PFT-α and PFT-μ ameliorate Mn-induced mitochondrial deficit and neuronal apoptosis.« less

The role of p53 in cancer drug resistance and targeted chemotherapy.

PubMed

Hientz, Karin; Mohr, André; Bhakta-Guha, Dipita; Efferth, Thomas

2017-01-31

Cancer has long been a grievous disease complicated by innumerable players aggravating its cure. Many clinical studies demonstrated the prognostic relevance of the tumor suppressor protein p53 for many human tumor types. Overexpression of mutated p53 with reduced or abolished function is often connected to resistance to standard medications, including cisplatin, alkylating agents (temozolomide), anthracyclines, (doxorubicin), antimetabolites (gemcitabine), antiestrogenes (tamoxifen) and EGFR-inhibitors (cetuximab). Such mutations in the TP53 gene are often accompanied by changes in the conformation of the p53 protein. Small molecules that restore the wild-type conformation of p53 and, consequently, rebuild its proper function have been identified. These promising agents include PRIMA-1, MIRA-1, and several derivatives of the thiosemicarbazone family. In addition to mutations in p53 itself, p53 activity may be also be impaired due to alterations in p53's regulating proteins such as MDM2. MDM2 functions as primary cellular p53 inhibitor and deregulation of the MDM2/p53-balance has serious consequences. MDM2 alterations often result in its overexpression and therefore promote inhibition of p53 activity. To deal with this problem, a judicious approach is to employ MDM2 inhibitors. Several promising MDM2 inhibitors have been described such as nutlins, benzodiazepinediones or spiro-oxindoles as well as novel compound classes such as xanthone derivatives and trisubstituted aminothiophenes. Furthermore, even naturally derived inhibitor compounds such as α-mangostin, gambogic acid and siladenoserinols have been discovered. In this review, we discuss in detail such small molecules that play a pertinent role in affecting the p53-MDM2 signaling axis and analyze their potential as cancer chemotherapeutics.

p53 is required for brain growth but is dispensable for resistance to nutrient restriction during Drosophila larval development

PubMed Central

Contreras, Esteban G.; Sierralta, Jimena

2018-01-01

Background Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called ‘brain sparing’. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Results Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Conclusions Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals. PMID:29621246

p53 is required for brain growth but is dispensable for resistance to nutrient restriction during Drosophila larval development.

PubMed

Contreras, Esteban G; Sierralta, Jimena; Glavic, Alvaro

2018-01-01

Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called 'brain sparing'. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals.

Circulating Betatrophin Levels and Gestational Diabetes Mellitus: A Systematic Review and Meta-Analysis.

PubMed

Kong, Fei-Juan; Ma, Lei-Lei; Li, Ge; Chen, Yi-Xin; Zhou, Jia-Qiang

2017-01-01

The association between circulating betatrophin levels and gestational diabetes mellitus (GDM) is controversial. The aim of our study was to systematically review available literature linking betatrophin to GDM for a comprehensive understanding of the relationship between circulating betatrophin levels and GDM in human. PubMed, The Cochrane Library, Medline and CNKI were searched for studies published up to August 2016. Manual searches of references of the relevant original studies were conducted. Pooled estimates were measured using the fixed or random effect model. Overall effect was reported in a standard mean difference (SMD). All data were analyzed with Review Manager 5.3 and Stata 12.0. Of 25 references reviewed, 8 studies met our inclusion criteria and contributed to meta-analysis. All the studies were used to evaluate the relationship between betatrophin levels in blood and GDM. Betatrophin levels were significantly elevated in women with GDM compared with those without GDM (SMD = 1.05; 95% CI: 0.41-1.68, P = 0.001). This evidence was more consistent among women with betatrophin blood draw during the third trimester (SMD = 1.3, 95% CI: 1-1.61, P < 0.001) and for women BMI ≥ 28 kg/m2 (SMD = 1.53, 95% CI: 1.30-1.75, P < 0.001). The evidences from this meta-analysis indicated that the levels of circulating betatrophin were significantly elevated among women with GDM compared with women with normal glucose tolerance, especially with BMI ≥ 28 kg/m2 and in the third trimester.

Protective mechanisms of p53-p21-pRb proteins against DNA damage-induced cell death.

PubMed

Garner, Elizabeth; Raj, Kenneth

2008-02-01

There have been innumerate demonstrations of p53's activity as a tumour suppressor protein with the ability to stimulate cell signalling that can lead to cell cycle arrest and cell death in the event of DNA damage. Despite the solid body of evidence to support these properties of p53, reports have emerged that suggest a role for p53 in protecting cells from cell death. Our recent report highlighted a mechanism by which p53 activity can promote cell survival in the event of DNA damage. Here we present the various mechanisms that are activated by p53 signalling that can confer protection to cells with damaged DNA and emphasise the practical and clinical implications of a more balanced and context-dependent understanding of p53's pro-apoptotic and pro-survival activities.

p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

PubMed

Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

2004-06-01

The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

The expanding universe of p53 targets.

PubMed

Menendez, Daniel; Inga, Alberto; Resnick, Michael A

2009-10-01

The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

Cadmium, type 2 diabetes, and kidney damage in a cohort of middle-aged women

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barregard, Lars, E-mail: lars.barregard@amm.gu.se; Bergström, Göran, E-mail: goran.bergstrom@wlab.gu.se; Department of Molecular and Clinical Medicine, University of Gothenburg, SE-405 30 Gothenburg

Background: It has been proposed that diabetic patients are more sensitive to the nephrotoxicity of cadmium (Cd) compared to non-diabetics, but few studies have examined this in humans, and results are inconsistent. Aim: To test the hypothesis that women with type 2 diabetes mellitus (DM) or impaired glucose tolerance (IGT) have higher risk of kidney damage from cadmium compared to women with normal glucose tolerance (NGT). Methods: All 64-year-old women in Gothenburg, Sweden, were invited to a screening examination including repeated oral glucose tolerance tests. Random samples of women with DM, IGT, and NGT were recruited for further clinical examinations.more » Serum creatinine was measured and used to calculate estimated glomerular filtration rate (eGFR). Albumin (Alb) and retinol-binding protein (RBP) were analyzed in a 12 h urine sample. Cadmium in blood (B-Cd) and urine (U-Cd) was determined using inductively coupled plasma mass spectrometry. Associations between markers of kidney function (eGFR, Alb, and RBP) and quartiles of B-Cd and U-Cd were evaluated in models, including also blood pressure and smoking habits. Results: The mean B-Cd (n=590) was 0.53 µg/L (median 0.34 µg/L). In multivariable models, a significant interaction was seen between high B-Cd (upper quartile, >0.56 µg/L) and DM (point estimate +0.40 mg Alb/12 h, P=0.04). In stratified analyzes, the effect of high B-Cd on Alb excretion was significant in women with DM (53% higher Alb/12 h, P=0.03), but not in women with IGT or NGT. Models with urinary albumin adjusted for creatinine showed similar results. In women with DM, the multivariable odds ratio (OR) for microalbuminuria (>15 mg/12 h) was increased in the highest quartile of B-Cd vs. B-Cd quartiles 1–3 in women with DM (OR 4.2, 95% confidence interval 1.1–12). No such effect was found in women with IGT or NGT. There were no associations between B-Cd and eGFR or excretion of RBP, and no differences between women with DM, IGT, or NGT regarding effect of B-Cd on eGFR or RBP. Conclusion: The present study provides support for the hypothesis that women with DM have higher risk of renal glomerular damage from cadmium exposure compared to women without DM. - Highlights: • Cadmium in blood, kidney function, and glucose tolerance was examined in 590 women. • Blood cadmium was associated with albumin excretion in women with type 2 diabetes. • No such associations with cadmium were found in women without diabetes. • Women with type 2 diabetes have increased sensitivity to kidney damage from cadmium.« less

Relationship between human papillomavirus infection and overexpression of p53 protein in cervical carcinomas and lymph node metastases.

PubMed

Cavuslu, S; Goodlad, J; Hobbs, C; Connor, A M; Raju, K S; Best, J M; Cason, J

1997-10-01

Overexpression of p53 protein is common in cervical carcinoma. We investigated archival biopsies from 26 cervical cancer patients (24 with available lymph nodes) to determine the relationship between p53 overexpression and HPV infection at the cervix and lymph nodes. Twelve cervical carcinoma patients had p53 protein in cervical biopsies detectable by immunohistochemistry using monoclonal antibody DO-1, and 22 were positive for HPV DNA in polymerase chain reaction assays (16, contained HPV-16; 3, HPV-18; and, 3 HPV-X). Seven cervical cancer patients had one or more lymph nodes positive for p53 protein, and all but one of these were concordantly p53 positive at the cervix. However, detection of p53 protein in cervical biopsies was predictive neither of the expression of p53 at draining lymph nodes (P > 0.1) nor of the occurrence of metastases (P > 0.1). Fourteen patients were positive at one or more lymph nodes for HPV DNA. Cervical positivity for HPV DNA was associated significantly with concordant HPV positivity at the lymph nodes (P = 0.039) and was predictive of metastases (P = 0.019). There was no association between positivity for p53 and for HPV DNA at primary cervical carcinomas or at the lymph nodes (all P > 0.1). We conclude that, although detectable p53 protein is a common feature of cervical carcinomas, it is not predictive of metastases and is independent of HPV infection.

Expression of P53 protein after exposure to ionizing radiation

NASA Astrophysics Data System (ADS)

Salazar, A. M.; Salvador, C.; Ruiz-Trejo, C.; Ostrosky, P.; Brandan, M. E.

2001-10-01

One of the most important tumor suppressor genes is p53 gene, which is involved in apoptotic cell death, cell differentiation and cell cycle arrest. The expression of p53 gene can be evaluated by determining the presence of P53 protein in cells using Western Blot assay with a chemiluminescent method. This technique has shown variabilities that are due to biological factors. Film developing process can influence the quality of the p53 bands obtained. We irradiated tumor cell lines and human peripheral lymphocytes with 137Cs and 60Co gamma rays to standardize irradiation conditions, to compare ionizing radiation with actinomycin D and to reduce the observed variability of P53 protein induction levels. We found that increasing radiation doses increase P53 protein induction while it decreases viability. We also conclude that ionizing radiation could serve as a positive control for Western Blot analysis of protein P53. In addition, our results show that the developing process may play an important role in the quality of P53 protein bands and data interpretation.

Conformational detection of p53's oligomeric state by FlAsH Fluorescence.

PubMed

Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J

2009-06-19

The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.

Conformational detection of p53's oligomeric state by FlAsH Fluorescence

PubMed Central

Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.

2009-01-01

The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo. PMID:19393630

Specific interaction of mutant p53 with regions of matrix attachment region DNA elements (MARs) with a high potential for base-unpairing

PubMed Central

Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang

1998-01-01

Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860

CRISPR-Cas9-based target validation for p53-reactivating model compounds

PubMed Central

Wanzel, Michael; Vischedyk, Jonas B; Gittler, Miriam P; Gremke, Niklas; Seiz, Julia R; Hefter, Mirjam; Noack, Magdalena; Savai, Rajkumar; Mernberger, Marco; Charles, Joël P; Schneikert, Jean; Bretz, Anne Catherine; Nist, Andrea; Stiewe, Thorsten

2015-01-01

Inactivation of the p53 tumor suppressor by Mdm2 is one of the most frequent events in cancer, so compounds targeting the p53-Mdm2 interaction are promising for cancer therapy. Mechanisms conferring resistance to p53-reactivating compounds are largely unknown. Here we show using CRISPR-Cas9–based target validation in lung and colorectal cancer that the activity of nutlin, which blocks the p53-binding pocket of Mdm2, strictly depends on functional p53. In contrast, sensitivity to the drug RITA, which binds the Mdm2-interacting N terminus of p53, correlates with induction of DNA damage. Cells with primary or acquired RITA resistance display cross-resistance to DNA crosslinking compounds such as cisplatin and show increased DNA cross-link repair. Inhibition of FancD2 by RNA interference or pharmacological mTOR inhibitors restores RITA sensitivity. The therapeutic response to p53-reactivating compounds is therefore limited by compound-specific resistance mechanisms that can be resolved by CRISPR-Cas9-based target validation and should be considered when allocating patients to p53-reactivating treatments. PMID:26595461

The p53-reactivating small-molecule RITA enhances cisplatin-induced cytotoxicity and apoptosis in head and neck cancer.

PubMed

Roh, Jong-Lyel; Ko, Jung Ho; Moon, Soo Jin; Ryu, Chang Hwan; Choi, Jun Young; Koch, Wayne M

2012-12-01

We evaluated whether the restoration of p53 function by the p53-reactivating small molecule RITA (reactivation of p53 and induction of tumor cell apoptosis enhances cisplatin-induced cytotoxicity and apoptosis in head-and-neck cancer (HNC). RITA induced prominent accumulation and reactivation of p53 in a wild-type TP53-bearing HNC cell line. RITA showed maximal growth suppression in tumor cells showing MDM2-dependent p53 degradation. RITA promoted apoptosis in association with upregulation of p21, BAX, and cleaved caspase-3; notably, the apoptotic response was blocked by pifithrin-α, demonstrating its p53 dependence. With increasing concentrations, RITA strongly induced apoptosis rather than G2-phase arrest. In combination therapy, RITA enhanced cisplatin-induced growth inhibition and apoptosis of HNC cells invitro and in vivo. Our data suggest that the restoration of p53 tumor-suppressive function by RITA enhances the cytotoxicity and apoptosis of cisplatin, an action that may offer an attractive strategy for treating HNC. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

The expression of TP53 pathway-related proteins in ovarian carcinoma transplanted subcutaneously in nude mice.

PubMed

Zhang, S-R; Li, D-B; Xue, J-W

2018-03-01

Given the important functions of TP53 pathway in various biological processes, this study aimed to investigate the expression of TP53 pathway-related proteins in ovarian carcinoma transplanted subcutaneously in nude mice with and without the presence of p53 inhibitor and to explore possible roles of p53 in the development of ovarian cancer. Thirty BALB/c-nu female nude mice were randomly divided into model group, control group and p53 inhibitor group (Pftα group). There were 10 rats in each group. The nude mice were subcutaneously inoculated with human ovarian cancer cell line SKOV3, and the tumor growth was observed. Morphological changes of tumor tissue were observed by hematoxylin and eosin (HE) staining. The mRNA and protein levels of TP53 pathway related factors-p53, p21 and mouse double minute 2 homolog (MDM2) were detected by RT-PCR and Western blot. p53 inhibitor can increase the growth rate of subcutaneously transplanted tumor in nude mice. p53 inhibitor could decrease the expression of p53 and p21 at both mRNA and protein levels and increase the expression of MDM2 at both mRNA and protein levels in ovarian carcinoma transplanted subcutaneously in nude mice. TP53 pathway may play pivotal roles in the development of ovarian cancer and TP53 pathway may be a new target for the treatment of ovarian cancer.

Activation of p53 Transcriptional Activity by SMRT: a Histone Deacetylase 3-Independent Function of a Transcriptional Corepressor

PubMed Central

Adikesavan, Anbu Karani; Karmakar, Sudipan; Pardo, Patricia; Wang, Liguo; Liu, Shuang; Li, Wei

2014-01-01

The silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) is an established histone deacetylase 3 (HDAC3)-dependent transcriptional corepressor. Microarray analyses of MCF-7 cells transfected with control or SMRT small interfering RNA revealed SMRT regulation of genes involved in DNA damage responses, and the levels of the DNA damage marker γH2AX as well as poly(ADP-ribose) polymerase cleavage were elevated in SMRT-depleted cells treated with doxorubicin. A number of these genes are established p53 targets. SMRT knockdown decreased the activity of two p53-dependent reporter genes as well as the expression of p53 target genes, such as CDKN1A (which encodes p21). SMRT bound directly to p53 and was recruited to p53 binding sites within the p21 promoter. Depletion of GPS2 and TBL1, components of the SMRT corepressor complex, but not histone deacetylase 3 (HDAC3) decreased p21-luciferase activity. p53 bound to the SMRT deacetylase activation domain (DAD), which mediates HDAC3 binding and activation, and HDAC3 could attenuate p53 binding to the DAD region of SMRT. Moreover, an HDAC3 binding-deficient SMRT DAD mutant coactivated p53 transcriptional activity. Collectively, these data highlight a biological role for SMRT in mediating DNA damage responses and suggest a model where p53 binding to the DAD limits HDAC3 interaction with this coregulator, thereby facilitating SMRT coactivation of p53-dependent gene expression. PMID:24449765

Combined p16 and p53 expression in cervical cancer of unknown primary and other prognostic parameters : A single-center analysis.

PubMed

Yildirim, Müjdat; Müller von der Grün, Jens; Winkelmann, Ria; Fokas, Emmanouil; Rödel, Franz; Ackermann, Hanns; Rödel, Claus; Balermpas, Panagiotis

2017-04-01

Cervical cancer of unknown primary (CUP) represents an uncommon and heterogeneous subentity of head and neck cancer. However, both optimal diagnostics and therapy remain unclear. An improved understanding of the underlying pathology is essential to enable future tailored therapies and optimized outcomes. We retrospectively analyzed 53 patients with head and neck CUP and 48 available cervical lymph node specimens. All patients have received radiotherapy between 2007 and 2015. Preradiotherapy involved lymph node specimens were analyzed for p16 and p53 immunoreactivity. The prognostic relevance of the combined p16 and p53 status and other clinical parameters were examined by univariate and multivariate analyses. Median patient age was 61.5 years and median irradiation dose to the involved nodal levels was 66 Gy. Of the 48 evaluated specimens, 13 (27%) were p16-positive and 31 (64.6%) p53-positive. After a median follow up of 32.9 months, patients with p16-negative and simultaneously p53-positive tumors showed a significantly inferior tumor-specific survival (TSS) compared to those with either p16+/p53-, p16+/p53+, or p16-/p53- (univariate: p = 0.055, multivariate: p = 0.038). Other factors with an adverse impact on TSS in the univariate analysis were smoking history (p = 0.032) and nodal stage (p = 0.038). The combined p16- and p53-expression status in cervical metastases of CUP may represent a simple method for risk stratification. Further validation of these biomarkers in large prospective trials is essential to design rational trials for CUP treatment optimization.

Relationships of self-identified cold tolerance and cold-induced vasodilatation in the finger

NASA Astrophysics Data System (ADS)

Park, Joonhee; Lee, Joo-Young

2016-04-01

This study was conducted to investigate relationships of self-identified cold tolerance and cold-induced vasodilatation (CIVD) in the finger. Nine males and 34 females participated in the following 2 tests: a CIVD test and a self-reported survey. The CIVD test was conducted 30-min cold-water immersion (3.8 ± 0.3 °C) of the middle finger at an air temperature of 27.9 ± 0.1 °C. The self-reported questionnaire consisted of 28 questions about whole and local body cold and heat tolerances. By a cluster analysis on the survey results, the participants were divided into two groups: high self-identified cold tolerance (HSCT, n = 25) and low self-identified cold tolerance (LSCT, n = 18). LSCT had lower self-identified cold tolerance ( P < 0.001), preferred hot thermal stimulation ( P = 0.006), and wore heavier clothing during daily life ( P < 0.001) than HSCT. LSCT had significantly lower maximal finger temperatures ( T max) ( P = 0.040), smaller amplitude ( P = 0.029), and delayed onset time of CIVD ( P = 0.080) when compared to HSCT. Some questions examining the self-identified cold or heat tolerance had relationships with cold tolerance index, T max, and amplitude ( P < 0.1). These results indicate that self-identified cold tolerance classified through a standardized survey could be a good index to predict physiological cold tolerance.

Relationships of self-identified cold tolerance and cold-induced vasodilatation in the finger.

PubMed

Park, Joonhee; Lee, Joo-Young

2016-04-01

This study was conducted to investigate relationships of self-identified cold tolerance and cold-induced vasodilatation (CIVD) in the finger. Nine males and 34 females participated in the following 2 tests: a CIVD test and a self-reported survey. The CIVD test was conducted 30-min cold-water immersion (3.8 ± 0.3 °C) of the middle finger at an air temperature of 27.9 ± 0.1 °C. The self-reported questionnaire consisted of 28 questions about whole and local body cold and heat tolerances. By a cluster analysis on the survey results, the participants were divided into two groups: high self-identified cold tolerance (HSCT, n = 25) and low self-identified cold tolerance (LSCT, n = 18). LSCT had lower self-identified cold tolerance (P < 0.001), preferred hot thermal stimulation (P = 0.006), and wore heavier clothing during daily life (P < 0.001) than HSCT. LSCT had significantly lower maximal finger temperatures (T max) (P = 0.040), smaller amplitude (P = 0.029), and delayed onset time of CIVD (P = 0.080) when compared to HSCT. Some questions examining the self-identified cold or heat tolerance had relationships with cold tolerance index, T max, and amplitude (P < 0.1). These results indicate that self-identified cold tolerance classified through a standardized survey could be a good index to predict physiological cold tolerance.

Combined Analysis of COX-2 and p53 Expressions Reveals Synergistic Inverse Correlations with Microsatellite Instability and CpG Island Methylator Phenotype in Colorectal Cancer1

PubMed Central

Ogino, Shuji; Brahmandam, Mohan; Kawasaki, Takako; Kirkner, Gregory J; Loda, Massimo; Fuchs, Charles S

2006-01-01

Abstract Cyclooxygenase-2 (COX-2) overexpression and mutations of p53 (a known COX-2 regulator) are inversely associated with microsatellite instability—high (MSI-H) and CpG island methylator phenotype (CIMP), characterized by extensive promoter methylation, is associated with MSI-H. However, no studies have comprehensively examined interrelations between COX-2, p53, MSI, and CIMP. Using MethyLight, we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A), CRABP1, MLH1, and NEUROG1] in relatively unbiased samples of 751 colorectal cancer cases obtained from two large prospective cohorts; 115 (15%) tumors were CIMP-high (≥ 4 of 5 methylated promoters), 251 (33%) were CIMP-low (1 to 3 methylated promoters), and the remaining 385 (51%) were CIMP-0 (no methylated promoters). CIMP-high tumors were much less frequent in COX-2+/p53+ tumors (4.6%) than in COX-2+/p53- tumors (19%; P < .0001), COX-2-/p53+ tumors (17%; P= .04), and COX-2-/p53- tumors (28%; P < .0001). In addition, COX-2+/p53+ tumors were significantly less common in MSI-H CIMP-high tumors (9.7%) than in non-MSI-H CIMP-low/CIMP-0 tumors (44–47%; P< .0001). In conclusion, COX-2 and p53 alterations were synergistically inversely correlated with both MSI-H and CIMP-high. Our data suggest that a combined analysis of COX-2 and p53 may be more useful for the molecular classification of colorectal cancer than either COX-2 or p53 analysis alone. PMID:16820091

Novel small molecule induces p53-dependent apoptosis in human colon cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Sang Eun; Min, Yong Ki; Ha, Jae Du

2007-07-06

Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser{sup 6}, Ser{sup 15}, and Ser{sup 20}, which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21{sup WAF1/CIP}. Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular targetmore » of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent.« less

mTOR inhibitors blunt the p53 response to nucleolar stress by regulating RPL11 and MDM2 levels

PubMed Central

Goudarzi, Kaveh M; Nistér, Monica; Lindström, Mikael S

2014-01-01

Mechanistic target of rapamycin (mTOR) is a master regulator of cell growth through its ability to stimulate ribosome biogenesis and mRNA translation. In contrast, the p53 tumor suppressor negatively controls cell growth and is activated by a wide range of insults to the cell. The mTOR and p53 signaling pathways are connected by a number of different mechanisms. Chemotherapeutics that inhibit ribosome biogenesis often induce nucleolar stress and activation of p53. Here we have investigated how the p53 response to nucleolar stress is affected by simultaneous mTOR inhibition in osteosarcoma and glioma cell lines. We found that inhibitors of the mTOR pathway including rapamycin, wortmannin, and caffeine blunted the p53 response to nucleolar stress induced by actinomycin D. Synthetic inhibitors of mTOR (temsirolimus, LY294.002 and PP242) also impaired actinomycin D triggered p53 stabilization and induction of p21. Ribosomal protein (RPL11) is known to be required for p53 protein stabilization following nucleolar stress. Treatment of cells with mTOR inhibitors may lead to reduced synthesis of RPL11 and thereby destabilize p53. We found that rapamycin mimicked the effect of RPL11 depletion in terms of blunting the p53 response to nucleolar stress. However, the extent to which the levels of p53 and RPL11 were reduced by rapamycin varied between cell lines. Additional mechanisms whereby rapamycin blunts the p53 response to nucleolar stress are likely to be involved. Indeed, rapamycin increased the levels of endogenous MDM2 despite inhibition of its phosphorylation at Ser-166. Our findings may have implications for the design of combinatorial cancer treatments with mTOR pathway inhibitors. PMID:25482947

N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

PubMed Central

Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

2012-01-01

Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy. PMID:22801474

N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

PubMed

Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

2012-08-01

Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

Low-dose lisinopril in normotensive men with idiopathic oligospermia and infertility: a 5-year randomized, controlled, crossover pilot study.

PubMed

Mbah, A U; Ndukwu, G O; Ghasi, S I; Shu, E N; Ozoemena, F N; Mbah, J O; Onodugo, O D; Ejim, E C; Eze, M I; Nkwo, P O; Okonkwo, P O

2012-04-01

The outcomes of drug treatment for male infertility remain conjectural, with controversial study results. Our pilot study employed a randomized, placebo-controlled, crossover methodology with intention-to-treat analysis. Thirty-three men with idiopathic oligospermia were randomized to start either daily oral lisinopril 2.5 mg (n = 17) or daily oral placebo (n = 16). Lisinopril was found to cause a normalization of seminal parameters in 53.6% of the participants. Although the mean ejaculate volume was unchanged (P ≥ 0.093), the total sperm cell count and the percentage of motile sperm cells increased (P ≤ 0.03 and P < 0.001, respectively), whereas the percentage of sperm cells with abnormal morphology decreased (P ≤ 0.04). The pregnancy rate was 48.5%, and there was no serious adverse drug event. It is concluded, albeit cautiously, that prolonged treatment with 2.5 mg/day of oral lisinopril may be well tolerated in normotensive men with idiopathic oligospermia, may improve sperm quantity and quality, and may enhance fertility in approximately half of those treated.

p53 as an Effector or Inhibitor of Therapy Response

PubMed Central

Ablain, Julien; Poirot, Brigitte; Esnault, Cécile; Lehmann-Che, Jacqueline; de Thé, Hugues

2016-01-01

Although integrity of the p53 signaling pathway in a given tumor was expected to be a critical determinant of response to therapies, most clinical studies failed to link p53 status and treatment outcome. Here, we present two opposite situations: one in which p53 is an essential effector of cure by targeted leukemia therapies and another one in advanced breast cancers in which p53 inactivation is required for the clinical efficacy of dose-dense chemotherapy. If p53 promotes or blocks therapy response, therapies must be tailored on its status in individual tumors. PMID:26637438

Degradation of phosphorylated p53 by viral protein-ECS E3 ligase complex.

PubMed

Sato, Yoshitaka; Kamura, Takumi; Shirata, Noriko; Murata, Takayuki; Kudoh, Ayumi; Iwahori, Satoko; Nakayama, Sanae; Isomura, Hiroki; Nishiyama, Yukihiro; Tsurumi, Tatsuya

2009-07-01

p53-signaling is modulated by viruses to establish a host cellular environment advantageous for their propagation. The Epstein-Barr virus (EBV) lytic program induces phosphorylation of p53, which prevents interaction with MDM2. Here, we show that induction of EBV lytic program leads to degradation of p53 via an ubiquitin-proteasome pathway independent of MDM2. The BZLF1 protein directly functions as an adaptor component of the ECS (Elongin B/C-Cul2/5-SOCS-box protein) ubiquitin ligase complex targeting p53 for degradation. Intringuingly, C-terminal phosphorylation of p53 resulting from activated DNA damage response by viral lytic replication enhances its binding to BZLF1 protein. Purified BZLF1 protein-associated ECS could be shown to catalyze ubiquitination of phospho-mimetic p53 more efficiently than the wild-type in vitro. The compensation of p53 at middle and late stages of the lytic infection inhibits viral DNA replication and production during lytic infection, suggesting that the degradation of p53 is required for efficient viral propagation. Taken together, these findings demonstrate a role for the BZLF1 protein-associated ECS ligase complex in regulation of p53 phosphorylated by activated DNA damage signaling during viral lytic infection.

Identification of a small molecule that overcomes HdmX-mediated suppression of p53

PubMed Central

Chakrabarti, Amit; Karan, Sukanya; Liu, Zhigang; Xia, Zhiqiang; Gundluru, Mahesh; Moreton, Stephen; Saunthararajah, Yogen; Jackson, Mark W; Agarwal, Mukesh K; Wald, David N

2016-01-01

Inactivation of the p53 tumor suppressor by mutation or overexpression of negative regulators occurs frequently in cancer. Since p53 plays a key role in regulating proliferation or apoptosis in response to DNA damaging chemotherapies, strategies aimed at reactivating p53 are increasingly being sought. Strategies to reactivate wild-type p53 include the use of small molecules capable of releasing wild-type p53 from key, cellular negative regulators, such as Hdm2 and HdmX. Derivatives of the Hdm2 antagonist Nutlin-3 are in clinical trials. However, Nutlin-3 specifically disrupts Hdm2-p53, leaving tumors harboring high levels of HdmX resistant to Nutlin-3 treatment. Here we identify CTX1, a novel small molecule that overcomes HdmX-mediated p53 repression. CTX1 binds directly to HdmX to prevent p53-HdmX complex formation, resulting in the rapidly induction of p53 in a DNA damage-independent manner. Treatment of a panel of cancer cells with CTX1 induced apoptosis or suppressed proliferation and importantly, CTX1 demonstrates promising activity as a single agent in a mouse model of circulating primary human leukemia. CTX1 is a small molecule HdmX inhibitor that demonstrates promise as a cancer therapeutic candidate. PMID:26883273

S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

PubMed

Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

2013-12-05

S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

Various stress stimuli rewire the profile of liver secretome in a p53-dependent manner.

PubMed

Charni-Natan, Meital; Solomon, Hilla; Molchadsky, Alina; Jacob-Berger, Adi; Goldfinger, Naomi; Rotter, Varda

2018-05-29

Liver is an important secretory organ that consistently manages various insults in order to retain whole-body homeostasis. Importantly, it was suggested that the tumor-suppressor p53 plays a role in a variety of liver physiological processes and thus it is being regarded as a systemic homeostasis regulator. Using high-throughput mass spectrometric analysis, we identified various p53-dependent liver secretome profiles. This allowed a global view on the role of p53 in maintaining the harmony of liver and whole-body homeostasis. We found that p53 altered the liver secretome differently under various conditions. Under physiological conditions, p53 controls factors that are related mainly to lipid metabolism and injury response. Upon exposure to various types of cancer therapy agents, the hepatic p53 is activated and induces the secretion of proteins related to additional pathways, such as hemostasis, immune response, and cell adhesion. Interestingly, we identified a possible relationship between p53-dependent liver functions and lung tumors. The latter modify differently liver secretome profile toward the secretion of proteins mainly related to cell migration and immune response. The notion that p53 may rewire the liver secretome profile suggests a new non-cell autonomous role of p53 that affect different liver functions and whole organism homeostasis.

p53 inhibits autophagy by interacting with the human ortholog of yeast Atg17, RB1CC1/FIP200.

PubMed

Morselli, Eugenia; Shen, Shensi; Ruckenstuhl, Christoph; Bauer, Maria Anna; Mariño, Guillermo; Galluzzi, Lorenzo; Criollo, Alfredo; Michaud, Mickael; Maiuri, Maria Chiara; Chano, Tokuhiro; Madeo, Frank; Kroemer, Guido

2011-08-15

The tumor suppressor protein p53 tonically suppresses autophagy when it is present in the cytoplasm. This effect is phylogenetically conserved from mammals to nematodes, and human p53 can inhibit autophagy in yeast, as we show here. Bioinformatic investigations of the p53 interactome in relationship to the autophagy-relevant protein network underscored the possible relevance of a direct molecular interaction between p53 and the mammalian ortholog of the essential yeast autophagy protein Atg17, namely RB1-inducible coiled-coil protein 1 (RB1CC1), also called FAK family kinase-interacting protein of 200 KDa (FIP200). Mutational analyses revealed that a single point mutation in p53 (K382R) abolished its capacity to inhibit autophagy upon transfection into p53-deficient human colon cancer or yeast cells. In conditions in which wild-type p53 co-immunoprecipitated with RB1CC1/FIP200, p53 (K382R) failed to do so, underscoring the importance of the physical interaction between these proteins for the control of autophagy. In conclusion, p53 regulates autophagy through a direct molecular interaction with RB1CC1/FIP200, a protein that is essential for the very apical step of autophagy initiation.

The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

PubMed

Hale, T K; Braithwaite, A W

1999-08-20

Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

Photodynamic injury of isolated crayfish neuron and surrounding glial cells: the role of p53

NASA Astrophysics Data System (ADS)

Sharifulina, S. A.; Uzdensky, A. B.

2015-03-01

The pro-apoptotic transcription factor p53 is involved in cell responses to injurious impacts. Using its inhibitor pifithrin- α and activators tenovin-1, RITA and WR-1065, we studied its potential participation in inactivation and death of isolated crayfish mechanoreceptor neuron and satellite glial cells induced by photodynamic treatment, a strong inducer of oxidative stress. In dark, p53 activation by tenovin-1 or WR-1065 shortened activity of isolated neurons. Tenovin-1 and WR-1065 induced apoptosis of glial cells, whereas pifithrin-α was anti-apoptotic. Therefore, p53 mediated glial apoptosis and suppression of neuronal activity after axotomy. Tenovin-1 but not other p53 modulators induced necrosis of axotomized neurons and surrounding glia, possibly, through p53-independent pathway. Under photodynamic treatment, p53 activators tenovin-1 and RITA enhanced glial apoptosis indicating the pro-apoptotic activity of p53. Photoinduced necrosis of neurons and glia was suppressed by tenovin-1 and, paradoxically, by pifithrin-α. Modulation of photoinduced changes in the neuronal activity and necrosis of neurons and glia was possibly p53-independent. The different effects of p53 modulators on neuronal and glial responses to axotomy and photodynamic impact were apparently associated with different signaling pathways in neurons and glial cells.

Loss of P53 regresses cardiac remodeling induced by pressure overload partially through inhibiting HIF1α signaling in mice.

PubMed

Li, Jiming; Zeng, Jingjing; Wu, Lianpin; Tao, Luyuan; Liao, Zhiyong; Chu, Maoping; Li, Lei

2018-06-22

The tumor suppressor p53 is recognized as the guardian of the genome in cell cycle and cell death. P53 expression increases as cardiac hypertrophy worsens to heart failure, suggesting that p53 may play important role in cardiac remodeling. In the present study, deletion of p53 in the mice heart would ameliorate cardiac hypertrophy induced by pressure overload. The role of p53 on heart was investigated using in vivo models. Cardiac hypertrophy in mice was induced by transverse aortic banding surgery. The extent of cardiac hypertrophy was examined by echocardiography, as well as pathological and molecular analyses of heart tissue. Global knockout of p53 in the mice reduced the hypertrophic response and markedly reduced cardiac apoptosis, and fibrosis. Ejection fraction of heart was also improved in hearts without p53 in response to pressure overload. Protein determination further suggested loss of p53 expression markedly increased Hypoxia-inducible factor 1-alpha (HIF1α) and vascular endothelial growth factor (VEGF) expression. The study indicated p53 deteriorated cardiac functions and cardiac hypertrophy, apoptosis, and fibrosis by partially inhibition of HIF1α and VEGF. Copyright © 2018 Elsevier Inc. All rights reserved.

A Synthetic Interaction Screen Identifies Factors Selectively Required for Proliferation and TERT Transcription in p53-Deficient Human Cancer Cells

PubMed Central

Park, Sung Mi; Zhu, Lihua J.; Debily, Marie-anne; Kittler, Ellen L. W.; Zapp, Maria L.; Lapointe, David; Gobeil, Stephane; Virbasius, Ching-Man; Green, Michael R.

2012-01-01

Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi)–based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53−) human cancer cells. We find that compared to p53-competent (p53+) human cancer cell lines, diverse p53− human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53− cells, RNAi–mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53− but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53− cancer cells. PMID:23284306

On p53 revival using system oriented drug dosage design.

PubMed

Haseeb, Muhammad; Azam, Shumaila; Bhatti, A I; Azam, Rizwan; Ullah, Mukhtar; Fazal, Sahar

2017-02-21

We propose a new paradigm in the drug design for the revival of the p53 pathway in cancer cells. It is shown that the current strategy of using small molecule based Mdm2 inhibitors is not enough to adequately revive p53 in cancerous cells, especially when it comes to the extracting pulsating behavior of p53. This fact has come to notice when a novel method for the drug dosage design is introduced using system oriented concepts. As a test case, small molecule drug Mdm2 repressor Nutlin 3a is considered. The proposed method determines the dose of Nutlin to revive p53 pathway functionality. For this purpose, PBK dynamics of Nutlin have also been integrated with p53 pathway model. The p53 pathway is the focus of researchers for the last thirty years for its pivotal role as a frontline cancer suppressant protein due to its effect on cell cycle checkpoints and cell apoptosis in response to a DNA strand break. That is the reason for finding p53 being absent in more than 50% of tumor cancers. Various drugs have been proposed to revive p53 in cancer cells. Small molecule based drugs are at the foremost and are the subject of advanced clinical trials. The dosage design of these drugs is an important issue. We use control systems concepts to develop the drug dosage so that the cancer cells can be treated in appropriate time. We investigate by using a computational model how p53 protein responds to drug Nutlin 3a, an agent that interferes with the MDM2-mediated p53 regulation. The proposed integrated model describes in some detail the regulation network of p53 including the negative feedback loop mediated by MDM2 and the positive feedback loop mediated by Mdm2 mRNA as well as the reversible represses of MDM2 caused by Nutlin. The reported PBK dynamics of Nutlin 3a are also incorporated to see the full effect. It has been reported that p53 response to stresses in two ways. Either it has a sustained (constant) p53 response, or there are oscillations in p53 concentration. The claimed dosage strategy achieves the p53 response in the first case. However, for the induction of oscillations, it is shown through bifurcation analysis that to achieve oscillating behavior of p53 inhibition of Mdm2 is not enough, rather antirepression of the p53-Mdm2 complex is also needed which leads to the need of a new drug design paradigm. Copyright © 2016 Elsevier Ltd. All rights reserved.

Safety and tolerability of the novel non-steroidal mineralocorticoid receptor antagonist BAY 94-8862 in patients with chronic heart failure and mild or moderate chronic kidney disease: a randomized, double-blind trial.

PubMed

Pitt, Bertram; Kober, Lars; Ponikowski, Piotr; Gheorghiade, Mihai; Filippatos, Gerasimos; Krum, Henry; Nowack, Christina; Kolkhof, Peter; Kim, So-Young; Zannad, Faiez

2013-08-01

Mineralocorticoid receptor antagonists (MRAs) improve outcomes in patients with heart failure and reduced left ventricular ejection fraction (HFrEF), but their use is limited by hyperkalaemia and/or worsening renal function (WRF). BAY 94-8862 is a highly selective and strongly potent non-steroidal MRA. We investigated its safety and tolerability in patients with HFrEF associated with mild or moderate chronic kidney disease (CKD). This randomized, controlled, phase II trial consisted of two parts. In part A, the safety and tolerability of oral BAY 94-8862 [2.5, 5, or 10 mg once daily (q.d.)] was assessed in 65 patients with HFrEF and mild CKD. In part B, BAY 94-8862 (2.5, 5, or 10 mg q.d., or 5 mg twice daily) was compared with placebo and open-label spironolactone (25 or 50 mg/day) in 392 patients with HFrEF and moderate CKD. BAY 94-8862 was associated with significantly smaller mean increases in serum potassium concentration than spironolactone (0.04-0.30 and 0.45 mmol/L, respectively, P < 0.0001-0.0107) and lower incidences of hyperkalaemia (5.3 and 12.7%, respectively, P = 0.048) and WRF. BAY 94-8862 decreased the levels of B-type natriuretic peptide (BNP), amino-terminal proBNP, and albuminuria at least as much as spironolactone. Adverse events related to BAY 94-8862 were infrequent and mostly mild. In patients with HFrEF and moderate CKD, BAY 94-8862 5-10 mg/day was at least as effective as spironolactone 25 or 50 mg/day in decreasing biomarkers of haemodynamic stress, but it was associated with lower incidences of hyperkalaemia and WRF.

Crosstalk between the IGF-1R/AKT/mTORC1 pathway and the tumor suppressors p53 and p27 determines cisplatin sensitivity and limits the effectiveness of an IGF-1R pathway inhibitor

PubMed Central

Davaadelger, Batzaya; Duan, Lei; Perez, Ricardo E.; Gitelis, Steven; Maki, Carl G.

2016-01-01

The insulin-like growth factor-1 receptor (IGF-1R) signaling pathway is aberrantly activated in multiple cancers and can promote proliferation and chemotherapy resistance. Multiple IGF-1R inhibitors have been developed as potential therapeutics. However, these inhibitors have failed to increase patient survival when given alone or in combination with chemotherapy agents. The reason(s) for the disappointing clinical effect of these inhibitors is not fully understood. Cisplatin (CP) activated the IGF-1R/AKT/mTORC1 pathway and stabilized p53 in osteosarcoma (OS) cells. p53 knockdown reduced IGF-1R/AKT/mTORC1 activation by CP, and IGF-1R inhibition reduced the accumulation of p53. These data demonstrate positive crosstalk between p53 and the IGF-1R/AKT/mTORC1 pathway in response to CP. Further studies showed the effect of IGF-1R inhibition on CP response is dependent on p53 status. In p53 wild-type cells treated with CP, IGF-1R inhibition increased p53s apoptotic function but reduced p53-dependent senescence, and had no effect on long term survival. In contrast, in p53-null/knockdown cells, IGF-1R inhibition reduced apoptosis in response to CP and increased long term survival. These effects were due to p27 since IGF-1R inhibition stabilized p27 in CP-treated cells, and p27 depletion restored apoptosis and reduced long term survival. Together, the results demonstrate 1) p53 expression determines the effect of IGF-1R inhibition on cancer cell CP response, and 2) crosstalk between the IGF-1R/AKT/mTORC1 pathway and p53 and p27 can reduce cancer cell responsiveness to chemotherapy and may ultimately limit the effectiveness of IGF-1R pathway inhibitors in the clinic. PMID:27050276

Selective sensitization to DNA-damaging agents in a human rhabdomyosarcoma cell line with inducible wild-type p53 overexpression.

PubMed

Gibson, A A; Harwood, F G; Tillman, D M; Houghton, J A

1998-01-01

Drug-induced cytotoxicity or apoptosis may be influenced by the expression of the p53 tumor suppressor gene and by the specific oncogene expressed, which may dictate the threshold at which a cytotoxic response may by induced. The objective of the study was to elucidate how DNA-damaging agents with different mechanisms of action were sensitized in the context of expression of the Pax3/FKHR fusion protein, a transformation event unique to alveolar rhabdomyosarcomas (ARMSs), and wild-type p53 (wtp53). A wtp53 cDNA was subcloned into the pGRE5-2/EBV vector with dexamethasone-inducible overexpression and transfected into Rh30 ARMS cells that express Pax3/FKHR and a mutant p53 phenotype. Following dexamethasone induction of wtp53 overexpression in a derived clone (Cl.#27), growth was slowed, and cells accumulated in G1. Functional wtp53 activity was demonstrated by selective transactivation of p50-2, a wtp53 chloramphenicol acetyltransferase reporter construct, and by up-regulated expression of endogenous p21Waf1. Data demonstrated p53-dependent sensitization (> or = 4-fold) to bleomycin, actinomycin D, and 5-fluorouracil and considerably less p53-dependence (< or = 2-fold) for doxorubicin, topotecan, etoposide, and cisplatin in Cl.#27 compared to an equivalent clone containing the pGRE5-EBV vector alone (VC#3). Data demonstrate that ARMS cells show a selective sensitization to DNA-damaging agents when wtp53 is overexpressed. The cytotoxic activity of agents that are not potentiated substantially must, therefore, depend upon p53-independent factors that relate to the mechanism of drug action.

Comparison of the QuantiGene 2.0 Assay and Real-Time RT-PCR in the Detection of p53 Isoform mRNA Expression in Formalin-Fixed Paraffin-Embedded Tissues- A Preliminary Study

PubMed Central

Morten, Brianna C.; Scott, Rodney J.; Avery-Kiejda, Kelly A.

2016-01-01

p53 is expressed as multiple smaller isoforms whose functions in cancer are not well understood. The p53 isoforms demonstrate abnormal expression in different cancers, suggesting they are important in modulating the function of full-length p53 (FLp53). The quantification of relative mRNA expression has routinely been performed using real-time PCR (qPCR). However, there are serious limitations when detecting p53 isoforms using this method, particularly for formalin-fixed paraffin-embedded (FFPE) tissues. The use of FFPE tumours would be advantageous to correlate expression of p53 isoforms with important clinical features of cancer. One alternative method of RNA detection is the hybridization-based QuantiGene 2.0 Assay, which has been shown to be advantageous for the detection of RNA from FFPE tissues. In this pilot study, we compared the QuantiGene 2.0 Assay to qPCR for the detection of FLp53 and its isoform Δ40p53 in matched fresh frozen (FF) and FFPE breast tumours. FLp53 mRNA expression was detected using qPCR in FF and FFPE tissues, but Δ40p53 mRNA was only detectable in FF tissues. Similar results were obtained for the QuantiGene 2.0 Assay. FLp53 relative mRNA expression was shown to be strongly correlated between the two methods (R2 = 0.9927, p = 0.0031) in FF tissues, however Δ40p53 was not (R2 = 0.4429, p = 0.3345). When comparing the different methods for the detection of FLp53 mRNA from FFPE and FF samples, no correlation (R2 = 0.0002, p = 0.9863) was shown using the QuantiGene 2.0 Assay, and in contrast, the level of expression was highly correlated between the two tissues using qPCR (R2 = 0.8753, p = 0.0644). These results suggest that both the QuantiGene 2.0 Assay and qPCR methods are inadequate for the quantification of Δ40p53 mRNA in FFPE tissues. Therefore, alternative methods of RNA detection and quantification are required to study the relative expression of Δ40p53 in FFPE samples. PMID:27832134

Expression of p53 protein in advanced head and neck squamous cell carcinoma before and after chemotherapy.

PubMed

Dunphy, C H; Dunphy, F R; Boyd, J H; Varvares, M A; Kim, H J; Lowe, V; Dunleavy, T L; Rodriguez, J; McDonough, E M; Minster, J

1997-11-01

The expression of p53 protein has been reported to be in the range of 35% to 67% in head and neck squamous cell carcinoma (HNSCC). Mutations of the gene for p53 protein have been associated with rapidly proliferating tumors, and p53 protein expression has been shown to be a significant predictor of worse survival in surgically resected HNSCC. To determine whether p53 protein expression in advanced (stages III and IV) HNSCC has any impact on tumor response to 2 to 3 courses of paclitaxel (Taxol) and carboplatin, we prospectively studied prechemotherapy specimens from patients with previously untreated, advanced-stage HNSCC. We also attempted to study residual tumors after chemotherapy to determine if the p53 status of the tumor changed. The expression of p53 protein was evaluated by immunohistochemical analysis (clone BP53-12-1; Bio-Genex, San Ramon, Calif). Tertiary university medical center. Two to 3 courses of chemotherapy with paclitaxel and carboplatin. Pathologic complete remission or residual tumor. The results of p53 immunostaining were positive in 24 (67%) of 36 HNSCC specimens before chemotherapy. After chemotherapy, 8 patients achieved pathologic complete remission. Before chemotherapy, the tumor was p53 negative in 2 patients and positive in 6 patients. No correlation of p53 protein expression with response to chemotherapy was noted. The expression of p53 protein converted from positive to negative in 5 (42%) of 12 specimens from patients with residual tumor after chemotherapy, with no impact on clinical outcome.

Long-term clinical and immunological effects of p53-SLP® vaccine in patients with ovarian cancer.

PubMed

Leffers, Ninke; Vermeij, Renee; Hoogeboom, Baukje-Nynke; Schulze, Ute R; Wolf, Rinze; Hamming, Ineke E; van der Zee, Ate G; Melief, Kees J; van der Burg, Sjoerd H; Daemen, Toos; Nijman, Hans W

2012-01-01

Vaccine-induced p53-specific immune responses were previously reported to be associated with improved response to secondary chemotherapy in patients with small cell lung cancer. We investigated long-term clinical and immunological effects of the p53-synthetic long peptide (p53-SLP®) vaccine in patients with recurrent ovarian cancer. Twenty patients were immunized with the p53-SLP® vaccine between July 2006 and August 2007. Follow-up information on patients was obtained. Clinical responses to secondary chemotherapy after p53-SLP® immunizations were determined by computerized tomography and/or tumor marker levels (CA125). Disease-specific survival was compared to a matched historical control group. Immune responses were analyzed by flow cytometry, proliferation assay, interferon gamma (IFN-γ) ELISPOT and/or cytokine bead array. Lymphocytes cultured from skin biopsy were analyzed by flow cytometry and proliferation assay. Of 20 patients treated with the p53-SLP® vaccine, 17 were subsequently treated with chemotherapy. Eight of these patients volunteered another blood sample. No differences in clinical response rates to secondary chemotherapy or disease-specific survival were observed between immunized patients and historical controls (p = 0.925, resp. p = 0.601). p53-specific proliferative responses were observed in 5/8 patients and IFN-γ production in 2/7 patients. Lymphocytes cultured from a prior injection site showing inflammation during chemotherapy did not recognize p53-SLP®. Thus, treatment with the p53-SLP® vaccine does not affect responses to secondary chemotherapy or survival, although p53-specific T-cells do survive chemotherapy. Copyright © 2011 UICC.

Occupational stress and suicidality among firefighters: Examining the buffering role of distress tolerance.

PubMed

Stanley, Ian H; Boffa, Joseph W; Smith, Lia J; Tran, Jana K; Schmidt, N Brad; Joiner, Thomas E; Vujanovic, Anka A

2018-05-24

Past research indicates that firefighters are at increased risk for suicide. Firefighter-specific occupational stress may contribute to elevated suicidality. Among a large sample of firefighters, this study examined if occupational stress is associated with multiple indicators of suicide risk, and whether distress tolerance, the perceived and/or actual ability to endure negative emotional or physical states, attenuates these associations. A total of 831 firefighters participated (mean [SD] age = 38.37y[8.53y]; 94.5% male; 75.2% White). The Sources of Occupational Stress-14 (SOOS-14), Distress Tolerance Scale (DTS), and Suicidal Behaviors Questionnaire-Revised (SBQ-R) were utilized to examine firefighter-specific occupational stress, distress tolerance, and suicidality, respectively. Consistent with predictions, occupational stress interacted with distress tolerance, such that the effects of occupational stress on suicide risk, broadly, as well as lifetime suicide threats and current suicidal intent, specifically, were attenuated at high levels of distress tolerance. Distress tolerance may buffer the effects of occupational stress on suicidality among firefighters. Pending replication, findings suggest that distress tolerance may be a viable target for suicide prevention initiatives within the fire service. Copyright © 2018 Elsevier B.V. All rights reserved.

Reciprocal regulation of p53 and malic enzymes modulates metabolism and senescence.

PubMed

Jiang, Peng; Du, Wenjing; Mancuso, Anthony; Wellen, Kathryn E; Yang, Xiaolu

2013-01-31

Cellular senescence both protects multicellular organisms from cancer and contributes to their ageing. The pre-eminent tumour suppressor p53 has an important role in the induction and maintenance of senescence, but how it carries out this function remains poorly understood. In addition, although increasing evidence supports the idea that metabolic changes underlie many cell-fate decisions and p53-mediated tumour suppression, few connections between metabolic enzymes and senescence have been established. Here we describe a new mechanism by which p53 links these functions. We show that p53 represses the expression of the tricarboxylic-acid-cycle-associated malic enzymes ME1 and ME2 in human and mouse cells. Both malic enzymes are important for NADPH production, lipogenesis and glutamine metabolism, but ME2 has a more profound effect. Through the inhibition of malic enzymes, p53 regulates cell metabolism and proliferation. Downregulation of ME1 and ME2 reciprocally activates p53 through distinct MDM2- and AMP-activated protein kinase-mediated mechanisms in a feed-forward manner, bolstering this pathway and enhancing p53 activation. Downregulation of ME1 and ME2 also modulates the outcome of p53 activation, leading to strong induction of senescence, but not apoptosis, whereas enforced expression of either malic enzyme suppresses senescence. Our findings define physiological functions of malic enzymes, demonstrate a positive-feedback mechanism that sustains p53 activation, and reveal a connection between metabolism and senescence mediated by p53.

Structural studies of p53 inactivation by DNA-contact mutations and its rescue by suppressor mutations via alternative protein–DNA interactions

PubMed Central

Eldar, Amir; Rozenberg, Haim; Diskin-Posner, Yael; Rohs, Remo; Shakked, Zippora

2013-01-01

A p53 hot-spot mutation found frequently in human cancer is the replacement of R273 by histidine or cysteine residues resulting in p53 loss of function as a tumor suppressor. These mutants can be reactivated by the incorporation of second-site suppressor mutations. Here, we present high-resolution crystal structures of the p53 core domains of the cancer-related proteins, the rescued proteins and their complexes with DNA. The structures show that inactivation of p53 results from the incapacity of the mutated residues to form stabilizing interactions with the DNA backbone, and that reactivation is achieved through alternative interactions formed by the suppressor mutations. Detailed structural and computational analysis demonstrates that the rescued p53 complexes are not fully restored in terms of DNA structure and its interface with p53. Contrary to our previously studied wild-type (wt) p53-DNA complexes showing non-canonical Hoogsteen A/T base pairs of the DNA helix that lead to local minor-groove narrowing and enhanced electrostatic interactions with p53, the current structures display Watson–Crick base pairs associated with direct or water-mediated hydrogen bonds with p53 at the minor groove. These findings highlight the pivotal role played by R273 residues in supporting the unique geometry of the DNA target and its sequence-specific complex with p53. PMID:23863845

Abrogation of p53 by its antisense in MCF-7 breast carcinoma cells increases cyclin D1 via activation of Akt and promotion of cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chhipa, Rishi Raj; Kumari, Ratna; Upadhyay, Ankur Kumar

2007-11-15

The p53 protein has been a subject of intense research interest since its discovery as about 50% of human cancers carry p53 mutations. Mutations in the p53 gene are the most frequent genetic lesions in breast cancers suggesting a critical role of p53 in breast cancer development, growth and chemosensitivity. This report describes the derivation and characterization of MCF-7As53, an isogenic cell line derived from MCF-7 breast carcinoma cells in which p53 was abrogated by antisense p53 cDNA. Similar to MCF-7 and simultaneously selected hygromycin resistant MCF-7H cells, MCF-7As53 cells have consistent basal epithelial phenotype, morphology, and estrogen receptor expressionmore » levels at normal growth conditions. Present work documents investigation of molecular variations, growth kinetics, and cell cycle related studies in relation to absence of wild-type p53 protein and its transactivation potential as well. Even though wild-type tumor suppressor p53 is an activator of cell growth arrest and apoptosis-mediator genes such as p21, Bax, and GADD45 in MCF-7As53 cells, no alterations in expression levels of these genes were detected. The doubling time of these cells decreased due to depletion of G0/G1 cell phase because of constitutive activation of Akt and increase in cyclin D1 protein levels. This proliferative property was abrogated by wortmannin, an inhibitor of PI3-K/Akt signaling pathway. Therefore this p53 null cell line indicates that p53 is an indispensable component of cellular signaling system which is regulated by caveolin-1 expression, involving Akt activation and increase in cyclin D1, thereby promoting proliferation of breast cancer cells.« less

Postprandial plasma incretin hormones in exercise-trained versus untrained subjects.

PubMed

Weiss, Edward P; Royer, Nathaniel K; Fisher, Jonathan S; Holloszy, John O; Fontana, Luigi

2014-06-01

After food ingestion, the incretin hormones, glucagon-like peptide-1 (GLP-1) and glucose-dependent insulinotropic polypeptide (GIP), are secreted by the intestines into circulation where they act on the pancreas to promote insulin secretion. We evaluated the hypothesis that low postprandial plasma insulin levels in lean exercise-trained individuals are associated with low concentrations of incretin hormones. A cross-sectional study was performed to compare postprandial incretin hormone levels in lean endurance exercise-trained individuals (EX; n = 14, ≥40 yr) and age- and sex-matched, nonobese, sedentary control subjects (CON, n = 14). The main outcome measures were GLP-1, GIP, insulin, and glucose incremental areas under the curve (AUC) as measured in plasma samples collected during a 2-h,75-g oral glucose tolerance test (OGTT). The EX group had lower body fat percentage (14.6% ± 1.1% vs 23.3% ± 1.7%, P = 0.0002) and higher maximal oxygen uptake (53 ± 2 vs 34 ± 2, P < 0.0001) than CON. Glucose AUC did not differ between groups (P = 0.20). Insulin AUC was lower in EX (2.5 ± 0.5 vs 4.2 ± 1.2 μU·mL·1000 min, P = 0.02). No differences were observed between groups (EX and CON, respectively) for GLP-1 AUC (3.5 ± 0.7 vs 4.1 ± 1.1 pmol·min·100 L, P = 0.61) or GIP AUC (19.2 ± 1.4 vs 18.0 ± 1.4 pg·min·1000 mL; P = 0.56). In CON, insulin AUC was correlated with AUC for GLP-1 (r = 0.53, P = 0.05) and GIP (r = 0.71, P = 0.004), but no such correlations were observed in EX (both P ≥ 0.67). Low postprandial insulin levels in lean exercise-trained individuals are not attributable to lower incretin hormone concentrations. However, exercise may decrease the dependency of postprandial insulin levels on incretin hormones.

Modeling the Etiology of p53-mutated Cancer Cells*

PubMed Central

Perez, Ricardo E.; Shen, Hong; Duan, Lei; Kim, Reuben H.; Kim, Terresa; Park, No-Hee; Maki, Carl G.

2016-01-01

p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds. PMID:27022024

Molecular Mechanism of Mutant p53 Stabilization: The Role of HSP70 and MDM2

PubMed Central

Wiech, Milena; Olszewski, Maciej B.; Tracz-Gaszewska, Zuzanna; Wawrzynow, Bartosz; Zylicz, Maciej; Zylicz, Alicja

2012-01-01

Numerous p53 missense mutations possess gain-of-function activities. Studies in mouse models have demonstrated that the stabilization of p53 R172H (R175H in human) mutant protein, by currently unknown factors, is a prerequisite for its oncogenic gain-of-function phenotype such as tumour progression and metastasis. Here we show that MDM2-dependent ubiquitination and degradation of p53 R175H mutant protein in mouse embryonic fibroblasts is partially inhibited by increasing concentration of heat shock protein 70 (HSP70/HSPA1-A). These phenomena correlate well with the appearance of HSP70-dependent folding intermediates in the form of dynamic cytoplasmic spots containing aggregate-prone p53 R175H and several molecular chaperones. We propose that a transient but recurrent interaction with HSP70 may lead to an increase in mutant p53 protein half-life. In the presence of MDM2 these pseudoaggregates can form stable amyloid-like structures, which occasionally merge into an aggresome. Interestingly, formation of folding intermediates is not observed in the presence of HSC70/HSPA8, the dominant-negative K71S variant of HSP70 or HSP70 inhibitor. In cancer cells, where endogenous HSP70 levels are already elevated, mutant p53 protein forms nuclear aggregates without the addition of exogenous HSP70. Aggregates containing p53 are also visible under conditions where p53 is partially unfolded: 37°C for temperature-sensitive variant p53 V143A and 42°C for wild-type p53. Refolding kinetics of p53 indicate that HSP70 causes transient exposure of p53 aggregate-prone domain(s). We propose that formation of HSP70- and MDM2-dependent protein coaggregates in tumours with high levels of these two proteins could be one of the mechanisms by which mutant p53 is stabilized. Moreover, sequestration of p73 tumour suppressor protein by these nuclear aggregates may lead to gain-of-function phenotypes. PMID:23251530

pH tolerance in freshwater bacterioplankton: trait variation of the community as measured by leucine incorporation.

PubMed

Bååth, Erland; Kritzberg, Emma

2015-11-01

pH is an important factor determining bacterial community composition in soil and water. We have directly determined the community tolerance (trait variation) to pH in communities from 22 lakes and streams ranging in pH from 4 to 9 using a growth-based method not relying on distinguishing between individual populations. The pH in the water samples was altered to up to 16 pH values, covering in situ pH ± 2.5 U, and the tolerance was assessed by measuring bacterial growth (Leu incorporation) instantaneously after pH adjustment. The resulting unimodal response curves, reflecting community tolerance to pH, were well modeled with a double logistic equation (mean R(2) = 0.97). The optimal pH for growth (pHopt) among the bacterial communities was closely correlated with in situ pH, with a slope (0.89 ± 0.099) close to unity. The pH interval, in which growth was ≥90% of that at pHopt, was 1.1 to 3 pH units wide (mean 2.0 pH units). Tolerance response curves of communities originating from circum-neutral pH were symmetrical, whereas in high-pH (8.9) and especially in low-pH (<5.5) waters, asymmetric tolerance curves were found. In low-pH waters, decreasing pH was more detrimental for bacterial growth than increasing pH, with a tendency for the opposite for high-pH waters. A pH tolerance index, using the ratio of growth at only two pH values (pH 4 and 8), was closely related to pHopt (R(2) = 0.83), allowing for easy determination of pH tolerance during rapid changes in pH. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Prognostic Value of Abnormal p53 Expression in Locally Advanced Prostate Cancer Treated With Androgen Deprivation and Radiotherapy: A Study Based on RTOG 9202

DOE Office of Scientific and Technical Information (OSTI.GOV)

Che Mingxin; DeSilvio, Michelle; Pollack, Alan

2007-11-15

Purpose: The goal of this study was to verify the significance of p53 as a prognostic factor in Radiation Therapy Oncology Group 9202, which compared short-term androgen deprivation (STAD) with radiation therapy (RT) to long-term androgen deprivation + RT in men with locally advanced prostate cancer (Pca). Methods and Materials: Tumor tissue was sufficient for p53 analysis in 777 cases. p53 status was determined by immunohistochemistry. Abnormal p53 expression was defined as 20% or more tumor cells with positive nuclei. Univariate and multivariate Cox proportional hazards models were used to evaluate the relationships of p53 status to patient outcomes. Results:more » Abnormal p53 was detected in 168 of 777 (21.6%) cases, and was significantly associated with cause-specific mortality (adjusted hazard ratio [HR] = 1.89; 95% confidence interval (CI) 1.14 - 3.14; p = 0.014) and distant metastasis (adjusted HR = 1.72; 95% CI 1.13-2.62; p = 0.013). When patients were divided into subgroups according to assigned treatment, only the subgroup of patients who underwent STAD + RT showed significant correlation between p53 status and cause-specific mortality (adjusted HR = 2.43; 95% CI = 1.32-4.49; p = 0.0044). When patients were divided into subgroups according to p53 status, only the subgroup of patients with abnormal p53 showed significant association between assigned treatment and cause-specific mortality (adjusted HR = 3.81; 95% CI 1.40-10.37; p = 0.0087). Conclusions: Abnormal p53 is a significant prognostic factor for patients with prostate cancer who undergo short-term androgen deprivation and radiotherapy. Long-term androgen deprivation may significantly improve the cause-specific survival for those with abnormal p53.« less

Thymidilate synthase and p53 primary tumour expression as predictive factors for advanced colorectal cancer patients

PubMed Central

Paradiso, A; Simone, G; Petroni, S; Leone, B; Vallejo, C; Lacava, J; Romero, A; Machiavelli, M; Lena, M De; Allegra, C J; Johnston, P G

2000-01-01

The purpose of this work was to analyse the ability of p53 and thymidilate synthase (TS) primary tumour expression to retrospectively predict clinical response to chemotherapy and long-term prognosis in patients with advanced colorectal cancers homogeneously treated by methotrexate (MTX)-modulated–5-fluorouracil (5-FU-FA). A total of 108 advanced colorectal cancer patients entered the present retrospective study. Immunohistochemical p53 (pAb 1801 mAb) and TS (TS106 mAb) expression on formalin-fixed paraffin-embedded primary tumour specimens was related to probability of clinical response to chemotherapy, time to progression and overall survival. p53 was expressed in 53/108 (49%) tumours, while 54/108 (50%) showed TS immunostaining. No relationship was demonstrated between p53 positivity and clinical response to chemotherapy (objective response (OR): 20% vs 23%, in p53+ and p53– cases respectively) or overall survival. Percent of OR was significantly higher in TS-negative with respect to TS-positive tumours (30% vs 15% respectively;P< 0.04); simultaneous analysis of TS and p53 indicated 7% OR for p53-positive/TS-positive tumours vs 46% for p53-positive/TS-negative tumours (P< 0.03). Logistic regression analysis confirmed a significant association between TS tumour status and clinical response to chemotherapy (hazard ratio (HR): 2.91; 95% confidence interval (CI) 8.34–1.01; two-sided P< 0.05). A multivariate analysis of overall survival showed that only a small number of metastatic sites was statistically relevant (HR 1.89; 95% CI 2.85–1.26; two-sided P< 0.03). Our study suggests that immunohistochemical expression of p53 and TS could assist the clinician in predicting response of colorectal cancer patients to modulated MTX-5-FU therapy. © 2000 Cancer Research Campaign PMID:10682666

Integrated High Throughput Analysis Identifies GSK3 as a Crucial Determinant of p53-Mediated Apoptosis in Lung Cancer Cells.

PubMed

Zhang, Yu; Zhu, Chenyang; Sun, Bangyao; Lv, Jiawei; Liu, Zhonghua; Liu, Shengwang; Li, Hai

2017-01-01

p53 dysfunction is frequently observed in lung cancer. Although restoring the tumour suppressor function of p53 is recently approved as a putative strategy for combating cancers, the lack of understanding of the molecular mechanism underlying p53-mediated lung cancer suppression has limited the application of p53-based therapies in lung cancer. Using RNA sequencing, we determined the transcriptional profile of human non-small cell lung carcinoma A549 cells after treatment with two p53-activating chemical compounds, nutlin and RITA, which could induce A549 cell cycle arrest and apoptosis, respectively. Bioinformatics analysis of genome-wide gene expression data showed that distinct transcription profiles were induced by nutlin and RITA and 66 pathways were differentially regulated by these two compounds. However, only two of these pathways, 'Adherens junction' and 'Axon guidance', were found to be synthetic lethal with p53 re-activation, as determined via integrated analysis of genome-wide gene expression profile and short hairpin RNA (shRNA) screening. Further functional protein association analysis of significantly regulated genes associated with these two synthetic lethal pathways indicated that GSK3 played a key role in p53-mediated A549 cell apoptosis, and then gene function study was performed, which revealed that GSK3 inhibition promoted p53-mediated A549 cell apoptosis in a p53 post-translational activity-dependent manner. Our findings provide us with new insights regarding the mechanism by which p53 mediates A549 apoptosis and may cast light on the development of more efficient p53-based strategies for treating lung cancer. © 201 The Author(s). Published by S. Karger AG, Basel.

Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yi Fuming; Saha, Abhik; Murakami, Masanao

The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less

Changes in O-Linked N-Acetylglucosamine (O-GlcNAc) Homeostasis Activate the p53 Pathway in Ovarian Cancer Cells*

PubMed Central

de Queiroz, Rafaela Muniz; Madan, Rashna; Chien, Jeremy; Dias, Wagner Barbosa; Slawson, Chad

2016-01-01

O-GlcNAcylation is a dynamic post-translational modification consisting of the addition of a single N-acetylglucosamine sugar to serine and threonine residues in proteins by the enzyme O-linked β-N-acetylglucosamine transferase (OGT), whereas the enzyme O-GlcNAcase (OGA) removes the modification. In cancer, tumor samples present with altered O-GlcNAcylation; however, changes in O-GlcNAcylation are not consistent between tumor types. Interestingly, the tumor suppressor p53 is modified by O-GlcNAc, and most solid tumors contain mutations in p53 leading to the loss of p53 function. Because ovarian cancer has a high frequency of p53 mutation rates, we decided to investigate the relationship between O-GlcNAcylation and p53 function in ovarian cancer. We measured a significant decrease in O-GlcNAcylation of tumor tissue in an ovarian tumor microarray. Furthermore, O-GlcNAcylation was increased, and OGA protein and mRNA levels were decreased in ovarian tumor cell lines not expressing the protein p53. Treatment with the OGA inhibitor Thiamet-G (TMG), silencing of OGA, or overexpression of OGA and OGT led to p53 stabilization, increased nuclear localization, and increased protein and mRNA levels of p53 target genes. These data suggest that changes in O-GlcNAc homeostasis activate the p53 pathway. Combination treatment of the chemotherapeutic cisplatin with TMG decreased tumor cell growth and enhanced cell cycle arrest without impairing cytotoxicity. The effects of TMG on tumor cell growth were partially dependent on wild type p53 activation. In conclusion, changes in O-GlcNAc homeostasis activate the wild type p53 pathway in ovarian cancer cells, and OGA inhibition has the potential as an adjuvant treatment for ovarian carcinoma. PMID:27402830

Dual targeting of wild-type and mutant p53 by small molecule RITA results in the inhibition of N-Myc and key survival oncogenes and kills neuroblastoma cells in vivo and in vitro.

PubMed

Burmakin, Mikhail; Shi, Yao; Hedström, Elisabeth; Kogner, Per; Selivanova, Galina

2013-09-15

Restoration of the p53 function in tumors is a promising therapeutic strategy due to the high potential of p53 as tumor suppressor and the fact that established tumors depend on p53 inactivation for their survival. Here, we addressed the question whether small molecule RITA can reactivate p53 in neuroblastoma and suppress the growth of neuroblastoma cells in vitro and in vivo. The ability of RITA to inhibit growth and to induce apoptosis was shown in seven neuroblastoma cell lines. Mechanistic studies were carried out to determine the p53 dependence and the molecular mechanism of RITA-induced apoptosis in neuroblastoma, using cell viability assays, RNAi silencing, co-immunoprecipitation, qPCR, and Western blotting analysis. In vivo experiments were conducted to study the effect of RITA on human neuroblastoma xenografts in mice. RITA induced p53-dependent apoptosis in a set of seven neuroblastoma cell lines, carrying wild-type or mutant p53; it activated p53 and triggered the expression of proapoptotic p53 target genes. Importantly, p53 activated by RITA inhibited several key oncogenes that are high-priority targets for pharmacologic anticancer strategies in neuroblastoma, including N-Myc, Aurora kinase, Mcl-1, Bcl-2, Wip-1, MDM2, and MDMX. Moreover, RITA had a strong antitumor effect in vivo. Reactivation of wild-type and mutant p53 resulting in the induction of proapoptotic factors along with ablation of key oncogenes by compounds such as RITA may be a highly effective strategy to treat neuroblastoma. ©2013 AACR.

Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leão, Mariana; Gomes, Sara; Bessa, Cláudia

In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either permore » se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.« less

The influence of SV40 immortalization of human fibroblasts on p53-dependent radiation responses

NASA Technical Reports Server (NTRS)

Kohli, M.; Jorgensen, T. J.

1999-01-01

The simian virus 40 large tumor antigen (SV40 Tag) has been ascribed many functions critical to viral propagation, including binding to the mammalian tumor suppressor p53. Recent studies have demonstrated that SV40-transformed murine cells have functional p53. The status of p53 in SV40-immortalized human cells, however, has not been characterized. We have found that in response to ionizing radiation, p53-dependent p21 transactivation activity is present, albeit reduced, in SV40-immortalized cells and that this activity can be further reduced with either dominant negative p53 expression or higher SV40 Tag expression. Furthermore, overexpression of p53 in SV40-immortalized ataxia-telangiectasia (A-T) cells restores p53-dependent p21 induction to typical A-T levels. All SV40-immortalized cell lines exhibited an absence of G1 arrest. Moreover, all SV40-immortalized cell lines exhibited increased apoptosis relative to primary cells in response to ionizing radiation, suggesting that SV40 immortalization results in a unique phenotype with regard to DNA damage responses. Copyright 1999 Academic Press.

Clinical benefit in Fabry patients given enzyme replacement therapy--a case series.

PubMed

Guffon, N; Fouilhoux, A

2004-01-01

Fabry disease is a rare lysosomal storage disorder resulting from deficient activity of alpha-galactosidase A and subsequent pathological accumulation of glycosphingolipids throughout the body. Traditionally, Fabry disease was managed symptomatically, but the introduction of enzyme replacement therapies (ERTs) (agalsidase beta (Fabrazyme); agalsidase alfa (Replagal)) has transformed treatment of this disorder. Clinical studies of both compounds have demonstrated clearance of glycosphingolipds from key tissues. To explore whether substrate clearance translates into clinical benefit, a retrospective survey of 17 patients (mean age 34.7 years) treated with agalsidase beta (1 mg/kg every 2 weeks) was undertaken, using an eight-item retrospective questionnaire developed specifically to assess the effect of ERT on the symptoms of Fabry disease. Pain severity, heat tolerance, physical activity, fatigue and psychological status were scored using a 10-point visual analogue scale (e.g. for pain severity: 1=none, 10=strong). Answers to all other questions were quantitative. Changes in mean scores were 4.69 to 2.25 (p =0.012) for pain severity; 4.38 to 2.21 (p =0.019) for number of pain crises per month; 8.69 to 2.98 (p =0.097) for duration of pain crises in hours; 2.76 to 5.76 (p =0.002) for heat tolerance; 3.28 to 2.51 (p =0.058) for bowel movements per day; 2.47 to 4.47 (p =0.007) for frequency of physical activity; 5.53 to 3.71 (p =0.046) for fatigue, and 5.82 to 8.12 (p =0.005) for psychological status. All patients improved in at least one aspect, although the degree of improvement across patients and aspects varied widely; reasons for this remain unclear. Despite the inherent bias involved in retrospective questionnaires, we believe that the findings are encouraging. A prospective version of the questionnaire is currently under validation.

Electrical stimulation (ES) in the management of sexual pain disorders.

PubMed

Nappi, Rossella E; Ferdeghini, Francesea; Abbiati, Ileana; Vercesi, Claudia; Farina, Claudio; Polatti, Franco

2003-01-01

We performed an open study to investigate the use of electrical stimulation (ES) on the vestibular area and vaginal introitus in women with sexual pain disorders. We recruited 29 women (age range 20-45 years) from among the patients at our Reproductive Psychobiology Unit to participate in the present study. They each experienced vestibular pain, inducing dyspareunia and vaginism. We performed ES with an ECL43400 apparatus (Elite, EssediEsse srl, Milan, Italy) once a week for 10 weeks. To evaluate the muscular activity of the perineal floor and sexual function, we employed the same apparatus with a vaginal probe for recording myoelectrical activity (muV), we employed a VAS scale for evaluating pain, and we administered the Female Sexual Function Index (FSFI; Rosen et al., 2000) before and after the study protocol. We analyzed data by parametric and nonparametric comparisons and correlations, as appropriate. Our major findings were as follows: (a) the contractile ability of pelvic floor muscles (p < 0.001), as well as the resting ability (p < 0.001), significantly improved following ES; (b) the current intensity tolerated significantly increased (p < 0.001) throughout the study, from 41.3 +/- 7.4 mA at the start of the study to 50 +/- 7.4 mA at the end of the stimulation protocol; (c) the Visual Analogic Scale (VAS) for pain significantly declined (p < 0.001), whereas FSFI pain scores (p < 0.001) and full scale scores (p < 0.001) significantly improved following ES, and 4 out of 9 women with vaginism went back to coital activity; (d) FSFI pain score and the current intensity tolerated, both before (R = .59; p < 0.006) and at the end (R = .53; p < 0.02) of the stimulation protocol, positively correlated. ES may be effective in the management of sexual pain disorders. Further controlled studies are necessary to standardize stimulation protocols according to the severity of pain and to better clarify the long-term clinical effects of ES.

Pharmacological characterization of the bifunctional opioid ligand H-Dmt-Tic-Gly-NH-Bzl (UFP-505).

PubMed

Dietis, N; McDonald, J; Molinari, S; Calo, G; Guerrini, R; Rowbotham, D J; Lambert, D G

2012-02-01

While producing good-quality analgesia, µ-opioid (MOP) receptor activation produces a number of side-effects including tolerance. Simultaneous blockade of δ-opioid (DOP) receptors has been shown to reduce tolerance to morphine. Here, we characterize a prototype bifunctional opioid H-Dmt-Tic-Gly-NH-Bzl (UFP-505). We measured receptor binding affinity in Chinese hamster ovary (CHO) cells expressing recombinant human MOP, DOP, k-opioid (KOP), nociceptin/orphanin (NOP) receptors. For activation, we measured the binding of GTPγ(35)S to membranes from CHO(hMOP), CHO(hDOP), rat cerebrocortex, and rat spinal cord. In addition, we assessed 'end organ' responses in the guinea pig ileum and mouse vas deferens. UFP-505 bound to CHO(hMOP) and CHO(hDOP) with (binding affinity) pK(i) values of 7.79 and 9.82, respectively. There was a weak interaction at KOP and NOP (pK(i) 6.29 and 5.86). At CHO(hMOP), UFP-505 stimulated GTPγ(35)S binding with potency (pEC(50)) of 6.37 and in CHO(hDOP) reversed the effects of a DOP agonist with affinity (pK(b)) of 9.81 (in agreement with pK(i) at DOP). UFP-505 also stimulated GTPγ(35)S binding in rat cerebrocortex and spinal cord with pEC(50) values of 6.11-6.53. In the guinea pig ileum (MOP-rich preparation), UFP-505 inhibited contractility with pEC(50) of 7.50 and in the vas deferens (DOP-rich preparation) reversed the effects of a DOP agonist with an affinity (pA(2)) of 9.15. We have shown in a range of preparations and assays that UFP-505 behaves as a potent MOP agonist and DOP antagonist; a MOP/DOP bifunctional opioid. Further studies in dual expression systems and whole animals with this prototype are warranted.

Transduction of Recombinant M3-p53-R12 Protein Enhances Human Leukemia Cell Apoptosis

PubMed Central

Lu, Tsung Chi; Zhao, Guan- Hao; Chen, Yao Yun; Chien, Chia-Ying; Huang, Chi-Hung; Lin, Kwang Hui; Chen, Shen Liang

2016-01-01

Tumor suppressor protein p53 plays important roles in initiating cell cycle arrest and promoting tumor cell apoptosis. Previous studies have shown that p53 is either mutated or defective in approximately 50% of human cancers; therefore restoring normal p53 activity in cancer cells might be an effective anticancer therapeutic approach. Herein, we designed a chimeric p53 protein flanked with the MyoD N-terminal transcriptional activation domain (amino acids 1-62, called M3) and a poly-arginine (R12) cell penetrating signal in its N-and C-termini respectively. This chimeric protein, M3-p53-R12, can be expressed in E. coli and purified using immobilized metal ion chromatography followed by serial refolding dialysis. The purified M3-p53-R12 protein retains DNA-binding activity and gains of cell penetrating ability. Using MTT assay, we demonstrated that M3-p53-R12 inhibited the growth of K562, Jurkat as well as HL-60 leukemia cells carrying mutant p53 genes. Results from FACS analysis also demonstrated that transduction of M3-p53-R12 protein induced cell cycle arrest of these leukemia cells. Of special note, M3-p53-R12 has no apoptotic effect on normal mesenchymal stem cells (MSC) and leukocytes, highlighting its differential effects on normal and tumor cells. To sum up, our results reveal that purified recombinant M3-p53-R12 protein has functions of suppressing the leukemia cell lines' proliferation and launching cell apoptosis, suggesting the feasibility of using M3-p53-R12 protein as an anticancer drug. In the future we will test whether this chimeric protein can preferentially trigger the death of malignant cancer cells without affecting normal cells in animals carrying endogenous or xenographic tumors. PMID:27390612

Bcl-2 protein expression associated with resistance to apoptosis in clear cell adenocarcinomas of the vagina and cervix expressing wild-type p53.

PubMed

Waggoner, S E; Baunoch, D A; Anderson, S A; Leigh, F; Zagaja, V G

1998-09-01

Clear cell adenocarcinomas (CCAs) of the vagina and cervix are rare tumors that often overexpress wild-type p53. In vitro, expression of protooncogene bcl-2 can block p53-mediated apoptosis. The objective of this study was to determine if bcl-2 is expressed in CCAs and whether this expression is associated with inhibition of apoptosis. Twenty-one paraffin-embedded clear cell adenocarcinomas were immunohistochemically stained for bcl-2 (antibody M 887, Dako, Carpinteria, CA) and DNA fragmentation (ApopTag, Oncor, Gaithersburg, MD), a marker for apoptosis. Fifteen tumors were associated with in utero exposure to diethylstilbestrol (DES). Prior p53 gene analysis had indicated the presence of wild-type p53 in each tumor. Human lymphoid tissue containing bcl-2-expressing lymphocytes and DNase I-exposed CCA tissue sections were used as positive controls for the bcl-2 and apoptosis assays, respectively. Expression of bcl-2 and DNA fragmentation was classified (0 to 3+) according to percentage of positive cells and intensity of staining. Expression of bcl-2 was identified in each CCA examined, and was strongly positive (2+ to 3+) in 18 of 21 samples. Despite the presence of wild-type p53, only 4 of 21 tumors showed evidence of apoptosis as assessed through DNA fragmentation. DNA damage leads to increased intracellular p53 levels. Overexpression of p53 induces apoptosis as a means of protecting organisms from the development of malignancy. CCAs of the vagina and cervix, which contain wild-type p53 genes and often overexpress p53 protein, presumably have evolved mechanisms to avoid p53-induced apoptosis. Our observations are consistent with the hypothesis that overexpression of bcl-2 can inhibit p53-mediated apoptosis and suggest a mechanism by which these rare tumors can arise without mutation of the p53 gene.

p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.

PubMed

Cox, Darren P

2012-01-01

Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cappadone, C., E-mail: concettina.cappadone@unibo.it; Stefanelli, C.; Malucelli, E.

2015-11-13

Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of themore » cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.« less

A study on the effect of Helicobacter pylori infection on p53 expression in gastric cancer and gastritis tissues.

PubMed

Salih, Barik A; Gucin, Zuhal; Bayyurt, Nizamettin

2013-09-16

Helicobacter pylori cause damage to gastric epithelial cells and alterations in the p53 gene that lead to cancer development. This study aimed to determine the correlation of p53 expression with H. pylori using immunohistochemistry, RFLP-PCR, and histopathology. Gastric biopsy samples from gastric cancer (GC) (n = 54) and gastritis (n = 31) patients were examined for histopathological changes and expression of p53 protein by immunohistochemistry. Immunohistochemical analysis of p53 protein expression in H. pylori-positive GC sections showed an average of 44.3% positive cells in tumors and 6.9% in normal tissues, as compared to 16.4% and 4.4% in H. pylori-negative sections. P53 expression showed significant association with H. pylori (P = 0.005), invasion depth (P = 0.029) and inflammation reaction (P = 0.008). In gastritis sections, no difference in the average p53 staining in H. pylori-positive or -negative sections was seen. PCR-RFLP results also showed no difference in genotype frequencies of p53 in H. pylori-positive or -negative gastritis sections. Histopathology study of H. pylori-positive GC sections showed that 97.2% were the intestinal type and 2.8% the diffuse type, while in H. pylori-negative sections 35.2% were the intestinal type and 64.8% the diffuse type. Biopsy sections from H. pylori-positive gastritis patients revealed more severe inflammation than those of H. pylori-negative patients. Our results show that H. pylori infection affects p53 expression in GC. The average p53 expression was significantly higher in tumor than in normal tissues. In gastritis sections p53 expression was significantly associated with H. pylori.

ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53

PubMed Central

Sullivan, Kelly D.; Padilla-Just, Nuria; Henry, Ryan E.; Porter, Christopher C.; Kim, Jihye; Tentler, John J.; Eckhardt, S. Gail; Tan, Aik Choon; DeGregori, James; Espinosa, Joaquín M.

2012-01-01

The p53 tumor suppressor orchestrates alternative stress responses including cell cycle arrest and apoptosis, but the mechanisms defining cell fate upon p53 activation are poorly understood. Several small molecule activators of p53 have been developed, including Nutlin-3, but their therapeutic potential is limited by the fact that they induce reversible cell cycle arrest in most cancer cell types. We report here the results of a ‘Synthetic Lethal with Nutlin-3’ genome-wide shRNA screen, which revealed that the ATM and MET kinases govern cell fate choice upon p53 activation. Genetic or pharmacological interference with ATM or MET activity converts the cellular response from cell cycle arrest into apoptosis in diverse cancer cell types without affecting expression of key p53 target genes. ATM and MET inhibitors enable Nutlin-3 to kill tumor spheroids. These results identify novel pathways controlling the cellular response to p53 activation and aid in the design of p53-based therapies. PMID:22660439

p53 regulates the mevalonate pathway in human glioblastoma multiforme

PubMed Central

Laezza, C; D'Alessandro, A; Di Croce, L; Picardi, P; Ciaglia, E; Pisanti, S; Malfitano, A M; Comegna, M; Faraonio, R; Gazzerro, P; Bifulco, M

2015-01-01

The mevalonate (MVA) pathway is an important metabolic pathway implicated in multiple aspects of tumorigenesis. In this study, we provided evidence that p53 induces the expression of a group of enzymes of the MVA pathway including 3′-hydroxy-3′-methylglutaryl-coenzyme A reductase, MVA kinase, farnesyl diphosphate synthase and farnesyl diphosphate farnesyl transferase 1, in the human glioblastoma multiforme cell line, U343 cells, and in normal human astrocytes, NHAs. Genetic and pharmacologic perturbation of p53 directly influences the expression of these genes. Furthermore, p53 is recruited to the gene promoters in designated p53-responsive elements, thereby increasing their transcription. Such effect was abolished by site-directed mutagenesis in the p53-responsive element of promoter of the genes. These findings highlight another aspect of p53 functions unrelated to tumor suppression and suggest p53 as a novel regulator of the MVA pathway providing insight into the role of this pathway in cancer progression. PMID:26469958

p53 mutation and expression in lymphoma.

PubMed Central

Adamson, D. J.; Thompson, W. D.; Dawson, A. A.; Bennett, B.; Haites, N. E.

1995-01-01

Mutation and abnormal expression of p53 was studied in 38 lymphomas [five Hodgkin's disease and 33 non-Hodgkin's lymphoma (NHL)]. CM1 polyclonal antibody was used to detect overexpression of p53. Three missense mutations were characterised in three cases of NHL after screening exons 5-8 of p53 of all the tumours with single-strand conformation polymorphism (SSCP) analysis. Only two out of three tumours with a missense mutation showed abnormal expression of p53 as measured by CM1. Conversely, seven out of nine tumours with positive CM1 staining had no point mutation demonstrated. Overexpression of p53 in the cases of NHL occurred in three out of twenty four low-grade tumours and five out of nine high-grade tumours (Kiel classification). The results suggest that abnormalities of p53 are commoner in high-grade than low-grade NHL, and that positive immunocytochemistry cannot be used to determine which tumours have mutations of p53. Images Figure 1 Figure 2 PMID:7599045

The tumour suppressor CYLD regulates the p53 DNA damage response

PubMed Central

Fernández-Majada, Vanesa; Welz, Patrick-Simon; Ermolaeva, Maria A.; Schell, Michael; Adam, Alexander; Dietlein, Felix; Komander, David; Büttner, Reinhard; Thomas, Roman K.; Schumacher, Björn; Pasparakis, Manolis

2016-01-01

The tumour suppressor CYLD is a deubiquitinase previously shown to inhibit NF-κB, MAP kinase and Wnt signalling. However, the tumour suppressing mechanisms of CYLD remain poorly understood. Here we show that loss of CYLD catalytic activity causes impaired DNA damage-induced p53 stabilization and activation in epithelial cells and sensitizes mice to chemical carcinogen-induced intestinal and skin tumorigenesis. Mechanistically, CYLD interacts with and deubiquitinates p53 facilitating its stabilization in response to genotoxic stress. Ubiquitin chain-restriction analysis provides evidence that CYLD removes K48 ubiquitin chains from p53 indirectly by cleaving K63 linkages, suggesting that p53 is decorated with complex K48/K63 chains. Moreover, CYLD deficiency also diminishes CEP-1/p53-dependent DNA damage-induced germ cell apoptosis in the nematode Caenorhabditis elegans. Collectively, our results identify CYLD as a deubiquitinase facilitating DNA damage-induced p53 activation and suggest that regulation of p53 responses to genotoxic stress contributes to the tumour suppressor function of CYLD. PMID:27561390

Prognosis for Survival of Young Women with Breast Cancer by Quantitative p53 Immunohistochemistry

PubMed Central

Axelrod, David E.; Shah, Kinsuk; Yang, Qifeng; Haffty, Bruce G.

2015-01-01

p53 protein detected immunohistochemically has not been accepted as a biomarker for breast cancer patients because of disparate reports of the relationship between the amount of p53 protein detected and patient survival. The purpose of this study was to determine experimental conditions and methods of data analysis for which p53 stain intensity could be prognostic for survival of young breast cancer patients. A tissue microarray of specimens from 93 patients was stained with anti-p53 antibody, and stain intensity measured with a computer-aided image analysis system. A cut-point at one standard deviation below the mean of the distribution of p53 stain intensity separated patients into two groups with significantly different survival. These results were confirmed by Quantitative Nuclear Grade determined by DNA-specific Feulgen staining. P53 provided information beyond ER and PR status. Therefore, under the conditions reported here, p53 protein can be an effective prognostic factor for young breast cancer patients. PMID:26322145

The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

PubMed

Noda, Takeshi

2011-12-01

I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

[Study on serum p53 protein in cops in Guangzhou city].

PubMed

Zhu, Wen-Chang; Chen, Qing; Chu, Xin-Wei; Luo, Chen-Ling; Wu, Min; Wang, Ya-Xian; Chen, Si-Dong

2003-10-01

Serum p53 protein overexpression was detected in population exposed to traffic exhaust gas to study the relation between traffic exhaust gas and the increased risk in p53 gene mutation. Serum p53 protein expression was measured by enzyme-linked immunosorbent assay. Relationship between different types of job and serum p53 protein overexpression were studied by pearson Chi-square tests. Results on serum p53 protein overexpression on jobs outside of office (5.74%) were not significantly higher than jobs inside the office. However, it suggested that traffic police men (12.12%) working outside of office, with whose length of service longer than 30 years had a significant overexpression of serum p53 protein than the others (5.36%) whose length of service was less than 30 years (P < 0.05, OR = 2.43, 95% CI: 1.11 - 5.33). Overexpression rate of p53 protein appeared to be 6.89% in the group whose average weekly exposure hours were more than 40 hours, which was significant higher than the group whose exposed hours were less than 40 hours (P < 0.05, OR = 1.71, 95% CI: 1.03 - 2.81). The result suggested that traffic exhaust gas was likely to cause mutation of p53 gene and increasing the incidence of lung cancer.

The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

PubMed Central

Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

2010-01-01

Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

Prognostic significance of p53 immunohistochemical expression in adenoid cystic carcinoma of the salivary glands: a meta-analysis

PubMed Central

Zheng, Chuanming; Wang, Jiafeng; Ge, Minghua

2017-01-01

Adenoid cystic carcinoma of salivary glands is a rare adenocarcinoma and has been placed in “high-risk” category as poor long-term prognosis. The purpose of this study was to investigate p53 protein expression in adenoid cystic carcinoma of salivary glands and its correlation with clinicopathological parameters and prognosis. Literatures were searched from PubMed, Embase, Cochrane Library and Web of Science, which investigated the relationships between p53 expression and pathological type, clinical stage, local recurrence, metastasis, nerve infiltration and overall survival. A total of 1,608 patients from 36 studies were included in the analysis. The results showed that p53-postive expression rate was 49% in adenoid cystic carcinoma of salivary glands (OR=10.34, 95%CI: 4.93-21.71, P < 0.0001). The p53-postive expression was closely related to tumor types (OR=0.30, 95%CI: 0.14-0.65, P < 0.0001). The tumor with solid histological subtype had a strong positive correlation with p53 expression. The combined analysis revealed that the p53-positive expression rate among patients in T1and T2 stage was 41.4%, compared to 53.2% among those in T3 and T4 stage. However, there was no significant correlation between tumor stage and p53 expression (OR=0.47, 95% CI: 0.17-1.29, P = 0.14). Besides, compared to patients with p53-negative expression, those with p53-positive expression had a greater chance of developing metastasis, local recurrence and nerve infiltration as well as poorer 5-year overall survival (P < 0.01). In conclusion, the p53 expression is related to the survival of adenoid cystic carcinoma of salivary glands. It can be considered as the auxiliary detection index in treatment and prognosis of adenoid cystic carcinoma of salivary glands. PMID:28206977

Prognostic significance of p53 immunohistochemical expression in adenoid cystic carcinoma of the salivary glands: a meta-analysis.

PubMed

Li, Qinglin; Huang, Ping; Zheng, Chuanming; Wang, Jiafeng; Ge, Minghua

2017-04-25

Adenoid cystic carcinoma of salivary glands is a rare adenocarcinoma and has been placed in "high-risk" category as poor long-term prognosis. The purpose of this study was to investigate p53 protein expression in adenoid cystic carcinoma of salivary glands and its correlation with clinicopathological parameters and prognosis. Literatures were searched from PubMed, Embase, Cochrane Library and Web of Science, which investigated the relationships between p53 expression and pathological type, clinical stage, local recurrence, metastasis, nerve infiltration and overall survival. A total of 1,608 patients from 36 studies were included in the analysis. The results showed that p53-postive expression rate was 49% in adenoid cystic carcinoma of salivary glands (OR=10.34, 95%CI: 4.93-21.71, P < 0.0001). The p53-postive expression was closely related to tumor types (OR=0.30, 95%CI: 0.14-0.65, P < 0.0001). The tumor with solid histological subtype had a strong positive correlation with p53 expression. The combined analysis revealed that the p53-positive expression rate among patients in T1and T2 stage was 41.4%, compared to 53.2% among those in T3 and T4 stage. However, there was no significant correlation between tumor stage and p53 expression (OR=0.47, 95% CI: 0.17-1.29, P = 0.14). Besides, compared to patients with p53-negative expression, those with p53-positive expression had a greater chance of developing metastasis, local recurrence and nerve infiltration as well as poorer 5-year overall survival (P < 0.01).In conclusion, the p53 expression is related to the survival of adenoid cystic carcinoma of salivary glands. It can be considered as the auxiliary detection index in treatment and prognosis of adenoid cystic carcinoma of salivary glands.

Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

PubMed

Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

2016-03-01

The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

MDM2 phenotypic and genotypic profiling, respective to TP53 genetic status, in diffuse large B-cell lymphoma patients treated with rituximab-CHOP immunochemotherapy: a report from the International DLBCL Rituximab-CHOP Consortium Program

PubMed Central

Xu-Monette, Zijun Y.; Møller, Michael B.; Tzankov, Alexander; Montes-Moreno, Santiago; Hu, Wenwei; Manyam, Ganiraju C.; Kristensen, Louise; Fan, Lei; Visco, Carlo; Dybkær, Karen; Chiu, April; Tam, Wayne; Zu, Youli; Bhagat, Govind; Richards, Kristy L.; Hsi, Eric D.; Choi, William W. L.; van Krieken, J. Han; Huang, Qin; Huh, Jooryung; Ai, Weiyun; Ponzoni, Maurilio; Ferreri, Andrés J. M.; Wu, Lin; Zhao, Xiaoying; Bueso-Ramos, Carlos E.; Wang, Sa A.; Go, Ronald S.; Li, Yong; Winter, Jane N.; Medeiros, L. Jeffrey

2013-01-01

MDM2 is a key negative regulator of the tumor suppressor p53, however, the prognostic significance of MDM2 overexpression in diffuse large B-cell lymphoma (DLBCL) has not been defined convincingly. In a p53 genetically–defined large cohort of de novo DLBCL patients treated with rituximab, cyclophosphamide, hydroxydaunorubicin, vincristine, and prednisone (R-CHOP) chemotherapy, we assessed MDM2 and p53 expression by immunohistochemistry (n = 478), MDM2 gene amplification by fluorescence in situ hybridization (n = 364), and a single nucleotide polymorphism in the MDM2 promoter, SNP309, by SNP genotyping assay (n = 108). Our results show that MDM2 overexpression, unlike p53 overexpression, is not a significant prognostic factor in overall DLBCL. Both MDM2 and p53 overexpression do not predict for an adverse clinical outcome in patients with wild-type p53 but predicts for significantly poorer survival in patients with mutated p53. Variable p53 activities may ultimately determine the survival differences, as suggested by the gene expression profiling analysis. MDM2 amplification was observed in 3 of 364 (0.8%) patients with high MDM2 expression. The presence of SNP309 did not correlate with MDM2 expression and survival. This study indicates that evaluation of MDM2 and p53 expression correlating with TP53 genetic status is essential to assess their prognostic significance and is important for designing therapeutic strategies that target the MDM2-p53 interaction. PMID:23982177

A comparison of the effectiveness of extracorporeal shock wave and ultrasound therapy in the management of heel pain

NASA Astrophysics Data System (ADS)

Cheing, G. L. Y.; Chang, H.; Lo, S. K.

2007-11-01

The aim of this study was to compare the effectiveness of extracorporeal shock wave therapy (ESWT) and ultrasound therapy (US) for managing heel pain. Thirty-seven subjects received either: ESWT (once a week), US (three times a week), or CONTROL (no treatment) for 3 consecutive weeks and were followed-up for 3 more weeks. A visual analogue scale (VAS), the maximum tolerable duration for prolonged walking or standing, and the Mayo clinical scoring system (MCSS) were evaluated. Mixed models treating baseline measures as covariates were adopted for statistical analysis. By week 3, intensity of heel pain on palpation was reduced by 37% (VAS score from 7.5 to 4.6) in the ESWT group, 24% (from 5.3 to 4.2) in the US group, and increased by 3% (5.6-5.7) in the control group; this difference was significant after adjusting for baseline VAS scores ( p = 0.022). The improvements in the maximum tolerable duration of prolonged walking or standing was only significant in the ESWT group (157% increase, p = 0.043) but not the other two groups. Both active treatment groups maintained the treatment effect at the three-week follow-up. We conclude that ESWT is potentially more effective in reducing heel pain than ultrasound therapy but additional evidence is needed due to the various limitations of the study.

Effects of pitavastatin on walking capacity and CD34+/133+ cell number in patients with peripheral artery disease.

PubMed

Arao, Kenshiro; Yasu, Takanori; Endo, Yasuhiro; Funazaki, Toshikazu; Ota, Yoshimi; Shimada, Kazunori; Tokutake, Eiichi; Naito, Naoki; Takase, Bonpei; Wake, Minoru; Ikeda, Nahoko; Horie, Yasuto; Sugimura, Hiroyuki; Momomura, Shin-Ichi; Kawakami, Masanobu

2017-10-01

This multi-center prospective non-randomized comparative study investigated the effects of pitavastatin in patients with peripheral artery disease (PAD) in terms of exercise tolerance capacities and peripheral CD34 + /133 + cell numbers. At baseline, a peripheral blood test was administered to 75 patients with PAD, along with a treadmill exercise test using the Skinner-Gardner protocol to measure asymptomatic walking distance (AWD) and maximum walking distance (MWD). Each patient was assigned to a 6-month pitavastatin treatment group (n = 53) or a control group (n = 22), according to the patient's preference. The tests were repeated in both groups at 3 and 6 months. Baseline AWD and MWD correlated positively with the ankle-brachial pressure index (r = 0.342, p = 0.0032 and r = 0.324, p = 0.0054, respectively). Both AWD and MWD values improved at 3 and 6 months compared with baseline, and the degrees of their improvement were higher in the pitavastatin treatment group. CD34 + /133 + cell numbers did not change over time or between groups. Eighty-seven percent of patients in the treatment group attained low-density lipoprotein cholesterol levels below 100 mg/dL after 3 months. The study shows that pitavastatin may be effective in increasing exercise tolerance capacity in patients with PAD.

[Ibrutinib: A new drug of B-cell malignancies].

PubMed

Thieblemont, Catherine

2015-06-01

Ibrutinib (Imbruvica®) is a first-in-class, orally administered once-daily, that inhibits B-cell antigen receptor signaling downstream of Bruton's tyrosine kinase (BTK). Ibrutinib has been approved in USA in February 2014 and in France in October 2014 for the treatment of patients with relapsed/refractory mantle cell lymphoma (MCL) or chronic lymphocytic leukaemia (CLL) and for the treatment of patients with CLL and a chromosome 17 deletion (del 17p) or TP53 mutation. In clinical studies, ibrutinib induced an impressive overall response rate (68%) in patients with relapsed/refractory MCL (phase II study). In CLL, ibrutinib has shown to significantly improve progression-free survival, response rate and overall survival in patients with relapsed/refractory CLL, including in those with del 17p. Ibrutinib had an acceptable tolerability profile. Less than 10% of patients discontinued their treatment because of adverse events. Results are pending in other B-cell lymphomas subtypes such as in diffuse large B-cell lymphoma and in follicular lymphoma. An approval extension has already been enregistered for Waldenström disease in USA in January 2015. Given its efficacy and tolerability, ibrutinib is an emerging treatment option for patients with B-cell malignancies. Copyright © 2015 Société Françise du Cancer. Publié par Elsevier Masson SAS. Tous droits réservés. Published by Elsevier Masson SAS. All rights reserved.

Immunohistochemical detection of p53 protein in ameloblastoma types.

PubMed

el-Sissy, N A

1999-05-01

Overexpression of p53 protein in unicystic ameloblastoma (uAB) is denser than in the conventional ameloblastoma (cAB) type, indicating increased wild type p53--suppressing the growth potential of uAB and denoting the early event of neoplastic transformation, probably of a previous odontogenic cyst. Overexpression of p53 in borderline cAB and malignant ameloblastoma (mAB) types might reflect a mutational p53 protein playing an oncogenic role, promoting tumour growth. Overexpression of p53 protein could be a valid screening method for predicting underlying malignant genetic changes in AB types, through increased frequency of immunoreactive cells or increased staining density.