Sample records for usw g-1 g-2

  1. Commercial geophysical well logs from the USW G-1 drill hole, Nevada Test Site, Nevada

    USGS Publications Warehouse

    Muller, D.C.; Kibler, J.E.

    1983-01-01

    Drill hole USW G-1 was drilled at Yucca Mountain, Nevada Test Site, Nevada, as part of the ongoing exploration program for the Nevada Nuclear Waste Storage Investigations. Contract geophysical well logs run at USW G-1 show only limited stratigraphic correlations, but correlate reasonably well with the welding of the ash-flow and ash-fall tuffs. Rocks in the upper part of the section have highly variable physical properties, but are more uniform and predictably lower in the section.

  2. Preliminary assessment of in-situ geomechanical characteristics in drill hole USW G-1, Yucca Mountain, Nevada

    USGS Publications Warehouse

    Ellis, William L.; Swolfs, Henri S.

    1983-01-01

    Observations made during drilling and subsequent testing of the USW G-1 drill hole, Yucca Mountain, Nevada, provide qualitative insights into the in- situ geomechanical characteristics of the layered tuff units penetrated by the hole. Substantial drilling-fluid losses, and the occurrence of drilling-induced fracturing, are understandable in terms of the low, minimum horizontal stress magnitudes interpreted from six hydraulic-fracturing stress measurements conducted between hole depths of 640 and 1,300 meters. Although not confirmed directly by the hydraulic-fracturing data, other observations suggest that the minimum stress magnitudes in the more densely welded and brittle tuff layers may be even smaller than in the less welded and more ductile rocks. Stress-induced borehole ellipticity observed along most of the length of USW G-1 indicates that the horizontal stress components are not equal, and that the concentration of these stresses around the hole is sufficient to locally exceed the yield strength of the rock. The low, minimum horizontal stress magnitudes, perhaps variable with lithology, and the indications from borehole ellipticity of a high in-situ stress/strength ratio, indicate the need for further studies to characterize the structural and geomechanical properties of the rocks at depth in Yucca Mountain.

  3. Thermal conductivity, bulk properties, and thermal stratigraphy of silicic tuffs from the upper portion of hole USW-G1, Yucca Mountain, Nye County, Nevada

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lappin, A.R.; VanBuskirk, R.G.; Enniss, D.O.

    1982-03-01

    Thermal-conductivity and bulk-property measurements were made on welded and nonwelded silicic tuffs from the upper portion of Hole USW-G1, located near the southwestern margin of the Nevada Test Site. Bulk-property measurements were made by standard techniques. Thermal conductivities were measured at temperatures as high as 280{sup 0}C, confining pressures to 10 MPa, and pore pressures to 1.5 MPa. Extrapolation of measured saturated conductivities to zero porosity suggests that matrix conductivity of both zeolitized and devitrified tuffs is independent of stratigraphic position, depth, and probably location. This fact allows development of a thermal-conductivity stratigraphy for the upper portion of Hole G1.more » Estimates of saturated conductivities of zeolitized nonwelded tuffs and devitrified tuffs below the water table appear most reliable. Estimated conductivities of saturated densely welded devitrified tuffs above the water table are less reliable, due to both internal complexity and limited data presently available. Estimation of conductivity of dewatered tuffs requires use of different air thermal conductivities in devitrified and zeolitized samples. Estimated effects of in-situ fracturing generally appear negligible.« less

  4. Stratigraphy, structure, and some petrographic features of Tertiary volcanic rocks in the USW G-2 drill hole, Yucca Mountain, Nye County, Nevada

    USGS Publications Warehouse

    Maldonado, Florian; Koether, S.L.

    1983-01-01

    A continuously cored drill hole designated as USW G-2, located at Yucca Mountain in southwestern Nevada, penetrated 1830.6 m of Tertiary volcanic strata composed of abundant silicic ash-flow tuffs, minor lava and flow breccias, and subordinate volcaniclastic rocks. The volcanic strata penetrated are comprised of the following in descending order: Paintbrush Tuff (Tiva Canyon Member, Yucca Mountain Member, bedded tuff, Pah Canyon Member, and Topopah Spring Member), tuffaceous beds of Calico Hills, Crater Flat Tuff (Prow Pass Member, Bullfrog Member, and Tram unit), lava and flow breccia (rhyodacitic), tuff of Lithic Ridge, bedded and ash-flow tuff, lava and flow breccia (rhyolitic, quartz latitic, and dacitic), bedded tuff, conglomerate and ash-flow tuff, and older tuffs of USW G-2. Comparison of unit thicknesses at USW G-2 to unit thicknesses at previously drilled holes at Yucca Mountain indicate the following: (1) thickening of the Paintbrush Tuff members and tuffaceous beds of Calico Hills toward the northern part of Yucca Mountain; (2) thickening of the Prow Pass Member but thinning of the Bullfrog Member and Tram unit; (3) thinning of the tuff of Lithic Ridge; (4) presence of approximately 280 m of lava and flow breccia not previously penetrated by any drill hole; and (5) presence of an ash-flow tuff unit at the bottom of the drill hole not previously intersected, apparently the oldest unit penetrated at Yucca Mountain to date. Petrographic features of some of the units include: (1) decrease in quartz and K-feldspar and increases in biotite and plagioclase with depth in the tuffaceous beds of Calico Hills; (2) an increase in quartz phenocrysts from the top to the bottom members of the Crater Flat Tuff; (3) a low quartz content in the tuff of Lithic Ridge, suggesting tapping of the magma chamber at quartz-poor levels; (4) a change in zeolitic alteration from heulandite to clinoptilolite to mordenite with increasing depth; (5) lavas characterized by a rhyolitic top and dacitic base, suggesting reverse compositional zoning; and (6) presence of hydrothermal mineralization in the lavas that could be related to an intrusive under Yucca Mountain or to volcanism associated with the Timber Mountain-Claim Canyon caldera complex. A fracture analysis of the core resulted n tabulation of 7,848 fractures, predominately open and high angle. The fractures were filled or coated with material in various combinations and include the following in decreasing abundance: CaCo3, iron oxides and hydroxides, SiO2, manganese oxides and hydroxides, clays and zeolites. An increase in the intensity of fracturing can be correlated with the following: (1) densely welded zones, (2) lithophysal zones, (3) vitrophyre, (4) silicified zones, (5) fault zones, and (6) cooling joints. Numerous fault zones were penetrated by the drill hole, predominately in the lithophysal zone of the Topopah Spring Member and below the tuffaceous beds of Calico Hills. The faults are predominately high angle with both a vertical and lateral component. Three major faults were penetrated, two of which intersect the ground surface, with displacements of at least 20 m and possibly as much as 52 m. The faults and some fractures are probably related to the regional doming of the area associated with the volcanism-tectonism of the Timber Mountain-Claim Canyon caldera complex, and to Basin and Range tectonism.

  5. Fractures in outcrops in the vicinity of drill hole USW G-4. Yucca Mountain, Nevada; data analysis and compilation

    USGS Publications Warehouse

    Barton, Christopher C.; Page, William R.; Morgan, Terrance L.

    1989-01-01

    Fractures on outcrops in the vicinity of drill hole USW G-4, Yucca Mountain, Nevada, were studied in order to contribute to characterization of fractures for hydrologjc, geomechanical, and tectonic modeling of the Yucca Mountain block and to characterize fractures prior to the excavation of a proposed exploratory shaft located near USW G-4. Yucca Mountain is a prospective site for the construction of an underground repository for high-level nuclear waste.Measurements were taken and recorded on 5,000 fractures at 50 outcrop stations primarily in the upper lithophysal unit of the Tiva Canyon Member of the Miocene Paintbrush Tuff. Fracture orientation and surface roughness were recorded for each fracture. Additionally, notes were taken on fracture abutting, crossing, and offsetting relations, swarming, curvature, brecciation, slickensides, and fracture fillings. Frequency distributions of orientation and roughness were plotted and analyzed. Fractures with low roughness coefficients (0-4) group tightly into two sets based on orientation. We conclude that such fractures are cooling joints and that all other fractures are tectonic. The development of small-scale fractures adjacent, subparallel, and possibly related to the Ghost Dance fault has been addressed in a preliminary way based on data collected in this study. Such sympathetic fractures are abundant in the upper cliff unit but not in the upper lithophysal unit.

  6. Corrective Action Investigation Plan for Corrective Action Unit 168: Areas 25 and 26 Contaminated Materials and Waste Dumps, Nevada Test Site, Nevada (Rev. 0) includes Record of Technical Change No. 1 (dated 8/28/2002), Record of Technical Change No. 2 (dated 9/23/2002), and Record of Technical Change No. 3 (dated 6/2/2004)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    U.S. Department of Energy, National Nuclear Security Administration Nevada

    This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Operations Office's approach to collect data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit 168 under the Federal Facility Agreement and Consent Order. Corrective Action Unit 168 consists of a group of twelve relatively diverse Corrective Action Sites (CASs 25-16-01, Construction Waste Pile; 25-16-03, MX Construction Landfill; 25-19-02, Waste Disposal Site; 25-23-02, Radioactive Storage RR Cars; 25-23-18, Radioactive Material Storage; 25-34-01, NRDS Contaminated Bunker; 25-34-02, NRDS Contaminated Bunker; CAS 25-23-13, ETL - Lab Radioactive Contamination; 25-99-16, USW G3;more » 26-08-01, Waste Dump/Burn Pit; 26-17-01, Pluto Waste Holding Area; 26-19-02, Contaminated Waste Dump No.2). These CASs vary in terms of the sources and nature of potential contamination. The CASs are located and/or associated wit h the following Nevada Test Site (NTS) facilities within three areas. The first eight CASs were in operation between 1958 to 1984 in Area 25 include the Engine Maintenance, Assembly, and Disassembly Facility; the Missile Experiment Salvage Yard; the Reactor Maintenance, Assembly, and Disassembly Facility; the Radioactive Materials Storage Facility; and the Treatment Test Facility Building at Test Cell A. Secondly, the three CASs located in Area 26 include the Project Pluto testing area that operated from 1961 to 1964. Lastly, the Underground Southern Nevada Well (USW) G3 (CAS 25-99-16), a groundwater monitoring well located west of the NTS on the ridgeline of Yucca Mountain, was in operation during the 1980s. Based on site history and existing characterization data obtained to support the data quality objectives process, contaminants of potential concern (COPCs) for CAU 168 are primarily radionuclide; however, the COPCs for several CASs were not defined. To address COPC uncertainty, the analytical program for most CASs will include volatile organic compounds, semivolatile organic compounds, Resource Conservation and Recovery Act metals, total petroleum hydrocarbons, polychlorinated biphenyls, and radionuclides. Upon reviewing historical data and current site conditions, it has been determined that no further characterization is required at USW G3 (CAS 25-99-16) to select the appropriate corrective action. A cesium-137 source was encased in cement within the vadous zone during the drilling of the well (CAS 25-99-16). A corrective action of closure in place with a land-use restriction for drilling near USW G3 is appropriate. This corrective action will be documented in the Corrective Action Decision Document (CADD) for CAU 168. The results of the remaining field investigation will support a defensible evaluation of corrective action alternatives for the other CASs within CAU 168 in this CADD.« less

  7. Petrology and geochemistry of samples from bed-contact zones in Tunnel Bed 5, U12g-Tunnel, Nevada Test Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Connolly, J.R.; Keil, K.; Mansker, W.L.

    1984-10-01

    This report summarizes the detailed geologic characterization of samples of bed-contact zones and surrounding nonwelded bedded tuffs, both within Tunnel Bed 5, that are exposed in the G-Tunnel complex beneath Rainier Mesa on the Nevada Test Site (NTS). Original planning studies treated the bed-contact zones in Tunnel Bed 5 as simple planar surfaces of relatively high permeability. Detailed characterization, however, indicates that these zones have a finite thickness, are depositional in origin, vary considerably over short vertical and horizontal distances, and are internally complex. Fluid flow in a sequence of nonwelded zeolitized ash-flow or bedded tuffs and thin intervening reworkedmore » zones appears to be a porous-medium phenomenon, regardless of the presence of layering. There are no consistent differences in either bulk composition or detailed mineralogy between bedded tuffs and bed-contact zones in Tunnel Bed 5. Although the original bulk composition of Tunnel Bed 5 was probably peralkaline, extensive zeolitization has resulted in a present peraluminous bulk composition of both bedded tuffs and bed-contact zones. The major zeolite present, clinoptilolite, is intermediate (Ca:K:Na = 26:35:39) and effectively uniform in composition. This composition is similar to that of clinoptilolite from the tuffaceous beds of Calico Hills above the static water level in hole USW G-1, but somewhat different from that reported for zeolites from below the static water level in USW G-2. Tunnel Bed 5 also contains abundant hydrous manganese oxides. The similarity in composition of the clinoptilolites from Tunnel Bed 5 and those above the static water level at Yucca Mountain indicates that many of the results of nuclide-migration experiments in Tunnel Bed 5 would be transferrable to zeolitized nonwelded tuffs above the static water level at Yucca Mountain.« less

  8. The Effect of Early Diagenesis on the 238U/235U Ratio of Platform Carbonates.

    NASA Astrophysics Data System (ADS)

    Tissot, F.; Chen, C.; Go, B. M.; Naziemiec, M.; Healy, G.; Swart, P. K.; Dauphas, N.

    2017-12-01

    In the past 15 years, the so-called non-traditional stable isotopes systems (e.g., Mg, Fe, Mo, U) have emerged as powerful tracers of both high-T and low-T geochemical processes (e.g., [1]). Of particular interest for paleoredox studies is the ratio of "stable" isotopes of U (238U/235U), which has the potential to track the global extent of oceanic anoxia (e.g., [2, 3]). Indeed, in the modern ocean, U exists in two main oxidation states, soluble U6+ and insoluble U4+, and has a mean residence time of 400 kyr ([4]), much longer than the global ocean mixing time (1-2 kyr). As such the salinity-normalized ocean is homogeneous with regards to both U concentrations and isotopes (δ238USW = -0.392±0.005 ‰, [2]). The value of δ238USW at any given time is therefore the balance between U input to the ocean, mainly from rivers, and U removal, mostly into biogenic carbonates, anoxic/euxinic sediments and suboxic/hypoxic sediments (e.g., [2, 5]). Because the 238U/235U ratio of the past ocean cannot be measured directly, it has to be estimated from the measurement of the 238U/235U ratio of a sedimentary rock and assuming a constant fractionation factor. Carbonates appear as a promising record since they span most of Earth's history, and the δ238U values of modern primary carbonate precipitates and well-preserved fossil aragonitic coral up to 600 ka are indistinguishable from that of seawater (e.g., [2, 6, 7]). Yet, the effect of secondary processes on the δ238U values of non-coral carbonates, which represent the bulk of the rock record, has only been studied in a handful of shallow samples (down to 40cm, [6]) and remains poorly understood. To investigate the effect of early diagenesis on the 238U/235U ratio of carbonates on the 30kyr to 1Myr timescale, we measured δ13C, δ18O, and δ238U in samples from a 220m long drill core from the Bahamas carbonate platform. In order to separate lattice bound U from secondary U we developed a leaching protocol applicable to carbonate of all ages. We find that early diagenesis results in a 0 to +0.50 ‰ offset between the δ238U of carbonates and that of seawater. [1] Teng et al (2017) RiMG 82. [2] Tissot & Dauphas (2015) GCA 167. [3] Andersen et al. (2016) Chem. Geol. 420. [4] Ku et al (1977) Deep-Sea Research 24. [5] Dunk et al (2002) Chem. Geol. 190. [6] Romaniello et al (2013) Chem. Geol. 362. [7] Andersen et al. (2014) EPSL 400.

  9. Multiple clinical presentations of anal ultra slow waves and high anal pressure: megacolon, hemorrhoids and constipation.

    PubMed

    Yoshino, Hiroaki; Kayaba, Hiroyuki; Hebiguchi, Tatsuzo; Morii, Mayako; Hebiguchi, Taku; Ito, Wataru; Chihara, Junichi; Kato, Tetsuo

    2007-02-01

    The physiopathology of idiopathic chronic constipation is complex and yet to be investigated. In the manometric studies of the patients with severe chronic constipation, we noticed that some patients with megacolon show very slow periodical (< 2/min) pressure change in the anal canal, namely ultra slow waves (USWs). USWs are considered to represent the hyperactivity of the internal anal sphincter; however, USW-related clinical presentations have yet to be investigated. We retrospectively re-evaluated the patient records and manometric studies of 85 cases, 51 subjects without defecatory problems and 34 patients with constipation, to elucidate USW-related clinical presentations. USWs were seen in 10 patients, including eight patients with chronic constipation and two subjects without defecatory problems. Out of the eight patients with constipation, one had no organic change in the anorectum, three had hemorrhoids and four exhibited megacolon. Manometric and pathological studies proved that none of the four patients with megacolon was suffering from Hirschsprung's disease. Among the 51 subjects without defecatory problems, only two had USWs. Anal pressure in the USW-positive group (106.0 +/- 37.0 cmH2O) was significantly higher than that in the group without defecatory problems (56.0 +/- 27.0 cmH2O) or constipated patients without USWs (55.0 +/- 26.0 cmH2O). Megacolon and high anal pressure, as well as chronic constipation and hemorrhoids, were the clinical presentations related to USWs. This is the first report to show the clinical relevance of USWs to megacolon. USWs should be recognized as an important manometric finding indicating a possible new clinical entity in chronic constipation.

  10. Photovoltaics - Where are we going?

    NASA Technical Reports Server (NTRS)

    Callaghan, W. T.

    1984-01-01

    The directions that will be followed for solar cell development, production and marketing are projected on the basis of experiences gained during the JPL's Flat-Plate Solar Array project. It is thought that a billion dollar market for Si ribbons can be established by 1990. Thin film technology will yield a product at $2 U.S./W at the end of the 1980s. R&D is growing more focused on central station photovoltaic generators, although the residential market may be the more suitable goal. The intermediate markets, e.g., schools, hospitals and shopping centers may be developed before the central stations.

  11. Distribution of rubidium, strontium, and zirconium in tuff from two deep coreholes at Yucca Mountain, Nevada

    USGS Publications Warehouse

    Spengler, Richard W.; Peterman, Zell E.; ,

    1991-01-01

    Variations in concentrations of trace elements Rb, Sr, and Zr within the sequence of high-silica tuff and dacitic lava beneath Yucca Mountain reflect both primary composition and secondary alteration. Rb and K concentrations have parallel trends. Rb concentrations are significantly lower within intervals containing zeolitic nonwelded to partially welded and bedded tuffs and are higher in thick moderately to densely welded zones. Sr concentrations increase with depth from about 30 ppm in the Topopah Spring Member of the Paintbrush Tuff to almost 300 ppm in the older tuffs. Zr concentrations are about 100 ppm in the Topopah Spring Member and also increase with depth to about 150 ppm in the Lithic Ridge Tuff and upper part of the older tuffs. Conspicuous local high concentrations of Sr in the lower part of the Tram Member, in the dacite lava, and in unit c of the older tuffs in USW G-1, and in the densely welded zone of the Bullfrog Member in USW GU-3/G-3 closely correlate with high concentrations of less-mobile Zr and may reflect either primary composition or elemental redistribution resulting largely from smectitic alteration. Initial 87Sr/86Sr values from composite samples increase upward in units above the Bullfrog Member of the Crater Flat Tuff. The progressive tenfold increase in Sr with depth coupled with the similarity of initial 87Sr/86Sr values within the Bullfrog Member and older units to those of Paleozoic marine carbonates are consistent with a massive influx of Sr from water derived from a Paleozoic carbonate aquifer.

  12. [Comparison on extraction of volatile oils from Lithospermum erythrorhizon by different methods].

    PubMed

    Yang, Ri-fu; Huang, Ping-ping; Qiu, Tai-qiu; Fan, Xiao-dan

    2011-02-01

    To extract the volatile oils from Lithospermum erythrorhizon via ultrasound-enhanced sub-critical water extraction (USWE) and compare with ultrasound-enhanced solvent extraction (USE) and steam distillation extraction (SD). The extraction yield of the volatile oils, the containing components of extract, the effect of scanvenging activities on free radical DPPH and reducing activities as well as the inhibitory on escherichia coli and staphylococcus aureus were investigated. The extraction yield of volatile oils by USWE, USE and SD were 2.39%, 1.93% and 0.62%, respectively, the extracts by three methods all contained six major components, but the extracts by SD and USE contained more impurities. The inhibitory effect on escherichia coli and staphylococcus aureus of the extract by SD and its reducing action were the best,but those by USWE were the worst. the extraction yield of volatile oils by USWE is the highest, and it contains less impurities based on the worst in reducing power and inhibitory effects.

  13. Use of genetic algorithms to improve the solid waste collection service in an urban area.

    PubMed

    Buenrostro-Delgado, Otoniel; Ortega-Rodriguez, Juan Manuel; Clemitshaw, Kevin C; González-Razo, Carlos; Hernández-Paniagua, Iván Y

    2015-07-01

    Increasing generation of Urban Solid Waste (USW) has become a significant issue in developing countries due to unprecedented population growth and high rates of urbanisation. This issue has exceeded current plans and programs of local governments to manage and dispose of USW. In this study, a Genetic Algorithm for Rule-set Production (GARP) integrated into a Geographic Information System (GIS) was used to find areas with socio-economic conditions that are representative of the generation of USW constituents in such areas. Socio-economic data of selected variables categorised by Basic Geostatistical Areas (BGAs) were taken from the 2000 National Population Census (NPC). USW and additional socio-economic data were collected during two survey campaigns in 1998 and 2004. Areas for sampling of USW were stratified into lower, middle and upper economic strata according to income. Data on USW constituents were analysed using descriptive statistics and Multivariate Analysis. ARC View 3.2 was used to convert the USW data and socio-economic variables to spatial data. Desk-top GARP software was run to generate a spatial model to identify areas with similar socio-economic conditions to those sampled. Results showed that socio-economic variables such as monthly income and education are positively correlated with waste constituents generated. The GARP used in this study revealed BGAs with similar socio-economic conditions to those sampled, where a similar composition of waste constituents generated is expected. Our results may be useful to decrease USW management costs by improving the collection services. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. New Combinational Method for Noninvasive Treatments of Superficial Tissues for Body Aesthetics Applications

    NASA Astrophysics Data System (ADS)

    Rybyanets, A. N.; Naumenko, A. A.

    The paper introduces an innovative combinational treatment method based on ultrasonic standing waves (USW) technology for noninvasive surgical, therapeutic, lypolitic or cosmetic treatment of tissues including subcutaneous adipose tissue, cellulite or skin on arbitrary body part of patient. The method is based on simultaneous or successive applying of constructively interfering physically and biologically sensed influences: USW, ultrasonic shear waves, radio-frequency (RF) heating, and vacuum massage. The paper provides basic physical principles of USW as well as critical comparison of USW and HIFU methods. The results of finite-elements and finite- difference modeling of USW transducer design and nodal pattern structure in tissue are presented. Biological effects of USW-tissue interaction and synergetic aspects of USW and RF combination are explored. Combinational treatment transducer designs and original in-vitro experiments on tissues are described.

  15. Geohydrologic and drill-hole data for test well USW H-1, adjacent to Nevada Test Site, Nye County, Nevada

    USGS Publications Warehouse

    Rush, F. Eugene; Thordarson, William; Bruckheimer, Laura

    1983-01-01

    This report presents data collected to determine the hydraulic characteristics of rocks penetrated in test well USW H-1. The well is one of a series of test wells drilled in and near the southwestern part of the Nevada Test Site, Nye County, Nevada, in a program conducted on behalf of the U.S. Department of Energy. These investigations are part of the Nevada Nuclear Waste Storage Investigations to identify suitable sites for storage of high-level radioactive wastes. Data on drilling operations, lithology, borehole geophysics, hydrologic monitoring, core analysis, ground-water chemistry and pumping and injection tests for well USW H-1 are contained in this report.

  16. Geohydrologic and drill-hole data for test well USW H-1, adjacent to Nevada Test Site, Nye County, Nevada

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rush, F.E.; Thordarson, W.; Bruckheimer, L.

    This report presents data collected to determine the hydraulic characteristics of rocks penetrated in test well USW H-1. The well is one of a series of test wells drilled in and near the southwestern part of the Nevada Test Site, Nye County, Nevada, in a program conducted on behalf of the US Department of Energy. These investigations are part of the Nevada Nuclear Waste Storage Investigations to identify suitable sites for storage of high-level radioactive wastes. Data on drilling operations, lithology, borehole geophysics, hydrologic monitoring, core analysis, ground-water chemistry and pumping and injection tests for well USW H-1 are inmore » this report.« less

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Connolly, J.R.

    Petrologic, bulk chemical, and mineralogic data are presented for 49 samples of tuffaceous rocks from core holes USW G-1 and UE-25a{number_sign}1 at Yucca Mountain, Nevada. Included, in descending stratigraphic order, are 11 samples from the Topopah Spring Member of the Paintbrush Tuff, 12 samples from the Tuffaceous Beds of Calico Hills, 3 samples from the Prow Pass Member of the Crater Flat Tuff, 20 samples from the Bullfrog Member of the Crater Flat Tuff and 3 samples from the Tram Member of the Crater Flat Tuff. The suite of samples contains a wide variety of petrologic types, including zeolitized, glassy,more » and devitrified tuffs. Data vary considerably between groups of samples, and include thin section descriptions (some with modal analyses for which uncertainties are estimated), electron microprobe analyses of mineral phases and matrix, mineral identifications by X-ray diffraction, and major element analyses with uncertainty estimates.« less

  18. Carbon isotopic data from test hole USW UZ-1, Yucca Mountain, Nevada

    USGS Publications Warehouse

    Yang, In C.; Peters, C.A.; Thorstenson, D.C.

    1993-01-01

    Rock-CO2-gas analyses in test hole USW UZ-1 at Yucca Mountain indicate that gas movement in the unsaturated zone is likely through a dry-fracture system with little porewater or caliche-calcite interaction. This is because near-surface ??13C values are of biogenic origin and have changed little throughout the total depth. Post-bomb 14C activity is observed to the depth of about 12 m. An abrupt change in plotted 14C/depth slope is seen at 61 m. The less steep upper segment corresponds to the zone with greater porosity and moisture content, and consequently more tortuosity, with an estimated traveltime of 1.27 cm/yr; the steeper sloped zone corresponding to the lower segment has smaller porosity and moisture content but larger fracture density for gas transport, with an estimated traveltime of 3.26 cm/yr.

  19. Ultrasonic Stir Welding

    NASA Technical Reports Server (NTRS)

    Nabors, Sammy

    2015-01-01

    NASA Marshall Space Flight Center (MSFC) developed Ultrasonic Stir Welding (USW) to join large pieces of very high-strength metals such as titanium and Inconel. USW, a solid-state weld process, improves current thermal stir welding processes by adding high-power ultrasonic (HPU) energy at 20 kHz frequency. The addition of ultrasonic energy significantly reduces axial, frictional, and shear forces; increases travel rates; and reduces wear on the stir rod, which results in extended stir rod life. The USW process decouples the heating, stirring, and forging elements found in the friction stir welding process allowing for independent control of each process element and, ultimately, greater process control and repeatability. Because of the independent control of USW process elements, closed-loop temperature control can be integrated into the system so that a constant weld nugget temperature can be maintained during welding.

  20. The Effectiveness of Surface Coatings on Preventing Interfacial Reaction During Ultrasonic Welding of Aluminum to Magnesium

    NASA Astrophysics Data System (ADS)

    Panteli, Alexandria; Robson, Joseph D.; Chen, Ying-Chun; Prangnell, Philip B.

    2013-12-01

    High power ultrasonic spot welding (USW) is a solid-state joining process that is advantageous for welding difficult dissimilar material couples, like magnesium to aluminum. USW is also a useful technique for testing methods of controlling interfacial reaction in welding as the interface is not greatly displaced by the process. However, the high strain rate deformation in USW has been found to accelerate intermetallic compound (IMC) formation and a thick Al12Mg17 and Al3Mg2 reaction layer forms after relatively short welding times. In this work, we have investigated the potential of two approaches for reducing the IMC reaction rate in dissimilar Al-Mg ultrasonic welds, both involving coatings on the Mg sheet surface to (i) separate the join line from the weld interface, using a 100- μm-thick Al cold spray coating, and (ii) provide a diffusion barrier layer, using a thin manganese physical vapor deposition (PVD) coating. Both methods were found to reduce the level of reaction and increase the failure energy of the welds, but their effectiveness was limited due to issues with coating attachment and survivability during the welding cycle. The effect of the coatings on the joint's interface microstructure, and the fracture behavior have been investigated in detail. Kinetic modeling has been used to show that the benefit of the cold spray coating can be attributed to the reaction rate reverting to that expected under static conditions. This reduces the IMC growth rate by over 50 pct because at the weld line, the high strain rate dynamic deformation in USW normally enhances diffusion through the IMC layer. In comparison, the thin PVD barrier coating was found to rapidly break up early in USW and become dispersed throughout the deformation layer reducing its effectiveness.

  1. Comparisons of body size, composition, and whole body bone mass between North American and South African children.

    PubMed

    Micklesfield, Lisa K; Norris, Shane A; Nelson, Dorothy A; Lambert, Estelle V; van der Merwe, Lize; Pettifor, John M

    2007-12-01

    We compared whole body BMC of 811 black, white, and mixed ancestral origin children from Detroit, MI; Johannesburg, South Africa; and Cape Town, South Africa. Our findings support the role of genetic and environmental influences in the determination of bone mass in prepubertal children. Higher bone mass and lower fracture rates have been shown in black compared with white children and adults in North America. We compared whole body BMC (WBBMC), whole body fat mass (WBFM), and whole body fat free soft tissue (WBFFST) data between three ethnic groups of children from Detroit, MI (n = 181 white, USW; n = 230 black, USB), Johannesburg, South Africa (n = 73 white, SAW; n = 263 black, SAB), and Cape Town, South Africa (n = 64 mixed ancestral origin, SAM). SAB and SAW groups were slightly older than USW and USB groups (9.5 +/- 0.3 versus 9.3 +/- 0.1 yr); however, USB and USW boys were significantly taller, were heavier, and had a higher BMI than SAM and SAB boys. USB girls were significantly taller than SAB girls and heavier than SAB and SAM girls. In South Africa and the United States, black children had a significantly higher WBBMC than white children, after adjusting for selected best predictors. After adjusting for age, weight, and height, WBBMC was significantly higher in the SAB and SAW boys than in USW and USB and in the SAM group compared with the USW and USB groups. WBFFST and WBFM made significant contributions to a best linear model for log(WBBMC), together with age, height, and ethnicity. The best model accounted for 79% of the WBBMC variance. When included separately in the model, the model containing WBFFST accounted for 76%, and the model containing WBFM accounted for 70%, of the variance in WBBMC. WBBMC is lower in children of European ancestry compared with African ancestry, irrespective of geographical location; however, South African children have significantly higher WBBMC compared with USB and USW groups, thereby acknowledging the possible contribution of environmental factors. Reasons for the significantly higher WBBMC in the children of mixed ancestral origin compared with the other groups need to be studied further.

  2. Geohydrologic and drill-hole data for test well USW H-4, Yucca Mountain, Nye County, Nevada

    USGS Publications Warehouse

    Whitfield, M.S.; Thordarson, William; Eshom, E.P.

    1984-01-01

    Data are presented on drilling operations, lithology, geophysical well logs, sidewall-core samples, water-level monitoring, pumping tests, injection tests, radioactive-tracer borehole flow survey, and water chemistry for test well USW H-4. The well is one of a series of test wells drilled in the southwestern part of the Nevada Test Site, Nye County, Nevada, in cooperation with the U.S. Department of Energy. These test wells are part of the Nevada Nuclear Waste Storage Investigations to identify sites for storage of high-level radioactive wastes. Test well USW H-4 was drilled in ash-flow tuff to a total depth of 1,219 meters. Depth to water below land surface was 519 meters or at an altitude of 730 meters above sea level. After test pumping at a rate of 17.4 liters per second for approximately 9 days, the drawdown was 4.85 meters. A radioactive borehole-flow survey indicated that the Bullfrog Member was the most productive geologic unit, producing 36.5 percent of the water in the well. The second most productive geologic unit was the Tram Member, which produced 32 percent of the water. The water in test well USW H-4 is predominantly a soft, sodium bicarbonate type of water typical of water produced in tuffaceous rocks in southern Nevada. (USGS)

  3. Occurrence of Endocrine and Thyroid Cancers Among Alaska Native People, 1969-2013.

    PubMed

    Nash, Sarah H; Lanier, Anne P; Southworth, Molly B

    2018-04-01

    Nationwide, the incidence of thyroid cancer is lower among American Indian/Alaska Native (AI/AN) people than among U.S. whites (USW). However, little is known about the incidence of thyroid or other endocrine cancers specifically among Alaska Native (AN) people. Data were examined from the National Cancer Institute's Surveillance, Epidemiology, and End Results Alaska Native Tumor Registry on endocrine cancers diagnosed among AN people from 1969-2013, with a specific focus on thyroid cancers. Frequencies of endocrine cancers by site and also of thyroid cancers by histology, size, and stage at diagnosis were evaluated. Distributions were compared to USW (Surveillance, Epidemiology, and End Results 9 Registries) using the chi-square test. Five-year average annual age-adjusted incidence rates of thyroid cancers were calculated, stratified by histology, age, and five-year period of diagnosis, and compared to those observed among USW. Five-year cause-specific survival was evaluated using cause of death data from the National Death Index Plus from the National Center for Health Statistics. During the 45-year period (1969-2013), 224 endocrine cancers were diagnosed among AN people, of which 210 (94%) were thyroid cancers. Compared to USW, AN people were diagnosed at a slightly younger age, had a higher proportion of thyroid cancers diagnosed with a size of 20-40 mm, and a larger proportion of patients with regional metastases. More than 85% of AN thyroid cancers were of papillary histology. The incidence of thyroid cancers was similar between AN people and USW, and appeared to increase among AN people over the period of surveillance. Finally, five-year cause-specific survival rate was 100% for papillary carcinoma patients and 86.3% [confidence interval 54.7-96.5] for follicular thyroid cancer patients. This study is the first report of endocrine cancers and the first detailed examination of thyroid cancer among AN people. The incidence of thyroid cancer was similar among AN people and USW. However, compared to USW, AN people appear to be at risk for diagnosis at a younger age, larger size, and higher stage. Further research is needed to explore the causes of these differences.

  4. Kinetics and mechanism of bacterial inactivation by ultrasound waves and sonoprotective effect of milk components.

    PubMed

    Gera, N; Doores, S

    2011-03-01

    Inactivation of Escherichia coli and Listeria monocytogenes were investigated in buffer and milk upon treatment with ultrasound waves (USW). In addition, sonoprotective effect of milk components and ultrasound-induced changes in bacterial cells were investigated using scanning electron microscopy (SEM). Bacterial cells were added to phosphate buffer, whole milk, skim milk, or simulated milk ultrafiltrate (SMUF). To determine the sonoprotective effect of milk components, lactose (5%), casein (3%), or β lactoglobulin (0.3%) was added to SMUF. Samples were sonicated with 24 kHz pulse USW while maintaining the system temperature between 30 to 35 °C. Aliquots were drawn at set times during sonication and bacteria were enumerated by surface plating appropriate dilutions on selective and nonselective media plates. Escherichia coli exhibited significantly higher D values in whole (2.43 min) and skim milk (2.41 min) than phosphate buffer (2.19 min). Listeria monocytogenes also showed higher D values in whole (9.31 min) and skim milk (8.61 min) compared to phosphate buffer (7.63 min). Data suggest that milk exerts a sonoprotective effect on these bacteria. Escherichia coli exhibited a log-linear inactivation kinetics followed by tailing whereas L. monocytogenes showed 1st-order kinetics throughout. Among the milk components tested, presence of lactose in SMUF resulted in significantly higher D values than SMUF for both organisms suggesting that lactose was exerting a protective effect on bacteria. SEM images showed that USW caused mechanical damage to the cell wall and cell membrane of bacteria leading to their inactivation.

  5. Effect of Zinc Coatings on Joint Properties and Interfacial Reactions in Aluminum to Steel Ultrasonic Spot Welding

    NASA Astrophysics Data System (ADS)

    Haddadi, F.; Strong, D.; Prangnell, P. B.

    2012-03-01

    Dissimilar joining of aluminum to steel sheet in multimaterial automotive structures is an important potential application of ultrasonic spot welding (USW). Here, the weldability of different zinc-coated steels with aluminum is discussed, using a 2.5-kW USW welder. Results show that soft hot-dipped zinc (DX56-Z)-coated steel results in better weld performance than hard (galv-annealed) zinc coatings (DX53-ZF). For Al to hard galv-annealed-coated steel welds, lap shear strengths reached a maximum of ~80% of the strength of an Al-Al joint after a 1.0 s welding time. In comparison, welds between Al6111-T4 and hot dipped soft zinc-coated steel took longer to achieve the same maximum strength, but nearly matched the Al-Al joint properties. The reasons for these different behaviors are discussed in terms of the interfacial reactions between the weld members.

  6. Volcanotectonic history of Crater Flat, southwestern Nevada, as suggested by new evidence from drill hole USW-VH-1 and vicinity

    USGS Publications Warehouse

    Carr, W.J.

    1982-01-01

    New evidence for a possible resurgent dome in the caldera related to eruption of the Bullfrog Member of the Crater Flat Tuff has been provided by recent drilling of a 762-meter (2,501-foot) hole in central Crater Flat. Although no new volcanic units were penetrated by the drill hole (USW-VH-1), the positive aeromagnetic anomaly in the vicinity of the drill hole appears to result in part from the unusually thick, densely welded tuff of the Bullfrog. Major units penetrated include alluvium, basalt of Crater Flat, Tiva Canyon and Topopah Spring Members of the Paintbrush Tuff, and Prow Pass and Bullfrog Members of the Crater Flat Tuff. In addition, the drill hole provided the first subsurface hydrologic information for the area. The water table in the hole is at about 180 meters (600 feet), and the temperature gradient appears slightly higher than normal for the region.

  7. Preliminary evaluation of hydrologic properties of cores of unsaturated tuff, test well USW H-1, Yucca Mountain, Nevada

    USGS Publications Warehouse

    Weeks, E.P.; Wilson, W.E.

    1984-01-01

    Analyses were made on 19 core samples of unsaturated tuff from test well USW H-1. Moisture-characteristic curves relating saturation and moisture tension were developed from results of mercury-injection tests. Ambient moisture tension estimated from these curves generally was 1 to 2 bars. Values of relative permeability ranging from about 0.002 to 0.1 were determined by fitting an analytical expression to eight of the moisture-characteristic curves, and then integrating to solve for relative permeability. These values of relative permeability were applied to values of saturated hydraulic conductivity of core from a nearby test well to obtain effective hydraulic conductivities of about 8 x 10 to the minus twelfth power to 7 x 10 to the minus tenth power centimeter per second. If a unit hydraulic-head gradient is assumed, these values convert to a vertial matrix flux of 0.003 to 0.2 millimeter per year. The validity of this assumption was not verified due to the sparseness of data and uncertainties in their reliability. Consequently, the results of this study are preliminary and need to be used principally as a guide for future studies. (USGS)

  8. Chemistry of unsaturated zone gases sampled in open boreholes at the crest of Yucca Mountain, Nevada: Data and basic concepts of chemical and physical processes in the mountain

    USGS Publications Warehouse

    Thorstenson, Donald C.; Weeks, Edwin P.; Haas, Herbert; Busenberg, Eurybiades; Plummer, Niel; Peters, Charles A.

    1998-01-01

    Boreholes open to the unsaturated zone at the crest of Yucca Mountain, Nevada, were variously sampled for CO2 (including 13C and 14C), CH4, N2, O2, Ar, CFC-11, CFC-12, and CFC-113 from 1986 to 1993. Air enters the mountain in outcrops, principally on the eastern slope, is enriched in CO2by mixing with soil gas, and is advected to the mountain crest, where it returns to the atmosphere. The CFC data indicate that travel times of the advecting gas in the shallow Tiva Canyon hydrogeologic unit are ≤5 years. The 14C activities are postbomb to depths of 100 m, indicating little retardation of 14CO2 in the shallow flow systems. The 14C activities from 168 to 404 m in the Topopah Spring hydrogeologic unit are 85–90 pMC at borehole USW-UZ6. The CFC data show that the drilling of USW-UZ6 in 1984 has altered the natural system by providing a conduit through the Paintbrush Nonwelded unit, allowing flow from Topopah Spring outcrops in Solitario Canyon on the west to USW-UZ6, upward in the borehole through the Paintbrush, to the shallow Tiva Canyon flow systems, and out of the mountain.

  9. Geohydrologic and drill-hole data for test well USW H-3, Yucca Mountain, Nye County, Nevada

    USGS Publications Warehouse

    Thordarson, William; Rush, F.E.; Spengler, R.W.; Waddell, S.J.

    1984-01-01

    Test well USW H-3 is one of a series of test wells drilled in and near the southwestern part of the Nevada Test Site for hydraulic testing, hydrologic monitoring, and geophysical logging. The work was performed in cooperation with the U.S. Department of Energy as part of the Nevada Nuclear Waste Storage investigations. The well penetrated volcanic tuffs of Tertiary age to a depth of 1,219 meters. This report presents data collected to determine the hydraulic characteristics of rocks penetrated. Data on drilling operations, lithology, borehole geophysics, hydrologic monitoring, pumping, swabbing, and injection tests for the well are contained in this report. (USGS)

  10. A Stable U Isotopic Perspective on the U Budget and Global Extent of Modern Anoxia in the Ocean.

    NASA Astrophysics Data System (ADS)

    Tissot, F.; Dauphas, N.

    2015-12-01

    Isotopic fractionation between U4+ and U6+makes U stable isotopes potential tracers of global paleoredox conditions. In this work [1], we put the U-proxy up to a test against a highly constrained system: the modern ocean. We measured a large number of seawater samples from geographically diverse locations and found that the open ocean has a homogenous isotopic composition at δ238USW= -0.392 ± 0.005 ‰ (rel. to CRM-112a). From our measurement of rock samples (n=64) and compilations of literature data (n=380), we then estimated the U isotopic compositions of the various reservoirs involved in the modern oceanic U budget, as well as the fractionation factors associated with U incorporation into those reservoirs. Using a steady-state model, we compared the isotopic composition of the seawater predicted by the four most recent U oceanic budgets [2-5] to the modern seawater value we measured. Three of these budgets [2-4] predict a seawater isotopic composition in very good agreement with the observed δ238USW, which strengthens our confidence in the isotopic fractionation factors associated with each deposition environment and the fact that U is at steady-state in the modern ocean. The U oceanic budget of Henderson and Anderson (2003) does not reproduce the observed seawater composition because the U flux to anoxic/euxinic sediments relative to the total U flux out of the ocean is high in their model, which our analysis shows cannot be correct. The U isotopic composition of seawater is used to constrain the extent of anoxia in the modern ocean (% of seafloor covered by anoxic/euxinic sediments), which is 0.21 ± 0.09 %. This work demonstrates that stable isotopes of U can indeed trace the extent of anoxia in the modern global ocean, thereby validating the application of U isotope measurements to paleoredox reconstructions. Based on the above work, we will present the best estimate of the modern oceanic U budget. [1] Tissot F.L.H., Dauphas N. (2015) Geochim Cosmochim Ac 167, 113-143 [2] Barnes C. E., Cochran J. K. (1990) Earth Planet Sc Lett 97, 94-101 [3] Morford J. L., Emerson S. (1999) Geochim Cosmochim Ac 63, 1735-1750 [4] Dunk R. M., Mills R. A., Jenkins W. J. (2002) Chemical Geology 190, 45-67 [5] Henderson G. M., Anderson R. F. (2003) Rev Mineral Geochem 52, 493-531

  11. Assessment of highway condition using combined geophysical surveys

    NASA Astrophysics Data System (ADS)

    Dera, Abdallah Alhadi

    Four pavement sections were investigated using ground penetrating radar (GPR) and Ultrasonic Surface Wave (USW). The objective of this research was to compare the effectiveness of two non-destructive geophysical tools, GPR and the PSPA, in assessing the condition of the pavements, composed of different construction materials. The GPR data were acquired using a 1.5 GHz antenna along five traverses spaced at two ft. intervals approximately 1000 ft. long. On the other hand, the PSPA data were acquired at the stations spaced at 1000 ft. along the five GPR traverses. Core samples were collected at each site to constrain the interpretation of the acquired geophysical data. The sites include section US 63 about three miles north of Rolla, US 54 in Camdenton County, MO 179 in Jefferson City, and HWY U in Dent County. The types of pavement in these sites were, asphalt concrete overlaying portland cement concrete (AC/PCC), and full-depth asphalt concrete (AC) pavements or full depth bituminous mix (BM). Based on the acquired and analyzed data of the GPR and PSPA, the data of both tools correlated reasonably well. The PSPA technique successfully measured the elastic modulus and the thickness of pavement and detected horizontal flaws (e.g. debonding and delaminations). Similarly, the GPR technique successfully measured the thickness of pavement and detected horizontal flaws (e.g. debonding and delaminations) within the pavement. The research demonstrated that both non-destructive geophysical tools (GPR and PSPA) are effective in assessing the condition of different types of pavement.

  12. Ultrasonic alignment of bio-functionalized magnetic beads and live cells in PDMS micro-fluidic channel.

    PubMed

    Islam, Afroja T; Siddique, Ariful H; Ramulu, T S; Reddy, Venu; Eu, Young-Jae; Cho, Seung Hyun; Kim, CheolGi

    2012-12-01

    In this work, we demonstrated the alignment of polystyrene latex microspheres (diameter of 1 ~45 μm), bio-functionalized superparamagnetic beads (diameter 2.8 μm), and live cells (average diameter 1 ~2 μm) using an ultrasonic standing wave (USW) in a PDMS microfluidic channel (330 μm width) attached on a Si substrate for bio-medical applications. To generate a standing wave inside the channel, ultrasound of 2.25 MHz resonance frequency (for the channel width) was applied by two ultrasound transducers installed at both sides of the channel which caused the radiation force to concentrate the micro-particles at the single pressure nodal plane of USW. By increasing the frequency to the next resonance condition of the channel, the particles were concentrated in dual nodal planes. Migration time of the micro-particles towards the single nodal plane was recorded as 108 s, 17 s, and 115 s for polystyrene particles of 2 μm diameter, bio-functionalized magnetic beads, and live cells, respectively. These successful alignments of the bio-functionalized magnetic beads along the desired part of the channel can enhance the performance of a sensor which is applicable for the bio-hybrid system and the alignment of live cells without any damage can be used for sample pre-treatment for the application of lab-on-a-chip type bioassays.

  13. Geohydrology of test well USW H-3, Yucca Mountain, Nye County, Nevada

    USGS Publications Warehouse

    Thordarson, William; Rush, F.E.; Waddell, S.J.

    1985-01-01

    Test well USW H-3 is one of several wells drilled in the southwestern part of the Nevada Test Site for hydraulic testing, hydrologic monitoring, and geophysical logging. The work was performed in cooperation with the U.S. Department of Energy. The rocks penetrated by the well to a total depth of 1,219 meters were volcanic tuffs of Tertiary age. The most transmissive zone in this well is in the upper part of the Tram Member of the Crater Flat Tuff that was penetrated at a depth from 809 to 841 meters; transmissivity is about 7 x 10 -1 meter squared per day. The remainder of the rocks penetrated between the depths of 841 to 1,219 meters have a transmissivity of about 4 x 10 -1 meter squared per day and are predominatly in the Tram Member of the Crater Flat Tuff and the Lithic Ridge Tuff in the depths from 841 to 1,219 meters. (USGS)

  14. Ultrasonic Stir Welding Development for Ground-Based and In Situ Fabrication and Repair for In-Space Propulsion Systems/Commercial Space Sector

    NASA Technical Reports Server (NTRS)

    Ding, Jeff

    2015-01-01

    The completed Center Innovation Fund (CIF) project used the upgraded Ultrasonic Stir Weld (USW) Prototype System (built in 2013/2014) to begin characterizing the weld process using 2219 aluminum (fig. 1). This work is being done in Bldg. 4755 at NASA Marshall Space Flight Center (MSFC). The capabilities of the USW system provides the means to precisely control and document individual welding parameters. The current upgraded system has the following capabilities: (1) Ability to 'pulse' ultrasonic (US) energy on and off and adjust parameters real-time (travel speed, spindle rpm, US amplitude, X and Z axis positions, and plunge and pin axis force; (2) Means to measure draw force; (3) Ability to record US power versus time; (4) Increasing stiffness of Z axis drive and reduce head deflection using laser technology; (5) Adding linear encoder to better control tool penetration setting; (6) Ultrasonic energy integrated into stir rod and containment plate; (7) Maximum 600 rpm; (8) Maximum Z force 15,000 lb; (9) Real-time data acquisition and logging capabilities at a minimum frequency of 10 Hz; and (10) Two separate transducer power supplies operating at 4.5 kW power.

  15. Diagnostic Performance of Wells Score Combined With Point-of-care Lung and Venous Ultrasound in Suspected Pulmonary Embolism.

    PubMed

    Nazerian, Peiman; Volpicelli, Giovanni; Gigli, Chiara; Becattini, Cecilia; Sferrazza Papa, Giuseppe Francesco; Grifoni, Stefano; Vanni, Simone

    2017-03-01

    Lung and venous ultrasound are bedside diagnostic tools increasingly used in the early diagnostic approach of suspected pulmonary embolism (PE). However, the possibility of improving the conventional prediction rule for PE by integrating ultrasound has never been investigated. We performed lung and venous ultrasound in consecutive patients suspected of PE in four emergency departments. Conventional Wells score (Ws) was adjudicated by the attending physician, and ultrasound was performed by one of 20 investigators. Signs of deep venous thrombosis (DVT) at venous ultrasound and signs of pulmonary infarcts or alternative diagnoses at lung ultrasound were considered to recalculate two items of the Ws: signs and symptoms of DVT and alternative diagnosis less likely than PE. The diagnostic performances of the ultrasound-enhanced Ws (USWs) and Ws were then compared after confirmation of the final diagnosis. A total of 446 patients were studied. PE was confirmed in 125 patients (28%). USWs performed significantly better than Ws, with a sensitivity of 69.6% versus 57.6% and a specificity of 88.2% versus 68.2%. In combination with D-dimer, USWs showed an optimal failure rate (0.8%) and a significantly superior efficiency than Ws (32.3% vs. 27.2%). A strategy based on lung and venous ultrasound combined with D-dimer would allow to avoid CT pulmonary angiography in 50.5% of patients with suspected PE, compared to 27.2% when the rule without ultrasound is applied. A pretest risk stratification enhanced by ultrasound of lung and venous performs better than Ws in the early diagnostic process of PE. © 2016 by the Society for Academic Emergency Medicine.

  16. Geohydrologic and drill-hole data for test well USW H-4, Yucca Mountain, Nye County, Nevada

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Whitfield, M.S. Jr.; Thordarson, W.; Eshom, E.P.

    This report presents data on drilling operations, lithology, geophysical well logs, sidewall-core samples, water-level monitoring, pumping tests, injection tests, radioactive-tracer borehole flow survey, and water chemistry for test well USW H-4. The well is one of a series of test wells drilled in the southwestern part of the Nevada Test Site, Nye County, Nevada, in cooperation with the US Department of Energy. These test wells are part of the Nevada Nuclear Waste Storage Investigations to identify sites for storage of high-level radioactive wastes. Test well USW H-4 was drilled in ash-flow tuff to a total depth of 1219 meters. Depthmore » to water below land surface was 519 meters, or at an altitude of 730 meters above sea level. After test pumping at a rate of 17.4 liters per second for approximately 9 days, the drawdown was 4.85 meters. A radioactive borehole-flow survey indicated that the Bullfrog Member of the Crater Flat Tuff (Tertiary age) was the most productive geologic unit, producing 36.5 percent of the water in the well. The second most productive geologic unit was the Tram Member of the Crater Flat Tuff, which produced 32 percent of the water. The water in test well USW H-4 is predominantly a soft, sodium bicarbonate type of water typical of water produced in tuffaceous rocks in southern Nevada. 7 references, 26 figures, 9 tables.« less

  17. Solid State Welding Development at Marshall Space Flight Center

    NASA Technical Reports Server (NTRS)

    Ding, Robert J.; Walker, Bryant

    2012-01-01

    What is TSW and USW? TSW is a solid state weld process consisting of an induction coil heating source, a stir rod, and non-rotating containment plates Independent heating, stirring and forging controls Decouples the heating, stirring and forging process elements of FSW. USW is a solid state weld process consisting of an induction coil heating source, a stir rod, and a non-rotating containment plate; Ultrasonic energy integrated into non-rotating containment plate and stir rod; Independent heating, stirring and forging controls; Decouples the heating, stirring and forging process elements of FSW.

  18. [Experiment study on ultrashort wave for treating vascular crisis after rat tail replantation].

    PubMed

    Tan, Long; Gao, Wenshan; Xi, Ali; Wang, Cong; Chen, Shouying; Zhao, Yanyan; Di, Keqian; Yang, Xincai; Weng, Shengbin

    2012-10-01

    To explore the effect and mechanism of ultrashort wave (USW) for prevention and treatment of vascular crisis after rat tail replantation. Eighty 3-month old female Sprague Dawley rats (weighing 232.8-289.6 g) were randomly divided into 5 groups. In each group, based on the caudal vein and the coccyx was retained, the tail was cut off. The tail artery was ligated in group A; the tail artery was anastomosed in groups B, C, D, and E to establish the tail replantation model. After surgery, the rats of group B were given normal management; the rats of group C were immediately given intraperitoneal injection (3.125 mL/kg) of diluted papaverine hydrochloride injection (1 mg/mL); the rats of groups D and E were immediately given the local USW treatment (once a day) at anastomotic site for 5 days at the dosage of 3 files and 50 mA for 20 minutes (group D) and 2 files and 28 mA for 20 minutes (group E). The survival rate of the rat tails was observed for 10 days after the tail replantation. The tail skin temperature difference between proximal and distal anastomosis was measured at pre- and post-operation; the change between postoperative and preoperative temperature difference was calculated. The blood plasma specimens were collected from the inner canthus before operation and from the tip of the tail at 8 hours after operation to measure the content of nitric oxide (NO). The survival rates of the rat tails were 0 (0/14), 36.4% (8/22), 57.1% (8/14), 22.2% (4/18), and 75.0% (9/12) in groups A, B, C, D, and E, respectively, showing significant overall differences among 5 groups (chi2 = 19.935, P = 0.001); the survival rate of group E was significantly higher than that of group B at 7 days (P < 0.05), but no significant difference was found between the other groups by pairwise comparison (P > 0.05). At preoperation, there was no significant difference in tail skin temperature difference among 5 groups (P > 0.05); at 8 hours, 5 days, 6 days, and 7 days after operation, significant overall difference was found in the change of the skin temperature difference among groups (P < 0.05); pairwise comparison showed significant differences after operation (P < 0.05): group B > group D at 8 hours, group C > group D at 5 days, groups A, B, and C > group D at 6 days, groups B and C > groups A and E, and group B > group D at 7 days; but no significant difference was found between the other groups at the other time points (P > 0.05). Preoperative plasma NO content between each group had no significant difference (P > 0.05). The overall differences had significance in the NO content at postopoerative 8 hours and in the change of the NO content at pre- and post-operation among groups (P < 0.05). Significant differences were found by pairwise comparison (P < 0.05): group D > groups A, B, and C in the plasma NO content, group D > groups A and B in the change of the NO content at pre- and post-operation; but no significant difference was found between the other groups by pairwise comparison (P > 0.05). Rat tail replantation model in this experiment is feasible. USW therapy can increase the survival rate of replanted rat tails, reduce skin temperature at 7 days, improve blood supply, increase the content of nitric oxide at the early period and prevent vascular crisis.

  19. Characterization and mapping of leaf rust resistance in four durum wheat cultivars.

    PubMed

    Kthiri, Dhouha; Loladze, Alexander; MacLachlan, P R; N'Diaye, Amidou; Walkowiak, Sean; Nilsen, Kirby; Dreisigacker, Susanne; Ammar, Karim; Pozniak, Curtis J

    2018-01-01

    Widening the genetic basis of leaf rust resistance is a primary objective of the global durum wheat breeding effort at the International Wheat and Maize Improvement Center (CIMMYT). Breeding programs in North America are following suit, especially after the emergence of new races of Puccinia triticina such as BBG/BP and BBBQD in Mexico and the United States, respectively. This study was conducted to characterize and map previously undescribed genes for leaf rust resistance in durum wheat and to develop reliable molecular markers for marker-assisted breeding. Four recombinant inbred line (RIL) mapping populations derived from the resistance sources Amria, Byblos, Geromtel_3 and Tunsyr_2, which were crossed to the susceptible line ATRED #2, were evaluated for their reaction to the Mexican race BBG/BP of P. triticina. Genetic analyses of host reactions indicated that leaf rust resistance in these genotypes was based on major seedling resistance genes. Allelism tests among resistant parents supported that Amria and Byblos carried allelic or closely linked genes. The resistance in Geromtel_3 and Tunsyr_2 also appeared to be allelic. Bulked segregant analysis using the Infinium iSelect 90K single nucleotide polymorphism (SNP) array identified two genomic regions for leaf rust resistance; one on chromosome 6BS for Geromtel_3 and Tunsyr_2 and the other on chromosome 7BL for Amria and Byblos. Polymorphic SNPs identified within these regions were converted to kompetitive allele-specific PCR (KASP) assays and used to genotype the RIL populations. KASP markers usw215 and usw218 were the closest to the resistance genes in Geromtel_3 and Tunsyr_2, while usw260 was closely linked to the resistance genes in Amria and Byblos. DNA sequences associated with these SNP markers were anchored to the wild emmer wheat (WEW) reference sequence, which identified several candidate resistance genes. The molecular markers reported herein will be useful to effectively pyramid these resistance genes with other previously marked genes into adapted, elite durum wheat genotypes.

  20. Characterization and mapping of leaf rust resistance in four durum wheat cultivars

    PubMed Central

    Kthiri, Dhouha; Loladze, Alexander; MacLachlan, P. R.; N’Diaye, Amidou; Walkowiak, Sean; Nilsen, Kirby; Dreisigacker, Susanne; Ammar, Karim

    2018-01-01

    Widening the genetic basis of leaf rust resistance is a primary objective of the global durum wheat breeding effort at the International Wheat and Maize Improvement Center (CIMMYT). Breeding programs in North America are following suit, especially after the emergence of new races of Puccinia triticina such as BBG/BP and BBBQD in Mexico and the United States, respectively. This study was conducted to characterize and map previously undescribed genes for leaf rust resistance in durum wheat and to develop reliable molecular markers for marker-assisted breeding. Four recombinant inbred line (RIL) mapping populations derived from the resistance sources Amria, Byblos, Geromtel_3 and Tunsyr_2, which were crossed to the susceptible line ATRED #2, were evaluated for their reaction to the Mexican race BBG/BP of P. triticina. Genetic analyses of host reactions indicated that leaf rust resistance in these genotypes was based on major seedling resistance genes. Allelism tests among resistant parents supported that Amria and Byblos carried allelic or closely linked genes. The resistance in Geromtel_3 and Tunsyr_2 also appeared to be allelic. Bulked segregant analysis using the Infinium iSelect 90K single nucleotide polymorphism (SNP) array identified two genomic regions for leaf rust resistance; one on chromosome 6BS for Geromtel_3 and Tunsyr_2 and the other on chromosome 7BL for Amria and Byblos. Polymorphic SNPs identified within these regions were converted to kompetitive allele-specific PCR (KASP) assays and used to genotype the RIL populations. KASP markers usw215 and usw218 were the closest to the resistance genes in Geromtel_3 and Tunsyr_2, while usw260 was closely linked to the resistance genes in Amria and Byblos. DNA sequences associated with these SNP markers were anchored to the wild emmer wheat (WEW) reference sequence, which identified several candidate resistance genes. The molecular markers reported herein will be useful to effectively pyramid these resistance genes with other previously marked genes into adapted, elite durum wheat genotypes. PMID:29746580

  1. Geohydrologic and drill-hole data for test well USW H-3, Yucca Mountain, Nye County, Nevada

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thordarson, W.; Rush, F.E.; Spengler, R.W.

    This report presents data collected to determine the hydraulic characteristics of rocks penetrated in test well USW H-3. The well is one of a series of test wells drilled in and near the southwestern part of the Nevada Test Site, Nye County, Nevada, in a program conducted in cooperation with the US Department of Energy. These investigations are part of the Nevada Nuclear Waste Storage Investigations to identify suitable sites for storage of high-level radioactive wastes. Data on drilling operations, lithology, borehole geophysics, hydrologic monitoring, pumping, swabbing, and injection tests for the well are contained in this report.

  2. Effect of Brass Interlayer Sheet on Microstructure and Joint Performance of Ultrasonic Spot-Welded Copper-Steel Joints

    NASA Astrophysics Data System (ADS)

    Satpathy, Mantra Prasad; Kumar, Abhishek; Sahoo, Susanta Kumar

    2017-07-01

    Solid-state ultrasonic spot welding (USW) inevitably offers a potential solution for joining dissimilar metal combination like copper (Cu) and steel (SS). In this study, the USW has been performed on Cu (UNS C10100) and SS (AISI 304) with brass interlayer by varying various welding parameters, aiming to identify the interfacial reaction, changes in microstructure and weld strength. The highest tensile shear and T-peel failure loads of 1277 and 174 N are achieved at the optimum conditions like 68 µm of vibration amplitude, 0.42 MPa of weld pressure and 1 s of weld time. The fractured surface analysis of brass interlayer and AISI 304 stainless steel samples reveals the features like swirls, voids and intermetallic compounds (IMCs). These IMCs are composed of CuZn and FeZn composite-like structures with 1.0 μm thickness. This confirms that the weld quality is specifically sensitive to the levels of input parameter combinations as well as the type of material present on the sonotrode side.

  3. Non-ambiguous recovery of Biot poroelastic parameters of cellular panels using ultrasonicwaves

    NASA Astrophysics Data System (ADS)

    Ogam, Erick; Fellah, Z. E. A.; Sebaa, Naima; Groby, J.-P.

    2011-03-01

    The inverse problem of the recovery of the poroelastic parameters of open-cell soft plastic foam panels is solved by employing transmitted ultrasonic waves (USW) and the Biot-Johnson-Koplik-Champoux-Allard (BJKCA) model. It is shown by constructing the objective functional given by the total square of the difference between predictions from the BJKCA interaction model and experimental data obtained with transmitted USW that the inverse problem is ill-posed, since the functional exhibits several local minima and maxima. In order to solve this problem, which is beyond the capability of most off-the-shelf iterative nonlinear least squares optimization algorithms (such as the Levenberg Marquadt or Nelder-Mead simplex methods), simple strategies are developed. The recovered acoustic parameters are compared with those obtained using simpler interaction models and a method employing asymptotic phase velocity of the transmitted USW. The retrieved elastic moduli are validated by solving an inverse vibration spectroscopy problem with data obtained from beam-like specimens cut from the panels using an equivalent solid elastodynamic model as estimator. The phase velocities are reconstructed using computed, measured resonance frequencies and a time-frequency decomposition of transient waves induced in the beam specimen. These confirm that the elastic parameters recovered using vibration are valid over the frequency range ofstudy.

  4. Contribution of cysteine residues to the structure and function of herpes simplex virus gH/gL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cairns, Tina M.; Landsburg, Daniel J.; Charles Whitbeck, J.

    2005-02-20

    In HSV types 1 and 2, gH forms a noncovalent heterodimer with gL. Previous studies demonstrated that the first 323 amino acids of gH1 and the first 161 amino acids of gL1 are sufficient for gH/gL binding. For gL1, substitution of any of its four cysteine (C) residues (all located within the gH/gL binding region) destroyed gH binding and function. Although gH1 contains 8 cysteines in its ectodomain, gH 2 contains 7 (C3 of gH1 is replaced by arginine in gH2). We found that mutation of any of the four C-terminal cysteines led to a reduction or loss of gH/gLmore » function. Mutation of C5 or C6 in gH1 or gH2 rendered the proteins non-functional. However, substitution of C7 and/or C8 in gH1 has a definite negative impact on cell-cell fusion, although these mutations had less effect on complementation. Remarkably, all four gH1 N-terminal cysteines could be mutated simultaneously with little effect on fusion or complementation. As gH2 already lacks C3, we constructed a triple mutant (gH2-C1/2/4) which exhibited a similar phenotype. Since gH1 is known to bind gL2 and vice versa, we wondered whether binding of gH2 to the heterologous gL1 would enhance the fusion defect seen with the gH2-C2 mutant. The combination of mutant gH2-C2 with wild-type gL1 was nonfunctional in a cell-cell fusion assay. Interestingly, the reciprocal was not true, as gH1-C2 could utilize both gL1 and gL2. These findings suggest that there is a structural difference in the gH2 N-terminus as compared to gH1. We also present genetic evidence for at least one disulfide bond within gH2, between cysteines 2 and 4.« less

  5. Intergenerational Continuity in Parenting Behavior: Mediating Pathways and Child Effects

    PubMed Central

    Neppl, Tricia K.; Conger, Rand D.; Scaramella, Laura V.; Ontai, Lenna L.

    2009-01-01

    This prospective, longitudinal investigation examined mechanisms proposed to explain continuities in parenting behavior across two generations (G1, G2). Data came from 187 G2 adults, their mothers (G1), and their children (G3). Prospective information regarding G2 was collected both during adolescence and early adulthood. G1 data were collected during G2’s adolescence and G3 data were generated during the preschool years. Assessments included both observational and self-report measures. The results indicated a direct relationship between G1 and G2 harsh parenting and between G1 and G2 positive parenting. As predicted, specific mediators accounted for intergenerational continuity in particular types of parenting behavior. G2 externalizing behavior mediated the relationship between G1 and G2 harsh parenting, while G2 academic attainment mediated the relationship between G1 and G2 positive parenting. In addition, the hypothesized mediating pathways remained statistically significant after taking into account possible G2 effects on G1 parenting and G3 effects on G2 parenting. PMID:19702389

  6. The Use of Geographic Information Technologies in Environmental Decision-Making in the State of Michoacan, Mexico

    NASA Astrophysics Data System (ADS)

    Teodoro, Silva García José; Gustavo, Cruz Cárdenas; Salvador, Ochoa Estrada; Franciso, Estrada Godoy; Fabian, Villalpando Barragán

    2008-05-01

    One of the most urgent issues facing the human environment, a result of current human evolution is the increase in the production of Urban Solid Waste (USW). The State of Michoacán is no exception; the presence of waste facilities in the area is a very big problem and one with a strong geographical content (Mena et al., 2006). SIGs are one tool for addressing this kind of need. A model which has been commonly used for selecting areas for the final deposit of USW, and which has obtained good results, is so-called multicriterion decision-making. It has been applied in the context of integral USW management, and has generated both a methodology for the determination of safe places for final waste deposit and an Environmental Risk Index (ERI), which fulfills the requirements indicated by the Official Mexican Norm (NOM-083-SEMARNAT-2003). The methodology consists of a quadrant analysis of 25 ha of five factors. A rank was assigned to each of the factors, and this rank was standardized according to a scale from 0 to 10 and subsequently multiplied by a weight (W) which numerically represents the degree of importance and influence of each factor in the environment. Five represented the largest impact, and two represented the smallest impact. The ERI is the sum of the five factors considered and it is represented by means of the following equation: ERI = VVw+UsUsw+FrFrw+ln lnw+Zi Ziw, where ERI is the Environmental Risk Index, V Vw is the aquifer vulnerability, Us Usw represents the use of the soil, Fr Frw refers to the fracturing density, ln lnw represents the domain of the urban and industrial infrastructure, and Zi Ziw refers to flood zones. This was shown to be successful in different regions of Michoacán State, such as the Bajío area, the Paísde la Mariposa Monarca and Tierra Caliente. Another example is its application in the hydrogeologic context, which generated the Aquifer Veda index (a restriction diagram for the opening of new exploitations), and which is intended to regulate and give advice about the design of wells, their depth and optimum slot interval, their appropriate location and caudal, in those cases in which well-drilling is permitted. The above-mentioned approach is fundamental to the sustainable operating schemes for the handling of the underground water in the Ciénega de Chapala. This approach is intended to influence the scientific handling of the hydro resource, promoting sustainable politics and rules of operation.

  7. Geohydrology of rocks penetrated by test well USW H-4, Yucca Mountain, Nye County, Nevada

    USGS Publications Warehouse

    Whitfield, M.S.; Eshom, E.P.; Thordarson, William; Schaefer, D.H.

    1985-01-01

    Test well USW H-4 is one of several wells drilled in the southwestern part of the Nevada Test Site for hydraulic testing, hydrologic monitoring, and geophysical logging. The work was performed in cooperation with the U.S. Department of Energy. The rocks penetrated by the well to a total depth of 1,219 m were volcanic tuffs of Tertiary age. Hydraulic coefficients calculated from pumping test data indicate that transmissivity ranged from 200 to 790 sq m/day. A radioactive tracer, borehole flow survey indicated that the two most productive zones during this borehole flow survey occurred in the upper part of the Bullfrog Member of the Crater Flat Tuff, depth interval from 721 to 731.5m, and in the underlying part of the Tram Member, depth interval from 864 to 920m. The water is predominantly a sodium biocarbonate type with small concentrations of calcium, magnesium, and sulfate. The apparent age of this composite water sample was determined by carbon-14 date of 17,200 years before present. (USGS)

  8. Prediction of Curve Correction Using Alternate Level Pedicle Screw Placement in Patients With Adolescent Idiopathic Scoliosis (AIS) Lenke 1 and 2 Using Supine Side Bending (SB) and Fulcrum Bending (FB) Radiograph.

    PubMed

    Kwan, Mun Keong; Zeyada, Hassan E; Chan, Chris Yin Wei

    2015-10-15

    Prospective cohort study. To compare side bending (SB) and fulcrum bending (FB) radiographs in patients with adolescent idiopathic scoliosis (AIS) and effect of magnitude and AR curves on curve correctability. The prediction of correction using side bending flexibility (SBF) and fulcrum bending flexibility (FBF) in alternate level pedicle screw (PS) configuration and effect of curve magnitude and AR curves are not well understood. 100 AIS Lenke 1 and 2 were recruited. Curve magnitude was stratified to G1 (41°-60°), G2 (61°-80°), G3 (>80°). The main thoracic (MT) curves were subclassified to AR curves [Miyanji F, Pawelek JB, Van Valin SE, et al. Is the lumbar modifier useful in surgical decision making? Defining two distinct Lenke 1A curve patterns. Spine 2008;33:2545-51]. Preoperatively SBF and FBF were determined whereas postoperative parameters were correction rate (CR), fulcrum bending correction index (FBCI), and side bending correction index (SBCI). Correlation test were carried out between SBF, FBF versus CR for the cohort. There were 38 (G1), 42 (G2), and 20 (G3) patients. 34% were AR curves. SBF for G1, G2, and G3 were 61.3 ± 14.4, 59.2 ± 16.2 and 43.1 ± 13.1% (P = 0.000) whereas FBF for G1, G2, and G3 were 71.1 ± 16.5, 58.3 ± 18.1 and 52.7 ± 17.1% (P = 0.000). The CR was G1 (74.5 ± 11.5%), G2 (69.2 ± 12.7%), and G3 (70.2 ± 8.6%). FBCI was 1.11 ± 0.3 (G1), 1.28 ± 0.4 (G2) and 1.48 ± 0.6 for G3. SBCI was 1.26 ± 0.2 (G1), 1.50 ± 0.5 (G2), and 1.72 ± 0.4 for G3. There was strong correlation for SBF and FBF versus CR for G1 and G2. For G3, a very strong correlation was established between SBF (r = 0.846, r = 0.716) and FBF versus CR (r = 0.700, r = 0.540). AR curves demonstrated higher SBF and FBF. CR remains almost constant in G1, G2, and G3. SBCI and FBCI increase significantly in G1, G2, and G3. Correlation between SBF and FBF and CR was strong for G1, G2, and very strong for G3. AR curves showed better correctability with SB and FB films.

  9. Working for America: A Federal Employee Survey

    DTIC Science & Technology

    1990-06-01

    take concerning these is- developed and trained; restructuring the Federal sues. employees ’ health insurance program ; increasing 2 A Report by the U.S...we do that is by periodically conducting surveys of the employees in that system. In developing this questionnaire, we received assistance from...AD-A234 177 I WORKING FOR AMERICA: A FEDERAL EMPLOYEE SURVEY A SPECIAL STUDY (2 THE CHAIRMAN U.S. MERIT SYSTEMS PROTECTION BOARD 1120 Vermont Avenue

  10. Comprehensive phenotypic analysis of knockout mice deficient in cyclin G1 and cyclin G2

    PubMed Central

    Ohno, Shouichi; Ikeda, Jun-ichiro; Naito, Yoko; Okuzaki, Daisuke; Sasakura, Towa; Fukushima, Kohshiro; Nishikawa, Yukihiro; Ota, Kaori; Kato, Yorika; Wang, Mian; Torigata, Kosuke; Kasama, Takashi; Uchihashi, Toshihiro; Miura, Daisaku; Yabuta, Norikazu; Morii, Eiichi; Nojima, Hiroshi

    2016-01-01

    Cyclin G1 (CycG1) and Cyclin G2 (CycG2) play similar roles during the DNA damage response (DDR), but their detailed roles remain elusive. To investigate their distinct roles, we generated knockout mice deficient in CycG1 (G1KO) or CycG2 (G2KO), as well as double knockout mice (DKO) deficient in both proteins. All knockouts developed normally and were fertile. Generation of mouse embryonic fibroblasts (MEFs) from these mice revealed that G2KO MEFs, but not G1KO or DKO MEFs, were resistant to DNA damage insults caused by camptothecin and ionizing radiation (IR) and underwent cell cycle arrest. CycG2, but not CycG1, co-localized with γH2AX foci in the nucleus after γ-IR, and γH2AX-mediated DNA repair and dephosphorylation of CHK2 were delayed in G2KO MEFs. H2AX associated with CycG1, CycG2, and protein phosphatase 2A (PP2A), suggesting that γH2AX affects the function of PP2A via direct interaction with its B’γ subunit. Furthermore, expression of CycG2, but not CycG1, was abnormal in various cancer cell lines. Kaplan–Meier curves based on TCGA data disclosed that head and neck cancer patients with reduced CycG2 expression have poorer clinical prognoses. Taken together, our data suggest that reduced CycG2 expression could be useful as a novel prognostic marker of cancer. PMID:27982046

  11. Normzahlen, Toleranzen, Passungen

    NASA Astrophysics Data System (ADS)

    Böge, Gert; Böge, Wolfgang

    Vor allem wegen der Kosten ist es sinnvoll, sich beim Festlegen von Maßen aller Art auf Vorzugszahlen zu beschränken (Baugrößen, Drehzahlen, Drehmomente, Leistungen, Drücke usw.). Man verwendet dazu eine geometrisch gestufte Zahlenfolge (siehe Teil Mathematik). Abb. 40.1 zeigt, dass bei der geometrischen Stufung die Werte im unteren Bereich fein, im oberen grob gestuft sind. Das ist nicht nur technisch sinnvoll.

  12. Optimization of Aluminium-to-Magnesium Ultrasonic Spot Welding

    NASA Astrophysics Data System (ADS)

    Panteli, A.; Chen, Y.-C.; Strong, D.; Zhang, Xiaoyun; Prangnell, P. B.

    2012-03-01

    The ability to join dissimilar materials in the automotive industry will result in more efficient multimaterial structures. However, welding of aluminium (Al) to magnesium (Mg) alloys is problematic because of the rapid formation of brittle intermetallic phases at the weld interface. Ultrasonic welding (USW) is a solid-state joining technology that may offer a potential solution, but USW of Al to Mg is currently not well understood. Here, we have investigated the effect of process variables and energy input on joint formation between Al-6111 and Mg-AZ31 alloys, and we report on the optimum welding conditions, heat generation, and the formation of a significant intermetallic reaction layer. Furthermore, the factors influencing the interface reaction rate and the advantages of precoating the Mg with Al are discussed.

  13. Analysis of Zn, Cd, As, Cu, Pb, and Fe in snails as bioindicators and soil samples near traffic road by ICP-OES.

    PubMed

    Massadeh, Adnan M; Alomary, Ahmed A; Mir, Sayeeda; Momani, Fouad A; Haddad, Hazem I; Hadad, Yazen A

    2016-07-01

    Snails are used as biological indicators of the environment pollution for heavy metals. Living snail samples were collected from different sites at the city of Irbid-Jordan and classified according to their morphological features including Helix pelasga, Eobania vermiculata, Xeropicta derbentina, Oychilus, Xerocrassa seetzenii, Xerocrassa simulata, and Pila. Zn, Cd, As, Cu, Pb, and Fe levels were measured by inductively coupled plasma-optical emission spectroscopy. Results indicated that metal concentrations in all snail shell samples were with an average and range for Zn 22.4 (6.5-105.5) μg g(-1), Cd 7.8 (0.4-48.1) μg g(-1), As 25.9 (0.7-248.5) μg g(-1), Cu 15.1 (1.6-69.0) μg g(-1), Pb 0.4 (0.2-1.7) μg g(-1), and Fe 119.6 (14.0-1102.0) μg g(-1), whereas, in soil samples, the average and range for Zn 204.0 (12.0-709.0) μg g(-1), Cd 5.7 (0.2-39.5) μg g(-1), As 3.2 (1.8-5.2) μg g(-1), Cu 22.1 (2.3-77.4) μg g(-1), Pb 0.2 (0.1-0.3) μg g(-1), and Fe 242.4 (25.0-680.0) μg g(-1).

  14. PAI-1 4G/5G Polymorphism Contributes to Cancer Susceptibility: Evidence from Meta-Analysis

    PubMed Central

    Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

    2013-01-01

    Background The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. Methods A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I2 test. Results Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03–1.18, I2 = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06–1.39, I2 = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04–1.18, I2 = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09–1.59, I2 = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04–1.21, I2 = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05–1.21, I2 = 25.3%). Conclusions The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer. PMID:23437240

  15. PAI-1 4G/5G polymorphism contributes to cancer susceptibility: evidence from meta-analysis.

    PubMed

    Wang, Shangqian; Cao, Qiang; Wang, Xiaoxiang; Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

    2013-01-01

    The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I(2) test. Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03-1.18, I(2) = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06-1.39, I(2) = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04-1.18, I(2) = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09-1.59, I(2) = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04-1.21, I(2) = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05-1.21, I(2) = 25.3%). The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer.

  16. Association between PAI-1 4G/5G polymorphism and diabetic nephropathy: a meta-analysis in the Chinese population.

    PubMed

    Gao, Wen-Feng; Guo, Ying-Bo; Bai, Yu; Ding, Xin-Yu; Yan, Yong-Ji; Wu, Zhen-Qi

    2016-09-01

    Although a number of studies have been conducted on the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and diabetic nephropathy (DN) in Chinese population, this association remains elusive and controversial. To further assess the effects of PAI-1 4G/5G polymorphism on the risk of DN, a meta-analysis was performed in the Chinese population. Relevant studies were identified using PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure, and Chinese Biology Medicine through November, 2015. Pooled odds ratios (ORs) and 95 % confidence intervals (CIs) were used to assess the strength of the associations. This meta-analysis identified nine studies, including 777 DN cases, 413 healthy controls, and 523 DM controls. In the total analyses, a significantly elevated risk of DN was associated with variants of PAI-1 4G/5G when compared with the healthy group (4G vs. 5G, OR 2.46, 95 % CI 1.45-4.16; 4G/4G vs. 5G/5G, OR 4.32, 95 % CI 1.79-10.39; 4G/4G vs. 4G/5G +5G/5G, OR 2.96, 95 % CI 1.59-5.53; 4G/4G +4G/5G vs. 5G/5G, OR 2.78, 95 % CI 1.34-5.75) and DM group (4G vs. 5G, OR 1.93, 95 % CI 1.28-2.92; 4G/4G vs. 5G/5G, OR 2.99, 95 % CI 1.44-6.21; 4G/4G vs. 4G/5G +5G/5G, OR 2.84, 95 % CI 1.77-4.54). In the subgroup analyses stratified by ethnicity and geographic areas, it revealed the significant results in Chinese Han, in North and South China. This meta-analysis showed that the PAI-1 4G/4G variant, 4G allele might be risk alleles for DN susceptibility in the Chinese population, and further studies in other ethic groups are required for definite conclusions.

  17. Intergenerational continuity in economic hardship, parental positivity, and positive parenting: The association with child behavior

    PubMed Central

    Jeon, Shinyoung; Neppl, Tricia K.

    2015-01-01

    The current study examined intergenerational continuity in economic hardship, parental positivity, and positive parenting across generations based on both the Family Stress Model and the Family Resilience Framework. The study included 220 generation one (G1) parents, their target youth (generation two: G2) who participated from adolescence through adulthood, and the target’s child (generation three: G3). Assessments included observational and self-report measures. Results indicated that G1 economic hardship negatively influenced both G1 positivity and G1 positive parenting. Similarly, G2 economic hardship was negatively related to both G2 positivity and G2 positive parenting which, in turn, was associated with G3 positive behavior to G2. For both G1 and G2, parental positivity mediated the association between economic hardship and positive parenting. G2 economic hardship was indirectly related to G3 positive behavior through G2 parental positivity and positive parenting. An important finding is that the intergenerational continuity of economic hardship, positivity, and positive parenting were transmitted from G1 to G2. Results suggest that even in times of economic adversity, parental positivity and positive parenting were transmitted from G1 parents to their G2 youth during adulthood. Such continuity seems to influence the positive behavior of the G3 children. PMID:26371448

  18. Measurement of the IgG2 response to Pneumococcal capsular polysaccharides may identify an antibody deficiency in individuals referred for immunological investigation.

    PubMed

    Parker, Antony; Irure Ventura, Juan; Sims, Dawn; Echeverría de Carlos, Ainara; Gómez de la Torre, Ricardo; Tricas Aizpún, Lourdes; Ocejo-Vinyals, J Gonzalo; López-Hoyos, Marcos; Wallis, Gregg; Harding, Stephen

    2017-01-01

    IgG2 is the most efficient subclass for providing protection against pneumococcal pathogens. We hypothesised that some individuals may be unable to mount an effective pneumococcal capsular polysaccharide (PCP) IgG2 response despite having a normal PCP IgG concentration (PCP IgG2 deficient). The median pre-vaccination PCP IgG2 concentration was significantly lower in individuals referred for immunological investigation compared to healthy controls (2.8 mg/L range, 95% CI 1.1-88 vs. 29.5mg/L, 95% CI 13.5-90, p = 0.0002). PCP IgG:IgG2 ratios were significantly higher for the referral population than for healthy controls suggesting the increased production of PCP specific subclasses other than IgG2. The percentage of individuals with PCP IgG2 deficiency was significantly higher in referral groups compared to controls (31% vs. 5%; p = 0.0009) and in an individual with PCP IgG2 deficiency, the balance of PCP specific IgG subclass antibodies post vaccination changed from IgG2>IgG1>IgG3>IgG4 to IgG1>IgG3>IgG2>IgG4. The median PCP IgG2 concentration in those with PCP IgG2 deficiency was significantly lower in the referral groups compared to controls (7.8 mg/L, 95% CI 1.1-12 vs. 12.7 mg/L, 95% CI 11.8-13.1; p = 0.006). The data suggests a defect in the production PCP IgG2 may be present in individuals with normal PCP IgG referred for immunological investigation.

  19. The Intergenerational Continuity of SES: Effects of Parenting, Personality, and Age at First Romantic Partnership

    PubMed Central

    Senia, Jennifer M.; Neppl, Tricia K.; Gudmunson, Clinton G.; Donnellan, M. Brent; Lorenz, Frederick O.

    2015-01-01

    Research indicates that socioeconomic status (SES) is related to individual health and wellbeing, and may be transmitted across generations. The interactionist model proposes that circumstances in the family of origin and individual characteristics both account for social, economic, and developmental outcomes associated with SES. Thus, the present investigation evaluated continuities in SES across two generations (G1, G2) as mediated through G1 maternal positive parenting, G2 personality, and G2 age of first committed romantic partnership. Participants were 432 emerging adults from an ongoing longitudinal study. Consistent with the interactionist model, G1 SES was associated with G2 personality indirectly through G1 maternal positive parenting. G1 SES, G2 personality, and G2 first partnership directly predicted G2 SES. G1 maternal positive parenting was also indirectly associated with G2 age at first partnership through G2 personality. Findings were consistent across two broad personality domains – negative emotionality and constraint. However, positive emotionality was not associated with G2 age at partnership. PMID:26651350

  20. 40 CFR 721.5960 - N,N′-Bis(2-(2-(3-alkyl)thia- zoline) vinyl)-1,4-pheny-lene-dia-mine methyl sulfate double salt...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...), (f) (concentration set at 1 percent), (g)(1)(iii), (g)(1), (may be lethal if inhaled or in contact with eyes), (g)(2)(i), (g)(2)(ii), (g)(2)(iv), (g)(2)(v), and (g)(5). The provision of § 721.72(d...

  1. 40 CFR 721.5960 - N,N′-Bis(2-(2-(3-alkyl)thia- zoline) vinyl)-1,4-pheny-lene-dia-mine methyl sulfate double salt...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...), (f) (concentration set at 1 percent), (g)(1)(iii), (g)(1), (may be lethal if inhaled or in contact with eyes), (g)(2)(i), (g)(2)(ii), (g)(2)(iv), (g)(2)(v), and (g)(5). The provision of § 721.72(d...

  2. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

  3. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

  4. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

  5. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY.... § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C...(g) for a catch-up eligible participant (within the meaning of § 1.414(v)-1(g)), the otherwise...

  6. Introducing the thyroid gland as another victim of the insulin resistance syndrome.

    PubMed

    Rezzonico, Jorge; Rezzonico, Mariana; Pusiol, Eduardo; Pitoia, Fabián; Niepomniszcze, Hugo

    2008-04-01

    Insulin is a thyroid growth factor that stimulates proliferation of thyroid cells in culture. In order to evaluate the effects of insulin resistance (IR) on the thyroid gland, we developed a prospective study in euthyroid women. One hundred eleven women (mean age 32.2 +/- 7 years) were evaluated by a thyroid ultrasound (US) and basal and postprandial serum insulin. Subjects were divided into four groups as follows: G1 (n = 42), subjects with IR and obesity; G2 (n = 21), subjects with obesity without IR; G3 (n = 17), subjects with IR and normal weight; and G4 (n = 31) control group (without IR and obesity). The thyroid volume (TV), measured by US, showed the following values: G1, 17 +/- 3 mL; G2, 13.8 +/- 2.8 mL; G3, 16.2 +/- 2.1 mL; and G4,12.1 +/- 2.4 mL. There was no significant difference in TV between G1 and G3, but differences between G1 and G2, and between G3 and G4 were significant at p < 0.05. The percentage of nodular thyroid glands observed by US in each group was as follows: G1, 50%; G2, 23.8%; G3, 61%; G4, 16.1%. Again, the differences between G1 and G2 and between G3 and G4 were statistically significant (p < 0.005 and p < 0.001, respectively, for each comparison). It is concluded that the higher circulating levels of insulin cause increased thyroid proliferation. The clinical manifestations are the larger thyroid volume and the formation of nodules. Thus, the thyroid gland appears to be another victim of the insulin resistance syndrome.

  7. Thermochemical cycles for the production of hydrogen

    DOEpatents

    Steinberg, M.; Dang, V.D.

    Two-step processes for the preparation of hydrogen are described: CrCl/sub 3/(g) ..-->.. CrCl/sub 2/(g) + 1/2Cl/sub 2/(g) and CrCl/sub 2/(s) + HCl(g) reversible CrCl/sub 3/(s) + 1/2H/sub 2/(g); UCl/sub 4/(g) ..-->.. UCl/sub 3/(g) + 1/2Cl/sub 2/(g) and UCl/sub 3/(s) + HCl(g) ..-->.. UCl/sub 4/(s) + 1/2H/sub 2/(g); and CaSO/sub 4/(s) ..-->.. CaO(s) + SO/sub 2/(g) + 1/2O/sub 2/(g) and CaO(s) + SO/sub 2/(g) + H/sub 2/O(l) ..-->.. CaSO/sub 4/(s) + H/sub 2/(g). The high temperature available from solar collectors, high temperature gas reactors or fusion reactors is utilized in the first step in which the reaction is endothermic. The efficiency is at least 60% and with process heat recovery, the efficiency may be increased up to 74.4%. An apparatus fr carrying out the process in conjunction with a fusion reactor, is described.

  8. Glucose trajectories in cystic fibrosis and their association with pulmonary function.

    PubMed

    Reynaud, Quitterie; Rabilloud, Muriel; Roche, Sylvain; Poupon-Bourdy, Stéphanie; Iwaz, Jean; Nove-Josserand, Raphaële; Blond, Emilie; Laville, Martine; Llerena, Cathy; Quetant, Sébastien; Reix, Philippe; Touzet, Sandrine; Durieu, Isabelle

    2018-05-01

    The prevalence of cystic fibrosis-related diabetes is increasing. This condition is potentially responsible for respiratory decline. At inclusion, then yearly (over three years), 111 children and 117 adults with cystic fibrosis had oral glucose tolerance and insulin tests at one (G1) and 2h (G2). KmL analysis identified homogeneous G1 and G2 glucose trajectories. A linear mixed model quantified the relationships between trajectories and FEV1 changes. In children, there were three G1 and four G2 trajectories and FEV1 decrease was not significantly different between G1 or G2 trajectories. In adults, two G1 and four G2 trajectories were identified and FEV1 change was estimated at -0.85/year (95% CI: [-1.54; -0.17], p=0.01) whatever the G1 trajectory and found significantly faster in the high and increasing G2 trajectory (-2.1/year, [-3.9; -0.2], p=0.03). In case of persistent G2 abnormality, physicians should be alert for clinical deterioration and intensify patient surveillance. Copyright © 2017 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  9. Effects of weak/non-complement-binding HLA antibodies on C1q-binding.

    PubMed

    Hönger, G; Amico, P; Arnold, M-L; Spriewald, B M; Schaub, S

    2017-08-01

    It is unknown under what conditions and to what extent weak/non-complement (C)-binding IgG subclasses (IgG2/IgG4) can block C1q-binding triggered by C-binding IgG subclasses (IgG1/IgG3). Therefore, we investigated in vitro C1q-binding induced by IgG subclass mixtures targeting the same HLA epitope. Various mixtures of HLA class II specific monoclonal antibodies of different IgG subclasses but identical V-region were incubated with HLA DRB1*07:01 beads and monitored for C1q-binding. The lowest concentration to achieve maximum C1q-binding was measured for IgG3, followed by IgG1, while IgG2 and IgG4 did not show appreciable C1q-binding. C1q-binding occurred only after a critical amount of IgG1/3 has bound and sharply increased thereafter. When both, C-binding and weak/non-C-binding IgG subclasses were mixed, C1q-binding was diminished proportionally to the fraction of IgG2/4. A 2- to 4-fold excess of IgG2/4 inhibited C1q-binding by 50%. Very high levels (10-fold excess) almost completely abrogated C1q-binding even in the presence of significant IgG1/3 levels that would usually lead to strong C1q-binding. In sensitized renal allograft recipients, IgG subclass constellations with ≥ 2-fold excess of IgG2/4 over IgG1/3 were present in 23/66 patients (34.8%) and overall revealed slightly decreased C1q signals. However, spiking of patient sera with IgG2 targeting a different epitope than the patient's IgG1/3 synergistically increased C1q-binding. In conclusion, if targeting the same epitope, an excess of IgG2/4 is repressing the extent of IgG1/3 triggered C1q-binding in vitro. Such IgG subclass constellations are present in about a third of sensitized patients and their net effect on C1q-binding is slightly inhibitory. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Hypergravity Effects on Rodent Pregnancy and Parturition

    NASA Technical Reports Server (NTRS)

    Ronca, A. E.; Baer, L. A.; Mills, N. A.; Wade, C. E.; Dalton, Bonnie (Technical Monitor)

    2002-01-01

    No mammal has yet undergone birth, or parturition, in the microgravity of space. Previous studies (Ronco & Alberts, 2000) have shown that mid-pregnant rat dams exposed to spaceflight (0-g) and landed 48-72 hrs before term successfully delivered robust, healthy offspring Microgravity-exposed dams exhibited twice the expected numbers of labor contractions whereas length of pregnancy, duration of labor, fetal wastage, number of neonates born and litter gender ratios were identical to controls. In the present study, we report the results of rodent pregnancy and parturition at the opposite end of the gravity spectrum, in hypergravity. Dams exposed to either: 1.0-g, 1.5-g, 1.75-g or 2.0-g from Gestational day (G) 11 and throughout the births of their litters had comparable pregnancy and labor durations, fetal wastage, numbers of neonates born and litter Tender ratios. During parturition, hypergravity-exposed dams exhibited significantly fewer labor contractions as compared to 1.0-g controls. Dams that underwent birth in hypergravity had significantly fewer offspring surviving the immediate postpartum period (P1: 1.0-g, 11.92 +/- 2.84; 1.5-g, 10.88 +/- 2.17; 1.75-g, 9.22 +/-1.99; 2.0-g, 8.83 +/- 3.31). Within 24 hrs postpartum, neonatal survival was further diminished in hypergravity [P2: 100% (1.0-g); 96% (1.5-g); 96% (1.75-g); 73% (2.0-g)] and continued to decline (P10: 100%(1.0-g.); 90%(1.5-g); 87%(1.75-g), 40%(2.0-g)]. Neonatal losses stabilized by P5 for the 1.5-g andl.75-g conditions but continued until P9 for the 2.0-g condition. Together, these findings show that postnatal, but not prenatal, survival is compromised following birth in hypergravity, Maternal and neonatal factors that contribute to peri-parturitional vulnerability to altered gravity environments will be discussed.

  11. [Evaluation of changes in the mode of twin deliveries over the years].

    PubMed

    Madej, Anna; Szymusik, Iwona; Oledzka, Magdalena; Kosińska-Kaczyńska, Katarzyna; Bomba-Opoń, Dorota A; Wielgoś, Mirosław

    2012-10-01

    The aim of the study was to evaluate changes in the course of twin deliveries over the years, with particular emphasis on the history of infertility duration of pregnancy mode of delivery indications for caesarean section (CS) and infant condition. The study consisted of three groups of patients who delivered twins at the First Department of Obstetrics & Gynecology Medical University of Warsaw: 92 women in years 1987-1991 (G1), 62 in years 1997-2001 (G2) and 126 in years 2007-2010 (G3). The history of infertility treatment (especially in vitro fertilization), mode of delivery indications for cesarean section and newborn condition were taken into account. The results were afterwards compared among the groups and the differences were analyzed with the use of Statistica 10.0 software, with p value <0.05 considered as significant. The rate of twin deliveries in G1 was 1.03% of all deliveries, 1.09% in G2 and 1.77% in G3 (p=0.049 G3 vs. G1). An increase of twin deliveries among primiparas (from 44.5% in G1 through 48.3% in G2 to 66.7% in G3; p=0.0016) and primiparas after in vitro fertilization (from 9.76% in G1 through 26.67% in G2 to 58% in G3; p<0.001) was noted. The average age of patients and mean duration of pregnancies were similar in G1, G2 and G3. However there was a significant increase in preterm delivery rate in G2 and G3 in comparison to G1 (G1 - 38.4%; G2 - 63.3%; G3 - 64.3%; G1 vs G2 and G3 p<0.001). CS was performed in 47.8% vs. 58% vs. 90.5% of all cases (p<0.0001). In G1 CS was most often performed when the presentation of the 1st fetus was non-cephalic (53.3%). In G2 and G3 the non-cephalic presentation of the 1st or 2nd fetus was equally important as an indication for CS (30.5%, 30.5% and 19.3%, 21.9%, respectively). Manual maneuvers on the 2nd twins were applied in 25% vs. 6.5% vs. 0.79% of deliveries (p<0.01). Cesarean section on the second twin, after the first twin was delivered vaginally was performed in 1.07% of the cases in G1, 1.61% in G2 and in 0.79% in G3 (p=ns). There were no differences in the Apgar scores of the first twins in the 1st and 5th minute of life among the studied groups. However, second twins were delivered in significantly better condition in G2 and G3 than in G1 (5-minute Apgar of 8-10 points: 79.7% vs. 93.3% vs. 92.6%; p<0.05). Twin pregnancy rate almost doubled over the years, mostly due to a growing popularity of the infertility treatment. Cesarean section is increasingly being chosen to deliver twins. The non-cephalic position of the 2nd fetus has become an important indication for cesarean section. Change in the mode of twin deliveries can be beneficial for the condition of the 2nd twin.

  12. Forecasting generation of urban solid waste in developing countries--a case study in Mexico.

    PubMed

    Buenrostro, O; Bocco, G; Vence, J

    2001-01-01

    Based on a study of the composition of urban solid waste (USW) and of socioeconomic variables in Morelia, Mexico, generation rates were estimated. In addition, the generation of residential solid waste (RSW) and nonresidential solid waste (NRSW) was forecasted by means of a multiple linear regression (MLR) analysis. For residential sources, the independent variables analyzed were monthly wages, persons per dwelling, age, and educational level of the heads of the household. For nonresidential sources, variables analyzed were number of employees, area of facilities, number of working days, and working hours per day. The forecasted values for residential waste were similar to those observed. This approach may be applied to areas in which available data are scarce, and in which there is an urgent need for the planning of adequate management of USW.

  13. Efficacy of the injectable calcium phosphate ceramics suspensions containing magnesium, zinc and fluoride on the bone mineral deficiency in ovariectomized rats.

    PubMed

    Otsuka, Makoto; Oshinbe, Ayako; Legeros, Racquel Z; Tokudome, Yoshihiro; Ito, Atsuo; Otsuka, Kuniko; Higuchi, William I

    2008-01-01

    The purpose of this study was to evaluate the therapeutic efficacy of a new calcium phosphate (CaP)-based formulation in improving the bone mineral deficiency in ovariectomized (OVX) rats. The ions release experiments for CaP preparations (G2: 0.46% Mg, 5.78% Zn, and 2.5% F; G3:3.1% Mg, 0.03% Zn, and 3.01% F; G4: 1.25% Mg, 1.77% Zn, 1.35% F) and of a Zn-TCP (G1: 6.17% Zn) powders, the initial Mg and Zn ion release rates of MZF-CaPs were performed in acetate buffer at pH 4.5 (37 degrees C). Wistar rats were divided into six groups including a normal (not OVX) group (GN) and a control, OVX group (GC). Rats in groups GC, G1, G2, G3, G4 were OVX. Suspensions consisting of CaP preparations (G2, G3, G4) and of a Zn-TCP (G1) powders were injected in the right thighs of OVX rats in all groups except for GN and GC, once a week for 4 weeks. GN and GC rats were injected with saline solutions. Plasma was analyzed for Zn land alkaline phosphatase levels. The bone mineral density (BMD) was measured using DEXA and the bone (femur) strength determined using three-point-bending analysis. G1 and G2 groups showed high plasma Zn levels. The area under the curve of plasma Zn was significantly greater in the G1, G2, and GN groups than in the G3, G4, and GC groups (p < 0.05). The BMD and bone mechanical strength of the right femur were significantly higher in the G1, G2, G3, and G4 groups than GC group on day 28. The right femur had significantly greater BMD and bone mechanical strength than the left femur in G1, G2, G3, and G4 groups. However, there was no significant difference in the BMD of the right femur between the G1, G2, G3, and G4 groups. Results indicate that the new injectable CaP formulations are effective in improving bone properties of OVX rats and may be useful in osteoporosis therapy. (c) 2007 Wiley-Liss, Inc.

  14. Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2

    PubMed Central

    Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E.; Chen, Shuang; Bodie, Wesley W.; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A.; Kramer, Lora B.; Dent, Paul

    2011-01-01

    Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138+ cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138+ primary samples, but spared normal CD138− and CD34+ cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G0/G1 arrest and increased apoptosis in all cell-cycle phases, including G0/G1. To determine whether this regimen is active against quiescent G0/G1 MM cells, cells were cultured in low-serum medium to enrich the G0/G1 population. G0/G1–enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G0/G1–enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G0) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst+), low pyronin Y (PY)–staining (2N Hst+/PY−) G0 population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition. PMID:21911831

  15. Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2.

    PubMed

    Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E; Chen, Shuang; Bodie, Wesley W; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A; Kramer, Lora B; Dent, Paul; Grant, Steven

    2011-11-10

    Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138(+) cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138(+) primary samples, but spared normal CD138(-) and CD34(+) cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G(0)/G(1) arrest and increased apoptosis in all cell-cycle phases, including G(0)/G(1). To determine whether this regimen is active against quiescent G(0)/G(1) MM cells, cells were cultured in low-serum medium to enrich the G(0)/G(1) population. G(0)/G(1)-enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G(0)/G(1)-enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G(0)) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst(+)), low pyronin Y (PY)-staining (2N Hst(+)/PY(-)) G(0) population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition.

  16. Rate Coefficient for Collisional Removal of O2(X3Σ ^-g, v = 1) with O Atoms at 240 K

    NASA Astrophysics Data System (ADS)

    Pejaković, D. A.; Campbell, Z.; Kalogerakis, K. S.; Copeland, R. A.; Slanger, T. G.

    2004-12-01

    Knowledge of the water concentration profile is key to understanding of the chemistry and energy flow in the stratosphere and mesosphere. One of the tasks of the SABER instrument in NASA's TIMED mission is to measure water vapor concentration by detecting H2O(ν 2) emission in the 6.8 μ m region. An important source of the H2O(ν 2) emission is the collisional deactivation of vibrationally excited O2: O2(X3Σ ^-g, v = 1) + H2O <-> O2(X3Σ ^-g, v = 0) + H2O(ν 2). For reliable interpretation of the SABER data it is crucial to determine rate coefficient for the competing process: O2(X3Σ ^-g, v = 1) + O(3P) -> O2(X3Σ ^-g, v = 0) + O(3P) [1]. Laboratory measurements are reported of the rate coefficient for collisional removal of O2(X3Σ ^-g, v = 1) by O(3P) at a temperature of 240 K, relevant to the upper mesosphere. Instead of directly detecting the O2(X3Σ ^-g, v = 1) population, a novel, technically simpler, approach is used in which the v = 1 level of the O2(a1Δ g) state is monitored. With ground-state O2 present, owing to the rapid equilibration of the O2(X3Σ ^-g, v = 1) and O2(a1Δ g, v = 1) populations via the processes O2(a1Δ g, v = 1) + O2(X3Σ ^-g, v = 0) <-> O2(a1Δ g, v = 0) + O2(X3Σ ^-g, v = 1), the information on the O2(X3Σ ^-g, v = 1) kinetics is extracted from the O2(a1Δ g, v = 1) temporal evolution. A two-laser method is employed, in which the pulsed output of the first laser near 285 nm photodissociates ozone to produce atomic oxygen and O2(a1Δ g, v = 1), and the pulsed output of the second laser detects O2(a1Δ g, v = 1) via the resonance-enhanced multiphoton ionization. In the same experiment, rate coefficients for removal of O2(a1Δ g, v = 1) with the atmospherically relevant colliders O2, CO2, and O also were measured at room temperature and 240 K. The measured rate coefficient for O2(X3Σ ^-g, v = 1) removal by O(3P) is in the range 2--3 × 10-12 cm3s-1 at 240 K, compared to the recently measured room temperature value of about 3 × 10-12 cm3s-1 [2]. Interestingly, removal of O2(a1Δ g, v = 1) by O(3P) is about five times less efficient than removal of O2(X3Σ ^-g, v = 1). The rate coefficient for O2(a1Δ g, v = 1) removal by O2 is in the range 5--6 × 10-11 cm3s-1 and is nearly temperature independent in the region 296--240 K. The removal by CO2 is about 3000 times slower than removal by O2 and nearly independent on temperature. Implications of the results for atmospheric modeling will be discussed. This work is supported by the NASA Geospace Sciences Program under grant NAG5-13002. Participation of Z. Campbell was made possible through the NSF Research Experience for Undergraduates Program under grant PHY-0353745. [1] M. G. Mlynczak, D. K. Zhou, M. Lopez-Puertas, G. Zaragoza, and J. M. Russell, Geophys. Res. Lett. 26, 63 (1999). [2] Konstantinos S. Kalogerakis, Richard A. Copeland, and Tom G. Slanger, Eos. Trans. AGU 82(47), Fall Meet. Suppl., Abstract SA41B-0728, 2001.

  17. Grading the neuroendocrine tumors of the lung: an evidence-based proposal.

    PubMed

    Rindi, G; Klersy, C; Inzani, F; Fellegara, G; Ampollini, L; Ardizzoni, A; Campanini, N; Carbognani, P; De Pas, T M; Galetta, D; Granone, P L; Righi, L; Rusca, M; Spaggiari, L; Tiseo, M; Viale, G; Volante, M; Papotti, M; Pelosi, G

    2014-02-01

    Lung neuroendocrine tumors are catalogued in four categories by the World Health Organization (WHO 2004) classification. Its reproducibility and prognostic efficacy was disputed. The WHO 2010 classification of digestive neuroendocrine neoplasms is based on Ki67 proliferation assessment and proved prognostically effective. This study aims at comparing these two classifications and at defining a prognostic grading system for lung neuroendocrine tumors. The study included 399 patients who underwent surgery and with at least 1 year follow-up between 1989 and 2011. Data on 21 variables were collected, and performance of grading systems and their components was compared by Cox regression and multivariable analyses. All statistical tests were two-sided. At Cox analysis, WHO 2004 stratified patients into three major groups with statistically significant survival difference (typical carcinoid vs atypical carcinoid (AC), P=0.021; AC vs large-cell/small-cell lung neuroendocrine carcinomas, P<0.001). Optimal discrimination in three groups was observed by Ki67% (Ki67% cutoffs: G1 <4, G2 4-<25, G3 ≥25; G1 vs G2, P=0.021; and G2 vs G3, P≤0.001), mitotic count (G1 ≤2, G2 >2-47, G3 >47; G1 vs G2, P≤0.001; and G2 vs G3, P≤0.001), and presence of necrosis (G1 absent, G2 <10% of sample, G3 >10% of sample; G1 vs G2, P≤0.001; and G2 vs G3, P≤0.001) at uni and multivariable analyses. The combination of these three variables resulted in a simple and effective grading system. A three-tiers grading system based on Ki67 index, mitotic count, and necrosis with cutoffs specifically generated for lung neuroendocrine tumors is prognostically effective and accurate.

  18. Serum IgG subclass levels and risk of exacerbations and hospitalizations in patients with COPD.

    PubMed

    Leitao Filho, Fernando Sergio; Ra, Seung Won; Mattman, Andre; Schellenberg, Robert S; Criner, Gerard J; Woodruff, Prescott G; Lazarus, Stephen C; Albert, Richard; Connett, John E; Han, Meilan K; Martinez, Fernando J; Leung, Janice M; Paul Man, S F; Aaron, Shawn D; Reed, Robert M; Sin, Don D

    2018-02-14

    The literature is scarce regarding the prevalence and clinical impact of IgG subclass deficiency in COPD. We investigated the prevalence of IgG subclass deficiencies and their association with exacerbations and hospitalizations using subjects from two COPD cohorts. We measured IgG subclass levels using immunonephelometry in serum samples from participants enrolled in two previous COPD trials: Macrolide Azithromycin for Prevention of Exacerbations of COPD (MACRO; n = 976) and Simvastatin for the Prevention of Exacerbations in Moderate-to-Severe COPD (STATCOPE; n = 653). All samples were collected from clinically stable participants upon entry into both studies. IgG subclass deficiency was diagnosed when IgG subclass levels were below their respective lower limit of normal: IgG1 < 2.8 g/L; IgG2 < 1.15 g/L; IgG3 < 0.24 g/L; and IgG4 < 0.052 g/L. To investigate the impact of IgG subclass levels on time to first exacerbation or hospitalization, we log-transformed IgG levels and performed Cox regression models, with adjustments for confounders. One or more IgG subclass deficiencies were found in 173 (17.7%) and 133 (20.4%) participants in MACRO and STATCOPE, respectively. Lower IgG1 or IgG2 levels resulted in increased risk of exacerbations with adjusted hazard ratios (HR) of 1.30 (95% CI, 1.10-1.54, p < 0.01) and 1.19 (95% CI, 1.05-1.35, p < 0.01), respectively in the MACRO study, with STATCOPE yielding similar results. Reduced IgG1 or IgG2 levels were also associated with increased risk of hospitalizations: the adjusted HR for IgG1 and IgG2 was 1.52 (95% CI: 1.15-2.02, p < 0.01) and 1.33 (95% CI, 1.08-1.64, p < 0.01), respectively for the MACRO study; in STATCOPE, only IgG2 was an independent predictor of hospitalization. In our multivariate Cox models, IgG3 and IgG4 levels did not result in significant associations for both outcomes in either MACRO or STATCOPE cohorts. Approximately 1 in 5 COPD patients had one or more IgG subclass deficiencies. Reduced IgG subclass levels were independent risk factors for both COPD exacerbations (IgG1 and IgG2) and hospitalizations (IgG2) in two COPD cohorts. This study used serum samples from participants of the MACRO ( NCT00325897 ) and STATCOPE ( NCT01061671 ) trials.

  19. Potential use of glucuronylglucosyl-β-cyclodextrin/dendrimer conjugate (G2) as a DNA carrier in vitro and in vivo.

    PubMed

    Anno, Takayuki; Higashi, Taishi; Motoyama, Keiichi; Hirayama, Fumitoshi; Uekama, Kaneto; Arima, Hidetoshi

    2012-04-01

    In this study, we evaluated the polyamidoamine starburst dendrimer (dendrimer, generation 2: G2) conjugate with 6-O-α-(4-O-α-D-glucuronyl)-D-glucosyl-β-cyclodextrin (GUG-β-CDE (G2)) as a gene transfer carrier. The in vitro gene transfer activity of GUG-β-CDE (G2, degree of substitution (DS) of cyclodextrin (CyD) 1.8) was remarkably higher than that of dendrimer (G2) conjugate with α-CyD (α-CDE (G2, DS 1.2)) and that with β-CyD(β-CDE (G2, DS 1.3)) in A549 and RAW264.7 cells. The particle size, ζ-potential, DNase I-catalyzed degradation, and cellular association of plasmid DNA (pDNA) complex with GUG-β-CDE (G2, DS 1.8) were almost the same as those of the other CDEs. Fluorescent-labeled GUG-β-CDE (G2, DS 1.8) localized in the nucleus 6 h after transfection of its pDNA complex in A549 cells, suggesting that nuclear localization of pDNA complex with GUG-β-CDE (G2, DS 1.8), at least in part, contributes to its high gene transfer activity. GUG-β-CDE (G2, DS 1.8) provided higher gene transfer activity than α-CDE (G2, DS 1.2) and β-CDE (G2, DS 1.3) in kidney with negligible changes in blood chemistry values 12 h after intravenous injection of pDNA complexes with GUG-β-CDE (G2, DS 1.8) in mice. In conclusion, the present findings suggest that GUG-β-CDE (G2, DS 1.8) has the potential for a novel polymeric pDNA carrier in vitro and in vivo.

  20. Changes in biogas production due to different ratios of some animal and agricultural wastes.

    PubMed

    Al-Masri, M R

    2001-03-01

    The biogas production and some biochemical parameters of anaerobic fermentation at 30 degrees C for 40 days were studied for eight experimental groups of fermentation media, as affected by two factors: (1) the type of the animal waste (sheep waste, S and goat waste, G), and (2) the ratio of waste to olive cake which constitutes four levels (100:0 for S1 and G1; 80:20 for S2 and G2; 60:40 for S3 and G3 and 40:60 for S4 and G4). The results indicated that there was a significant decrease (P < 0.05) in the biogas production with an increase in the proportion of olive cake in place of animal waste. However, there was a significant increase in the biogas production for the S4 treatment compared with G4, reflecting an effect induced by the type of animal waste. The biogas production amounted to (l/kg VS/40 d): 62 (S1), 53 (S2), 49 (S3), 40 (S4), 58 (G1), 50 (G2), 44 (G3) and 25 (G4). The reduction in total solid (TS) weight, volatile solids (VS), neutral-detergent fiber decreased significantly (P < 0.05) with the increase in olive cake proportion in the digester. The reductions in VS were (% in DM): 58.2 (S1), 37.8 (S2), 26.6 (S3), 22.6 (S4), 58.1 (G1), 36 (G2), 33.4 (G3), 14.4 (G4). The rates of energy consumption were (MJ/kg DM/40 d): 15.36 (S1), 10.12 (S2), 7.84 (S3), 6.68 (S4), 14.16 (G1), 9.68 (G2), 8.41 (G3), 3.29 (G4).

  1. Percolation flux and Transport velocity in the unsaturated zone, Yucca Mountain, Nevada

    USGS Publications Warehouse

    Yang, I.C.

    2002-01-01

    The percolation flux for borehole USW UZ-14 was calculated from 14C residence times of pore water and water content of cores measured in the laboratory. Transport velocity is calculated from the depth interval between two points divided by the difference in 14C residence times. Two methods were used to calculate the flux and velocity. The first method uses the 14C data and cumulative water content data directly in the incremental intervals in the Paintbrush nonwelded unit and the Topopah Spring welded unit. The second method uses the regression relation for 14C data and cumulative water content data for the entire Paintbrush nonwelded unit and the Topopah Spring Tuff/Topopah Spring welded unit. Using the first method, for the Paintbrush nonwelded unit in boreholeUSW UZ-14 percolation flux ranges from 2.3 to 41.0 mm/a. Transport velocity ranges from 1.2 to 40.6 cm/a. For the Topopah Spring welded unit percolation flux ranges from 0.9 to 5.8 mm/a in the 8 incremental intervals calculated. Transport velocity ranges from 1.4 to 7.3 cm/a in the 8 incremental intervals. Using the second method, average percolation flux in the Paintbrush nonwelded unit for 6 boreholes ranges from 0.9 to 4.0 mm/a at the 95% confidence level. Average transport velocity ranges from 0.6 to 2.6 cm/a. For the Topopah Spring welded unit and Topopah Spring Tuff, average percolation flux in 5 boreholes ranges from 1.3 to 3.2 mm/a. Average transport velocity ranges from 1.6 to 4.0 cm/a. Both the average percolation flux and average transport velocity in the PTn are smaller than in the TS/TSw. However, the average minimum and average maximum values for the percolation flux in the TS/TSw are within the PTn average range. Therefore, differences in the percolation flux in the two units are not significant. On the other hand, average, average minimum, and average maximum transport velocities in the TS/TSw unit are all larger than the PTn values, implying a larger transport velocity for the TS/TSw although there is a small overlap.

  2. Simplified Quantum Logic with Trapped Ions

    DTIC Science & Technology

    2016-06-23

    j !52mj•E~z !52\\g j~S1~ j !1S2~ j !!~ei~k•z2vLt2f! 1e2i~k•z2vLt2f!). ~2! In this expression, g j5mj•E0 /2\\ is the resonant Rabi fre- quency...by g j ,1g j ,2 /D , where g j ,1 and g j ,2 are the individual Rabi fre- quencies of the two beams when resonantly coupled to the virtual level and D...couples the states un&u↓& and un&u↑& with Rabi frequency @13,14# Vn ,n5 1 \\ u^n z^↑uHI~ j !u↓& zn&u 5g jz^nueih~a1a †!un& z 5g je 2h2/2Ln~h 2!, ~4

  3. Intergenerational Continuity in Parenting Behavior: Mediating Pathways and Child Effects

    ERIC Educational Resources Information Center

    Neppl, Tricia K.; Conger, Rand D.; Scaramella, Laura V.; Ontai, Lenna L.

    2009-01-01

    This prospective, longitudinal investigation examined mechanisms proposed to explain continuities in parenting behavior across 2 generations (G1, G2). Data came from 187 G2 adults, their mothers (G1), and their children (G3). Prospective information regarding G2 was collected both during adolescence and early adulthood. G1 data were collected…

  4. Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis.

    PubMed

    Zhang, Tengyue; Pang, Chong; Li, Ningdong; Zhou, Elaine; Zhao, Kanxing

    2013-01-02

    Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10 years) indicated a gene-environment interaction in determining the risk of diabetic retinopathy.

  5. Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis

    PubMed Central

    2013-01-01

    Background Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Methods Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Results Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). Conclusions The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10 years) indicated a gene-environment interaction in determining the risk of diabetic retinopathy. PMID:23281898

  6. Salivary IgG subclasses in individuals with and without homozygous IGHG gene deletions.

    PubMed Central

    Engström, P E; Norhagen, G; Osipova, L; Helal, A; Wiebe, V; Brusco, A; Carbonara, A O; Lefranc, G; Lefranc, M P

    1996-01-01

    In this study, the levels of salivary IgG1, IgG2, IgG3 and IgG4 from individuals with and without homozygous immunoglobulin heavy chain constant gene deletions were quantified by enzyme-linked immunosorbent assay (ELISA). To analyse the restriction of salivary IgG subclasses, we used unstimulated whole saliva and sera collected at the same time from individuals with homozygous gene deletions, two with G1 deletion, one with G4 deletion, six with both G2 and G4 deletions and from eight individuals without IGHG gene deletions and expressing all four IgG subclasses. The median values of salivary IgG from individuals with homozygous G1, or G4, or both G2 and G4 deletions, and from individuals expressing all four subclasses were 24.2 mg/l and 23.4 mg/l, respectively. The median values of serum IgG were 13.7 g/l and 15.9 g/l, respectively. Our results show that the salivary and serum IgG levels were both within the normal range in individuals with homozygous gene deletions of either G1, or G4, or both G2 and G4. PMID:8943711

  7. Differentially expressed circulating microRNAs in the development of acute diabetic Charcot foot.

    PubMed

    Pasquier, Jennifer; Ramachandran, Vimal; Abu-Qaoud, Moh'd Rasheed; Thomas, Binitha; Benurwar, Manasi J; Chidiac, Omar; Hoarau-Véchot, Jessica; Robay, Amal; Fakhro, Khalid; Menzies, Robert A; Jayyousi, Amin; Zirie, Mahmoud; Al Suwaidi, Jassim; Malik, Rayaz A; Talal, Talal K; Najafi-Shoushtari, Seyed Hani; Rafii, Arash; Abi Khalil, Charbel

    2018-06-05

    Charcot foot (CF) is a rare complication of Type 2 diabetes (T2D). We assessed circulating miRNAs in 17 patients with T2D and acute CF (G1), 17 patients with T2D (G2) and equivalent neuropathy and 17 patients with T2D without neuropathy (G3) using the high-throughput miRNA expression profiling. 51 significantly deregulated miRNAs were identified in G1 versus G2, 37 in G1 versus G3 and 64 in G2 versus G3. Furthermore, we demonstrated that 16 miRNAs differentially expressed between G1 versus G2 could be involved in osteoclastic differentiation. Among them, eight are key factors involved in CF pathophysiology. Our data reveal that CF patients exhibit an altered expression profile of circulating miRNAs.

  8. Genetic history of hepatitis C virus in Venezuela: high diversity and long time of evolution of HCV genotype 2.

    PubMed

    Sulbarán, Maria Z; Di Lello, Federico A; Sulbarán, Yoneira; Cosson, Clarisa; Loureiro, Carmen L; Rangel, Héctor R; Cantaloube, Jean F; Campos, Rodolfo H; Moratorio, Gonzalo; Cristina, Juan; Pujol, Flor H

    2010-12-13

    The subtype diversity of the hepatitis C virus (HCV) genotypes is unknown in Venezuela. Partial sequencing of the NS5B region was performed in 310 isolates circulating in patients from 1995 to 2007. In the samples collected between 2005 and 2007, HCV genotype 1 (G1) was the most common genotype (63%), composed as expected of mainly G1a and G1b. G2 was the second most common genotype (33%), being G2a almost absent and G2j the most frequent subtype. Sequence analysis of the core region confirmed the subtype assignment performed within the NS5b region in 63 isolates. The complete genome sequence of G2j was obtained. G2j has been described in France, Canada and Burkina Fasso, but it was not found in Martinique, where several subtypes of G2 circulate in the general population. Bayesian coalescence analysis indicated a most recent common ancestor (MRCA) of G2j around 1785, before the introduction of G1b (1869) and G1a (1922). While HCV G1a and G1b experienced a growth reduction since 1990, coincident with the time when blood testing was implemented in Venezuela, HCV G2j did not seem to reach growth equilibrium during this period. Assuming the introduction of G2j from Africa during the slave trade, the high frequency of G2j found in Venezuela could suggest: 1- the introduction of African ethnic groups different from the ones introduced to Martinique or 2- the occurrence of a founder effect. This study represents an in-depth analysis of the subtype diversity of HCV in Venezuela, which is still unexplored in the Americas and deserves further studies.

  9. Bladder cancer risk associated with genotypic polymorphism of the matrix metalloproteinase-1 and 7 in North Indian population.

    PubMed

    Srivastava, Priyanka; Gangwar, Ruchika; Kapoor, Rakesh; Mittal, Rama D

    2010-01-01

    Matrix metalloproteinases (MMPs) contribute to tumor invasion and microenvironment, hence are associated with bladder cancer risk. We therefore, tested whether polymorphisms in MMP genes modify the risk of bladder cancer (BC) and whether smoke exposure modifies this risk. Genotyping was performed in 200 BC patients and 200 controls by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). MMP1-1607 2G/2G and MMP7-181 GG genotype were associated with increased risk of BC (p < 0.001; OR, 3.04; 95% CI- 1.71-5.39 and p, 0.005; OR, 2.38; 95% CI- 1.30-4.34) respectively. Smokers in BC patients showed significant increased risk for the same SNPs (p, 0.006; OR, 3.20; 95% CI- 1.40-7.31 and p, 0.009; OR, 2.85; 95% CI- 1.30-6.23 respectively). Haplotype analysis too revealed significant association with G/2G of MMP1-519-1607 (p< 0.001; OR, 2.62; 95% CI- 1.68-4.09). The 2G allele carrier (1G/2G + 2G/2G) of MMP1-1607 showed a protective effect and high recurrence free survival in Bacillus Calmette-Guérin (BCG) treated non muscle invasive BC (NMIBC) patients (log rank p, 0.030). Our data suggested that MMP1-1607 2G and MMP7-181 G allele were associated with high risk of BC, which was quite evident amongst smokers too. BCG treated NMIBC patients reflected protective effect for 2G allele carrier (1G/2G + 2G/2G) of MMP1-1607. This study provided new support for the association of MMP1-1607 and MMP7-181 in bladder cancer development, the tumorigenic effect of which was observed to be more enhanced in case of tobacco exposure.

  10. Effects of one-time and two-time intra-articular injection of hyaluronic acid sodium salt after joint surgery in dogs

    PubMed Central

    Boonsri, Burin; Sripratak, Thatdanai; Markmee, Patsanan

    2013-01-01

    Thirty-one dogs with patellar luxation (grades 2 and 3) were categorized into three groups. Group 1 (G.1; n = 12) had sodium hyaluronate (SHA) intra-articularly injected into the stifle joint that received surgery. Group 2 (G.2; n = 10) received SHA twice: first after surgery and then 1 week later. Group 3 (G.3; n = 9) served as a control, without injection. Blood was collected before injection and then once a week for 4 weeks after injection for evaluation of chondroitin sulfate (CS-WF6) and hyaluronan (HA). The results revealed significantly (p < 0.05) improved clinical scores by the end of week 4 in G.1 and G.2 relative to G.3; however, there was no significant difference between G.1 and G.2. There was a significant decrease (p < 0.05) in serum CS-WF6 levels beginning at week 2 in G.1 and G.2. At weeks 3 and 4, serum HA in G.1 and G.2 differed from that in G.3 (p < 0.05). No significant difference (p > 0.05) was observed in serum biomarkers between G.1 and G.2. In conclusion, intra-articular injection with SHA after joint surgery may improve homeostasis of the joint, retarding the process of OA. PMID:23814475

  11. A 52-week extension study of switching from gemigliptin vs sitagliptin to gemigliptin only as add-on therapy for patients with type 2 diabetes who are inadequately controlled with metformin alone.

    PubMed

    Jung, Chan-Hee; Rhee, Eun-Jung; Lee, Won-Young; Min, Kyung Wan; Shivane, Vyankatesh K; Sosale, Aravind R; Jang, Hak Chul; Chung, Choon Hee; Nam-Goong, Il Seong

    2018-06-01

    We investigated the long-term efficacy and safety of gemigliptin and the efficacy and safety of gemigliptin treatment after once-daily treatment with sitagliptin 100 mg, in patients with type 2 diabetes. This was a 28-week extension of a 24-week, randomized, double-blind, parallel study of gemigliptin or sitagliptin added to ongoing metformin therapy. After randomization to sitagliptin 100 mg qd (S), gemigliptin 25 mg bid (G1) or gemigliptin 50 mg qd (G2) and after completing 24 weeks of treatment, 118 patients switched from gemigliptin 25 mg bid to 50 mg qd (G1/G2), 111 patients continued gemigliptin 50 mg qd (G2/G2) and 106 patients switched from sitagliptin 100 mg qd to gemigliptin 50 mg qd (S/G2). All 3 treatments reduced glycated haemoglobin (HbA1c) (S/G2,-0.99% [95% CI -1.25%, -0.73%]; G1/G2, -1.11% [95% CI -1.33%, -0.89%]; G2/G2, -1.06% [95% CI -1.28%, -0.85%]). The percentage of patients achieving HbA1c < 6.5% was 27.6% in the G1/G2 group at both Week 24 and Week 52, and ranged from 27.3% to 32.7% in the G2/G2 group (difference in proportions, 5% [95% CI -6%, 17%]), while it increased from 6.8% to 27.3% from Week 24 to Week 52 in the S/G2 group (difference in proportions, 20% [95% CI 7%, 34%]). Addition of gemigliptin 50 mg qd to metformin was shown to be efficacious for 52 weeks. Switching from sitagliptin 100 mg to gemigliptin 50 mg showed consistent glyacemic control over the previous treatment. © 2018 John Wiley & Sons Ltd.

  12. Upper bound for the span of pencil graph

    NASA Astrophysics Data System (ADS)

    Parvathi, N.; Vimala Rani, A.

    2018-04-01

    An L(2,1)-Coloring or Radio Coloring or λ coloring of a graph is a function f from the vertex set V(G) to the set of all nonnegative integers such that |f(x) ‑ f(y)| ≥ 2 if d(x,y) = 1 and |f(x) ‑ f(y)| ≥ 1 if d(x,y)=2, where d(x,y) denotes the distance between x and y in G. The L(2,1)-coloring number or span number λ(G) of G is the smallest number k such that G has an L(2,1)-coloring with max{f(v) : v ∈ V(G)} = k. [2]The minimum number of colors used in L(2,1)-coloring is called the radio number rn(G) of G (Positive integer). Griggs and yeh conjectured that λ(G) ≤ Δ2 for any simple graph with maximum degree Δ>2. In this article, we consider some special graphs like, n-sunlet graph, pencil graph families and derive its upper bound of (G) and rn(G).

  13. Weapon System Costing Methodology for Aircraft Airframes and Basic Structures Volume II - Estimating Handbook and User’s Manual, Part 2

    DTIC Science & Technology

    1975-05-01

    4bo» i) (46u t2) ( 4tib > 3 ) ( 4bD » fa) .1 .1 .1 .1 LÜG LÜG LÜG LUG LÜG LUG LÜG Lud LÜG LUG LUG LUG LÜG LÜG LUG Lüb LÜG LUG...PC2UI LUG PC310 LUG PL 111 LuG PC211 LÜG PL 31 1 LÜG PL212 PL312 .OB LUG LUG LÄWüING GEAR «LWüRK (4bb»1) + (468»1) (4bbf2) + (46P»2) ( 4bD »3...JiJCDtJCDCDt3(JCDO»-tOOCDC3tDC3i-J_7CD( t^cJtJCJ(D^J Ducju>ot-Jt-Jur>j > 03 J- IT J- -* IP ip >r IP 0- *S -* <D O rj >1 O --i TD -D -i TD O 4 * UJ

  14. 26 CFR 1.1503(d)-8 - Effective dates.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... loss that was incurred in 2004, and a triggering event described in § 1.1503-2(g)(2)(iv)(B)(1)(ii... agreements filed under §§ 1.1503-2A(c)(3), 1.1503-2A(d)(3), 1.1503-2(g)(2)(i), or 1.1503-2T(g)(i). If an agreement is filed in accordance with §§ 1.1503-2A(c)(3), 1.1503-2A(d)(3), 1.1503-2(g)(2)(i), or 1.1503-2T(g...

  15. 26 CFR 1.1503(d)-8 - Effective dates.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... loss that was incurred in 2004, and a triggering event described in § 1.1503-2(g)(2)(iv)(B)(1)(ii... agreements filed under §§ 1.1503-2A(c)(3), 1.1503-2A(d)(3), 1.1503-2(g)(2)(i), or 1.1503-2T(g)(i). If an agreement is filed in accordance with §§ 1.1503-2A(c)(3), 1.1503-2A(d)(3), 1.1503-2(g)(2)(i), or 1.1503-2T(g...

  16. 26 CFR 1.1503(d)-8 - Effective dates.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... loss that was incurred in 2004, and a triggering event described in § 1.1503-2(g)(2)(iv)(B)(1)(ii... agreements filed under §§ 1.1503-2A(c)(3), 1.1503-2A(d)(3), 1.1503-2(g)(2)(i), or 1.1503-2T(g)(i). If an agreement is filed in accordance with §§ 1.1503-2A(c)(3), 1.1503-2A(d)(3), 1.1503-2(g)(2)(i), or 1.1503-2T(g...

  17. 26 CFR 1.1503(d)-8 - Effective dates.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... loss that was incurred in 2004, and a triggering event described in § 1.1503-2(g)(2)(iv)(B)(1)(ii... agreements filed under §§ 1.1503-2A(c)(3), 1.1503-2A(d)(3), 1.1503-2(g)(2)(i), or 1.1503-2T(g)(i). If an agreement is filed in accordance with §§ 1.1503-2A(c)(3), 1.1503-2A(d)(3), 1.1503-2(g)(2)(i), or 1.1503-2T(g...

  18. Do serum angiopoietin-1, angiopoietin-2, and their receptor Tie-2 and 4G/5G variant of PAI-1 gene have a role in the pathogenesis of preeclampsia?

    PubMed

    Kamal, Manal; El-Khayat, Waleed

    2011-10-01

    To evaluate whether serum angiogenesis markers such as angiopoietins (Ang-1, Ang-2) and their receptor (Tie-2) are altered in women with preeclampsia. We also performed genotyping to determine if the 4G/5G genotypes of -675 PAI-1 gene may play a role in the pathogenesis of preeclampsia. Sixty-eight pregnant women with preeclampsia were compared to 35 normotensive pregnant women and 24 normotensive nonpregnant women in a cross-sectional study. Using enzyme-linked immunosorbent assay, levels of serum Ang-1 and Ang-2, and Tie-2 were measured. A single base pair insertion/deletion 4G/5G polymorphism of the PAI-1 gene was determined by polymerase chain reaction. Serum levels of Ang-1 and Tie-2 were significantly different among the study groups (P = 0.001 and P = 0.025, respectively) being lower in the preeclamptic group. Positive significant correlation was found between Ang-2 and Tie-2, (r = 0.26, P = 0.024). The frequency of the genotypes (4G/5G, 4G/4G, and 5G/5G) differed among the groups (P = 0.001). Also, the mean of systolic and diastolic blood pressures differed significantly according to the PAI-1 genotype being higher in those bearing the 4G allele; P = 0.04 and P = 0.023, respectively. Sera Ang-1 and Ang-2, and Tie-2 as well as variants of 4G/5G of PAI-1 polymorphism have positive implications in the pathogenesis of preeclampsia.

  19. Conformational preferences for some 2-substituted N-methoxy- N-methylacetamides through spectroscopic and theoretical studies

    NASA Astrophysics Data System (ADS)

    Olivato, Paulo R.; da Silva Gomes, Roberto; Rodrigues, Alessandro; Reis, Adriana K. C. A.; Domingues, Nelson L. C.; Rittner, Roberto; Dal Colle, Maurizio

    2010-08-01

    The analysis of the IR carbonyl band of the 2-substituted N-methoxy- N-methylacetamides Y-CH 2C(O)N(OMe)Me (Y = F 1, OMe 2, OPh 3, Cl 4), supported by B3LYP/6-311++G(3df, 3pd) calculations along with the NBO analysis for 1- 4, indicated the existence of cis- gauche conformers i.e. ( c) and ( g) for 1 and 3, ( c1,c2) and ( g1,g2) for 2, and ( c) and ( g1,g2) for 4. In the gas phase, the g conformer population prevails over the c one, for 1 and 3, the ( c1 + c2) population prevails over the ( g1 + g2) one for 2, and the ( g1 + g2) conformer population is more abundant than ( c) one for 4. In n-hexane solution, the cis conformer is more abundant for 1- 3. The occurrence of Fermi resonance in the νCO region, in n-hexane, precludes the estimative of relative populations of the ( c, g1, g2) conformers for 4. The SCI-PCM calculations agree with the solvent effect on the νCO band component relative intensities for 1- 3. NBO analysis showed that the nN → πco∗ orbital interaction is the main factor which stabilizes the gauche ( g, g1, g2) conformers for 1- 4 into a larger extent relative to the cis ( c, c1, c2) ones. The nY → πco∗, σCsbnd Y → πco∗, πco → σC sbnd Y ∗ and πco∗ → σC sbnd Y ∗ orbital interactions still contribute, but into a minor extent for the stabilization of the gauche conformers relative to the cis ones. The existence of some pyramidalization at the nitrogen atom of the Weinreb amides 1- 4 is responsible for the occurrence of Y δ-(4)···O δ-(9) and Y δ-(4)···N δ-(7) short contacts in the gauche ( g, g1, g2) conformers, which originates strong repulsive Coulombic interactions, acting in opposition to the large orbital stabilization of the gauche conformer with respect to the cis one. Therefore, a delicate balance of the Coulombic and orbital interactions seems to be responsible for the observed stabilization of the gauche ( g, g1, g2) and cis ( c, c1, c2) conformers, both in the gas phase and in the solution for 1- 4. However, the cis conformer predominance, in non polar solvents, for the 2-substituted N-methoxy- N-methyl acetamides 1- 3, bearing in α first raw (fluorine and oxygen) atoms, is in the opposite direction to the gauche conformer preference for the corresponding 2-substituted N, N-dialkyl-acetamides.

  20. 26 CFR 1.1503(d)-8 - Effective dates.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... loss that was incurred in 2004, and a triggering event described in § 1.1503-2(g)(2)(iv)(B)(1)(ii...-2A(c)(3), 1.1503-2A(d)(3), 1.1503-2(g)(2)(i), or 1.1503-2T(g)(i). If an agreement is filed in accordance with §§ 1.1503-2A(c)(3), 1.1503-2A(d)(3), 1.1503-2(g)(2)(i), or 1.1503-2T(g)(2)(i) with respect to...

  1. Selenium impacts on razorback sucker, Colorado River, Colorado: I. Adults

    USGS Publications Warehouse

    Hamilton, S.J.; Holley, K.M.; Buhl, K.J.; Bullard, F.A.; Weston, L.K.; McDonald, S.F.

    2005-01-01

    Adult razorback sucker (Xyrauchen texanus) were exposed to various selenium concentrations in ponds and isolated river channels of the Colorado River near Grand Junction, CO, to determine effects on their growth and residue accumulation over an 11-month period. Adults at Horsethief ponds were fed a commercial diet, whereas fish at Adobe Creek channel and North Pond foraged on natural food items. Selenium concentrations at Horsethief were 2.2 μg/L in water, 0.1–1.4 μg/g in sediment, and 2.3–3.1 μg/g in food organisms (1.1 μg/g in commercial fish food), at Adobe Creek were 3.8 μg/L in water, 0.5–2.1 μg/g in sediment, and 4–56 μg/g in food organisms, and at North Pond were 9.5 μg/L in water, 7–55 μg/g in sediment, and 20–81 μg/g in food organisms. The selenium concentrations in muscle plugs from adults at Adobe Creek (11.7 μg/g, SD=0.4, n=6) and North Pond (16.6 μg/g, SD=1.0, n=6) were greater than at Horsethief (4.5 μg/g, SD=0.2, n=6). During a depuration period adults from Adobe Creek and North Pond lost 1–2% of their selenium burden in 32 days and 14–19% in 66 days. Selenium accumulated in razorback sucker above toxic thresholds reported in other studies, yet those residues were less than those reported in muscle plugs of 40% of wild razorback sucker caught in the Green River, Utah.

  2. Influence of food restriction on the reproduction and larval performance of matrinxã, Brycon amazonicus (Spix and Agassiz, 1829).

    PubMed

    Camargo, A C S; Urbinati, E C

    2008-11-01

    This work evaluated the effect of food restriction and refeeding of matrinxã females, Brycon amazonicus, on their reproductive performance and on the growth and survival of the progeny. Broodstocks were distributed in 8 earthen tanks (15 fish/tank) and fish from 4 tanks were fed daily (G1) while fish from the other 4 tanks were fed for 3 days and not fed for 2 days (G2) during 6 months prior to artificial spawning. Among the induced females, 57% in G1 group and 45% in G2 group spawned and the mean egg weights were 208.1 g (G1) and 131.6 g (G2). Oocytes of G2 fish were smaller (1.017 +/- 0.003 mm) than oocytes of G1 fish (1.048 +/- 0.002 mm). Fertilization (71.91 +/- 12.6% and 61.18 +/- 13.7%) and hatching (61.28 +/- 33.9% and 67.50 +/- 23.4%) rates did not differ between G1 and G2 fish. Larvae were collected at hatching and at 24, 48 and 72 hours of incubation and fixed for growth measurement. After incubation, fry were transferred to aquaria and sampled 1, 5, 9 and 15 days later. G1 and G2 larvae had similar weight (1.51 +/- 0.15 and 1.46 +/- 0.07 mg) but the G2 length was significantly higher (6.26 +/- 0.13 and 6.74 +/- 0.14 mm). By the ninth day of rearing, G2 fry had higher weight (13.6 +/- 0.26 and 18.9 +/- 0.07 mg) and length (11.8 +/- 0.09 and 14.5 +/- 0.04 mm) but by the fifteenth day, G1 fry had higher weight (90.2 +/- 1.19 and 68.6 +/- 0.77 mg) and length (18.8 +/- 0.16 and 18.5 +/- 0.04 mm) than G2 fry. By the ninth day of rearing, when fry are recommended to be transferred to outdoor tanks, G2 fry were larger and after 15 days, fry produced by restricted-fed females showed higher survival. The survival rate of G2 progeny by the fifteenth day was significantly higher (24.7 +/- 2.07%) than that of G1 progeny (19.2 +/- 1.91%). The ration restriction (35% reduction) imposed on matrinxã broodstock during 6 months prior to spawning reduced the number of spawned females and the egg amount, but it did not affect fertilization and hatching rates. Otherwise restricted-female larvae were larger and presented higher survival.

  3. Observation of the spin-orbit components of the 3B 2g( 3A 2g) ground state in the system Ni 2+:MgF 2 by fluorescence line narrowing

    NASA Astrophysics Data System (ADS)

    Tonucci, R. J.; Jacobsen, S. M.; Yen, W. M.

    1990-10-01

    Using a tunable narrow-band infrared laser, we demonstrate for the first time infrared-fluorescnece line narrowing in the system Ni 2+:MgF 2. High-resolution emission spectra were obtained by pumping the lowest spin-orbit component B 3 ( 3T 2g) (orthorhombic notation with octahedral notation in parentheses) of the 3T 2g multiplet and observing the B 3( 3T 2g)→B 1, A, B 2( 3A 2g) luminescent transitions at low temperature. By tuning the narrow-band laser over the B 3( 3T 2g) band, resonant and non-resonant fluorescence were obtained which narrowed with respect to the inhomogeneously broadened profile, and additional lines were observed. The spectra can be understood in terms of a simultaneous excitation of two different subsets of Ni 2+ ions which have their B 2( 3A 2g)→B 3( 3T 2g) and A( 3A 2g)→B 3( 3T 2g) transitions in resonance with the laser. The A( 3A 2g) and B 1( 3A 2g) spin-orbit components of the ground-state multiplet lie 1.9 cm -1 and 6.5 cm -1 above the B 2( 3A 2g) ground state, respectively, at 2 K.

  4. Unconventionally prepared TiO2/g-C3N4 photocatalysts for photocatalytic decomposition of nitrous oxide

    NASA Astrophysics Data System (ADS)

    Troppová, Ivana; Šihor, Marcel; Reli, Martin; Ritz, Michal; Praus, Petr; Kočí, Kamila

    2018-02-01

    The TiO2/g-C3N4 nanocomposites with the various TiO2:g-C3N4 weight ratios from 1:1 to 1:3 were prepared unconventionally by pressurized hot water processing in a flow regime. The parent TiO2 and g-C3N4 was prepared by thermal hydrolysis and thermal annealing, respectively. The nanocomposites as well as parent TiO2 and g-C3N4 were characterized using several complementary characterization methods and investigated in the photocatalytic decomposition of N2O under UVA (λ = 365 nm) irradiation. All the prepared TiO2/g-C3N4 nanocomposites showed higher photocatalytic activity in comparison with the pure g-C3N4 and chiefly pure TiO2. The photocatalytic activity of TiO2/g-C3N4 nanocomposites was decreasing in the following sequence: TiO2/g-C3N4 (1:3) > TiO2/g-C3N4 (1:2) > TiO2/g-C3N4 (1:1). In comparison with the parent TiO2 or g-C3N4, the TiO2/g-C3N4 nanocomposites' photocatalytic capability was significantly enhanced by coupling TiO2 with g-C3N4. The generation of TiO2/g-C3N4 Z-scheme photocatalyst mainly benefited from the effective separation of photoinduced electron-hole pairs and the extended optical absorption range. The TiO2/g-C3N4 (1:3) nanocomposite showed the best photocatalytic behavior in a consequence of the optimal weight ratio of TiO2:g-C3N4 and the lowest band gap energy from all nanocomposites. The N2O conversion in its presence was 70.6% after 20 h of UVA irradiation.

  5. Base-Displaced Intercalated Conformation of the 2-Amino-3-methylimidazo[4,5-f]quinoline N2-dG DNA Adduct Positioned at the Nonreiterated G1 in the NarI Restriction Site

    PubMed Central

    2016-01-01

    The conformation of an N2-dG adduct arising from the heterocyclic amine 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), a potent food mutagen, was determined in 5′-d(C1T2C3X4G5C6G7C8C9A10T11C12)-3′:5′-d(G13A14T15G16G17C18G19C20C21G22A23G24)-3′; X = N2-dG-IQ, in which the modified nucleotide X4 corresponds to G1 in the 5′-d(G1G2CG3CC)-3′ NarI restriction endonuclease site. Circular dichroism (CD) revealed blue shifts relative to the unmodified duplex, consistent with adduct-induced twisting, and a hypochromic effect for the IQ absorbance in the near UV region. NMR revealed that the N2-dG-IQ adduct adopted a base-displaced intercalated conformation in which the modified guanine remained in the anti conformation about the glycosidic bond, the IQ moiety intercalated into the duplex, and the complementary base C21 was displaced into the major groove. The processing of the N2-dG-IQ lesion by hpol η is sequence-dependent; when placed at the reiterated G3 position, but not at the G1 position, this lesion exhibits a propensity for frameshift replication [Choi, J. Y., et al. (2006) J. Biol. Chem., 281, 25297–25306]. The structure of the N2-dG-IQ adduct at the nonreiterated G1 position was compared to that of the same adduct placed at the G3 position [Stavros, K. M., et al. (2014) Nucleic Acids Res., 42, 3450–3463]. CD indicted minimal spectral differences between the G1 vs G3N2-dG-IQ adducts. NMR indicated that the N2-dG-IQ adduct exhibited similar base-displaced intercalated conformations at both the G1 and G3 positions. This result differed as compared to the corresponding C8-dG-IQ adducts placed at the same positions. The C8-dG-IQ adduct adopted a minor groove conformation when placed at position G1 but a base-displaced intercalated conformation when placed at position G3 in the NarI sequence. The present studies suggest that differences in lesion bypass by hpol η may be mediated by differences in the 3′-flanking sequences, perhaps modulating the ability to accommodate transient strand slippage intermediates. PMID:26083477

  6. An evaluation of the rate of absorption of solar radiation in the O2(X3Sigma-g - b1Sigma-g) transition

    NASA Technical Reports Server (NTRS)

    Mlynczak, Martin G.

    1993-01-01

    The rate at which molecular oxygen absorbs radiation in the O2(X3Sigma-g - b1Sigma-g) transition is calculated using a line-by-line radiative transfer model. This rate is critical to the determination of the population of the O2(b1Sigma-g) state required for studies of the O2(b1Sigma-g - X3Sigma-g) dayglow, the O2(a1Delta-g - X3Sigma-g) dayglow, and possibly the rates of oxidation of H2 and N2O. Previous evaluations of this rate (which is sometimes called the g-factor) have significantly overestimated its value. The rate is tabulated as a function of altitude, pressure, and solar zenith angle.

  7. Reduced carriership of 4G allele of plasminogen activator inhibitor-1 4G/5G polymorphism in very young survivors of myocardial infarction.

    PubMed

    Rallidis, Loukianos S; Gialeraki, Argyri; Merkouri, Efrosyni; Liakos, George; Dagres, Nikolaos; Sionis, Dimitrios; Travlou, Anthi; Lekakis, John; Kremastinos, Dimitrios T

    2010-05-01

    There are limited and controversial data regarding the impact of 4G/5G polymorphism of the plasminogen activator inhibitor-1 (PAI-1) gene in the pathogenesis of premature myocardial infarction (MI). We explored whether 4G/5G polymorphism of the PAI-1 gene is associated with the development of MI

  8. Accelerated Post-Weld Natural Ageing in Ultrasonic Welding Aluminium 6111-T4 Automotive Sheet

    NASA Astrophysics Data System (ADS)

    Chen, Ying-Chun; Prangnell, Phil

    In contrast to previously published reports, it is shown that there is an observable HAZ when ultrasonic spot welding (USW) automotive alloys, like AA6111-T4, the severity of which depends on the welding energy. Immediately after welding, softening is seen relative to the T4 condition, but this is rapidly recovered by natural ageing, which masks the presence of a HAZ, and the weld strength eventually exceeds that of the parent material. This behaviour is caused by dissolution of the solute clusters/GPZs in the T4 sheet, due to the high weld temperatures (> 400 °C), combined with accelerated post-weld natural ageing to a more advanced state than in the parent material. Modelling has demonstrated that this accelerated natural ageing behaviour can be attributed to an excess vacancy concentration generated by the USW process.

  9. Translesion Synthesis of the N(2)-2'-Deoxyguanosine Adduct of the Dietary Mutagen IQ in Human Cells: Error-Free Replication by DNA Polymerase κ and Mutagenic Bypass by DNA Polymerases η, ζ, and Rev1.

    PubMed

    Bose, Arindam; Millsap, Amy D; DeLeon, Arnie; Rizzo, Carmelo J; Basu, Ashis K

    2016-09-19

    Translesion synthesis (TLS) of the N(2)-2'-deoxyguanosine (dG-N(2)-IQ) adduct of the carcinogen 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) was investigated in human embryonic kidney 293T cells by replicating plasmid constructs in which the adduct was individually placed at each guanine (G1, G2, or G3) of the NarI sequence (5'-CG1G2CG3CC-3'). TLS efficiency was 38%, 29%, and 25% for the dG-N(2)-IQ located at G1, G2, and G3, respectively, which suggests that dG-N(2)-IQ is bypassed more efficiently by one or more DNA polymerases at G1 than at either G2 or G3. TLS efficiency was decreased 8-35% in cells with knockdown of pol η, pol κ, pol ι, pol ζ, or Rev1. Up to 75% reduction in TLS occurred when pol η, pol ζ, and Rev1 were simultaneously knocked down, suggesting that these three polymerases play important roles in dG-N(2)-IQ bypass. Mutation frequencies (MFs) of dG-N(2)-IQ at G1, G2, and G3 were 23%, 17%, and 11%, respectively, exhibiting a completely reverse trend of the previously reported MF of the C8-dG adduct of IQ (dG-C8-IQ), which is most mutagenic at G3 ( ( 2015 ) Nucleic Acids Res. 43 , 8340 - 8351 ). The major type of mutation induced by dG-N(2)-IQ was targeted G → T, as was reported for dG-C8-IQ. In each site, knockdown of pol κ resulted in an increase in MF, whereas MF was reduced when pol η, pol ι, pol ζ, or Rev1 was knocked down. The reduction in MF was most pronounced when pol η, pol ζ, and Rev1 were simultaneously knocked down and especially when the adduct was located at G3, where MF was reduced by 90%. We conclude that pol κ predominantly performs error-free TLS of the dG-N(2)-IQ adduct, whereas pols η, pol ζ, and Rev1 cooperatively carry out the error-prone TLS. However, in vitro experiments using yeast pol ζ and κ showed that the former was inefficient in full-length primer extension on dG-N(2)-IQ templates, whereas the latter was efficient in both error-free and error-prone extensions. We believe that the observed differences between the in vitro experiments using purified DNA polymerases, and the cellular results may arise from several factors including the crucial roles played by the accessory proteins in TLS.

  10. Translesion Synthesis of the N2-2′-Deoxyguanosine Adduct of the Dietary Mutagen IQ in Human Cells: Error-Free Replication by DNA Polymerase κ and Mutagenic Bypass by DNA Polymerases η, ζ, and Rev1

    PubMed Central

    2016-01-01

    Translesion synthesis (TLS) of the N2-2′-deoxyguanosine (dG-N2-IQ) adduct of the carcinogen 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) was investigated in human embryonic kidney 293T cells by replicating plasmid constructs in which the adduct was individually placed at each guanine (G1, G2, or G3) of the NarI sequence (5′-CG1G2CG3CC-3′). TLS efficiency was 38%, 29%, and 25% for the dG-N2-IQ located at G1, G2, and G3, respectively, which suggests that dG-N2-IQ is bypassed more efficiently by one or more DNA polymerases at G1 than at either G2 or G3. TLS efficiency was decreased 8–35% in cells with knockdown of pol η, pol κ, pol ι, pol ζ, or Rev1. Up to 75% reduction in TLS occurred when pol η, pol ζ, and Rev1 were simultaneously knocked down, suggesting that these three polymerases play important roles in dG-N2-IQ bypass. Mutation frequencies (MFs) of dG-N2-IQ at G1, G2, and G3 were 23%, 17%, and 11%, respectively, exhibiting a completely reverse trend of the previously reported MF of the C8-dG adduct of IQ (dG-C8-IQ), which is most mutagenic at G3 ((2015) Nucleic Acids Res.43, 8340−835126220181). The major type of mutation induced by dG-N2-IQ was targeted G → T, as was reported for dG-C8-IQ. In each site, knockdown of pol κ resulted in an increase in MF, whereas MF was reduced when pol η, pol ι, pol ζ, or Rev1 was knocked down. The reduction in MF was most pronounced when pol η, pol ζ, and Rev1 were simultaneously knocked down and especially when the adduct was located at G3, where MF was reduced by 90%. We conclude that pol κ predominantly performs error-free TLS of the dG-N2-IQ adduct, whereas pols η, pol ζ, and Rev1 cooperatively carry out the error-prone TLS. However, in vitro experiments using yeast pol ζ and κ showed that the former was inefficient in full-length primer extension on dG-N2-IQ templates, whereas the latter was efficient in both error-free and error-prone extensions. We believe that the observed differences between the in vitro experiments using purified DNA polymerases, and the cellular results may arise from several factors including the crucial roles played by the accessory proteins in TLS. PMID:27490094

  11. Psychological profiles derived by cluster analysis of Minnesota Multiphasic Personality Inventory and long term clinical outcome after coronary artery by pass grafting.

    PubMed

    Modica, Maddalena; Carabalona, Roberta; Spezzaferri, Rosa; Tavanelli, Monica; Torri, A; Ripamonti, Vittorino; Castiglioni, Paolo; De Maria, Renata; Ferratini, Maurizio

    2012-03-01

    To evaluate the psychological characteristics of coronary heart disease (CHD) patients after coronary artery bypass grafting (CABG) by cluster analysis of Minnesota Multiphasic Personality Inventory (MMPI-2) questionnaires and to assess the impact of the profiles obtained on long-term outcome. 229 CHD patients admitted to cardiac rehabilitation filled in self-administered MMPI-2 questionnaires early after CABG. We assessed the relation between MMPI-2 profiles derived by cluster analysis, clinical characteristics and outcome at 3-year follow-up. Among the 215 patients (76% men, median age 66 years) with valid criteria in control scales, we identified 3 clusters (G) with homogenous psychological characteristics: G1 patients (N = 75) presented somatoform complaints but overall minimal psychological distress. G2 patients (N=72) presented type D personality traits. G3 subjects (N=68) showed a trend to cynicism, mild increases in anger, social introversion and hostility. Clusters overlapped for clinical characteristics such as smoking (G1 21%, G2 24%, G3 24%, p ns), previous myocardial infarction (G1 43%, G2 47%, G3 49% p ns), LV ejection fraction (G1 60 [51-60]; G2 58 [49-60]; G3 60 [55-60], p ns), 3-vessel-disease prevalence (G1 69%, G2 65%, G3 71%, p ns). Three-year event rates were comparable (G1 15%; G2 18%; G3 15%) and Kaplan-Meier curves overlapped among clusters (p ns). After CABG, the interpretation of MMPI-2 by cluster analysis is useful for the psychological and personological diagnosis to direct psychological assistance. Conversely, results from cluster analysis of MMPI-2 do not seem helpful to the clinician to predict long term outcome.

  12. Compliance of 2012/13 Combat Ration Packs to the Recommended Nutritional Criteria

    DTIC Science & Technology

    2014-08-01

    mixes, instant noodle flavouring and processed cheese. Figure 26 Sodium content of 2012/13 CRP vs RNC. The red line indicates the UL and the black...various 1 x 50g Cereal Bar various 2 x 50g Cereal Bar various 1 x 50g Cereal Bar various 2 x 50g Muesli, Fruitful with Skim Milk 1 x 100g Noodles , Instant ...Candy 1 x 50g Noodles , Instant , Beef Flavour 1 x 40g Werther’s® Cream Candy 1 x 50g Lifesavers® Candy 1 x 34g Lifesavers® Candy 1 x 34g

  13. Changes of headspace volatile constituents of palm olein and selected oils after frying French fries.

    PubMed

    Omar, Muhammad Nor Bin; Nor, Nor Nazuha M; Idris, Nor Aini

    2007-04-01

    Changes of aroma constituents of palm olein and selected oils after frying French fries have been studied. The aroma constituents of used oils were collected using a solid-phase microextraction (SPME) headspace technique with an absorbent of a divinylbenzene/carboxen (DVB/CAR) (50/30 microm) on polydimethylsiloxane (PDMS) fibre. The extracted volatiles were desorbed from the fibre in the injection port of the gas chromatograph at 250 degrees C and the aroma constituents were identified by GC-MS. Analytical data showed that volatile constituents of palm olein, soybean oil, corn oil and sunflower oil changed while frying continued from 2 to 40 h, respectively. In palm olein, the 2t,4t-decadienal content decreased from 14.7 to 5.5 microg g(-1) (40 h) whilst hexanal increased from 7.9 microg g(-1) (2 h) to 29.2 microg g(-1) (40 h), respectively. Similar result was also obtained from soybean oil after frying French fries. The 2t,4t-decadienal content decreased from 15.9 microg g(-1) (2 h) to 3.2 microg g(-1) after 40 h frying whilst hexanal increased from 10.2 microg g(-1) (2 h) to 34.2 microg g(-1) (40 h). Meanwhile, in corn oil, it was found that 2t,4t-decadienal decreased from 15.6 microg g(-1) (2 h) to 3.2 microg g(-1) (40 h) whilst hexanal increased from 11.3 microg g(-1) (2 h) to 33.8 microg g(-1) when frying time reached 40 h. In sunflower oil, it was found that 2t,4t-decadienal, decreased from 16.8 microg g(-1) (2 h) to 1.2 microg g(-1) (40 h) while hexanal increased from 9.5 microg g(-1) (2 h) to 32.4 microg g(-1) when frying time reached 40 h. It also showed that used oils exhibited off-odour characteristics due to the increasing amount ofhexanal while their freshness characteristics diminished due to the decreasing amount of 2t, 4t-decadienal.

  14. Group 1B phospholipase A₂ inactivation suppresses atherosclerosis and metabolic diseases in LDL receptor-deficient mice.

    PubMed

    Hollie, Norris I; Konaniah, Eddy S; Goodin, Colleen; Hui, David Y

    2014-06-01

    Previous studies have shown that inactivation of the group 1B phospholipase A2 (Pla2g1b) suppresses diet-induced obesity, hyperglycemia, insulin resistance, and hyperlipidemia in C57BL/6 mice. A possible influence of Pla2g1b inactivation on atherosclerosis has not been addressed previously. The current study utilized LDL receptor-deficient (Ldlr(-/-)) mice with plasma lipid levels and distribution similar to hyperlipidemic human subjects as a preclinical animal model to test the effectiveness of Pla2g1b inactivation on atherosclerosis. The Pla2g1b(+/+)Ldlr(-/-) and Pla2g1b(-/-)Ldlr(-/-) mice were fed a low fat chow diet or a hypercaloric diet with 58.5 kcal% fat and 25 kcal% sucrose for 10 weeks. Minimal differences were observed between Pla2g1b(+/+)Ldlr(-/-) and Pla2g1b(-/-)Ldlr(-/-) mice when the animals were maintained on the low fat chow diet. However, when the animals were maintained on the hypercaloric diet, the Pla2g1(+/+)Ldlr(-/-) mice showed the expected body weight gain but the Pla2g1b(-/-)Ldlr(-/-) mice were resistant to diet-induced body weight gain. The Pla2g1b(-/-)Ldlr(-/-) mice also displayed lower fasting glucose, insulin, and plasma lipid levels compared to the Pla2g1b(+/+)Ldlr(-/-) mice, which displayed robust hyperglycemia, hyperinsulinemia, and hyperlipidemia in response to the hypercaloric diet. Importantly, atherosclerotic lesions in the aortic roots were also reduced 7-fold in the Pla2g1b(-/-)Ldlr(-/-) mice. The effectiveness of Pla2g1b inactivation to suppress diet-induced body weight gain and reduce diabetes and atherosclerosis in LDL receptor-deficient mice suggests that pharmacological inhibition of Pla2g1b may be a viable strategy to decrease diet-induced obesity and the risk of diabetes and atherosclerosis in humans. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  15. Loss of G2 subunit of vacuolar-type proton transporting ATPase leads to G1 subunit upregulation in the brain

    PubMed Central

    Kawamura, Nobuyuki; Sun-Wada, Ge-Hong; Wada, Yoh

    2015-01-01

    Vacuolar-type ATPase (V-ATPase) is a primary proton pump with versatile functions in various tissues. In nerve cells, V-ATPase is required for accumulation of neurotransmitters into secretory vesicles and subsequent release at the synapse. Neurons express a specific isoform (G2) of the G subunit of V-ATPase constituting the catalytic sector of the enzyme complex. Using gene targeting, we generated a mouse lacking functional G2 (G2 null), which showed no apparent disorders in architecture and behavior. In the G2-null mouse brain, a G1 subunit isoform, which is ubiquitously expressed in neuronal and non-neuronal tissues, accumulated more abundantly than in wild-type animals. This G1 upregulation was not accompanied by an increase in mRNA. These results indicate that loss of function of neuron-specific G2 isoform was compensated by an increase in levels of the G1 isoform without apparent upregulation of the G1 mRNA. PMID:26353914

  16. [Comparative study of cefpirome and ceftazidime in complicated urinary tract infections].

    PubMed

    Naide, Y; Aso, Y; Oshi, M; Kumamoto, Y; Hirose, T; Machida, T; Tsuchida, S; Suzuki, K; Orikasa, S; Kawada, Y

    1991-04-01

    We carried out a randomized multi-center study comparing cefpirome (CPR) 0.5 g b.i.d. (1 g group), 1.0 g b.i.d. (2 g group) and ceftazidime (CAZ) 1.0 g b.i.d. (CAZ group) in the treatment of complicated urinary tract infections. Patients who were over 16 years old and had underlying urinary tract disease, with bacteriuria of more than 10(4) cells ml or more and pyuria of more than 5 WBCs/hpf (x 400) or more were randomly allocated to receive either 0.5 g of CPR, 1.0 g of CPR or 1.0 g of CAZ twice a day for 5 days by intravenous drip infusion. The overall clinical efficacy of the treatment was evaluated by the criteria of the Japanese UTI Committee as excellent, moderate or poor, on the basis of the changes in pyuria and bacteriuria. A total of 530 patients were treated. Of these, 141 patients in the 1 g group, 136 in the 2 g group, and 140 in the CAZ group were evaluable for clinical efficacy. No significant differences in background characteristics were observed among the treatment groups. The overall clinical efficacy rate of the 1 g group, the 2 g group and the CAZ group was 80.1%, 76.5% and 71.4%, respectively. The differences were not statistically significant. The overall bacteriological eradication rate of the 1 g group, the 2 g group and the CAZ group was 81.0%, 88.1% and 83.8%. The differences were not statistically significant either. Against the enterococcus group, however, eradication rates were higher significantly in the 1 g and 2 g groups than in the CAZ group. The incidence of adverse reactions was 2.2% in the 1 g group, 0.6% in the 2 g group and 2.9% in the CAZ group. Abnormal laboratory data after medication were observed in 10.8% of the 1 g group, 12.1% of the 2 g group and 10.2% of the CAZ group, the difference not being statistically significant. There were no serious untoward reactions to medication. From the results obtained in this study, we consider that CPR is at least as useful as CAZ in the treatment of complicated urinary tract infections.

  17. Association of MMP-1 -1607 1G/2G (rs1799750) polymorphism with primary knee osteoarthritis in the Greek population.

    PubMed

    Lepetsos, Panagiotis; Pampanos, Andreas; Kanavakis, Emmanouil; Tzetis, Maria; Korres, Dimitrios; Papavassiliou, Athanasios G; Efstathopoulos, Nicolaos

    2014-09-01

    Osteoarthritis is the most common form of arthritis with still unknown pathogenic etiology and considerable contribution of genetic factors. One of the mechanisms of cartilage degradation in osteoarthritis is enzymatic proteolysis of the extracellular matrix by metalloproteinases. MMP-1, produced by chondrocytes and synovial cells, is a major proteinase of the MMPs family. The present study aims at evaluating the association of MMP1 gene -1607 1G/2G (rs1799750) polymorphism with primary knee osteoarthritis in the Greek population. One hundred fifty five patients with primary symptomatic knee osteoarthritis participated in the study along with 139 controls. Genotypes were determined using PCR-RLFP technique. Allelic and genotypic frequencies were compared between both study groups. There was no significant association between MMP1 -1607 1G/2G polymorphism and knee osteoarthritis, in crude analysis; however, after multiple logistic regression analysis, 1G/2G was associated with reduced odds of knee osteoarthritis by 75% in males, compared to genotypes 1G/1G + 2G/2G, adjusting for age and BMI (adjusted OR: 0.25, 95% CI: 0.069, 0.910, p = 0.035). The present study shows that MMP1 -1607 1G/2G (rs1799750) polymorphism might be a risk factor for knee osteoarthritis susceptibility in the Greek population. Further investigations are needed to confirm this association in the pathogenesis of osteoarthritis. © 2014 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  18. Probing the binding of cationic lipids with dendrimers.

    PubMed

    Mandeville, J S; Bourassa, P; Tajmir-Riahi, H A

    2013-01-14

    Polycationic polymers are used extensively in biology to disrupt cell membranes and thus enhance the transport of materials into the cell. We report the bindings of several lipids cholesterol (Chol), 1,2-dioleoyl-3-trimethylammonium-propane(DOTAP), dioctadecyldimethylammoniumbromide (DDAB), and dioleoylphosphatidylethanolamine (DOPE) to dendrimers of different compositions such as mPEG-PAMAM (G3), mPEG-PAMAM (G4), and PAMAM (G4) under physiological conditions. FTIR, UV-visible spectroscopic, methods and molecular modeling were used to analyze the lipid binding mode, the binding constant, and the effects of lipid complexation on the dendrimer structure. The structural analysis showed that lipids bind dendrimers through both hydrophilic and hydrophobic contacts with overall binding constants of K(chol-mPEG-G3) = 1.7 × 10(3) M(-1), K(chol-mPEG-PAMAM-G4) = 2.7 × 10(3) M(-1), K(chol-PAMAM-G4) = 1.0 × 10(3) M(-1), K(DOPE-mPEG-G3) = 1.5 × 10(3) M(-1), K(DOPE-mPEG-PAMAM-G4) = 1.6 × 10(3) M(-1), K(DOPE-PAMAM-G4) = 5.3 × 10(2) M(-1), K(DDAB-mPEG-G3) = 1.5 × 10(3) M(-1), K(DDAB-mPEG-PAMAM-G4) = 1.9 × 10(2) M(-1), K(DDAB-PAMAM-G4) = 7.0 × 10(2) M(-1), K(DOTAP-mPEG-G3) = 1.9 × 10(3) M(-1), K(DOTAP-mPEG-PAMAM-G4) = 1.5 × 10(3) M(-1), and K(DOTAP-PAMAM-G4) = 5.7 × 10(2) M(-1). Weaker interaction was observed as dendrimer cationic charges increased. The free binding energies from docking were -5.15 (cholesterol), -5.79 (DDAB), and -5.36 kcal/mol (DOTAP) with the order of stability DDAB-PAMAM-G-4 > DOTAP-PAMAM-G4 > cholesterol-PAMAM-G4, consistent with the spectroscopic results. Dendrimers might act as carriers to transport lipids in vitro.

  19. Approximate analytic solutions to coupled nonlinear Dirac equations

    DOE PAGES

    Khare, Avinash; Cooper, Fred; Saxena, Avadh

    2017-01-30

    Here, we consider the coupled nonlinear Dirac equations (NLDEs) in 1+11+1 dimensions with scalar–scalar self-interactions g 1 2/2(more » $$\\bar{ψ}$$ψ) 2 + g 2 2/2($$\\bar{Φ}$$Φ) 2 + g 2 3($$\\bar{ψ}$$ψ)($$\\bar{Φ}$$Φ) as well as vector–vector interactions g 1 2/2($$\\bar{ψ}$$γμψ)($$\\bar{ψ}$$γμψ) + g 2 2/2($$\\bar{Φ}$$γμΦ)($$\\bar{Φ}$$γμΦ) + g 2 3($$\\bar{ψ}$$γμψ)($$\\bar{Φ}$$γμΦ). Writing the two components of the assumed rest frame solution of the coupled NLDE equations in the form ψ=e –iω1tR 1cosθ,R 1sinθΦ=e –iω2tR 2cosη,R 2sinη, and assuming that θ(x),η(x) have the same functional form they had when g3 = 0, which is an approximation consistent with the conservation laws, we then find approximate analytic solutions for Ri(x) which are valid for small values of g 3 2/g 2 2 and g 3 2/g 1 2. In the nonrelativistic limit we show that both of these coupled models go over to the same coupled nonlinear Schrödinger equation for which we obtain two exact pulse solutions vanishing at x → ±∞.« less

  20. Approximate analytic solutions to coupled nonlinear Dirac equations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khare, Avinash; Cooper, Fred; Saxena, Avadh

    Here, we consider the coupled nonlinear Dirac equations (NLDEs) in 1+11+1 dimensions with scalar–scalar self-interactions g 1 2/2(more » $$\\bar{ψ}$$ψ) 2 + g 2 2/2($$\\bar{Φ}$$Φ) 2 + g 2 3($$\\bar{ψ}$$ψ)($$\\bar{Φ}$$Φ) as well as vector–vector interactions g 1 2/2($$\\bar{ψ}$$γμψ)($$\\bar{ψ}$$γμψ) + g 2 2/2($$\\bar{Φ}$$γμΦ)($$\\bar{Φ}$$γμΦ) + g 2 3($$\\bar{ψ}$$γμψ)($$\\bar{Φ}$$γμΦ). Writing the two components of the assumed rest frame solution of the coupled NLDE equations in the form ψ=e –iω1tR 1cosθ,R 1sinθΦ=e –iω2tR 2cosη,R 2sinη, and assuming that θ(x),η(x) have the same functional form they had when g3 = 0, which is an approximation consistent with the conservation laws, we then find approximate analytic solutions for Ri(x) which are valid for small values of g 3 2/g 2 2 and g 3 2/g 1 2. In the nonrelativistic limit we show that both of these coupled models go over to the same coupled nonlinear Schrödinger equation for which we obtain two exact pulse solutions vanishing at x → ±∞.« less

  1. Excitation of O 2(a 1Δ g, b 1Σ g+) and I( 2P 1/2) by energy transfer from I 2(A, A' 3Π 1,2u) in solid rare gases

    NASA Astrophysics Data System (ADS)

    Böhling, R.; Becker, A. C.; Minaev, B. F.; Seranski, K.; Schurath, U.

    1990-04-01

    O 2a 1Δ g, b 1Σ g+ → X 3Σ g- and I 2P 1/2→ 2P 3/4 fluorescence occurs in I 2/O 2-doped rare gas matrices when I 2 is excited with visible laser light. O 2(a 1Δ g) and I( 2P 1/2) are populated independently by near-resonant energy transfer from the metastable triplet states of I 2. The doublet splitting of the O 2a→X band, which peaks at 7879 and 7863 cm -1 in argon, is interpreted as sensitized emission from O 2 trapped in distinct nearest neighbour positions of the donor 3I 2. Annealing reverses the intensity of the doublet, showing that the sites can be interconverted. It is suggested that the a→X emission rate is enhanced by the sensitizer, causing a lifetime reduction of the a 1Δ g state from 79 s in pure argon to 21 and 3±1 s next to I 2. The long-lived O 2(a 1Δ g) state is the precursor of I 2-sensitized emission from O 2(b 1Σ g+). The lifetime of O 2(b 1Σ g+) is reduced from 24.5 ms in pure argon to 17±1 ms in the presence of I 2.

  2. 1D Cu(OH)2 nanorod/2D SnO2 nanosheets core/shell structured array: Covering with graphene layer leads to excellent performances on lithium-ion battery

    NASA Astrophysics Data System (ADS)

    Xia, Huicong; Zhang, Jianan; Chen, Zhimin; Xu, Qun

    2018-05-01

    A facile in-situ growth strategy is employ to achieving the two-dimensional SnO2 nanosheets/one-dimensional Cu(OH)2 nanorods nanoarchitecture on Cu foil current collector (SnO2/Cu(OH)2/Cu foil), follow by modification of a uniform layer of graphene (G). Confine with the graphene layer and unique one-dimensional/two-dimensional the nanoarchitecture, the remarkably enhance electrical conductivity and structural stability of G/SnO2/Cu(OH)2/Cu foil leads to a high reversible capacity of 1080.6 mAh g-1 at a current density of 200 mA g-1, much better than the samples without graphene (512.6 mAh g-1) and Cu(OH)2 nanorod (117.4 mAh g-1). Furthermore, G/SnO2/Cu(OH)2/Cu foil electrode shows high rate capacity (600.8 mAh g-1 at 1 A g-1) and excellent cycling stability (1057.1 mAh g-1 at 200 mA g-1 even after 500 cycles). This work highlights that increasing surface and interface effects with desirable three-dimensional nanoarchitecture can open a new avenue to electrochemical performance improvement in lithium-ion battery for SnO2-base anode.

  3. Overview of Shipyard coast line with Piers G1, G2, G3, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Overview of Shipyard coast line with Piers G-1, G-2, G-3, G-4, and G-5 in view, view facing east-southeast - U.S. Naval Base, Pearl Harbor, Pier & Quay Walls, Entrance to Dry Dock No. 2 & Repair Wharfs, east & west sides of Dry Dock No. 2 & west side of Dry Dock No. 3, Pearl City, Honolulu County, HI

  4. Higher-Dimensional Signal Processing via Multiscale Geometric Analysis

    DTIC Science & Technology

    2010-02-10

    dimensions. Surflets allowed a multiscale, piecewise polynomial approximation of discontinuities. We also created a compression algorithm using ...h (p) g (p) g (p) 0 1 g (p) g (p) 1,p 2,p 2,p dg h d h d 1,p 3,p 3,p 3,p 3,p Figure 1: The 1-D dual-tree CWT is implemented using a pair of...ψh(x)ψh(y) + j1ψg(x)ψh(y) + j2ψh(x)ψg(y) + j3ψg(x)ψg(y). (19) To compute the QWT coefficients, we can use a separable 2-D implementation [4] of the

  5. Evaluation of Human Exposure to metals from some popular brands of underarm cosmetics in Nigeria.

    PubMed

    Iwegbue, Chukwujindu M A

    2015-08-01

    The concentrations of metals (Cd, Pb, Ni, Cr, Cu, Co, Fe, Mn, Zn and Al) were determined in thirty brands of popular of underarm cosmetics in Nigeria with a view to providing information on the levels of metals and the risk of exposure to metals by humans through long time usage of these products. The concentrations of metals in these samples of underarm cosmetics were measured by using atomic absorption spectrometry after acid digestion. The concentrations of metals in these types of underarm cosmetics studied ranged from <0.15 to 1.2 μg g(-1)Cd, <0.02 to 11.2 μg g(-1)Pb, <0.03 to 4.9 μg g(-1)Ni, <0.1 to 25.0 μg g(-1), <0.02 to 2.8 μg g(-1)Co, 2.0 to 6.4 μg g(-1)Cu, 4.7 to 91.2 μg g(-1)Fe, <0.05 to 14.1 μg g(-1)Mn, 77.9 to 132 μg g(-1) and 69.2 to 83,500 μg g(-1)Al. The results of this study indicate that Cd, Pb, Ni, Cr and Co were presents in these types of underarm cosmetics at concentrations below the regulatory control limits for metal impurities in color additives for cosmetics and suggested limits following good manufacturing practice. The estimated margin of safety (MoS) indicated that the concentrations of the examined metals in these underarm cosmetic products present no potential risk to the users. The continuous use of these brands of underarm cosmetics represents a potential source of human exposure to metals such as aluminum in the local area of the breast, particularly to the upper outer quadrant. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. 26 CFR 1.904(g)-2T - Recapture of overall domestic losses (temporary).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...). 1.904(g)-2T Section 1.904(g)-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE....904(g)-2T Recapture of overall domestic losses (temporary). (a) In general. A taxpayer shall recapture... provided in § 1.904(g)-1T(f)(2), the balance in a taxpayer's overall domestic loss account with respect to...

  7. Vaginal isolation of beta-haemolytic Streptococcus from bitches with and without neonatal deaths in the litters.

    PubMed

    Guerrero, A E; Stornelli, M C; Jurado, S B; Giacoboni, G; Sguazza, G H; de la Sota, R L; Stornelli, M A

    2018-06-01

    The aim of the study was to identify beta-haemolytic streptococci in the vagina of bitches who had delivered healthy litters and bitches who had delivered litters in which neonatal deaths occurred. Fifty-one bitches divided into two groups were used. Group 1 (G1) included 28 bitches that had delivered healthy litters and group 2 (G2) included 23 bitches that had delivered puppies who died in the neonatal period. Two vaginal samples were taken, one in proestrus and the other at the end of gestation (EG). Beta-haemolytic Streptococcus (BS) was isolated from 16 bitches (57%) in G1 and from 21 bitches (91%) in G2. The bacteriological cultures, serological tests (Streptex ® ) and PCR assay allowed identification of Streptococcus canis and Streptococcus dysgalactiae in G1 and G2. Ultramicroscopic studies allowed the observation of M Protein and capsules in strains of S. dysgalactiae and S. canis in G1 and G2. The S. canis strains isolated from G2 showed thicker capsules than S. canis strains isolated from G1 (234 ± 24.2 vs 151.23 ± 28.93 nm; p < .001.). No differences were observed in capsule thickness between strains of S. dysgalactiae isolated from G1 and G2 (210 ± 13.54 vs 211.66 ± 19.67 nm; p > .70). All strains of beta-haemolytic Streptococcus isolated were penicillin sensitive. Penicillin was administered from EG to 5 days post-partum in 10 G2 females with isolation of BS (G2A). Saline solution was administered in eleven G2 females with isolation of BS (G2B). Ninety per cent of the puppies survived in G2A and 25% survived in G2B. Our results suggest BS is involved in canine neonatal deaths. © 2018 Blackwell Verlag GmbH.

  8. Genetic History of Hepatitis C Virus in Venezuela: High Diversity and Long Time of Evolution of HCV Genotype 2

    PubMed Central

    Sulbarán, Maria Z.; Di Lello, Federico A.; Sulbarán, Yoneira; Cosson, Clarisa; Loureiro, Carmen L.; Rangel, Héctor R.; Cantaloube, Jean F.; Campos, Rodolfo H.; Moratorio, Gonzalo; Cristina, Juan; Pujol, Flor H.

    2010-01-01

    Background The subtype diversity of the hepatitis C virus (HCV) genotypes is unknown in Venezuela. Methodology/Principal Findings Partial sequencing of the NS5B region was performed in 310 isolates circulating in patients from 1995 to 2007. In the samples collected between 2005 and 2007, HCV genotype 1 (G1) was the most common genotype (63%), composed as expected of mainly G1a and G1b. G2 was the second most common genotype (33%), being G2a almost absent and G2j the most frequent subtype. Sequence analysis of the core region confirmed the subtype assignment performed within the NS5b region in 63 isolates. The complete genome sequence of G2j was obtained. G2j has been described in France, Canada and Burkina Fasso, but it was not found in Martinique, where several subtypes of G2 circulate in the general population. Bayesian coalescence analysis indicated a most recent common ancestor (MRCA) of G2j around 1785, before the introduction of G1b (1869) and G1a (1922). While HCV G1a and G1b experienced a growth reduction since 1990, coincident with the time when blood testing was implemented in Venezuela, HCV G2j did not seem to reach growth equilibrium during this period. Conclusions/Significance Assuming the introduction of G2j from Africa during the slave trade, the high frequency of G2j found in Venezuela could suggest: 1- the introduction of African ethnic groups different from the ones introduced to Martinique or 2- the occurrence of a founder effect. This study represents an in-depth analysis of the subtype diversity of HCV in Venezuela, which is still unexplored in the Americas and deserves further studies. PMID:21179440

  9. How does the long G·G* Watson-Crick DNA base mispair comprising keto and enol tautomers of the guanine tautomerise? The results of a QM/QTAIM investigation.

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-08-14

    The double proton transfer (DPT) in the long G·G* Watson-Crick base mispair (|C6N1(G*)N1C6(G)| = 36.4°; C1 symmetry), involving keto and enol tautomers of the guanine (G) nucleobase, along two intermolecular neighboring O6H···O6 (8.39) and N1···HN1 (6.14 kcal mol(-1)) H-bonds that were established to be slightly anti-cooperative, leads to its transformation into the G*·G base mispair through a single transition state (|C6N1N1C6| = 37.1°; C1), namely to the interconversion into itself. It was shown that the G·G* ↔ G*·G tautomerisation via the DPT is assisted by the third specific contact, that sequentially switches along the intrinsic reaction coordinate (IRC) in an original way: (G)N2H···N2(G*) H-bond (-25.13 to -10.37) → N2···N2 van der Waals contact (-10.37 to -9.23) → (G)N2···HN2(G*) H-bond (-9.23 to 0.79) → (G*)N2···HN2(G) H-bond (0.79 to 7.35 Bohr). The DPT tautomerisation was found to proceed through the asynchronous concerted mechanism by employing the QM/QTAIM approach and the methodology of the scans of the geometric, electron-topological, energetic, polar and NBO properties along the IRC. Nine key points, that can be considered as part of the tautomerisation repertoire, have been established and analyzed in detail. Furthermore, it was shown that the G·G* or G*·G base mispair is a thermodynamically and dynamically stable structure with a lifetime of 8.22 × 10(-10) s and all 6 low-frequency intermolecular vibrations are able to develop during this time span. Lastly, our results highlight the importance of the G·G* ↔ G*·G DPT tautomerisation, which can have implications for biological and chemical sensing applications.

  10. 26 CFR 1.904(g)-2T - Recapture of overall domestic losses (temporary).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...). 1.904(g)-2T Section 1.904(g)-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... States § 1.904(g)-2T Recapture of overall domestic losses (temporary). (a) In general. A taxpayer shall... increased. As provided in § 1.904(g)-1T(f)(2), the balance in a taxpayer's overall domestic loss account...

  11. 26 CFR 1.904(g)-2T - Recapture of overall domestic losses (temporary).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...). 1.904(g)-2T Section 1.904(g)-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... States § 1.904(g)-2T Recapture of overall domestic losses (temporary). (a) In general. A taxpayer shall... increased. As provided in § 1.904(g)-1T(f)(2), the balance in a taxpayer's overall domestic loss account...

  12. 21 CFR 558.4 - Requirement of a medicated feed mill license.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    .../ton 75-125. Oxytetracycline 90-120 20.0 g/lb (4.4%) 75-125/65-135. Penicillin 80-120 10.0 g/lb (2.2... 85-115 10.0 g/lb (2.2%) 85-125/70-130. Penicillin 85-115 5.0 g/lb (1.1%) 85-125/70-130.../lb (2.2%) 70-130. Penicillin 80-120 5.0 g/lb (1.1%) 70-130. Thiabendazole 94-106 45.4 g/lb (10.0%) >7...

  13. 21 CFR 558.4 - Requirement of a medicated feed mill license.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    .../ton 75-125. Oxytetracycline 90-120 20.0 g/lb (4.4%) 75-125/65-135. Penicillin 80-120 10.0 g/lb (2.2... 10.0 g/lb (2.2%) 85-125/70-130. Penicillin 85-115 5.0 g/lb (1.1%) 85-125/70-130. Sulfamethazine 85.../lb (2.2%) 70-130. Penicillin 80-120 5.0 g/lb (1.1%) 70-130. Thiabendazole 94-106 45.4 g/lb (10.0%) >7...

  14. 21 CFR 558.4 - Requirement of a medicated feed mill license.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    .../ton 75-125. Oxytetracycline 90-120 20.0 g/lb (4.4%) 75-125/65-135. Penicillin 80-120 10.0 g/lb (2.2... 10.0 g/lb (2.2%) 85-125/70-130. Penicillin 85-115 5.0 g/lb (1.1%) 85-125/70-130. Sulfamethazine 85.../lb (2.2%) 70-130. Penicillin 80-120 5.0 g/lb (1.1%) 70-130. Thiabendazole 94-106 45.4 g/lb (10.0%) >7...

  15. Biomarkers of chronic kidney disease in the urine of diabetic/hypertensive patients by means of Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Vieira, Elzo Everton de Sousa; Bispo, Jeyse Aliana Martis; Fernandes, Adriana Barrinha; Silveira, Landulfo

    2016-03-01

    Diabetes mellitus (DM) and arterial hypertension (AH) are common diseases that, if untreated, predispose the patient to renal failure. This study aimed to evaluate possible biomarkers in the urine of patients with DM and AH capable to predict the chronic renal disease, by means of Raman spectroscopy. Urines were obtained from patients with DM and AH, and separated into four groups: no symptoms of diseases related to DM and AH (G1), with low clinical complications (G2), with severe clinical complications (G3), and with chronic kidney disease (G4) arised from DM and AH. It has been used a dispersive Raman spectrometer (830nm, 250mW, 20s accumulation). In the spectra of urine it was identified Raman peaks at 680cm-1 (creatinine), 1004cm-1 (urea) and 1128cm-1 (glucose). The results revealed that G2, G3 and G4 presented the creatinine peak with lower intensity than G1 (p < 0.05). It was observed that G2, G3 and G4 showed lower intensity of the urea peak compared to G1 (p < 0.05) and G4 showed lower intensity compared to G2 and G3 (p < 0.05). Despite not significant, the glucose peak showed lower intensity in G1 when compared to the other groups. A model for classification of groups according to clinical criteria, using Sparse Multinomial Logistic Regression, taking as inputs the intensities of creatine, urea and glucose peaks allowed correct classification of 88.9% for G1, 36.8% for G2, 43.8% for G3 and 84.2% for G4. These results demonstrated the possibility of obtaining diagnostic information for complications of kidney disease associated to DM and AH, particularly the renal failure.

  16. Crop yield and light/energy efficiency in a closed ecological system: Laboratory Biosphere experiments with wheat and sweet potato

    NASA Astrophysics Data System (ADS)

    Nelson, M.; Dempster, W. F.; Silverstone, S.; Alling, A.; Allen, J. P.; van Thillo, M.

    Two crop growth experiments in the soil-based closed ecological facility, Laboratory Biosphere, were conducted from 2003 to 2004 with candidate space life support crops. Apogee wheat (Utah State University variety) was grown, planted at two densities, 400 and 800 seeds m -2. The lighting regime for the wheat crop was 16 h of light - 8 h dark at a total light intensity of around 840 μmol m -2 s -1 and 48.4 mol m -2 d -1 over 84 days. Average biomass was 1395 g m -2, 16.0 g m -2 d -1 and average seed production was 689 g m -2 and 7.9 g m -2 d -1. The less densely planted side was more productive than the denser planting, with 1634 g m -2 and 18.8 g m -2 d -1 of biomass vs. 1156 g m -2 and 13.3 g m -2 d -1; and a seed harvest of 812.3 g m -2 and 9.3 g m -2 d -1 vs. 566.5 g m -2 and 6.5 g m -2 d -1. Harvest index was 0.49 for the wheat crop. The experiment with sweet potato used TU-82-155 a compact variety developed at Tuskegee University. Light during the sweet potato experiment, on a 18 h on/6 h dark cycle, totaled 5568 total moles of light per square meter in 126 days for the sweet potatoes, or an average of 44.2 mol m -2 d -1. Temperature regime was 28 ± 3 °C day/22 ± 4 °C night. Sweet potato tuber yield was 39.7 kg wet weight, or an average of 7.4 kg m -2, and 7.7 kg dry weight of tubers since dry weight was about 18.6% wet weight. Average per day production was 58.7 g m -2 d -1 wet weight and 11.3 g m -2 d -1. For the wheat, average light efficiency was 0.34 g biomass per mole, and 0.17 g seed per mole. The best area of wheat had an efficiency of light utilization of 0.51 g biomass per mole and 0.22 g seed per mole. For the sweet potato crop, light efficiency per tuber wet weight was 1.33 g mol -1 and 0.34 g dry weight of tuber per mole of light. The best area of tuber production had 1.77 g mol -1 wet weight and 0.34 g mol -1 of light dry weight. The Laboratory Biosphere experiment's light efficiency was somewhat higher than the USU field results but somewhat below greenhouse trials at comparable light levels, and the best portion of the crop at 0.22 g mol -1 was in-between those values. Sweet potato production was overall close to 50% higher than trials using hydroponic methods with TU-82-155 at NASA JSC. Compared to projected yields for the Mars on Earth life support system, these wheat yields were about 15% higher, and the sweet potato yields averaged over 80% higher.

  17. Optimization of chromatographic conditions for determination of aflatoxin B1, B2, G1 and G2 by using liquid chromatography-mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Ramadhaningtyas, Dillani Putri; Aryana, Nurhani; Aristiawan, Yosi; Styarini, Dyah

    2017-11-01

    The optimization of instrument condition and chromatographic separation for analysis of aflatoxin B1, B2, G1 and G2 using liquid chromatography tandem with mass spectrometer detector was conducted in the aim to provide more accurate and reliable analysis results. The aflatoxin known to be serious threat for human health as it is classified as the carcinogenic compounds. The aflatoxin B1, B2, G1 and G2 were selected due to its extensive contamination in various agricultural commodities. The best chromatographic separation was obtained using C-18 column with gradient elution of solvent 5 mM ammonium acetate and 0.1% formic acid in methanol at 7 minutes runtime analysis. The linearity of the detector showed satisfied results as the coefficient determination found to be 0.9994, 0.9996, 0.9998 and 0.9987 for aflatoxin B1, G1, B2, and G2 respectively in the range concentration from 1 to 20 ng/g. The quantifier ion selected for the aflatoxin B1, B2, G1 and G2 was m/z 285.1, 259, 243 and 313 respectively. The instrument precision at these quantifier ions also showed satisfied result with %RSD was around 3.4 to 6.8%. The optimized method present in this study can be used for further sample analysis.

  18. Bioelectricity versus bioethanol from sugarcane bagasse: is it worth being flexible?

    PubMed Central

    2013-01-01

    Background Sugarcane is the most efficient crop for production of (1G) ethanol. Additionally, sugarcane bagasse can be used to produce (2G) ethanol. However, the manufacture of 2G ethanol in large scale is not a consolidated process yet. Thus, a detailed economic analysis, based on consistent simulations of the process, is worthwhile. Moreover, both ethanol and electric energy markets have been extremely volatile in Brazil, which suggests that a flexible biorefinery, able to switch between 2G ethanol and electric energy production, could be an option to absorb fluctuations in relative prices. Simulations of three cases were run using the software EMSO: production of 1G ethanol + electric energy, of 1G + 2G ethanol and a flexible biorefinery. Bagasse for 2G ethanol was pretreated with a weak acid solution, followed by enzymatic hydrolysis, while 50% of sugarcane trash (mostly leaves) was used as surplus fuel. Results With maximum diversion of bagasse to 2G ethanol (74% of the total), an increase of 25.8% in ethanol production (reaching 115.2 L/tonne of sugarcane) was achieved. An increase of 21.1% in the current ethanol price would be enough to make all three biorefineries economically viable (11.5% for the 1G + 2G dedicated biorefinery). For 2012 prices, the flexible biorefinery presented a lower Internal Rate of Return (IRR) than the 1G + 2G dedicated biorefinery. The impact of electric energy prices (auction and spot market) and of enzyme costs on the IRR was not as significant as it would be expected. Conclusions For current market prices in Brazil, not even production of 1G bioethanol is economically feasible. However, the 1G + 2G dedicated biorefinery is closer to feasibility than the conventional 1G + electric energy industrial plant. Besides, the IRR of the 1G + 2G biorefinery is more sensitive with respect to the price of ethanol, and an increase of 11.5% in this value would be enough to achieve feasibility. The ability of the flexible biorefinery to take advantage of seasonal fluctuations does not make up for its higher investment cost, in the present scenario. PMID:24088415

  19. Morning meal more efficient for fat loss in a 3-month lifestyle intervention.

    PubMed

    Lombardo, Mauro; Bellia, Alfonso; Padua, Elvira; Annino, Giuseppe; Guglielmi, Valeria; D'Adamo, Monica; Iellamo, Ferdinando; Sbraccia, Paolo

    2014-01-01

    To evaluate the effects of 2 low-calorie diets but with different distributions of calories throughout the day on weight loss and other major obesity-related metabolic parameters. We randomly assigned 42 nonsmoking homemakers (age = 46.3 ± 2.3 years, body mass index [BMI] = 35.7 ± 0.8 kg/m(2), mean ± SD) in 2 groups of 21 subjects (G1 and G2). The participants underwent a 3 month individualized Mediterranean-style diet (55% carbohydrate, 30% fat, 15% protein and fiber > 30 g), calorie (600 kcal daily deficit compared to the total energy expenditure measured by a metabolic Holter). Diets consisted of the same food and complied with cardiovascular disease prevention guidelines but differed in the distribution of calories throughout the day (G1: 70% breakfast, morning snack, lunch and 30% afternoon snack and dinner; G2: 55 breakfast, morning snack, lunch and 45% afternoon snack and dinner). Dual-energy X-ray absorptiometry was used for pre- and postintervention body composition assessment. Thirty-six subjects completed the study (G1 = 18, G2 = 18). Both groups had significant improvements in body composition and metabolic parameters but G1 had enhanced results for weight loss (G1: -8.2 ± 3.0 kg; G2: -6.5 ± 3.4 kg; p = 0.028), waist circumference reduction (G1: -7 ± 0.6 cm; G2: -5 ± 0.3 cm; p = 0.033), and fat mass loss (G1: -6.8 ± 2.1 kg, G2: -4.5 ± 2.9 kg, p = 0.031; mean ± SD). Improvements were detected in both groups for blood pressure and blood and lipid parameters. G1 subjects showed a greater improvement in insulin sensitivity measured by homeostasis model assessment-estimated insulin resistance (G1: -1.37 ± 0.27, G2: -0.74 ± 0.12, p = 0.017). These data suggest that a low-calorie Mediterranean diet with a higher amount of calories in the first part of the day could establish a greater reduction in fat mass and improved insulin sensitivity than a typical daily diet.

  20. Adsorption characteristics of sulfur solution by acticarbon against drinking-water toxicosis.

    PubMed

    Ge, Shengbo; Liu, Zhenling; Furuta, Yuzo; Peng, Wanxi

    2017-09-01

    Sulfur and ammonia nitrogen are rich nutrient pollutants, after entering water can cause algal blooms, cause eutrophication of water body, the spread of them will not only pollute the environment, destroy the ecological balance, but also harm human health through food chain channels, especially drinking-water toxicosis. Acticarbon can adsorb harmful substances, it was beneficial for people's health. In order to figure out the optimal adsorption condition and the intrinsic change of acticarbon, five chemicals were adsorbed by acticarbon and analyzed by FT-IR. The optimal adsorption condition of Fe 2 (SO 4 ) 3 , Na 2 SO 4 , Na 2 S 2 O 8 , S and Na 2 SO 3 was 9 g/1000 g at 80 min, 21 g/1000 g at 20 min, 15g/1000 g at 20 min, 21 g/1000 g at 60 min and 21 g/1000 g at 100 min, respectively. FT-IR spectra showed that acticarbon had eight characteristic peaks, such as S-S stretch, H 2 O stretch, O-H stretch, -C-H stretch, C 000000000000 000000000000 000000000000 111111111111 000000000000 111111111111 000000000000 000000000000 000000000000 O or CC stretch, CH 2 bend, C-H were at 3850 cm -1 , 3740 cm -1 , 3435 cm -1 , 2925 cm -1 , 1630 cm -1 , 1390 cm -1 , 1115 cm -1 , 600 cm -1 , respectively. For FT-IR spectra of Fe 2 (SO 4 ) 3 , the peaks at 3850 cm -1 , 3740 cm -1 , 2925 cm -1 achieved the maximum with 9 g/1000 g at 20 min. For Na 2 SO 4 , the peaks at 2925 cm -1 , 1630 cm -1 , 1390 cm -1 , 1115 cm -1 , 600 cm -1 achieved the maximum with 21 g/1000 g at 120 min. For ones of Na 2 S 2 O 8 , the peaks at 3850 cm -1 , 3740 cm -1 , 1390 cm -1 , 1115 cm -1 , 600 cm -1 , achieved the maximum with 2 g/1000 g at 80 min. For ones of S, the peaks at 3850 cm -1 , 3740 cm -1 , 2925 cm -1 achieved the maximum with 19 g/1000 g at 100 min, the peaks at 1390 cm -1 , 1115 cm -1 , 600 cm -1 achieved the maximum with 19 g/1000 g at 20 min. For FT-IR spectra of Na 2 SO 3 , the peaks at 1630 cm -1 , 1390 cm -1 , 1115 cm -1 , 600 cm -1 achieved the maximum with 2 g/1000 g at 100 min. It provided that acticarbon could adsorb and desulphurize from sulfur solution against drinking-water toxicosis.

  1. Regulation of Herpes Simplex Virus Glycoprotein-Induced Cascade of Events Governing Cell-Cell Fusion

    PubMed Central

    Saw, Wan Ting; Eisenberg, Roselyn J.; Cohen, Gary H.

    2016-01-01

    ABSTRACT Receptor-dependent herpes simplex virus (HSV)-induced cell-cell fusion requires glycoproteins gD, gH/gL, and gB. Our current model posits that during fusion, receptor-activated conformational changes in gD activate gH/gL, which subsequently triggers the transformation of the prefusion form of gB into a fusogenic state. To examine the role of each glycoprotein in receptor-dependent cell-cell fusion, we took advantage of our discovery that fusion by wild-type herpes simplex virus 2 (HSV-2) glycoproteins occurs twice as fast as that achieved by HSV-1 glycoproteins. By sequentially swapping each glycoprotein between the two serotypes, we established that fusion speed was governed by gH/gL, with gH being the main contributor. While the mutant forms of gB fuse at distinct rates that are dictated by their molecular structure, these restrictions can be overcome by gH/gL of HSV-2 (gH2/gL2), thereby enhancing their activity. We also found that deregulated forms of gD of HSV-1 (gD1) and gH2/gL2 can alter the fusogenic potential of gB, promoting cell fusion in the absence of a cellular receptor, and that deregulated forms of gB can drive the fusion machinery to even higher levels. Low pH enhanced fusion by affecting the structure of both gB and gH/gL mutants. Together, our data highlight the complexity of the fusion machinery, the impact of the activation state of each glycoprotein on the fusion process, and the critical role of gH/gL in regulating HSV-induced fusion. IMPORTANCE Cell-cell fusion mediated by HSV glycoproteins requires gD, gH/gL, gB, and a gD receptor. Here, we show that fusion by wild-type HSV-2 glycoproteins occurs twice as fast as that achieved by HSV-1 glycoproteins. By sequentially swapping each glycoprotein between the two serotypes, we found that the fusion process was controlled by gH/gL. Restrictions imposed on the gB structure by mutations could be overcome by gH2/gL2, enhancing the activity of the mutants. Under low-pH conditions or when using deregulated forms of gD1 and gH2/gL2, the fusogenic potential of gB could only be increased in the absence of receptor, underlining the exquisite regulation that occurs in the presence of receptor. Our data highlight the complexity of the fusion machinery, the impact of the activation state of each glycoprotein on the fusion process, and the critical role of gH/gL in regulating HSV-induced fusion. PMID:27630245

  2. Collisional relaxation of O2(X^3Σ _g^ -, υ = 1) and O2(a1Δg, υ = 1) by atmospherically relevant species

    NASA Astrophysics Data System (ADS)

    Pejaković, Dušan A.; Campbell, Zachary; Kalogerakis, Konstantinos S.; Copeland, Richard A.; Slanger, Tom G.

    2011-09-01

    Laboratory measurements are reported of the rate coefficient for collisional removal of O2(X^3Σ _g^ -, υ = 1) by O(3P), and the rate coefficients for removal of O2(a1Δg, υ = 1) by O2, CO2, and O(3P). A two-laser method is employed, in which the pulsed output of the first laser at 285 nm photolyzes ozone to produce oxygen atoms and O2(a1Δg, υ = 1), and the output of the second laser detects O2(a1Δg, υ = 1) via resonance-enhanced multiphoton ionization. The kinetics of O2(X^3Σ _g^ -, υ = 1) + O(3P) relaxation is inferred from the temporal evolution of O2(a1Δg, υ = 1), an approach enabled by the rapid collision-induced equilibration of the O2(X^3Σ _g^ -, υ = 1) and O2(a1Δg, υ = 1) populations in the system. The measured O2(X^3Σ _g^ -, υ = 1) + O(3P) rate coefficient is (2.9 ± 0.6) × 10-12 cm3 s-1 at 295 K and (3.4 ± 0.6) × 10-12 cm3 s-1 at 240 K. These values are consistent with the previously reported result of (3.2 ± 1.0) × 10-12 cm3 s-1, which was obtained at 315 K using a different experimental approach [K. S. Kalogerakis, R. A. Copeland, and T. G. Slanger, J. Chem. Phys. 123, 194303 (2005)]. For removal of O2(a1Δg, υ = 1) by O(3P), the upper limits for the rate coefficient are 4 × 10-13 cm3 s-1 at 295 K and 6 × 10-13 cm3 s-1 at 240 K. The rate coefficient for removal of O2(a1Δg, υ = 1) by O2 is (5.6 ± 0.6) × 10-11 cm3 s-1 at 295 K and (5.9 ± 0.5) × 10-11 cm3 s-1 at 240 K. The O2(a1Δg, υ = 1) + CO2 rate coefficient is (1.5 ± 0.2) × 10-14 cm3 s-1 at 295 K and (1.2 ± 0.1) × 10-14 cm3 s-1 at 240 K. The implications of the measured rate coefficients for modeling of atmospheric emissions are discussed.

  3. A Randomized Controlled Trial to Determine the Appropriate Time to Initiate Peritoneal Dialysis after Insertion of Catheter (Timely PD Study).

    PubMed

    Ranganathan, Dwarakanathan; John, George T; Yeoh, Edward; Williams, Nicola; O'Loughlin, Barry; Han, Thin; Jeyaseelan, Lakshmanan; Ramanathan, Kavitha; Healy, Helen

    2017-01-01

    The optimal time for the commencement of peritoneal dialysis (PD) after PD catheter insertion is unclear. If dialysis is started too soon after insertion, dialysate leaks and infection could occur. However, by starting PD earlier, morbidity and costs can be reduced through lesser hemodialysis requirements. This is the first randomized controlled trial to determine the safest and shortest interval to commence PD after catheter insertion. All consecutive patients undergoing PD catheter insertion at the Royal Brisbane and Women's Hospital and Rockhampton Hospital from 1 March 2008 to 31 May 2013 who met the inclusion and exclusion criteria were invited to participate in the trial. Participants were randomized to 1 of 3 groups. Group 1 (G1) commenced PD at 1 week, group 2 (G2) at 2 weeks and group 3 (G3) at 4 weeks after PD catheter insertion. These groups were stratified by hospital and the presence of diabetes. Primary outcomes were the incidence of peritoneal fluid leaks or PD-related infection during the 4 weeks after commencement of PD. In total 122 participants were recruited, 39, 42, and 41 randomized to G1, G2, and G3, respectively. The primary outcome catheter leak was significantly higher in G1 (28.2%) compared with G3 (2.4%, p = 0.001) but not compared with G2 (9.5%, p = 0.044), based on intention to treat analysis. These differences were even more marked when analyzed with per protocol method: G1 had a significantly higher percentage (32.4 %) compared with G3 (3.3%, p = 0.003) but not compared with G2 (10.5%, p = 0.040). Event percentages of leak were statistically higher in G1 and occurred significantly earlier compared with other groups ( p = 0.002). Amongst diabetics, technique failure was significantly higher (28.6%) in G3 compared with 0% in G1 and 7.1% in G2 ( p = 0.036) and earlier in G3 at 163.2 days vs 176.8 and 175.8 ( p = 0.037) for G1 and G2, respectively. Leaks were higher in participants commencing PD at 1 week after catheter insertion compared with the other 2 groups, and technique failure was higher in diabetics starting PD at 4 weeks. Copyright © 2017 International Society for Peritoneal Dialysis.

  4. Determination of aflatoxins B1, B2, G1 and G2 in spices using a multifunctional column clean-up.

    PubMed

    Akiyama, H; Goda, Y; Tanaka, T; Toyoda, M

    2001-10-12

    A rapid and simple method using a multifunctional column, which contains lipophilic and charged active sites, was developed to analyse aflatoxins B1, B2, G1 and G2 in various spices, such as red pepper and nutmeg. After extraction by acetonitrile:water (9:1) and clean-up using MultiSep #228 column, the aflatoxins and aflatoxin-TFA derivatives are determined using LC with fluorescence detection. Recoveries of each aflatoxin B1, B2, G1 and G2 spiked to red pepper, white pepper, black pepper, nutmeg and tear grass at the level of 10 ng/g were over 80-85% in all instances. The minimum detectable concentration for aflatoxins in red pepper was 0.5 ng/g.

  5. High androgen receptor immunoexpression in human "Sertoli cell only" testis.

    PubMed

    Loukil, L Hadjkacem; Boudawara, T Sellami; Ayadi, I; Bahloul, A; Jlidi, R; Ayadi, H; Keskes, L Ammar

    2005-01-01

    Our purpose was to evaluate cellular androgen receptor (AR) distribution and intensity of immunostaining in the human azoospermic testis. Thirty six biopsy specimens from azoospermic men were immunostained, using a monoclonal antibody of human AR. The localization and the intensity of AR immunostaining was evaluated in Sertoli Cell Only (SCO) testis (G1, n = 21), in spermatogenesis arrest testis (G2, n = 11) and in histologically normal testis (G3, n = 4). We found an AR immunostaining in Sertoli, peritubular myoid and Leydig cells, but not in germ cells. The intensity of the immunostaining varied substantially between biopsy specimens of different patients. Sertoli and Leydig cells AR immunostaining (score and intensity) in SCO group was higher than in the other groups. For Sertoli cells, the score means of AR immunoreactivity were 20 +/- 2.36, 10.18 +/- 1.0 and 1 +/- 1, for G1, G2 and G3 groups, respectively. For Leydig cells, the score means were 10.24 +/- 1.37, 6 +/- 0.71 and 0, for G1, G2 and G3 groups, respectively. We found significant differences between G1 and G2 (p = 0.0008), between G1 and G3 (p = 1.54 10-7) and G2 and G3 (p = 0.00032). These results suggest that in the testis AR is located exclusively in somatic cells and its expression is higher in SCO syndrome than in normal and in arrest spermatogenesis testes.

  6. Anti-Toxoplasma gondii antibodies in patients with beta-hemoglobinopathies: the first report in the Americas.

    PubMed

    Ferreira, Marina Neves; Bonini-Domingos, Claudia Regina; Fonseca Estevão, Isabeth; de Castro Lobo, Clarice Lopes; Souza Carrocini, Gisele Cristina; Silveira-Carvalho, Aparecida Perpétuo; Ricci, Octávio; de Mattos, Luiz Carlos; Brandão de Mattos, Cinara Cássia

    2017-06-14

    In Brazil, there have been no previous studies of Toxoplasma gondii infection in sickle cell anemia patients and carriers of severe forms of beta-thalassemia. This study evaluated T. gondii infection in patients with beta-hemoglobinopathies. A total of 158 samples, 77 (48.7%) men and 81 (51.3%) women, were evaluated. Three groups were formed: G1 (85 patients with sickle cell disease); G2 (11 patients with homozygous beta-thalassemia; G3 (62 patients with heterozygous beta-thalassemia). ELISA was employed to identify anti-T. gondii IgM and IgG antibodies, and molecular analysis was performed to determine beta-hemoglobin mutations. Fisher's exact test was used to compare frequencies of anti-T. gondii IgM and IgG antibodies in respect to gender and age. Anti-T. gondii IgG antibodies were found in 43.5% of individuals in G1, 18.1% in G2 and 50% in G3. All samples from G1 and G2 were seronegative for anti-T. gondii IgM antibodies, but 3.2% from G3 were seropositive. Considering anti-T. gondii IgG antibodies, no statistical significant differences were found between these groups nor in seroprevalence between genders within each group. Despite this, comparisons of the mean ages between G1, G2 and G3 were statistically significant (G2 vs. G1: p value = 0.0001; G3 vs. G1: p-value <0.0001; G3 vs. G2: p-value = 0.0001). A comparison by age of patients with sickle cell anemia showed a trend of lower risk of infection among younger individuals. Therefore, this study demonstrates that T. gondii infection occurs in patients with beta-thalassemia and sickle cell anemia in Brazil as seen by the presence of anti-T. gondii IgM and IgG antibodies.

  7. A combined effort to avoid strongyle infection in horses in an oceanic climate region: rotational grazing and parasiticidal fungi.

    PubMed

    Hernández, José Ángel; Sánchez-Andrade, Rita; Cazapal-Monteiro, Cristiana Filipa; Arroyo, Fabián Leonardo; Sanchís, Jaime Manuel; Paz-Silva, Adolfo; Arias, María Sol

    2018-04-12

    An approach to preventing strongyle infection in horses was tested, comprising rotational pasturing and the administration of spores of two parasiticidal fungi, Mucor circinelloides and Duddingtonia flagrans. Twenty-two adult Spanish Sport Horses were dewormed with ivermectin (1 mg pour-on/kg body weight) and then randomly divided into three groups. G-1 was maintained with continuous grazing, and G-2 and G-3 were kept on a four-paddock rotation system. Commercial pelleted feed (2.5 kg/horse) was supplied to G-1 and G-2 twice a week; horses in G-3 received pellets containing 2 × 10 6 spores/kg of each fungus. Fecal samples were analyzed by the flotation method to estimate the reduction in the fecal egg counts (FECR), the percentage of horses shedding eggs (PHR), and the egg reappearance period (ERP). Third-stage larvae were identified in fecal pats as Cyathostomum (sensu lato) types A, C and D, Gyalocephalus capitatus, Triodontophorus serratus, Poteriosthomum spp., Strongylus vulgaris and S. edentatus. Two weeks after treatment, the FECR values were 100% in G-1, 96% in G-2 and 99% in G-3; the PHR values were 100% in G-1, 75% in G-2 and 88% in G-3. A strongyle ERP of 6 weeks was observed in G-1, ERP of 10 weeks was observed in G-2, and ERP of 16 weeks was observed in G-3. The counts of eggs per gram of feces (EPG) were > 300 EPG in G-1 and G-2 but remained below 250 EPG in G-3 throughout the observation period of 12 months. These results suggest that horse strongyle infection could be decreased by combining rotational pasturing with feeding pellets containing the spores of parasiticidal fungi.

  8. Evaluation of compatibility between different types of adhesives and dual-cured resin cement.

    PubMed

    Franco, Eduardo B; Lopes, Lawrence G; D'alpino, Paulo H P; Pereira, José C; Mondelli, Rafael F L; Navarro, Maria F L

    2002-01-01

    The objective of this in vitro study was to evaluate the bonding compatibility between different adhesives and a dual-cured resin cement, using a conventional tensile bond test. The adhesives used were: Prime & Bond (PB) (Dentsply) (PB), Scotchbond Multi Purpose (SB) (3M), and the activator Self Cure (SC) (Dentsply). The dual-curing resin cement used was Enforce (EF) (Dentsply). Six groups with five specimens in each were tested: G1: EF/PB/EF (light cured); G2: EF/SB/EF (light cured); G3: EF/PB+SC/EF (light cured); G4: EF/PB+SC/EF (only chemically cured); G5: EF/EF (light cured); G6: EF/EF (only chemically cured). The resin cement was applied in two stainless steel molds with a cone-shaped perforation measuring 4 mm in diameter and 1 mm in thickness, and the adhesive was applied between them. Ten minutes after specimens were cured, the tensile strength was measured in a universal testing machine at a crosshead speed of 0.5 mm/min. The mean values (MPa) +/- SD obtained in each experimental group were: G1: 1.4 +/- 0.2; G2: 1.3 +/- 0.2; G3: 1.2 +/- 0.4; G4: 0.8 +/- 0.2; G5: 1.2 +/- 0.1; G6: 0.7 +/- 0.1. The results were statistically evaluated using nonparametric Kruskal-Wallis and Dunn tests (p < or = 0.05). Statistically significant differences among groups were found only between G1 and G4, and G1 and G6. There was no incompatibility among the different adhesives used with dual-cured resin cement. The lowest tensile bond strength values occurred in the absence of photoactivation.

  9. The association between PAI-1 -675 4G/5G polymorphism and type 2 diabetes mellitus.

    PubMed

    Chen, L; Li, S-Y; Liu, M

    2017-08-15

    In this study, we aimed to analyze the association between plasminogen activator inhibitor 1 (PAI-1) -675 4G/5G polymorphism and type 2 diabetes mellitus (T2DM) risk. We included in 187 T2DM patients and 186 heathy controls between 2014 and 2017 from Tianjin Gong An Hospital, China. All patients and controls were ethnically Chinese Han population. The primers and polymerase chain reaction (PCR) conditions were performed. Results from this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in four genetic models. Additionally, PAI-1 -675 4G/5G polymorphism was not associated with clinical and laboratory characteristics, such as age, gender, body mass index, systolic blood pressure, diastolic blood pressure, total cholesterol, triglycerides, and HbA1c. In conclusion, this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in this population.

  10. Electroencephalographic characterization of subgroups of children with learning disorders

    PubMed Central

    Roca-Stappung, Milene; Bosch-Bayard, Jorge; Harmony, Thalía; Ricardo-Garcell, Josefina

    2017-01-01

    Electroencephalographic alterations have been reported in subjects with learning disorders, but there is no consensus on what characterizes their electroencephalogram findings. Our objective was to determine if there were subgroups within a group of scholars with not otherwise specified learning disorders and if they had specific electroencephalographic patterns. Eighty-five subjects (31 female, 8–11 years) who scored low in at least two subscales -reading, writing and arithmetic- of the Infant Neuropsychological Evaluation were included. Electroencephalograms were recorded in 19 leads during rest with eyes closed; absolute power was obtained every 0.39 Hz. Three subgroups were formed according to children’s performance: Group 1 (G1, higher scores than Group 2 in reading speed and reading and writing accuracy), Group 2 (G2, better performance than G1 in composition) and Group 3 (G3, lower scores than Groups 1 and 2 in the three subscales). G3 had higher absolute power in frequencies in the delta and theta range at left frontotemporal sites than G1 and G2. G2 had higher absolute power within alpha frequencies than G3 and G1 at the left occipital site. G3 had higher absolute power in frequencies in the beta range than G1 in parietotemporal areas and than G2 in left frontopolar and temporal sites. G1 had higher absolute power within beta frequencies than G2 in the left frontopolar site. G3 had lower gamma absolute power values than the other groups in the left hemisphere, and gamma activity was higher in G1 than in G2 in frontopolar and temporal areas. This group of children with learning disorders is very heterogeneous. Three subgroups were found with different cognitive profiles, as well as a different electroencephalographic pattern. It is important to consider these differences when planning interventions for children with learning disorders. PMID:28708890

  11. The different effector function capabilities of the seven equine IgG subclasses have implications for vaccine strategies

    PubMed Central

    Lewis, Melanie J.; Wagner, Bettina; Woof, Jenny M.

    2008-01-01

    Recombinant versions of the seven equine IgG subclasses were expressed in CHO cells. All assembled into intact immunoglobulins stabilised by disulphide bridges, although, reminiscent of human IgG4, a small proportion of equine IgG4 and IgG7 were held together by non-covalent bonds alone. All seven IgGs were N-glycosylated. In addition IgG3 appeared to be O-glycosylated and could bind the lectin jacalin. Staphylococcal protein A displayed weak binding for the equine IgGs in the order: IgG1 > IgG3 > IgG4 > IgG7 > IgG2 = IgG5 > IgG6. Streptococcal protein G bound strongly to IgG1, IgG4 and IgG7, moderately to IgG3, weakly to IgG2 and IgG6, and not at all to IgG5. Analysis of antibody effector functions revealed that IgG1, IgG3, IgG4, IgG5 and IgG7, but not IgG2 and IgG6, were able to elicit a strong respiratory burst from equine peripheral blood leukocytes, predicting that the former five IgG subclasses are able to interact with Fc receptors on effector cells. IgG1, IgG3, IgG4 and IgG7, but not IgG2, IgG5 and IgG6, were able to bind complement C1q and activate complement via the classical pathway. The differential effector function capabilities of the subclasses suggest that, for maximum efficacy, equine vaccine strategies should seek to elicit antibody responses of the IgG1, IgG3, IgG4, and IgG7 subclasses. PMID:17669496

  12. Subclass specificities of rabbit antibodies to human antidextran.

    PubMed

    Outschoorn, I M

    1983-03-01

    Rabbits were immunized with purified antidextran containing IgG2. Half of the animals were treated with commercial human IgG intravenously to induce tolerance. The antisera were absorbed and/or eluted from IgG-Sepharose columns and the antibodies tested with a panel of at least eight human myeloma proteins of the four IgG subclasses, both kappa and lambda types. All animals produced mainly anti-IgG2 or IgG4, sometimes intechanged between these maxima or between kappa and lambda types over a series of bleedings. Absorption with IgG2 and/or IgG4 myeloma proteins resulted in sera or antibody preparations specific for the IgG1 or IgG3 subclasses, and the amount of those antibodies also varied between bleedings from the same animal. It may be concluded that anti-IgG2 and anti-IgG4 syntheses are related in a complementary manner or are equally likely to be produced in a response to IgG2; while IgG1 and IgG3 are also interrelated, but with an inverse relationship to IgG2 and IgG4. Alternatively anti-IgG2 and anti-IgG4 antibodies could be highly cross-reactive, and so could anti-IgG1 and anti-IgG3 antibodies.

  13. Subclass specificities of rabbit antibodies to human antidextran.

    PubMed Central

    Outschoorn, I M

    1983-01-01

    Rabbits were immunized with purified antidextran containing IgG2. Half of the animals were treated with commercial human IgG intravenously to induce tolerance. The antisera were absorbed and/or eluted from IgG-Sepharose columns and the antibodies tested with a panel of at least eight human myeloma proteins of the four IgG subclasses, both kappa and lambda types. All animals produced mainly anti-IgG2 or IgG4, sometimes intechanged between these maxima or between kappa and lambda types over a series of bleedings. Absorption with IgG2 and/or IgG4 myeloma proteins resulted in sera or antibody preparations specific for the IgG1 or IgG3 subclasses, and the amount of those antibodies also varied between bleedings from the same animal. It may be concluded that anti-IgG2 and anti-IgG4 syntheses are related in a complementary manner or are equally likely to be produced in a response to IgG2; while IgG1 and IgG3 are also interrelated, but with an inverse relationship to IgG2 and IgG4. Alternatively anti-IgG2 and anti-IgG4 antibodies could be highly cross-reactive, and so could anti-IgG1 and anti-IgG3 antibodies. PMID:6186599

  14. Effects of diet and body size on phosphorus utilization of Liza haematocheila T. & S.

    NASA Astrophysics Data System (ADS)

    Kang, Bin; Xian, Weiwei; Wu, Yunfei

    2008-05-01

    A 21-d laboratory experiment was conducted to study, the phosphorus (P) utilization of two different diets by redlip mullet Liza haematocheila T. & S. Sand-filtered water in salinity 30 and temperature 25°C was used. Twenty-nine fish individuals were divided into three groups: 11 to group 1 (G1) fed on diet 1, 11 to group 2 (G2) fed on diet 2, and 7 to contrast group. Diet 1 was a commercial feed, more valuable in nutrition than diet 2 that similar to natural detritus. The results show the intake phosphorus (IP) of G1 was significantly higher than that of G2, and both increased linearly with body size at a certain amount of diet. The retention phosphorus (RP) in fish of G1 was lower than G2. The relationship between retention phosphorus and body size was positive and stronger in G2. Significant difference in faecal phosphorus (FP) was found between G1 and G2. Body size significantly impacted the excretion phosphorus (EP) in G1 but G2. The loss of intake phosphorus in G1 was 10.83-20.27 mg per g fish weight gain, higher than that in G2 for 6.63-9.56. Of the phosphorus, about 10% was allocated into growth, 50% in faeces, and the rest lost in excretion. The main part of phosphorus was lost in faeces but excretion. The phosphorus budget of the fish could be described as 100IP = 7.40RP + 47.39FP + 36.63EP (Diet 1) or 100IP = 11.93RP + 56.64FP + 21.76EP (Diet 2).

  15. On Super Edge-magic Total Labeling of Modified Watermill Graph

    NASA Astrophysics Data System (ADS)

    Nurdin; Ungko, T. S.; Gormantara, J.; Abdullah, A.; Aulyah, S.; Nikita

    2018-03-01

    An edge-magic total labeling on a graph G is one-to-one map from V(G) ∪ E(G) onto the set of integers 1,2, ...,ν + e, where ν = |V(G)| and e = |E(G)|, with the property that, given any edge uv, f(u) + f(u, ν}) + f(ν) = k for every u,v ∈ V(G), and k is called magic valuation. An edge-magic total labeling f is called super edge-magic total if f(v(G)) = {1,2 ...,|V(G)|} and f(E(G)) = {|V(G)| + 1, |V(G)| + 2,... |V(G) + E(G)|}. In this paper we investigate edge-magic total labeling of a new graph called modified Watermill graph. Furthermore, the magic valuation of the modified Watermill graph WM(n) is k=\\frac{1}{2}(21n+3), for n odd, n ≥ 3.

  16. Effects of carbon amendment on in situ atrazine degradation and total microbial biomass.

    PubMed

    Ngigi, Anastasiah N; Getenga, Zachary M; Dörfler, Ulrike; Boga, Hamadi I; Kuria, Benson; Ndalut, Paul; Schroll, Reiner

    2013-01-01

    This study elucidates the effects of carbon amendment on metabolic degradation of atrazine (6-chloro-N(2)-ethyl-N(4)-isopropyl-1,3,5-triazine-2,4-diamine) and total microbial biomass in soil. Degradation of (14)C-ring-labelled atrazine was monitored in laboratory incubations of soils supplemented with 0, 10, 100 and 1000 μg g(-1) sucrose concentrations. An experiment to determine the effect of carbon amendment on total microbial biomass and soil respiration was carried out with different concentrations of sucrose and non-labelled atrazine. The soils were incubated at a constant temperature and constant soil moisture at water potential of -15 kPa and a soil density of 1.3 g cm(-3). Mineralization of (14)C-ring-labelled atrazine was monitored continuously over a period of 59 d in the first experiment. The CO(2) production was monitored for 62 d in the second experiment and microbial biomass determined at the end of the incubation period. The addition of 1000 μg g(-1) sucrose reduced atrazine mineralization to 43.5% compared to 51.7% of the applied amount for the treatment without sucrose. The addition of 1000 μg g(-1) sucrose modified the transformation products to 1.08 μg g(-1) deisopropylatrazine (DIA), 0.32 μg g(-1) desethylatrazine (DEA) and 0.18 μg g(-1) deisopropyl-2-hydroxyatrazine (OH-DIA). Treatment without sucrose resulted in formation of 0.64 μg g(-1) hydroxyatrazine (HA), 0.28 μg g(-1) DIA and 0.20 μg g(-1) OH-DIA. Atrazine dealkylation was enhanced in treatments with 100 and 1000 μg g(-1) of sucrose added. HA metabolite was formed in the control (no sucrose) and in the presence of 10 μg g(-1) of sucrose, whereas DEA was only detected in treatment with 1000 μg g(-1) sucrose. Results indicate that total microbial biomass increased significantly (P < 0.001) with the addition of 1000 μg g(-1) sucrose.

  17. 21 CFR 558.4 - Requirement of a medicated feed mill license.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 90-120 20.0 g/lb (4.4%) 75-125/65-135. Penicillin 80-120 10.0 g/lb (2.2%) 65-135. Poloxalene 90-110... 10.0 g/lb (2.2%) 85-125/70-130. Penicillin 85-115 5.0 g/lb (1.1%) 85-125/70-130. Sulfamethazine 85.... Chlortetracycline 85-125 10.0g/lb (2.2%) 70-130. Penicillin 80-120 5.0 g/lb (1.1%) 70-130. Thiabendazole 94-106 45.4...

  18. Prenatal Centrifugation: A Mode1 for Fetal Programming of Body Weight?

    NASA Technical Reports Server (NTRS)

    Baer, Lisa A.; Rushing, Linda; Wade, Charles E.; Ronca, April E.

    2005-01-01

    'Fetal programming' is a newly emerging field that is revealing astounding insights into the prenatal origins of adult disease, including metabolic, endocrine, and cardiovascular pathophysiology. In the present study, we tested the hypothesis that rat pups conceived, gestated and born at 2-g have significantly reduced birth weights and increased adult body weights as compared to 1-g controls. Offspring were produced by mating young adult male and female rats that were adapted to 2-g centrifugation. Female rats underwent conception, pregnancy and birth at 2-g. Newborn pups in the 2-g condition were removed from the centrifuge and fostered to non-manipulated, newly parturient dams maintained at 1 -g. Comparisons were made with 1-g stationary controls, also crossfostered at birth. As compared to 1-g controls, birth weights of pups gestated and born at 2-g were significantly reduced. Pup body weights were significantly reduced until Postnatal day (P) 12. Beginning on P63, body weights of 2-g-gestated offspring exceeded those of 1-g controls by 7-10%. Thus, prenatal rearing at 2-g restricts neonatal growth and increases adult body weight. Collectively, these data support the hypothesis that 2-g centrifugation alters the intrauterine milieu, thereby inducing persistent changes in adult phenotype.

  19. Impacts, Effectiveness and Regional Inequalities of the GeoMIP G1 to G4 Solar Radiation Management Scenarios

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Xiaoyong; Moore, John; Cui, Xuefeng

    We evaluate the regional effectiveness of solar radiation management (SRM) to compensate for simultaneous changes in temperature and precipitation induced by increased greenhouse gas concentrations. We analyze results from multiple earth system models under four Geoengineering Model Intercomparison Project(GeoMIP) experiments with a modified form of the Residual Climate Response approach. Under the solar dimming geoengineering experiments G1(4xCO2) and G2(increasing CO2 by 1% per year), global average temperature is successfully restored to pre-industrial level over 50 years simulations. However, these two SRM experiments also produce a robust global precipitation decrease. The stratospheric aerosol GeoMIP geoengineering experiment, G4 has significantly greater regionalmore » inequality and lower effectiveness for compensating temperature change than G1 and G2. G4 also has significantly larger regional inequality for compensating precipitation change than G1and G2. However, there is no significant difference between precipitation change compensation effectiveness of G4 and G2, though there is much larger across model variability in G4 results. G3 has significant greater regional inequality for compensating temperature change than G1 and G2, and has significant lower effectiveness than G1. The effectiveness of four SRMs to compensate for temperature change is much higher than for precipitation. The large cross-model variation in adjustment percentage of compensated SAT and precipitation change by SRM to achieve optimal compensation effectiveness shed a light on the uncertainty accumulation effect in optimizing compensation effectiveness of SRM.« less

  20. Bewertung von Fahrzeuggeräuschen

    NASA Astrophysics Data System (ADS)

    Genuit, Klaus; Schulte-Fortkamp, Brigitte; Fiebig, André; Haverkamp, Michael

    Bei der Wahrnehmung und Beurteilung eines Automobils sind unzählige Merkmale und Eigenschaften von Bedeutung. Dabei können Merkmale objektiv-technisch beschrieben werden, wie Angaben zur Motorisierung, Höchstgeschwindigkeit, Drehmoment, zulässige Zuladung, Verbrauch usw. Daneben sind weitere Eigenschaften von Bedeutung, die sich einer einfachen objektiv-technischen Beschreibung entziehen. Hier sind Begriffe zu nennen, wie Sicherheit, allgemeine Qualitätsanmutung, Design, Ergonomie, Komfort, Haptik, Fahrdynamik, Zuverlässigkeit, die deutlich schwieriger objektiv erfassbar und beschreibbar sind (Abb. 4.1).

  1. Effects of 2 G on adiposity, leptin, lipoprotein lipase, and uncoupling protein-1 in lean and obese Zucker rats

    NASA Technical Reports Server (NTRS)

    Warren, L. E.; Horwitz, B. A.; Hamilton, J. S.; Fuller, C. A.

    2001-01-01

    Male Zucker rats were exposed to 2 G for 8 wk to test the hypothesis that the leptin regulatory pathway contributes to recovery from effects of 2 G on feeding, growth, and nutrient partitioning. After initial hypophagia, body mass-independent food intake of the lean rats exposed to 2 G surpassed that of the lean rats maintained at 1 G, but food intake of the obese rats exposed to 2 G remained low. After 8 wk at 2 G, body mass and carcass fat were less in both genotypes. Leptin and percent fat were lower in lean rats exposed to 2 G vs. 1 G but did not differ in obese rats exposed to 2 G vs. 1 G. Although exposure to 2 G did not alter uncoupling protein-1 levels, it did elicit white fat pad-specific changes in lipoprotein lipase activity in obese but not lean rats. We conclude that 2 G affects both genotypes but that the lean Zucker rats recover their food intake and growth rate and retain "normal" lipoprotein lipase activity to a greater degree than do the obese rats, emphasizing the importance of a functional leptin regulatory pathway in this acclimation.

  2. Synthesis of Asynchronous Systems from Data Flow Specifications

    DTIC Science & Technology

    1993-12-01

    Sarma B. K. Vrudhula, UA-ECE ISI/RR-93-366 December 1993 DTIC S ELECTE APR 2 81994 U G D!MC QUA& f n MC’W". 1 S INFORMATION SCIENCES 3101822-1511...wire data types is denoted by nb, where n is a positive integer. 3. Group data types are denoted by (g1,g2,.. . , g ,), where each gi is a null data type...During the manipulation of a DFG, a data type may be reduced to an equiv- alent data type. (gl) is equivalent to g1 , and (g1,g2,. . . , g 3 i--9,g9,gj+1

  3. Determination of O2(a1 delta g) and O2(b1 sigma+ g) yields in the reaction O + ClO --> Cl + O2: implications for photochemistry in the atmosphere of Venus

    NASA Technical Reports Server (NTRS)

    Leu, M. T.; Yung, Y. L.

    1987-01-01

    A discharge flow apparatus with chemiluminescence detector has been used to study the reaction O + ClO --> Cl + O2, where O2 = O2(a1 delta g) or O2(b1 sigma+ g). The measured quantum yields for producing O2(a1 delta g) and O2(b1 sigma+ g) in the above reaction are less than 2.5 x 10(-2) and equal to (4.4 +/- 1.1) x 10(-4), respectively. The observed O2(a1 delta g) airglow of Venus cannot be explained in the context of standard photochemistry using our experimental results and those reported in recent literature. The possibility of an alternative source of O atoms derived from SO2 photolysis in the mesosphere of Venus is suggested.

  4. 49 CFR 173.52 - Classification codes and compatibility groups of explosives.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... one containing white phosphorus, phosphide or flammable liquid or gel or hypergolic liquid) G 1.1G1.2G 1.3G 1.4G Article containing both an explosive substance and white phosphorus H 1.2H1.3H Article...

  5. 49 CFR 173.52 - Classification codes and compatibility groups of explosives.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... one containing white phosphorus, phosphide or flammable liquid or gel or hypergolic liquid) G 1.1G1.2G 1.3G 1.4G Article containing both an explosive substance and white phosphorus H 1.2H1.3H Article...

  6. Enzymatic hydrolysis and fermentation of pretreated cashew apple bagasse with alkali and diluted sulfuric Acid for bioethanol production.

    PubMed

    Rocha, Maria Valderez Ponte; Rodrigues, Tigressa Helena Soares; de Macedo, Gorete Ribeiro; Gonçalves, Luciana R B

    2009-05-01

    The aim of this work was to optimize the enzymatic hydrolysis of the cellulose fraction of cashew apple bagasse (CAB) after diluted acid (CAB-H) and alkali pretreatment (CAB-OH), and to evaluate its fermentation to ethanol using Saccharomyces cerevisiae. Glucose conversion of 82 +/- 2 mg/g CAB-H and 730 +/- 20 mg/g CAB-OH was obtained when 2% (w/v) of solid and 30 FPU/g bagasse was used during hydrolysis at 45 degrees C, 2-fold higher than when using 15 FPU/g bagasse, 44 +/- 2 mg/g CAB-H, and 450 +/- 50 mg/g CAB-OH, respectively. Ethanol concentration and productivity, achieved after 6 h of fermentation, were 20.0 +/- 0.2 g L(-1) and 3.33 g L(-1) h(-1), respectively, when using CAB-OH hydrolyzate (initial glucose concentration of 52.4 g L(-1)). For CAB-H hydrolyzate (initial glucose concentration of 17.4 g L(-1)), ethanol concentration and productivity were 8.2 +/- 0.1 g L(-1) and 2.7 g L(-1) h(-1) in 3 h, respectively. Hydrolyzates fermentation resulted in an ethanol yield of 0.38 and 0.47 g/g glucose with pretreated CAB-OH and CAB-H, respectively. Ethanol concentration and productivity, obtained using CAB-OH hydrolyzate, were close to the values obtained in the conventional ethanol fermentation of cashew apple juice or sugar cane juice.

  7. Health care utilization history, GOLD guidelines, and respiratory medication prescriptions in patients with COPD.

    PubMed

    Seaman, Joseph; Leonard, Anthony C; Panos, Ralph J

    2010-04-07

    The relationship between prior health care utilization and respiratory medication prescriptions in an unselected population of patients with COPD is not known. We determined the prescribed respiratory medications and respiratory and nonrespiratory health care encounters in 523 Veterans with COPD at the Cincinnati Veterans Affairs Medical Center between 2000 and 2005. Prescribed treatments were compared with the GOLD guidelines and each patient was classified as receiving less medications than recommended in the guidelines (G). Respiratory medications were G for 14% of the patients studied. For GOLD stages 1 and 2, G patients the most prior respiratory encounters during a 12 month period (0.31 +/- 0.073 (0.21, 0.47), 0.75 +/- 0.5 (0.37, 1.5), 1.1 +/- 0.27 (0.74, 1.6) visits/person/year, G, respectively, mean + standard error of mean (SEM) (95% confidence limits) 2 degrees of freedom (df) ANOVA P < 0.001 for prescription effect). For GOLD stages 3 and 4, G respectively, 2 df ANOVA P = 0.096) or for GOLD stages 3 and 4 (3.6 +/- 0.25 (3.2, 4.1) and 4.0 +/- 0.44 (3.3, 4.9) visits/person/year,

  8. Formation of g-C3N4@Ni(OH)2 Honeycomb Nanostructure and Asymmetric Supercapacitor with High Energy and Power Density.

    PubMed

    Dong, Bitao; Li, Mingyan; Chen, Sheng; Ding, Dawei; Wei, Wei; Gao, Guoxin; Ding, Shujiang

    2017-05-31

    Nickel hydroxide (Ni(OH) 2 ) has been regarded as a potential next-generation electrode material for supercapacitor owing to its attractive high theoretical capacitance. However, practical application of Ni(OH) 2 is hindered by its lower cycling life. To overcome the inherent defects, herein we demonstrate a unique interconnected honeycomb structure of g-C 3 N 4 and Ni(OH) 2 synthesized by an environmentally friendly one-step method. In this work, g-C 3 N 4 has excellent chemical stability and supports a perpendicular charge-transporting direction in charge-discharge process, facilitating electron transportation along that direction. The as-prepared composite exhibits higher specific capacities (1768.7 F g -1 at 7 A g -1 and 2667 F g -1 at 3 mV s -1 , respectively) compared to Ni(OH) 2 aggregations (968.9 F g -1 at 7 A g -1 ) and g-C 3 N 4 (416.5 F g -1 at 7 A g -1 ), as well as better cycling performance (∼84% retentions after 4000 cycles). As asymmetric supercapacitor, g-C 3 N 4 @Ni(OH) 2 //graphene exhibits high capacitance (51 F g -1 ) and long cycle life (72% retentions after 8000 cycles). Moreover, high energy density of 43.1 Wh kg -1 and power density of 9126 W kg -1 has been achieved. This attractive performance reveals that g-C 3 N 4 @Ni(OH) 2 with honeycomb architecture could find potential application as an electrode material for high-performance supercapacitors.

  9. Recombinant HPA-1a antibody therapy for treatment of fetomaternal alloimmune thrombocytopenia: proof of principle in human volunteers.

    PubMed

    Ghevaert, Cedric; Herbert, Nina; Hawkins, Louise; Grehan, Nicola; Cookson, Philip; Garner, Steve F; Crisp-Hihn, Abigail; Lloyd-Evans, Paul; Evans, Amanda; Balan, Kottekkattu; Ouwehand, Willem H; Armour, Kathryn L; Clark, Mike R; Williamson, Lorna M

    2013-07-18

    Fetomaternal alloimmune thrombocytopenia, caused by the maternal generation of antibodies against fetal human platelet antigen-1a (HPA-1a), can result in intracranial hemorrhage and intrauterine death. We have developed a therapeutic human recombinant high-affinity HPA-1a antibody (B2G1Δnab) that competes for binding to the HPA-1a epitope but carries a modified constant region that does not bind to Fcγ receptors. In vitro studies with a range of clinical anti-HPA-1a sera have shown that B2G1Δnab blocks monocyte chemiluminescence by >75%. In this first-in-man study, we demonstrate that HPA-1a1b autologous platelets (matching fetal phenotype) sensitized with B2G1Δnab have the same intravascular survival as unsensitized platelets (190 hours), while platelets sensitized with a destructive immunoglobulin G1 version of the antibody (B2G1) are cleared from the circulation in 2 hours. Mimicking the situation in fetuses receiving B2G1Δnab as therapy, we show that platelets sensitized with a combination of B2G1 (representing destructive HPA-1a antibody) and B2G1Δnab survive 3 times as long in circulation compared with platelets sensitized with B2G1 alone. This confirms the therapeutic potential of B2G1Δnab. The efficient clearance of platelets sensitized with B2G1 also opens up the opportunity to carry out studies of prophylaxis to prevent alloimmunization in HPA-1a-negative mothers.

  10. Synthesis of ethylene diamine-based ferrocene terminated dendrimers and their application as burning rate catalysts.

    PubMed

    Zain-Ul-Abdin; Wang, Li; Yu, Haojie; Saleem, Muhammad; Akram, Muhammad; Khalid, Hamad; Abbasi, Nasir M; Yang, Xianpeng

    2017-02-01

    Ferrocene-based derivatives are widely used as ferrocene-based burning rate catalysts (BRCs) for ammonium perchlorate (AP)-based propellant. However, in long storage, small ferrocene-based derivatives migrate to the surface of the propellant, which results in changes in the designed burning parameters and finally causes unstable combustion. To retard the migration of ferrocene-based BRCs in the propellant and to increase the combustion of the solid propellant, zero to third generation ethylene diamine-based ferrocene terminated dendrimers (0G, 1G, 2G and 3G) were synthesized. The synthesis of these dendrimers was confirmed by 1 H NMR and FT-IR spectroscopy. The electrochemical behavior of 0G, 1G, 2G and 3G was investigated by cyclic voltammetry (CV) and the burning rate catalytic activity of 0G, 1G, 2G and 3G on thermal disintegration of AP was examined by thermogravimetry (TG) and differential thermogravimetry (DTG) techniques. Anti-migration studies show that 1G, 2G and 3G exhibit improved anti-migration behavior in the AP-based propellant. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. The effect of postsurgical pain on attentional processing in horses.

    PubMed

    Dodds, Louise; Knight, Laura; Allen, Kate; Murrell, Joanna

    2017-07-01

    To investigate the effect of postsurgical pain on the performance of horses in a novel object and auditory startle task. Prospective clinical study. Twenty horses undergoing different types of surgery and 16 control horses that did not undergo surgery. The interaction of 36 horses with novel objects and a response to an auditory stimulus were measured at two time points; the day before surgery (T1) and the day after surgery (T2) for surgical horses (G1), and at a similar time interval for control horses (G2). Pain and sedation were measured using simple descriptive scales at the time the tests were carried out. Total time or score attributed to each of the behavioural categories was compared between groups (G1 and G2) for each test and between tests (T1 and T2) for each group. The median (range) time spent interacting with novel objects was reduced in G1 from 58 (6-367) seconds in T1 to 12 (0-495) seconds in T2 (p=0.0005). In G2 the change in interaction time between T1 and T2 was not statistically significant. Median (range) total auditory score was 7 (3-12) and 10 (1-12) in G1 and G2, respectively, at T1, decreasing to 6 (0-10) in G1 after surgery and 9.5 (1-12) in G2 (p=0.0003 and p=0.94, respectively). There was a difference in total auditory score between G1 and G2 at T2 (p=0.0169), with the score being lower in G1 than G2. Postsurgical pain negatively impacts attention towards novel objects and causes a decreased responsiveness to an auditory startle test. In horses, tasks demanding attention may be useful as a biomarker of pain. Copyright © 2017 Association of Veterinary Anaesthetists and American College of Veterinary Anesthesia and Analgesia. All rights reserved.

  12. 26 CFR 1.402(g)-2 - Increased limit for catch-up contributions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ....402(g)-2 Section 1.402(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Pension, Profit-Sharing, Stock Bonus Plans, Etc. § 1.402(g)-2 Increased limit for catch-up contributions. (a) General rule. Under section 402(g)(1)(C), in determining the...

  13. Heterotypic Protection and Induction of a Broad Heterotypic Neutralization Response by Rotavirus-Like Particles

    PubMed Central

    Crawford, Sue E.; Estes, Mary K.; Ciarlet, Max; Barone, Christopher; O’Neal, Christine M.; Cohen, Jean; Conner, Margaret E.

    1999-01-01

    The recognition that rotaviruses are the major cause of life-threatening diarrheal disease and significant morbidity in young children has focused efforts on disease prevention and control of these viruses. Although the correlates of protection in children remain unclear, some studies indicate that serotype-specific antibody is important. Based on this premise, current live attenuated reassortant rotavirus vaccines include the four predominant serotypes of virus. We are evaluating subunit rotavirus vaccines, 2/6/7-VLPs and 2/4/6/7-VLPs, that contain only a single VP7 of serotype G1 or G3. In mice immunized parenterally twice, G3 virus-like particles (VLPs) induced a homotypic, whereas G1 VLPs induced a homotypic and heterotypic (G3) serum neutralizing immune response. Administration of three doses of G1 or G3 VLPs induced serum antibodies that neutralized five of seven different serotype test viruses. The inclusion of VP4 in the VLPs was not essential for the induction of heterotypic neutralizing antibody in mice. To confirm these results in another species, rabbits were immunized parenterally with two doses of 2/4/6/7-VLPs containing a G3 or G1 VP7, sequentially with G3 VLPs followed by G1 (G3/G1) VLPs, or with live or psoralen-inactivated SA11. High-titer homotypic serum neutralizing antibody was induced in all rabbits, and low-level heterotypic neutralizing antibody was induced in a subset of rabbits. The rabbits immunized with the G1 or G3/G1 VLPs in QS-21 were challenged orally with live G3 ALA rotavirus. Protection levels were similar in rabbits immunized with homotypic G3 2/4/6/7-VLPs, heterotypic G1 2/4/6/7-VLPs, or G3/G1 2/4/6/7-VLPs. Therefore, G1 2/4/6/7-VLPs can induce protective immunity against a live heterotypic rotavirus challenge in an adjuvant with potential use in humans. Following challenge, broad serum heterotypic neutralizing antibody responses were detected in rabbits parenterally immunized with G1, G3/G1, or G3 VLPs but not with SA11. Immunization with VLPs may provide sufficient priming of the immune system to induce protective anamnestic heterotypic neutralizing antibody responses upon subsequent rotavirus infection. Therefore, a limited number of serotypes of VLPs may be sufficient to provide a broadly protective subunit vaccine. PMID:10233942

  14. Strain energy release rate analysis of cyclic delamination growth in compressively loaded laminates

    NASA Technical Reports Server (NTRS)

    Whitcomb, J. D.

    1983-01-01

    Delamination growth in compressively loaded composite laminates was studied analytically and experimentally. The configuration used was a laminate with an across-the-width delamination. An approximate super-position stress analysis was developed to quantify the effects of various geometric, material, and load parameters on mode 2 and mode 2 strain energy release rates G sub/1 and G sub 2, respectively. Calculated values of G sub 1 and G sub 2 were then compared with measured cyclic delamination growth rates to determine the relative importance of G sub 1 and G sub 2. High growth rates were observed only when G sub 1 was large. However, slow growth was observed even when G sub 1 was negligibly small. This growth apparently was due to a large value of G sub 2.

  15. Excitation energy dependent Raman spectrum of MoSe2

    PubMed Central

    Nam, Dahyun; Lee, Jae-Ung; Cheong, Hyeonsik

    2015-01-01

    Raman investigation of MoSe2 was carried out with eight different excitation energies. Seven peaks, including E1g, A1g, E2g1, and A2u2 peaks are observed in the range of 100–400 cm−1. The phonon modes are assigned by comparing the peak positions with theoretical calculations. The intensities of the peaks are enhanced at different excitation energies through resonance with different optical transitions. The A1g mode is enhanced at 1.58 and 3.82 eV, which are near the A exciton energy and the band-to-band transition between higher energy bands, respectively. The E2g1 mode is strongly enhanced with respect to the A1g mode for the 2.71- and 2.81-eV excitations, which are close to the C exciton energy. The different enhancements of the A1g and E2g1 modes are explained in terms of the symmetries of the exciton states and the exciton-phonon coupling. Other smaller peaks including E1g and A2u2 are forbidden but appear due to the resonance effect near optical transition energies. PMID:26601614

  16. In vitro hydrolytic digestion, glycemic response in dogs, and true metabolizable energy content of soluble corn fibers.

    PubMed

    de Godoy, M R C; Knapp, B K; Parsons, C M; Swanson, K S; Fahey, George C

    2014-06-01

    The objective of this research was to measure in vitro hydrolytic digestion, glycemic and insulinemic responses in dogs, and true ME (TMEn) content of select soluble corn fibers (SCF) in roosters. The first generation (G1) SCF included hydrochloric acid-treated corn syrup (G1-CS-HCl), an SCF with an increased total dietary fiber (TDF) content (G1-SCF-HCl), an SCF that was spray-dried (G1-SCF-SD), and a hydrogenated SCF (G1-SCF-hydrog). The second generation (G2) SCF included those prepared using phosphoric acid catalyzation in both a liquid [G2-SCF-phos (Lq)] and powder [G2-SCF-phos (Pw)] form, and SCF that were prepared using hydrochloric acid catalyzation in both a liquid [G2-SCF-HCl (Lq)] and powder [G2-SCF-HCl (Pw)] form. Also, in the G2 set of samples were SCF prepared using the same method, but in 3 separate batches, all of which contained 70% TDF and 15% sugars. Two were in liquid form [G2-SCF-phos+HCl (Lq1)] and [G2-SCF-phos+HCl (Lq2)], and one in powder form ([G2-SCF-phos+HCl (Pw)]. A lower sugar form (80% TDF and 5% sugar) of SCF was also evaluated (G2-SCF-low sugar). Glucose was the major free sugar and bound monosaccharide in all SCF except for G1-SCF-hydrog that had greater concentrations of sorbitol. All SCF had intermediate to low amounts of monosaccharides released as a result of in vitro hydrolytic digestion, with glucose being the primary sugar component released. The G1-SCF were more digestible in vitro (approximately 50%) compared to G2-SCF (approximately 32%). All SCF had attenuated glycemic responses in adult dogs compared to a maltodextrin control (P < 0.05). The G2-SCF, on average, had lower glycemic responses and TMEn values in roosters than G1-SCF. All SCF had low free sugar concentrations with varying degrees of resistance to digestion, reduced caloric content, and attenuated glycemic and insulinemic responses in adult dogs. These ingredients are potential candidates for inclusion in reduced calorie and low glycemic canine diets.

  17. Structural and thermodynamic insight into E. coli UvrABC mediated incision of cluster di-acetylaminofluorene adducts on the NarI sequence

    PubMed Central

    Jain, Vipin; Hilton, Benjamin; Lin, Bin; Jain, Anshu; MacKerell, Alexander D.; Zou, Yue; Cho, Bongsup P.

    2014-01-01

    Cluster DNA damage refers to two or more lesions in a single turn of the DNA helix. Such clustering may occur with bulky DNA lesions, which may be responsible for their sequence dependent repair and mutational outcomes. Here we prepared three 16-mer cluster duplexes in which two fluoroacetylaminofluorene adducts (dG-FAAF) are separated by none, one and two nucleotides in the E. coli NarI mutational hot spot (5'-CTCTCG1G2CG3CCATCAC-3'): i.e. 5'-- CG1*G2*CG3CC--3', 5'--CG1G2*CG3*CC--3', and 5'--CG1*G2CG3*CC--3' [G*=dG-FAAF], respectively. We conducted spectroscopic, thermodynamic, and molecular dynamics studies of these di-FAAF duplexes and the results were compared with those of the corresponding mono- FAAF adducts in the same NarI sequence (Nucleic Acids Res. 2012, 3939–3951). Our nucleotide excision repair results showed greater reparability of the di-adducts in comparison to the corresponding mono-adducts. Moreover, we observed dramatic flanking base sequence effects on their repair efficiency in the order of NarI-G2G3 > -G1G3 > -G1G2. The NMR/CD/UV-melting and MD-simulation results revealed that in contrast to the mono-adducts, di-adducts produced synergistic effect on duplex destabilization. In addition, dG-FAAF at G2G3 and G1G3 destack the neighboring bases with greater destabilization occurring with the former. Overall, the results indicate the importance of base stacking and related thermal/thermodynamic destabilization in the repair of bulky cluster arylamine DNA adducts. PMID:23841451

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sheng, Y; Ge, Y; Yuan, L

    Purpose: To investigate the impact of outliers on knowledge modeling in radiation therapy, and develop a systematic workflow for identifying and analyzing geometric and dosimetric outliers using pelvic cases. Methods: Four groups (G1-G4) of pelvic plans were included: G1 (37 prostate cases), G2 (37 prostate plus lymph node cases), and G3 (37 prostate bed cases) are all clinical IMRT cases. G4 are 10 plans outside G1 re-planned with dynamic-arc to simulate dosimetric outliers. The workflow involves 2 steps: 1. identify geometric outliers, assess impact and clean up; 2. identify dosimetric outliers, assess impact and clean up.1. A baseline model wasmore » trained with all G1 cases. G2/G3 cases were then individually added to the baseline model as geometric outliers. The impact on the model was assessed by comparing leverage statistic of inliers (G1) and outliers (G2/G3). Receiver-operating-characteristics (ROC) analysis was performed to determine optimal threshold. 2. A separate baseline model was trained with 32 G1 cases. Each G4 case (dosimetric outliers) was then progressively added to perturb this model. DVH predictions were performed using these perturbed models for remaining 5 G1 cases. Normal tissue complication probability (NTCP) calculated from predicted DVH were used to evaluate dosimetric outliers’ impact. Results: The leverage of inliers and outliers was significantly different. The Area-Under-Curve (AUC) for differentiating G2 from G1 was 0.94 (threshold: 0.22) for bladder; and 0.80 (threshold: 0.10) for rectum. For differentiating G3 from G1, the AUC (threshold) was 0.68 (0.09) for bladder, 0.76 (0.08) for rectum. Significant increase in NTCP started from models with 4 dosimetric outliers for bladder (p<0.05), and with only 1 dosimetric outlier for rectum (p<0.05). Conclusion: We established a systematic workflow for identifying and analyzing geometric and dosimetric outliers, and investigated statistical metrics for detecting. Results validated the necessity for outlier detection and clean-up to enhance model quality in clinical practice. Research Grant: Varian master research grant.« less

  19. Sub-lethal exposure of cockroaches to boric acid pesticide contributes to increased Bla g 2 excretion.

    PubMed

    Zhang, Y C; Perzanowski, M S; Chew, G L

    2005-07-01

    Several epidemiology studies have found an increase in the major cockroach allergen Bla g 2 with reported pesticide use. Our aim was to investigate the effect on the excretion of Bla g 1 and Bla g 2 allergens by cockroaches exposed to sub-lethal doses of the pesticides, boric acid and hydramethylnon gel. German cockroaches in separate colonies were fed either boric acid or hydramethylnon gel at concentrations of 0.2, 0.1 and 0.01% in their water supply over a 2 week period. Ten colonies were exposed to each treatment concentration. Bla g 1 and Bla g 2 in fecal pellets were measured by ELISA. Cockroaches exposed to boric acid excreted fecal pellets with significantly higher concentrations of Bla g 2 (35,400 U/g) than did controls (12,700 U/g) (P = 0.001). Bla g 1 concentrations were not significantly different. There was no difference in either Bla g 1 or Bla g 2 concentrations between cockroaches that ingested hydramethylnon gel and those in the controls colonies. The application of boric acid, a common pesticide, appears to paradoxically increase the production of Bla g 2, a major allergen, by the surviving cockroaches. This may have important implications in avoidance strategies.

  20. Vibrational Relaxation of Ground-State Oxygen Molecules With Atomic Oxygen and Carbon Dioxide

    NASA Astrophysics Data System (ADS)

    Saran, D. V.; Pejakovic, D. A.; Copeland, R. A.

    2008-12-01

    Vertical water vapor profiles are key to understanding the composition and energy budget in the mesosphere and lower thermosphere (MLT). The SABER instrument onboard NASA's TIMED satellite measures such profiles by detecting H2O(ν2) emission in the 6.8 μm region. Collisional deactivation of vibrationally excited O2, O2(X3Σ-g, υ = 1) + H2O ↔ O2(X3Σ-g, υ = 0) + H2O(ν2), is an important source of H2O(ν2). A recent study has identified two other processes involving excited O2 that control H2O(ν2) population in the MLT: (1) the vibrational-translational (V-T) relaxation of O2(X3Σ-g, υ = 1) level by atomic oxygen and (2) the V-V exchange between CO2 and excited O2 molecules [1]. Over the past few years SRI researchers have measured the atomic oxygen removal process mentioned above at room temperature [2] and 240 K [3]. These measurements have been incorporated into the models for H2O(ν2) emission [1]. Here we report laboratory studies of the collisional removal of O2(X3Σ-g, υ = 1) by O(3P) at room temperature and below, reaching temperatures relevant to mesopause and polar summer MLT (~150 K). Instead of directly detecting the O2(X3Σ-g, υ = 1) population, a technically simpler approach is used in which the υ = 1 level of the O2(a1Δg) state is monitored. A two-laser method is employed, in which the pulsed output of the first laser near 285 nm photodissociates ozone to produce atomic oxygen and O2(a1Δg, υ = 1), and the pulsed output of the second laser detects O2(a1Δg, υ = 1) via resonance-enhanced multiphoton ionization. With ground-state O2 present, owing to the rapid equilibration of the O2(X3Σ-g, υ = 1) and O2(a1Δg, υ = 1) populations via the processes O2(a1Δg, υ = 1) + O2(X3Σ-g, υ = 0) ↔ O2(a1Δg, υ = 0) + O2(X3Σ-g, υ = 1), the information on the O2(X3Σ-g, υ = 1) kinetics is extracted from the O2(a1Δg, υ = 1) temporal evolution. In addition, measurements of the removal of O2(X3Σ-g, υ = 1) by CO2 at room temperature will also be presented. This work is supported by the Johns Hopkins University, Applied Physics Laboratory, under grant 939991 (under NASA grant NAG5-13002). [1] Feofilov, A., Kutepov, A. A., Garcí­a-Comas, M., López-Puertas, M., Marshall, B. T., Gordley, L. L., Manuilova, R. O., Yankovsky, V. A., Pesnell, W. D., Goldberg, R. A., Petelina, S. V., and Russell III., J. M. 'SABER/TIMED Observations of Water Vapor in the Mesosphere: Retrieval Methodology and First Results'. Submitted to J. of Atmos. and Terrest. Phys., (2008). [2] Kalogerakis, K. S., Copeland, R. A., and Slanger, T. G., J. of Chem. Phys., 123, 194303, (2005). [3] Pejakovic, D. A., Campbell, Z., Kalogerakis, K. S., Copeland, R. A., and Slanger, T. G., Eos. Trans. AGU 85(47), Fall Meet. Suppl., Abstract SA41A-1032, (2004).

  1. Evolution of the stellar mass function in multiple-population globular clusters

    NASA Astrophysics Data System (ADS)

    Vesperini, Enrico; Hong, Jongsuk; Webb, Jeremy J.; D'Antona, Franca; D'Ercole, Annibale

    2018-05-01

    We present the results of a survey of N-body simulations aimed at studying the effects of the long-term dynamical evolution on the stellar mass function (MF) of multiple stellar populations in globular clusters. Our simulations show that if first-(1G) and second-generation (2G) stars have the same initial MF (IMF), the global MFs of the two populations are affected similarly by dynamical evolution and no significant differences between the 1G and 2G MFs arise during the cluster's evolution. If the two populations have different IMFs, dynamical effects do not completely erase memory of the initial differences. Should observations find differences between the global 1G and 2G MFs, these would reveal the fingerprints of differences in their IMFs. Irrespective of whether the 1G and 2G populations have the same global IMF or not, dynamical effects can produce differences between the local (measured at various distances from the cluster centre) 1G and 2G MFs; these differences are a manifestation of the process of mass segregation in populations with different initial structural properties. In dynamically old and spatially mixed clusters, however, differences between the local 1G and 2G MFs can reveal differences between the 1G and 2G global MFs. In general, for clusters with any dynamical age, large differences between the local 1G and 2G MFs are more likely to be associated with differences in the global MF. Our study also reveals a dependence of the spatial mixing rate on the stellar mass, another dynamical consequence of the multiscale nature of multiple-population clusters.

  2. Privatization of Army Lodging

    DTIC Science & Technology

    2008-03-25

    primary point person for this initiative is ASA for Installations and Environment (ASA- I& E ). 9 * There are 11 major commands, only 1 shown on...FM&C) DCS G-8 DCS G-8 ASA (I& E ) ASA (I& E ) ASA (M&RA) ASA (M&RA) DCS G-1 DCS G-1 CIO/ G-6 CIO/ G-6 DCS G-2 DCS G-2 DCS G-3 DCS G-3 DASDAS ACSIM/ IMCOM...Army Ch of Staff Army Figure 1 – Army Stakeholders in Policy Process18 The Office of the ASA-I& E has responsibility for policy development

  3. Long-range magnetic order in the Heisenberg pyrochlore antiferromagnets G d2G e2O7 and G d2P t2O7 synthesized under high pressure

    NASA Astrophysics Data System (ADS)

    Li, X.; Cai, Y. Q.; Cui, Q.; Lin, C. J.; Dun, Z. L.; Matsubayashi, K.; Uwatoko, Y.; Sato, Y.; Kawae, T.; Lv, S. J.; Jin, C. Q.; Zhou, J.-S.; Goodenough, J. B.; Zhou, H. D.; Cheng, J.-G.

    2016-12-01

    G d2S n2O7 and G d2T i2O7 have been regarded as good experimental realizations of the classical Heisenberg pyrochlore antiferromagnet with dipolar interaction. The former was found to adopt the Palmer-Chalker state via a single, first-order transition at TN≈1 K , while the latter enters a distinct, partially ordered state through two successive transitions at TN 1≈1 K and TN 2= 0.75 K . To shed more light on their distinct magnetic ground states, we have synthesized two more gadolinium-based pyrochlore oxides, G d2G e2O7 and G d2P t2O7 , under high-pressure conditions and performed detailed characterizations via x-ray powder diffraction, dc and ac magnetic susceptibility, and specific heat measurements down to 100 mK. We found that both compounds enter a long-range antiferromagnetically ordered state through a single, first-order transition at TN= 1.4 K for G d2G e2O7 and TN= 1.56 K for G d2P t2O7 , with the specific heat anomaly similar to that of G d2S n2O7 rather than G d2T i2O7 . Interestingly, the low-temperature magnetic specific heat values of both G d2G e2O7 and G d2P t2O7 were found to follow nicely the T3 dependence as expected for a three-dimensional antiferromagnet with gapless spin-wave excitations. We have rationalized the enhancement of TN in terms of the reduced Gd-Gd distances for the chemically pressurized G d2G e2O7 and the addition of extra superexchange pathways through the empty Pt -eg orbitals for G d2P t2O7 . Our current study has expanded the family of gadolinium-based pyrochlores and permits us to achieve a better understanding of their distinct magnetic properties in a more comprehensive perspective.

  4. [Correlation between IgG subtypes and hematological diseases].

    PubMed

    Shao, Yuan-Yuan; Shao, Zong-Hong

    2015-02-01

    IgG is the main immunoglobulin, brings the immunolgic effects in body. The human IgG can be divided into four kinds; IgG1, IgG2, IgG3, IgG4, respectively. The structures of IgG1, IgG2, IgG3, IgG4 are different, therefore, their functions are also different. The defects, increase or imbalance of the IgG subtypes in autoimmune diseases, infectious diseases, cancer and other diseases are indicators of the immune response. IgG1, IgG2, IgG3 and IgG4 also play a different important roles in the disease progress. The analysis of IgG subtypes is beneficial to study the etiology, pathogenesis and prognosis of above menthioned deseases. This review briefly summarizes the characteristics of IgG subtypes in thrombotic thrombocytopenic purpura, autoimmune hemolytic anemia, hemophilia, lymphoma and leukemia.

  5. Nasobiliary drainage after endoscopic papillary balloon dilatation may prevent postoperative pancreatitis

    PubMed Central

    Xu, Xiao-Dan; Dai, Jian-Jun; Qian, Jian-Qing; Wang, Wei-Jun

    2015-01-01

    AIM: To evaluate the necessity of endoscopic nasobiliary drainage (ENBD) catheter placement after clearance of common bile duct (CBD) stones. METHODS: Patients enrolled in this study were randomly divided into two groups, according to whether or not they received ENBD after the removal of CBD stones. Group 1 (ENBD group) was then subdivided into three groups: G1a patients received an endoscopic papillary balloon dilatation (EPBD), G1b patients received an endoscopic sphincterotomy (EST), and G1c patients received neither. Group 2 (non-ENBD group) patients were also subdivided into three groups (G2a, G2b, and G2c), similar to Group 1. The maximum CBD diameter, the time for C-reactive protein (CRP) to normalize, levels of serum amylase, total serum bilirubin (TB) and alanine aminotransferase (ALT), and postoperative hospitalization duration (PHD) were measured. RESULTS: A total of 218 patients (139 males, 79 females), with an average age of 60.1 ± 10.8 years, were enrolled in this study. One hundred and thirteen patients who received ENBD were included in Group 1, and 105 patients who did not receive ENBD were included in Group 2. The baseline clinical characteristics were similar in both groups. There were no significant differences in post-endoscopic retrograde cholangiopancreatography (ERCP)-related complications when Groups 1 and 2 were compared. Seventy-seven patients underwent EPBD, and 41 received an ENBD tube (G1a) and 36 did not (G2a). Seventy-three patients underwent EST, and 34 patients received an ENBD tube (G1b) and 39 did not (G2b). The remaining 68 patients underwent neither EPBD nor EST; of these patients, 38 received an ENBD tube (G1c) and 30 did not (G2c). For each of the three pairs of subgroups (G1a vs G2a, G1b vs G2b, G1c vs G2c), there were no significant differences detected in the PHD or the time to normalization of CRP, TB and ALT. In the EPBD group, the incidence of post-ERCP pancreatitis, hyperamylasemia and overall patient complications was significantly higher for G2a (post-ERCP pancreatitis: 6/36 vs 0/41, P = 0.0217; hyperamylasemia: 11/36 vs 4/41, P = 0.0215; overall patient complications: 18/36 vs 7/41, P = 0.0029). CONCLUSION: After successful CBD stone clearance, ENBD is only beneficial when an EPBD procedure has been performed. PMID:25741153

  6. Few-layered Ni(OH)2 nanosheets for high-performance supercapacitors

    NASA Astrophysics Data System (ADS)

    Sun, Wenping; Rui, Xianhong; Ulaganathan, Mani; Madhavi, Srinivasan; Yan, Qingyu

    2015-11-01

    Few-layered Ni(OH)2 nanosheets (4-5 nm in thickness) are synthesized towards high-performance supercapacitors. The ultrathin Ni(OH)2 nanosheets show high specific capacitance and good rate capability in both three-electrode and asymmetric devices. In the three-electrode device, the Ni(OH)2 nanosheets deliver a high capacitance of 2064 F g-1 at 2 A g-1, and the capacitance still has a retention of 1837 F g-1 at a high current density of 20 A g-1. Such excellent performance is by far one of the best for Ni(OH)2 electrodes. In the two-electrode asymmetric device, the specific capacitance is 248 F g-1 at 1 A g-1, and reaches 113 F g-1 at 20 A g-1. The capacitance of the asymmetric device maintains to be 166 F g-1 during the 4000th cycle at 2 A g-1, suggesting good cycling stability of the device. Besides, the asymmetric device exhibits gravimetric energy density of 22 Wh kg-1 at a power density of 0.8 kW kg-1. The present results demonstrate that the ultrathin Ni(OH)2 nanosheets are highly attractive electrode materials for achieving fast charging/discharging and high-capacity supercapacitors.

  7. The G protein Gi1 exhibits basal coupling but not preassembly with G protein-coupled receptors.

    PubMed

    Bondar, Alexey; Lazar, Josef

    2017-06-09

    The G i/o protein family transduces signals from a diverse group of G protein-coupled receptors (GPCRs). The observed specificity of G i/o -GPCR coupling and the high rate of G i/o signal transduction have been hypothesized to be enabled by the existence of stable associates between G i/o proteins and their cognate GPCRs in the inactive state (G i/o -GPCR preassembly). To test this hypothesis, we applied the recently developed technique of two-photon polarization microscopy (2PPM) to Gα i1 subunits labeled with fluorescent proteins and four GPCRs: the α 2A -adrenergic receptor, GABA B , cannabinoid receptor type 1 (CB 1 R), and dopamine receptor type 2. Our experiments with non-dissociating mutants of fluorescently labeled Gα i1 subunits (exhibiting impaired dissociation from activated GPCRs) showed that 2PPM is capable of detecting GPCR-G protein interactions. 2PPM experiments with non-mutated fluorescently labeled Gα i1 subunits and α 2A -adrenergic receptor, GABA B , or dopamine receptor type 2 receptors did not reveal any interaction between the G i1 protein and the non-stimulated GPCRs. In contrast, non-stimulated CB 1 R exhibited an interaction with the G i1 protein. Further experiments revealed that this interaction is caused solely by CB 1 R basal activity; no preassembly between CB 1 R and the G i1 protein could be observed. Our results demonstrate that four diverse GPCRs do not preassemble with non-active G i1 However, we also show that basal GPCR activity allows interactions between non-stimulated GPCRs and G i1 (basal coupling). These findings suggest that G i1 interacts only with active GPCRs and that the well known high speed of GPCR signal transduction does not require preassembly between G proteins and GPCRs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Frequency Response Evaluation of Multiple Accelerometers Using a Modal Data Acquisition System

    DTIC Science & Technology

    1988-01-01

    Computedi PCB @80 HZ 49mv/g 1@500 HZ 9.3mv/g lImp-sine Ifrom Imp-sine SN (2)V/g figureIV/g figure jV/g l(V/ gpk )xl.414(2)1 857 1 1.17 42 1 1.17 3 1.20 1.20...per g rms, V/ gpk = volts rms per g peak. 15 II Laboratory Transfer Function Procedures - 1. Setup and Power up equipment. a. Setup equipment per

  9. Crop yield and light/energy efficiency in a closed ecological system: Laboratory Biosphere experiments with wheat and sweet potato.

    PubMed

    Nelson, M; Dempster, W F; Silverstone, S; Alling, A; Allen, J P; van Thillo, M

    2005-01-01

    Two crop growth experiments in the soil-based closed ecological facility, Laboratory Biosphere, were conducted from 2003 to 2004 with candidate space life support crops. Apogee wheat (Utah State University variety) was grown, planted at two densities, 400 and 800 seeds m-2. The lighting regime for the wheat crop was 16 h of light-8 h dark at a total light intensity of around 840 micromoles m-2 s-1 and 48.4 mol m-2 d-1 over 84 days. Average biomass was 1395 g m-2, 16.0 g m-2 d-1 and average seed production was 689 g m-2 and 7.9 g m-2 d-1. The less densely planted side was more productive than the denser planting, with 1634 g m-2 and 18.8 g m-2 d-1 of biomass vs. 1156 g m-2 and 13.3 g m-2 d-1; and a seed harvest of 812.3 g m-2 and 9.3 g m-2 d-1 vs. 566.5 g m-2 and 6.5 g m-2 d-1. Harvest index was 0.49 for the wheat crop. The experiment with sweet potato used TU-82-155 a compact variety developed at Tuskegee University. Light during the sweet potato experiment, on a 18 h on/6 h dark cycle, totaled 5568 total moles of light per square meter in 126 days for the sweet potatoes, or an average of 44.2 mol m-2 d-1. Temperature regime was 28 +/- 3 degrees C day/22 +/- 4 degrees C night. Sweet potato tuber yield was 39.7 kg wet weight, or an average of 7.4 kg m-2, and 7.7 kg dry weight of tubers since dry weight was about 18.6% wet weight. Average per day production was 58.7 g m-2 d-1 wet weight and 11.3 g m-2 d-1. For the wheat, average light efficiency was 0.34 g biomass per mole, and 0.17 g seed per mole. The best area of wheat had an efficiency of light utilization of 0.51 g biomass per mole and 0.22 g seed per mole. For the sweet potato crop, light efficiency per tuber wet weight was 1.33 g mol-1 and 0.34 g dry weight of tuber per mole of light. The best area of tuber production had 1.77 g mol-1 wet weight and 0.34 g mol-1 of light dry weight. The Laboratory Biosphere experiment's light efficiency was somewhat higher than the USU field results but somewhat below greenhouse trials at comparable light levels, and the best portion of the crop at 0.22 g mol-1 was in-between those values. Sweet potato production was overall close to 50% higher than trials using hydroponic methods with TU-82-155 at NASA JSC. Compared to projected yields for the Mars on Earth life support system, these wheat yields were about 15% higher, and the sweet potato yields averaged over 80% higher. c2005 Published by Elsevier Ltd on behalf of COSPAR.

  10. The effect of α2-δ and other accessory subunits on expression and properties of the calcium channel α1G

    PubMed Central

    Dolphin, A C; Wyatt, C N; Richards, J; Beattie, R E; Craig, P; Lee, J-H; Cribbs, L L; Volsen, S G; Perez-Reyes, E

    1999-01-01

    The effect has been examined of the accessory α2-δ and β subunits on the properties of α1G currents expressed in monkey COS-7 cells and Xenopus oocytes. In immunocytochemical experiments, the co-expression of α2-δ increased plasma membrane localization of expressed α1G and conversely, the heterologous expression of α1G increased immunostaining for endogenous α2-δ, suggesting an interaction between the two subunits. Heterologous expression of α2-δ together with α1G in COS-7 cells increased the amplitude of expressed α1G currents by about 2-fold. This finding was confirmed in the Xenopus oocyte expression system. The truncated δ construct did not increase α1G current amplitude, or increase its plasma membrane expression. This indicates that it is the exofacial α2 domain that is involved in the enhancement by α2-δ. β1b also produced an increase of functional expression of α1G, either in the absence or the presence of heterologously expressed α2-δ, whereas the other β subunits had much smaller effects. None of the accessory subunits had any marked influence on the voltage dependence or kinetics of the expressed α1G currents. These results therefore suggest that α2-δ and β1b interact with α1G to increase trafficking of, or stabilize, functional α1G channels expressed at the plasma membrane. PMID:10432337

  11. FoxG1 and TLE2 act cooperatively to regulate ventral telencephalon formation.

    PubMed

    Roth, Martin; Bonev, Boyan; Lindsay, Jennefer; Lea, Robert; Panagiotaki, Niki; Houart, Corinne; Papalopulu, Nancy

    2010-05-01

    FoxG1 is a conserved transcriptional repressor that plays a key role in the specification, proliferation and differentiation of the telencephalon, and is expressed from the earliest stages of telencephalic development through to the adult. How the interaction with co-factors might influence the multiplicity and diversity of FoxG1 function is not known. Here, we show that interaction of FoxG1 with TLE2, a Xenopus tropicalis co-repressor of the Groucho/TLE family, is crucial for regulating the early activity of FoxG1. We show that TLE2 is co-expressed with FoxG1 in the ventral telencephalon from the early neural plate stage and functionally cooperates with FoxG1 in an ectopic neurogenesis assay. FoxG1 has two potential TLE binding sites: an N-terminal eh1 motif and a C-terminal YWPMSPF motif. Although direct binding seems to be mediated by the N-terminal motif, both motifs appear important for functional synergism. In the neurogenesis assay, mutation of either motif abolishes functional cooperation of TLE2 with FoxG1, whereas in the forebrain deletion of both motifs renders FoxG1 unable to induce the ventral telencephalic marker Nkx2.1. Knocking down either FoxG1 or TLE2 disrupts the development of the ventral telencephalon, supporting the idea that endogenous TLE2 and FoxG1 work together to specify the ventral telencephalon.

  12. FoxG1 and TLE2 act cooperatively to regulate ventral telencephalon formation

    PubMed Central

    Roth, Martin; Bonev, Boyan; Lindsay, Jennefer; Lea, Robert; Panagiotaki, Niki; Houart, Corinne; Papalopulu, Nancy

    2010-01-01

    FoxG1 is a conserved transcriptional repressor that plays a key role in the specification, proliferation and differentiation of the telencephalon, and is expressed from the earliest stages of telencephalic development through to the adult. How the interaction with co-factors might influence the multiplicity and diversity of FoxG1 function is not known. Here, we show that interaction of FoxG1 with TLE2, a Xenopus tropicalis co-repressor of the Groucho/TLE family, is crucial for regulating the early activity of FoxG1. We show that TLE2 is co-expressed with FoxG1 in the ventral telencephalon from the early neural plate stage and functionally cooperates with FoxG1 in an ectopic neurogenesis assay. FoxG1 has two potential TLE binding sites: an N-terminal eh1 motif and a C-terminal YWPMSPF motif. Although direct binding seems to be mediated by the N-terminal motif, both motifs appear important for functional synergism. In the neurogenesis assay, mutation of either motif abolishes functional cooperation of TLE2 with FoxG1, whereas in the forebrain deletion of both motifs renders FoxG1 unable to induce the ventral telencephalic marker Nkx2.1. Knocking down either FoxG1 or TLE2 disrupts the development of the ventral telencephalon, supporting the idea that endogenous TLE2 and FoxG1 work together to specify the ventral telencephalon. PMID:20356955

  13. The plasminogen activator inhibitor-1 (PAI-1) gene -844 A/G and -675 4G/5G promoter polymorphism significantly influences plasma PAI-1 levels in women with polycystic ovary syndrome.

    PubMed

    Lin, Sun; Huiya, Zhang; Bo, Liu; Wei, Wei; Yongmei, Guan

    2009-12-01

    Mutations in the plasminogen activator inhibitor-1 (PAI-1) gene, along with increased PAI-1 levels, have been implicated in the pathogenesis of polycystic ovarian syndrome (PCOS). We investigated a possible influence of the promoter polymorphism (-844 A/G and -675 4G/5G) in the PAI-1 gene on plasma PAI-1 levels in 126 PCOS patients and 97 healthy controls. Levels of total testosterone, luteinizing hormone (LH), follicle stimulating hormone (FSH), fasting plasma glucose (FPG), fasting insulin, and PAI-1 were measured, and body mass index (BMI), waist-to-hip ratio (WHR), LH/FSH ratio, and homeostasis model assessment for insulin resistance (HOMA-IR) were calculated. PAI-1 -675 4G/5G and -844 A/G gene polymorphisms were also performed. Total testosterone, fasting insulin, and PAI-1 levels; BMI, LH/FSH, and HOMA-IR were significantly higher in PCOS patients than controls (P < 0.05). The odds ratio of 4G/4G genotype, 4G allele, and the combination genotype of 4G/4G and -844 A/A were 2.49 (95% confidence interval (CI), 1.4-4.44), 2.1 (95% CI, 1.43-3.08), and 2.9 (95% CI, 1.41-5.98), respectively, (P < 0.001). In the PCOS group, the PAI-1 level of the A/A was significantly higher than that of the A/G or G/G genotype, similarly was 4G/4G genotype compared with 4G/5G or 5G/5G genotype. The plasma PAI-1 levels of the combination of the PAI-1 -844 A/A and -675 4G/4G or 4G/5G genotypes, or the coadunation of 4G/4G and -844 non-G/G (A/A + A/G) genotypes were significantly high in PCOS women compared with controls. A trend to a positive interaction between PAI-1 -675 4G/5G and -844 A/G gene polymorphism may elevate plasma PAI-1 levels and hypofibrinolysis, which is probably an important hereditary risk factor in PCOS.

  14. Cowpeas and pinto beans: yields and light efficiency of candidate space crops in the Laboratory Biosphere closed ecological system

    NASA Astrophysics Data System (ADS)

    Nelson, M.; Dempster, W. F.; Silverstone, S.; Alling, A.; Allen, J. P.; van Thillo, M.

    An experiment utilizing cowpeas Vigna unguiculata pinto beans Phaseolus vulgaris L and Apogee ultra-dwarf wheat was conducted in the soil-based closed ecological facility Laboratory Biosphere from February to May 2005 The lighting regime was 13 hours light 11 hours dark at a light intensity of 960 mu mol m -2 s -1 45 moles m -2 day -1 supplied by high-pressure sodium lamps The pinto beans and cowpeas were grown at two different plant densities The pinto bean produced 710 g m -2 total aboveground biomass and 341 g m -2 at 33 5 plants per m 2 and at 37 5 plants per m 2 produced 1092 g m -2 total biomass and 537 g m -2 of dry seed an increase of almost 50 Cowpeas at 28 plants m -2 yielded 1060 g m -2 of total biomass and 387 g seed m -2 outproducing the less dense planting by more than double 209 in biomass and 86 more seed as the planting of 21 plants m -2 produced 508 g m-2 of total biomass and 209 g m-2 of seed Edible yield rate EYR for the denser cowpea bean was 4 6 g m -2 day -1 vs 2 5 g m -2 day -1 for the less dense stand average yield was 3 5 g m -2 day -1 EYR for the denser pinto bean was 8 5 g m -2 day -1 vs 5 3 g m -2 day -1 average EYR for the pinto beans was 7 0 g m -2 day -1 Yield efficiency rate YER the ratio of edible to non-edible biomass was 0 97 for the dense pinto bean 0 92 for the less dense pinto bean and average 0 94 for the entire crop The cowpeas

  15. In Spite of It All

    ERIC Educational Resources Information Center

    Sanchez, Ricardo

    1978-01-01

    The history of the Chicano and/or Mexicano undocumented worker is one and the same. More than a century of being raped, ravaged, pillaged, and genocidally victimized people has not broken us--we continue surviving in spite and against all odds. (Author/NQ)

  16. Prenatal centrifugation: A model for fetal programming of adult weight?

    NASA Astrophysics Data System (ADS)

    Baer, Lisa A.; Rushing, Linda; Wade, Charles E.; Ronca, April E.

    2005-08-01

    'Fetal programming' is a newly emerging field that is revealing astounding insights into the prenatal origins of adult disease, including metabolic, endocrine, and cardiovascular pathophysiology. In the present study, we tested the hypothesis that rat pups conceived, gestated and born at 2-g have significantly reduced birth weights and increased adult body weights as compared to 1-g controls. Offspring were produced by mating young adult male and female rats that were adapted to 2-g centrifugation. Female rats underwent conception, pregnancy and birth at 2-g. Newborn pups in the 2-g condition were removed from the centrifuge and fostered to non-manipulated, newly parturient dams maintained at 1-g. Comparisons were made with 1-g stationary controls, also cross- fostered at birth. As compared to 1-g controls, birth weights of pups gestated and born at 2-g were significantly reduced. Pup body weights were significantly reduced until Postnatal day (P)12. Beginning on P63, body weights of 2-g-gestated offspring exceeded those of 1-g controls by 7-10%. Thus, prenatal rearing at 2-g restricts neonatal growth and increases adult body weight. Collectively, these data support the hypothesis that 2-g centrifugation alters the intrauterine milieu, thereby inducing persistent changes in adult phenotype.

  17. [Distribution of rubidium, cesium, beryllium, strontium, and barium in blood and urine in general Chinese population].

    PubMed

    Ding, Chunguang; Pan, Yajuan; Zhang, Aihua; Zhu, Chun; Liu, Deye; Xu, Guang; Zheng, Yuxin; Yan, Huifang

    2015-12-01

    To investigate the distribution of rubidium (Rb), cesium (Cs), beryllium (Be), strontium (Sr), and barium (Ba) in blood and urine in general Chinese population. A total of 18 120 subjects aged 6~60 years were enrolled from 24 regions in 8 provinces in Eastern, Central, and Western China from 2009 to 2010 based on the method of cluster random sampling. Questionnaire survey was conducted to collect the data on living environment and health status. Blood and urine samples were collected from these subjects, and the levels of Rb, Cs, Be, Sr, and Ba in these samples were determined by inductively coupled plasma mass spectrometry. The distribution of these elements in blood and urine in male or female subjects living in different regions was analyzed statistically. In the general Chinese population, the concentration of Be in the whole blood was below the detection limit (0.06 μg/L); the geometric mean (GM) of Ba in the whole blood was below the detection limit (0.45 μg/L), with the 95th percentile (P95)of 1.37 μg/L; the GMs (95% CI)of Rb, Cs, and Sr in the whole blood were 2 374(2 357~2 392) μg/L, 2.01 (1.98~2.05) μg/L, and 23.5 (23.3~23.7) μg/L, respectively; in males and females, the GMs (95%CI)of blood Rb, Cs, and Sr were 2 506 (2 478~2 533) μg/L and 2 248 (2 227~2 270) μg/L, 1.88 (1.83~1.94) μg/L and 2.16 (2.11~2.20) μg/L, and 23.4 (23.1~23.7) μg/L and 23.6 (23.3~23.9) μg/L, respectively(P<0.01, P>0.05, and P>0.05). In the general Chinese population, the GM of urine Be was below the detection limit (0.06 μg/L), while the GMs (95%CI)of urine Rb, Cs, Sr, and Ba were 854 (836~873) μg/L, 3.65 (3.56~3.74) μg/L, 39.5 (38.4~40.6) μg/L, and 1.10 (1.07~1.12) μg/L, respectively; in males and females, the GMs (95%CI)of urine Rb, Cs, Sr, and Ba were 876 (849~904) μg/L and 832 (807~858) μg/L, 3.83 (3.70~3.96) μg/L and 3.47 (3.35~3.60) μg/L, 42.5 (40.9~44.2) μg/L and 36.6 (35.1~38.0) μg/L, and 1.15 (1.12~1.19) μg/L and 1.04 (1.01~1.07) μg/L, respectively (all P< 0.01). Correlation analyses showed that there were weak correlations between blood Rb and urine Rb (r=0.197)and between blood Sr and urine Sr (r=0.180), but a good correlation between blood Cs and urine Cs (r=0.487). The levels of Rb, Cs, Be, Sr, and Ba in the general Chinese population are similar to those reported in other countries, and there is a significant difference in the concentration of each element among the populations living in different regions, as well as significant differences in blood Rb, urine Rb, urine Cs, urine Sr, and urine Ba between males and females.

  18. Effects of grand unification interactions on weak symmetry breaking in supergravity theories

    NASA Astrophysics Data System (ADS)

    Moxhay, Peter; Yamamoto, Katsuji

    Possible effects of grand unification interactions on SU(2) × U(1) breaking are investigated by explicitly considering a supersymmetric SU(5) model coupled to N = 1 supergravity. Some remarkable features concerning the effects of renormalization on the effective soft supersymmetry breaking terms of SU(5) in the GUT region MP - MG are clarified, which are relevant for determining the SU(3) × SU(2) × U(1) theory below MG. In particular, the (mass) 2 of the Higgs doublets, g Hm g2and g overlineHm g2, might become significantly small at M G (g H ⋍ g overlineH ≈ 0.1) through the effect of SU(5) couplings such as overlineHø EH . Then, gH can rather easily become negative below MG, so as to realize SU(2) × U(1) breaking naturally even for the "diet" top quark case ( mt ≈ 40 GeV). On the other hand, if g H ⋍ g overlineH ⋍ 1 at M G by neglecting the grand unification interactions, some careful tuning of μ32/ mg2 is required with an accuracy ⪅10 -2 to achieve SU(2) × U(1) breaking with "diet" top quark, though a mass term μ 32( overlineHH) may be present.

  19. United States Army in the Gulf War. Certain Victory,

    DTIC Science & Technology

    1993-01-01

    explosives ......................... 241 1st Armored Division’s destruction of the 26th Infantry ......... 242 British 1st Armoured Division, G+1, G+2...Norfolk ........................ 283 British 1st Armoured Division, G+2-G+3 .................... 286 VII Corps deep attack, G+2- G+3...120mm version of the Abrams tank. To bolster the coastal forces, Schwarzkopf attached the British 7th Armoured Brigade to the Marines, and for Desert

  20. [Excitation transfer between high-lying states in K2 in collisions with ground state K and H2 molecules].

    PubMed

    Shen, Xiao-Yan; Liu, Jing; Dai, Kang; Shen, Yi-Fan

    2010-02-01

    Pure potassium vapor or K-H2 mixture was irradiated in a glass fluorescence cell with pulses of 710 nm radiation from an OPO laser, populating K2 (1lambda(g)) state by two-photon absorption. Cross sections for 1lambda(g)-3lambda(g) transfer in K2 were determined using methods of molecular fluorescence. During the experiments with pure K vapor, the cell temperature was varied between 553 and 603 K. The K number density was determined spectroscopically by the white-light absorption measurement in the blue wing of the self-broadened resonance D2 line. The resulting fluorescence included a direct component emitted in the decay of the optically excitation and a sensitized component arising from the collisionally populated state. The decay signal of time-resolved fluorescence from1lambda(g) -->1 1sigma(u)+ transition was monitored. It was seen that just after the laser pulse the fluorescence of the photoexcited level decreased exponentially. The effective lifetimes of the 1lambda(g) state can be resolved. The plot of reciprocal of effective lifetimes of the 1lambda(g) state against K densities yielded the slope that indicated the total cross section for deactivation and the intercept that provided the radiative lifetime of the state. The radiative lifetime (20 +/- 2) ns was obtained. The cross section for deactivation of the K2(1lambda(g)) molecules by collisions with K is (2.5 +/- 0.3) x 10(-14) cm2. The time-resolved intensities of the K23lambda(g) --> 1 3sigma(u)+ (484 nm) line were measured. The radiative lifetime (16.0 +/- 3.2) ns and the total cross section (2.5 +/- 0.6) x 10(-14) cm2 for deactivation of the K2 (3lambda(g)) state can also be determined through the analogous procedure. The time-integrated intensities of 1lambda(g) --> 1 1sigma(u)+ and 3lambda(g) --> 1 3sigma(u)+ transitions were measured. The cross section (1.1 +/- 0.3) x10(-14) cm2 was obtained for K2 (1lambda(g))+ K --> K2 (3lambda(g)) + K collisions. During the experiments with K-H2 mixture, the cell temperature was kept constant at 553 K. The H2 pressure was varied between 40 and 400 Pa. The effects of K2-K collisions could not be neglected. These effects were subtracted out using the results of the pure K experiments. The cross section (2.7 +/- 1.1) x 10(-15) cm2 was obtained for K2 (1lambda(g)) + H2 --> K2 (3lambda(g))+H2 collisions. The cross section is (6.8 +/- 2.7) x 10(-15) cm2 for K2 (3lambda(g)) + H2 --> states out of K2 (3lambda(g)) + H2 collisions.

  1. Identification and determination of flavonoids, carotenoids and chlorophyll concentration in Cynodon dactylon (L.) by HPLC analysis.

    PubMed

    Muthukrishnan, Saradha Devi; Kaliyaperumal, Ashokkumar; Subramaniyan, Annapoorani

    2015-01-01

    Cynodon dactylon (L.) is a potent medicinal plant in the traditional and current Indian medicinal systems. The objective of this research was to find out the levels of flavonoids, carotenoids and chlorophyll b in C. dactylon leaves by high-performance liquid chromatography (HPLC) equipped with a diode array detector. HPLC analysis revealed that total carotenoid and total flavonoid concentration were 62 mg/100 g and 249.1 μg/g, respectively. The mean chlorophyll b was 85.1 mg/100 g in C. dactylon. Among the flavonoids, quercetin (164.7 μg/g) was the major flavonoid followed by kaempferol (48.2 μg/g), rutin (18.4 μg/g), catechin (12.1 μg/g) and myricetin (5.7 μg/g). Of the carotenoids, β-carotene (35.2 mg/100 g) was predominant followed by lutein (17.0 mg/100 g), violaxanthin (5.8 mg/100 g) and zeaxanthin (4.2 mg/100 g). Chlorophyll b concentration was 85.1 mg/100 g in C. dactylon. The results of this investigation should be useful information for further pharmacological studies.

  2. Effects of the addition of nanoparticulate calcium carbonate on setting time, dimensional change, compressive strength, solubility and pH of MTA.

    PubMed

    Bernardi, A; Bortoluzzi, E A; Felippe, W T; Felippe, M C S; Wan, W S; Teixeira, C S

    2017-01-01

    To evaluate nanoparticulate calcium carbonate (NPCC) using transmission electron microscopy and the effects of NPCC addition to MTA in regard to the setting time, dimensional change, compressive strength, solubility and pH. The experimental groups were G1 (MTA), G2 (MTA with 5% NPCC) and G3 (MTA with 10% NPCC). The tests followed ISO and ADA standards. The specimens in the dimensional change and compressive strength tests were measured immediately after setting, after 24 h and after 30 days. In the solubility test, rings filled with cement were weighed after setting and after 30 days. The pH was measured after 24 h and 30 days. The data were analysed with the ANOVA, Tukey's and Kruskal-Wallis tests (α = 5%). The setting time was reduced (P < 0.05) in samples from G2 and G3 compared to G1. After 24 h, the dimensional change was similar amongst the groups, and after 30 days, G2 was associated with less alteration than G1 and G3. There was a difference in the compressive strength (P < 0.001) after 24 h and 30 days (G1 > G2 > G3). The solubility test revealed a difference amongst the groups when the specimens were hydrated: G2 > G1 > G3 and dehydrated: G3 > G2 > G1. The pH of the groups was similar at 24 h with higher values in each group after 30 days (P < 0.05), and G2 and G3 had similar mean pH values but both were higher than G1. Nanoparticulate calcium carbonate had a cubic morphology with few impurities. The addition of nanoparticulate calcium carbonate to MTA accelerated the setting time, decreased compressive strength and, after 30 days, resulted in lower dimensional change (G2), higher solubility and a higher pH. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  3. Monoclonal antibodies and human sera directed to the secreted glycoprotein G of herpes simplex virus type 2 recognize type-specific antigenic determinants.

    PubMed

    Liljeqvist, Jan-Ake; Trybala, Edward; Hoebeke, Johan; Svennerholm, Bo; Bergström, Tomas

    2002-01-01

    Glycoprotein G-2 (gG-2) of herpes simplex virus type 2 (HSV-2) is cleaved to a secreted amino-terminal portion (sgG-2) and to a cell-associated carboxy-terminal portion which is further O-glycosylated to constitute the mature gG-2 (mgG-2). In contrast to mgG-2, which is known to elicit a type-specific antibody response in the human host, information on the immunogenic properties of sgG-2 is lacking. Here the sgG-2 protein was purified on a heparin column and used for production of monoclonal antibodies (mAbs). Four anti-sgG-2 mAbs were mapped using a Pepscan technique and identified linear epitopes which localized to the carboxy-terminal part of the protein. One additional anti-sgG-2 mAb, recognizing a non-linear epitope, was reactive to three discrete peptide stretches where the most carboxy-terminally located stretch was constituted by the amino acids (320)RRAL(323). Although sgG-2 is rapidly secreted into the cell-culture medium after infection, the anti-sgG-2 mAbs identified substantial amounts of sgG-2 in the cytoplasm of HSV-2-infected cells. All of the anti-sgG-2 mAbs were HSV-2 specific showing no cross-reactivity to HSV-1 antigen or to HSV-1-infected cells. Similarly, sera from 50 HSV-2 isolation positive patients were all reactive to sgG-2 in an enzyme immunoassay whilst no reactivity was seen in 25 sera from HSV-1 isolation positive patients or in 25 serum samples from HSV-negative patients suggesting that sgG-2 is a novel antigen potentially suitable for type-discriminating serodiagnosis.

  4. The -675 4G/5G polymorphism in plasminogen activator inhibitor-1 gene is associated with risk of asthma: a meta-analysis.

    PubMed

    Nie, Wei; Li, Bing; Xiu, Qing-Yu

    2012-01-01

    A number of studies assessed the association of -675 4G/5G polymorphism in the promoter region of plasminogen activator inhibitor (PAI)-1 gene with asthma in different populations. However, most studies reported inconclusive results. A meta-analysis was conducted to investigate the association between polymorphism in the PAI-1 gene and asthma susceptibility. Databases including Pubmed, EMBASE, HuGE Literature Finder, Wanfang Database, China National Knowledge Infrastructure (CNKI) and Weipu Database were searched to find relevant studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association in the dominant model, recessive model, codominant model, and additive model. Eight studies involving 1817 cases and 2327 controls were included. Overall, significant association between 4G/5G polymorphism and asthma susceptibility was observed for 4G4G+4G5G vs. 5G5G (OR = 1.56, 95% CI 1.12-2.18, P = 0.008), 4G/4G vs. 4G/5G+5G/5G (OR = 1.38, 95% CI 1.06-1.80, P = 0.02), 4G/4G vs. 5G/5G (OR = 1.80, 95% CI 1.17-2.76, P = 0.007), 4G/5G vs. 5G/5G (OR = 1.40, 95% CI 1.07-1.84, P = 0.02), and 4G vs. 5G (OR = 1.35, 95% CI 1.08-1.68, P = 0.008). This meta-analysis suggested that the -675 4G/5G polymorphism of PAI-1 gene was a risk factor of asthma.

  5. The −675 4G/5G Polymorphism in Plasminogen Activator Inhibitor-1 Gene Is Associated with Risk of Asthma: A Meta-Analysis

    PubMed Central

    Xiu, Qing-yu

    2012-01-01

    Background A number of studies assessed the association of −675 4G/5G polymorphism in the promoter region of plasminogen activator inhibitor (PAI)-1 gene with asthma in different populations. However, most studies reported inconclusive results. A meta-analysis was conducted to investigate the association between polymorphism in the PAI-1 gene and asthma susceptibility. Methods Databases including Pubmed, EMBASE, HuGE Literature Finder, Wanfang Database, China National Knowledge Infrastructure (CNKI) and Weipu Database were searched to find relevant studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association in the dominant model, recessive model, codominant model, and additive model. Results Eight studies involving 1817 cases and 2327 controls were included. Overall, significant association between 4G/5G polymorphism and asthma susceptibility was observed for 4G4G+4G5G vs. 5G5G (OR = 1.56, 95% CI 1.12–2.18, P = 0.008), 4G/4G vs. 4G/5G+5G/5G (OR = 1.38, 95% CI 1.06–1.80, P = 0.02), 4G/4G vs. 5G/5G (OR = 1.80, 95% CI 1.17–2.76, P = 0.007), 4G/5G vs. 5G/5G (OR = 1.40, 95% CI 1.07–1.84, P = 0.02), and 4G vs. 5G (OR = 1.35, 95% CI 1.08–1.68, P = 0.008). Conclusions This meta-analysis suggested that the −675 4G/5G polymorphism of PAI-1 gene was a risk factor of asthma. PMID:22479620

  6. Recombinant HPA-1a antibody therapy for treatment of fetomaternal alloimmune thrombocytopenia: proof of principle in human volunteers

    PubMed Central

    Herbert, Nina; Hawkins, Louise; Grehan, Nicola; Cookson, Philip; Garner, Steve F.; Crisp-Hihn, Abigail; Lloyd-Evans, Paul; Evans, Amanda; Balan, Kottekkattu; Ouwehand, Willem H.; Armour, Kathryn L.; Clark, Mike R.; Williamson, Lorna M.

    2013-01-01

    Fetomaternal alloimmune thrombocytopenia, caused by the maternal generation of antibodies against fetal human platelet antigen-1a (HPA-1a), can result in intracranial hemorrhage and intrauterine death. We have developed a therapeutic human recombinant high-affinity HPA-1a antibody (B2G1Δnab) that competes for binding to the HPA-1a epitope but carries a modified constant region that does not bind to Fcγ receptors. In vitro studies with a range of clinical anti–HPA-1a sera have shown that B2G1Δnab blocks monocyte chemiluminescence by >75%. In this first-in-man study, we demonstrate that HPA-1a1b autologous platelets (matching fetal phenotype) sensitized with B2G1Δnab have the same intravascular survival as unsensitized platelets (190 hours), while platelets sensitized with a destructive immunoglobulin G1 version of the antibody (B2G1) are cleared from the circulation in 2 hours. Mimicking the situation in fetuses receiving B2G1Δnab as therapy, we show that platelets sensitized with a combination of B2G1 (representing destructive HPA-1a antibody) and B2G1Δnab survive 3 times as long in circulation compared with platelets sensitized with B2G1 alone. This confirms the therapeutic potential of B2G1Δnab. The efficient clearance of platelets sensitized with B2G1 also opens up the opportunity to carry out studies of prophylaxis to prevent alloimmunization in HPA-1a–negative mothers. PMID:23656729

  7. Lack of evidence for the presence of emerging HoBi-like viruses in North American fetal bovine serum lots.

    PubMed

    Bauermann, Fernando V; Flores, Eduardo F; Falkenberg, Shollie M; Weiblen, Rudi; Ridpath, Julia F

    2014-01-01

    The detection of an emerging pestivirus species, "HoBi-like virus," in fetal bovine serum (FBS) labeled as U.S. origin, but packaged in Europe, raised concerns that HoBi-like virus may have entered the United States. In the current study, 90 lots of FBS originating in North America (NA) were screened for pestivirus antigen and antibodies. Lots in group 1 (G1, 72 samples) and group 2 (G2, 9 samples) originated in NA and were packaged in the United States. Group 3 (G3) was composed of 9 lots collected in NA and processed in Europe. Lots in G1 were claimed negative for Bovine viral diarrhea virus (BVDV), while lots in G2 and G3 were claimed positive by the commercial processor. All lots in G1 and G2 tested negative by reverse transcription polymerase chain reaction (RT-PCR) using HoBi-like-specific primers. Two G1 lots tested positive by BVDV RT-PCR. One of these was also positive by virus isolation. All G2 lots were positive by BVDV RT-PCR. In addition, four G2 lots were VI positive while 1 lot was antigen-capture enzyme-linked immunosorbent assay (ELISA) positive. Two G3 lots were positive by HoBi-like-specific RT-PCR tests. All lots were negative for HoBi_D32/00 neutralizing antibodies. Seven lots (4 G1; 1 G2; 2 G3) had antibodies against BVDV by virus neutralization and/or antigen-capture ELISA. While there is no evidence of HoBi-like viruses in NA based on tested samples, further studies are required to validate HoBi-like virus-free status and develop means to prevent the spread of HoBi-like virus into NA.

  8. Liposomal gD Ectodomain (gD1-306) Vaccine Protects Against HSV2 Genital or Rectal Infection of Female and Male Mice

    PubMed Central

    Olson, K.; Macias, P.; Hutton, S.; Ernst, W. A.; Fujii, G.; Adler-Moore, J. P.

    2009-01-01

    Herpes simplex virus type 2 (HSV2) is the most common causative agent of genital herpes, with infection rates as high as 1 in 6 adults. The present studies were done to evaluate the efficacy of a liposomal HSV2 gD1-306 vaccine (L-gD1-306-HD) in an acute murine HSV2 infection model of intravaginal (female) or intrarectal (male or female) challenge. Two doses of L-gD1-306-HD containing 60μg gD1-306-HD and 15μg monophosphoryl lipid A (MPL) per dose provided protection against HSV2 intravaginal challenge (86-100% survival, P≤0.0003 vs control liposomes; P=0.06 vs L-gD1-306-HD without MPL). Both male and female mice (BALB/c and C57BL/6) immunized with L-gD1-306-HD/MPL were significantly protected against HSV2 intrarectal challenge, with higher survival rates compared to controls (71-100%, P≤0.007). L-gD1-306-HD/MPL also provided increased survival when compared to a liposomal peptide vaccine, L-gD264-285-HD/MPL (male BALB/c, P≤0.001; female BALB/c and male C57BL/6, P=0.06). Mice given L-gD1-306-HD/MPL also had minimal disease signs, reduced viral burden in their spinal cords and elevated neutralizing antibody titers in the females. The vaccine also stimulated gD1-306-HD specific splenocytes of both male and female mice with significantly elevated levels of IFN-γ compared to IL-4 (P≤0.01) indicating that there was an enhanced Th1 response. These results provide the first evidence that the L-gD1-306–HD vaccine can protect both male and female mice against intrarectal HSV2 challenge. PMID:19835825

  9. Nuclease digestion and mass spectrometric characterization of oligodeoxyribonucleotides containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG cisplatin intrastrand cross-links.

    PubMed

    Williams, Renee T; Nalbandian, Jenifer N; Tu, Audrey; Wang, Yinsheng

    2013-05-01

    The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, toward the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with (15)N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5' or 3' terminus revealed that the dinucleotide carries a terminal 5' phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Nuclease Digestion and Mass Spectrometric Characterization of Oligodeoxyribonucleotides Containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG Cisplatin Intrastrand Cross-links

    PubMed Central

    Williams, Renee T.; Nalbandian, Jenifer; Tu, Audrey; Wang, Yinsheng

    2013-01-01

    Background The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, towards the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. Methods We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with 15N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). Results 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5′ or 3′ terminus revealed that the dinucleotide carries a terminal 5′ phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. Results The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. PMID:23266768

  11. A Comparative Study on the Microstructure and Mechanical Properties of Cu6Sn5 and Cu3Sn Joints Formed by TLP Soldering With/Without the Assistance of Ultrasonic Waves

    NASA Astrophysics Data System (ADS)

    Zhao, H. Y.; Liu, J. H.; Li, Z. L.; Song, X. G.; Zhao, Y. X.; Niu, H. W.; Tian, H.; Dong, H. J.; Feng, J. C.

    2018-07-01

    In this study, the microstructure and mechanical properties of Cu6Sn5 and Cu3Sn intermetallic joints, formed by the transient liquid phase (TLP) soldering process with and without the assistance of ultrasonic waves (USWs), were compared. After the application of USWs in the TLP soldering process, Cu-Sn intermetallic compounds (IMCs) exhibited a novel noninterfacial growth pattern in the molten solder interlayer. The resulting Cu6Sn5 and Cu3Sn joints consisted of refined equiaxed IMC grains with average sizes of 3 and 2.3 µm, respectively. The Cu6Sn5 grains in the ultrasonically soldered intermetallic joints demonstrated uniform mechanical properties with elastic modulus and hardness values of 123.0 and 5.98 GPa, respectively, while those of Cu3Sn grains were 133.9 and 5.08 GPa, respectively. The shear strengths of ultrasonically soldered Cu6Sn5 and Cu3Sn joints were measured to be 60 and 65 MPa, respectively, higher than that for reflow-soldered intermetallic joints. Ultrasonically soldered Cu6Sn5 and Cu3Sn joints both exhibited a combination of transgranular and intergranular fractures during shear testing.

  12. A Comparative Study on the Microstructure and Mechanical Properties of Cu6Sn5 and Cu3Sn Joints Formed by TLP Soldering With/Without the Assistance of Ultrasonic Waves

    NASA Astrophysics Data System (ADS)

    Zhao, H. Y.; Liu, J. H.; Li, Z. L.; Song, X. G.; Zhao, Y. X.; Niu, H. W.; Tian, H.; Dong, H. J.; Feng, J. C.

    2018-05-01

    In this study, the microstructure and mechanical properties of Cu6Sn5 and Cu3Sn intermetallic joints, formed by the transient liquid phase (TLP) soldering process with and without the assistance of ultrasonic waves (USWs), were compared. After the application of USWs in the TLP soldering process, Cu-Sn intermetallic compounds (IMCs) exhibited a novel noninterfacial growth pattern in the molten solder interlayer. The resulting Cu6Sn5 and Cu3Sn joints consisted of refined equiaxed IMC grains with average sizes of 3 and 2.3 µm, respectively. The Cu6Sn5 grains in the ultrasonically soldered intermetallic joints demonstrated uniform mechanical properties with elastic modulus and hardness values of 123.0 and 5.98 GPa, respectively, while those of Cu3Sn grains were 133.9 and 5.08 GPa, respectively. The shear strengths of ultrasonically soldered Cu6Sn5 and Cu3Sn joints were measured to be 60 and 65 MPa, respectively, higher than that for reflow-soldered intermetallic joints. Ultrasonically soldered Cu6Sn5 and Cu3Sn joints both exhibited a combination of transgranular and intergranular fractures during shear testing.

  13. Does laboratory automation for the preanalytical phase improve data quality?

    PubMed

    Lima-Oliveira, Gabriel; Lippi, Giuseppe; Salvagno, Gian Luca; Danese, Elisa; Montagnana, Martina; Brocco, Giorgio; Voi, Monica; Picheth, Geraldo; Guidi, Gian Cesare

    2013-10-01

    Our aim was to evaluate whether automation for the preanalytical phase improves data quality. Blood from 100 volunteers was collected into two vacuum tubes. One sample from each volunteer was respectively assigned to (G1) traditional processing, starting with centrifugation at 1200 g for 10 min, and (G2) the MODULAR PRE-ANALYTICALS EVO-MPA system. The routine clinical chemistry tests were performed in duplicate on the same instrument Cobas 6000 module. G1 samples were uncapped manually and immediately placed into the instrument. G2 samples were directly fed from the MPA system to the instrument without further staff intervention. At the end, (1) the G1 samples were stored for 6 h at 4 °C as prescribed in our accredited laboratory and (2) the G2 samples were stored for 6 h in the MPA output buffer. Results from G1 and G2, before and after storage, were compared. Significant increases were observed in G1 compared with G2 samples as follows: (1) before storage for alkaline phosphatase (ALP), lactate dehydrogenase (LDH), phosphate (P), magnesium (MG), iron (FE), and hemolysis index and (2) after storage for total cholesterol (COL), triglycerides (TG), total protein (TP), albumin (ALB), blood urea nitrogen (BUN), creatinine (CRE), uric acid (UA), ALP, pancreatic amylase, aspartate aminotransferase (AST), alanine aminotransferase (ALT), g-glutamyltransferase (GGT), LDH, creatine kinase (CK), calcium (CA), FE, sodium (NA), potassium (K), and hemolysis index. Moreover, significant increases were observed in (3) G1-after versus G1-before storage samples for COL, high-density lipoprotein cholesterol, TG, TP, ALB, BUN, CRE, UA, AST, ALT, GGT, LDH, P, CA, MG, FE, NA, K, and hemolysis index and (4) G2-after versus G2-before storage only for BUN, AST, LDH, P, and CA. In conclusion, our results show that the MPA system improves the quality of laboratory testing.

  14. Investigations of the prevalence and virulence of Candida albicans in periodontal and endodontic lesions in diabetic and normoglycemic patients.

    PubMed

    Gomes, Cinthya Cristina; Guimarães, Ludmila Silva; Pinto, Larissa Christina Costa; Camargo, Gabriela Alessandra da Cruz Galhardo; Valente, Maria Isabel Bastos; Sarquis, Maria Inêz de Moura

    2017-01-01

    The aim of this study was to investigate the prevalence of isolated Candida albicans from periodontal endodontic lesions in diabetic and normoglycemic patients, and the fungi's virulence in different atmospheric conditions. A case-control study was conducted on 15 patients with type 2 diabetes mellitus (G1) and 15 non-diabetics (G2) with periodontal endodontic lesions. Samples of root canals and periodontal pockets were plated on CHROMagar for later identification by polymerase chain reaction (PCR) and virulence test. C. albicans was identified in 79.2% and 20.8% of the 60 samples collected from diabetic and normoglycemic patients, respectively. Of the 30 samples collected from periodontal pockets, 13 showed a positive culture for C. albicans, with 77% belonging to G1 and 23% to G2. Of the 11 positive samples from root canals, 82% were from G1 and 18% from G2. Production of proteinase presented a precipitation zone Pz<0.63 of 100% in G1 and 72% in G2, in redox and negative (Pz=1), under anaerobic conditions in both groups. Hydrophobicity of the strains from G1 indicated 16.4% with low, 19.3% with moderate, and 64.3% with high hydrophobicity in redox. In G2, 42.2% had low, 39.8% had moderate, 18% had high hydrophobicity in redox. In anaerobic conditions, G1 showed 15.2% with low, 12.8% with moderate, and 72% with high hydrophobicity; in G2, 33.6% had low, 28.8% had moderate, and 37.6% had high hydrophobicity. There was statistical difference in the number of positive cultures between G1 and G2 (p<0.05) with predominance in G1. There was statistical difference for all virulence factors, except hemolysis (p=0.001). Candida albicans was isolated more frequently and had higher virulence in diabetic patients.

  15. [Stimulation of human hepatic stellate cells by cytochrome P4502E1-mediated oxidative stress].

    PubMed

    Li, Jing; Liu, Tian-hui; You, Hong; Xu, You-qing; Wang, Chen

    2010-08-01

    To explore the stimulation of human hepatic stellate cells by Cytochrome P4502E1-mediated oxidative stress. HepG2-line was transfected with human CYP2E1 plasmid (HepG2/CYP2E1) and empty plasmid (HepG2/PCI) respectively. The CYP2E1 expression was evaluated with RT-PCR and Western blot. MDA was measured in culture medium of HepG2 cell lines. LX2 was co-incubated with HepG2/CYP2E1, HepG2/PCI and HepG2 respectively. The level of hydroxyproline in culture medium was examined in 48 hours and the cells were lysated and total RNA and protein were extracted. COL-1 and MMP2 mRNA levels were detected by RT-PCR and analyzed semi-quantitatively. PICP proteins were measured by ELISA. Zymography was performed to investigate MMP2 enzymatic activities. (1) MDA from the HepG2 which (HepG2/CYP2E1)express human CYP2E1 (6.51+/-0.25) was significantly higher than that from the HepG2 which do not (HepG2/PCI) express human CYP2E1 (3.07+/-0.29) and HepG2 alone (2.57+/-0.29). (F=22.66, all P<0.01). (2) After co-incubated for 48 hours,the level of hydroxyproline in culture medium (35.24+/-3.52) excreted from CYP2E1/LX2 could significantly increase (F=58.89, P is less than 0.01). PICP protein (540.01+/-11.38) excreted from CYP2E1/LX2 was significantly increased (F=124.97, P<0.01). Zymography showed MMP2 gene expression and enzymatic activities of MMP2 had no difference among the groups (F=0.29, P>0.05) (F=0.33, P>0.05). CYP2E1 derived oxidative stress mediated stimulation of collagen I synthesis by hepatic stellate cells. Hydroxyproline excreted by LX2 was increased by CYP2E1. COL-1mRNA had no difference among the groups (F=0.73, P>0.05).

  16. Circular Dichroism reveals evidence of coupling between immunoglobulin constant and variable region secondary structure.

    PubMed

    Janda, Alena; Casadevall, Arturo

    2010-04-01

    Antibodies (Ab) are bifunctional molecules with two domains, a constant region (C) that confers effector properties and a variable (V) region responsible of antigen (Ag) binding. Historically the C and V regions were considered to be functionally independent, with Ag specificity being solely determined by the V region. However, recent studies suggest that the C region can affect Ab fine specificity. This has led to the proposal that the C(H) domain influences the structure of the V region, thus affecting Ab affinity and fine specificity. An inference from this proposal is that V region identical monoclonal Abs (mAbs) differing in C region (eg isotype) would manifest different secondary structures arising from isotype-induced variation in the V-C regions after Ag binding. We hypothesized that such effects could translate into differences in Circular Dichroism (CD) upon Ag-Ab complexes formation. Consequently we studied the interaction of a set of V region identical IgG(1), IgG(2a), IgG(2b) and IgG(3) mAbs with glucuronoxylomannan (GXM). The native CD spectra of the pairs IgG(1)/IgG(2a) and IgG(3)/IgG(2b) were strikingly similar, implying similar secondary structure content. GXM binding by IgG(1), IgG(2a), IgG(2b) and IgG(3) produced different CD changes, with the pairs IgG(1)/IgG(2a) and IgG(3)/IgG(2b) again manifesting qualitatively similar trends in secondary structure changes. The magnitude of the changes differed among the isotypes with IgG(2a)>IgG(3)>IgG(2b)>IgG(1). These differences in CD changes were interpreted to reflect differences in V-C secondary structures. Copyright 2010 Elsevier Ltd. All rights reserved.

  17. Oxygen consumption during cold exposure at 2.1 G in rats adapted to hypergravic fields

    NASA Technical Reports Server (NTRS)

    Horowitz, J.; Patterson, S.; Monson, C.

    1985-01-01

    The thermoregulation ability of rats exposed to various gravitational fields is examined. Male Sprague-Dawley rats were exposed to 22 C and 1 G, and 9 C and 2.1 G in experiment one, 1 G, 2.4 G, 5.8 G and 22 + or - 1.5 C in experiment two, and 1 G, 19-22 C, and 5 C in experiment three. It is observed that the core temperature in the control rats was 36.8 + or 0.4 C at 22C and 30.8 + or - 0.6 C at 9 C, and oxygen consumption dropped from 37 + or - 0.3 C core temperature at 22 C, 36.4 + or - 0.3 C at 9 C, 0.4 oxygen consumption was 8.18 + or - 0.9 ml/min at 22 C, and 14.2 + or - 0.4 ml/min at 9 C. The data from experiment two reveal that tail temperature in the control rats peaked at 2.4 G and at 5.8 G for the acclimated rats, and in experiment three a greater decrease in core temperature is detected in the 2.1-G rats. It is noted that prior acclimation to 2.1 G enhances the thermoregulation ability when exposed to the cold.

  18. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 8 2014-04-01 2014-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  19. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 8 2013-04-01 2013-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  20. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 8 2011-04-01 2011-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  1. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 8 2012-04-01 2012-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  2. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It is not required that the total deductions, or the total amount of any deduction, to which section 642(g) is...

  3. Co2+-doped diopside: crystal structure and optical properties

    NASA Astrophysics Data System (ADS)

    Gori, C.; Tribaudino, M.; Mezzadri, F.; Skogby, H.; Hålenius, U.

    2018-05-01

    Synthetic clinopyroxenes along the CaMgSi2O6-CaCoSi2O6 join were investigated by a combined chemical-structural-spectroscopic approach. Single crystals were synthesized by flux growth methods, both from Ca-saturated and Ca-deficient starting compositions. Single crystal structure refinements show that the incorporation of Co2+ at the octahedrally coordinated cation sites of diopside, increases the unit-cell as well as the M1 and the M2 polyhedral volumes. Spectroscopic investigations (UV-VIS-NIR) of the Ca-rich samples reveal three main optical absorption bands, i.e. 4 T 1g → 4 T 2g( F), 4 T 1g → 4 A 2g( F) and 4 T 1g → 4 T 1g( P) as expected for Co2+ at a six-coordinated site. The bands arising from the 4 T 1g → 4 T 2g( F) and the 4 T 1g → 4 T 1g( P) electronic transitions, are each split into two components, due to the distortions of the M1 polyhedron from ideal Oh-symmetry. In spectra of both types, a band in the NIR range at ca 5000 cm-1 is caused by the 4 A 2g → 4 T 1g( F) electronic transition in Co2+ in a cubic field in the M2 site. Furthermore, an additional component to a band system at 14,000 cm-1, due to electronic transitions in Co2+ at the M2 site, is recorded in absorption spectra of Ca-deficient samples. No variations in Dq and Racah B parameters for Co2+ at the M1 site in response to compositional changes, were demonstrated, suggesting complete relaxation of the M1 polyhedron within the CaMgSi2O6-CaCoSi2O6 solid solution.

  4. Co2+-doped diopside: crystal structure and optical properties

    NASA Astrophysics Data System (ADS)

    Gori, C.; Tribaudino, M.; Mezzadri, F.; Skogby, H.; Hålenius, U.

    2017-12-01

    Synthetic clinopyroxenes along the CaMgSi2O6-CaCoSi2O6 join were investigated by a combined chemical-structural-spectroscopic approach. Single crystals were synthesized by flux growth methods, both from Ca-saturated and Ca-deficient starting compositions. Single crystal structure refinements show that the incorporation of Co2+ at the octahedrally coordinated cation sites of diopside, increases the unit-cell as well as the M1 and the M2 polyhedral volumes. Spectroscopic investigations (UV-VIS-NIR) of the Ca-rich samples reveal three main optical absorption bands, i.e. 4 T 1g → 4 T 2g(F), 4 T 1g → 4 A 2g(F) and 4 T 1g → 4 T 1g(P) as expected for Co2+ at a six-coordinated site. The bands arising from the 4 T 1g → 4 T 2g(F) and the 4 T 1g → 4 T 1g(P) electronic transitions, are each split into two components, due to the distortions of the M1 polyhedron from ideal Oh-symmetry. In spectra of both types, a band in the NIR range at ca 5000 cm-1 is caused by the 4 A 2g → 4 T 1g(F) electronic transition in Co2+ in a cubic field in the M2 site. Furthermore, an additional component to a band system at 14,000 cm-1, due to electronic transitions in Co2+ at the M2 site, is recorded in absorption spectra of Ca-deficient samples. No variations in Dq and Racah B parameters for Co2+ at the M1 site in response to compositional changes, were demonstrated, suggesting complete relaxation of the M1 polyhedron within the CaMgSi2O6-CaCoSi2O6 solid solution.

  5. Transmammary infection in BALB/c mice with chronic toxocariasis.

    PubMed

    de Souza Aguiar, Patricia; Furtado, Raquel Dutra; de Avila, Luciana Farias da Costa; de Lima Telmo, Paula; Martins, Lourdes Helena Rodrigues; Berne, Maria Elisabeth Aires; da Silva, Pedro Eduardo Almeida; Scaini, Carlos James

    2015-04-01

    Human toxocariasis is a neglected public health problem. Infection of humans generally results from the accidental ingestion of embryonated Toxocara canis eggs, but it is important to broaden knowledge about other forms of transmission. This study aimed to demonstrate the prevalence of transmammary transmission in mice with chronic toxocariasis. BALB/c mice in groups 1 (G1) and 3 (G3) were inoculated with 1200 T. canis eggs 60days before mating, whereas those of group 2 (G2) were not infected. After delivery, the G1 neonates were transferred to G2 females to be nursed, and vice versa. Thus, the mice generated by G2 females and breastfed by G1 females could be infected only during lactation. In the G3 group, offspring were not exchanged. The search for T. canis larvae in the bodies of the lactating females and their offspring was performed after weaning and at 60days old, respectively. The frequency of transmammary infection in the mice generated by G2 uninfected females and breastfed by G1 infected females was 19.8%, which was similar to that observed (19.6%) in the mice bred and fed by G3 females. The frequency of infection in the mice generated by G1 females and breastfed by G2 females was only 4.2%, which was lower than that of G1 (p=0.0064) and G3 (p=0.0062) groups. Transmammary infection by mice with chronic toxocariasis was found to be more prevalent than congenital infection. Copyright © 2014. Published by Elsevier Ireland Ltd.

  6. Models for the action of barley alpha-amylase isozymes on linear substrates.

    PubMed

    MacGregor, E A; MacGregor, A W; Macri, L J; Morgan, J E

    1994-05-05

    The formation of maltodextrins, G1 to G12, during the hydrolysis of amylose by alpha-amylases 1 and 2 from barley malt was followed by HPLC. Similar, but not identical, distributions of products were obtained with the two alpha-amylase components. Maltose, G6, and G7 were major products, but G7 was degraded as hydrolysis proceeded. alpha-Amylase 1 produced more G1 and G3 than did alpha-amylase 2 at all stages of hydrolysis. Products formed during the hydrolysis of G9, G10, G11, and G12 by the two alpha-amylases were also determined. A different spectrum of products was observed with each substrate and small differences were observed in the action pattern of the two alpha-amylases, e.g., G3 and G7 were the major products formed during the hydrolysis of G10 by alpha-amylase 1, whereas G2 and G8 were the major products formed by alpha-amylase 2 on the same substrate. These results were used to develop a model of the active site of barley malt alpha-amylases. This site contains ten contiguous subsites with the catalytic site situated between subsites 7 and 8. The model can be used to predict hydrolysis patterns of amylose and maltodextrins by cereal alpha-amylases.

  7. An overactivated ATR/CHK1 pathway is responsible for the prolonged G2 accumulation in irradiated AT cells

    NASA Technical Reports Server (NTRS)

    Wang, Xiang; Khadpe, Jay; Hu, Baocheng; Iliakis, George; Wang, Ya

    2003-01-01

    Induction of checkpoint responses in G1, S, and G2 phases of the cell cycle after exposure of cells to ionizing radiation (IR) is essential for maintaining genomic integrity. Ataxia telangiectasia mutated (ATM) plays a key role in initiating this response in all three phases of the cell cycle. However, cells lacking functional ATM exhibit a prolonged G2 arrest after IR, suggesting regulation by an ATM-independent checkpoint response. The mechanism for this ataxia telangiectasia (AT)-independent G2-checkpoint response remains unknown. We report here that the G2 checkpoint in irradiated human AT cells derives from an overactivation of the ATR/CHK1 pathway. Chk1 small interfering RNA abolishes the IR-induced prolonged G2 checkpoint and radiosensitizes AT cells to killing. These results link the activation of ATR/CHK1 with the prolonged G2 arrest in AT cells and show that activation of this G2 checkpoint contributes to the survival of AT cells.

  8. Synthesis and Properties of Hexachloromolybdates(V) and Related Species.

    DTIC Science & Technology

    1983-11-04

    2 1 6200 EC N ) t2ICoC 1 3 14400 - 311 699 3134 solid state 4A2 4 TI (F) 14900 - 15750 - 4890 4 5210 44 A2 "." T1( P ) 5470 [Et4N32 £CoCI4 3 6080 in...g T19( P ) transition with the*! l i! Fir 5* E tro n1ic spctra o f coba t(I) ino eta he d r ql enviro n .’en ts9 9 Inset: CoC] in Al Ci 23 I’% I�...3A 2g T2g 6400 NiC12 in 3A 2g- T Ig(F) 10800 640 aluminium chloride 3A2g 3 Tlg ( P ) 21000 (ref. 45) 3A2g 3 T 2g 6670 11220 EEt4 N 2ECoCl4 3 A2g TIg

  9. Inflammation Modulatory Protein TSG-6 for Chemical Injuries to the Cornea

    DTIC Science & Technology

    2015-10-01

    Col1a1 (collagen, type I, alpha 1) Col1a1 C o l1 a 1 /G A P D H co...0.25 Col1a1 C o l1 a 1 /G A P D H PB S TS G- 6 0.0 0.5 1.0 1.5 2.0 2.5 Thrombomodulin (CD141) ELANE (Neutrophil elastase) Emr1 (EGF-like module...TS G- 6 0.00 0.01 0.02 0.03 0.04 0.05 Thbd T h b d /G A P D H PB S TS G- 6 0.00 0.05 0.10 0.15 Col1a1 C o l1 a 1 /G A P D H PB S TS G- 6 0 1 2 3 4

  10. Vaccine-Derived NSP2 Segment in Rotaviruses from Vaccinated Children with Gastroenteritis in Nicaragua

    PubMed Central

    Bucardo, Filemón; Rippinger, Christine M.; Svensson, Lennart; Patton, John T.

    2012-01-01

    Rotavirus (RV) vaccination programs have been established in several countries using the human-attenuated G1P[8] monovalent vaccine Rotarix™ (GlaxoSmithKline) and/or the human-bovine reassortant G1, G2, G3, G4, P[8] pentavalent vaccine RotaTeq™ (Merck). The efficacy of both vaccines is high (~90%) in developed countries, but can be remarkably lower in developing countries. For example, a vaccine efficacy against severe diarrhea of only 58% was observed in a 2007–2009 Nicaraguan study using RotaTeq. To gain insight into the significant level of vaccine failure in this country, we sequenced the genomes of RVs recovered from vaccinated Nicaraguan children with gastroenteritis. The results revealed that all had genotype specificities typical for human RVs (11 G1P[8], 1 G3P[8]) and that the sequences and antigenic epitopes of the outer capsid proteins (VP4 and VP7) of these viruses were similar to those reported for RVs isolated elsewhere in the world. As expected, nine of the G1P[8] viruses and the single G3P[8] virus had genome constellations typical of human G1P[8] and G3P[8] RVs: G1/3-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1. However, two of the G1P[8] viruses had atypical constellations, G1-P[8]-I1-R1-C1-M1-A1-N2-T1-E1-H1, due to the presence of a genotype-2 NSP2 (N2) gene. The sequence of the N2 NSP2 gene was identical to the bovine N2 NSP2 gene of RotaTeq, indicating that the two atypical viruses originated via reassortment of human G1P[8] RVs with RotaTeq viruses. Together, our data suggest that the high level of vaccine failure in Nicaraguan is probably not due to antigenic drift of commonly circulating virus strains nor the emergence of new antigenetically distinct virus strains. Furthermore, our data suggests that the widespread use of the RotaTeq vaccine has led to the introduction of vaccine genes into circulating human RVs. PMID:22487061

  11. APOL1 nephropathy risk variants are associated with altered high-density lipoprotein profiles in African Americans.

    PubMed

    Gutiérrez, Orlando M; Judd, Suzanne E; Irvin, Marguerite R; Zhi, Degui; Limdi, Nita; Palmer, Nicholette D; Rich, Stephen S; Sale, Michèle M; Freedman, Barry I

    2016-04-01

    Two independent coding variants in the apolipoprotein L1 gene (APOL1), G1 and G2, strongly associate with nephropathy in African Americans; associations with cardiovascular disease are more controversial. Although APOL1 binds plasma high-density lipoproteins (HDLs), data on APOL1 risk variant associations with HDL subfractions are sparse. Two APOL1 G1 single nucleotide polymorphisms and the G2 insertion/deletion polymorphism were genotyped in 2010 Reasons for Geographic and Racial Differences in Stroke (REGARDS) Study participants with nuclear magnetic resonance spectroscopy-based lipoprotein subfraction measurements. Linear regression was used to model associations between numbers of APOL1 G1/G2 risk variants and HDL subfractions, adjusting for demographic, clinical and ancestral covariates. Female sex and higher percentage of African ancestry were positively associated with the number of APOL1 G1/G2 risk alleles. In the unadjusted analysis, mean (standard error) small HDL concentrations (μmol/L) for participants with zero, one and two G1/G2 risk alleles were 19.0 (0.2), 19.7 (0.2) and 19.9 (0.4), respectively (P = 0.02). Adjustment for age, sex, diabetes and African ancestry did not change the results but strengthened the statistical significance (P = 0.004). No significant differences in large or medium HDL, very low-density lipoprotein or low-density lipoprotein particle concentrations were observed by APOL1 genotype. Greater numbers of APOL1 G1/G2 risk alleles were associated with higher small HDL particle concentrations in African Americans. These results may suggest novel areas of investigation to uncover reasons for the association between APOL1 risk variants with adverse outcomes in African Americans. © The Author 2015. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

  12. APOL1 nephropathy risk variants are associated with altered high-density lipoprotein profiles in African Americans

    PubMed Central

    Gutiérrez, Orlando M.; Judd, Suzanne E.; Irvin, Marguerite R.; Zhi, Degui; Limdi, Nita; Palmer, Nicholette D.; Rich, Stephen S.; Sale, Michèle M.; Freedman, Barry I.

    2016-01-01

    Background Two independent coding variants in the apolipoprotein L1 gene (APOL1), G1 and G2, strongly associate with nephropathy in African Americans; associations with cardiovascular disease are more controversial. Although APOL1 binds plasma high-density lipoproteins (HDLs), data on APOL1 risk variant associations with HDL subfractions are sparse. Methods Two APOL1 G1 single nucleotide polymorphisms and the G2 insertion/deletion polymorphism were genotyped in 2010 Reasons for Geographic and Racial Differences in Stroke (REGARDS) Study participants with nuclear magnetic resonance spectroscopy-based lipoprotein subfraction measurements. Linear regression was used to model associations between numbers of APOL1 G1/G2 risk variants and HDL subfractions, adjusting for demographic, clinical and ancestral covariates. Results Female sex and higher percentage of African ancestry were positively associated with the number of APOL1 G1/G2 risk alleles. In the unadjusted analysis, mean (standard error) small HDL concentrations (μmol/L) for participants with zero, one and two G1/G2 risk alleles were 19.0 (0.2), 19.7 (0.2) and 19.9 (0.4), respectively (P = 0.02). Adjustment for age, sex, diabetes and African ancestry did not change the results but strengthened the statistical significance (P = 0.004). No significant differences in large or medium HDL, very low-density lipoprotein or low-density lipoprotein particle concentrations were observed by APOL1 genotype. Conclusions Greater numbers of APOL1 G1/G2 risk alleles were associated with higher small HDL particle concentrations in African Americans. These results may suggest novel areas of investigation to uncover reasons for the association between APOL1 risk variants with adverse outcomes in African Americans. PMID:26152403

  13. Neisseria meningitidis Group A IgG1 and IgG2 Subclass Immune Response in African Children Aged 12–23 Months Following Meningococcal Vaccination

    PubMed Central

    Holme, Daniel; Findlow, Helen; Sow, Samba O.; Idoko, Olubukola T.; Preziosi, Marie-Pierre; Carlone, George; Plikaytis, Brian D.; Borrow, Ray

    2015-01-01

    Background. A group A meningococcal conjugate vaccine, PsA-TT, was licensed in 2010 and was previously studied in a phase 2 clinical trial to evaluate its safety and immunogenicity in African children 12–23 months of age. Methods. Subjects received either PsA-TT; meningococcal group A, C, W, Y polysaccharide vaccine (PsACWY); or Haemophilus influenzae type b conjugate vaccine (Hib-TT). Forty weeks following primary vaccination, the 3 groups were further randomized to receive either PsA-TT, one-fifth dose of PsACWY, or Hib-TT. Group A–specific immunoglobulin G (IgG) subclass response was characterized using an enzyme-linked immunosorbent assay. Results. The predominant IgG subclass response, regardless of vaccine, was IgG1. One month following primary vaccination, the geometric mean concentrations (GMCs) of IgG1 and IgG2 in the PsA-TT group were 21.73 µg/mL and 6.27 µg/mL, whereas in the PsACWY group the mean GMCs were 2.01 µg/mL and 0.97 µg/mL, respectively (P < .0001). Group A–specific IgG1 and IgG2 GMCs remained greater in the PsA-TT group than in the PsACWY group 40 weeks following primary vaccination (P < .0001). One week following revaccination, those given 2 doses of PsA-TT had the greatest IgG1 and IgG2 GMCs of 125.23 µg/mL and 36.12 µg/mL, respectively (P = .0008), and demonstrated a significant increase in IgG1:IgG2 mean ratio, indicative of the T-cell–dependent response associated with conjugate vaccines. Conclusions. Vaccination of African children aged 12–24 months with either PsA-TT or PsACWY elicited a predominantly IgG1 response. The IgG1:IgG2 mean ratio decreased following successive vaccination with PsACWY, indicating a shift toward IgG2, suggestive of the T-cell–independent immune response commonly associated with polysaccharide antigens. Clinical Trials Registration. SRCTN78147026. PMID:26553689

  14. 40 CFR 721.4320 - Hydrazinecarboxamide, N,N′-(methylenedi-4,1-phenylene)bis [2,2-dimethyl-.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...- (PMN P-88-522) is subject to reporting under this section for the significant new uses described in... blood effects), (g)(1)(vii), (g)(2)(iv), (g)(2)(v), (g)(4)(iii), and (g)(5). The provisions of § 721.72... substance, as specified in § 721.125 (a), (b), (c), (e), (f), (g), (h), and (k). (2) Limitations or...

  15. 40 CFR 721.4320 - Hydrazinecarboxamide, N,N′-(methylenedi-4,1-phenylene)bis [2,2-dimethyl-.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...- (PMN P-88-522) is subject to reporting under this section for the significant new uses described in... blood effects), (g)(1)(vii), (g)(2)(iv), (g)(2)(v), (g)(4)(iii), and (g)(5). The provisions of § 721.72... substance, as specified in § 721.125 (a), (b), (c), (e), (f), (g), (h), and (k). (2) Limitations or...

  16. Docetaxel as neoadjuvant chemotherapy in patients with advanced cervical carcinoma.

    PubMed

    Vallejo, Carlos T; Machiavelli, Mario R; Pérez, Juan E; Romero, Alberto O; Bologna, Fabrina; Vicente, Hernán; Lacava, Juan A; Ortiz, Eduardo H; Cubero, Alberto; Focaccia, Guillermo; Suttora, Guillermo; Scenna, Mirna; Boughen, José M; Leone, Bernardo A

    2003-10-01

    The purpose of this study was to evaluate the efficacy and toxicity of docetaxel as single-agent neoadjuvant chemotherapy in locoregionally advanced cervical carcinoma. Between April 1998 and August 2000, 38 untreated patients with International Federation of Gynecology and Obstetrics stages IIB to IVA were entered onto this study. The median age was 44 years (range: 25-66 years). Stages: IIB 22 patients, IIIB 15 patients, and IVA 1 pt. Treatment consisted of docetaxel 100 mg/m2 IV infusion during 1 hour. Standard premedication with dexamethasone, diphenhydramine, and ranitidine was used. Cycles were repeated every 3 weeks for three courses, followed by radical surgery when it was judged appropriate, or definitive radiotherapy. Both staging and response assessment were performed by a multidisciplinary team. 106 cycles of therapy were administered; all patients were evaluable for TX, whereas 35 were evaluable for response (3 patients refused further treatment after the first cycle of therapy). Complete response (CR): 1 patient (3%); partial response: 11 patients (31%), for an overall objective response rate of 34% (95% CI: 15-53%); no change (NC): 16 patients (46%); and progressive disease: 7 patients (20%). Six patients (17%) underwent surgery and a pathologic CR was confirmed in 1 of them. The median time to treatment failure and the median survival have not been reached yet. The limiting toxicity was leukopenia in 25 patients (69%) (G1-G2: 14 patients, G3: 10 patients, and G4: 1 patient). Neutropenia: 28 patients (78%) (G1-G2: 10 patients, G3: 8 and G4: 10). Myalgias: 17 patients (47%) (G1-G2: 15 patients and G3: 2 patients). Emesis: 21 patients (55%) (G1-G2: 19 patients and G3: 2 patients). Alopecia G3: 13 patients (36%); rash cutaneous 26 patients (68%) (G1-G2: 22 patients and G3: 4 patients). There were no hypersensitivity reactions or fluid-retention syndrome. The received dose intensity was 91% of that projected. Docetaxel is an active drug against advanced cervical carcinoma with moderate toxicity. Further evaluation in association with other agents is clearly justified.

  17. Crop yield and light / energy efficiency in a closed ecological system: two laboratory biosphere experiments

    NASA Astrophysics Data System (ADS)

    Nelson, M.; Dempster, W. F.; Silverstone, S.; Alling, A.; Allen, J. P.; van Thillo, M.

    Two crop growth experiments in the soil-based closed ecological facity, Laboratory Biosphere, were conducted from 2003-2004 with candidate space life support crops. Apogee wheat (Utah State University variety) was grown, planted in 2 densities, 400 and 800 seeds m-2. The lighting regime for the wheat crop was 16 hours of light -- 8 hours dark at a total light intensity of around 840 mol m2 sec-1 and 48.4 mol m-2 d-1 over 84 days Average biomass was 1395 g m-2, 16.0 g m-2 day-1 and average seed production was 689 g m-2 and 7.9 g m2 day-1. The less densely planted side was more productive than the denser planting, with 1634 g m-2 and 18.8g m-2 day-1 of biomass vs. 1156 g m-2 and 13.3 g m-2 day-1; and a seed harvest of 812.3 g m-2 and 9.3 g m-2 day-1 vs. 566.5 g m-2 and 6.5 g m-2 day-1 Harvest index was 0.49 for the wheat crop. The experiment with sweet potato used TU-82-155, a compact variety developed at Tuskegee University. Light during the sweet potato experiment, on a 16 hour on/8 hours dark cycle, totalled 5568 total moles of light in 126 days for the sweet potatoes, or an average of 44.2 moles m-2 day-1. Temperature regime was 28 deg +/- 3 deg C day /22 deg +/- 4 deg C night. Sweet potato tuber yield was 39.7 kg wet weight, or an average of 7.4 kg m-2 and 7.7 kg dry weight of tubers since dry weight was about 18.6% wet weight.^Average per day production was 58.7 g m-2 day-1 wet weight and 11.3 g m-2 day-1. For the wheat, average light efficiency was 0.34 grams biomass per mole, and 0.17 grams seed per mole. The best area of wheat had an efficiency of light utilization of 0.51 g biomass per mole and 0.22 g seed per mole. For the sweet potato crop, light efficiency per tuber wet weight was 7.13 g/mole and 1.38 g dry weight of tuber per mole of light. The best area of tuber production had 9.49 g/mole wet weight and 1.85 g/mole of light dry weight. Production from the wheat was The Laboratory Biosphere experiment's light efficiency was somewhat higher than the USU field results but somewhat below greenhouse trials at comparable light levels, and the best portion of the crop at 0.22g/mole was inbetween those values. Sweet potato production was overall close to 50% higher than trials using hydroponic methods with TU-82-155 at NASA JSC. Compared to projected yields for the Mars on Earth life support system, these wheat yields were about 15% higher, and the sweet potato yields averaged over 80% higher

  18. How Long Does Antimycobacterial Antibiotic-loaded Bone Cement Have In Vitro Activity for Musculoskeletal Tuberculosis?

    PubMed

    Lee, Jae Hoo; Han, Chang Dong; Cho, Sang-Nae; Yang, Ick Hwan; Lee, Woo Suk; Baek, Seung-Hun; Shin, Jae Won; Husein, Khalid Elfadil Ibrahim; Park, Kwan Kyu

    2017-11-01

    Antibiotic-loaded bone cement is accepted as an effective treatment modality for musculoskeletal tuberculosis. However, comparative information regarding combinations and concentrations of second-line antimycobacterial drugs, such as streptomycin and amoxicillin and clavulanic acid, are lacking. (1) In antibiotic-loaded cement, is there effective elution of streptomycin and Augmentin ® (amoxicillin and clavulanic acid) individually and in combination? (2) What is the antibacterial activity duration for streptomycin- and amoxicillin and clavulanic acid -loaded cement? Six different types of bone cement discs were created by mixing 40 g bone cement with 1 or 2 g streptomycin only, 0.6 g or 1.2 g Augmentin ® (amoxicillin and clavulanic acid) only, and a combination of 1 g streptomycin plus 0.6 g amoxicillin and clavulanic acid and 2 g streptomycin plus 1.2 g amoxicillin and clavulanic acid. Five bone discs of each type were incubated in phosphate buffered saline for 30 days with renewal of the phosphate buffered saline every day. The quantity of streptomycin and/or amoxicillin and clavulanic acid in eluates were measured by a liquid chromatography-mass spectrometry system, and the antimycobacterial activity of eluates against Mycobacterium tuberculosis H37Rv, were calculated by comparing the minimal inhibitory concentration of each eluate with that of tested drugs using broth dilution assay on microplate. Streptomycin was detected in eluates for 30 days (in 1 g and 2 g discs), whereas 1.2 g amoxicillin and clavulanate eluted until Day 7 and 0.6 g amoxicillin and clavulanate until Day 3. All eluates in streptomycin-containing discs (streptomycin only, and in combination with amoxicillin and clavulanic acid) had effective antimycobacterial activity for 30 days, while amoxicillin and clavulanate-only preparations were only active until Day 14. The antimycobacterial activity of eluates of 2 g streptomycin plus 1.2 g amoxicillin and clavulanate were higher than those of discs containing 1 g streptomycin plus 0.6 g amoxicillin and clavulanate until Day 3, without differences (Day 3, 1 g streptomycin plus 0.6 g amoxicillin and clavulanate: 17.5 ± 6.85 ug/mL; 2 g streptomycin plus 1.2 g amoxicillin and clavulanate: 32.5 ± 16.77 ug/mL; p = 0.109). After Day 7, however, values of the two combinations remained no different than that of Day 30 (Day 30, 1 g streptomycin plus 0.6 g amoxicillin and clavulanate: 0.88 ± 0.34 ug/mL; 2 g streptomycin plus 1.2 g amoxicillin and clavulanate: 0.59 ± 0.94 ug/mL; p = 0.107). Streptomycin, in the form of antibiotic-loaded bone cement, had effective elution characteristics and antimycobacterial effects during a 30-day period, whereas amoxicillin and clavulanate only had effective elution and antimycobacterial characteristics during the early period of this study. The two drugs did not interfere with each other during the elution test. This research revealed that combinations of streptomycin and amoxicillin and clavulanate mixed with bone cement are effective for 30 days. Further trials to determine various different combinations of drugs are necessary to improve the effectiveness of treatments for musculoskeletal tuberculosis.

  19. Analysis of Laparoscopic Sleeve Gastrectomy Learning Curve and Its Influence on Procedure Safety and Perioperative Complications.

    PubMed

    Major, Piotr; Wysocki, Michał; Dworak, Jadwiga; Pędziwiatr, Michał; Pisarska, Magdalena; Wierdak, Mateusz; Zub-Pokrowiecka, Anna; Natkaniec, Michał; Małczak, Piotr; Nowakowski, Michał; Budzyński, Andrzej

    2018-06-01

    Laparoscopic sleeve gastrectomy (LSG) has become an attractive bariatric procedure with promising treatment effects yet amount of data regarding institutional learning process is limited. Retrospective study included patients submitted to LSG at academic teaching hospital. Patients were divided into groups every 100 consecutive patients. LSG introduction was structured along with Enhanced Recovery after Surgery (ERAS) treatment protocol. Primary endpoint was determining the LSG learning curve's stabilization point, using operative time, intraoperative difficulties, intraoperative adverse events (IAE), and number of stapler firings. Secondary endpoints: influence on perioperative complications and reoperations. Five hundred patients were included (330 females, median age of 40 (33-49) years). Operative time in G1-G2 differed significantly from G3-G5. Stabilization point was the 200th procedure using operative time. Intraoperative difficulties of G1 differed significantly from G2-G5, with stabilization after the 100th procedure. IAE and number of stapler firings could not be used as predictor. Based on perioperative morbidity, the learning curve was stabilized at the 100th procedure. The morbidity rates in the groups were G1, 13%; G2, 4%; G3, 5%; G4, 5%; and G5, 2%. The reoperation rate in G1 was 3%; G2, 2%; G3, 2%; G4, 1%; and G5, 0%. The institutional learning process stabilization point for LSG in a newly established bariatric center is between the 100th and 200th operation. Initially, the morbidity rate is high, which should concern surgeons who are willing to perform bariatric surgery.

  20. Preparation and Characterization of Graphite Waste/CeO2 Composites

    NASA Astrophysics Data System (ADS)

    Kusrini, E.; Utami, C. S.; Nasruddin; Prasetyanto, E. A.; Bawono, Aji A.

    2018-03-01

    In this research, the chemical modification of graphite waste with CeO2 was developed and characterized. Graphite waste was pretreated with mechanical to obtain the size 200 mesh (75 μm), and thermal methods at 110°C oven for 6 hours. Here, we demonstrate final properties of graphite before modification (GBM), activated graphite (GA) and graphite/CeO2 composite with variation of 0.5, 1 and 2 g of CeO2 (G0.5; G1; G2). The effect of CeO2 concentration was observed. The presence of cerium in modified graphite samples (G0.5; G1; G2) were analyzed using SEM-EDX. The results show that the best surface area was found in G2 is 26.82 m2/g. The presence of CeO2 onto graphite surface does not significantly increase the surface area of composites.

  1. Three energy scales in the superconducting state of hole-doped cuprates detected by electronic Raman scattering

    DOE PAGES

    Benhabib, S.; Gu, G. D.; Gallais, Y.; ...

    2015-10-06

    We explore by electronic Raman scattering the superconducting state of the Bi 2Sr 2CaCu 2O 8+δ (Bi-2212) crystal by performing a fine-tuned doping study. We find three distinct energy scales in A 1g, B 1g, and B 2g symmetries which show three distinct doping dependencies. Above p=0.22, the three energies merge; below p=0.12, the A 1g scale is no longer detectable, while the B 1g and B 2g scales become constant in energy. In between, the A 1g and B 1g scales increase monotonically with underdoping, while the B 2g one exhibits a maximum at p=0.16. The three superconducting energymore » scales appear to be a universal feature of hole-doped cuprates. Furthermore, we propose that the nontrivial doping dependencies of the three scales originate from the Fermi-surface changes and reveal competing orders inside the superconducting dome.« less

  2. UCAC and URAT: Optical Astrometric Catalog Observing Programs

    DTIC Science & Technology

    2010-09-21

    12 100 K 1.0 1997 Tycho-2 G/S yes <= 12 2.5 M 10..100 2000 UCAC G yes 8..16 100 M 20.. 70 2004+ 2MASS G no IR...UCAC3 G yes 8..16 100 M 20.. 70 2009 first CCD survey 2MASS G no IR 500 M 90 2003 1 epoch USNO-B G yes 12..21 1000 M 200 2003 Schmidt plates PanSTARRS G

  3. Peripheral Signals of Food Intake in Response to Low Leptin Levels Induced by Centrifugation

    NASA Technical Reports Server (NTRS)

    Moran, M. M.; Wade, Charles E.; Stein, T. P.; Dalton, Bonnie P. (Technical Monitor)

    2001-01-01

    The focus of the study was to examine leptin and other peripheral signals of energy balance, following hypergravity. The study was conducted in two experiments. In experiment 1 rats were centrifuged at either 1.5, 2, or remained at 1 G. During days 8 to 14 of experiment 1, mean body mass of the 1.5 and 2 G groups was significantly (p<0.05) lower than controls. No differences were found in food intake (g/day/100 g body mass). Epididymal fat in the 2 G group was 21% lower than controls and 14% lower than the 1.5 G group. Plasma leptin was reduced from controls in the 1.5 and 2 G groups by 45 and 63%, respectively. A significant correlation was found between G load and urinary catecholamines. In experiment 2, rats were centrifuged at either 1.25, 1.5, or remained at 1 G. During days 8 to 14, body mass and food intake were similar between the 1, 1.25, and 1.5 G groups. Epididymal fat was reduced from controls in the 1.25 (14%) and 1.5 (19%) G groups. Leptin was reduced from controls in the 1.25 (45%) and 1.5 (46%) G groups. No differences were found in urinary epinephrine. Urinary norepinephrine levels were significantly higher than controls in each centrifuge group. During hypergravity exposure, food intake is the result of a complex relationship between multiple pathways, which abates the importance of leptin as a primary signal.

  4. Efflux transport of estrogen glucuronides by human MRP2, MRP3, MRP4 and BCRP.

    PubMed

    Järvinen, Erkka; Deng, Feng; Kidron, Heidi; Finel, Moshe

    2018-04-01

    Estrone, estradiol and estriol are endogenous human estrogens that are rapidly conjugated with glucuronic acid in both intestinal and hepatic epithelial cells. The resulting glucuronides, estrone-3-glucuronide (E 1 -G), estradiol-3- and 17-glucuronides (E 2 -3G and E 2 -17G), as well as estriol-3- and 16-glucuronides (E 3 -3G and E 3 -16G) are found in human plasma and urine. Unlike E 2 -17G, the efflux transport of other estrogen glucuronides by human transporters has not yet been investigated comprehensively. We have studied the transport of E 1 -G, E 2 -3G, E 3 -3G, E 3 -16G and estrone-3-sulfate (E 1 -S), another important estrogen conjugate, using the vesicular transport assay with recombinant human MRP2, MRP3, MRP4, MDR1 and BCRP that were expressed in insect cells. The transport screening assays revealed that whereas E 1 -S was a good and specific substrate for BCRP, the less transporter-specific conjugates, E 1 -G and E 2 -3G, were still transported by BCRP at 10-fold higher rates than E 1 -S. BCRP also transported E 3 -16G at higher rates than the studied MRPs, while it transported E 3 -3G at lower rates than MRP3. MRP2 exhibited lower or equal transport rates of E 1 -G, E 2 -3G, E 3 -3G and E 3 -16G in comparison to MRP3 and BCRP in the screening assays, mainly due to its high K m values, between 180 and 790 μM. MRP3 transported all the tested glucuronides at rather similar rates, at K m values below 20 μM, but lower V max values than other transporters. In the case of E 3 -3G, MRP3 was the most active transporter in the screening assay. MRP4 transported only E 3 -16G at considerable rates, while none of the tested estrogen conjugates was transported by MDR1 at higher rates than control vesicles. These new results, in combination with previously reported in vivo human data, stimulate our understanding on the substrate specificity and role of efflux transporters in disposition of estrogen glucuronides in humans. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. The petrogenesis of the Early Permian Variscan granites of the Cornubian Batholith: Lower plate post-collisional peraluminous magmatism in the Rhenohercynian Zone of SW England

    NASA Astrophysics Data System (ADS)

    Simons, B.; Shail, Robin K.; Andersen, Jens C. Ø.

    2016-09-01

    The Early Permian Cornubian Batholith was generated during an extensional regime following Variscan convergence within the Rhenohercynian Zone of SW England. Its component granites can be classified, using mineralogical, textural and geochemical criteria, into five main types, all of which are peraluminous (A/CNK > 1.1): G1 (two-mica), G2 (muscovite), G3 (biotite), G4 (tourmaline) and G5 (topaz). G1 granites formed through up to 20% muscovite and minor biotite dehydration melting of a metagreywacke source at moderate temperatures and pressures (731-806 °C, > 5 kbar). Younger G3 granites formed through higher temperature, lower pressure (768-847 °C, < 4 kbar) biotite-dominated melting of a similar source. Partial melting was strongly influenced by the progressive lower-mid crustal emplacement of mafic igneous rocks during post-Variscan extension and a minor (< 5%-10%) mantle-derived component in the granites is possible. Two distinct fractionation series, G1-G2 and G3-G4, are defined using whole-rock geochemical and mineral chemical data. Variations in the major elements, Ba, Sr and Rb indicate that G1 and G3 granites underwent 15%-30% fractionation of an assemblage dominated by plagioclase, alkali feldspar and biotite to form more evolved G2 and G4 granites, respectively. Decreasing whole-rock abundances of Zr, Th and REE support the fractionation of zircon, monazite, apatite and allanite. Subsolidus alteration in G2 and G4 granites is indicated by non-primary muscovite and tourmaline and modification of major and trace element trends for G3-G4 granites, particularly for P2O5 and Rb. Topaz (G5) granites show low Zr, REE and extreme enrichment in Rb (up to 1530 ppm) and Nb (79 ppm) that cannot be related in a straightforward manner to continued differentiation of the G1-G2 or G3-G4 series. Instead, they are considered to represent partial melting, mediated by granulite facies fluids, of a biotite-rich restite following extraction of G1 and/or G3 magmas; they do not exhibit the typical geochemical characteristics of intraplate A-type granites.

  6. Using the Small Ruminant Nutrition System to develop and evaluate an alternative approach to estimating the dry matter intake of goats when accounting for ruminal fiber stratification.

    PubMed

    Regadas Filho, J G L; Tedeschi, L O; Cannas, A; Vieira, R A M; Rodrigues, M T

    2014-11-01

    The first objective of this research was to assess the ability of the Small Ruminant Nutrition System (SRNS) mechanistic model to predict metabolizable energy intake (MEI) and milk yield (MY) when using a heterogeneous fiber pool scenario (GnG1), compared with a traditional, homogeneous scenario (G1). The second objective was to evaluate an alternative approach to estimating the dry matter intake (DMI) of goats to be used in the SRNS model. The GnG1 scenario considers an age-dependent fractional transference rate for fiber particles from the first ruminal fiber pool (raft) to an escapable pool (λr), and that this second ruminal fiber pool (i.e., escapable pool) follows an age-independent fractional escape rate for fiber particles (ke). Scenario G1 adopted only a single fractional passage rate (kp). All parameters were estimated individually by using equations published in the literature, except for 2 passage rate equations in the G1 scenario: 1 developed with sheep data (G1-S) and another developed with goat data (G1-G). The alternative approach to estimating DMI was based on an optimization process using a series of dietary constraints. The DMI, MEI, and MY estimated for the GnG1 and G1 scenarios were compared with the results of an independent dataset (n=327) that contained information regarding DMI, MEI, MY, and milk and dietary compositions. The evaluation of the scenarios was performed using the coefficient of determination (R(2)) between the observed and predicted values, mean bias (MB), bias correction factor (Cb), and concordance correlation coefficient. The MEI estimated by the GnG1 scenario yielded precise and accurate values (R(2) = 082; MB = 0.21 Mcal/d; Cb = 0.98) similar to those of the G1-S (R(2) = 0.85; MB = 0.10 Mcal/d; Cb=0.99) and G1-G (R(2) = 0.84; MB = 0.18 Mcal/d; Cb = 0.98) scenarios. The results were also similar for the MY, but a substantial MB was found as follows: GnG1 (R(2) = 0.74; MB = 0.70 kg/d; Cb = 0.79), G1-S (R(2) = 0.71; MB = 0.58 kg/d(1); Cb = 0.85) and G1-G (R(2) = 0.71; MB = 0.65 kg/d; Cb = 0.82). The alternative approach for DMI prediction provided better results with the G1-G scenario (R(2)=0.88; MB = -71.67 g/d; Cb = 0.98). We concluded that the GnG1 scenario is valid within mechanistic models such as the SRNS and that the alternative approach for estimating DMI is reasonable and can be used in diet formulations for goats. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. Local metric dimension of circulant graph c i r c (n :1 ,2 ,…,n/+1 2 )

    NASA Astrophysics Data System (ADS)

    Rimadhany, Ruzika; Darmaji

    2017-08-01

    Let G be a connected graph with two vertices u and v. The distance between u and v, denoted by d(u, v), is defined as length of the shortest path from u to v in G. For an ordered set W = {w1, w2, w3, … , wk} of k distinct vertices in a nontrivial connected graph G, the representation of a vertex v of V(G) respect to W is r(v|W) = (d(v, w1), d(v, w2), … , d(v, wk)). The set W is a resolving set of G if r(v|W) for each vertex v ∈ V(G) is distinct. A resolving set of minimum cardinality is a metric dimension and denoted by dim(G). The set W is a local resolving set of G if r(v|W) for every two adjacent vertices of V(G) is distinct. The minimum cardinality of local resolving set of G is a local metric dimension and denoted by ldim(G). In this research, we determine local metric dimension of circulant graph c i r c (n :1 ,2 ,3 ,…,n/+1 2 ) .

  8. Contribution of uranium to gross alpha radioactivity in some environmental samples in Kuwait

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bou-Rabee, F.; Bakir, Y.; Bem, H.

    1995-08-01

    This study was done in connection with the use of uranium-tipped antitank shells during the Gulf War and possible contamination of the environment of Kuwait. It was found that uranium concentrations in the soil samples ranged from 0.3 {mu}g/g to 1.85 {mu}g/g. The average value of 0.7 {mu}g/g was lower than the world average value of 2.1 {mu}g/g for surface soils. Its contribution to the total natural alpha radioactivity (excluding Rn and its short-lived daughters) varied from 1.1% to 14%. The solid fall-out samples showed higher uranium concentration which varied from 0.35 {mu}g/g to 1.73 {mu}/g (average 1.47 {mu}g/g) butmore » its contribution to the gross alpha radioactivity was in the same range, from 1.1 to 13.2%. The difference in the concentration of uranium in suspended air matter samples during the summer of 1993 and the winter of 1994 was found to be 2.0 {mu}g/g and 1.0 {mu}g/g, respectively. The uranium contribution to the natural alpha radioactivity in these samples was in the same range but lower for the winter period. The isotopic ratio of {sup 235}U to {sup 238}U for the measured samples was basically within an experimental error of {+-}0.001, close to the theoretical value of 0.007. The calculated total annual intake of uranium via inhalation for the Kuwait population was 0.07 Bq, e.g., 0.2% of the annual limit on intake. 13 refs., 1 fig., 3 tabs.« less

  9. Characterization of biosurfactants from indigenous soil bacteria recovered from oil contaminated sites.

    PubMed

    Kumar, Govind; Kumar, Rajesh; Sharma, Anita

    2015-09-01

    Three bacterial isolates (G1, G2 and G3) characterized as Pseudomonas plecoglossicida, Lysinibacillus fusiformis and Bacillus safensis were recovered from contaminated soil of oil refinery. These bacterial isolates produced biosurfactants in MSM medium in stationary phase. Biosurfactants were characterized on the basis of their emulsifying properties with petrol, diesel, mobil oil and petrol engine oil. Reduction in surface tension (below 40 mN m(-1)) and blood hemolysis were also included in biosurfactants characterization. Emulsification indices of G1, G2 and G3 were in the range of 98.82, 23.53 and 58.82 for petrol; 29.411,1.05 and 70.588 for diesel; 35.31, 2.93 and 17.60 for mobil oil and 35.284, 58.82 and 17.647 for petrol engine oil respectively. Dry weight of the extracted biosurfactant was 4.6, 1.4 and 2.4 g I(-1) for G1, G2 and G3 respectively. Structural analysis of the biosurfactants by Fourier Transform Infrared Spectroscopy (FTIR) revealed significant differences in the bonding pattern of individual biosurfactant.

  10. Evaluation of epithelial cell proliferating activity and fibroblast nuclear kariometry in recurrent pterygium treated with mitomycin C.

    PubMed

    Almeida Junior, Gildasio Castello de; Frederico, Fabio Batista; Watanabe, Karina Paula; Garcia, Tatiana Vanucci; Iquejiri, Angela Yuri; Cury, Patrícia Maluf; Taboga, Sebastião Roberto; Azoubel, Reinaldo

    2008-01-01

    To evaluate the effectiveness of mitomycin C (MMC) in preventing recurrence of pterygium following conjunctival autograft transplantation (CAT). Ki-67 antigen to evaluate epithelial cell proliferation and fibroblast nuclear kariometry were used to assist treatment evaluation. Twenty-nine patients with recurrent pterygium were divided into three groups: Group (G) 1--CAT and placebo eyedrops (PED); G2--CAT, 0.015% MMC subconjunctivally, and PED; G3--CAT and 0.02% MMC eyedrops. Immunohistochemistry for the Ki-67 antigen and fibroblast nuclei kariometry were performed on the excised tissue, divided into nasal and temporal sides. Kariometry was evaluated in terms of volume (Vl) and area (Ar) using at least 50 cells/patient. The percentage of positive epithelial cells for the Ki-67 antigen on the nasal and temporal side after treatment of the three groups were: nasal (5.39% G1, 4.49% G2, and 3.88% G3); temporal (3.30% G1, 4.46% G2, 4.14% G3), did not show significant differences. Fibroblast nucleus kariometry was: nasal Vl (792.1 mu3 G1, 605.1 mu3 G2, and 549.9 mu3 G3) and Ar (100.58 mu2 G1, 83.13 mu2 G2, and 78.41 mu2 G3). The three groups showed significant differences: p=0.039 and p=0.035, for respectively Vl and Ar, on the nasal side. After a six month of treatment, the three groups presented the following recurrence rates: G1, 22.22%, G2, 18.18% and G3, 33.33%, respectively. MMC did not reduce the number of positive epithelial cells for the Ki-67 antigen in recurrent pterygium, but decreased fibroblast nucleus volume and area on the nasal side of the pterygia. The number of positive epithelial cells for the Ki-67 antigen seemed not to be related to pterygium recurrence observed over a six-month post-surgery period. The role of epithelial cell proliferation in pterygium recurrence should be evaluated by further studies.

  11. Parenting practices and problem behavior across three generations: monitoring, harsh discipline, and drug use in the intergenerational transmission of externalizing behavior.

    PubMed

    Bailey, Jennifer A; Hill, Karl G; Oesterle, Sabrina; Hawkins, J David

    2009-09-01

    Using data from grandparents (G1), parents (G2), and children (G3), this study examined continuity in parental monitoring, harsh discipline, and child externalizing behavior across generations, and the contribution of parenting practices and parental drug use to intergenerational continuity in child externalizing behavior. Structural equation and path modeling of prospective, longitudinal data from 808 G2 participants, their G1 parents, and their school-age G3 children (n = 136) showed that parental monitoring and harsh discipline demonstrated continuity from G1 to G2. Externalizing behavior demonstrated continuity from G2 to G3. Continuity in parenting practices did not explain the intergenerational continuity in externalizing behavior. Rather, G2 adolescent externalizing behavior predicted their adult substance use, which was associated with G3 externalizing behavior. A small indirect effect of G1 harsh parenting on G3 was observed. Interparental abuse and socidemographic risk were included as controls but did not explain the intergenerational transmission of externalizing behavior. Results highlight the need for preventive interventions aimed at breaking intergenerational cycles in poor parenting practices. More research is required to identify parental mechanisms influencing the continuity of externalizing behavior across generations.

  12. DNA polymerases κ and ζ cooperatively perform mutagenic translesion synthesis of the C8–2′-deoxyguanosine adduct of the dietary mutagen IQ in human cells

    PubMed Central

    Bose, Arindam; Pande, Paritosh; Jasti, Vijay P.; Millsap, Amy D.; Hawkins, Edward K.; Rizzo, Carmelo J.; Basu, Ashis K.

    2015-01-01

    The roles of translesion synthesis (TLS) DNA polymerases in bypassing the C8–2′-deoxyguanosine adduct (dG-C8-IQ) formed by 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), a highly mutagenic and carcinogenic heterocyclic amine found in cooked meats, were investigated. Three plasmid vectors containing the dG-C8-IQ adduct at the G1-, G2- or G3-positions of the NarI site (5′-G1G2CG3CC-3′) were replicated in HEK293T cells. Fifty percent of the progeny from the G3 construct were mutants, largely G→T, compared to 18% and 24% from the G1 and G2 constructs, respectively. Mutation frequency (MF) of dG-C8-IQ was reduced by 38–67% upon siRNA knockdown of pol κ, whereas it was increased by 10–24% in pol η knockdown cells. When pol κ and pol ζ were simultaneously knocked down, MF of the G1 and G3 constructs was reduced from 18% and 50%, respectively, to <3%, whereas it was reduced from 24% to <1% in the G2 construct. In vitro TLS using yeast pol ζ showed that it can extend G3*:A pair more efficiently than G3*:C pair, but it is inefficient at nucleotide incorporation opposite dG-C8-IQ. We conclude that pol κ and pol ζ cooperatively carry out the majority of the error-prone TLS of dG-C8-IQ, whereas pol η is involved primarily in its error-free bypass. PMID:26220181

  13. Airborne Pointing and Tracking Systems Open Port Design and Modification Analysis

    DTIC Science & Technology

    1976-04-01

    into 1 gives n 2: FX = S Ujk co8 2G + k. sin2G.) + 6v(k -kJslnG. cosG. - G, kt R sinG.] i=l n ZFy = ^ [ ^^r"^) 8inei co8ei + 6y...sinei cos6. = 0 Ul i=l i^l (4) and n n 1 Sin2ei 1 2 cos e. 1=1 And Equation 3 reduces to i=l n^ 2 (5) ! £ Fx - f (kr + V...Bornhorst) AFAPL (CC/D. Cheatom, Jr.) CINCSAC (INEP) ARL (AP/Lt Col Duggins) AFFDL ( FX /Dr. VanKuren) AFFTD (PDTR/Lt Faehl) AFFTC (ETEO/R. Buxton) AF

  14. Effect of diode lasers with wavelength of 445 and 980 nm on a temperature rise when uncovering implants for second stage surgery: An ex-vivo study in pigs.

    PubMed

    Matys, Jacek; Flieger, Rafał; Dominiak, Marzena

    2017-07-01

    Many surgical procedures in soft tissue are performed using diode lasers. Recently, a novel diode laser operating at 445 nm wavelength was introduced in dentistry. The aim of our study was to evaluate the time of surgery and an increase in temperature of titanium implants during its uncovering using 445 and 980 nm wavelengths. The research included 45 pig mandibles (n = 45). The specimens were randomly divided into 3 groups (n = 15) according to the laser irradiation mode and wavelength; G1 - 445 nm laser, power: 3 W, continuous wave (CW), distance: 2 mm, power density: 7460 W/cm2, fiber: 320 μm, noncontact mode; G2 - 445 nm laser (power: 2 W, CW, power density: 4970 W/cm2, fiber: 320 μm, contact mode; G3 (control) - 980 nm laser, power: 2.5 W, CW, power density: 15920 W/cm2, fiber: 200 μm, contact mode. The temperature was measured with a 2 K-type thermocouples (a P1 at collar and a P2 at mid height of the implant). The mean temperature rises measured by the P1 thermocouple were 16.9°C, 36.1°C and 21.6°C in the G1, G2 and G3 group, respectively. Significant differences in temperature rise were found between the G1 and G2 group (p = 0.0007) and the G2 and G3 group (p = 0.01). The mean temperature rises measured by the P2 thermocouple were 1.8°C, 1.4°C and 5.6°C in the G1, G2 and G3 group, respectively. Significant differences in temperature rise were found between the G1 and the G2 or G3 group (p = 0.0001). The significant differences among the study groups in average time necessary for uncovering the implants amounted to 69.7, 54.4 and 83.6 s, respectively (p < 0.05). The application of the 445 nm diode laser in non-contact mode reduced the temperature rise of the implants. The additional pulse intervals during laser irradiation with wavelength of 445 nm when operating in contact mode are needed.

  15. Diversity of rotavirus strains circulating in children under 5 years of age admitted to hospital for acute gastroenteritis in Morocco, June 2006 to May 2009.

    PubMed

    Benhafid, Mohammed; Elomari, Nezha; Elqazoui, Maria; Meryem, Azzouzi Idrissi; Rguig, Ahmed; Filali-Maltouf, Abdelkarim; Elaouad, Rajae

    2013-02-01

    Rotavirus vaccine was introduced in Morocco during 2010. In anticipation of introducing rotavirus vaccines, the Ministry of Health in Morocco established a rotavirus surveillance network in June 2006 at four hospitals in Morocco to obtain baseline data on rotavirus disease burden and prevalent strains. From June 2006 to May 2009, stool samples were collected from children under 5 years of age admitted for diarrhea to four sentinel hospitals serving different regions of Morocco. Rotaviruses were detected in stools using enzyme immunoassay, then genotyped by reverse-transcriptase polymerase chain reaction. Samples with adequate stool in which the P or G types could not be determined by RT-PCR were subjected to nucleotide sequence analysis. Overall, 42% (579 of 1,388) of the stools samples tested were positive for rotavirus. Genotyping of 548 (95%) samples demonstrated that G1P[8] (55%) was the most prevalent strain, followed by G9P[8] (11.3%), G2P[4] (9.1%), G4P[8] (0.9%), and G3P[8] (0.4%). Several other strains were identified including G1P[4] (0.2%), G1P[6] (0.9%), G2P[6] (4.3%), G2P[8] (0.2%), G3P[6] (0.4%), G3P[4] (0.2%), and G9P[6] (0.2%). A high prevalence of mixed infections was found (15% of all samples) of which G1G2P[8] (4%) and G1G3P[8] (3.6%) accounted for the majority. Considerable diversity of rotavirus genotypes was present among strains circulating in Morocco prior to the introduction of the vaccine. This study highlighted the need for maintaining active surveillance to monitor changes in rotavirus disease burden and strain dynamics and to detect changes over time that could impact the effectiveness of the vaccination program. Copyright © 2012 Wiley Periodicals, Inc.

  16. Photobiomodulation changes type 1 collagen gene expression by pulp fibroblasts

    NASA Astrophysics Data System (ADS)

    Lourenço Ribeiro Vitor, Luciana; Tavares Oliveira Prado, Mariel; Lourenço Neto, Natalino; Cardoso de Oliveira, Rodrigo; Ferreira Santos, Carlos; Moreira Machado, Maria Aparecida Andrade; Marchini Oliveira, Thais

    2018-06-01

    This study aimed to evaluate type 1 collagen (COL1) gene expression by human pulp fibroblasts from primary teeth (HPF) after the variation of photobiomodulation (PBM) parameters. HPF were obtained from a biorepository, used at 4th passage, and irradiated (InGaAlP—660 nm) varying the power and application time according to the following groups: G1: 1.2 J cm‑2–05 mW–10 s G2: 2.5 J cm‑2–05 mW–20 s G3: 3.7 J cm‑2–05 mW–30 s G4: 5.0 J cm‑2–05 mW–40 s G5: 6.2 J cm‑2–05 mW–50 s G6: 2.5 J cm‑2–10 mW–10 s G7: 3.7 J cm‑2–15 mW–10 s G8: 5.0 J cm‑2–20 mW–10 s G9: 6.2 J cm‑2–25 mW–10 s. The control group (G10) was not irradiated and maintained with DMEM  +  10% SFB. RT-PCR was used to evaluate COL1 gene expression at 6, 12, and 24 h after irradiation. Intra- and intergroup comparisons were performed by two-way ANOVA followed by Tukey test (p  <  0.05). The intragroup comparison showed statistically significant differences among periods (p  <  0.05). In G1, G9, and G10 higher COL1 gene expression occurred at 12 h (p  =  0.07), while in G2 to G8, the peak of higher expression occurred at 6 h (p  =  0.02). The intergroup comparison did not show statistically significant differences (p  >  0.05). The energy densities from 2.5 to 5 J cm‑2, regardless of the variation in PBM parameters, biomodulated the COL1 gene expression. At the energy density of 6.2 J cm‑2, longer application time and smaller power changed the pattern of COL1 gene expression by pulp fibroblasts from human primary teeth.

  17. OVA-bound nanoparticles induce OVA-specific IgG1, IgG2a, and IgG2b responses with low IgE synthesis.

    PubMed

    Yanase, Noriko; Toyota, Hiroko; Hata, Kikumi; Yagyu, Seina; Seki, Takahiro; Harada, Mitsunori; Kato, Yasuki; Mizuguchi, Junichiro

    2014-10-14

    There is an urgent requirement for a novel vaccine that can stimulate immune responses without unwanted toxicity, including IgE elevation. We examined whether antigen ovalbumin (OVA) conjugated to the surface of nanoparticles (NPs) (OVA-NPs) with average diameter of 110nm would serve as an immune adjuvant. When BALB/c mice were immunized with OVA-NPs, they developed sufficient levels of OVA-specific IgG1 antibody responses with low levels of IgE synthesis, representing helper T (Th)2-mediated humoral immunity. OVA-specific IgG2a and IgG2b responses (i.e., Th1-mediated immunity) were also induced by secondary immunization with OVA-NPs. As expected, immunization with OVA in alum (OVA-alum) stimulated humoral immune responses, including IgG1 and IgE antibodies, with only low levels of IgG2a/IgG2b antibodies. CD4-positive T cells from mice primed with OVA-NPs produced substantial levels of IL-21 and IL-4, comparable to those from OVA-alum group. The irradiated mice receiving OVA-NPs-primed B cells together with OVA-alum-primed T cells exhibited enhanced anti-OVA IgG2b responses relative to OVA-alum-primed B cells and T cells following stimulation with OVA-NPs. Moreover, when OVA-NPs-primed, but not OVA-alum-primed, B cells were cultured in the presence of anti-CD40 monoclonal antibody, IL-4, and IL-21, or LPS plus TGF-β in vitro, OVA-specific IgG1 or IgG2b antibody responses were elicited, suggesting that immunization with OVA-NPs modulates B cells to generate IgG1 and IgG2b responses. Thus, OVA-NPs might exert their adjuvant action on B cells, and they represent a promising potential vaccine for generating both IgG1 and IgG2a/IgG2b antibody responses with low IgE synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Insights from LGI1 and CASPR2 potassium channel complex autoantibody subtyping.

    PubMed

    Klein, Christopher J; Lennon, Vanda A; Aston, Paula A; McKeon, Andrew; O'Toole, Orna; Quek, Amy; Pittock, Sean J

    2013-02-01

    To determine, in patients identified as seropositive for neuronal voltage-gated potassium channel (VGKC) complex autoantibodies, the spectrum of clinical presentations and frequency of leucine-rich glioma-inactivated protein 1 (LGI1) and contactin-associated protein-like 2 (CASPR2) as defined antigenic neuronal targets in the VGKC macromolecular complex. Retrospective cohort study. Clinical practice, Mayo Clinic Neuroimmunology Laboratory and Department of Neurology. A total of 54 853 patients were evaluated, of whom 1992 were found to be VGKC complex IgG positive. From June 1, 2008, to June 30, 2010, comprehensive service serologic evaluation performed on 54853 patients with unexplained neurologic symptoms identified 1992 patients (4%) who were positive for VGKC complex IgG (values ≥ 0.03 nmol/L). Among 316 seropositive patients evaluated clinically at our institution, 82 (26%) were seropositive for LGI1 IgG and/or CASPR2 IgG. Of these 82 patients, 27% had low (0.03-0.09 nmol/L), 51% had medium (0.10-0.99 nmol/L), and 22% had high (≥ 1.00 nmol/L) VGKC complex IgG values. Leucine-rich glioma-inactivated protein 1 IgG positivity was associated with higher VGKC complex IgG values (P< .001) and cortical presentations (P< .001); CASPR2 IgG was associated with peripheral motor excitability (P= .009). However, neither autoantibody was pathognomonic for a specific neurologic presentation or correlated significantly with cancer. Neurologic phenotypes were diverse. Cerebrocortical manifestations (including cognitive impairment and seizures) were recorded in 76% of patients with LGI1 IgG alone (n=46) and 29% with CASPR2 IgG alone (n=28). Peripheral motor hyperexcitability was found in 21% of patients with CASPR2 IgG alone and 6.5% of patients with LGI1 IgG alone. The study emphasizes diverse and overlapping neurologic phenotypes across a range of VGKC complex IgG values and varying LGI1 IgG and CASPR2 IgG specificities. The frequent occurrence of LGI1 IgG and CASPR2 IgG in serum samples with low and medium VGKC complex IgG values supports the clinical significance of low values in clinical evaluation. Additional antigenic components of VGKC macromolecular complexes remain to be defined.

  19. Insights From LGI1 and CASPR2 Potassium Channel Complex Autoantibody Subtyping

    PubMed Central

    Klein, Christopher J.; Lennon, Vanda A.; Aston, Paula A.; McKeon, Andrew; O’Toole, Orna; Quek, Amy; Pittock, Sean J.

    2014-01-01

    Objective: To determine, in patients identified as sero-positive for neuronal voltage-gated potassium channel (VGKC) complex autoantibodies, the spectrum of clinical presentations and frequency of leucine-rich glioma-inactivated protein 1 (LGI1) and contactin-associated protein-like 2 (CASPR2) as defined antigenic neuronal targets in the VGKC macromolecular complex. Design: Retrospective cohort study. Setting: Clinical practice, Mayo Clinic Neuroimmunology Laboratory and Department of Neurology. Patients: A total of 54853 patients were evaluated, of whom 1992 were found to be VGKC complex IgG positive. Results: From June 1, 2008, to June 30, 2010, comprehensive service serologic evaluation performed on 54 853 patients with unexplained neurologic symptoms identified 1992 patients (4%) who were positive for VGKC complex IgG (values ≥0.03 nmol/L). Among 316 seropositive patients evaluated clinically at our institution, 82 (26%) were seropositive for LGI1 IgG and/or CASPR2 IgG. Of these 82 patients, 27% had low (0.03-0.09 nmol/L), 51% had medium (0.10-0.99 nmol/L), and 22% had high (≥1.00 nmol/L) VGKC complex IgG values. Leucine-rich glioma-inactivated protein 1 IgG positivity was associated with higher VGKC complex IgG values (P<.001) and cortical presentations (P<.001); CASPR2 IgG was associated with peripheral motor excitability (P=.009). However, neither autoantibody was pathognomonic for a specific neurologic presentation or correlated significantly with cancer. Neurologic phenotypes were diverse. Cerebrocortical manifestations (including cognitive impairment and seizures) were recorded in 76% of patients with LGI1 IgG alone (n=46) and 29% with CASPR2 IgG alone (n=28). Peripheral motor hyperexcitability was found in 21% of patients with CASPR2 IgG alone and 6.5% of patients with LGI1 IgG alone. Conclusions: The study emphasizes diverse and overlapping neurologic phenotypes across a range of VGKC complex IgG values and varying LGI1 IgG and CASPR2 IgG specificities. The frequent occurrence of LGI1 IgG and CASPR2 IgG in serum samples with low and medium VGKC complex IgG values supports the clinical significance of low values in clinical evaluation. Additional antigenic components of VGKC macromolecular complexes remain to be defined. PMID:23407760

  20. Pretreatment and hydrolysis methods for recovery of fermentable sugars from de-oiled Jatropha waste.

    PubMed

    Kumar, Gopalakrishnan; Sen, Biswarup; Lin, Chiu-Yue

    2013-10-01

    The release of reducing sugars (RS) upon various pretreatments and hydrolysis methods from de-oiled Jatropha waste (DJW) was studied. The highest RS concentration of 12.9 g/L was observed at 10% enzyme hydrolysis. The next highest RS of 8.0 g/L and 7.8 g/L were obtained with 10% HCl and 2.5% H2SO4, respectively. The NaOH (2.5%), ultrasonication and heat (90°C for 60 min) treatments showed the RS concentration of 2.5 g/L, 1.1 g/L and 2.0 g/L, respectively. Autoclave treatment slightly enhanced the sugar release (0.9 g/L) compared to no treatment (0.7 g/L). Glucose release (11.4 g/L) peaked in enzyme hydrolysis. Enzyme treated acid unhydrolysed biomass showed 11.1 g/L RS. HCl and H2SO4 pretreatment gave maximal xylose (6.89 g/L and 6.16 g/L, respectively). Combined (acid and enzyme) hydrolysis employed was efficient and its subsequent batch hydrogen fermentation showed a production 3.1 L H2/L reactor. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Comparison of enamel remineralization potential after application of titanium tetra fluoride and carbon dioxide laser

    PubMed Central

    Fekrazad, Reza; Najafi, Ahmad; Mahfar, Ramona; Namdari, Mahshid

    2017-01-01

    Background and Aims The aim was comparison of enamel remineralization after application of APF, TiF4 and CO2 laser alone or in combination. Materials and Methods Enamel blocks were prepared from human third molars. The initial surface hardness was determined by Vicker's hardness tester. The samples underwent a demineralization regimen for 7 days to produce artificial initial caries. The hardness of enamel blocks with white spot lesions was measured, and the samples which had the mean hardness change of 65–90%, were selected, and randomly divided into 5 groups (N=15): G1: control; G2: APF 1.23%; G3: TiF4 4%; G4: TiF4 4% followed by CO2 laser (10.6 µm wavelength, 1 W peak power, 10 ms pulse duration, 500 ms repeat time, 0.2 mm beam spot size, 2 cm distance); G5: CO2 laser (same parameters) followed by TiF4 4%. Surface hardness recovery was measured after the treatments. Three samples in each group were observed under scanning electron microscope at ×1,000 magnification. Data were analyzed by repeated measure ANOVA and Bonferrouni tests. Significance level was set at 0.05. Results G2, G3, G4 indicated significant differences with control and G5 (p<0.05). Surface hardness in G5 was not significantly different from control (p=0.7) in enamel hardness test. There was not a significant difference between G2 & G3, G2 & G4, and G3 & G4 (p=1). The SEM results indicated globules of calcium fluoride on the surface in G2, and a smooth glaze-like surface layer in G3 and G4. In G5, some micro-cracks without any glaze-like layer were observed. Conclusions APF, TiF4 and TiF4 before CO2 laser irradiation significantly increased the micro-hardness of initially demineralized enamel surfaces. CO2 laser irradiation before TiF4 application could not remineralize the white-spot lesions. PMID:28785131

  2. Effects of Blood Flow and/or Ventilation Restriction on Radiofrequency Coagulation Size in the Lung: An Experimental Study in Swine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anai, Hiroshi; Uchida, Barry T.; Pavcnik, Dusan, E-mail: pavcnikd@ohsu.edu

    2006-10-15

    The purpose of this study was to investigate how the restriction of blood flow and/or ventilation affects the radiofrequency (RF) ablation coagulation size in lung parenchyma. Thirty-one RF ablations were done in 16 normal lungs of 8 living swine with 2-cm LeVeen needles. Eight RF ablations were performed as a control (group G1), eight with balloon occlusion of the ipsilateral mainstem bronchus (G2), eight with occlusion of the ipsilateral pulmonary artery (G3), and seven with occlusion of both the ipsilateral bronchus and pulmonary artery (G4). Coagulation diameters and volumes of each ablation zone were compared on computed tomography (CT) andmore » gross specimen examinations. Twenty-six coagulation zones were suitable for evaluation: eight in G1, five in G2, seven in G3, and six in G4 groups. In G1, the mean coagulation diameter was 21.5 {+-} 3.5 mm on CT and 19.5 {+-} 1.78 mm on gross specimen examination. In G2, the mean diameters were 26.5 {+-} 5.1 mm and 23.0 {+-} 2.7 mm on CT and gross specimen examination, respectively. In G3, the mean diameters were 29.4 {+-} 2.2 mm and 27.4 {+-} 2.9 mm on CT and gross specimen examination, respectively, and in G4, they were 32.6 {+-} 3.33 mm and 28.8 {+-} 2.6 mm, respectively. The mean coagulation volumes were 3.39 {+-} l.52 cm{sup 3} on CT and 3.01 {+-} 0.94 cm{sup 3} on gross examinations in G1, 6.56 {+-} 2.47 cm{sup 3} and 5.22 {+-} 0.85 cm{sup 3} in G2, 10.93 {+-} 2.17 cm{sup 3} and 9.97 {+-} 2.91 cm{sup 3} in G3, and 13.81 {+-} 3.03 cm{sup 3} and 11.06 {+-} 3.27 cm{sup 3} in G4, respectively. The mean coagulation diameters on gross examination and mean coagulation volumes on CT and gross examination with G3 and G4 were significantly larger than those in G1 (p < 0.0001, p < 0.0001, p < 0.0001, respectively) or in G2 (p < 0.05, p < 0.005, p < 0.005, respectively). Pulmonary collapse occurred in one lung in G2 and pulmonary artery thrombus in two lungs of G3 and two lungs of G4. The coagulation size of RF ablation of the lung parenchyma is increased by ventilation and particularly by pulmonary artery blood flow restriction. The value of these restrictions for potential clinical use needs to be explored in experimentally induced lung tumors.« less

  3. Geohydrologic data from test hole USW UZ-7, Yucca Mountain area, Nye County, Nevada

    USGS Publications Warehouse

    Kume, Jack; Hammermeister, D.P.

    1990-01-01

    This report contains a description of the methods used in drilling and coring of the test-hole USW UZ-7, a description of the methods used in collecting, handling, and testing of test-hole samples; Lithologic information from the test hole; and water-content, water-potential, bulk-density, grain-density, porosity, and tritium data for the test hole. Test-hole USW UZ-7 was drilled and cored to a total depth of 62.94 m. The drilling was done using air as a drilling fluid to minimize disturbance to the water content of cores, drill-bit cuttings, and borehole wall-rock. Beginning at the land surface, the unsaturated-zone rock that was penetrated consisted of alluvium; welded and partially to nonwelded ash-flow tuff; bedded and reworked ash-fall tuff; nonwelded ash-flow tuff; and welded ash-flow tuff. Values of gravimetric water content and water potential of alluvium were intermediate between the extreme values in welded and nonwelded units of tuff. Gravimetric water content was largest in bedded and nonwelded ash-fall tuffs and was smallest in welded ash-flow tuff. Values of water potential were more negative in densely welded ash-flow tuffs and were less negative in bedded and nonwelded ash-fall tuffs. Bulk density was largest in densely welded ash-flow tuffs and smallest in nonwelded and bedded ash-fall tuffs. Grain density was uniform but was slightly larger in nonwelded and bedded ash-fall tuffs than in welded ash-flow tuffs. Porosity trends were opposite to bulk-density trends. Tritium content in alluvium was smallest near the alluvium-bedrock contact, markedly increased in the middle of the deposit, and decreased in the near-surface zone of the deposit. (Author 's abstract)

  4. Autoimmune thyroiditis in children and adolescents with type 1 diabetes mellitus is associated with elevated IgG4 but not with low vitamin D.

    PubMed

    Demir, Korcan; Keskin, Mehmet; Kör, Yilmaz; Karaoğlan, Murat; Bülbül, Özlem Gümüştekin

    2014-01-01

    To assess levels of vitamin D and of immunoglobulin G subclasses in children and adolescents with type 1 Diabetes Mellitus with or without autoimmune thyroiditis. Among 213 patients with type 1 diabetes, the cases with thyroid-specific autoantibodies formed Group 1 [n=19, M/F: 7/12, median age 13 years (10.1-14.7)]. Nineteen age-, gender-, and diabetes duration-matched cases with type 1 diabetes without any other systemic disease were designated as controls [Group 2, M/F: 7/12, median age 12.9 years (10.5-14.9)]. Levels of thyroid hormones, vitamin D, total IgG and IgG subclasses, as well as IgG subclasses/total IgG ratios were similar between the groups. Five cases (26%) in Group 1 had IgG4 levels > + 2 SDS, whereas there were no such cases in Group 2 (p=0.046). These five patients had similar clinical features but higher median IgG4 levels and IgG4/Total IgG ratios compared to the subjects with IgG4 levels < + 2 SDS in Group 1 and Group 2. There was no difference of vitamin D levels between the groups. Only a small percentage of patients with type 1 diabetes also having autoimmune thyroiditis had elevated serum IgG4 levels, revealing the heterogeneity of autoimmune thyroiditis and existence of IgG4 thyroiditis in the pediatric age group. Total IgG, the other IgG subclasses, and vitamin D levels did not differ in patients with autoimmune thyroiditis and type 1 diabetes compared to those suffering only from type 1 diabetes.

  5. Energy management by enhanced glycolysis in G1-phase in human colon cancer cells in vitro and in vivo.

    PubMed

    Bao, Yan; Mukai, Kuniaki; Hishiki, Takako; Kubo, Akiko; Ohmura, Mitsuyo; Sugiura, Yuki; Matsuura, Tomomi; Nagahata, Yoshiko; Hayakawa, Noriyo; Yamamoto, Takehiro; Fukuda, Ryo; Saya, Hideyuki; Suematsu, Makoto; Minamishima, Yoji Andrew

    2013-09-01

    Activation of aerobic glycolysis in cancer cells is well known as the Warburg effect, although its relation to cell- cycle progression remains unknown. In this study, human colon cancer cells were labeled with a cell-cycle phase-dependent fluorescent marker Fucci to distinguish cells in G1-phase and those in S + G2/M phases. Fucci-labeled cells served as splenic xenograft transplants in super-immunodeficient NOG mice and exhibited multiple metastases in the livers, frozen sections of which were analyzed by semiquantitative microscopic imaging mass spectrometry. Results showed that cells in G1-phase exhibited higher concentrations of ATP, NADH, and UDP-N-acetylglucosamine than those in S and G2-M phases, suggesting accelerated glycolysis in G1-phase cells in vivo. Quantitative determination of metabolites in cells synchronized in S, G2-M, and G1 phases suggested that efflux of lactate was elevated significantly in G1-phase. By contrast, ATP production in G2-M was highly dependent on mitochondrial respiration, whereas cells in S-phase mostly exhibited an intermediary energy metabolism between G1 and G2-M phases. Isogenic cells carrying a p53-null mutation appeared more active in glycolysis throughout the cell cycle than wild-type cells. Thus, as the cell cycle progressed from G2-M to G1 phases, the dependency of energy production on glycolysis was increased while the mitochondrial energy production was reciprocally decreased. These results shed light on distinct features of the phase-specific phenotypes of metabolic systems in cancer cells. ©2013 AACR.

  6. Parent and Grandparent Marijuana Use and Child Substance Use and Norms

    PubMed Central

    Bailey, Jennifer A.; Hill, Karl G.; Guttmannova, Katarina; Epstein, Marina; Abbott, Robert D.; Steeger, Christine M.; Skinner, Martie L.

    2016-01-01

    Purpose Using prospective longitudinal data from 3 generations, this study seeks to test whether and how parent and grandparent marijuana use (current and prior) predicts an increased likelihood of child cigarette, alcohol, and marijuana use. Methods Using multilevel modeling of prospective data spanning 3 generations (N = 306 families, children ages 6-22), this study tested associations between grandparent (G1) and parent (G2) marijuana use and child (G3) past-year cigarette, alcohol, and marijuana use. Analyses tested whether G3 substance-related norms mediated these associations. Current G1 and G2 marijuana use was examined, as was G2 high school and early adult use and G1 marijuana use when G2 parents were in early adolescence. Controls included G2 age at G3 birth, G2 education and depression, and G3 gender. Results G2 current marijuana use predicted a higher likelihood of G3 alcohol and marijuana use, but was not related to the probability of G3 cigarette use. G3's perceptions of their parents' norms and G2 current marijuana use both contributed independently to the likelihood of G3 alcohol and marijuana use when included in the same model. G3 children's own norms and their perceptions of friends' norms mediated the link between G2 current marijuana use and G3 alcohol and marijuana use. Conclusions Results are discussed in light of the growing trend toward marijuana legalization. To the extent that parent marijuana use increases under legalization, we can expect more youth to use alcohol and marijuana and to have norms that favor substance use. PMID:27265424

  7. Associations Between Parental and Grandparental Marijuana Use and Child Substance Use Norms in a Prospective, Three-Generation Study.

    PubMed

    Bailey, Jennifer A; Hill, Karl G; Guttmannova, Katarina; Epstein, Marina; Abbott, Robert D; Steeger, Christine M; Skinner, Martie L

    2016-09-01

    Using prospective longitudinal data from three generations, this study seeks to test whether and how parent and grandparent marijuana use (current and prior) predicts an increased likelihood of child cigarette, alcohol, and marijuana use. Using multilevel modeling of prospective data spanning three generations (n = 306 families, children ages 6-22), this study tested associations between grandparent (G1) and parent (G2) marijuana use and child (G3) past-year cigarette, alcohol, and marijuana use. Analyses tested whether G3 substance-related norms mediated these associations. Current G1 and G2 marijuana use was examined, as was G2 high school and early adult use and G1 marijuana use when G2 parents were in early adolescence. Controls included G2 age at G3 birth, G2 education and depression, and G3 gender. G2 current marijuana use predicted a higher likelihood of G3 alcohol and marijuana use but was not related to the probability of G3 cigarette use. G3's perceptions of their parents' norms and G2 current marijuana use both contributed independently to the likelihood of G3 alcohol and marijuana use when included in the same model. G3 children's own norms and their perceptions of friends' norms mediated the link between G2 current marijuana use and G3 alcohol and marijuana use. Results are discussed in light of the growing trend toward marijuana legalization. To the extent that parent marijuana use increases under legalization, we can expect more youth to use alcohol and marijuana and to have norms that favor substance use. Copyright © 2016 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

  8. Absolute Quantitation of Glycoforms of Two Human IgG Subclasses Using Synthetic Fc Peptides and Glycopeptides

    NASA Astrophysics Data System (ADS)

    Roy, Rini; Ang, Evelyn; Komatsu, Emy; Domalaon, Ronald; Bosseboeuf, Adrien; Harb, Jean; Hermouet, Sylvie; Krokhin, Oleg; Schweizer, Frank; Perreault, Hélène

    2018-05-01

    Immunoglobulins, such as immunoglobulin G (IgG), are of prime importance in the immune system. Polyclonal human IgG comprises four subclasses, of which IgG1 and IgG2 are the most abundant in healthy individuals. In an effort to develop an absolute MALDI-ToF-MS quantitative method for these subclasses and their Fc N-glycoforms, (glyco)peptides were synthesized using a solid-phase approach and used as internal standards. Tryptic digest glycopeptides from monoclonal IgG1 and IgG2 samples were first quantified using EEQYN(GlcNAc)STYR and EEQFN(GlcNAc)STFR standards, respectively. For IgG1, a similar glycopeptide where tyrosine (Y) was isotopically labelled was used to quantify monoclonal IgG1 that had been treated with the enzyme Endo-F2, i.e., yielding tryptic glycopeptide EEQYN(GlcNAc)STYR. The next step was to quantify single subclasses within polyclonal human IgG samples. Although ion abundances in the MALDI spectra often showed higher signals for IgG2 than IgG1, depending on the spotting solvent used, determination of amounts using the newly developed quantitative method allowed to obtain accurate concentrations where IgG1 species were predominant. It was observed that simultaneous analysis of IgG1 and IgG2 yielded non-quantitative results and that more success was obtained when subclasses were quantified one by one. More experiments served to assess the respective extraction and ionization efficiencies of EEQYNSTYR/EEQFNSTFR and EEQYN(GlcNAc)STYR/EEQFN(GlcNAc)STFR mixtures under different solvent and concentration conditions.

  9. The Post-periapsis Evolution of Galactic Center Source G1: The Second Case of a Resolved Tidal Interaction with a Supermassive Black Hole

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Witzel, G.; Sitarski, B. N.; Ghez, A. M.

    We present new adaptive optics (AO) imaging and spectroscopic measurements of Galactic center source G1 from W. M. Keck Observatory. Our goal is to understand its nature and relationship to G2, which is the first example of a spatially resolved object interacting with a supermassive black hole (SMBH). Both objects have been monitored with AO for the past decade (2003–2014) and are comparatively close to the black hole ( a {sub min} ∼ 200–300 au) on very eccentric orbits ( e {sub G1} ∼ 0.99; e {sub G2} ∼ 0.96). While G2 has been tracked before and during periapsis passagemore » ( T {sub 0} ∼ 2014.2), G1 has been followed since soon after emerging from periapsis ( T {sub 0} ∼ 2001.3). Our observations of G1 double the previously reported observational time baseline, which improves its orbital parameter determinations. G1's orbital trajectory appears to be in the same plane as that of G2 but with a significantly different argument of periapsis (Δ ω = 21° ± 4°). This suggests that G1 is an independent object and not part of a gas stream containing G2, as has been proposed. Furthermore, we show for the first time that (1) G1 is extended in the epochs closest to periapsis along the direction of orbital motion, and (2) it becomes significantly smaller over time (450 au in 2004 to less than 170 au in 2009). Based on these observations, G1 appears to be the second example of an object tidally interacting with an SMBH. G1's existence 14 yr after periapsis, along with its compactness in epochs further from the time of periapsis, suggest that this source is stellar in nature.« less

  10. Excited singlet molecular O2 (1Δg) is generated enzymatically from excited carbonyls in the dark

    PubMed Central

    Mano, Camila M.; Prado, Fernanda M.; Massari, Júlio; Ronsein, Graziella E.; Martinez, Glaucia R.; Miyamoto, Sayuri; Cadet, Jean; Sies, Helmut; Medeiros, Marisa H. G.; Bechara, Etelvino J. H.; Di Mascio, Paolo

    2014-01-01

    In mammalian tissues, ultraweak chemiluminescence arising from biomolecule oxidation has been attributed to the radiative deactivation of singlet molecular oxygen [O2 (1Δg)] and electronically excited triplet carbonyl products involving dioxetane intermediates. Herein, we describe evidence of the generation of O2 (1Δg) in aqueous solution via energy transfer from excited triplet acetone. This involves thermolysis of 3,3,4,4-tetramethyl-1,2-dioxetane, a chemical source, and horseradish peroxidase-catalyzed oxidation of 2-methylpropanal, as an enzymatic source. Both sources of excited carbonyls showed characteristic light emission at 1,270 nm, directly indicative of the monomolecular decay of O2 (1Δg). Indirect analysis of O2 (1Δg) by electron paramagnetic resonance using the chemical trap 2,2,6,6-tetramethylpiperidine showed the formation of 2,2,6,6-tetramethylpiperidine-1-oxyl. Using [18O]-labeled triplet, ground state molecular oxygen [18O2 (3Σg-)], chemical trapping of 18O2 (1Δg) with disodium salt of anthracene-9,10-diyldiethane-2,1-diyl disulfate yielding the corresponding double-[18O]-labeled 9,10-endoperoxide, was detected through mass spectrometry. This corroborates formation of O2 (1Δg). Altogether, photoemission and chemical trapping studies clearly demonstrate that chemically and enzymatically nascent excited carbonyl generates 18O2 (1Δg) by triplet-triplet energy transfer to ground state oxygen O2 (3Σg−), and supports the long formulated hypothesis of O2 (1Δg) involvement in physiological and pathophysiological events that might take place in tissues in the absence of light. PMID:25087485

  11. pH and calcium ion release evaluation of pure and calcium hydroxide-containing Epiphany for use in retrograde filling

    PubMed Central

    TANOMARU-FILHO, Mário; SAÇAKI, Juliana Nogueira; FALEIROS, Frederico Bordini Chaves; GUERREIRO-TANOMARU, Juliane Maria

    2011-01-01

    Objective Hydroxyl (OH-) and calcium (Ca++) ion release was evaluated in six materials: G1) Sealer 26, G2) White mineral trioxide aggregate (MTA), G3) epiphany, G4) epiphany + 10% calcium hydroxide (CH), G5) epiphany + 20% CH, and G6) zinc oxide and eugenol. Material and Methods Specimens were placed in polyethylene tubes and immersed in distilled water. After 3, 6, 12, 24, and 48 h, 7, 14, and 28 days, the water was assessed for pH with a pH meter and for Ca++ release by atomic absorption spectrophotometry. Results G1, G2, G4, and G5 had the highest pH until 14 days (p<0.05). G1 presented the highest Ca++ release until 6 h, and G4 and G5, from 12 h through 14 days. Ca++ release was greater for G1 and G2 at 28 days. G6 released the least Ca++. Conclusion MTA, Sealer 26, epiphany, and epiphany + CH release OH - and Ca++ ions. Epiphany + CH may be an alternative as retrofilling material. PMID:21437461

  12. Linking Substance Use and Problem Behavior across Three Generations

    ERIC Educational Resources Information Center

    Bailey, Jennifer A.; Hill, Karl G.; Oesterle, Sabrina; Hawkins, J. David

    2006-01-01

    This study examined patterns of between-generation continuity in substance use from generation 1 (G1) parents to generation 2 (G2) adolescents and from G2 adult substance use and G1 substance use to generation 3 (G3) problem behavior in childhood. Structural equation modeling of prospective, longitudinal data from 808 participants, their parents,…

  13. As, Cd, Cr, Ni and Pb pressurized liquid extraction with acetic acid from marine sediment and soil samples

    NASA Astrophysics Data System (ADS)

    Moreda-Piñeiro, Jorge; Alonso-Rodríguez, Elia; López-Mahía, Purificación; Muniategui-Lorenzo, Soledad; Prada-Rodríguez, Darío; Moreda-Piñeiro, Antonio; Bermejo-Barrera, Adela; Bermejo-Barrera, Pilar

    2006-12-01

    Rapid leaching procedures by Pressurized Liquid Extraction (PLE) have been developed for As, Cd, Cr, Ni and Pb leaching from environmental matrices (marine sediment and soil samples). The Pressurized Liquid Extraction is completed after 16 min. The released elements by acetic acid Pressurized Liquid Extraction have been evaluated by inductively coupled plasma-optical emission spectrometry. The optimum multi-element leaching conditions when using 5.0 ml stainless steel extraction cells, were: acetic acid concentration 8.0 M, extraction temperature 100 °C, pressure 1500 psi, static time 5 min, flush solvent 60%, two extraction steps and 0.50 g of diatomaceous earth as dispersing agent (diatomaceous earth mass/sample mass ratio of 2). Results have showed that high acetic acid concentrations and high extraction temperatures increase the metal leaching efficiency. Limits of detection (between 0.12 and 0.5 μg g - 1 ) and repeatability of the over-all procedure (around 6.0%) were assessed. Finally, accuracy was studied by analyzing PACS-2 (marine sediment), GBW-07409 (soil), IRANT-12-1-07 (cambisol soil) and IRANT-12-1-08 (luvisol soil) certified reference materials (CRMs). These certified reference materials offer certified concentrations ranges between 2.9 and 26.2 μg g - 1 for As, from 0.068 to 2.85 μg g - 1 for Cd, between 26.4 and 90.7 μg g - 1 for Cr, from 9.3 to 40.0 μg g - 1 for Ni and between 16.3 and 183.0 μg g - 1 for Pb. Recoveries after analysis were between 95.7 and 105.1% for As, 96.2% for Cd, 95.2 and 100.6% for Cr, 95.7 and 103% for Ni and 94.2 and 105.5% for Pb.

  14. Could an abdominal drainage be avoided in complicated acute appendicitis? Lessons learned after 1300 laparoscopic appendectomies.

    PubMed

    Schlottmann, Francisco; Reino, Romina; Sadava, Emmanuel E; Campos Arbulú, Ana; Rotholtz, Nicolás A

    2016-12-01

    Complicated appendicitis (CA) may be a risk factor for postoperative intra-abdominal abscess formation (IAA). In addition, several publications have shown an increased risk of postoperative collection after laparoscopic appendectomy. Most surgeons prefer to place a drain to collect contaminated abdominal fluid to prevent consequent abscess formation. We aimed to evaluate the utility of placing an intra-abdominal drain in laparoscopic appendectomy for complicated acute appendicitis. From January 2005 to June 2015 all charts of consecutive patients who underwent laparoscopic appendectomy for CA were revised. CA was defined as a perforated appendix with associated peritonitis. The sample was divided into two groups, G1: intra-abdominal drain and G2: no drain. Demographics, operative factors and 30-day postoperative complications were analyzed. In the study period 1300 laparoscopic appendectomies were performed. Laparoscopic findings showed that 17.3% of the surgeries were for complicated acute appendicitis (225 patients). Fifty-six patients (25%) were in G1 and 169 patients (75%) in G2. No significant differences in clinical presentation and demographics were found (p: NS). G1 had an increased conversion rate (G1: 19.6% vs. G2: 7.1%; p: 0.007). No differences were found in the overall morbidity (G1: 32.1% vs. G2: 21.3%, p: NS). The rate of postoperative IAA was 14.2% in G1 and 8.9% in G2 (p: NS). Length of stay was higher in G1 (G1: 5.2 days vs. G2 2.9 days, p: 0.001). There was no mortality in either group. The placement of intra-abdominal drain in complicated acute appendicitis may not present benefits and may even lengthen hospital stay. These observations suggest that there is no need of using a drain in laparoscopic appendectomy for complicated acute appendicitis. Copyright © 2016 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.

  15. Binding of the cSH3 Domain of Grb2 Adaptor to Two Distinct RXXK Motifs within Gab1 Docker Employs Differential Mechanisms

    PubMed Central

    McDonald, Caleb B.; Seldeen, Kenneth L.; Deegan, Brian J.; Bhat, Vikas; Farooq, Amjad

    2010-01-01

    A ubiquitous component of cellular signaling machinery, Gab1 docker plays a pivotal role in routing extracellular information in the form of growth factors and cytokines to downstream targets such as transcription factors within the nucleus. Here, using isothermal titration calorimetry (ITC) in combination with macromolecular modeling (MM), we show that although Gab1 contains four distinct RXXK motifs, designated G1, G2, G3 and G4, only G1 and G2 motifs bind to the cSH3 domain of Grb2 adaptor and do so with distinct mechanisms. Thus, while the G1 motif strictly requires the PPRPPKP consensus sequence for high-affinity binding to the cSH3 domain, the G2 motif displays preference for the PXVXRXLKPXR consensus. Such sequential differences in the binding of G1 and G2 motifs arise from their ability to adopt distinct polyproline type II (PPII)- and 310-helical conformations upon binding to the cSH3 domain, respectively. Collectively, our study provides detailed biophysical insights into a key protein-protein interaction involved in a diverse array of signaling cascades central to health and disease. PMID:21472810

  16. Cross-Genotypic Examination of Hepatitis C Virus Polymerase Inhibitors Reveals a Novel Mechanism of Action for Thumb Binders

    PubMed Central

    Eltahla, Auda A.; Tay, Enoch; Douglas, Mark W.

    2014-01-01

    Direct-acting antivirals (DAAs) targeting proteins encoded by the hepatitis C virus (HCV) genome have great potential for the treatment of HCV infections. However, the efficacy of DAAs designed to target genotype 1 (G1) HCV against non-G1 viruses has not been characterized fully. In this study, we investigated the inhibitory activities of nonnucleoside inhibitors (NNIs) against the HCV RNA-dependent RNA polymerase (RdRp). We examined the ability of six NNIs to inhibit G1b, G2a, and G3a subgenomic replicons in cell culture, as well as in vitro transcription by G1b and G3a recombinant RdRps. Of the six G1 NNIs, only the palm II binder nesbuvir demonstrated activity against G1, G2, and G3 HCV, in both replicon and recombinant enzyme models. The thumb I binder JTK-109 also inhibited G1b and G3a replicons and recombinant enzymes but was 41-fold less active against the G2a replicon. The four other NNIs, which included a palm I binder (setrobuvir), two thumb II binders (lomibuvir and filibuvir), and a palm β-hairpin binder (tegobuvir), all showed at least 40-fold decreases in potency against G2a and G3a replicons and the G3a enzyme. This antiviral resistance was largely conferred by naturally occurring amino acid residues in the G2a and G3a RdRps that are associated with G1 resistance. Lomibuvir and filibuvir (thumb II binders) inhibited primer-dependent but not de novo activity of the G1b polymerase. Surprisingly, these compounds instead specifically enhanced the de novo activity at concentrations of ≥100 nM. These findings highlight a potential differential mode of RdRp inhibition for HCV NNIs, depending on their prospective binding pockets, and also demonstrate a surprising enhancement of de novo activity for thumb RdRp binders. These results also provide a better understanding of the antiviral coverage for these polymerase inhibitors, which will likely be used in future combinational interferon-free therapies. PMID:25246395

  17. Immunocytochemical localization of the ovine immunoglobulins IgA, IgG1, IgG1A and IgG2: effect of gastro-intestinal parasitism in the sheep

    PubMed Central

    Curtain, C. C.; Anderson, N.

    1971-01-01

    A study has been made of the immunocytochemical localization of IgG1, IgG2, IgG1A and IgA in the alimentary tract and associated lymph nodes of parasitized and parasite-free sheep. No immunoglobulin-containing cells were found in the abomasal mucosa of the parasite-free sheep. On the other hand, large numbers of IgG1 and IgG1A-containing cells were found in the lamina propria and at the base of the villi of the abomasum of the parasitized sheep. IgG1, IgG1A, and IgA-containing cells were found in mucosal sections from the jejunum and ileum of both parasitized and parasite-free sheep, the number of IgG1A-containing cells being sifnificantly greater in the former than in the latter. This increase was considered to be of some importance since the IgG1A subclass appears to be involved in the allergic response of the sheep to intestinal parasites. ImagesFIG. 1FIG. 2FIG. 3FIG. 4FIG. 5FIG. 6FIG. 7 PMID:4924939

  18. Meta-analysis of the association between plasminogen activator inhibitor-1 4G/5G polymorphism and recurrent pregnancy loss.

    PubMed

    Li, Xuejiao; Liu, Yukun; Zhang, Rui; Tan, Jianping; Chen, Libin; Liu, Yinglin

    2015-04-11

    The association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and recurrent pregnancy loss (RPL) risk is still contradictory. We thus performed a meta-analysis. Relevant studies were searched for in PubMed, Web of Science, Embase, and Cochrane Library. An odds ratio (OR) with a 95% confidence interval (CI) was used to assess the association between PAI-1 4G/5G polymorphism and RPL risk. A total of 22 studies with 4306 cases and 3076 controls were included in this meta-analysis. We found that PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk (OR=1.89; 95% CI 1.34-2.67; P=0.0003). In the subgroup analysis by race, PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk in Caucasians (OR=2.23; 95% CI 1.44-3.46; P=0.0003). However, no significant association was observed in Asians (OR=1.47; 95% CI 0.84-2.59; P=0.18). In conclusion, this meta-analysis suggests that PAI-1 4G/5G polymorphism might be associated with RPL development in Caucasians.

  19. Sequencing and phylogenetic analysis of the coding region of six common rotavirus strains: evidence for intragenogroup reassortment among co-circulating G1P[8] and G2P[4] strains from the United States.

    PubMed

    Bányai, K; Mijatovic-Rustempasic, S; Hull, J J; Esona, M D; Freeman, M M; Frace, A M; Bowen, M D; Gentsch, J R

    2011-03-01

    The segmented genome of rotaviruses provides an opportunity for rotavirus strains to generate a large genetic diversity through reassortment; however, this mechanism is considered to play little role in the generation of mosaic gene constellations between Wa-like and DS-1-like strains in genes other than the neutralization antigens. A pilot study was undertaken to analyze these two epidemiologically important strains at the genomic level in order to (i) identify intergenogroup reassortment and (ii) to make available additional reference genome sequences of G1P[8] and G2P[4] for future genomics analyses. The full or nearly complete coding region of all 11 genes for 3 G1P[8] (LB2719, LB2758, and LB2771) and 3 G2P[4] (LB2744, LB2764, and LB2772) strains isolated from children hospitalized with severe diarrhea in Long Beach, California, where these strains were circulating at comparable rates during 2005-2006 are described in this study. Based on the full-genome classification system, all G1P[8] strains had a conserved genomic constellation: G1-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-E1-H1 and were mostly identical to the few Wa-like strains whose genome sequences have already been determined. Similarly, the genome sequences of the 3 G2P[4] strains were highly conserved: G2-P[4]-I2-R2-C2-M2-A2-N2-T2-E2-E2-H2 and displayed an overall lesser genetic divergence with reference DS-1-like strains. While intergenogroup reassortment was not seen between the G1P[8] and G2P[4] strains studied here, evidence for intragenogroup reassortment events was identified. Similar studies in the post-rotavirus genomic era will help uncover whether intergenogroup reassortment affecting the backbone genes could play a significant role in any potential vaccine breakthrough events by evading immunity of vaccinated children. Copyright © 2011 Wiley-Liss, Inc.

  20. Cardiovascular effects of anti-G suit inflation at 1 and 2 G.

    PubMed

    Montmerle, Stéphanie; Linnarsson, Dag

    2005-06-01

    We sought to determine to which pressure a full-coverage anti-G suit needs to be inflated in order to obtain the same stroke volume during a brief exposure to twice the normal gravity (2 G) as that at 1 G without anti-G suit inflation. Nine sitting subjects were studied at normal (1 G) and during 20 s of exposure to 2 G. They wore anti-G suits, which were inflated at both G-levels to the following target pressures: 0, 70, 140 and 210 mmHg. Stroke volume was computed from cardiac output, which was measured by rebreathing. Heart rate and mean arterial pressure at heart level were recorded. Inflation to 70 mmHg compensated for the decrease in stroke volume and cardiac output caused by hypergravity. Mean arterial pressure at heart level was comparable at 1 G and at 2 G and increased gradually and similarly with inflation (P<0.001) at both gravity levels. Thus, anti-G suits act by increasing both preload and afterload but the two effects counteract each other in terms of cardiac output, so that cardiac output at 2 G is maintained at its 1 G level. This effect is reached already at 70 mmHg of inflation. Greater inflation pressure further increases mean arterial pressure at heart level and compensates for the increased difference in hydrostatic pressure between heart and head in moderate hypergravity.

  1. Comparison of beta-lactam regimens for the treatment of gram-negative pulmonary infections in the intensive care unit based on pharmacokinetics/pharmacodynamics.

    PubMed

    Burgess, David S; Frei, Christopher R

    2005-11-01

    This study utilized pharmacokinetics/pharmacodynamics to compare beta-lactam regimens for the empirical and definitive treatment of gram-negative pulmonary infections in the ICU. Susceptibility data were extracted from the 2002 Intensive Care Unit Surveillance System (ISS) and pharmacokinetic parameters were obtained from published human studies. Monte Carlo simulation was used to model the free percent time above the MIC (free %T > MIC) for 18 beta-lactam regimens against all gram-negative isolates, Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii. The cumulative fraction of response (CFR) was determined for bacteriostatic and bactericidal targets (free %T > MIC): penicillins (> or = 30/50%), cephalosporins/monobactams (> or = 40/70%) and carbapenems (> or = 20/40%). The 2002 ISS database contained MICs for 2408 gram-negative isolates including 1430 Enterobacteriaceae, 799 P. aeruginosa, and 179 A. baumannii. Imipenem had the highest percentage susceptible for all gram-negatives, Enterobacteriaceae and A. baumannii, while piperacillin/tazobactam had the highest percentage susceptible for P. aeruginosa. For empirical therapy, imipenem 0.5 g every 6 h, cefepime 2 g every 8 h and ceftazidime 2 g every 8 h demonstrated the highest CFR. For definitive therapy, imipenem 0.5 g every 6 h, ertapenem 1 g daily and cefepime 2 g every 8 h, cefepime 1 g every 8 h and cefepime 1 g every 12 h had the highest bactericidal CFR against Enterobacteriaceae; ceftazidime 2 g every 8 h, cefepime 2 g every 8 h, piperacillin/tazobactam 3.375 g every 4 h, ceftazidime 1 g every 8 h and aztreonam 1 g every 8 h against P. aeruginosa; and imipenem 0.5 g every 6 h, ticarcillin/clavulanate 3.1 g every 4 h, ceftazidime 2 g every 8 h, cefepime 2 g every 8 h and ticarcillin/clavulanate 3.1 g every 6 h against A. baumannii. Based on pharmacokinetics/pharmacodynamics, imipenem 0.5 g every 6 h, cefepime 2 g every 8 h and ceftazidime 2 g every 8 h should be the preferred beta-lactam regimens for the empirical treatment of gram-negative pulmonary infections in the ICU. The order of preference varied against Enterobacteriaceae, P. aeruginosa and A. baumannii.

  2. Characterization of Date (Deglet Nour) Seed Free and Bound Polyphenols by High-Performance Liquid Chromatography-Mass Spectrometry.

    PubMed

    Sirisena, Sameera; Zabaras, Dimitrios; Ng, Ken; Ajlouni, Said

    2017-02-01

    Date (Pheonix dactylifera L.) seeds are a valuable and abundant by-product with various potential food applications. Free polyphenols (FPPs) and bound polyphenols (BPPs) of date seeds from Deglet Nour variety grown in Australia were investigated using high-performance liquid chromatography-mass spectrometry. The FPP fraction contained the following main phenolic compounds per gram of date seed powder; procyanidin B1 (499.8 ± 7.8 μg), procyanidin B2 (288.6 ± 6.1 μg), catechin (167.6 ± 2.1 μg), epicatechin (39.44 ± 0.39 μg), and protocatechuic acid (1.77 ± 0.22 μg). Additionally, one of the 2 A-type dimers was confirmed as procyanidin A2 (24.05 ± 0.12 μg/g). A-type dimers have not been reported before in date seeds. The BPP fraction contained epicatechin (52.59 ± 0.76 μg/g) and procyanidin B2 (294.2 ± 3.7 μg/g), while several peaks exhibiting ESI - m/z of 153 indicated dihydroxybenzoic acid isomers including protocatechuic acid (2.138 ± 0.025 μg/g). These findings contributed to our knowledge of date seed phytochemicals and understanding of their contribution to the reported bioactivities. © 2017 Institute of Food Technologists®.

  3. Developing recombinant HPA-1a-specific antibodies with abrogated Fcgamma receptor binding for the treatment of fetomaternal alloimmune thrombocytopenia.

    PubMed

    Ghevaert, Cedric; Wilcox, David A; Fang, Juan; Armour, Kathryn L; Clark, Mike R; Ouwehand, Willem H; Williamson, Lorna M

    2008-08-01

    Fetomaternal alloimmune thrombocytopenia (FMAIT) is caused by maternal generation of antibodies specific for paternal platelet antigens and can lead to fetal intracranial hemorrhage. A SNP in the gene encoding integrin beta3 causes a clinically important maternal-paternal antigenic difference; Leu33 generates the human platelet antigen 1a (HPA-1a), whereas Pro33 generates HPA-1b. As a potential treatment to prevent fetal intracranial hemorrhage in HPA-1a alloimmunized pregnancies, we generated an antibody that blocks the binding of maternal HPA-1a-specific antibodies to fetal HPA-1a1b platelets by combining a high-affinity human HPA-1a-specific scFv (B2) with an IgG1 constant region modified to minimize Fcgamma receptor-dependent platelet destruction (G1Deltanab). B2G1Deltanab saturated HPA-1a+ platelets and substantially inhibited binding of clinical HPA-1a-specific sera to HPA-1a+ platelets. The response of monocytes to B2G1Deltanab-sensitized platelets was substantially less than their response to unmodified B2G1, as measured by chemiluminescence. In addition, B2G1Deltanab inhibited chemiluminescence induced by B2G1 and HPA-1a-specific sera. In a chimeric mouse model, B2G1 and polyclonal Ig preparations from clinical HPA-1a-specific sera reduced circulating HPA-1a+ platelets, concomitant with transient thrombocytopenia. As the Deltanab constant region is uninformative in mice, F(ab')2 B2G1 was used as a proof of principle blocking antibody and prevented the in vivo platelet destruction seen with B2G1 and polyclonal HPA-1a-specific antibodies. These results provide rationale for human clinical studies.

  4. The MCP-1 Gene A-2518G Polymorphism Confers an Increased Risk of Vascular Complications in Type 2 Diabetes Mellitus Patients.

    PubMed

    Xu, Jin; Liao, Yun-Fei; Zhou, Wei-Ping; Ming, Hua-Li; Wang, Qing-Hai

    2015-08-01

    We aimed to evaluate the correlation of the monocyte chemoattractant protein 1 (MCP-1) A-2518G polymorphism with type 2 diabetes mellitus (T2DM) and vascular complications in T2DM, to aid in understanding its role in pathogenesis. A total of 150 T2DM patients and 50 healthy controls (group A) were enrolled. The T2DM patients were divided into three groups based on the absence of complications (group B) presence of microvascular disease (group C) or macrovascular disease (group D). DNA of all enrolled subjects was genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) for the MCP-1 A-2518G polymorphism. Serum MCP-1 levels were measured by an enzyme-linked immunosorbent assay (ELISA). Participants in group D had increased serum MCP-1 levels relative to group B, group C, and group A (all p<0.01). Compared with group A, the frequencies of the MCP-1 A-2518G G/G genotype and G allele were significantly higher in group C and group D (all p<0.05). In contrast to group B, group C had higher frequencies of the G/G genotype and G allele, while group D had higher G allele frequencies (all p<0.05). Logistic regression analysis showed that lower body-mass index (BMI) and free cholesterol (FC), as well as higher high-density lipoprotein cholesterol (HDL-C) levels may be the protective factors for T2DM, while higher levels of triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and G/G genotype frequency were independent risk factors for T2DM. Our data indicates a correlation between the MCP-1 A-2518G polymorphism with macrovascular complications in T2DM patients; lower BMI and FC, as well as higher HDL-C levels may be the protective factors for T2DM, while higher levels of TG, LDL-C, and G/G genotype frequency were independent risk factors for T2DM.

  5. New mitogenome and nuclear evidence on the phylogeny and taxonomy of the highly zoonotic tapeworm Echinococcus granulosus sensu stricto.

    PubMed

    Kinkar, Liina; Laurimäe, Teivi; Sharbatkhori, Mitra; Mirhendi, Hossein; Kia, Eshrat Beigom; Ponce-Gordo, Francisco; Andresiuk, Vanessa; Simsek, Sami; Lavikainen, Antti; Irshadullah, Malik; Umhang, Gérald; Oudni-M'rad, Myriam; Acosta-Jamett, Gerardo; Rehbein, Steffen; Saarma, Urmas

    2017-08-01

    Cystic echinococcosis, a zoonotic disease caused by Echinococcus granulosus sensu lato (s. l.), is a significant global public health concern. Echinococcus granulosus s. l. is currently divided into numerous genotypes (G1-G8 and G10) of which G1-G3 are the most frequently implicated genotypes in human infections. Although it has been suggested that G1-G3 could be regarded as a distinct species E. granulosus sensu stricto (s. s.), the evidence to support this is inconclusive. Most importantly, data from nuclear DNA that provide means to investigate the exchange of genetic material between G1-G3 is lacking as none of the published nuclear DNA studies have explicitly included G2 or G3. Moreover, the commonly used relatively short mtDNA sequences, including the complete cox1 gene, have not allowed unequivocal differentiation of genotypes G1-G3. Therefore, significantly longer mtDNA sequences are required to distinguish these genotypes with confidence. The main aim of this study was to evaluate the phylogenetic relations and taxonomy of genotypes G1-G3 using sequences of nearly complete mitogenomes (11,443bp) and three nuclear loci (2984bp). A total of 23 G1-G3 samples were analysed, originating from 5 intermediate host species in 10 countries. The mtDNA data demonstrate that genotypes G1 and G3 are distinct mitochondrial genotypes (separated by 37 mutations), whereas G2 is not a separate genotype or even a monophyletic cluster, but belongs to G3. Nuclear data revealed no genetic separation of G1 and G3, suggesting that these genotypes form a single species due to ongoing gene flow. We conclude that: (a) in the taxonomic sense, genotypes G1 and G3 can be treated as a single species E. granulosus s. s.; (b) genotypes G1 and G3 should be regarded as distinct genotypes only in the context of mitochondrial data; (c) we recommend excluding G2 from the genotype list. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. The binding of human and guinea-pig IgG subclasses to homologous macrophage and monocyte Fc receptors.

    PubMed Central

    Alexander, M D; Andrews, J A; Leslie, R G; Wood, N J

    1978-01-01

    Guinea-pig IgG2 and IgT1 bind to contiguous Fc receptors on homologous peritoneal macrophages. Equilibrium association constants determined for the binding of human IgG subclasses to homologous peripheral blood monocytes show that the order of binding is IgG1 greater than IgG3 greater than IgG4 greater than IgG2. Direct binding and rosette assay techniques independently established that both guinea-pig IgG2 and human IgG bind to homologous macrophage-monocyte Fc receptors through a site present in whole Fc (CH2. CH3)2, but absent in pFc' subfragments (CH3)2. PMID:680795

  7. TeV γ-ray observations of the young synchrotron-dominated SNRs G1.9+0.3 and G330.2+1.0 with H.E.S.S.

    NASA Astrophysics Data System (ADS)

    H.E.S.S. Collaboration; Abramowski, A.; Aharonian, F.; Benkhali, F. Ait; Akhperjanian, A. G.; Angüner, E.; Anton, G.; Balenderan, S.; Balzer, A.; Barnacka, A.; Becherini, Y.; Becker Tjus, J.; Bernlöhr, K.; Birsin, E.; Bissaldi, E.; Biteau, J.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Brucker, J.; Brun, F.; Brun, P.; Bulik, T.; Carrigan, S.; Casanova, S.; Cerruti, M.; Chadwick, P. M.; Chalme-Calvet, R.; Chaves, R. C. G.; Cheesebrough, A.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Conrad, J.; Couturier, C.; Cui, Y.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; deWilt, P.; Dickinson, H. J.; Djannati-Ataï, A.; Domainko, W.; O'C. Drury, L.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Edwards, T.; Egberts, K.; Eger, P.; Espigat, P.; Farnier, C.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fernandez, D.; Fiasson, A.; Fontaine, G.; Förster, A.; Füßling, M.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Grondin, M.-H.; Grudzińska, M.; Häffner, S.; Hahn, J.; Harris, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hofverberg, P.; Holler, M.; Horns, D.; Jacholkowska, A.; Jahn, C.; Jamrozy, M.; Janiak, M.; Jankowsky, F.; Jung, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kaufmann, S.; Khélifi, B.; Kieffer, M.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kneiske, T.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lefaucheur, J.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Lennarz, D.; Lohse, T.; Lopatin, A.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; McComb, T. J. L.; Méhault, J.; Meintjes, P. J.; Menzler, U.; Meyer, M.; Moderski, R.; Mohamed, M.; Moulin, E.; Murach, T.; Naumann, C. L.; de Naurois, M.; Niemiec, J.; Nolan, S. J.; Oakes, L.; Ohm, S.; Wilhelmi, E. de Oña; Opitz, B.; Ostrowski, M.; Oya, I.; Panter, M.; Parsons, R. D.; Arribas, M. Paz; Pekeur, N. W.; Pelletier, G.; Perez, J.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Poon, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Raue, M.; Reimer, A.; Reimer, O.; Renaud, M.; Reyes, R. de los; Rieger, F.; Rob, L.; Romoli, C.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Sanchez, D. A.; Santangelo, A.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Sol, H.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Szostek, A.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tluczykont, M.; Trichard, C.; Valerius, K.; van Eldik, C.; van Soelen, B.; Vasileiadis, G.; Venter, C.; Viana, A.; Vincent, P.; Völk, H. J.; Volpe, F.; Vorster, M.; Vuillaume, T.; Wagner, S. J.; Wagner, P.; Ward, M.; Weidinger, M.; Weitzel, Q.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Zabalza, V.; Zacharias, M.; Zajczyk, A.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.

    2014-06-01

    The non-thermal nature of the X-ray emission from the shell-type supernova remnants (SNRs) G1.9+0.3 and G330.2+1.0 is an indication of intense particle acceleration in the shock fronts of both objects. This suggests that the SNRs are prime candidates for very-high-energy (VHE; E > 0.1 TeV) γ-ray observations. G1.9+0.3, recently established as the youngest known SNR in the Galaxy, also offers a unique opportunity to study the earliest stages of SNR evolution in the VHE domain. The purpose of this work is to probe the level of VHE γ-ray emission from both SNRs and use this to constrain their physical properties. Observations were conducted with the H.E.S.S. (High Energy Stereoscopic System) Cherenkov Telescope Array over a more than six-year period spanning 2004-2010. The obtained data have effective livetimes of 67 h for G1.9+0.3 and 16 h for G330.2+1.0. The data are analysed in the context of the multiwavelength observations currently available and in the framework of both leptonic and hadronic particle acceleration scenarios. No significant γ-ray signal from G1.9+0.3 or G330.2+1.0 was detected. Upper limits (99 per cent confidence level) to the TeV flux from G1.9+0.3 and G330.2+1.0 for the assumed spectral index Γ = 2.5 were set at 5.6 × 10-13 cm-2 s-1 above 0.26 TeV and 3.2 × 10-12 cm-2 s-1 above 0.38 TeV, respectively. In a one-zone leptonic scenario, these upper limits imply lower limits on the interior magnetic field to BG1.9 ≳ 12 μG for G1.9+0.3 and to BG330 ≳ 8 μG for G330.2+1.0. In a hadronic scenario, the low ambient densities and the large distances to the SNRs result in very low predicted fluxes, for which the H.E.S.S. upper limits are not constraining.

  8. Inverse expression of somatostatin and CXCR4 chemokine receptors in gastroenteropancreatic neuroendocrine neoplasms of different malignancy

    PubMed Central

    Kaemmerer, Daniel; Träger, Tina; Hoffmeister, Maike; Sipos, Bence; Hommann, Merten; Sänger, Järg; Schulz, Stefan; Lupp, Amelie

    2015-01-01

    Introduction Somatostatin receptors (SSTR) are widely distributed in well-differentiated neuroendocrine neoplasms (NEN) and serve as primary targets for diagnostics and treatment. An overexpression of the chemokine receptor CXCR4, in contrast, is considered to be present mainly in highly proliferative and advanced tumors. Comparative data are still lacking, however, for neuroendocrine carcinomas (NEC). Methods SSTR subtype (1, 2A, 3, 5) and CXCR4 expression was evaluated in G1 (n = 31), G2 (n = 47), and low (G3a; Ki-67: 21–49%; n = 21) and highly proliferative (G3b; Ki-67: >50%, n = 22) G3 (total n = 43) gastroenteropancreatic NEN samples by performing immunohistochemistry with monoclonal rabbit anti-human anti-SSTR and anti-CXCR4 antibodies, respectively, and was correlated with clinical data. Results Both CXCR4 and SSTR were widely expressed in all tumors investigated. CXCR4 expression differed significantly between the G1 and G3 specimens and within the G3 group (G3a to G3b), and was positively correlated with Ki-67 expression. SSTR2A, in contrast, exhibited an inverse association with Ki-67. SSTR2A was highly expressed in G1 and G2 tumors, but was significantly less abundant in G3 carcinomas. Additionally, SSTR1 expression was higher in G3a than in G3b tumors. Conclusion We observed an elevation in CXCR4 and a decrease in SSTR2A expression with increasing malignancy. Interestingly, 23% of the G3 specimens had strong SSTR2A expression. Because CXCR4 was strongly expressed in highly proliferative G3 carcinomas, it is an interesting new target and needs to be validated in larger studies. PMID:26259237

  9. Spectrum of Gastroenteropancreatic NENs in Routine Histological Examinations of Bioptic and Surgical Specimen: A Study of 161 Cases Collected from 17 Departments of Pathology in the Czech Republic

    PubMed Central

    Mandys, Václav

    2014-01-01

    Objective. To characterize GEP-NENs in routine biopsies and surgical specimen in the Czech Republic and to evaluate how WHO Classification (2010) is acceptable in diagnostic practice. Methods. Paraffin-embedded blocks and bioptic reports were collected from 17 departments of pathology. Histologic slides were stained with H&E and immunohistologically for CgA, synaptophysin, and Ki-67. Results. Out of 28 gastric NENs, there were 22 NETs, G1, 5 NETs, G2, and 1 NEC. Ten duodenal NENs were NETs, G1. Among 27 NENs of jejunum and ileum, 23 were NETs, G1, 2 NETs, G2, and 1 NEC and 1 mixed adenoneuroendocrine carcinoma (MANEC). Among 42 appendiceal “incidentalomas”, 39 were NETs G1, 2 goblet cell carcinoids, and 1 MANEC. Out of 34 large intestinal NENs, 30 were NETs, G1, 3 NETs, G2, and 1 NEC. One small intestinal and 6 large bowel neoplasms were reclassified as poorly differentiated adenocarcinomas. In 12 pancreatic NENs, there were 7 NETs, G1, 3 NETs, G2, and 2 NECs. Conclusions. Our study demonstrates differences in GEP-NENs frequency in sites of origin in our region, comparing to other countries. Regarding routine bioptic diagnostics, we gave evidence that the WHO 2010 classification of NENs is fully acceptable for exact categorisation of tumours. PMID:24695372

  10. Control of galactosylated glycoforms distribution in cell culture system.

    PubMed

    McCracken, Neil A; Kowle, Ronald; Ouyang, Anli

    2014-01-01

    Cell culture process conditions including media components and bioreactor operation conditions have a profound impact on recombinant protein quality attributes. Considerable changes in the distribution of galactosylated glycoforms (G0F, G1F, and G2F) were observed across multiple CHO derived recombinant proteins in development at Eli Lilly and Company when switching to a new chemically defined (CD) media platform condition. In the new CD platform, significantly lower G0F percentages and higher G1F and G2F were observed. These changes were of interest as glycosylation heterogeneity can impact the effectiveness of a protein. A systematic investigation was done to understand the root cause of the change and control strategy for galactosylated glycoforms distribution. It was found that changes in asparagine concentration could result in a corresponding change in G0F, G1F, and G2F distribution. A follow-up study examined a wider range of asparagine concentration and it was found that G0F, G1F, and G2F percentage could be titrated by adjusting asparagine concentration. The observed changes in heterogeneity from changing asparagine concentration are due to resulting changes in ammonium metabolism. Further study ascertained that different integrated ammonium level during the cell culture process could control G0F, G1F, and G2F percentage distribution. A mechanism hypothesis is proposed that integrated ammonium level impacts intracellular pH, which further regulates β-1, 4 galactosyltransferase activity. © 2014 American Institute of Chemical Engineers.

  11. The human leukocyte antigen G promotes trophoblast fusion and β-hCG production through the Erk1/2 pathway in human choriocarcinoma cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Ji-meng; State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101; Zhao, Hong-xi

    2013-05-10

    Highlights: •HLA-G expression promotes BeWo cells fusion and fusogenic gene expression. •HLA-G is capable of inducing β-hCG production in human choriocarcinoma cell lines. •Up-regulation of β-hCG production by HLA-G is mediated via the Erk1/2 pathway. -- Abstract: The human leukocyte antigen G (HLA-G) is expressed on the fetal–maternal interface and plays a role in protecting fetal-derived trophoblasts from the maternal immune response, allowing trophoblasts to invade the uterus. However, HLA-G also possesses immune suppressing-independent functions. We found that HLA-G expressing BeWo choriocarcinoma cells increased cell–cell fusion compared to control BeWo cells under forskolin treatment. Regardless of forskolin treatment, the expressionmore » of fusogenic gene mRNAs, including syncytin-1, the transcription factor glial cell missing 1 (Gcm1), and beta human chorionic gonadotropin (β-hCG) were elevated. HLA-G up-regulates β-hCG production in human choriocarcinoma cells because HLA-G knockdown in JEG-3 cells induces a dramatic decrease in β-hCG compared with control cells. The defect in β-hCG production in HLA-G knocked-down cells could not be completely overcome by stimulating hCG production through increasing intracellular cAMP levels. HLA-G expressing cells have increased phosphorylation levels for extracellular signal-regulated kinase1/2 (Erk1/2) in BeWo cells. The Erk1/2 pathway is inactivated after the inhibition of HLA-G expression in JEG-3 cells. Finally, Erk1/2 inhibition was able to suppress the increased hCG production induced by HLA-G expression. Together, these data suggest novel roles for HLA-G in regulating β-hCG production via the modulation of the Erk1/2 pathway and by inducing trophoblast cell fusion.« less

  12. Nanoarchitectured Nb2O5 hollow, Nb2O5@carbon and NbO2@carbon Core-Shell Microspheres for Ultrahigh-Rate Intercalation Pseudocapacitors

    NASA Astrophysics Data System (ADS)

    Kong, Lingping; Zhang, Chuanfang; Wang, Jitong; Qiao, Wenming; Ling, Licheng; Long, Donghui

    2016-02-01

    Li-ion intercalation materials with extremely high rate capability will blur the distinction between batteries and supercapacitors. We construct a series of nanoarchitectured intercalation materials including orthorhombic (o-) Nb2O5 hollow microspheres, o-Nb2O5@carbon core-shell microspheres and tetragonal (t-) NbO2@carbon core-shell microspheres, through a one-pot hydrothermal method with different post-treatments. These nanoarchitectured materials consist of small nanocrystals with highly exposed active surface, and all of them demonstrate good Li+ intercalation pseudocapacitive properties. In particular, o-Nb2O5 hollow microspheres can deliver the specific capacitance of 488.3 F g-1, and good rate performance of 126.7 F g-1 at 50 A g-1. The o-Nb2O5@carbon core-shell microspheres show enhanced specific capacitance of 502.2 F g-1 and much improved rate performance (213.4 F g-1 at 50 A g-1). Furthermore, we demonstrate for the first time, t-NbO2 exhibits much higher rate capability than o-Nb2O5. For discharging time as fast as 5.9 s (50 A g-1), it still exhibits a very high specific capacitance of 245.8 F g-1, which is 65.2% retention of the initial capacitance (377.0 F g-1 at 1 A g-1). The unprecedented rate capability is an intrinsic feature of t-NbO2, which may be due to the conductive lithiated compounds.

  13. Dietary Fat, Eicosanoids and Breast Cancer Risk

    DTIC Science & Technology

    2005-04-01

    Celery log 1Og log Peas 15g 15g 15g Garlic Powder/Salt/Pepper Dash Dash Dash Lemon Juice 2g 2g 2g Mayonnaise 25g 9g 0 Fat Free Miracle Whip 0 20g 30g...Sugar 0 4g 4g Oatmeal Walnut Cookie 30g 30g 30g Dinner: Beef Tenderloin 65g 60g 75g Mashed Potatoes 10Og 140g 140g w/Butter/Olive Oil 5g/4g 0 0 Corn 80g...Fat Free Gravy 40g 40g 40g w/ Safflower Oil/Flax Oil 7g (Safflower) 3g (Safflower) 3g (Flax) Mashed Potato 100g 140g 140g Green Beans 100g 100g �g

  14. 40 CFR 721.1760 - Substituted benzotriazole derivatives.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... derivatives (PMNs P-93-374 and P-93-375) are subject to reporting under this section for the significant new... the workplace. Requirements as specified in § 721.63 (a)(1), (b) (concentration set at 1.0 percent...), (e) (concentration set at 1.0 percent), (f), (g)(1)(i), (g)(1)(iv), (g)(1)(vi), (g)(2)(i), (g)(2)(v...

  15. 40 CFR 721.1760 - Substituted benzotriazole derivatives.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... derivatives (PMNs P-93-374 and P-93-375) are subject to reporting under this section for the significant new... the workplace. Requirements as specified in § 721.63 (a)(1), (b) (concentration set at 1.0 percent...), (e) (concentration set at 1.0 percent), (f), (g)(1)(i), (g)(1)(iv), (g)(1)(vi), (g)(2)(i), (g)(2)(v...

  16. 40 CFR 721.1760 - Substituted benzotriazole derivatives.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... derivatives (PMNs P-93-374 and P-93-375) are subject to reporting under this section for the significant new... the workplace. Requirements as specified in § 721.63 (a)(1), (b) (concentration set at 1.0 percent...), (e) (concentration set at 1.0 percent), (f), (g)(1)(i), (g)(1)(iv), (g)(1)(vi), (g)(2)(i), (g)(2)(v...

  17. 40 CFR 721.1760 - Substituted benzotriazole derivatives.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... derivatives (PMNs P-93-374 and P-93-375) are subject to reporting under this section for the significant new... the workplace. Requirements as specified in § 721.63 (a)(1), (b) (concentration set at 1.0 percent...), (e) (concentration set at 1.0 percent), (f), (g)(1)(i), (g)(1)(iv), (g)(1)(vi), (g)(2)(i), (g)(2)(v...

  18. One-year clinical evaluation of two resin composites, two polymerization methods, and a resin-modified glass ionomer in non-carious cervical lesions.

    PubMed

    Koubi, Stephen; Raskin, Anne; Bukiet, Frédéric; Pignoly, Christian; Toca, Edwige; Tassery, Hervé

    2006-11-01

    The aim of this study was to examine clinically relevant data on four restorative procedures for non-carious cervical lesions using United States Public Health Service (USPHS)-compatible clinical and photographic criteria and to compare different methods of analyzing clinical data. Fourteen patients with at least one or two pairs of non-carious lesions under occlusion and a mean age of 50 were enrolled in this study. A total of 56 restorations (14 with each material) were placed by three experienced, calibrated dental practitioners. Two other experienced and calibrated practitioners, under single-blind conditions, followed up on all restorations for a period of one year. Three materials were randomly placed: a micro-hybrid composite with two polymerization methods (G1 and G2), a flowable micro-hydrid composite (G3), and a resin-modified glass ionomer (G4). Statistical analysis was performed using the Kruskall-Wallis test (p<0.05) and a Mann-Whitney U modified test with a corrected significance level. At the one year evaluation time, there were no restorations with secondary caries and the retention rates in G1 (IntenS with a hard polymerization), G2 (IntenS with a soft polymerization), G3 (Filtek flow), and G4 (Fuji II LC) were 85.7% (two losses), 92.8% (one loss), 100%, and 100%, respectively. The total visual comparison of the results at baseline (15 days later) showed significant differences only with the clinical acceptance criterion: G1 was different from G2, with a soft polymerization device (p<0.05). In terms of surface quality at one year, G1, G2, and G3 exhibited a statistically significant difference from G4, p<0.05. The digital analysis at baseline showed significant differences only with the clinical acceptance criterion: G1=G2 was different from G3=G4, p<0.05. At one year, only the microporosity criterion showed any statistical differences: G1=G2=G3 was different from G4, p<0.05. The resin-modified glass ionomer was easier to use and had a high retention rate, but it failed in terms of surface quality (visual mode) and porosity (digital mode) criteria compared to the others groups. Overall results showed no difference between groups G1 (hard-polymerized) and G2 (soft-polymerized), and only G1 was affected by the marginal edge (p<0.03) and integrity criteria (p<0.02) at one year.

  19. Time-resolved EPR study of singlet oxygen in the gas phase.

    PubMed

    Ruzzi, Marco; Sartori, Elena; Moscatelli, Alberto; Khudyakov, Igor V; Turro, Nicholas J

    2013-06-27

    X-band EPR spectra of singlet O2((1)Δg) and triplet O2((3)Σg(-)) were observed in the gas phase under low molecular-oxygen pressures PO2 = 0.175-0.625 Torr, T = 293-323 K. O2((1)Δg) was produced by quenching of photogenerated triplet sensitizers naphthalene C8H10, perdeuterated naphthalene, and perfluoronaphthalene in the gas phase. The EPR spectrum of O2((1)Δg) was also observed under microwave discharge. Integrated intensities and line widths of individual components of the EPR spectrum of O2((3)Σg(-)) were used as internal standards for estimating the concentration of O2 species and PO2 in the EPR cavity. Time-resolved (TR) EPR experiments of C8H10 were the main focus of this Article. Pulsed irradiation of C8H10 in the presence of O2((3)Σg(-)) allowed us to determine the kinetics of formation and decay for each of the four components of the O2((1)Δg) EPR signal, which lasted for only a few seconds. We found that the kinetics of EPR-component decay fit nicely to a biexponential kinetics law. The TR EPR 2D spectrum of the third component of the O2((1)Δg) EPR spectrum was examined in experiments using C8H10. This spectrum vividly presents the time evolution of an EPR component. The largest EPR signal and the longest lifetime of O2((1)Δg), τ = 0.4 s, were observed at medium pressure PO2 = 0.4 Torr, T = 293 K. The mechanism of O2((1)Δg) decay in the presence of photosensitizers is discussed. EPR spectra of O2((1)Δg) evidence that the spin-rotational states of O2((1)Δg) are populated according to Boltzmann distribution in the studied time range of 10-100 ms. We believe that this is the first report dealing with the dependence of O2((1)Δg) EPR line width on PO2 and T.

  20. Impact of intraoperative temperature and humidity on healing of intestinal anastomoses.

    PubMed

    Glatz, Torben; Boldt, Johannes; Timme, Sylvia; Kulemann, Birte; Seifert, Gabriel; Holzner, Philipp Anton; Chikhladze, Sophia; Grüneberger, Jodok Matthias; Küsters, Simon; Sick, Olivia; Höppner, Jens; Hopt, Ulrich Theodor; Marjanovic, Goran

    2014-04-01

    Clinical data indicate that laparoscopic surgery has a beneficial effect on intestinal wound healing and is associated with a lower incidence of anastomotic leakage. This observation is based on weak evidence, and little is known about the impact of intraoperative parameters during laparoscopic surgery, e.g., temperature and humidity. A small-bowel anastomosis was formed in rats inside an incubator, in an environment of stable humidity and temperature. Three groups of ten Wistar rats were operated: a control group (G1) in an open surgical environment and two groups (G2 and G3) in the incubator at a humidity of 60 % and a temperature of 30 and 37 °C (G2 and G3, respectively). After 4 days, bursting pressure and hydroxyproline concentration of the anastomosis were analyzed. The tissue was histologically examined. Serum levels of C-reactive-protein (CRP) were measured. No significant changes were seen in the evaluation of anastomotic stability. Bursting pressure was very similar among the groups. Hydroxyproline concentration in G3 (36.3 μg/g) was lower by trend (p = 0.072) than in G1 (51.7 μg/g) and G2 (46.4 μg/g). The histological evaluation showed similar results regarding necrosis, inflammatory cells, edema, and epithelization for all groups. G3 (2.56) showed a distinctly worse score for submucosal bridging (p = 0.061) than G1 (1.68). A highly significant increase (p = 0.008) in CRP was detected in G3 (598.96 ng/ml) compared to G1 (439.49 ng/ml) and G2 (460 ng/ml). A combination of high temperature and humidity during surgery induces an increased systemic inflammatory response and seems to be attenuating the early regeneration process in the anastomotic tissue.

  1. Stable 1T-phase MoS2 as an effective electron mediator promoting photocatalytic hydrogen production.

    PubMed

    Shi, Jian-Wen; Zou, Yajun; Ma, Dandan; Fan, Zhaoyang; Cheng, Linhao; Sun, Diankun; Wang, Zeyan; Niu, Chunming; Wang, Lianzhou

    2018-05-17

    Coupling two semiconductors together to construct a Z-scheme type photocatalytic system is an efficient strategy to solve the serious recombination challenge of photogenerated electrons and holes. In this work, we develop a novel composite photocatalyst by sandwiching metallic 1T-phase MoS2 nanosheets between MoO3 and g-C3N4 (MoO3/1T-MoS2/g-C3N4) for the first time. The metallic 1T-phase MoS2 acts as an efficient electron mediator between MoO3 and g-C3N4 to construct an all-solid-state Z-scheme photocatalytic system, resulting in a highly-efficient spatial charge separation and transfer process. Benefiting from this, the newly developed MoO3/1T-MoS2/g-C3N4 exhibits a drastically enhanced photocatalytic H2 evolution rate of 513.0 μmol h-1 g-1 under visible light irradiation (>420 nm), which is nearly 12 times higher than that of the pure g-C3N4 (39.5 μmol h-1 g-1), and 3.5 times higher than that of MoO3/g-C3N4 (145.7 μmol h-1 g-1). More importantly, the originally unstable 1T-phase MoS2 becomes very stable in MoO3/1T-MoS2/g-C3N4 because of the sandwich structure where 1T-phase MoS2 is protected by MoO3 and g-C3N4, which endows the photocatalyst with excellent photostability. It is believed that this study will provide new insights into the design of efficient and stable Z-scheme heterostructures for photocatalytic applications.

  2. Serum levels of immunoglobulins and severity of community-acquired pneumonia

    PubMed Central

    de la Torre, Mari C; Torán, Pere; Serra-Prat, Mateu; Palomera, Elisabet; Güell, Estel; Vendrell, Ester; Yébenes, Joan Carles; Torres, Antoni; Almirall, Jordi

    2016-01-01

    Instruction There is evidence of a relationship between severity of infection and inflammatory response of the immune system. The objective is to assess serum levels of immunoglobulins and to establish its relationship with severity of community-acquired pneumonia (CAP) and clinical outcome. Methods This was an observational and cross-sectional study in which 3 groups of patients diagnosed with CAP were compared: patients treated in the outpatient setting (n=54), patients requiring in-patient care (hospital ward) (n=173), and patients requiring admission to the intensive care unit (ICU) (n=191). Results Serum total IgG (and IgG subclasses IgG1, IgG2, IgG3, IgG4), IgA and IgM were measured at the first clinical visit. Normal cutpoints were defined as the lowest value obtained in controls (≤680, ≤323, ≤154, ≤10, ≤5, ≤30 and ≤50 mg/dL for total IgG, IgG1, IgG2, IgG3, IgG4, IgM and IgA, respectively). Serum immunoglobulin levels decreased in relation to severity of CAP. Low serum levels of total IgG, IgG1 and IgG2 showed a relationship with ICU admission. Low serum level of total IgG was independently associated with ICU admission (OR=2.45, 95% CI 1.4 to 4.2, p=0.002), adjusted by the CURB-65 severity score and comorbidities (chronic respiratory and heart diseases). Low levels of total IgG, IgG1 and IgG2 were significantly associated with 30-day mortality. Conclusions Patients with severe CAP admitted to the ICU showed lower levels of immunoglobulins than non-ICU patients and this increased mortality. PMID:27933180

  3. Thermodynamic constrains on the flux of organic matter through a peatland ecosystem

    NASA Astrophysics Data System (ADS)

    Worrall, Fred; Moody, Catherine; Clay, Gareth; Kettridge, Nick; Burt, Tim

    2017-04-01

    The transformations and transitions of organic matter into, through and out of a peatland ecosystem must obey the 2nd law of thermodynamics. Beer and Blodau (Geochimica Cosmochimica Acta, 2007, 71, 12, 2989-3002) showed that the evolution of CH4 in peatlands was constrained by equilibrium occurring at depth in the peat as the pore water became a closed system. However, that study did not consider the transition in the solid components of the organic matter flux through the entire ecosystem. For this study, organic matter samples were taken from each organic matter reservoir and fluvial transfer pathway and analysed the samples by elemental analysis and bomb calorimetry. The samples analysed were: above- and below-ground biomass, heather, mosses, sedges, plant litter layer, peat soil, and monthly samples of particulate and dissolved organic matter. All organic matter samples were taken from a 100% peat catchment within Moor House National Nature Reserve in the North Pennines, UK, and collected samples were compared to standards of lignin, cellulose, and plant protein. It was possible to calculate ∆H_f^OM ∆S_f^OM and ∆G_f^OM for each of the samples and standards. By assuming that each thermodynamic property can be expressed per g C and that any increase in ∆G_f^OM can be balanced by the production of CO2, DOM or CH4 then it is possible to predict the consequences of the fixation of 1 g of carbon in a peatland soil. The value of ∆G_f^OMincreases from glucose to components of the biomass: 1g of C fixed as glucose by photosynthesis would result in 0.68 g C as biomass and 0.32 g C as CO2. The transition from biomass to litter could occur spontaneously but the transition from surface to 1m depth in the peat profile would release 0.18 g C as CO2 per 1 g of carbon entering the peat profile. Therefore, for every 1 g of carbon fixed from photosynthesis then 0.44g of C would be released as CO2 and 0.54 g C would be present at 1 m depth. Alternatively, if DOM only were released in transition down the peat profile then for every 1 g of carbon fixed by photosynthesis 0.32 g C would be released as CO2 and 0.22 g C would be lost as DOM and leaving 0.46 g C as residual peat at 1m depth. If the variation in ∆G_f^OM of the DOM were considered then for every 1 g of C produced as DOM then between 0 and 0.57g C would be lost as CO2. At median value of DOM loss then for every 1g of carbon fixed as photosynthesis 0.39 g C would be lost as CO2 and 0.15 g lost as DOM with 0.46 g C as residual peat. Alternatively, if CH4 only were released down the soil profile then no organic matter would be left in the peat profile, i.e. CH4 is not an efficient method of transferring Gibbs free energy. The measured carbon budget for this catchment is that 1 g C fixed as photosynthesis resulted in 0.42 g C as CO2; 0.29 g C as DOM; 0.04 g C as CH4 and 0.24 g C as residual peat at 1m depth.

  4. [Postnatal growth of very low birth weight infants during hospitalization].

    PubMed

    2013-01-01

    To study the postnatal growth of very low birth weight infant (VLBWI) and its relevant influencing factors during hospitalization. Clinical data of very low birth weight infants (VLBWI), who were discharged from July 1(st), 2010 to June 30(th), 2011, were collected retrospectively from 9 NICUs of 9 cities in Pearl River Delta, Guangdong province. A total of 183 cases of VLBW premature infants were enrolled in this research. The incidence of intrauterine growth retardation (IUGR) at birth and extrauterine growth retardation (EUGR) on discharge were assessed. According to IUGR at birth, they were assigned into two groups: IUGR group (n = 63) and non-IUGR group (n = 120). And non-IUGR group were further assigned into EUGR group (n = 71) and non-EUGR group (n = 49). The mean daily growth rate during hospitalization and the incidence of EUGR on discharge were studied comparatively to IUGR group and non-IUGR group. The nutrition intake, mean growth rate and relevant illnesses were studied comparatively to IUGR group and non-IUGR group, EUGR group and non-EUGR group. (1) The incidence of IUGR at birth was 34.4%, while the incidence of EUGR on discharge was 72.1%. The mean daily growth rate to body weight of IUGR group was higher than that of non-IUGR group [(12.5 ± 2.7) g/kg vs (11.3 ± 2.5) g/kg, P = 0.002]. The increasing incidence from IUGR to EUGR, IUGR group was higher than non-IUGR group (96.8% vs 59.2%, P = 0.000). (2) The mean daily energy and protein intake in postnatal time of 1 week [62 (51, 69) kcal/kg vs 56 (45, 64) kcal/kg (1 kcal = 4.1840 kJ), 1.7 (1.3, 2.0) g/kg vs 1.6 (1.2, 1.8) g/kg], 2 weeks [83 (71, 94) kcal/kg vs 76 (66, 88) kcal/kg, 2.6 (2.1, 2.9) g/kg vs 2.3 (1.9, 2.7) g/kg], 4 weeks [107 (94, 120) kcal/kg vs 95 (85, 108) kcal/kg, 3.3 (2.7, 3.6) g/kg vs 2.7 (2.4, 3.2) g/kg], before total enteral nutrition [103 (96, 110) kcal/kg vs 97 (89, 106) kcal/kg, 3.1 (2.6, 3.4) g/kg vs 2.8 (2.4, 3.3) g/kg] and the whole hospitalization [121 (111, 131) kcal/kg vs 111 (101, 119) kcal/kg, 3.4 (3.1, 3.8) g/kg vs 3.1 (2.8, 3.5) g/kg], IUGR group were more than non-IUGR group (P < 0.05).While the cumulative losses of energy [407 (360, 483) kcal/kg vs 448 (393, 527) kcal/kg, 534 (369, 689) kcal/kg vs 612 (453, 758) kcal/kg, 367 (12, 724) kcal/kg vs 718 (330, 996) kcal/kg, 381 (231, 609) kcal/kg vs 656 (394, 959) kcal/kg, 0 (0, 350) kcal/kg vs 387 (85, 826) kcal/kg] and protein [12.3 (10.2, 15.5) g/kg vs 13.7 (11.7, 16.4) g/kg, 12.8 (7.8, 19.4) g/kg vs 17.5 (11.9, 22.7) g/kg, 6.2 (0, 22.6) g/kg vs 21.7 (7.3, 30.3) g/kg, 6.6 (1.8, 23.0) g/kg vs 22.1 (7.2, 32.5) g/kg, 1.9 (0, 16.7) g/kg vs 20.1 (0, 32.6) g/kg] were lower in IUGR group than in non-IUGR group at the same time (P < 0.05). (3) The mean daily growth rate to body weight of non-EUGR group was higher than that of EUGR group [(12.7 ± 2.2) g/kg vs (10.3 ± 2.1) g/kg, P = 0.000]. The date beginning to feed [1.0 (1.0, 3.0) d vs 3.0 (2.0, 5.0) d], the total fasting time [3.0 (1.0, 5.5) d vs 4.0 (3.0, 9.0) d], the time to reach the lowest body weight [4.0 (3.0, 6.0) d vs 6.0 (5.0, 8.0) d], and the time to restoring birth weight [11.0 (9.0, 14.0) d vs 13.0 (10.0, 17.0) d], non-EUGR group were shorter than that of EUGR group (P < 0.05). The percentage of the infants who needed ventilator therapy was lower in non-EUGR group than in EUGR group (70.4% vs 51.0%, P = 0.031). (4) The mean daily energy intake in postnatal time of 2 weeks [81 (70, 91) kcal/kg vs 73 (63, 85) kcal/kg] and the mean protein intake daily in postnatal time of 1 week [1.6 (1.4, 2.0) g/kg vs 1.4 (1.1, 1.8) g/kg], 2 weeks [2.4 (2.1, 2.7) g/kg vs 2.1 (1.8, 2.6) g/kg] and before total enteral nutrition [3.0 (2.5, 3.4) g/kg vs 2.7 (2.3, 3.1) g/kg] were higher in non-EUGR group than in EUGR group (P < 0.05).While the cumulative losses of energy in postnatal time of 2 weeks [546 (403, 707) kcal/kg vs 655 (494, 795) kcal/kg] and the cumulative losses of protein in postnatal time of 1 week [13.1 (10.9, 15.1) g/kg vs 14.8 (12.0, 16.6) g/kg] and 2 weeks [15.5 (11.4, 19.8) g/kg vs 20.0 (12.1, 24.0) g/kg] were lower in non-EUGR group than in EUGR group (P < 0.05). (5) The incidence of neonatal respiratory distress syndrome was lower in IUGR group than in non-IUGR group (34.9% vs 56.7%, P = 0.005); the incidence of hypertensive disorders in pregnancy (54.0% vs 24.2%, P = 0.000) and fetal distress in uterus (25.4% vs 7.5%, P = 0.001)of the pregnant women were higher in IUGR group than in non-IUGR group. (6) The incidence of septicemia of the newborn (11.3% vs 0%, P = 0.020) and the incidence of hypertensive disorders in pregnancy of the pregnant women (31.0% vs 14.3%, P = 0.036) in EUGR group were higher than in non-EUGR group. EUGR was still a serious problem in VLBWI. The risk of EUGR in the VLBWI with IUGR was much higher than those of non-IUGR. The relevant influencing factors of EUGR included mean daily growth rate to body weight, the date beginning to feed, the total fasting time, the time to reach the lowest body weight, the time to restoring birth weight, ventilator therapy, the daily nutrition intake, the cumulative nutrition losses, and illnesses of infants or their mother.

  5. 100 Gbit Interconnects and Above: The Need for Speed

    DTIC Science & Technology

    2007-01-01

    100Tb/s9 Board-board (~1m)2 $1/Gb 200Gb/ch3,6 $0.5/G/b 1Tb $0.1/G 5Tb Rack-rack (10-100m)1 $5/Gb $3/G 20Gb/ ch 100G...Critical need today $1/G 400G $0.25/G 1Tb/ ch 1. This market driven primarily by price 2. These markets are driven by needs/performance advantages...505) 272- 7845 Email: huffaker@chtm.unm.edu David Iams OIDA 1133 Connecticut Avenue, NW Suite 600 Washington, DC 20036-4329 Tel: (202) 785

  6. Use of oxytocin in penned sows and its effect on fetal intra-partum asphyxia.

    PubMed

    Alonso-Spilsbury, María; Mota-Rojas, Daniel; Martínez-Burnes, Julio; Arch, Emilio; López Mayagoitia, Alfonso; Ramírez-Necoechea, Ramiro; Olmos, Adriana; Trujillo, María Elena

    2004-08-01

    The objective of the present study was to evaluate in penned sows the effect of two commercial oxytocin products on umbilical cord pathology, degree of asphyxia and intra-partum mortality. This study included 120 sows divided in three groups of 40 animals with eight animals for parities one to five per subgroup, respectively. Group 1 (G(1)) or control received saline solution while oxytocin groups (G(2)) and (G(3)) were injected at the onset of fetal expulsion with two oxytocin products. The doses of oxytocin were as follow: Primiparous sows weighing less than 130 kg received 20 IU; multiparous sows weighing 130-180 g received 30 IU, and those above 250 kg, 40 IU. Piglets born alive and/or dead were classified at birth using a subjective scale based on the degree of meconium staining on skin. Umbilical cords of intra-partum stillbirths (IPS) were classified as adhered or ruptured and subdivided into four categories: without pathological changes, edematous, congested and hemorrhagic. Result analyses revealed significant differences (P < 0.01) between groups 1 and 2, and 1 and 3 regarding the following traits: expulsion interval (min) (X: G(1) 27.7; G(2) 22.6; G(3) 22.2), IPS with a severe stain degree (X: G(1) 0.10; G(2) 0.45; G(3) 0.50), IPS with ruptured umbilical cords (X: G(1) 0.07; G(2) 0.42; G(3) 0.47), and detectable heartbeats in IPS (X: G(1) 0.27; G(2) 0.25; G(3) 0.22). Treatment with oxytocin reduced the duration of the expulsion of the fetus, increased the number of IPS with ruptured umbilical cords and with severe meconium-stain degree and reduced the number of fetuses with inspiration attempts. Furthermore, the use of this hormone increased the need for obstetric assistance due to increased frequency of dystocia.

  7. The activation of G protein-coupled estrogen receptor induces relaxation via cAMP as well as potentiates contraction via EGFR transactivation in porcine coronary arteries.

    PubMed

    Yu, Xuan; Stallone, John N; Heaps, Cristine L; Han, Guichun

    2018-01-01

    Estrogen exerts protective effects against cardiovascular diseases in premenopausal women, but is associated with an increased risk of both coronary heart disease and stroke in older postmenopausal women. Studies have shown that activation of the G-protein-coupled estrogen receptor 1 (GPER) can cause either relaxation or contraction of arteries. It is highly likely that these dual actions of GPER may contribute to the seemingly paradoxical effects of estrogen in regulating coronary artery function. The objective of this study was to test the hypothesis that activation of GPER enhances agonist-stimulated porcine coronary artery contraction via epidermal growth factor receptor (EGFR) transactivation and its downstream extracellular signal-regulated kinases (ERK1/2) pathway. Isometric tension studies and western blot were performed to determine the effect of GPER activation on coronary artery contraction. Our findings demonstrated that G-1 caused concentration-dependent relaxation of ET-1-induced contraction, while pretreatment of arterial rings with G-1 significantly enhanced ET-1-induced contraction. GPER antagonist, G-36, significantly inhibited both the G-1-induced relaxation effect and G-1-enhanced ET-1 contraction. Gallein, a Gβγ inhibitor, significantly increased G-1-induced relaxation, yet inhibited G-1-enhanced ET-1-mediated contraction. Similarly, inhibition of EGFR with AG1478 or inhibition of Src with phosphatase 2 further increased G-1-induced relaxation responses in coronary arteries, but decreased G-1-enhanced ET-1-induced contraction. Western blot experiments in porcine coronary artery smooth muscle cells (PCASMC) showed that G-1 increased tyrosine phosphorylation of EGFR, which was inhibited by AG-1478. Furthermore, enzyme-linked immunosorbent assays showed that the level of heparin-binding EGF (HB-EGF) released by ET-1 treatment increased two-fold; whereas pre-incubation with G-1 further increased ET-1-induced HB-EGF release to four-fold over control conditions. Lastly, the role of ERK1/2 was determined by applying the MEK inhibitor, PD98059, in isometric tension studies and detecting phospho-ERK1/2 in immunoblotting. PD98059 potentiated G-1-induced relaxation response, but blocked G-1-enhanced ET-1-induced contraction. By western blot, G-1 treatment decreased phospho-ERK1/2, however, in the presence of the adenylyl cyclase inhibitor, SQ22536, G-1 significantly increased ERK1/2 phosphorylation in PCASMC. These data demonstrate that activation of GPER induces relaxation via cAMP as well as contraction via a mechanism involving transactivation of EGFR and the phosphorylation of ERK1/2 in porcine coronary arteries.

  8. Dose-dependent increases in flow-mediated dilation following acute cocoa ingestion in healthy older adults

    PubMed Central

    Feehan, Robert P.; Kunselman, Allen R.; Preston, Amy G.; Miller, Debra L.; Lott, Mary E. J.

    2011-01-01

    An inverse relation exists between intake of flavonoid-rich foods, such as cocoa, and cardiovascular-related mortality. Favorable effects of flavonoids on the endothelium may underlie these associations. We performed a randomized, double-blind, placebo-controlled study to test the hypothesis that acute cocoa ingestion dose dependently increases endothelium-dependent vasodilation, as measured by an increase in brachial artery flow-mediated dilation (FMD), in healthy older adults. Measurements were obtained before (preingestion) and after (1- and 2-h postingestion) ingestion of 0 (placebo), 2, 5, 13, and 26 g of cocoa in 23 adults (63 ± 2 yr old, mean ± SE). Changes in brachial artery FMD 1- and 2-h postingestion compared with preingestion were used to determine the effects of cocoa. FMD was unchanged 1 (Δ−0.3 ± 0.2%)- and 2-h (Δ0.1 ± 0.1%) after placebo (0 g cocoa). In contrast, FMD increased both 1-h postingestion (2 g cocoa Δ0.0 ± 0.2%, 5 g cocoa Δ0.8 ± 0.3%, 13 g cocoa Δ1.0 ± 0.3%, and 26 g cocoa Δ1.6 ± 0.3%: P < 0.05 compared with placebo for 5, 13, and 26 g cocoa) and 2-h postingestion (2 g cocoa Δ0.5 ± 0.3%, 5 g cocoa Δ1.0 ± 0.3%, 13 g cocoa Δ1.4 ± 0.2%, and 26 g cocoa Δ2.5 ± 0.4%: P < 0.05 compared with placebo for 5, 13, and 26 g cocoa) on the other study days. A serum marker of cocoa ingestion (total epicatechin) correlated with increased FMD 1- and 2-h postingestion (r = 0.44–0.48; both P < 0.05). Collectively, these results indicate that acute cocoa ingestion dose dependently increases brachial artery FMD in healthy older humans. These responses may help to explain associations between flavonoid intake and cardiovascular-related mortality in humans. PMID:21903881

  9. Investigations of the prevalence and virulence of Candida albicans in periodontal and endodontic lesions in diabetic and normoglycemic patients

    PubMed Central

    GOMES, Cinthya Cristina; GUIMARÃES, Ludmila Silva; PINTO, Larissa Christina Costa; CAMARGO, Gabriela Alessandra da Cruz Galhardo; VALENTE, Maria Isabel Bastos; SARQUIS, Maria Inêz de Moura

    2017-01-01

    Abstract Pulpal and periodontal tissues have similar microbiota that allows cross-contamination between the pulp and periodontal tissues. Objective The aim of this study was to investigate the prevalence of isolated Candida albicans from periodontal endodontic lesions in diabetic and normoglycemic patients, and the fungi's virulence in different atmospheric conditions. Material and Methods A case-control study was conducted on 15 patients with type 2 diabetes mellitus (G1) and 15 non-diabetics (G2) with periodontal endodontic lesions. Samples of root canals and periodontal pockets were plated on CHROMagar for later identification by polymerase chain reaction (PCR) and virulence test. Results C. albicans was identified in 79.2% and 20.8% of the 60 samples collected from diabetic and normoglycemic patients, respectively. Of the 30 samples collected from periodontal pockets, 13 showed a positive culture for C. albicans, with 77% belonging to G1 and 23% to G2. Of the 11 positive samples from root canals, 82% were from G1 and 18% from G2. Production of proteinase presented a precipitation zone Pz<0.63 of 100% in G1 and 72% in G2, in redox and negative (Pz=1), under anaerobic conditions in both groups. Hydrophobicity of the strains from G1 indicated 16.4% with low, 19.3% with moderate, and 64.3% with high hydrophobicity in redox. In G2, 42.2% had low, 39.8% had moderate, 18% had high hydrophobicity in redox. In anaerobic conditions, G1 showed 15.2% with low, 12.8% with moderate, and 72% with high hydrophobicity; in G2, 33.6% had low, 28.8% had moderate, and 37.6% had high hydrophobicity. There was statistical difference in the number of positive cultures between G1 and G2 (p<0.05) with predominance in G1. There was statistical difference for all virulence factors, except hemolysis (p=0.001). Conclusions Candida albicans was isolated more frequently and had higher virulence in diabetic patients. PMID:28678946

  10. Emission estimates of particulate matter (PM) and trace gases (SO2, NO and NO2) from biomass fuels used in rural sector of Indo-Gangetic Plain, India

    NASA Astrophysics Data System (ADS)

    Saud, T.; Mandal, T. K.; Gadi, Ranu; Singh, D. P.; Sharma, S. K.; Saxena, M.; Mukherjee, A.

    2011-10-01

    In this paper, we present the experimentally determined emission factors and emission estimates of particulate matter (PM), SO2, NO and NO2 emitted from biomass fuels used as energy in rural area of Indo-Gangetic Plain (IGP), India. Biomass fuel samples were collected at district level from this region. The burning of the collected biomass fuels is performed by using the modified dilution sampler based on studies done by Venkataraman et al. (2005). In this study, the emission factor represents the total period of burning including pyrolysis, flaming and smoldering. The average emission factor of PM from dung cake, fuel-wood and crop residue over Delhi, Uttar Pradesh, Punjab, Haryana, Uttarakhand and Bihar are estimated as 16.26 ± 2.29 g kg-1, 4.34 ± 1.06 g kg-1 and 7.54 ± 4.17 g kg-1 respectively. Similarly, the average emission factor of SO2, NO and NO2 from dung cake, fuel-wood and crop residue over this region are also determined (SO2: 0.28 ± 0.09 g kg-1, 0.26 ± 0.10 g kg-1 and 0.27 ± 0.11 g kg-1, NO: 0.27 ± 0.21 g kg-1, 0.41 ± 0.25 g kg-1 and 0.54 ± 0.50 g kg-1 and NO2: 0.31 ± 0.23 g kg-1, 0.35 ± 0.28 g kg-1 and 0.54 ± 0.47 g kg-1 respectively). The emission of PM, SO2, NO and NO2 from biomass fuels used as energy in rural household over, IGP are also estimated in this paper. The result shows the regional emission inventory from Indian scenario with spatial variability.

  11. Association Between Plasminogen Activator Inhibitor-1-675 4G/5G Insertion/Deletion Polymorphism and Chronic Obstructive Pulmonary Disease.

    PubMed

    Essa, Enas S; El Wahsh, Rabab A

    2016-12-01

    Molecular pathology of chronic obstructive pulmonary disease (COPD) is still being investigated to discover relationships with disease pathogenesis. Evidence of plasminogen activator inhibitor-1 (PAI-1) overexpression in the sputum and the blood of COPD patients is growing. We aimed to investigate the potential relation between PAI-1 promoter 4G/5G insertion/deletion polymorphism and COPD development. In a case-control study, we genotyped 117 COPD patients and 160 control subjects for PAI-1 promoter 4G/5G polymorphism by an allele-specific polymerase chain reaction analysis. All subjects were male smokers. In the co-dominant model, there was a significant difference in the distribution of 5G/5G, 4G/5G and 4G/4G genotypes between COPD patients and controls (p = 0.002). In the recessive model, carriers of 4G/4G genotype were significantly higher in COPD patients than controls (p = 0.01). Carriers of 4G/4G genotype were at higher risk to develop COPD than those carrying 5G/5G or 4G/5G genotypes (crude odds ratio (OR) = 2.10, 95% confidence interval (CI) = 1.19-3.73, adjusted OR = 2.5, 95% CI = 1.22-3.99). In conclusion, PAI-1 4G/5G genetic variations are associated with COPD development in males.

  12. Blood pressure control is similar in treated hypertensive patients with optimal or with high-normal albuminuria.

    PubMed

    Oliveras, Anna; Armario, Pedro; Lucas, Silvia; de la Sierra, Alejandro

    2014-09-01

    Although elevated urinary albumin excretion (UAE) is associated with cardiovascular prognosis and high blood pressure (BP), it is unknown whether differences in BP control could also exist between patients with different grades of UAE, even in the normal range. We sought to explore the association between different levels of UAE and BP control in treated hypertensive patients. A cohort of 1,200 treated hypertensive patients was evaluated. Clinical data, including 2 office BP measurements and UAE averaged from 2 samples, were recorded. Albuminuria was categorized into 4 groups: G0 (UAE <10mg/g), G1 (UAE 10-29 mg/g), G2 (UAE 30-299 mg/g), and G3 (UAE ≥300 mg/g). Forty-three percent of patients had systolic BP ≥140 mm Hg and/or diastolic BP ≥90 mm Hg. Median UAE was significantly higher (20.3 vs. 11.7 mg/g; P < 0.001) in these patients than in controlled hypertensive patients (BP<140/90 mm Hg). When UAE was categorized into the 4 groups, there were differences in BP control among groups (P < 0.001).The proportion of noncontrolled patients in G2 (52.3%) was significantly higher than in G0 (36.8%) and G1 (41.5%) (P < 0.01 and P < 0.05, respectively). Importantly, no significant differences were observed between G0 and G1 (P = 0.18) or between G2 and G3 (P = 0.48). With G0 as the reference group, the odds ratio of lack of BP control for the G2 group after adjustment for confounders was 1.40 (95% confidence interval =1.16-1.68; P < 0.001). Lack of BP control is more prevalent among patients with microalbuminuria than in patients with normoalbuminuria. No significant difference was seen between patients with optimal or high-normal UAE. © American Journal of Hypertension, Ltd 2014. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Lowering bronchoaspiration rate in an acute stroke unit by means of a 2 volume/3 texture dysphagia screening test with pulsioximetry.

    PubMed

    Cocho, D; Sagales, M; Cobo, M; Homs, I; Serra, J; Pou, M; Perez, G; Pujol, G; Tantinya, S; Bao, P; Aloy, A; Sabater, R; Gendre, J; Otermin, P

    During acute stroke, 30% of all patients present dysphagia and 50% of that subgroup will experience bronchoaspiration. Our aim was to compare mortality and bronchoaspiration rates associated with the water test compared to those associated with a 2 volume/3 texture test controlled with pulse oximetry (2v/3t-P test) in our stroke unit. Over a 5-year period, we performed a prospective analysis of all consecutive acute ischaemic stroke patients hospitalised in the Stroke Unit. Dysphagia was evaluated using the water test between 2008 and 2010 (group 0 or G0), and the 2v/3t-P test (group 1 or G1) between 2011 and 2012. We analysed demographic data, vascular risk factors, neurological deficit on the NIHSS, aetiological subtype according to TOAST criteria, clinical subtype according to the Oxfordshire classification, prevalence of dysphagia, percentage of patients with bronchoaspiration, and mortality. We examined 418 patients with acute stroke (G0=275, G1=143). There were significant differences between the 2 groups regarding the percentage of patients with TACI (17% in G0 vs. 29% in G1, P=.005) and median NIHSS score (4 points in G0 vs. 7 points in G1, P=.003). Since adopting the new swallowing test, we detected a non-significant increase in the percentage of dysphagia (22% in G0 vs. 25% in G1, P=.4), lower mortality (1.7% in G0 vs. 0.7% in G1, P=.3) and a significant decrease in the bronchoaspiration rate (6.2% in G0 vs. 2.1% in G1, P=.05). Compared to the water test used for dysphagia screening, the new 2v/3t-P test lowered bronchoaspiration rates in acute stroke patients. Copyright © 2014 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

  14. Studies of guinea pig immunoglobulin isotype, idiotype and antiidiotype

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tirrell, S.M.

    1988-01-01

    Immunization of Guinea pigs with diphtheria toxoid generated antibodies of the IgG class that were capable of neutralizing native toxin in vivo. Sera from these animals were used to affinity purify idiotypic antibodies (AB1). AB1 vaccines derived from the IgG1 class and from F(ab{prime}){sub 2} of IgG1 + IgG2 (IgG1/2) classes were effective in inducing a syngeneic anti-idiotype (AB2) response. Animals immunized with AB1 consisting of both IgG1/2 did not elicit a detectable AB2 response. Binding of homologous {sup 125}I-F(ab{prime}){sub 2} (AB1) to the antiidiotype was inhibited 90% in the presence of DT.F(ab{prime}){sub 2} derived from preimmune serum or hadmore » no inhibitory effects on the idiotype-antiidiotype interactions. Two groups of outbred guinea pigs were vaccinated with alum absorbed F(ab{prime}){sub 2} of anti-idiotype IgG1/2 (AB2). Of the ten animals inoculated with AB2, three tested positive by RIA against {sup 125}I-DT. Two of the RIA positive sera contained antibodies that neutralized diphtheria toxin in a rabbit intracutaneous assay. Purification of guinea pig IgG by protein A-Sepharose affinity chromatography resulted in the separation of three distinct IgG populations.« less

  15. [Evaluations of newborn screening program performance and enzymatic diagnosis of glucose-6-phosphate dehydrogenase deficiency in Guangzhou].

    PubMed

    Tang, F; Huang, Y L; Jiang, X; Jia, X F; Li, B; Feng, Y; Chen, Q Y; Tang, C F

    2018-05-02

    Objective: To reveal the molecular epidemiologic characteristics of glucose-6-phosphate dehydrogenase (G6PD) gene and to evaluate based on the genetic analysis the newborn screening program performance and enzymatic diagnosis of G6PD deficiency in Guangzhou. Methods: G6PD enzyme activities were measured by quantitative fluorescence assay in dry blood spots of 16 319 newborns(8 725 males, 7 594 females) 3-7 days after birth in Guangzhou Newborn Center. They were born in Guangzhou form Oct. 1 to 20, 2016. The cutoff value of G6PD was less than 2.6 U/g Hb in dry blood spots. G6PD deficiency was diagnosed when G6PD<1 700 U/L or G6PD/6PGD<1 in red blood cells. Genetic analysis of G6PD gene was performed on the dry blood spot samples of 823 newborns (including positive 346, negative 477)with various levels of G6PD enzyme activities through fluorescence PCR melting curve analysis(FMCA) to detect 15 kinds of mutations reported to be common among Chinese.G6PD gene Sanger sequency was performed in seven highly suspicious patients with negative results by FMCA. Results: (1) Using the cutoff value of G6PD< 2.6 U/g Hb , a total of 687(4.2%) newborns showed positive screening results, including 560 (6.4%) males and 127(1.7%) females. (2) Among the newborns with positive screening results, 214 males and 122 females were randomly chosen for G6PD gene analysis. The results showed that 197 (92.1%) males were hemizygote and 108(88.6%) females were mutation carriers with one to four alleles. Among the newborns with negative screening results, 41 males with G6PD 2.6-2.8 U/g Hb and 436 females with G6PD 2.6-4.5 U/g Hb were chosen for genetic analysis.Mutations were detected in 5(12.2%)boys, and 226(51.8%) girls were carriers.G6PD gene Sanger sequency of seven highly suspicious patients showed that c.406C>T, c.551C>T, c.835A>T hemizygote were found in 3 male's samples, respectively. (3) The estimated prevalence of harboring mutation was 6.0% in males and 13.5% in females according to rates of mutation in samples with various levels of G6PD enzyme activities. Six common mutations were c.1388G>A、c.1376G>T, c.95A> G, c.871G>A, c.1024C>T, c.392G>T, accounting for 95.5% of detected alleles .(4) based on results of G6PD gene analysis, the newborn scereening of G6PD deficiency with cutoff value G6PD<2.6 U/g Hb yielded a positive predict value(PPV) of 93.5%, a false-positive rate of 0.5%, and a sensitivity of 99.0% for males. A PPV of 88.5%, a false-positive rate of 0.2% . The prevalence of severe type G6PD deficiency in females was about 1.5%. Compared with to genetic analysis, the sensitivity and PPV of G6PD activity assay in red blood cells were 95.5%, 97.2%, respectively. Conclusions: The prevalence of G6PD deficiency in males was 6.0% in Guangzhou. Six mutations c.1388G>A, c.1376G>T, c.95A>G, c.871G>A, c.1024C>T, c.392G>T accounted for 95.5%. The cutoff value of G6PD<2.6 U/g Hb innewborn screening program and the criteria of biochemical diagnosis could accurately identify G6PD deficiency . Combined with biochemical and molecular analysis will improve the accuracy of diagnosis of G6PD deficiency and detect more heterozygous females.

  16. False-negative type-specific glycoprotein G antibody responses in STI clinic patients with recurrent HSV-1 or HSV-2 DNA positive genital herpes, The Netherlands.

    PubMed

    van Rooijen, Martijn S; Roest, Wim; Hansen, Gino; Kwa, David; de Vries, Henry J C

    2016-06-01

    Herpes simplex virus (HSV) type-discriminating antibody tests (glycoprotein G (gG) directed) are used to identify naïve persons and differentiate acute infections from recurrences. We studied test characteristics of three commercially available antibody tests in patients with recurrent (established by viral PCR tests) herpes simplex virus type 1 (HSV-1) or herpes simplex virus type 2 (HSV-2) genital herpes episodes. Serum samples (at minimum 3 months after t=0) were examined for the presence of gG-1-specific or gG-2-specific antibodies using the HerpeSelect 1 and 2 Immunoblot IgG, the HerpeSelect 1 and 2 enzyme linked immunoassays IgG and the LIAISON HSV-1 and HSV-2 IgG indirect chemiluminescence immunoassays. The immunoblot was HSV-1 positive in 70.6% (95% CI 44.0% to 89.7%), the LIAISON in 88.2% (95% CI 63.5% to 98.5%) and the ELISA in 82.4% (95% CI 56.6% to 96.2%) of the 17 patients with a recurrent HSV-1 episode. From 33 patients with a recurrent HSV-2 episode, the immunoblot was HSV-2 positive in 84.8% (95% CI 68.1% to 94.9%), the LIAISON in 69.7% (95% CI 51.3% to 84.4%) and the ELISA in 84.8% (95% CI 68.1% to 94.9%). Among 15/17 (88.2%; 95% CI 63.5% to 98.5%) patients with HSV-1 and 30/33 (90.1%; 95% CI 75.7% to 98.1%) patients with HSV-2, HSV-1 or HSV-2 antibodies, respectively, were detected in at least one of the three antibody tests. Commercial type-specific gG HSV-1 or HSV-2 antibody assays were false negative in 12-30% of patients with recurrent HSV-1 or HSV-2 DNA positive genital lesions. The clinical and epidemiological use of type-specific HSV serology can be hampered by false-negative results, especially if based on a single test. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  17. Facile and environmentally friendly synthesis of ultrathin nickel hydroxide nanosheets with excellent supercapacitor performances

    NASA Astrophysics Data System (ADS)

    Hu, Xiaowei; Liu, Sheng; Li, Chenghui; Huang, Jiahao; Luv, Jixing; Xu, Pan; Liu, Jian; You, Xiao-Zeng

    2016-06-01

    In this article, we report a facile and environmentally friendly glutamic acid-assisted hydrothermal strategy for the preparation of ultrathin two-dimensional (2D) β-Ni(OH)2 nanosheets with a thickness of about 2 nm, which exhibit a maximum specific capacitance of 2537.4 F g-1 at a current density of 1 A g-1, even at 10 A g-1, the specific capacitance is still maintained at 2290.0 F g-1 with 77.6% retention after 3000 cycles.In this article, we report a facile and environmentally friendly glutamic acid-assisted hydrothermal strategy for the preparation of ultrathin two-dimensional (2D) β-Ni(OH)2 nanosheets with a thickness of about 2 nm, which exhibit a maximum specific capacitance of 2537.4 F g-1 at a current density of 1 A g-1, even at 10 A g-1, the specific capacitance is still maintained at 2290.0 F g-1 with 77.6% retention after 3000 cycles. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02912d

  18. THE GALACTIC CENTER CLOUD G2 AND ITS GAS STREAMER

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pfuhl, Oliver; Gillessen, Stefan; Eisenhauer, Frank

    2015-01-10

    We present new, deep near-infrared SINFONI @ VLT integral field spectroscopy of the gas cloud G2 in the Galactic Center, from late 2013 August, 2014 April, and 2014 July. G2 is visible in recombination line emission. The spatially resolved kinematic data track the ongoing tidal disruption. The cloud reached minimum distance to the MBH of 1950 Schwarzschild radii. As expected for an observation near the pericenter passage, roughly half of the gas in 2014 is found at the redshifted, pre-pericenter side of the orbit, while the other half is at the post-pericenter, blueshifted side. We also present an orbital solutionmore » for the gas cloud G1, which was discovered a decade ago in L'-band images when it was spatially almost coincident with Sgr A*. The orientation of the G1 orbit in the three angles is almost identical to that of G2, but it has a lower eccentricity and smaller semi-major axis. We show that the observed astrometric positions and radial velocities of G1 are compatible with the G2 orbit, assuming that (1) G1 was originally on the G2 orbit preceding G2 by 13 yr, and (2) a simple drag force acted on it during pericenter passage. Taken together with the previously described tail of G2, which we detect in recombination line emission and thermal broadband emission, we propose that G2 may be a bright knot in a much more extensive gas streamer. This matches purely gaseous models for G2, such as a stellar wind clump or the tidal debris from a partial disruption of a star.« less

  19. Liposomal gD ectodomain (gD1-306) vaccine protects against HSV2 genital or rectal infection of female and male mice.

    PubMed

    Olson, K; Macias, P; Hutton, S; Ernst, W A; Fujii, G; Adler-Moore, J P

    2009-12-11

    Herpes simplex virus type 2 (HSV2) is the most common causative agent of genital herpes, with infection rates as high as 1 in 6 adults. The present studies were done to evaluate the efficacy of a liposomal HSV2 gD(1-306) vaccine (L-gD(1-306)-HD) in an acute murine HSV2 infection model of intravaginal (female) or intrarectal (male or female) challenge. Two doses of L-gD(1-306)-HD containing 60 microg gD(1-306)-HD and 15 microg monophosphoryl lipid A (MPL) per dose provided protection against HSV2 intravaginal challenge (86-100% survival, P< or =0.0003 vs. control liposomes; P=0.06 vs. L-gD(1-306)-HD without MPL). Both male and female mice (BALB/c and C57BL/6) immunized with L-gD(1-306)-HD/MPL were significantly protected against HSV2 intrarectal challenge, with higher survival rates compared to controls (71-100%, P< or =0.007). L-gD(1-306)-HD/MPL also provided increased survival when compared to a liposomal peptide vaccine, L-gD(264-285)-HD/MPL (male BALB/c, P

  20. Efficacy of a public promotion program on children's oral health.

    PubMed

    Alves, Ana Paula S; Rank, Rise C I C; Vilela, Joana Estela R; Rank, Marcos S; Ogawa, Wataro N; Molina, Omar F

    2017-09-25

    To assess the efficacy of the Baby's Mouth early dental care prevention and promotion program in preventing oral diseases (caries, gingivitis, or malocclusions) in children attended since 2010. This was a cross-sectional and cohort study that assessed 252 children between 36 and 60 months of age in both sexes. The children were divided into three groups: G1: effective participants of the program from birth; G2: children who have stopped participating for more than 24 months, and G3: children who have never attended a prevention program. The evaluation was carried out in two stages: first, an interview with the mothers and, afterwards, a clinical children examination to assess the presence of caries, gingivitis, and malocclusion. The chi-squared test was used for statistical analysis between groups (p<0.05). The diseases assessed were: caries (G1: 5.9%, G2: 54.7%, G3: 70%), gingivitis (G1: 8.3%, G2: 17.9%, G3: 40.5%), and malocclusion (G1: 22.6%; G2: 28.6%; G3: 50%). For gingivitis, there was no significant difference when comparing G1 and G2 (p=0.107), but it was significant between G1 and G3 (p<0.001). Regarding malocclusion, a statistically significant relationship was observed (p=0.004) among all groups. The prevention and promotion program in public oral health was effective in preventing caries disease, gingivitis, and malocclusion in children under 5 years of age. Copyright © 2017 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  1. The effect of repeated torque in small diameter implants with machined and premachined abutments.

    PubMed

    Saboury, Abolfazl; Neshandar Asli, Hamid; Vaziri, Shahram

    2012-05-01

    Detorquing value is an important factor in the amount of preload stresses during abutment screw fastening. This study evaluated the percentage of detorque values in two-piece machined titanium and premachined cast abutments in small diameter implants. Three groups of five samples were evaluated. Group 1 (G1), machined titanium abutments, group 2 (G2), premachined cast straight abutments that cast with gold-palladium, and group 3 (G3), premachined angled cast abutments that cast with the same alloy, were angled before casting. Each abutment was torque to 24 Ncm according to the manufacturer's instructions and detorqued five times. The means of detorquing and torquing values in all groups were recorded. The mean of detorque in each group as a percentage of the toque value was calculated. The data for all groups were compared and calculated using analysis of variance (ANOVA) and t-test. Mean detorque values in G1, G2, and G3 were 88.1 ± 1.69, 93.1 ± 2.68, and 80.9 ± 4.95%, respectively. The ANOVA showed significant differences in mean of applied detorque (p < .001) and torque (p = .06) tightening among different groups. G2 had significantly greater detorque values (p < .05). No significant differences were found between G1 and G2. Surprisingly, abutment screw fracture occurred in three samples of G3. G3 showed significant percentage torque reduction (p < .05) and exhibited abutment screw fracture during evaluation. G2 presented the lowest torque reduction. Screw fracture occurred only in G3. © 2012 Wiley Periodicals, Inc.

  2. The Contribution of Matrix Metalloproteinase-1 Genotype to Oral Cancer Susceptibility in Taiwan.

    PubMed

    Sun, Kuo-Ting; Tsai, Chia-Wen; Chang, Wen-Shin; Shih, Liang-Chun; Chen, Liang-Yu; Tsai, Ming-Hsiu; Ji, Hong-Xue; Hsiao, Chieh-Lun; Liu, Yu-Cheng; Li, Chi-Yuan; Bau, DA-Tian

    2016-01-01

    Metalloproteinases (MMPs) are a family of multifunctional proteins which have been shown to be up-regulated in various types of cancer. However, the contribution of MMP1 genotype to oral cancer has not been elucidated. This study aimed to evaluate the contribution of MMP1 promoter 1607 genotype to the risk of oral cancer. In this case-control study, MMP1 genotype and its interaction with consumption of areca, cigarettes, and alcohol in determining oral cancer risk were investigated in 788 patients with oral cancer and 956 gender-matched healthy controls. The distribution of 2G/2G, 1G/2G and 1G/1G for MMP1 promoter 1607 genotype was 36.8%, 40.2% and 23.0% in the oral cancer group and 34.3%, 44.9% and 20.8% in the non-cancer control group, respectively (p for trend=0.1454). We also analyzed the allelic frequency distributions and found that the variant 1G allele of MMP1 promoter 1607 conferred similar oral cancer susceptibility as the wild-type 2G allele (odds ratio=0.99, 95% confidence interval=0.87-1.14, p=0.9199). As for the gene-lifestyle interaction, there was an obvious protective effect of MMP1 promoter 1607 1G/2G genotype on the risk of oral cancer among smokers (odds ratio=0.71, 95% confidence interval=0.55-0.91, p=0.0076), but not non-smokers. There was no interaction between MMP1 promoter 1607 genotype and areca chewing or alcohol drinking habits. The 1G/2G genotype of MMP1 promoter 1607 may have a protective effect on oral cancer risk for smokers. The detailed mechanisms involved in this require further investigation. Copyright © 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  3. IgG Antibody Responses to Recombinant gp120 Proteins, gp70V1/V2 Scaffolds, and a CyclicV2 Peptide in Thai Phase I/II Vaccine Trials Using Different Vaccine Regimens.

    PubMed

    Karasavvas, Nicos; Karnasuta, Chitraporn; Savadsuk, Hathairat; Madnote, Sirinan; Inthawong, Dutsadee; Chantakulkij, Somsak; Rittiroongrad, Surawach; Nitayaphan, Sorachai; Pitisuttithum, Punnee; Thongcharoen, Prasert; Siriyanon, Vinai; Andrews, Charla A; Barnett, Susan W; Tartaglia, James; Sinangil, Faruk; Francis, Donald P; Robb, Merlin L; Michael, Nelson L; Ngauy, Viseth; de Souza, Mark S; Paris, Robert M; Excler, Jean-Louis; Kim, Jerome H; O'Connell, Robert J

    2015-11-01

    RV144 correlates of risk analysis showed that IgG antibodies to gp70V1V2 scaffolds inversely correlated with risk of HIV acquisition. We investigated IgG antibody responses in RV135 and RV132, two ALVAC-HIV prime-boost vaccine trials conducted in Thailand prior to RV144. Both trials used ALVAC-HIV (vCP1521) at 0, 1, 3, and 6 months and HIV-1 gp120MNgD and gp120A244gD in alum (RV135) or gp120SF2 and gp120CM235 in MF59 (RV132) at 3 and 6 months. We assessed ELISA binding antibodies to the envelope proteins (Env) 92TH023, A244gD and MNgD, cyclicV2, and gp70V1V2 CaseA2 (subtype B) and 92TH023 (subtype CRF01_AE), and Env-specific IgG1 and IgG3. Antibody responses to gp120 A244gD, MNgD, and gp70V1V2 92TH023 scaffold were significantly higher in RV135 than in RV132. Antibodies to gp70V1V2 CaseA2 were detected only in RV135 vaccine recipients and IgG1 and IgG3 antibody responses to A244gD were significantly higher in RV135. IgG binding to gp70V1V2 CaseA2 and CRF01_AE scaffolds was higher with the AIDSVAX(®)B/E boost but both trials showed similar rates of antibody decline post-vaccination. MF59 did not result in higher IgG antibody responses compared to alum with the antigens tested. However, notable differences in the structure of the recombinant proteins and dosage used for immunizations may have contributed to the magnitude and specificity of IgG induced by the two trials.

  4. Prognostic value of the PAI-1 4G/5G polymorphism in invasive ductal carcinoma of the breast.

    PubMed

    Yagmurdur, M C; Atac, F B; Tutar, N U; Verdi, H; Isiklar, I; Ozdemir, B H; Ozbek, N; Karakayali, H; Haberal, M

    2008-01-01

    The study group was derived from the archive materials of 55 invasive ductal breast cancer (IDC) patients who had undergone breast-preserving surgery (partial mastectomy/ axillary dissection). All patients included in the study had clinically T(1)-2, N0-M0 invasive ductal carcinoma. Genomic DNA species were extracted from paraffin-embedded blocks, and plasminogen activator inhibitor type-1 (PAI-1) gene 4G/5G genotyping was done by polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP). Patient demographics, axillary metastasis status, metastatic lymph nodi/total dissected lymph nodes from axilla, histopathologic characteristics of tumors, local recurrences, and survival ratio were assessed. PAI-1 4G/5G genotype frequencies were 4G/4G (64%), 4G/5G (31%), and 5G/5G (5%) in the patient group. According to the results based on frequencies, the demographics were not different. Five-year local recurrence rate of 4G/5G patients was the lowest (2/17, 12%) (P = 0.02). Also five-year distant metastases ratio of 4G/5G patients was the highest (18%) (P = 0.01). Five- and 10-year disease-free survival rates for the 4G/4G, 4G/5G, and 5G/5G groups were 97% and 94%, 82% and 77%, and 100% and 94%, respectively (P = 0.004). The results of this study indicate that the 4G allele in the PAI 1 gene had a negative impact on local recurrence and disease-free survival of patients with clinical T(1)-2N0M0 IDC.

  5. Influence of laser-welding and electroerosion on passive fit of implant-supported prosthesis.

    PubMed

    Silva, Tatiana Bernardon; De Arruda Nobilo, Mauro Antonio; Pessanha Henriques, Guilherme Elias; Mesquita, Marcelo Ferraz; Guimaraes, Magali Beck

    2008-01-01

    This study investigated the influence of laser welding and electroerosion procedure on the passive fit of interim fixed implant-supported titanium frameworks. Twenty frameworks were made from a master model, with five parallel placed implants in the inter foramen region, and cast in commercially pure titanium. The frameworks were divided into 4 groups: 10 samples were tested before (G1) and after (G2) electroerosion application; and another 10 were sectioned into five pieces and laser welded before (G3) and after (G4) electroerosion application. The passive fit between the UCLA abutment of the framework and the implant was evaluated using an optical microscope Olympus STM (Olympus Optical Co., Tokyo, Japan) with 0.0005mm of accuracy. Statistical analyses showed significant differences between G1 and G2, G1 and G3, G1 and G4, G2 and G4. However, no statistical difference was observed when comparing G2 and G3. These results indicate that frameworks may show a more precise adaptation if they are sectioned and laser welded. In the same way, electroerosion improves the precision in the framework adaptation.

  6. Measurement of singlet delta oxygen in an atmospheric-pressure helium-oxygen plasma jet

    NASA Astrophysics Data System (ADS)

    Inoue, Yuki; Ono, Ryo

    2017-06-01

    The density of singlet delta oxygen {{\\text{O}}2}≤ft({{a}1}{{ Δ }g}\\right) is measured in situ in a He/O2 atmospheric-pressure plasma jet using optical emission spectroscopy at 1.27 μm. A sinusoidal high voltage of 1-10 kHz is applied between two electrodes wrapped around a quartz tube, in which the working gas flows. The two-dimensional distribution of the {{\\text{O}}2}≤ft({{a}1}{{ Δ }g}\\right) density shows that {{\\text{O}}2}≤ft({{a}1}{{ Δ }g}\\right) is primarily produced in the dielectric barrier discharge inside the quartz tube and that the {{\\text{O}}2}≤ft({{a}1}{{ Δ }g}\\right) production in the plasma jet plume is negligibly small. Typically, 100 ppm of {{\\text{O}}2}≤ft({{a}1}{{ Δ }g}\\right) is produced. The {{\\text{O}}2}≤ft({{a}1}{{ Δ }g}\\right) density increases with O2 concentration and is proportional to the specific input energy (SIE; J/l) irrespective of the discharge voltage, frequency, and gas flow rate. The {{\\text{O}}2}≤ft({{a}1}{{ Δ }g}\\right) production per SIE was 10 ppm/(J/l). The loss processes of {{\\text{O}}2}≤ft({{a}1}{{ Δ }g}\\right) via reactions with O3 and O2 are discussed. The {{\\text{O}}2}≤ft({{a}1}{{ Δ }g}\\right) density decreases when the working gas is humidified. An addition of 200 ppm of H2O decreases the {{\\text{O}}2}≤ft({{a}1}{{ Δ }g}\\right) density by half.

  7. Neumann boundary controllability of the Gear-Grimshaw system with critical size restrictions on the spatial domain

    NASA Astrophysics Data System (ADS)

    Capistrano-Filho, Roberto A.; Gallego, Fernando A.; Pazoto, Ademir F.

    2016-10-01

    In this paper, we study the boundary controllability of the Gear-Grimshaw system posed on a finite domain (0, L), with Neumann boundary conditions: ut + uu_x+u_{xxx} + a v_{xxx} + a_1vv_x+a_2 (uv)_x =0, & {in} (0,L)× (0,T), c v_t +rv_x +vv_x+abu_{xxx} +v_{xxx}+a_2buu_x+a_1b(uv)_x =0, &{in} (0,L)× (0,T), u_{xx}(0,t)=h_0(t), u_x(L,t)=h_1(t), u_{xx}(L,t)=h_2(t), &{in} (0,T), v_{xx}(0,t)=g_0(t), v_x(L,t)=g_1(t), v_{xx}(L,t)=g_2(t), &{in} (0,T), u(x,0)= u^0(x), quad v(x,0)= v^0(x), & {in} (0,L). We first prove that the corresponding linearized system around the origin is exactly controllable in {(L^2(0,L))^2} when h 2( t) = g 2( t) = 0. In this case, the exact controllability property is derived for any L > 0 with control functions {h_0, g_0 in H^{-1/3}(0,T)} and {h_1, g_1in L^2(0,T)}. If we change the position of the controls and consider {h_0(t)=h_2(t)=0} (resp. {g_0(t)=g_2(t)=0)}, we obtain the result with control functions {g_0, g_2in H^{-1/3}(0,T)} and {h_1, g_1in L^2(0,T)} if and only if the length L of the spatial domain (0, L) does not belong to a countable set. In all cases, the regularity of the controls are sharp in time. If only one control act in the boundary condition, {h_0(t)=g_0(t)=h_2(t)=g_2(t)=0} and g 1( t) = 0 (resp. h 1( t) = 0), the linearized system is proved to be exactly controllable for small values of the length L and large time of control T. Finally, the nonlinear system is shown to be locally exactly controllable via the contraction mapping principle, if the associated linearized systems are exactly controllable.

  8. Multigene analysis suggests ecological speciation in the fungal pathogen Claviceps purpurea

    PubMed Central

    DOUHAN, G. W.; SMITH, M. E.; HUYRN, K. L.; WESTBROOK, A.; Beerli, P.; FISHER, A. J.

    2008-01-01

    Claviceps purpurea is an important pathogen of grasses and source of novel chemical compounds. Three groups within this species (G1, G2, and G3) have been recognized based on habitat association, sclerotia and conidia morphology, and alkaloid production. These groups have further been supported by RAPD and AFLP markers, suggesting this species may be more accurately described as a species complex. However, all divergent ecotypes can coexist in sympatric populations with no obvious physical barriers to prevent gene flow. In this study, we used both phylogenetic and population genetic analyses to test for speciation within C. purpurea using DNA sequences from ITS, a RAS-like locus, and a portion of beta-tubulin. The G1 types are significantly divergent from the G2/G3 types based on each of the three loci and the combined dataset, whereas the G2/G3 types are more integrated with one another. Although the G2 and G3 lineages have not diverged as much as the G1 lineage based on DNA sequence data, the use of three DNA loci does reliably separate the G2 and G3 lineages. However, the population genetic analyses strongly suggest little to no gene flow occurring between the different ecotypes and we argue that this process is driven by adaptations to ecological habitats; G1 isolates are associated with terrestrial grasses, G2 isolates are found in wet and shady environments, and G3 isolates are found in salt marsh habitats. PMID:18373531

  9. Enzymatic Formation of G-Group Aflatoxins and Biosynthetic Relationship between G- and B-Group Aflatoxins

    PubMed Central

    Yabe, Kimiko; Nakamura, Miki; Hamasaki, Takashi

    1999-01-01

    We detected biosynthetic activity for aflatoxins G1 and G2 in cell extracts of Aspergillus parasiticus NIAH-26. We found that in the presence of NADPH, aflatoxins G1 and G2 were produced from O-methylsterigmatocystin and dihydro-O-methylsterigmatocystin, respectively. No G-group aflatoxins were produced from aflatoxin B1, aflatoxin B2, 5-methoxysterigmatocystin, dimethoxysterigmatocystin, or sterigmatin, confirming that B-group aflatoxins are not the precursors of G-group aflatoxins and that G- and B-group aflatoxins are independently produced from the same substrates (O-methylsterigmatocystin and dihydro-O-methylsterigmatocystin). In competition experiments in which the cell-free system was used, formation of aflatoxin G2 from dihydro-O-methylsterigmatocystin was suppressed when O-methylsterigmatocystin was added to the reaction mixture, whereas aflatoxin G1 was newly formed. This result indicates that the same enzymes can catalyze the formation of aflatoxins G1 and G2. Inhibition of G-group aflatoxin formation by methyrapone, SKF-525A, or imidazole indicated that a cytochrome P-450 monooxygenase may be involved in the formation of G-group aflatoxins. Both the microsome fraction and a cytosol protein with a native mass of 220 kDa were necessary for the formation of G-group aflatoxins. Due to instability of the microsome fraction, G-group aflatoxin formation was less stable than B-group aflatoxin formation. The ordA gene product, which may catalyze the formation of B-group aflatoxins, also may be required for G-group aflatoxin biosynthesis. We concluded that at least three reactions, catalyzed by the ordA gene product, an unstable microsome enzyme, and a 220-kDa cytosol protein, are involved in the enzymatic formation of G-group aflatoxins from either O-methylsterigmatocystin or dihydro-O-methylsterigmatocystin. PMID:10473388

  10. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 8 2011-04-01 2011-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

  11. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 8 2013-04-01 2013-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

  12. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 8 2012-04-01 2012-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

  13. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a) In...

  14. 26 CFR 1.665(g)-2A - Application of separate share rule.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 8 2014-04-01 2014-04-01 false Application of separate share rule. 1.665(g)-2A Section 1.665(g)-2A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED... Taxable Years Beginning on Or After January 1, 1969 § 1.665(g)-2A Application of separate share rule. (a...

  15. [Oral nutritional supplementation in hematologic patients].

    PubMed

    Peñalva, A; San Martín, A; Rosselló, J; Pérez-Portabella, C; Palacios, A; Julià, A; Planas, M

    2009-01-01

    Hematological patients often present anorexia which along with other secondary effects from the chemotherapy and/or radiotherapy treatments compromise their nutritional status. Oral supplementation can aid to fulfill the energy and protein requirements of these patients. Nevertheless, the use of commercial nutritional supplements normally available, is limited by its poor intake. To evaluate the degree of fulfillment of the prescribed supplements and fulfillment of energy requirements, as well as the development of nutritional status in hematological patients hospitalized for treatment with chemotherapy and/or radiotherapy. Prospective, randomized and open study of inpatients at the hematological ward. Patients were randomized sequentially and they were assigned into 3 different nutritional interventions providing: Group 1 (G1), a flavored supplement; Group 2 (G2): a non flavored (neutral) supplement and Group 3 (G3): "kitchen" foods as supplements. Need and amount of nutritional supplements were provided according to the oral intake previously analyzed. Nutritional assessment (at admission and discharge) was based in the Subjective Global Assessment test (SGA), Risk Nutritional Index (RNI) and percentage of lost weight. Both fulfillment of supplement intake and achievement of energetic requirements were analyzed. 125 patients of 51.3 +/- 16.8 years; 45% men and 55% women. 54% lymphoma, 33% leukemia, 8% myeloma and others 4%. Length of stay (LOS): 7.0 +/- 3.6 d. The nutritional assessment done by SGA showed significant negative changes in G2 and G3 (G1: 30% developed malnutrition and 28% improved their nutritional status, p = NS; G2: 50% developed malnutrition against 7% whom improved their nutritional status, p = 0.002; y G3: 37% developed malnutrition against 21% whom improved their nutritional status, p = 0.02). According to RNI, patients evolved negatively from their nutritional state but no significant differences were found within groups (G1, from 81% of malnutrition to 90%; G2, from 77% to 91%, and G3 from 71% to 85%). Globally, during hospitalization patients lost weight significantly (2.3 +/- 2.2 kg, p < 0.001), but within groups weight loss differences were not significant (G1, 1.16 kg; G2, 1.75 kg, y G3, 1.17 kg). All three groups required intake of supplements (G1, 47%; G2, 30%, and G3, 47%). The percentage of fulfillment of oral intake was similar in both commercial supplemented groups (G1, 47% and G2, 58%) although it was significantly greater in those receiving kitchen supplements (G3, 100%, p < 0.001). The fulfillment of energy requirements at admission and discharge did not showed significant changes (G1, from 53% to 46%; G2, from 67% to 52% and G3 from 49% to 55%). Our results suggest that hematological patients admitted to hospital for treatment with chemotherapy and/or radiotherapy loose weight during their hospitalization and present intakes below their energy requirements so they need supplementation. Kitchen supplements are better accepted than commercial ones although that does not result in an increased total energy intake. The group which received commercial flavored supplements was the only one which did not showed negative significant changes in the nutritional status evaluated by SGA.

  16. Heteromerization of G2A and OGR1 enhances proton sensitivity and proton-induced calcium signals.

    PubMed

    Huang, Ya-Han; Su, Yeu-Shiuan; Chang, Chung-Jen; Sun, Wei-Hsin

    2016-12-01

    Proton-sensing G-protein-coupled receptors (GPCRs; OGR1, GPR4, G2A, TDAG8), with full activation at pH 6.4 ∼ 6.8, are important to pH homeostasis, immune responses and acid-induced pain. Although G2A mediates the G13-Rho pathway in response to acid, whether G2A activates Gs, Gi or Gq proteins remains debated. In this study, we examined the response of this fluorescence protein-tagged OGR1 family to acid stimulation in HEK293T cells. G2A did not generate detectable intracellular calcium or cAMP signals or show apparent receptor redistribution with moderate acid (pH ≥ 6.0) stimulation but reduced cAMP accumulation under strong acid stimulation (pH ≤ 5.5). Surprisingly, coexpression of OGR1- and G2A-enhanced proton sensitivity and proton-induced calcium signals. This alteration is attributed to oligomerization of OGR1 and G2A. The oligomeric potential locates receptors at a specific site, which leads to enhanced proton-induced calcium signals through channels.

  17. Chemoraces and Habitat Specialization of Claviceps purpurea Populations

    PubMed Central

    Pažoutová, Sylvie; Olšovská, Jana; Linka, Marek; Kolínská, Renata; Flieger, Miroslav

    2000-01-01

    We studied genetic variability of 100 isolates of Claviceps purpurea by using randomly amplified polymorphic DNA (RAPD), an EcoRI restriction site polymorphism in the 5.8S ribosomal DNA (rDNA), the alkaloids produced, and conidial morphology. We identified three groups: (i) group G1 from fields and open meadows (57 isolates), (ii) group G2 from shady or wet habitats (41 isolates), and (iii) group G3 from Spartina anglica from salt marshes (2 isolates). The sclerotia of G1 isolates contained ergotamines and ergotoxines; G2 isolates produced ergosine and ergocristine along with small amounts of ergocryptine; and G3 isolates produced ergocristine and ergocryptine. The conidia of G1 isolates were 5 to 8 μm long, the conidia of G2 isolates were 7 to 10 μm long, and the conidia of G3 isolates were 10 to 12 μm long. Sclerotia of the G2 and G3 isolates floated on water. In the 5.8S rDNA analysis, an EcoRI site was found in G1 and G3 isolates but not in G2 isolates. The host preferences of the groups were not absolute, and there were host genera that were common to both G1 and G2; the presence of members of different groups in the same locality was rare. Without the use of RAPD or rDNA polymorphism, it was not possible to distinguish the three groups solely on the basis of phenotype, host, or habitat. In general, populations of C. purpurea are not host specialized, as previously assumed, but they are habitat specialized, and collecting strategies and toxin risk assessments should be changed to reflect this paradigm shift. PMID:11097923

  18. Effects of different types of temporary cements on the tensile strength and marginal adaptation of crowns on implants.

    PubMed

    Akashia, Ana Eliza; Francischone, Carlos Eduardo; Tokutsune, Edson; da Silva, Walter

    2002-01-01

    The aim of this study was to evaluate the influence of four different types of temporary cements, Tempbond (Kerr), Tempbond NE (Kerr), Improv (Sterioss), and Dycal (Dentsply/Caulk), on the marginal adaptation and tensile strength of prosthetic specimens cemented on replicas of CeraOne abutments. Four test groups were formed: Group 1 (G-1), Tempbond (Kerr); Group 2 (G-2), Tempbond NE (Kerr); Group 3 (G-3), Improv (Sterioss); Group 4 (G-4), Dycal (Dentsply/Caulk). For the specimens, gold cylinders (DCB 160, Nobel Biocare) adapted to stainless steel replicas of CeraOne abutments (Nobel Biocare) were utilized. The replicas on a stainless steel base were made in a special machine for implant components. The cement thicknesses for each luting agent were measured using a Measurement Comparative Microscope (Mitutoyo). The readings obtained before cementation were used as the controls (G-0). Following each group's cementation, the specimens were submitted to tensile strength tests with a Universal Testing Machine (Kratus). The results of the marginal adaptation test as reflected by cement thicknesses were: G-0 = 11.7 microm, G-1 = 35.7 microm (+/- 8.8), G-2 = 41.7 microm (+/- 9.0), G-3 = 32.6 microm (+/- 9.7) and G-4 = 38.2 microm (+/- 6.7). The tensile strength tests yielded the following values: G-1 = 58.5 N (+/- 14.8), G-2 = 51 N (+/- 8.2), G-3 = 61.8 N (+/- 17.1) and G-4 = 71.8 N (+/- 9.3). The four temporary cements tested all provided similar marginal adaptation. G-4 (Dycal) showed a higher tensile strength than G-2 (Tempbond NE).

  19. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 9 2010-04-01 2010-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Income from Sources Without the United States § 1.904(g)-2 Recapture...

  20. 26 CFR 1.860G-2T - Other rules (temporary).

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 9 2013-04-01 2013-04-01 false Other rules (temporary). 1.860G-2T Section 1.860G-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-2T Other rules (temporary). (a...

  1. 26 CFR 1.860G-2T - Other rules (temporary).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 9 2012-04-01 2012-04-01 false Other rules (temporary). 1.860G-2T Section 1.860G-2T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Real Estate Investment Trusts § 1.860G-2T Other rules (temporary). (a...

  2. Changes in deciduous and permanent dentinal tubules diameter after several conditioning protocols: In vitro study.

    PubMed

    de Los Angeles Moyaho-Bernal, María; Contreras-Bulnes, Rosalía; Rodríguez-Vilchis, Laura Emma; Rubio-Rosas, Efraín

    2018-05-08

    Innovators conditioning protocols are emerged in permanent dentin, however for deciduous dentin the information is limited; the aim of this study was to evaluate in vitro diameter of deciduous and permanent dentinal tubules after several conditioning protocols. Eighty dentin samples were distributed in sixteen groups (n = 5 p/g) and dentin surface was conditioned as follow: G1D/G1P acid etching; G2D/G2P, self-etch adhesive; G3D/G3P, G4D/G4P, Er: YAG laser irradiation at 200 mJ-25.5 J/cm 2 and 300 mJ-38.2 J/cm 2 , at 10 Hz under water spray respectively; G5D/G5P, G6D/G6P, G7D/G7P, and G8D/G8P were irradiated under the same energy densities followed phosphoric acid or self-etch adhesive conditioning. The sample dentin of deciduous and permanent teeth was analyzed with scanning electron microscopy and tubule diameter was evaluated by Image Tools Scandium program. Data were subjected to one-way analysis ANOVA to compare among groups with a level of significance at p ≤ .05. For deciduous dentin, diameters were from 1.52 ± 0.32 µm in G3D to 3.88 ± 0.37 µm in G1D; narrowest and widest diameter, respectively (p < .000). While permanent dentin tubules exhibited diameters from 1.16 ± 0.16/1.19 ± 0.12 µm in G7P/G8P to 2.76 ± 0.28 µm in G6P; narrowest and widest diameter, respectively (p < .000). All dentin conditioning protocols produced more open dentin tubules (diameter size) in deciduous dentin than permanent, specific conditioning protocols are required for each tissue (deciduous or permanent dentin), since same protocol produced stronger effects on primary dentin, which is important for dental clinical success in children and adolescents. © 2018 Wiley Periodicals, Inc.

  3. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  4. Genetic diversity and recombination of enterovirus G strains in Japanese pigs: High prevalence of strains carrying a papain-like cysteine protease sequence in the enterovirus G population.

    PubMed

    Tsuchiaka, Shinobu; Naoi, Yuki; Imai, Ryo; Masuda, Tsuneyuki; Ito, Mika; Akagami, Masataka; Ouchi, Yoshinao; Ishii, Kazuo; Sakaguchi, Shoichi; Omatsu, Tsutomu; Katayama, Yukie; Oba, Mami; Shirai, Junsuke; Satani, Yuki; Takashima, Yasuhiro; Taniguchi, Yuji; Takasu, Masaki; Madarame, Hiroo; Sunaga, Fujiko; Aoki, Hiroshi; Makino, Shinji; Mizutani, Tetsuya; Nagai, Makoto

    2018-01-01

    To study the genetic diversity of enterovirus G (EV-G) among Japanese pigs, metagenomics sequencing was performed on fecal samples from pigs with or without diarrhea, collected between 2014 and 2016. Fifty-nine EV-G sequences, which were >5,000 nucleotides long, were obtained. By complete VP1 sequence analysis, Japanese EV-G isolates were classified into G1 (17 strains), G2 (four strains), G3 (22 strains), G4 (two strains), G6 (two strains), G9 (six strains), G10 (five strains), and a new genotype (one strain). Remarkably, 16 G1 and one G2 strain identified in diarrheic (23.5%; four strains) or normal (76.5%; 13 strains) fecal samples possessed a papain-like cysteine protease (PL-CP) sequence, which was recently found in the USA and Belgium in the EV-G genome, at the 2C-3A junction site. This paper presents the first report of the high prevalence of viruses carrying PL-CP in the EV-G population. Furthermore, possible inter- and intragenotype recombination events were found among EV-G strains, including G1-PL-CP strains. Our findings may advance the understanding of the molecular epidemiology and genetic evolution of EV-Gs.

  5. Microwave Observations and Modeling of O2 (1-delta(sub g)) and O3 Diurnal Variation in the Mesosphere

    NASA Technical Reports Server (NTRS)

    Sandor, Brad J.; Clancy, R. Todd; Rusch, David W.; Randall, Cora E.; Eckman, Richard S.; Siskind, David S.; Muhleman, Duane O.

    1997-01-01

    The first microwave measurements of an electronically excited molecular species in the Earth's atmosphere are presented. Local thermodynamic equilibrium (LTE) rotational line emission from mesospheric O2(1-del(sub g)) was observed at a frequency of 255.01794 GHz (lambda is approx. 1.2 mm), employing the National Radio Astronomy Observatory (NRAO) millimeter facility at Kitt Peak, Arizona (32 N, 111 W). The pressure broadened line shapes of the O2(1-del(sub g)) spectra, which were obtained in January and April 1992 and in January and November 1993, are inverted to retrieve O2(1-del(sub g)) mixing profiles over the 50-70 km altitude region. The observed daytime abundances exceed ozone abundances in the lower mesosphere, which are separately retrieved with coincident O3 spectral line (249.7886 GHz) observations. The January and November 1993 observations are binned into 20-60 min time intervals to study O2(1-del(sub g)) diurnal behavior. Derived abundances of O2(1-del(sub g)) between 50 and 70 km for the four observation dates are 9%, 31%, 3%, and 26%, respectively, each +/- 10% higher than predicted, based on the simple photochemistry of lower mesospheric O2(1-del(sub g)). Modeled variation of [O2(1-del(sub g))] with time of day agrees with observed variation in that the observed difference between model and data abundances is constant throughout the daylight hours of each observation date. Model underprediction Of [02(lAg)] is consistent with similar model underprediction of mesospheric [O3]. A perturbation to the photochemical model that forces decreased ozone chemical loss brings brings both model [O3] and [O2(1-del(sub g))] into agreement with the observations. O2(1-del(sub g)) abundances derived from these 1.2 mm observations agree with [O2(1-del(sub g))] values derived from comparable SME observations of the 1.27 micrometers emission, with assumption of a 3880 sec O2(1-del(sub g)) radiative lifetime. The 6800 sec O2(1-del(sub g)) radiative lifetime proposed by Mlynczak and Nesbitt is ruled out by the similar comparison.

  6. Influence of matrix metalloproteinase gene polymorphisms in healthy North Indians compared to variations in other ethnic groups worldwide.

    PubMed

    Srivastava, Priyanka; Kapoor, Rakesh; Mittal, Rama Devi

    2009-01-01

    Matrix metalloproteinases have a range of biological functions, including the liberation of cytokines and membrane-bound receptors, with roles in promotion of tumor invasion and angiogenesis. Several polymorphisms in MMPs have been implicated in the development of cancer as well as other diseases. Since their frequency distributions in the general North Indian population is not known the present study was conducted with the focus on MMP-1(-519) Aandgt; G, MMP-1(-1607) 1Gandgt; 2G, and MMP-7(-181) Aandgt; G gene polymorphisms. PCR-based analysis was conducted for 200 normal healthy individuals of similar ethnicity. Allelic frequencies in wild type of MMP-1(-519) Aandgt; G were 71.2% A; MMP-1(-1607) 1Gandgt; 2G 48.2% 1G; MMP-7(-181) Aandgt; G 60.7% A. The variant allele frequencies were 29% A in MMP-1(-519) Aandgt; G; 52% 2G in MMP-1(-1607) 1Gandgt; 2G; and 39.3% G in MMP-7(-181) Aandgt; G respectively. We further compared frequency distribution for these genes with various published studies in different ethnicity globally. Our results suggest that frequency in these MMP genes exhibit distinctive patterns in India that could perhaps be attributed to ethnic variation. This study is important as it can form a baseline for screening individuals who are at high risk when exposed to environmental carcinogens. More emphasis is needed on evaluating polymorphisms, alone or in combination, as modifiers of risk from relevant environmental/lifestyle exposures.

  7. Wii Fit® training vs. Adapted Physical Activities: which one is the most appropriate to improve the balance of independent senior subjects? A randomized controlled study.

    PubMed

    Toulotte, Claire; Toursel, Cindy; Olivier, Nicolas

    2012-09-01

    To compare the effectiveness of three protocols (Adapted Physical Activities, Wii Fit(®), Adapted Physical Activities + Wii Fit(®)) on the balance of independent senior subjects. Case comparison study. Healthy elderly subjects living in independent community dwellings. Thirty-six subjects, average age 75.09 ± 10.26 years, took part in this study, and were randomly assigned to one of the four experimental groups: G1 followed an Adapted Physical Activities training programme, while the second group (G2) participated in Wii Fit(®) training and the third one (G3) combined both methods. There was no training for the fourth group (G4). All subjects trained once a week (1 hour) for 20 weeks and were assessed before and after treatment. The Tinetti test, unipedal tests and the Wii Fit(®) tests. After training, the scores in the Tinetti test decreased significantly (P < 0.05) for G1, G2 and G3 respectively in static conditions and for G1 and G3 in dynamic conditions. After training, the performance in the unipedal tests decreased significantly (P < 0.05) for G1 and G3. The position of the centre of gravity was modified significantly (P < 0.05) for G2 and G3. After 20 training sessions, G1 (Adapted Physical Activities), G2 (Wii Fit(®)) and G3 (Adapted Physical Activities and Wii Fit(®)) improved their balance. In addition, G1 and G3 increased their dynamic balance. The findings suggest that Adapted Physical Activities training limits the decline in sensorial functions in the elderly.

  8. The 3D structures of G-quadruplexes of HIV-1 integrase inhibitors: molecular dynamics simulations in aqueous solution and in the gas phase.

    PubMed

    Li, Ming-Hui; Zhou, Yi-Han; Luo, Quan; Li, Ze-Sheng

    2010-04-01

    The unimolecular G-quadruplex structures of d(GGGTGGGTGGGTGGGT) (G1) and d(GTGGTGGGTGGGTGGGT) (G2) are known as the potent nanomolar HIV-1 integrase inhibitors, thus investigating the 3D structures of the two sequences is significant for structure-based rational anti-HIV drug design. In this research, based on the experimental data of circular dichroism (CD) spectropolarimetry and electrospray ionization mass spectrometry (ESI-MS), the initial models of G1 and G2 were constructed by molecular modeling method. The modeling structures of G1 and G2 are intramolecular parallel-stranded quadruplex conformation with three guanine tetrads. Particularly, the structure of G2 possesses a T loop residue between the first and the second G residues that are the component of two adjacent same-stranded G-tetrad planes. This structure proposed by us has a very novel geometry and is different from all reported G-quadruplexes. The extended (35 ns) molecular dynamic (MD) simulations for the models indicate that the G-quadruplexes maintain their structures very well in aqueous solution whether the existence of K(+) or NH (4) (+) in the central channel. Furthermore, we perform 500 ns MD simulations for the models in the gas phase. The results show that all the ion-G-quadruplex complexes are maintained during the whole simulations, despite the large magnitude of phosphate-phosphate repulsions. The gas phase MD simulations provide a good explanation to ESI-MS experiments. Our 3D structures for G1 and G2 will assist in understanding geometric formalism of G-quadruplex folding and may be helpful as a platform for rational anti-HIV drug design.

  9. Mode of action of (R)-9-[4-hydroxy-2-(hydroxymethyl)butyl]guanine against herpesviruses.

    PubMed Central

    Lowe, D M; Alderton, W K; Ellis, M R; Parmar, V; Miller, W H; Roberts, G B; Fyfe, J A; Gaillard, R; Ertl, P; Snowden, W

    1995-01-01

    The activity, metabolism, and mode of action of (R)-9-[4-hydroxy-2-(hydroxymethyl)butyl]guanine (H2G) against herpes simplex virus type 1 (HSV-1) and type 2 (HSV-2) and varicella-zoster virus (VZV) were studied. Compared to acyclovir (ACV), H2G has superior activity against VZV (50% inhibitory concentration of 2.3 microM) and Epstein-Barr virus (50% inhibitory concentration of 0.9 microM), comparable activity against HSV-1, and weaker activity against HSV-2. The antiviral effect on HSV-1 showed persistence after removal of compound. H2G was metabolized to its mono-, di- and triphosphate derivatives in virus-infected cells, with H2G-triphosphate being the predominant product. Only small amounts of H2G-triphosphate were detected in uninfected cells (1 to 10 pmol/10(6) cells), whereas the level in HSV-1-infected cells reached 1,900 pmol/10(6) cells. H2G was a substrate for all three viral thymidine kinases and could also be phosphorylated by mitochondrial deoxyguanosine kinase. The intracellular half-life of H2G-triphosphate varied in uninfected (2.5 h) and infected (HSV-1, 14 h; VZV, 3.7 h) cells but was always longer than the half-life of ACV-triphosphate (1 to 2 h). H2G-triphosphate inhibited HSV-1, HSV-2, and VZV DNA polymerases competitively with dGTP (Ki of 2.8, 2.2, and 0.3 microM, respectively) but could not replace dGTP as a substrate in a polymerase assay. H2G was not an obligate chain terminator but would only support limited DNA chain extension. Only very small amounts of radioactivity, which were too low to be identified by high-performance liquid chromatography analysis of the digested DNA, could be detected in purified DNA from uninfected cells incubated with [3H]H2G. Thus, H2G acts as an anti-herpesvirus agent, particularly potent against VZV, by formation of high concentrations of relatively stable H2G-triphosphate, which is a potent inhibitor of the viral DNA polymerases. PMID:7486922

  10. Critical Test of Some Computational Chemistry Methods for Prediction of Gas-Phase Acidities and Basicities.

    PubMed

    Toomsalu, Eve; Koppel, Ilmar A; Burk, Peeter

    2013-09-10

    Gas-phase acidities and basicities were calculated for 64 neutral bases (covering the scale from 139.9 kcal/mol to 251.9 kcal/mol) and 53 neutral acids (covering the scale from 299.5 kcal/mol to 411.7 kcal/mol). The following methods were used: AM1, PM3, PM6, PDDG, G2, G2MP2, G3, G3MP2, G4, G4MP2, CBS-QB3, B1B95, B2PLYP, B2PLYPD, B3LYP, B3PW91, B97D, B98, BLYP, BMK, BP86, CAM-B3LYP, HSEh1PBE, M06, M062X, M06HF, M06L, mPW2PLYP, mPW2PLYPD, O3LYP, OLYP, PBE1PBE, PBEPBE, tHCTHhyb, TPSSh, VSXC, X3LYP. The addition of the Grimmes empirical dispersion correction (D) to B2PLYP and mPW2PLYP was evaluated, and it was found that adding this correction gave more-accurate results when considering acidities. Calculations with B3LYP, B97D, BLYP, B2PLYPD, and PBE1PBE methods were carried out with five basis sets (6-311G**, 6-311+G**, TZVP, cc-pVTZ, and aug-cc-pVTZ) to evaluate the effect of basis sets on the accuracy of calculations. It was found that the best basis sets when considering accuracy of results and needed time were 6-311+G** and TZVP. Among semiempirical methods AM1 had the best ability to reproduce experimental acidities and basicities (the mean absolute error (mae) was 7.3 kcal/mol). Among DFT methods the best method considering accuracy, robustness, and computation time was PBE1PBE/6-311+G** (mae = 2.7 kcal/mol). Four Gaussian-type methods (G2, G2MP2, G4, and G4MP2) gave similar results to each other (mae = 2.3 kcal/mol). Gaussian-type methods are quite accurate, but their downside is the relatively long computational time.

  11. Intergenerational Transmission of Internalizing Problems: Effects of Parental and Grandparental Major Depressive Disorder on Child Behavior

    ERIC Educational Resources Information Center

    Pettit, Jeremy W.; Olino, Thomas M.; Roberts, Robert E.; Seeley, John R.; Lewinsohn, Peter M.

    2008-01-01

    Effects of lifetime histories of grandparental (G1) and parental (G2) major depressive disorder (MDD) on children's (G3) internalizing problems were investigated among 267 G3 children (ages 2-18 years) who received Child Behavior Checklist (CBCL) ratings and had diagnostic data available on 267 biological G2 parents and 527 biological G1…

  12. Cross-communication between Gi and Gs in a G-protein-coupled receptor heterotetramer guided by a receptor C-terminal domain.

    PubMed

    Navarro, Gemma; Cordomí, Arnau; Brugarolas, Marc; Moreno, Estefanía; Aguinaga, David; Pérez-Benito, Laura; Ferre, Sergi; Cortés, Antoni; Casadó, Vicent; Mallol, Josefa; Canela, Enric I; Lluís, Carme; Pardo, Leonardo; McCormick, Peter J; Franco, Rafael

    2018-02-28

    G-protein-coupled receptor (GPCR) heteromeric complexes have distinct properties from homomeric GPCRs, giving rise to new receptor functionalities. Adenosine receptors (A 1 R or A 2A R) can form A 1 R-A 2A R heteromers (A 1 -A 2A Het), and their activation leads to canonical G-protein-dependent (adenylate cyclase mediated) and -independent (β-arrestin mediated) signaling. Adenosine has different affinities for A 1 R and A 2A R, allowing the heteromeric receptor to detect its concentration by integrating the downstream G i - and G s -dependent signals. cAMP accumulation and β-arrestin recruitment assays have shown that, within the complex, activation of A 2A R impedes signaling via A 1 R. We examined the mechanism by which A 1 -A 2A Het integrates G i - and G s -dependent signals. A 1 R blockade by A 2A R in the A 1 -A 2A Het is not observed in the absence of A 2A R activation by agonists, in the absence of the C-terminal domain of A 2A R, or in the presence of synthetic peptides that disrupt the heteromer interface of A 1 -A 2A Het, indicating that signaling mediated by A 1 R and A 2A R is controlled by both G i and G s proteins. We identified a new mechanism of signal transduction that implies a cross-communication between G i and G s proteins guided by the C-terminal tail of the A 2A R. This mechanism provides the molecular basis for the operation of the A 1 -A 2A Het as an adenosine concentration-sensing device that modulates the signals originating at both A 1 R and A 2A R.

  13. Differential effect of isotype on efficacy of anti-tumor necrosis factor alpha chimeric antibodies in experimental septic shock

    PubMed Central

    1994-01-01

    Immune complexes containing human gamma (g)1 or murine g2a antibodies generate secondary effector mechanisms via Fc receptor binding or complement activation, whereas those containing human g4 or murine g1 antibodies generally do not. Therefore, isotype selection of therapeutic antibodies may have important clinical consequences. In a rabbit model of human tumor necrosis factor (rhuTNF)-induced pyrexia, a murine/human chimeric g4 anti-human TNF-alpha monoclonal antibody (mAb) (cCB0011) showed a dose-dependent inhibition of pyrexia, whereas a g1 isotype variant of the same mAb gave a marked pyrexia that was seen at all doses indicative of an immune complex-mediated response. To investigate whether isotype difference could influence mAb efficacy in pathological disease states, hamster/murine chimeric g1 and g2a anti- murine TNF-alpha mAbs (TN3g1, TN3g2a) were studied in experimental shock in mice and rats. In lipopolysaccharide-induced shock in mice, treatment with TN3g1 mAb at 30 and 3 mg/kg resulted in 90% survival by 72 h (p < or = 0.004), and prolonged survival to 45 h (p < or = 0.05), respectively, compared with 100% mortality by 27 h in controls. In contrast, a g2a isotype variant of the same mAb (30 mg/kg) resulted in only 10% survival by 72 h (p < or = 0.05). In a neutropenic sepsis model in rats there was greater survival in animals receiving the g1 isotype of TN3 compared with g2a isotype variant (70 vs. 27%; p < or = 0.005) with 100% mortality in the controls. These differences were not due to the pharmacokinetic profiles of the mAbs. In models of experimental shock antibody isotype can affect outcome with inactive isotypes (human g4 and murine g1) being more efficacious than active isotypes (human g1 and murine g2a). PMID:8113678

  14. Effects of common hemoglobin variants on HbA1c measurements in China: results for α- and β-globin variants measured by six methods.

    PubMed

    Xu, Anping; Chen, Weidong; Xia, Yong; Zhou, Yu; Ji, Ling

    2018-04-07

    HbA1c is a widely used biomarker for diabetes mellitus management. Here, we evaluated the accuracy of six methods for determining HbA1c values in Chinese patients with common α- and β-globin chains variants in China. Blood samples from normal subjects and individuals exhibiting hemoglobin variants were analyzed for HbA1c, using Sebia Capillarys 2 Flex Piercing (C2FP), Bio-Rad Variant II Turbo 2.0, Tosoh HLC-723 G8 (ver. 5.24), Arkray ADAMS A1c HA-8180V fast mode, Cobas c501 and Trinity Ultra2 systems. DNA sequencing revealed five common β-globin chain variants and three common α-globin chain variants. The most common variant was Hb E, followed by Hb New York, Hb J-Bangkok, Hb G-Coushatta, Hb Q-Thailand, Hb G-Honolulu, Hb Ube-2 and Hb G-Taipei. Variant II Turbo 2.0, Ultra2 and Cobas c501 showed good agreement with C2FP for most samples with variants. HLC-723 G8 yielded no HbA1c values for Hb J-Bangkok, Hb Q-Thailand and Hb G-Honolulu. Samples with Hb E, Hb G-Coushatta, Hb G-Taipei and Hb Ube-2 produced significant negative biases for HLC-723 G8. HA-8180V showed statistically significant differences for Hb E, Hb G-Coushatta, Hb G-Taipei, Hb Q-Thailand and Hb G-Honolulu. HA-8180V yielded no HbA1c values for Hb J-Bangkok. All methods showed good agreement for samples with Hb New York. Some common hemoglobin variants can interfere with HbA1c determination by the most popular methods in China.

  15. HIV1 V3 loop hypermutability is enhanced by the guanine usage bias in the part of env gene coding for it.

    PubMed

    Khrustalev, Vladislav Victorovich

    2009-01-01

    Guanine is the most mutable nucleotide in HIV genes because of frequently occurring G to A transitions, which are caused by cytosine deamination in viral DNA minus strands catalyzed by APOBEC enzymes. Distribution of guanine between three codon positions should influence the probability for G to A mutation to be nonsynonymous (to occur in first or second codon position). We discovered that nucleotide sequences of env genes coding for third variable regions (V3 loops) of gp120 from HIV1 and HIV2 have different kinds of guanine usage biases. In the HIV1 reference strain and 100 additionally analyzed HIV1 strains the guanine usage bias in V3 loop coding regions (2G>1G>3G) should lead to elevated nonsynonymous G to A transitions occurrence rates. In the HIV2 reference strain and 100 other HIV2 strains guanine usage bias in V3 loop coding regions (3G>2G>1G) should protect V3 loops from hypermutability. According to the HIV1 and HIV2 V3 alignment, insertion of the sequence enriched with 2G (21 codons in length) occurred during the evolution of HIV1 predecessor, while insertion of the different sequence enriched with 3G (19 codons in length) occurred during the evolution of HIV2 predecessor. The higher is the level of 3G in the V3 coding region, the lower should be the immune escaping mutation occurrence rates. This hypothesis was tested in this study by comparing the guanine usage in V3 loop coding regions from HIV1 fast and slow progressors. All calculations have been performed by our algorithms "VVK In length", "VVK Dinucleotides" and "VVK Consensus" (www.barkovsky.hotmail.ru).

  16. Heart Rate Recovery in the First Minute at the Six-Minute Walk Test in Patients with Heart Failure

    PubMed Central

    Lindemberg, Sabrina; Chermont, Sergio; Quintão, Mônica; Derossi, Milena; Guilhon, Sergio; Bernardez, Sabrina; Marchese, Luana; Martins, Wolney; Nóbrega, Antônio Claudio L.; Mesquita, Evandro Tinoco

    2014-01-01

    Background Heart rate recovery at one minute of rest (HRR1) is a predictor of mortality in heart failure (HF), but its prognosis has not been assessed at six-minute walk test (6MWT) in these patients. Objective This study aimed to determine the HRR1 at 6MWT in patients with HF and its correlation with six-minute walk distance (6MWD). Methods Cross-sectional, controlled protocol with 161 individuals, 126 patients with stable systolic HF, allocated into 2 groups (G1 and G2) receiving or not β-blocker and 35 volunteers in control group (G3) had HRR1 recorded at the 6MWT. Results HRR1 and 6MWD were significantly different in the 3 groups. Mean values of HRR1 and 6MWD were: HRR1 = 12 ± 14 beat/min G1; 18 ± 16 beat/min G2 and 21 ± 13 beat/min G3; 6MWD = 423 ± 102 m G1; 396 ± 101m G2 and 484 ± 96 m G3 (p < 0.05). Results showed a correlation between HRR1 and 6MWD in G1(r = 0.3; p = 0.04) and in G3(r = 0.4; p= 0.03), but not in G2 (r= 0.12; p= 0.48). Conclusion HRR1 response was attenuated in patients using βB and showed correlation with 6MWD, reflecting better exercise tolerance. HRR1 after 6MWT seems to represent an alternative when treadmill tests could not be tolerated. PMID:24714794

  17. Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with type 2 diabetes risk

    PubMed Central

    Zhao, Luqian; Huang, Ping

    2013-01-01

    A number of studies were performed to assess the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and susceptibility to type 2 diabetes (T2DM). However, the results were inconsistent and inconclusive. In the present study, the possible association was investigated by a meta-analysis. Eligible articles were identified for the period up to June 2013. Pooled odds ratios (OR) with 95% confidence intervals (CI) were appropriately derived from random-effects models or fixed-effects models. Fourteen case-control studies with a total of 2487 cases and 3538 controls were eligible. In recessive model, PAI-1 4G/5G polymorphism was associated with T2DM risk (OR = 1.23; 95% CI 1.07-1.41; P = 0.004). In the subgroup analysis by ethnicity, a significant association was found among Asians (OR = 1.27; 95% CI 1.08-1.51; P = 0.005). This meta-analysis suggested that PAI-1 4G/5G polymorphism may be associated with T2DM development. PMID:24040470

  18. A comparative study of the N-linked oligosaccharide structures of human IgG subclass proteins.

    PubMed Central

    Jefferis, R; Lund, J; Mizutani, H; Nakagawa, H; Kawazoe, Y; Arata, Y; Takahashi, N

    1990-01-01

    Quantitative oligosaccharide profiles were determined for each of 18 human IgG paraproteins representing the four subclasses. Each paraprotein exhibits a unique profile that may be substantially different from that observed for polyclonal IgG. The IgG2 and some IgG3 proteins analysed exhibit a predominance of oligosaccharide moieties having galactose on the Man(alpha 1----3) arm rather than the Man(alpha 1----6) arm; it was previously held that galactosylation of the Man(alpha 1----6) arm is preferred, as observed for IgG1, IgG4 and polyclonal IgG. An IgG4 protein is reported that has galactosylated Man(alpha 1----3) and Man(alpha 1----6) arms on both Fc-localized carbohydrate moieties; previous findings suggested that such fully glycosylated structures could not be accommodated within the internal space of the C gamma 2 domains. Unusual monoantennary oligosaccharides present in IgG2 and IgG3 proteins were isolated and their structures determined. Images Fig. 1. PMID:2363690

  19. Temperature Dependence of O2(b1Σ ^+g, v = 0 and 1) Relative Yield in O(1D) + O2 Energy Transfer

    NASA Astrophysics Data System (ADS)

    Kostko, O.; Raj, S.; Campbell, K.; Pejakovic, D. A.; Kalogerakis, K.

    2011-12-01

    Energy transfer from excited O(1D) atoms to ground-state O2(X3Σ ^-g) leads to production of O2 in the first two vibrational levels of the O2 (b1Σ ^+g) state: O(1D) + O2 -> O(3P) + O2(b1Σ ^+g, v = 0, 1). Subsequent radiative decay of O2(b1Σ ^+g, v = 0, 1) to the ground state results in the Atmospheric Band emission, a prominent feature of the terrestrial airglow. The relative yield for production of O2(b1Σ ^+g, v = 0 and 1) in the above process, k1/k0, is an important parameter in modeling of the observed Atmospheric Band emission intensities. Recent measurements at room temperature have shown that production of O2(b1Σ ^+g, v = 1) dominates that of O2(b1Σ ^+g, v = 0), with k1/k0 having a value of approximately 3.5 [1]. In the laboratory experiments, the output of a pulsed fluorine laser at 157 nm is used to photodissociate molecular oxygen in an O2/N2 mixture flowing through a heated gas cell. Photodissociation of O2 produces a ground-state O(3P) atom and an excited O(1D) atom. O(1D) rapidly transfers energy to the remaining O2 to produce O2(b1Σ ^+g, v = 0, 1). The populations of O2(b1Σ ^+g, v = 0 and 1) are monitored by observing emissions in the O2(b--X) 0--0 and 1--0 bands at 762 and 688 nm, respectively. The value of k1/k0 is extracted from the time-dependent O2(b1Σ ^+g, v = 0 and 1) fluorescence signals using computer simulations. We will present measurements on the temperature dependence of k1/k0 and discuss their atmospheric significance. This work was supported by the US National Science Foundation (NSF) Aeronomy Program under grant AGS-0937317. The fluorine laser was purchased under grant ATM-0216583 from the NSF Major Research Instrumentation Program. S. Raj and K. M. Campbell participated in a Research Experiences for Undergraduates (REU) site, co-funded by the Division of Physics of the NSF and the Department of Defense in partnership with the NSF REU program under grant PHY-1002892. [1] K. S. Kalogerakis, D. A. Pejaković, R. A. Copeland, T. G. Slanger (2005), Relative Yield of O2(b1Σ ^+g, v = 0 and 1) in O(1D) + O2 Collisions, Eos Trans. AGU, 86(52), Fall Meet. Suppl., Abstract SA11A-0220.

  20. Development of a Glycoprotein D-Expressing Dominant-Negative and Replication-Defective Herpes Simplex Virus 2 (HSV-2) Recombinant Viral Vaccine against HSV-2 Infection in Mice ▿

    PubMed Central

    Akhrameyeva, Natalie V.; Zhang, Pengwei; Sugiyama, Nao; Behar, Samuel M.; Yao, Feng

    2011-01-01

    Using the T-REx (Invitrogen, California) gene switch technology and a dominant-negative mutant polypeptide of herpes simplex virus 1 (HSV-1)-origin binding protein UL9, we previously constructed a glycoprotein D-expressing replication-defective and dominant-negative HSV-1 recombinant viral vaccine, CJ9-gD, for protection against HSV infection and disease. It was demonstrated that CJ9-gD is avirulent following intracerebral inoculation in mice, cannot establish detectable latent infection following different routes of infection, and offers highly effective protective immunity against primary HSV-1 and HSV-2 infection and disease in mouse and guinea pig models of HSV infections. Given these favorable safety and immunological profiles of CJ9-gD, aiming to maximize levels of HSV-2 glycoprotein D (gD2) expression, we have constructed an ICP0 null mutant-based dominant-negative and replication-defective HSV-2 recombinant, CJ2-gD2, that contains 2 copies of the gD2 gene driven by the tetracycline operator (tetO)-bearing HSV-1 major immediate-early ICP4 promoter. CJ2-gD2 expresses gD2 as efficiently as wild-type HSV-2 infection and can lead to a 150-fold reduction in wild-type HSV-2 viral replication in cells coinfected with CJ2-gD2 and wild-type HSV-2 at the same multiplicity of infection. CJ2-gD2 is avirulent following intracerebral injection and cannot establish a detectable latent infection following subcutaneous (s.c.) immunization. CJ2-gD2 is a more effective vaccine than HSV-1 CJ9-gD and a non-gD2-expressing dominant-negative and replication-defective HSV-2 recombinant in protection against wild-type HSV-2 genital disease. Using recall response, we showed that immunization with CJ2-gD2 elicited strong HSV-2-specific memory CD4+ and CD8+ T-cell responses. Collectively, given the demonstrated preclinical immunogenicity and its unique safety profiles, CJ2-gD2 represents a new class of HSV-2 replication-defective recombinant viral vaccines in protection against HSV-2 genital infection and disease. PMID:21389121

  1. Patient-Specific Neutralizing Antibody Responses to Herpes Simplex Virus Are Attributed to Epitopes on gD, gB, or Both and Can Be Type Specific

    PubMed Central

    Huang, Zhen-Yu; Gallagher, John R.; Lin, Yixin; Lou, Huan; Whitbeck, J. Charles; Wald, Anna; Cohen, Gary H.; Eisenberg, Roselyn J.

    2015-01-01

    ABSTRACT Herpes simplex virus 1 (HSV-1) and HSV-2 infect many humans and establish a latent infection in sensory ganglia. Although some infected people suffer periodic recurrences, others do not. Infected people mount both cell-mediated and humoral responses, including the production of virus-neutralizing antibodies (Abs) directed at viral entry glycoproteins. Previously, we examined IgGs from 10 HSV-seropositive individuals; all neutralized virus and were directed primarily against gD or gD+gB. Here, we expand our studies and examine 32 additional sera from HSV-infected individuals, 23 of whom had no recurrent disease. Using an Octet RED96 system, we screened all 32 serum samples directly for both glycoprotein binding and competition with known neutralizing anti-gD and -gB monoclonal Abs (MAbs). On average, the recurrent cohort exhibited higher binding to gD and gB and had higher neutralization titers. There were similar trends in the blocking of MAbs to critical gD and gB epitopes. When we depleted six sera of Abs to specific glycoproteins, we found different types of responses, but always directed primarily at gD and/or gB. Interestingly, in one dual-infected person, the neutralizing response to HSV-2 was due to gD2 and gB2, whereas HSV-1 neutralization was due to gD1 and gB1. In another case, virus neutralization was HSV-1 specific, with the Ab response directed entirely at gB1, despite this serum blocking type-common anti-gD and -gB neutralizing MAbs. These data are pertinent in the design of future HSV vaccines since they demonstrate the importance of both serotypes of gD and gB as immunogens. IMPORTANCE We previously showed that people infected with HSV produce neutralizing Abs directed against gD or a combination of gD+gB (and in one case, gD+gB+gC, which was HSV-1 specific). In this more extensive study, we again found that gD or gD+gB can account for the virus neutralizing response and critical epitopes of one or both of these proteins are represented in sera of naturally infected humans. However, we also found that some individuals produced a strong response against gB alone. In addition, we identified type-specific contributions to HSV neutralization from both gD and gB. Contributions from the other entry glycoproteins, gC and gH/gL, were minimal and limited to HSV-1 neutralization. Knowing the variations in how humans see and mount a response to HSV will be important to vaccine development. PMID:26109729

  2. Meta-Analysis of the Association between Plasminogen Activator Inhibitor-1 4G/5G Polymorphism and Recurrent Pregnancy Loss

    PubMed Central

    Li, Xuejiao; Liu, Yukun; Zhang, Rui; Tan, Jianping; Chen, Libin; Liu, Yinglin

    2015-01-01

    Background The association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and recurrent pregnancy loss (RPL) risk is still contradictory. We thus performed a meta-analysis. Material/Methods Relevant studies were searched for in PubMed, Web of Science, Embase, and Cochrane Library. An odds ratio (OR) with a 95% confidence interval (CI) was used to assess the association between PAI-1 4G/5G polymorphism and RPL risk. Results A total of 22 studies with 4306 cases and 3076 controls were included in this meta-analysis. We found that PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk (OR=1.89; 95% CI 1.34–2.67; P=0.0003). In the subgroup analysis by race, PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk in Caucasians (OR=2.23; 95% CI 1.44–3.46; P=0.0003). However, no significant association was observed in Asians (OR=1.47; 95% CI 0.84–2.59; P=0.18). Conclusions In conclusion, this meta-analysis suggests that PAI-1 4G/5G polymorphism might be associated with RPL development in Caucasians. PMID:25862335

  3. One-step spray processing of high power all-solid-state supercapacitors

    NASA Astrophysics Data System (ADS)

    Huang, Chun; Grant, Patrick S.

    2013-08-01

    Aqueous suspensions of multi-wall carbon nanotubes (MWNTs) in dilute H2SO4 were sprayed onto both sides of a Nafion membrane and dried to fabricate flexible solid-state supercapacitors. A single cell with MWNT-only electrodes had a capacitance of 57 F g-1 per electrode at 2 mV s-1 and 44 F g-1 at 150 mV s-1 but with low H+ mobility. Cells with MWNT + ionomer hybrid electrodes showed higher H+ mobility, and the electric double layer (EDL) capacitance increased to 145 F g-1 at 2 mV s-1 and 91 F g-1 at 150 mV s-1. The energy and power densities of one electrode charged to 1 V at 1 A g-1 were 12.9 Wh kg-1 and 3.3 kW kg-1 respectively. Three solid-state supercapacitor cells connected in series charged to 3 V at 1 and 2 A g-1 provided a device power density of 8.9 kW kg-1 at 1 A g-1 and 9.4 kW kg-1 at 2 A g-1, the highest for all-solid-state EDL supercapacitors.

  4. Super (a,d)-H-antimagic covering of möbius ladder graph

    NASA Astrophysics Data System (ADS)

    Indriyani, Novia; Sri Martini, Titin

    2018-04-01

    Let G = (V(G), E(G)) be a simple graph. Let H-covering of G is a subgraph H 1, H 2, …, Hj with every edge in G is contained in at least one graph Hi for 1 ≤ i ≤ j. If every Hi is isomorphic, then G admits an H-covering. Furthermore, an (a,d)-H-antimagic covering if there bijective function ξ :V(G)\\cup E(G)\\to \\{1,2,3,\\ldots,|V(G)|+|E(G)|\\}. The H‑-weights for all subgraphs H‑ isomorphic to H ω ({H}^{\\prime })={\\sum }v\\in V({H^{\\prime })}ξ (v)+{\\sum }e\\in E({H^{\\prime })}ξ (e). The weights of subgraphs constitutes an arithmatic progression {a, a + d, …, a + (t ‑ 1)d} where a and d are positive integers and t is the number of subgraphs G isomorphic to H. If ξ (V(G))=\\{1,2,\\ldots,|V(G)|\\} then ξ is called super (a, d)-H-antimagic covering. The research provides super (a, d)-H-antimagic covering with d = {1, 3} of Möbius ladder graph Mn for n > 5 and n is odd.

  5. Postprandial lysophospholipid suppresses hepatic fatty acid oxidation: the molecular link between group 1B phospholipase A2 and diet-induced obesity

    PubMed Central

    Labonté, Eric D.; Pfluger, Paul T.; Cash, James G.; Kuhel, David G.; Roja, Juan C.; Magness, Daniel P.; Jandacek, Ronald J.; Tschöp, Matthias H.; Hui, David Y.

    2010-01-01

    Decrease in fat catabolic rate on consuming a high-fat diet contributes to diet-induced obesity. This study used group 1B phospholipase A2 (Pla2g1b)-deficient mice, which are resistant to hyperglycemia, to test the hypothesis that Pla2g1b and its lipolytic product lysophospholipid suppress hepatic fat utilization and energy metabolism in promoting diet-induced obesity. The metabolic consequences of hypercaloric diet, including body weight gain, energy expenditure, and fatty acid oxidation, were compared between Pla2g1b+/+ and Pla2g1b−/− mice. The Pla2g1b−/− mice displayed normal energy balance when fed chow, but were resistant to obesity when challenged with a hypercaloric diet. Obesity resistance in Pla2g1b−/− mice is due to their ability to maintain elevated energy expenditure and core body temperature when subjected to hypercaloric diet, which was not observed in Pla2g1b+/+ mice. The Pla2g1b−/− mice also displayed increased postprandial hepatic fat utilization due to increased expression of peroxisome proliferator-activated receptor (PPAR)-α, PPAR-δ, PPAR-γ, cd36/Fat, and Ucp2, which coincided with reduced postprandial plasma lysophospholipid levels. Lysophospholipids produced by Pla2g1b hydrolysis suppress hepatic fat utilization and down-regulate energy expenditure, thereby preventing metabolically beneficial adaptation to a high-fat diet exposure in promoting diet-induced obesity and type 2 diabetes.—Labonté, E. D., Pfluger, P. T., Cash, J. G., Kuhel, D. G., Rojas, J. C., Magness, D. P., Jandacek, R. J., Tschöp, M. H., Hui, D. Y. Postprandial lysophospholipid suppresses hepatic fatty acid oxidation: the molecular link between group 1B phospholipase A2 and diet-induced obesity. PMID:20215528

  6. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 9 2012-04-01 2012-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

  7. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 9 2011-04-01 2011-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

  8. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 9 2014-04-01 2014-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

  9. 26 CFR 1.904(g)-2 - Recapture of overall domestic losses.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 9 2013-04-01 2013-04-01 false Recapture of overall domestic losses. 1.904(g)-2 Section 1.904(g)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Income from Sources Without the United States § 1.904(g...

  10. Binding of the cSH3 domain of Grb2 adaptor to two distinct RXXK motifs within Gab1 docker employs differential mechanisms.

    PubMed

    McDonald, Caleb B; Seldeen, Kenneth L; Deegan, Brian J; Bhat, Vikas; Farooq, Amjad

    2011-01-01

    A ubiquitous component of cellular signaling machinery, Gab1 docker plays a pivotal role in routing extracellular information in the form of growth factors and cytokines to downstream targets such as transcription factors within the nucleus. Here, using isothermal titration calorimetry (ITC) in combination with macromolecular modeling (MM), we show that although Gab1 contains four distinct RXXK motifs, designated G1, G2, G3, and G4, only G1 and G2 motifs bind to the cSH3 domain of Grb2 adaptor and do so with distinct mechanisms. Thus, while the G1 motif strictly requires the PPRPPKP consensus sequence for high-affinity binding to the cSH3 domain, the G2 motif displays preference for the PXVXRXLKPXR consensus. Such sequential differences in the binding of G1 and G2 motifs arise from their ability to adopt distinct polyproline type II (PPII)- and 3(10) -helical conformations upon binding to the cSH3 domain, respectively. Collectively, our study provides detailed biophysical insights into a key protein-protein interaction involved in a diverse array of signaling cascades central to health and disease. Copyright © 2010 John Wiley & Sons, Ltd.

  11. Restoration of On-Time Embryo Implantation Corrects the Timing of Parturition in Cytosolic Phospholipase A2 Group IVA Deficient Mice1

    PubMed Central

    Brown, Naoko; Morrow, Jason D.; Slaughter, James C.; Paria, Bibhash C.; Reese, Jeff

    2009-01-01

    Cytosolic phospholipase A2 (cPLA2, PLA2G4A) catalyzes the release of arachidonic acid for prostaglandin synthesis by cyclooxygenase 1 (PTGS1) and cyclooxygenase 2 (PTGS2). Mice with Pla2g4a deficiency have parturition delay and other reproductive deficits, including deferred onset of implantation, crowding of implantation sites, and small litters. In this study, we examined the contribution of PLA2G4A to parturition in mice. Pla2g4a mRNA and protein expression were discretely localized in the term and preterm uterine luminal epithelium and colocalized with Ptgs1, but not Ptgs2, expression. The levels of PGE2, PGF2alpha, 6-keto-PGF1alpha, and TxB2 were significantly decreased in Pla2g4a-null uterine tissues, similar to Ptgs1-null uteri, consistent with predominance of PLA2G4A-PTGS1-mediated prostaglandin synthesis in preparation for murine parturition. Litter size was strongly associated with the timing of parturition in Pla2g4a-null mice but could not fully account for the parturition delay. Pla2g4a-null females that received PGE2 + carbaprostacyclin at the time of implantation delivered earlier (20.5 ± 0.2 days vs. 21.6 ± 0.2 days, P < 0.01), although litter size was not improved (4.6 vs. 4.4 pups per litter, P = 0.6). After correction for small litter size, multivariate analysis indicated that Pla2g4a-null mice given prostaglandin treatment to improve implantation timing had gestational length that was similar to wild-type and Pla2g4a heterozygous mice. These results indicate that, despite specific Pla2g4a expression and function in term gestation uteri, the delayed parturition phenotype in Pla2g4a-null mice is primarily due to deferral of implantation. The role of PLA2G4A in timely parturition appears to be critically related to its actions in early pregnancy. PMID:19684335

  12. [Mitochondria-targeted antioxidant Mitoquinone protects post-thaw human sperm against oxidative stress injury].

    PubMed

    Liu, Li; Wang, Mei-jiao; Yu, Ting-he; Cheng, Zhi; Li, Min; Guo, Qian-wen

    2016-03-01

    To investigate the potential protective effect of the mitochondria-targeted antioxidant Mitoquinone (MitoQ) on post-thaw human sperm. Semen samples were collected from 60 normal fertile men, each divided into six parts of equal volume to be incubated at 37 °C in normal saline (G0, control) or in the extender with 2 nmol/L (G1), 20 nmol/L (G2), 200 nmol/L (G3), 2 µmol/L (G4), and 20 µmol/L of MitoQ (G5). After one hour of incubation, the samples were subjected to computer-assisted semen analysis (CASA) for sperm motility, flow cytometry for reactive oxygen species (ROS), thiobarbituric acid assay for the concentration of malondialdehyde (MDA), and MitoTracker fluorescent staining and flow cytometry for the sperm mitochondrial membrane potential (MMP). Then, the semen were cryopreserved with none (B0), 200 nmol/L (B1), and 2 µmol/L of MitoQ (B2), followed by detection of the changes in the ROS, MDA, and MMP of the post-thaw sperm. The percentage of progressively motile sperm and total rate of sperm motility were significantly higher in G3 ([30.8 ± 10.2]% and [70.6 ± 9.0]%) and G4 ([32.7 ± 13.5]% and [70.3 ± 11.9]%) than in G0 ([17.6 ± 5.0]% and [54.9 ± 11.5]%) (P < 0.05). The level of ROS dropped markedly with the increased concentration of MitoQ, 86.5 ± 31.6 in G3, 93.6 ± 42.0 in G4, and 45.1 ± 15.0 in G5, as compared with 160.8 ± 39.7 in G0 (P < 0.05). The content of MDA was remarkably lower in G3 ([0.9 ± 0.5] µmol/mg) and G4 ([0.9 ± 0.5] µmol/mg) than in G0 ([1.9 ± 1.1] µmol/mg) (P < 0.05), but not in G5 ([1.7 ± 0.7] µmol/mg), which was even higher than in G3 and G4 (P < 0.05). The MMP showed a significant reduction in G5 (1156 ± 216) in comparison with G0 (1701 ± 251) (P < 0.05) but exhibited no remarkable difference between G0 and G1 (1810 ± 298), G2 (1995 ± 437), G3 (1950 ± 334), or G4 (1582 ± 314). The percentage of progressively motile sperm and total rate of sperm motility after freezing-thawing were significantly decreased as compared with those of the fresh semen (P < 0.01), but both were remarkably higher in B1 ([3.2 ± 2.3]% and [ 43.0 ± 9.5]%) than in B0 ([0.8 ± 0.6]% and [26.5 ± 11.4]%) (P < 0.05). The ROS level was significantly lower in B1 and B2 than in B0 (34.6 ± 12. 3 and 37.0 ± 10.5 vs 56.9 ± 14.3, P < 0.05), and so was the MDA content ([1.4 ± 0.5] and [1.4 ± 0.6] µmol/mg vs [2.6 ± 1.0] µmol/mg, P < 0.05), but the MMP was markedly higher in B1 and B2 than in B0 (1010.0 ± 130.5 and 880.6 ± 128.6 vs 721.1 ± 24.8, P < 0.05). Addition of MitoQ to the freezing extender at 200 nmol/L may effectively improve the quality of human sperm and MitoQ is a good protective addictive for human sperm cryopreservation.

  13. Recombinant vesicular stomatitis virus vectors expressing herpes simplex virus type 2 gD elicit robust CD4+ Th1 immune responses and are protective in mouse and guinea pig models of vaginal challenge.

    PubMed

    Natuk, Robert J; Cooper, David; Guo, Min; Calderon, Priscilla; Wright, Kevin J; Nasar, Farooq; Witko, Susan; Pawlyk, Diane; Lee, Margaret; DeStefano, Joanne; Tummolo, Donna; Abramovitz, Aaron S; Gangolli, Seema; Kalyan, Narender; Clarke, David K; Hendry, R Michael; Eldridge, John H; Udem, Stephen A; Kowalski, Jacek

    2006-05-01

    Recombinant vesicular stomatitis virus (rVSV) vectors offer an attractive approach for the induction of robust cellular and humoral immune responses directed against human pathogen target antigens. We evaluated rVSV vectors expressing full-length glycoprotein D (gD) from herpes simplex virus type 2 (HSV-2) in mice and guinea pigs for immunogenicity and protective efficacy against genital challenge with wild-type HSV-2. Robust Th1-polarized anti-gD immune responses were demonstrated in the murine model as measured by induction of gD-specific cytotoxic T lymphocytes and increased gamma interferon expression. The isotype makeup of the serum anti-gD immunoglobulin G (IgG) response was consistent with the presence of a Th1-CD4+ anti-gD response, characterized by a high IgG2a/IgG1 IgG subclass ratio. Functional anti-HSV-2 neutralizing serum antibody responses were readily demonstrated in both guinea pigs and mice that had been immunized with rVSV-gD vaccines. Furthermore, guinea pigs and mice were prophylactically protected from genital challenge with high doses of wild-type HSV-2. In addition, guinea pigs were highly protected against the establishment of latent infection as evidenced by low or absent HSV-2 genome copies in dorsal root ganglia after virus challenge. In summary, rVSV-gD vectors were successfully used to elicit potent anti-gD Th1-like cellular and humoral immune responses that were protective against HSV-2 disease in guinea pigs and mice.

  14. Antigenic modulation of the cytophilic binding of guinea-pig IgG and IgM antibodies to homologous macrophages.

    PubMed Central

    Webster, R O; Lawrence, D A

    1979-01-01

    The cytophilic binding of immune complexes by peritoneal exudate cells (PEC) from adjuvant-stimulated guinea-pigs was studied using 125I-labelled guinea-pig IgG1, IgG2 and IgM antibodies to the dinitrophenyl (DNP) group. The influence of hapten density upon cytophilic activity was studied by the addition of DNP-conjugated antigens to antibody in 2-200 molar ratios of DNP:antibody. Only IgG2 binding was enhanced by immune complex formation, and the increased binding of IgG2 anti-DNP was dependent on the number of DNP determinants per antigen molecule. Cytophilic activity with epsilon-DNP-L-lysine (DNP-LYS), alpha,epsilon-di-DNP-L-lysine (DNP-LYS-DNP), or DNP1-8-BSA was no greater than that seen in the absence of hapten. Increased cytophilic binding was noted only with DNP20-41-BSA. The binding of IgG2 and IgG2 anti-DNP:DNP-bovine serum albumin (BSA) complexes was inhibited by monomeric IgG2. The relative cytophilic capacities of guinea-pig immunoglobulins appeared as follows: IgG greater than IgG1 greater than IgM. IgG1 and IgM binding of DNP conjugates did not enhance their cytophilic activity; therefore, IgG1 and IgM cytophilic binding to PEC was considered biologically insignificant. This investigation provides further evidence that cytophilic binding of immune complexes to macrophages is due to the co-operative action of multiple Fc sites rather than a conformational change in the IgG2 antibodies, and serum proteins, notably complement components, can alter the binding and/or phagocytosis of IgG2 anti-DNP:DNP-BSA complexes. PMID:86509

  15. Precise spatial control of cavitation erosion in a vessel phantom by using an ultrasonic standing wave.

    PubMed

    Shi, Aiwei; Huang, Peixuan; Guo, Shifang; Zhao, Lu; Jia, Yingjie; Zong, Yujin; Wan, Mingxi

    2016-07-01

    In atherosclerotic inducement in animal models, the conventionally used balloon injury is invasive, produces excessive vessel injuries at unpredictable locations and is inconvenient in arterioles. Fortunately, cavitation erosion, which plays an important role in therapeutic ultrasound in blood vessels, has the potential to induce atherosclerosis noninvasively at predictable sites. In this study, precise spatial control of cavitation erosion for superficial lesions in a vessel phantom was realised by using an ultrasonic standing wave (USW) with the participation of cavitation nuclei and medium-intensity ultrasound pulses. The superficial vessel erosions were restricted between adjacent pressure nodes, which were 0.87 mm apart in the USW field of 1 MHz. The erosion positions could be shifted along the vessel by nodal modulation under a submillimetre-scale accuracy without moving the ultrasound transducers. Moreover, the cavitation erosion of the proximal or distal wall could be determined by the types of cavitation nuclei and their corresponding cavitation pulses, i.e., phase-change microbubbles with cavitation pulses of 5 MHz and SonoVue microbubbles with cavitation pulses of 1 MHz. Effects of acoustic parameters of the cavitation pulses on the cavitation erosions were investigated. The flow conditions in the experiments were considered and discussed. Compared to only using travelling waves, the proposed method in this paper improves the controllability of the cavitation erosion and reduces the erosion depth, providing a more suitable approach for vessel endothelial injury while avoiding haemorrhage. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. The effects of bulking, viscous and gel-forming dietary fibres on satiation.

    PubMed

    Wanders, Anne J; Jonathan, Melliana C; van den Borne, Joost J G C; Mars, Monica; Schols, Henk A; Feskens, Edith J M; de Graaf, Cees

    2013-04-14

    The objective was to determine the effects of dietary fibre with bulking, viscous and gel-forming properties on satiation, and to identify the underlying mechanisms. We conducted a randomised crossover study with 121 men and women. Subjects were healthy, non-restrained eaters, aged 18-50 years and with normal BMI (18.5-25 kg/m²). Test products were cookies containing either: no added fibre (control), cellulose (bulking, 5 g/100 g), guar gum (viscous, 1.25 g/100 g and 2.5 g/100 g) or alginate (gel forming, 2.5 g/100 g and 5 g/100 g). Physico-chemical properties of the test products were confirmed in simulated upper gastrointestinal conditions. In a cinema setting, ad libitum intake of the test products was measured concurrently with oral exposure time per cookie by video recording. In a separate study with ten subjects, 4 h gastric emptying rate of a fixed amount of test products was assessed by ¹³C breath tests. Ad libitum energy intake was 22 % lower for the product with 5 g/100 g alginate (3.1 (sd 1.6) MJ) compared to control (4.0 (sd 2.2) MJ, P< 0.001). Intake of the other four products did not differ from control. Oral exposure time for the product with 5 g/100 g alginate (2.3 (sd 1.9) min) was 48 % longer than for control (1.6 (sd 0.9) min, P= 0.01). Gastric emptying of the 5 g/100 g alginate product was faster compared to control (P< 0.05). We concluded that the addition of 5 g/100 g alginate (i.e. gel-forming fibre) to a low-fibre cookie results in earlier satiation. This effect might be due to an increased oral exposure time.

  17. Negative regulation of G2-M by ATR (mei-41)/Chk1(Grapes) facilitates tracheoblast growth and tracheal hypertrophy in Drosophila.

    PubMed

    Kizhedathu, Amrutha; Bagul, Archit V; Guha, Arjun

    2018-04-16

    Imaginal progenitors in Drosophila are known to arrest in G2 during larval stages and proliferate thereafter. Here we investigate the mechanism and implications of G2 arrest in progenitors of the adult thoracic tracheal epithelium (tracheoblasts). We report that tracheoblasts pause in G2 for ~48-56 h and grow in size over this period. Surprisingly, tracheoblasts arrested in G2 express drivers of G2-M like Cdc25/String (Stg). We find that mechanisms that prevent G2-M are also in place in this interval. Tracheoblasts activate Checkpoint Kinase 1/Grapes (Chk1/Grp) in an ATR/mei-41-dependent manner. Loss of ATR/Chk1 led to precocious mitotic entry ~24-32 h earlier. These divisions were apparently normal as there was no evidence of increased DNA damage or cell death. However, induction of precocious mitoses impaired growth of tracheoblasts and the tracheae they comprise. We propose that ATR/Chk1 negatively regulate G2-M in developing tracheoblasts and that G2 arrest facilitates cellular and hypertrophic organ growth. © 2018, Kizhedathu et al.

  18. Re-Adaptation to 1-G of Pregnant Rats Following Exposure to Spaceflight or Centrifugation

    NASA Technical Reports Server (NTRS)

    Johnson, K. E.; Ronca, A. E.; Alberts, J. R.

    2003-01-01

    Late-pregnant rat dams were flown on a 9-day Space Shuttle mission or exposed to 1.5, 1.75 or 2-g centrifugation and compared with 1 .O-g vivarium controls. Exposure to altered gravity began on the 11th day and recovery occurred on the 20th day of the dams' 22-day pregnancy. In the 1 st experiment, comparisons were made between Flight (FLT), Synchronous (SYN; identically-housed) and Vivarium (VIV) controls. In the 2nd experiment, comparisons were made between dams centrifuged at 2-G, 1.75-G, 1.5-G, Rotational controls (1.08-G) or Stationary controls (1 G). Within three hours of recovery from either spaceflight or centrifugation, the dams' locomotor behavior was videotaped for 2 min. FLT dams showed dramatically reduced movement relative to both SYN and VIV control conditions, with significantly greater amounts of locomotor activity observed in SYN as compared to VIV dams. Significantly greater locomotor activity was observed in SYN as compared to VIV controls. In the second experiment, no differences were observed between dams exposed either 1, 1.5, 1.75, or 2-G. In both studies, the dams showed similar patterns of hindlimb rearing. Together, these findings provide quantitative evidence for decreased locomotor activity during re-adaptation to 1-g following spaceflight, but not centrifugation.

  19. Continuity of parenting practices across generations in an at-risk sample: a prospective comparison of direct and mediated associations.

    PubMed

    Capaldi, Deborah M; Pears, Katherine C; Patterson, Gerald R; Owen, Lee D

    2003-04-01

    A prospective model of parenting and externalizing behavior spanning 3 generations (G1, G2, and G3) was examined for young men from an at-risk sample of young adult men (G2) who were in approximately the youngest one third of their cohort to become fathers. It was first predicted that the young men in G2 who had children the earliest would show high levels of antisocial behavior. Second, it was predicted that G1 poor parenting practices would show both a direct association with the G2 son's subsequent parenting and a mediated effect via his development of antisocial and delinquent behavior by adolescence. The young fathers had more arrests and were less likely to have graduated from high school than the other young men in the sample. Findings were most consistent with the interpretation that there was some direct effect of parenting from G1 to G2 and some mediated effect via antisocial behavior in G2.

  20. Molecular Characterization of Rotavirus Gastroenteritis Strains, Iraqi Kurdistan

    PubMed Central

    Ahmed, Herish M.; Coulter, J. Brian S.; Nakagomi, Osamu; Zaki, Jamal M.; Al-Rabaty, Abas A.; Dove, Winifred; Cunliffe, Nigel A.

    2006-01-01

    Of 260 children with acute diarrhea in Erbil, Iraqi Kurdistan, 96 (37%) were infected with rotavirus. Reverse transcription–polymerase chain reaction identified G1, G4, G2, G9, P[8], P[6], and P[4] as the most common genotypes. Eight G/P combinations were found, but P[8]G1 and P[4]G2 accounted for >50% of the strains. PMID:16704845

  1. Impact of antibody subclass and disulfide isoform differences on the biological activity of CD200R and βklotho agonist antibodies.

    PubMed

    Grujic, Ognjen; Stevens, Jennitte; Chou, Robert Y-T; Weiszmann, Jennifer V; Sekirov, Laura; Thomson, Christy; Badh, Anita; Grauer, Stephanie; Chan, Brian; Graham, Kevin; Manchulenko, Kathy; Dillon, Thomas M; Li, Yang; Foltz, Ian N

    2017-05-13

    Agonism of cell surface receptors by monoclonal antibodies is dependent not only on its ability to bind the target, but also to deliver a biological signal through receptors to the cell. Immunoglobulin G2 antibodies (IgG2s) are made up of a mixture of distinct isoforms (IgG2-A, -B and A/B), which differ by the disulfide connectivity at the hinge region. When evaluating panels of agonistic antibodies against CD200 receptor (CD200R) or βklotho receptor (βklotho), we noticed striking activity differences of IgG1 or IgG2 antibodies with the same variable domains. For the CD200R antibody, the IgG2 antibody demonstrated higher activity than the IgG1 or IgG4 antibody. More significantly, for βklotho, agonist antibodies with higher biological activity as either IgG2 or IgG1 were identified. In both cases, ion exchange chromatography was able to isolate the bioactivity to the IgG2-B isoform from the IgG2 parental mixture. The subclass-related increase in agonist activity was not correlated with antibody aggregation or binding affinity, but was driven by enhanced avidity for the CD200R antibody. These results add to the growing body of evidence that show that conformational differences in the antibody hinge region can have a dramatic impact on the antibody activity and must be considered when screening and engineering therapeutic antibody candidates. The results also demonstrate that the IgG1 (IgG2-A like) or the IgG2-B form may provide the most active form of agonist antibodies for different antibodies and targets. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. 75 FR 10325 - Investigations Regarding Certifications of Eligibility To Apply for Worker Adjustment Assistance

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-05

    ... Systems (Comp) Keller, TX 02/17/10 02/10/10 73477 International Game Reno, NV 02/17/10 02/05/10 Technology.../10 Company (USW). 73495 Perkinelmer Health Sciences, Shelton, CT 02/18/10 02/08/10 Inc. (Wkrs). 73496...

  3. Alcohol Consumption and the Risk for Developing Pancreatitis: A Case-Control Study in Japan.

    PubMed

    Kume, Kiyoshi; Masamune, Atsushi; Ariga, Hiroyuki; Shimosegawa, Tooru

    2015-01-01

    This study aimed to estimate the association of alcohol consumption and pancreatitis in Japan. We performed a nationwide case-control study, which included 982 patients (574 patients with acute pancreatitis and 408 patients with chronic pancreatitis) and 1015 controls who were individually matched for sex, age, hospital, and time of their first hospital visit. Conditional logistic regression was used to assess the association of alcohol consumption and smoking with pancreatitis. The patients had a mean (SD) age of 57.6 (17.0) years; 71.8% were male. Compared with nondrinkers, alcohol consumption of less than 20 g/d was not associated with the risk for total pancreatitis (odds ratio [OR], 1.0; 95% confidence interval [CI], 0.7-1.4). In patients with acute pancreatitis, the ORs (95% CI) for alcohol consumption of 20 ≤ ∼ < 40 g/d, 40 ≤ ∼ < 60 g/d, 60 ≤ ∼ < 80 g/d, 80 ≤ ∼ < 100 g/d, and 100 g/d or greater were 1.7 (0.9-3.0), 3.1 (1.6-5.9), 4.2 (2.1-8.2), 5.3 (2.4-12.0), and 6.4 (3.4-12.4), respectively. In patients with chronic pancreatitis, the ORs (95% CI) for alcohol consumption of 20 ≤ ∼ < 40 g/d, 40 ≤ ∼ < 60 g/d, 60 ≤ ∼ < 80 g/d, 80 ≤ ∼ < 100 g/d, and 100 g/d or greater were 2.6 (1.2-5.5), 3.2 (1.5-7.1), 9.2 (4.1-20.3), 13.0 (5.3-31.6), and 19.6 (8.2-46.8), respectively. Our study precisely measured the quantitative effect of alcohol on the risk for developing pancreatitis.

  4. The Effects of Functional Training, Bicycle Exercise, and Exergaming on Walking Capacity of Elderly Patients With Parkinson Disease: A Pilot Randomized Controlled Single-blinded Trial.

    PubMed

    Ferraz, Daniel Dominguez; Trippo, Karen Valadares; Duarte, Gabriel Pereira; Neto, Mansueto Gomes; Bernardes Santos, Kionna Oliveira; Filho, Jamary Oliveira

    2018-05-01

    To compare the effects of functional training, bicycle exercise, and exergaming on walking capacity of elderly with Parkinson disease (PD). A pilot randomized, controlled, single-blinded trial. A state reference health care center for elderly, a public reference outpatient clinic for the elderly. Elderly individuals (≥60 years of age; N=62) with idiopathic PD (stage 2 to 3 of modified Hoehn and Yahr staging scale) according to the London Brain Bank. The participants were randomly assigned to three groups. Group 1 (G1) participated in functional training (n=22); group 2 (G2) performed bicycle exercise (n=20), and group 3 (G3) trained with Kinect Adventures (Microsoft, Redmond, WA) exergames (n=20). The primary outcome measure was the 6-minute walk test (6MWT); secondary outcome measures were the 10-m walk test (10MWT), sitting-rising test (SRT), body mass index, Parkinson Disease Questionnaire-39, World Health Organization Disability Assessment Schedule 2.0 (WHODAS 2.0), and 15-item Geriatric Depression Scale. All groups showed significant improvements in 6MWT (G1 P=.008; G2 P=.001; G3 P=.005), SRT (G1 P<.001; G2 P=.001; G3 P=.003), and WHODAS 2.0 (G1 P=.018; G2 P=.019; G3 P=.041). Only G3 improved gait speed in 10MWT (P=.11). G1 (P=.014) and G3 (P=.004) improved quality of life. No difference was found between groups. Eight weeks of exergaming can improve the walking capacity of elderly patients with PD. Exergame training had similar outcomes compared with functional training and bicycle exercise. The three physical exercise modalities presented significant improvements on walking capacity, ability to stand up and sit, and functionality of the participants. Copyright © 2018 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  5. Synthesis and Biological Testing of Novel Glucosylated Epigallocatechin Gallate (EGCG) Derivatives.

    PubMed

    Zhang, Xin; Wang, Jing; Hu, Jiang-Miao; Huang, Ye-Wei; Wu, Xiao-Yun; Zi, Cheng-Ting; Wang, Xuan-Jun; Sheng, Jun

    2016-05-11

    Epigallocatechin gallate (EGCG) is the most abundant component of green tea catechins and has strong physiological activities. In this study, two novel EGCG glycosides (EGCG-G1 and EGCG-G2) were chemoselectively synthesized by a chemical modification strategy. Each of these EGCG glycosides underwent structure identification, and the structures were assigned as follows: epigallocatechin gallate-4''-O-β-d-glucopyranoside (EGCG-G1, 2) and epigallocatechin gallate-4',4''-O-β-d-gluco-pyranoside (EGCG-G2, 3). The EGCG glycosides were evaluated for their anticancer activity in vitro against two human breast cell lines (MCF-7 and MDA-MB-231) using MTT assays. The inhibition rate of EGCG glycosides (EGCG-G1 and EGCG-G2) is not obvious. The EGCG glycosides are more stable than EGCG in aqueous solutions, but exhibited decreasing antioxidant activity in the DPPH radical-scavenging assay (EGCG > EGCG-G2 > EGCG-G1). Additionally, the EGCG glycosides exhibited increased water solubility: EGCG-G2 and EGCG-G1 were 15 and 31 times as soluble EGCG, respectively. The EGCG glycosides appear to be useful, and further studies regarding their biological activity are in progress.

  6. Amino-terminal sequence of glycoprotein D of herpes simplex virus types 1 and 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eisenberg, R.J.; Long, D.; Hogue-Angeletti, R.

    1984-01-01

    Glycoprotein D (gD) of herpes simplex virus is a structural component of the virion envelope which stimulates production of high titers of herpes simplex virus type-common neutralizing antibody. The authors caried out automated N-terminal amino acid sequencing studies on radiolabeled preparations of gD-1 (gD of herpes simplex virus type 1) and gD-2 (gD of herpes simplex virus type 2). Although some differences were noted, particularly in the methionine and alanine profiles for gD-1 and gD-2, the amino acid sequence of a number of the first 30 residues of the amino terminus of gD-1 and gD-2 appears to be quite similar.more » For both proteins, the first residue is a lysine. When we compared out sequence data for gD-1 with those predicted by nucleic acid sequencing, the two sequences could be aligned (with one exception) starting at residue 26 (lysine) of the predicted sequence. Thus, the first 25 amino acids of the predicted sequence are absent from the polypeptides isolated from infected cells.« less

  7. Hypergravity and estrogen effects on avian anterior pituitary growth hormone and prolactin levels

    NASA Technical Reports Server (NTRS)

    Fiorindo, R. P.; Negulesco, J. A.

    1980-01-01

    Developing female chicks with fractured right radii were maintained for 14 d at either earth gravity (1 g) or a hypergravity state (2 g). The birds at 1 g were divided into groups which received daily injections of (1) saline, (2) 200 micrograms estrone, and (3) 400 micrograms estrone for 14 d. The 2-g birds were divided into three similarly treated groups. All 2-g birds showed significantly lower body weights than did 1-g birds. Anterior pituitary (AP) glands were excised and analyzed for growth hormone and prolactin content by analytical electrophoresis. The 1-g chicks receiving either dose of daily estrogen showed increased AP growth hormone levels, whereas hypergravity alone did not affect growth hormone content. Chicks exposed to daily estrogen and hypergravity displayed reduced growth hormone levels. AP prolactin levels were slightly increased by the lower daily estrogen dose in 1-g birds, but markedly reduced in birds exposed only to hypergravity. Doubly-treated chicks displayed normal prolactin levels. Reduced growth in 2-g birds might be due, in part, to reduced AP levels of prolactin and/or growth hormone.

  8. Toxicology and carcinogenesis studies of kava kava extract (CAS No. 9000-38-8) in F344/N rats and B6C3F1 mice (Gavage Studies).

    PubMed

    2012-03-01

    Kava beverages, made from dried roots of the shrub Piper methysticum, have been used ceremonially and socially in the South Pacific and in Europe since the 1700s. The drink is reported to have pleasant mild psychoactive effects, similar to alcoholic beverages. In the United States, kava kava is an herbal product used extensively as an alternative to anti-anxiety drugs such as Xanax and Valium. It has also been reported as being used to help children with hyperactivity and as a skin-conditioning agent in cosmetics. Kava kava was nominated by the National Cancer Institute for study because of its increasing use as a dietary supplement in the mainstream United States market and reports of liver toxicity among humans. Male and female F344/N rats and B6C3F1 mice received kava kava extract in corn oil by gavage for 2 weeks, 3 months, or 2 years. Genetic toxicology studies were conducted in Salmonella typhimurium, Escherichia coli, and mouse peripheral blood erythrocytes. 2-WEEK STUDY IN RATS: Groups of five male and five female rats were administered kava kava extract in corn oil by gavage at doses of 0, 0.125, 0.25, 0.5, 1.0, or 2.0 g/kg body weight, 5 days per week for 16 days. One female rat administered 2.0 g/kg kava kava extract died on day 3 of the study. Mean body weights of all dosed groups of rats were similar to those of the vehicle controls. Clinical findings included abnormal breathing, ataxia, and lethargy in the 2.0 g/kg groups of males and females and ataxia and lethargy in the 1.0 g/kg group of females. Liver weights were significantly increased in 1.0 and 2.0 g/kg males and in 0.5 g/kg or greater females compared to the vehicle controls. Minimal hepatocellular hypertrophy occurred in all 2.0 g/kg males and in all females administered 0.25 g/kg or greater. 2-WEEK STUDY IN MICE: Groups of five male and five female mice were administered kava kava extract in corn oil by gavage at doses of 0, 0.125, 0.25, 0.5, 1.0, or 2.0 g/kg body weight, 5 days per week for 17 days. In the 2.0 g/kg group of males, one died on day 2 and one died on day 3. Mean body weights of all dosed groups of mice were similar to those of the vehicle controls. Clinical findings included abnormal breathing, ataxia, and lethargy in males and females in the 1.0 and 2.0 g/kg groups. Liver weights of 2.0 g/kg males and females were significantly increased. The incidence of hepatocellular hypertrophy in 2.0 g/kg female mice was significantly greater than that in the vehicle control group. 3-MONTH STUDY IN RATS: Groups of 10 male and 10 female rats were administered kava kava extract in corn oil by gavage at doses of 0, 0.125, 0.25, 0.5, 1.0, or 2.0 g/kg, 5 days per week for 14 weeks. Deaths attributed to kava kava extract administration included three males and four females in the 2.0 g/kg groups and one female in the 1.0 g/kg group. One 0.25 g/kg male and one vehicle control female also died before the end of the study. The mean body weights of males in the 1.0 and 2.0 g/kg groups and females in the 2.0 g/kg group were significantly less than those of the vehicle controls. Ataxia and lethargy were observed in males and females in the 1.0 g/kg groups during week 1 and in the 2.0 g/kg groups throughout the study. Increased -glutamyltransferase activity in 1.0 g/kg females and 2.0 g/kg males and females may represent enzyme induction. However, the hepatocellular hypertrophy observed in the 2.0 g/kg females may have contributed to the increased -glutamyltransferase activity. The liver weights of 0.25 g/kg or greater males and 0.5 g/kg or greater females were significantly increased compared to the vehicle controls. The kidney weights of 0.5 g/kg or greater males and females were significantly increased compared to the vehicle controls. The incidence of hepatocellular hypertrophy in 2.0 g/kg females was significantly greater than that in the vehicle controls. 3-MONTH STUDY IN MICE: Groups of 10 male and 10 female mice were administered kava kava extract in corn oil by gavage at doses of 0, 0.125, 0.25, 0.5, 1.0, or 2.0 g/kg, 5 days per week for 14 weeks. Four male and three female 2.0 g/kg mice died during week 1; these deaths were attributed to kava kava extract administration. One additional 2.0 g/kg female died during week 6 due to a gavage accident. The mean body weights of dosed males and females were similar to those of the vehicle controls. Ataxia and lethargy occurred in males and females in the 1.0 and 2.0 g/kg groups during week 1. The liver weights of 2.0 g/kg males and 1.0 and 2.0 g/kg females were significantly increased compared to those of the vehicle control groups. The incidences of centrilobular hypertrophy in the liver of 0.5 g/kg or greater males and 1.0 and 2.0 g/kg females were significantly greater than those in the vehicle controls. 2-YEAR STUDY IN RATS: Groups of 49 or 50 male and 50 female rats were administered kava kava extract in corn oil by gavage at doses of 0, 0.1, 0.3, or 1.0 g/kg, 5 days per week for 104 (males) or 105 (females) weeks. Survival of dosed groups of males and females was similar to that of the vehicle controls. Mean body weights of males administered 1.0 g/kg were less than those of the vehicle controls after week 65, and those of the 1.0 g/kg females were less than those of the vehicle controls after week 41. Clinical findings included ataxia and lethargy that occurred in 21 males and 14 females in the 1.0 g/kg groups during the first 4 weeks of the study. After week 5, ataxia and lethargy were noted in 10 males and eight females in the 1.0 g/kg groups and these findings were observed randomly and intermittently throughout the study. At approximately 1 year into the study, twitching and seizures were observed in males and females in all dosed groups but mainly in the 1.0 g/kg groups. There was a dose-related increase in the incidences of interstitial cell adenoma in the testis with increased incidences of bilateral neoplasms. The incidences of hepatocellular hypertrophy in 1.0 g/kg males and females were significantly greater than those in the vehicle controls. Increased -glutamyltransferase activity and/or bile salt concentrations in males and females may represent a cholestatic event related to the hepatocellular hypertrophy observed in rats. Enzyme induction may have played a role in the increased -glutamyltransferase activity. Significantly increased incidences of centrilobular fatty change occurred in 0.1 and 1.0 g/kg males. The incidences of inflammation, ulcer, and epithelial hyperplasia in the forestomach were significantly increased in 1.0 g/kg males and females. The severity of nephropathy was increased in 1.0 g/kg male rats, and the incidence of nephropathy was significantly increased in 1.0 g/kg females. Incidences of transitional epithelial hyperplasia of the pelvis of the kidney were significantly increased in 1.0 g/kg males and 0.3 and 1.0 g/kg females. The incidences of retinal degeneration in the eye were significantly increased in 1.0 g/kg males and females. The incidences of metaplasia of pancreatic acinar cells to a hepatocytic morphology increased in 1.0 g/kg males and females, and the increase in males was significant. Significantly decreased incidences of pars distalis adenoma in the pituitary gland occurred in 1.0 g/kg males and in 0.1 and 1.0 g/kg females. The incidence of fibroadenoma of the mammary gland in 1.0 g/kg females was significantly less than that in the vehicle control group. 2-YEAR STUDY IN MICE: Groups of 50 male and 50 female mice received kava kava extract in corn oil by gavage at doses of 0, 0.25, 0.5, or 1.0 g/kg, 5 days per week for 105 weeks. Survival of dosed groups of males and females was similar to that of the vehicle controls. Mean body weights of males administered 1.0 g/kg were generally similar to those of the vehicle controls until the end of the study; however, those of 1.0 g/kg females were less than those of the vehicle controls after week 21. Clinical findings included ataxia and lethargy that occurred in 13 males and 31 females in the 1.0 g/kg groups during the first week of the study. Decreasing numbers of animals exhibited ataxia or lethargy during the remainder of the study, but these findings were observed in 1.0 g/kg females as late as week 101. The incidences of hepatoblastoma in 0.5 and 1.0 g/kg males were significantly increased compared to the vehicle controls. The incidences of hepatocellular carcinoma or hepatoblastoma (combined) were significantly increased in 0.5 g/kg males. Incidences of hepatocellular carcinoma were increased in all dosed groups of females, and the increase was significant in the 0.25 g/kg group. The incidences of hepatocellular adenoma or carcinoma (combined) were significantly increased in 0.25 and 0.5 g/kg females. In the liver, the incidences of centrilobular hypertrophy in all dosed groups of males and females were significantly greater than those in the vehicle control groups. Significantly increased incidences of eosinophilic foci occurred in 0.5 g/kg males and in 1.0 g/kg males and females, and the incidence of angiectasis was significantly increased in the 1.0 g/kg males. The incidences of hepatocellular necrosis were significantly increased in 0.25 and 1.0 g/kg males. In the forestomach, the incidences of chronic inflammation, epithelial hyperplasia, and erosion were significantly increased in 0.5 and 1.0 g/kg females, and the incidence of ulceration was significantly increased in 1.0 g/kg females. Kava kava extract was tested for bacterial mutagenicity over a broad range of concentrations in two independent assays using several strains of bacteria (S. typhimurium tester strains TA97, TA98, TA100, and TA1535 and E. coli strain WP2 uvrA/pKM101), with and without exogenous metabolic activation. No increase in mutant colonies was seen in any of the tester strains, under any activation condition. (ABSTRACT TRUNCATED)

  9. 14 CFR 27.561 - General.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...) Downward—20g, after intended displacement of the seat device. (v) Rearward—1.5g. (c) The supporting... ultimate inertial load factors: (1) Upward—1.5g. (2) Forward—12g. (3) Sideward—6g. (4) Downward—12g. (5) Rearward—1.5g (d) Any fuselage structure in the area of internal fuel tanks below the passenger floor level...

  10. 14 CFR 27.561 - General.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...) Downward—20g, after intended displacement of the seat device. (v) Rearward—1.5g. (c) The supporting... ultimate inertial load factors: (1) Upward—1.5g. (2) Forward—12g. (3) Sideward—6g. (4) Downward—12g. (5) Rearward—1.5g (d) Any fuselage structure in the area of internal fuel tanks below the passenger floor level...

  11. 14 CFR 29.561 - General.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...) Downward—20g, after the intended displacement of the seat device. (v) Rearward—1.5g. (c) The supporting... ultimate inertial load factors: (1) Upward—1.5g. (2) Forward—12g. (3) Sideward—6g. (4) Downward—12g. (5) Rearward—1.5g. (d) Any fuselage structure in the area of internal fuel tanks below the passenger floor...

  12. 14 CFR 27.561 - General.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...) Downward—20g, after intended displacement of the seat device. (v) Rearward—1.5g. (c) The supporting... ultimate inertial load factors: (1) Upward—1.5g. (2) Forward—12g. (3) Sideward—6g. (4) Downward—12g. (5) Rearward—1.5g (d) Any fuselage structure in the area of internal fuel tanks below the passenger floor level...

  13. 14 CFR 29.561 - General.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...) Downward—20g, after the intended displacement of the seat device. (v) Rearward—1.5g. (c) The supporting... ultimate inertial load factors: (1) Upward—1.5g. (2) Forward—12g. (3) Sideward—6g. (4) Downward—12g. (5) Rearward—1.5g. (d) Any fuselage structure in the area of internal fuel tanks below the passenger floor...

  14. 14 CFR 29.561 - General.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...) Downward—20g, after the intended displacement of the seat device. (v) Rearward—1.5g. (c) The supporting... ultimate inertial load factors: (1) Upward—1.5g. (2) Forward—12g. (3) Sideward—6g. (4) Downward—12g. (5) Rearward—1.5g. (d) Any fuselage structure in the area of internal fuel tanks below the passenger floor...

  15. 14 CFR 27.561 - General.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...) Downward—20g, after intended displacement of the seat device. (v) Rearward—1.5g. (c) The supporting... ultimate inertial load factors: (1) Upward—1.5g. (2) Forward—12g. (3) Sideward—6g. (4) Downward—12g. (5) Rearward—1.5g (d) Any fuselage structure in the area of internal fuel tanks below the passenger floor level...

  16. 14 CFR 29.561 - General.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...) Downward—20g, after the intended displacement of the seat device. (v) Rearward—1.5g. (c) The supporting... ultimate inertial load factors: (1) Upward—1.5g. (2) Forward—12g. (3) Sideward—6g. (4) Downward—12g. (5) Rearward—1.5g. (d) Any fuselage structure in the area of internal fuel tanks below the passenger floor...

  17. Enhanced photocatalytic performances of ultrafine g-C3N4 nanosheets obtained by gaseous stripping with wet nitrogen

    NASA Astrophysics Data System (ADS)

    Fan, Chengkong; Feng, Qiang; Xu, Guangqing; Lv, Jun; Zhang, Yong; Liu, Jiaqin; Qin, Yongqiang; Wu, Yucheng

    2018-01-01

    Graphitic carbon nitride (g-C3N4) is a promising heterogeneous photocatalyst for organics pollutants degradation and water splitting. Herein, we highlight an available pathway to prepare the ultrafine g-C3N4 nanosheets by gaseous stripping of bulk g-C3N4 in wet nitrogen. As comparison, g-C3N4 treated in air and nitrogen atmospheres are also prepared. The obtained products are characterized with X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy and Fourier transform infrared spectra, respectively. Well dispersed g-C3N4 nanosheets can be obtained by this gaseous stripping process in wet nitrogen, which possess much higher specific surface area (211.2 m2 g-1) than that of bulk g-C3N4 (15.3 m2 g-1). Both RhB degradation and water splitting are applied to characterize the photocatalytic performances of the ultrafine g-C3N4 nanosheets. The g-C3N4 (w-N2) nanosheets can degrade 20 mg/L RhB completely within 12 min under visible light illumination, which is 5.32 times faster than that of bulk g-C3N4. Also, the g-C3N4 (w-N2) nanosheets possess the highest photocatalytic hydrogen evolution rate of 1113.48 μmol h-1 g-1 under visible light illumination, which is 6 times that of bulk g-C3N4. The mechanisms of enhancing the photocatalytic performance are discussed to be the higher oxidation ability of VB and higher specific surface area (211.2 m2/g) of the ultrafine g-C3N4 nanosheets.

  18. Effects of 2.0-g 1.75-g and 1.5-g Hypergravity on Pregnancy Outcome in Rats (Rattus norvegicus)

    NASA Technical Reports Server (NTRS)

    Mills, Nicole A.; Baer, Lisa A.; Ronca, April E.

    2001-01-01

    In 1995, ten pregnant female rats were launched on the Space Shuttle (STS-70) on Gestational day(G) 11 of their 22-day pregnancy as part of the NASA/NIH.Rodent (R)2 Experiment. Following landing on G20, fetuses were harvested from half of the dams, while the remaining five dams underwent birth. Spaceflight did not interrupt pregnancy, alter litter sizes, or affect body weights or gender ratios of the fetuses or neonates. In the present study we used the NASA/NIH.R2 experimental paradigm to analyze the effects of hypergravity on pregnancy outcome. On G10, time-bred Sprague-Dawley rat dams were assigned to either G20 or Birth conditions, then further assigned to Hypergravity (HG) 2.0-g, HG 1.75-g, HG 1.5-g, Rotational Control (RC, 1.03), or Stationary Control (SC, 1.0-g) treatments. Dams were exposed to continuous centrifugation from G11 through G20, with brief daily stops for animal health checks and maintenance. For both the G20 and Birth dams, comparable litter sizes and litter gender ratios were observed across gravity conditions. However, centrifugation-exposed (HG and RC) fetuses and neonates showed significantly lower body masses (p less than 0.05) relative to SC offspring. HG 2.0-g offspring weighed significantly less than those in all other gravity conditions (p less than 0.05). The observed reductions in offspring body mass at 1.5-g and 1.75-g, can be attributed to the rotational component of centrifugation, rather than to increased gravitational load, whereas 2.0-g hypergravity exposure further exacerbated the gravity centrifugation effect on offspring body mass. Pregnant dams exposed to centrifugation weighed significantly less than SC dams (p less than 0.05), suggesting that centrifugation effects on maternal body mass may contribute to reduced size of the developing offspring. These findings are consistent with previous reports of non-pregnant adult animals suggesting that, whereas spaceflight has virtually no effect on body mass, centrifugation is associated with changes in body weight regulation.

  19. Why Do We Miss Rare Targets? Exploring the Boundaries of the Low Prevalence Effect

    DTIC Science & Technology

    2008-11-24

    effect of prevalence ( F (1,8) = 34.2, p G 0.001, partial eta2 = 0.81), but no effect of set size ( F (1,8) G 1 , n.s.) and no interaction ( F (1,8) G 1 , n.s...Figure 2d; for Prevalence, Target Presence, and all interaction terms, F (1,8) G 1 , n.s.; for Set Size, F (1,8) = 1.7, p 9 0.2). What hints can we get... 1 , n.s.), and no interaction ( F (1,14) G 1 , n.s.). There were insufficient errors on target-absent trials for analysis. An analysis by RT quartile

  20. Overview of the Development of Australian Combat Ration Packs

    DTIC Science & Technology

    2014-12-01

    g) Variety B Serve Size (g) Retort Meal Chilli Con Carne 1 x 250 FD Meal Veal Italienne 1 x 110 Instant Oriental Noodles 1 x 74 White Rice 2 x 125...retort pouch meal freeze dried meal flexible retort pouch meal light meals (soup, noodles , steak bar, canned fish)  noodles steak bar...Items Common to all HWRP Menus Cracked Pepper Vita Wheat 1x36 g instant coffee 1x3.5 g tea bags# 1x2.5 g cheddar cheese (canned) 1x56 g cappuccino

  1. Vacancy-induced brittle to ductile transition of W-M co-doped Al3Ti (M=Si, Ge, Sn and Pb).

    PubMed

    Zhu, Mingke; Wu, Ping; Li, Qiulin; Xu, Ben

    2017-10-25

    We investigated the effect of vacancy formation on brittle (D0 22 ) to ductile (L1 2 -like) transition in Al 3 Ti using DFT calculations. The well-known pseudogap on the density of states of Al 3 Ti migrates towards its Fermi level from far above, via a W - M co-doping strategy, where M is Si, Ge, Sn or Pb respectively. In particular, by a W - M co-doping the underline electronic structure of the pseudogap approaches an octahedral (L1 2 : t 2g , e g ) from the tetragonal (D0 22 : e g , b 2g , a 1g , b 1g ) crystal field. Our calculations demonstrated that (1) a W-doping is responsible for the close up of the energy gap between a 1g and b 1g so that they tend to merge into an e g symmetry, and (2) all M-doping lead to a narrower gap between e g and b 2g (moving towards a t 2g symmetry). Thus, a brittle to ductile transition in Al 3 Ti is possible by adopting this W - M co-doping strategy. We further recommend the use of W-Pb co-doped Al 3 Ti to replace the less anodic Al electrode in Al-battery, due to its improved ductility and high Al diffusivity. Finally this study opens a new field in physics to tailor mechanical properties by manipulating electron energy level(s) towards higher symmetry via vacancy optimization.

  2. 26 CFR 1.904(g)-1 - Overall domestic loss and the overall domestic loss account.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... loss account. 1.904(g)-1 Section 1.904(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF... the United States § 1.904(g)-1 Overall domestic loss and the overall domestic loss account. (a... accounts for purposes of section 904(g). Section 1.904(g)-2 provides rules for recapturing the balance in...

  3. 26 CFR 1.904(g)-1 - Overall domestic loss and the overall domestic loss account.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... loss account. 1.904(g)-1 Section 1.904(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF... the United States § 1.904(g)-1 Overall domestic loss and the overall domestic loss account. (a... accounts for purposes of section 904(g). Section 1.904(g)-2 provides rules for recapturing the balance in...

  4. Effects of production and market factors on ethanol profitability for an integrated first and second generation ethanol plant using the whole sugarcane as feedstock

    PubMed Central

    2014-01-01

    Background Sugarcane is an attractive feedstock for ethanol production, especially if the lignocellulosic fraction can also be treated in second generation (2G) ethanol plants. However, the profitability of 2G ethanol is affected by the processing conditions, operating costs and market prices. This study focuses on the minimum ethanol selling price (MESP) and maximum profitability of ethanol production in an integrated first and second generation (1G + 2G) sugarcane-to-ethanol plant. The feedstock used was sugarcane juice, bagasse and leaves. The lignocellulosic fraction was hydrolysed with enzymes. Yields were assumed to be 95% of the theoretical for each of the critical steps in the process (steam pretreatment, enzymatic hydrolysis (EH), fermentation, solid/liquid separation, anaerobic digestion) in order to obtain the best conditions possible for ethanol production, to assess the lowest production costs. Techno-economic analysis was performed for various combinations of process options (for example use of pentoses, addition of leaves), EH conditions (water-insoluble solids (WIS) and residence time), operating cost (enzymes) and market factors (wholesale prices of electricity and ethanol, cost of the feedstock). Results The greatest reduction in 2G MESP was achieved when using the pentoses for the production of ethanol rather than biogas. This was followed, in decreasing order, by higher enzymatic hydrolysis efficiency (EHE), by increasing the WIS to 30% and by a short residence time (48 hours) in the EH. The addition of leaves was found to have a slightly negative impact on 1G + 2G MESP, but the effect on 2G MESP was negligible. Sugarcane price significantly affected 1G + 2G MESP, while the price of leaves had a much lower impact. Net present value (NPV) analysis of the most interesting case showed that integrated 1G + 2G ethanol production including leaves could be more profitable than 1G ethanol, despite the fact that the MESP was higher than in 1G ethanol production. Conclusions A combined 1G + 2G ethanol plant could potentially outperform a 1G plant in terms of NPV, depending on market wholesale prices of ethanol and electricity. Therefore, although it is more expensive than 1G ethanol production, 2G ethanol production can make the integrated 1G + 2G process more profitable. PMID:24559312

  5. Effects of production and market factors on ethanol profitability for an integrated first and second generation ethanol plant using the whole sugarcane as feedstock.

    PubMed

    Macrelli, Stefano; Galbe, Mats; Wallberg, Ola

    2014-02-21

    Sugarcane is an attractive feedstock for ethanol production, especially if the lignocellulosic fraction can also be treated in second generation (2G) ethanol plants. However, the profitability of 2G ethanol is affected by the processing conditions, operating costs and market prices. This study focuses on the minimum ethanol selling price (MESP) and maximum profitability of ethanol production in an integrated first and second generation (1G + 2G) sugarcane-to-ethanol plant. The feedstock used was sugarcane juice, bagasse and leaves. The lignocellulosic fraction was hydrolysed with enzymes. Yields were assumed to be 95% of the theoretical for each of the critical steps in the process (steam pretreatment, enzymatic hydrolysis (EH), fermentation, solid/liquid separation, anaerobic digestion) in order to obtain the best conditions possible for ethanol production, to assess the lowest production costs. Techno-economic analysis was performed for various combinations of process options (for example use of pentoses, addition of leaves), EH conditions (water-insoluble solids (WIS) and residence time), operating cost (enzymes) and market factors (wholesale prices of electricity and ethanol, cost of the feedstock). The greatest reduction in 2G MESP was achieved when using the pentoses for the production of ethanol rather than biogas. This was followed, in decreasing order, by higher enzymatic hydrolysis efficiency (EHE), by increasing the WIS to 30% and by a short residence time (48 hours) in the EH. The addition of leaves was found to have a slightly negative impact on 1G + 2G MESP, but the effect on 2G MESP was negligible. Sugarcane price significantly affected 1G + 2G MESP, while the price of leaves had a much lower impact. Net present value (NPV) analysis of the most interesting case showed that integrated 1G + 2G ethanol production including leaves could be more profitable than 1G ethanol, despite the fact that the MESP was higher than in 1G ethanol production. A combined 1G + 2G ethanol plant could potentially outperform a 1G plant in terms of NPV, depending on market wholesale prices of ethanol and electricity. Therefore, although it is more expensive than 1G ethanol production, 2G ethanol production can make the integrated 1G + 2G process more profitable.

  6. Distance Domination Number of Graphs Resulting from Edge Comb Product

    NASA Astrophysics Data System (ADS)

    Slamin; Dafik; Angger Waspodo, Gembong

    2018-05-01

    Let G be a simple, finite and connected graph with a vertex-set V (G) and an edge-set E(G). For an integer 1 ≤ k ≤ diam (G), a distance k-dominating set of a connected graph G is a set S of vertices of G such that every vertex of V (G)\\S is at distance at most k from some vertex of S. The k-domination number of G, denoted by γk (G), is the minimum cardinality of a k-dominating set of G. In this paper, we determine the exact value of k-domination number of graphs resulting from an edge comb product of two graphs G 1 and G 2, where G 1 is a wheel, a friendship graph, or a triangular book and G 2 is a cycle.

  7. Advective, Diffusive and Eruptive Leakage of CO2 and Brine within Fault Zone

    NASA Astrophysics Data System (ADS)

    Jung, N. H.; Han, W. S.

    2014-12-01

    This study investigated a natural analogue for CO2 leakage near the Green River, Utah, aiming to understand the influence of various factors on CO2 leakage and to reliably predict underground CO2 behavior after injection for geologic CO2 sequestration. Advective, diffusive, and eruptive characteristics of CO2 leakage were assessed via a soil CO2 flux survey and numerical modeling. The field results show anomalous CO2 fluxes (> 10 g m-2 d-1) along the faults, particularly adjacent to CO2-driven cold springs and geysers (e.g., 36,259 g m-2 d-1 at Crystal Geyser), ancient travertines (e.g., 5,917 g m-2 d-1), joint zones in sandstone (e.g., 120 g m-2 d-1), and brine discharge zones (e.g., 5,515 g m-2 d-1). Combined to similar isotopic ratios of gas and progressive evolution of brine chemistry at springs and geysers, a gradual decrease of soil CO2 flux from the Little Grand Wash (LGW; ~36,259 g m-2 d-1) to Salt Wash (SW; ~1,428 g m-2 d-1) fault zones reveals the same CO2 origin and potential southward transport of CO2 over 10-20 km. The numerical simulations overtly exhibit lateral transport of free CO2 and CO2-rich brine from the LGW to SW fault zones through the regional aquifers (e.g., Entrada, Navajo, Kayenta, Wingate, White Rim). CO2 travels predominantly as an aqueous phase (Xco2=~0.045) as previously suggested, giving rise to the convective instability that further accelerates CO2 dissolution. While the buoyant free CO2 always tends to ascend, a fraction of dense CO2-rich brine flows laterally into the aquifer and mixes with the formation fluids during upward migration along the fault. The fault always enhances advective CO2 transport regardless of its permeability (k). However, only the low-k fault scenario engenders development of CO2 anticlinal trap within the shallow aquifers (Entrada and Navajo), concentrating high CO­­­2 fluxes (~1,273 g m-2 d-1) within the northern footwall of the LGW fault similar to the field. Moreover, eruptive CO2 leakage at a well (Crystal Geyser) solely appears under the presence of anticlinal trap. Thus, it can be concluded that the LGW fault is likely low-permeable, 0.01 md ≤ kh <0.1 md and 0.5 md ≤ kv < 1 md, which could be used as a good starting point for other studies and further improved.

  8. Channel Gating Dependence on Pore Lining Helix Glycine Residues in Skeletal Muscle Ryanodine Receptor.

    PubMed

    Mei, Yingwu; Xu, Le; Mowrey, David D; Mendez Giraldez, Raul; Wang, Ying; Pasek, Daniel A; Dokholyan, Nikolay V; Meissner, Gerhard

    2015-07-10

    Type 1 ryanodine receptors (RyR1s) release Ca(2+) from the sarcoplasmic reticulum to initiate skeletal muscle contraction. The role of RyR1-G4934 and -G4941 in the pore-lining helix in channel gating and ion permeation was probed by replacing them with amino acid residues of increasing side chain volume. RyR1-G4934A, -G4941A, and -G4941V mutant channels exhibited a caffeine-induced Ca(2+) release response in HEK293 cells and bound the RyR-specific ligand [(3)H]ryanodine. In single channel recordings, significant differences in the number of channel events and mean open and close times were observed between WT and RyR1-G4934A and -G4941A. RyR1-G4934A had reduced K(+) conductance and ion selectivity compared with WT. Mutations further increasing the side chain volume at these positions (G4934V and G4941I) resulted in reduced caffeine-induced Ca(2+) release in HEK293 cells, low [(3)H]ryanodine binding levels, and channels that were not regulated by Ca(2+) and did not conduct Ca(2+) in single channel measurements. Computational predictions of the thermodynamic impact of mutations on protein stability indicated that although the G4934A mutation was tolerated, the G4934V mutation decreased protein stability by introducing clashes with neighboring amino acid residues. In similar fashion, the G4941A mutation did not introduce clashes, whereas the G4941I mutation resulted in intersubunit clashes among the mutated isoleucines. Co-expression of RyR1-WT with RyR1-G4934V or -G4941I partially restored the WT phenotype, which suggested lessening of amino acid clashes in heterotetrameric channel complexes. The results indicate that both glycines are important for RyR1 channel function by providing flexibility and minimizing amino acid clashes. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Risk of stent thrombosis among bare-metal stents, first-generation drug-eluting stents, and second-generation drug-eluting stents: results from a registry of 18,334 patients.

    PubMed

    Tada, Tomohisa; Byrne, Robert A; Simunovic, Iva; King, Lamin A; Cassese, Salvatore; Joner, Michael; Fusaro, Massimiliano; Schneider, Simon; Schulz, Stefanie; Ibrahim, Tareq; Ott, Ilka; Massberg, Steffen; Laugwitz, Karl-Ludwig; Kastrati, Adnan

    2013-12-01

    This study sought to compare the risk of stent thrombosis among patients treated with bare-metal stents (BMS), first-generation drug-eluting stents (G1-DES), and second-generation drug-eluting stents (G2-DES) for a period of 3 years. In patients undergoing coronary stenting, there is a scarcity of long-term follow-up data on cohorts large enough to compare rates of stent thrombosis across the stent generations. A total of 18,334 patients undergoing successful coronary stent implantation from 1998 to 2011 at 2 centers in Munich, Germany, were included in this study. Patients were stratified into 3 groups according to treatment with BMS, G1-DES, and G2-DES. The cumulative incidence of definite stent thrombosis at 3 years was 1.5% with BMS, 2.2% with G1-DES, and 1.0% with G2-DES. On multivariate analysis, G1-DES compared with BMS showed a significantly higher risk of stent thrombosis (odds ratio [OR]: 2.05; 95% confidence interval [CI]: 1.47 to 2.86; p < 0.001). G2-DES were associated with a similar risk of stent thrombosis compared with BMS (OR: 0.82; 95% CI: 0.56 to 1.19; p = 0.30). Beyond 1 year, the risk of stent thrombosis was significantly increased with G1-DES compared with BMS (OR: 4.72; 95% CI: 2.01 to 11.1; p < 0.001), but not with G2-DES compared with BMS (OR: 1.01; 95% CI: 0.32 to 3.25; p = 0.98). In a large cohort of unselected patients undergoing coronary stenting, compared with BMS, there was a significant excess risk of stent thrombosis at 3 years with G1-DES, driven by an increased risk of stent thrombosis events beyond 1 year. G2-DES were associated with a similar risk of stent thrombosis compared with BMS. Copyright © 2013 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  10. Comparative studies of saponins in 1-3-year-old main roots, fibrous roots, and rhizomes of Panax notoginseng, and identification of different parts and growth-year samples.

    PubMed

    Jia, Xiu-Hong; Wang, Chao-Qun; Liu, Jin-Huai; Li, Xiao-Wei; Wang, Xuan; Shang, Ming-Ying; Cai, Shao-Qing; Zhu, Shu; Komatsu, Katsuko

    2013-04-01

    Notoginsenosides R1, R4, Fa, and K (N-R1, N-R4, N-Fa, and N-K), as well as ginsenosides Rg1, Rb1, Rd, Re, Rf, Rg2 and Rh1 (G-Rg1, G-Rb1, G-Rd, G-Re, G-Rf, G-Rg2 and G-Rh1) in 47 Notoginseng samples including 1-, 2- and 3-year-old main roots, rhizomes and fibrous roots of Panax notoginseng were determined by high-performance liquid chromatography-diode array detection method. Total contents (%) of the 11 saponins were 9.82-14.57 for 2-year old and 14.20-16.00 for 3-year-old rhizomes; 2.72-4.50 for 2-year-old and 1.98-4.92 for 3-year-old fibrous roots; 1.75-3.05 for 1-year-old whole roots; and 3.71-8.98 for 2-year-old and 7.03-11.23 for 3-year-old main roots. Contents of most saponins and total content of 11 saponins were in the order 3- >2- >1-year-old main root samples. G-Rf content, sum of G-Rf and G-Rh1 were, respectively, 0.08-0.18 and 0.14-0.32 for 2- or 3-year-old rhizomes, and 0.01-0.07 and 0.03-0.10 for 2- or 3-year-old main roots. Combined contents of N-R1, G-Rg1 and G-Rb1 were 5.78-9.37 in 3-year-old main roots, and 2.99-7.13 in 2-year-old main roots, of which nearly one-third of samples were lower than the limit (5 %) in the Chinese Pharmacopoeia. Those of 2- or 3-year-old fibrous roots (1.47-3.83) and 1-year-old whole roots (1.41-2.44) were much lower than the limit, and were considered not suitable for use as Notoginseng. Two-year-old main roots are not appropriate for collection as Notoginseng. Different parts and growth years of P. notoginseng can be identified from each another according to differences in saponin content.

  11. Human rotavirus strains circulating in Venezuela after vaccine introduction: predominance of G2P[4] and reemergence of G1P[8].

    PubMed

    Vizzi, Esmeralda; Piñeros, Oscar A; Oropeza, M Daniela; Naranjo, Laura; Suárez, José A; Fernández, Rixio; Zambrano, José L; Celis, Argelia; Liprandi, Ferdinando

    2017-03-21

    Rotavirus (RV) is the most common cause of severe childhood diarrhea worldwide. Despite Venezuela was among the first developing countries to introduce RV vaccines into their national immunization schedules, RV is still contributing to the burden of diarrhea. Concerns exist about the selective pressure that RV vaccines could exert on the predominant types and/or emergence of new strains. To assess the impact of RV vaccines on the genotype distribution 1 year after the vaccination was implemented, a total of 912 fecal specimens, collected from children with acute gastroenteritis in Caracas from February 2007 to April 2008, were screened, of which 169 (18.5%) were confirmed to be RV positive by PAGE. Rotavirus-associated diarrhea occurred all year-round, although prevailed during the coolest and driest months among unvaccinated children under 24 months old. Of 165 RV strains genotyped for G (VP7) and P (VP4) by seminested multiplex RT-PCR, 77 (46.7%) were G2P[4] and 63 (38.2%) G1P[8]. G9P[8], G3P[8] and G2P[6] were found in a lower proportion (7.3%). Remarkable was also the detection of <5% of uncommon combinations (G8P[14], G8P[4], G1P[4] and G4P[4]) and 3.6% of mixed infections. A changing pattern of G/P-type distribution was observed during the season studied, with complete predominance of G2P[4] from February to June 2007 followed by its gradual decline and the reemergence of G1P[8], predominant since January 2008. Phylogenetic analysis of VP7 and VP4 genes revealed a high similarity among G2P[4] and global strains belonging to G2-II and P[4]-V lineages. The amino acid substitution 96D → N, related with reemergence of the G2 genotype elsewhere, was observed. The G1P[8] strains from Caracas were grouped into the lineages G1-I and P[8]-III, along with geographically remote G1P[8] rotaviruses, but they were rather distant from Rotarix ® vaccine and pre-vaccine strains. Unique amino acid substitutions observed on neutralization domains of the VP7 sequence from Venezuelan post-vaccine G1P[8] could have conditioned their re-emergence and a more efficient dissemination into susceptible population. The results suggest that natural fluctuations of genotypes in combination with forces driving the genetic evolution could determine the spread of novel strains, whose long-term effect on the efficacy of available vaccines should be determined.

  12. The Biology of IgG Subclasses and Their Clinical Relevance to Transplantation.

    PubMed

    Valenzuela, Nicole M; Schaub, Stefan

    2018-01-01

    Immunoglobulin G (IgG) is the dominant immunoglobulin and can be divided into 4 distinct subclasses. The evolution of IgG subclass switches is regulated by interaction with T cells and follows a 1-way direction (IgG3 → IgG1 → IgG2 → IgG4). Based on their structure, the 4 IgG subclasses can initiate different effector function such as complement activation, recruitment of various cells by Fc receptors, and agonistic signaling. Using current assays for HLA antibody detection as a template and replacing the generic reporter antibody with IgG subclass-specific reporter antibodies, it is possible to investigate the IgG subclasses of HLA antibodies. There are 15 different IgG subclass compositions possible. Based on the capability to activate the complement system and the class switch direction, 3 arbitrary patterns can be defined (ie, only complement-binding subclasses [IgG3 and/or IgG1], expansion to noncomplement-binding subclasses [IgG3 and/or IgG1 plus IgG2 and/or IgG4], and switch to noncomplement-binding subclasses [IgG2 and/or IgG4]). The latter group accounts for less than 5%, whereas the former 2 groups have a similar prevalence close to 50%. In the past 5 years, several studies correlated the IgG subclass pattern with occurrence of antibody-mediated rejection and allograft outcomes. Because of differences of the used IgG subclass assay, the time point of analyses, and the definition of outcomes, a clear picture has not emerged yet. Future needs are standardization of the assay, a more detailed knowledge of the initiated effector functions, and more well-designed clinical studies also looking at changes of the IgG subclass pattern over time.

  13. Effect on the lipid parameters of an intervention to reduce weight in overweight and obese patients.

    PubMed

    Tárraga Marcos, M Loreto; Panisello Royo, Josefa María; Carbayo Herencia, Julio A; Rosich Domenech, Nuria; Alins Presas, Josep; Tárraga López, Pedro J

    To assess the effect on lipid parameters most associated with excess weight (triglycerides [TG], cholesterol, and high density lipoprotein [HDL-C]) of an intervention to reduce weight in overweight and obese patients. A randomised, controlled, double blind clinical trial, with three groups, and a follow-up of 12 months. Patients included in the study were randomised into three intervention groups: Obesity motivational intervention group with previously trained nurse (G1), lower intensity consultation, non-motivational group, with digital platform support (G2), and a third group that received a recommendation to lose weight and usual follow-up (G3). The anthropometric variables measured were height, weight, and abdominal/waist circumference, and laboratory results, total cholesterol, TG and HDL cholesterol). The study include 176 patients, of whom 60 were randomised to G1, 61 to G2, and 59 to G3. All groups significantly decreased body weight at the end of the study, with a decrease in G1 (-5.6kg), followed by G2 (-4.3kg), and G3 (-1.7kg), with an overall mean loss of -3.9kg. There was a also significant decrease (P<.05) in total cholesterol and TG, and an increased HDL-C. These changes were more marked in the G1 group (the group that lost more weight). The clinical relevance indicators that were significant were: in the case of TG: G1/G3: relative risk: 1.42 (95% CI: 1.11-1.80); relative risk reduction: 41.7% (11.4-80.2); absolute risk reduction: 25% (9.2-40.8) and NNT: 5 (3-11). In the case of G1/G2 HDL-C: relative risk: 1.32 (1.07-1.63); relative risk reduction: 32.2% (7.4-62.6); absolute risk reduction: 21.1% (6.4-35.8) and NNT: 5 (3-16). Weight reduction is accompanied by favorable changes in the lipid parameters related to overweight and obesity, being more intense the greater the weight loss. Copyright © 2017 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

  14. Clitoral stimulation modulates appetitive sexual behavior and facilitates reproduction in rats.

    PubMed

    Cibrian-Llanderal, Tamara; Tecamachaltzi-Silvaran, Miriam; Triana-Del Rio, Rodrigo; Pfaus, James G; Manzo, Jorge; Coria-Avila, Genaro A

    2010-05-11

    In rats, sexual reward, appetitive sexual behaviors and reproduction are modulated by the amount and rate of vaginocervical stimulation. Here the effect of clitoral stimulation (CLS) on proceptivity was assessed. In Exp 1, ovariectomized, hormone-primed Wistar females formed three groups: G1 (1 CLS every second), G2 (1 CLS every 5s) and G3 (no CLS). Precopulatory CLS consisted of 5cycles of 1min of stimulation with the tip of a cotton swab connected to a vibrator device, followed by 1-2min of rest. CLS increased proceptive behavior in G1 compared to G2, but not compared to G3. In Exp 2, gonadally-intact rats in late proestrous received CLS prior to copulation. No differences in sexual behavior were detected between the groups, but CLS enhanced reproduction in females that received >9 intromissions. 28, 66 and 10% of females became pregnant in G1, G2, and G3, respectively. These data indicate that precopulatory CLS affects proceptive behaviors depending on the pattern and rhythm of stimulation in hormone-primed females. In virgin rats that have received sufficient vagino cervical stimulation CLS also increases fertility. Copyright 2010 Elsevier Inc. All rights reserved.

  15. Lifetime Occupation and Late-Life Cognitive Performance Among Women.

    PubMed

    Ribeiro, Pricila Cristina Correa; Lourenço, Roberto Alves

    2015-01-01

    We examined whether women who had regular jobs throughout life performed better cognitively than older adult housewives. Linear regression was used to compare global cognitive performance scores of housewives (G1) and women exposed to work of low (G2) and high (G3) complexity. The sample comprised 477 older adult Brazilian women, 430 (90.4%) of whom had performed lifelong jobs. In work with data, the G2 group's cognitive performance scores were 1.73 points higher (p =.03), and the G3 group scored 1.76 points (p =.02) higher, than the G1. In work with things and with people, the G3 scored, respectively, 2.04 (p <.01) and 2.21 (p <.01) cognitive test points higher than the G1. Based on our findings we suggest occupation of greater complexity is associated with better cognitive performance in women later in life.

  16. Effects of aerobic exercise on the blood pressure, oxidative stress and eNOS gene polymorphism in pre-hypertensive older people.

    PubMed

    Zago, Anderson Saranz; Park, Joon-Young; Fenty-Stewart, Nicola; Silveira, Leonardo Reis; Kokubun, Eduardo; Brown, Michael D

    2010-11-01

    The polymorphisms of endothelial nitric oxide synthase (eNOS) are associated with reduced eNOS activity. Aerobic exercise training (AEX) may influence resting nitric oxide (NO) production, oxidative stress and blood pressure. The purpose of this study was to investigate the effect of AEX on the relationship among blood pressure, eNOS gene polymorphism and oxidative stress in pre-hypertensive older people. 118 pre-hypertensive subjects (59 ± 6 years) had blood samples collected after a 12 h overnight fast for assessing plasma NO metabolites (NOx) assays, thiobarbituric acid reactive substances (T-BARS) and superoxide dismutase activity (ecSOD). eNOS polymorphism (T-786C and G-894T) was done by standard PCR methods. All people were divided according to the genotype results (G1: TT/GG, G2: TT/GT + TT, G3: TC + CC/GG, G4: TC + CC/GT + TT). All parameters were measured before and after 6 months of AEX (70% of VO(2 max)). At baseline, no difference was found in systolic and diastolic blood pressure, ecSOD and T-BARS activity. Plasma NOx levels were significantly different between G1 (19 ± 1 μM) and G4 (14.2 ± 0.6 μM) and between G2 (20.1 ± 1.7 μM) and G4 (14.2 ± 0.6 μM). Therefore, reduced NOx concentration in G4 group occurred only when the polymorphisms were associated, suggesting that these results are more related to genetic factors than NO-scavenging effect. After AEX, the G4 increased NOx values (17.2 ± 1.2 μM) and decreased blood pressure. G1, G3 and G4 decreased T-BARS levels. These results suggest the AEX can modulate the NOx concentration, eNOS activity and the relationship among eNOS gene polymorphism, oxidative stress and blood pressure especially in C (T-786C) and T (G-894T) allele carriers.

  17. The activation of G protein-coupled estrogen receptor induces relaxation via cAMP as well as potentiates contraction via EGFR transactivation in porcine coronary arteries

    PubMed Central

    Yu, Xuan; Stallone, John N.; Heaps, Cristine L.

    2018-01-01

    Estrogen exerts protective effects against cardiovascular diseases in premenopausal women, but is associated with an increased risk of both coronary heart disease and stroke in older postmenopausal women. Studies have shown that activation of the G-protein-coupled estrogen receptor 1 (GPER) can cause either relaxation or contraction of arteries. It is highly likely that these dual actions of GPER may contribute to the seemingly paradoxical effects of estrogen in regulating coronary artery function. The objective of this study was to test the hypothesis that activation of GPER enhances agonist-stimulated porcine coronary artery contraction via epidermal growth factor receptor (EGFR) transactivation and its downstream extracellular signal-regulated kinases (ERK1/2) pathway. Isometric tension studies and western blot were performed to determine the effect of GPER activation on coronary artery contraction. Our findings demonstrated that G-1 caused concentration-dependent relaxation of ET-1-induced contraction, while pretreatment of arterial rings with G-1 significantly enhanced ET-1-induced contraction. GPER antagonist, G-36, significantly inhibited both the G-1-induced relaxation effect and G-1-enhanced ET-1 contraction. Gallein, a Gβγ inhibitor, significantly increased G-1-induced relaxation, yet inhibited G-1-enhanced ET-1-mediated contraction. Similarly, inhibition of EGFR with AG1478 or inhibition of Src with phosphatase 2 further increased G-1-induced relaxation responses in coronary arteries, but decreased G-1-enhanced ET-1-induced contraction. Western blot experiments in porcine coronary artery smooth muscle cells (PCASMC) showed that G-1 increased tyrosine phosphorylation of EGFR, which was inhibited by AG-1478. Furthermore, enzyme-linked immunosorbent assays showed that the level of heparin-binding EGF (HB-EGF) released by ET-1 treatment increased two-fold; whereas pre-incubation with G-1 further increased ET-1-induced HB-EGF release to four-fold over control conditions. Lastly, the role of ERK1/2 was determined by applying the MEK inhibitor, PD98059, in isometric tension studies and detecting phospho-ERK1/2 in immunoblotting. PD98059 potentiated G-1-induced relaxation response, but blocked G-1-enhanced ET-1-induced contraction. By western blot, G-1 treatment decreased phospho-ERK1/2, however, in the presence of the adenylyl cyclase inhibitor, SQ22536, G-1 significantly increased ERK1/2 phosphorylation in PCASMC. These data demonstrate that activation of GPER induces relaxation via cAMP as well as contraction via a mechanism involving transactivation of EGFR and the phosphorylation of ERK1/2 in porcine coronary arteries. PMID:29360846

  18. Role of immunoglobulin G subclasses in Q fever.

    PubMed

    Camacho, M T; Outschoorn, I; Tellez, A

    1995-12-01

    The progression of Q fever to either acute or chronic disease has been attributed both to biological characteristics of the bacteria and to the host immune response. In order to determine whether a specific immunoglobulin G (IgG) subclass distribution could play a diagnostic or prognostic role in Q fever, IgG subclass levels were measured in patients with acute or chronic disease. It was observed that (i) IgG1 and IgG3 levels were elevated in patients with chronic Q fever compared to patients with acute disease or normal controls; (ii) variations over time reflected inverse complementary relationships of subclass levels, such as between IgG1 and IgG3 compared with IgG2 and IgG4, or an inverse relationship between IgG1 and IgG2; (iii) variations in IgG2 and IgG3 total subclass levels during follow-up of patients with chronic Q fever showed a decrease in IgG2 with a concomitant increase in IgG3 two years from disease onset. These findings indicate that measurements of IgG subclasses may be a simple, additional tool useful in the diagnosis of Q fever. This data raises the question of an unusual immunoregulatory mechanism in Q fever that is implicated in the presentation of the clinical disease.

  19. Morphology controlled MnO2 electrodeposited on carbon fiber paper for high-performance supercapacitors

    NASA Astrophysics Data System (ADS)

    Ye, Zhiguo; Li, Tao; Ma, Guang; Peng, Xinyuan; Zhao, Jun

    2017-05-01

    Four different morphologies of nanostructured MnO2 (nanospheres, nanosheets, nanoflowers and nanonods) were fabricated on a carbon fiber paper (CFP) substrate using a facile method of anodic electrodeposition by varying the H2SO4 concentration and current density. The fabricated composite electrodes were characterized by field emission scanning electron microscopy (FESEM), X-ray diffraction (XRD) and electrochemical techniques. The composite electrodes with MnO2 nanosphere/CFP, MnO2 nanosheet/CFP, MnO2 nanoflower/CFP and MnO2 nanonod/CFP achieved a relatively high specific capacitance (areal capacitance) of 134.4 F g-1 (0.20 F cm-2), 226.3 F g-1 (0.33 F cm-2), 235.6 F g-1 (0.35 F cm-2) and 362.5 F g-1 (0.54 F cm-2) at 0.5 A g-1, respectively. When the GV charging-discharging rate increased from 0.5 to 5 A g-1, the MnO2 nanorod/CFP composite decreased from 362.5 F g-1 (0.54 F cm-2) to 160.0 F g-1 (0.24 F cm-2), which is a relatively high retention of the original capacitance (i.e., 44.1%). All the composite electrodes with various nanostructured MnO2 morphologies under flat and bent states retained more than 95% and 90% of the initial capacitance after 5000 cycles at 5 A g-1, respectively, which demonstrates outstanding cycling stability. This study provides a novel approach for high-performance, morphology-controllable metal oxide electrodes for supercapacitors.

  20. Application of Monoclonal Antibodies in Functional and Comparative Investigations of Heavy-Chain Immunoglobulins in New World Camelids

    PubMed Central

    Daley, L. P.; Gagliardo, L. F.; Duffy, M. S.; Smith, M. C.; Appleton, J. A.

    2005-01-01

    Of the three immunoglobulin G (IgG) isotypes described to occur in camelids, IgG2 and IgG3 are distinct in that they do not incorporate light chains. These heavy-chain antibodies (HCAbs) constitute approximately 50% of the IgG in llama serum and as much as 75% of the IgG in camel serum. We have produced isotype-specific mouse monoclonal antibodies (MAbs) in order to investigate the roles of HCAbs in camelid immunity. Seventeen stable hybridomas were cloned, and three MAbs that were specific for epitopes on the γ chains of llama IgG1, IgG2, or IgG3 were characterized in detail. Affinity chromatography revealed that each MAb bound its isotype in solution in llama serum. The antibodies bound to the corresponding alpaca IgGs, to guanaco IgG1 and IgG2, and to camel IgG1. Interestingly, anti-IgG2 MAbs bound three heavy-chain species in llama serum, confirming the presence of three IgG2 subisotypes. Two IgG2 subisotypes were detected in alpaca and guanaco sera. The MAbs detected llama serum IgGs when they were bound to antigen in enzyme-linked immunosorbent assays and were used to discern among isotypes induced during infection with a parasitic nematode. Diseased animals, infected with Parelaphostrongylus tenuis, did not produce antigen-specific HCAbs; rather, they produced the conventional isotype, IgG1, exclusively. Our data document the utility of these MAbs in functional and physiologic investigations of the immune systems of New World camelids. PMID:15753251

  1. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids.

    PubMed

    Daley, L P; Gagliardo, L F; Duffy, M S; Smith, M C; Appleton, J A

    2005-03-01

    Of the three immunoglobulin G (IgG) isotypes described to occur in camelids, IgG2 and IgG3 are distinct in that they do not incorporate light chains. These heavy-chain antibodies (HCAbs) constitute approximately 50% of the IgG in llama serum and as much as 75% of the IgG in camel serum. We have produced isotype-specific mouse monoclonal antibodies (MAbs) in order to investigate the roles of HCAbs in camelid immunity. Seventeen stable hybridomas were cloned, and three MAbs that were specific for epitopes on the gamma chains of llama IgG1, IgG2, or IgG3 were characterized in detail. Affinity chromatography revealed that each MAb bound its isotype in solution in llama serum. The antibodies bound to the corresponding alpaca IgGs, to guanaco IgG1 and IgG2, and to camel IgG1. Interestingly, anti-IgG2 MAbs bound three heavy-chain species in llama serum, confirming the presence of three IgG2 subisotypes. Two IgG2 subisotypes were detected in alpaca and guanaco sera. The MAbs detected llama serum IgGs when they were bound to antigen in enzyme-linked immunosorbent assays and were used to discern among isotypes induced during infection with a parasitic nematode. Diseased animals, infected with Parelaphostrongylus tenuis, did not produce antigen-specific HCAbs; rather, they produced the conventional isotype, IgG1, exclusively. Our data document the utility of these MAbs in functional and physiologic investigations of the immune systems of New World camelids.

  2. Effect of desiccation on the dynamics of genome-wide DNA methylation in orthodox seeds of Acer platanoides L.

    PubMed

    Plitta, Beata P; Michalak, Marcin; Bujarska-Borkowska, Barbara; Barciszewska, Mirosława Z; Barciszewski, Jan; Chmielarz, Paweł

    2014-12-01

    5-methylcytosine, an abundant epigenetic mark, plays an important role in the regulation of plant growth and development, but there is little information about stress-induced changes in DNA methylation in seeds. In the present study, changes in a global level of m5C were measured in orthodox seeds of Acer platanoides L. during seed desiccation from a WC of 1.04 to 0.05-0.06 g H2O g g(-1) dry mass (g g(-1)). Changes in the level of DNA methylation were measured using 2D TLC e based method. Quality of desiccated seeds was examined by germination and seedling emergence tests. Global m5C content (R2)increase was observed in embryonic axes isolated from seeds collected at a high WC of 1.04 g g(-1) after their desiccation to significantly lower WC of 0.17 and 0.19 g g(-1). Further desiccation of these seeds to a WC of 0.06 g g(-1), however, resulted in a significant DNA demethylation to R2 ¼ 11.52-12.22%. Similar m5C decrease was observed in seeds which undergo maturation drying on the tree and had four times lower initial WC of 0.27 g g(-1) at the time of harvest, as they were dried to a WC of 0.05 g g(-1). These data confirm that desiccation induces changes in seed m5C levels. Results were validated by seed lots derived from tree different A. platanoides provenances. It is plausible that sine wave-like alterations in m5C amount may represent a specific response of orthodox seeds to drying and play a relevant role in desiccation tolerance in seeds.

  3. Rotavirus Surveillance in Kisangani, the Democratic Republic of the Congo, Reveals a High Number of Unusual Genotypes and Gene Segments of Animal Origin in Non-Vaccinated Symptomatic Children

    PubMed Central

    Heylen, Elisabeth; Batoko Likele, Bibi; Zeller, Mark; Stevens, Stijn; De Coster, Sarah; Conceição-Neto, Nádia; Van Geet, Christel; Jacobs, Jan; Ngbonda, Dauly; Van Ranst, Marc; Matthijnssens, Jelle

    2014-01-01

    Group A rotavirus (RVA) infections form a major public health problem, especially in low-income countries like the Democratic Republic of the Congo (COD). However, limited data on RVA diversity is available from sub-Saharan Africa in general and the COD in particular. Therefore, the first aim of this study was to determine the genetic diversity of 99 RVAs detected during 2007–2010 in Kisangani, COD. The predominant G-type was G1 (39%) and the most predominant P-type was P[6] (53%). A total of eight different G/P-combinations were found: G1P[8] (28%), G8P[6] (26%), G2P[4] (14%), G12P[6] (13%), G1P[6] (11%), G9P[8] (4%), G4P[6] (2%) and G8P[4] (1%). The second aim of this study was to gain insight into the diversity of P[6] RVA strains in the COD. Therefore, we selected five P[6] RVA strains in combination with the G1, G4, G8 (2x) or G12 genotype for complete genome analysis. Complete genome analysis showed that the genetic background of the G1P[6] and G12P[6] strains was entirely composed of genotype 1 (Wa-like), while the segments of the two G8P[6] strains were identified as genotype 2 (DS-1-like). Interestingly, all four strains possessed a NSP4 gene of animal origin. The analyzed G4P[6] RVA strain was found to possess the unusual G4-P[6]-I1-R1-C1-M1-A1-N1-T7-E1-H1 constellation. Although the majority of its genes (if not all), were presumably of porcine origin, this strain was able to cause gastro-enteritis in humans. The high prevalence of unusual RVA strains in the COD highlights the need for continued surveillance of RVA diversity in the COD. These results also underline the importance of complete genetic characterization of RVA strains and indicate that reassortments and interspecies transmission among human and animal RVAs strains occur regularly. Based on these data, RVA vaccines will be challenged with a wide variety of different RVA strain types in the COD. PMID:24968018

  4. Etidronate causes minimal changes in the ability of sodium hypochlorite to dissolve organic matter.

    PubMed

    Tartari, T; Guimarães, B M; Amoras, L S; Duarte, M A H; Silva e Souza, P A R; Bramante, C M

    2015-04-01

    To evaluate the effect of individual and combined use of sodium hypochlorite (NaOCl), etidronate (HEDP) and ethylenediaminetetraacetic acid (EDTA) in tissue dissolution. Sixty fragments of bovine muscle tissue were prepared and their weights determined on a precision scale. The samples were then distributed in the following groups (n = 10): G1 - saline solution (control); G2 - 17% EDTA; G3 - 18% HEDP; G4 - 2.5% NaOCl; G5 - mixture of 5% NaOCl + 17% EDTA; and G6 - mixture of 5% NaOCl + 18% HEDP. The specimens in each group were immersed in the solutions for 5, 10 and 15 min and reweighted at each time period. Analysis of variance (anova) and Tukey's multiple-comparison tests (α<0.05) were applied to identify the intragroup and intergroup differences. G1, G2, G3 and G5 did not dissolve the organic matter. G4 and G6 significantly reduced the weights of specimens at all periods. Amongst the groups, the difference in ability to dissolve organic matter was greater and significant in the following order G4 = G6 > G5 = G3 = G2 = G1 after 5 min of immersion and G4 > G6 > G5 = G3 = G2 = G1 after 10 and 15 min of immersion. The only solution capable of dissolving organic matter was NaOCl. In the mixtures analysed, this ability was arrested by EDTA; however, it was minimally affected by the HEDP, proving that this combination, if used during the biomechanical preparation, is able to dissolve of organic matter. © 2014 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  5. Lipid biomarker patterns of methane-derived carbonates from Dongsha area, the northern of South China Sea

    NASA Astrophysics Data System (ADS)

    Yu, X.; Lei, J.; Yang, K.; Fang, Y.

    2012-12-01

    Carbonate and sediment samples collected from the Dongsha area the South China by TV-grab. The δ13C values of the carbonate indicate that the carbonate carbon is mainly derived from the oxidation of methane. According to the δ13C value of two groups carbonates could be divided: Group1 (G1) is 13C-depleted as reported previously, the δ13C value lighter than -50‰ PDB; group2 (G2) is enriched in 13C relatively, the δ13C value is around -30‰PDB. The δ13C value of sediments associated with carbonate varying from -19.2 to -30.4‰PDB. G1 and G2 have similar n-alkanes distribution and with 13C-depleted PMI, but glycerol dialkyl glycerol tetraethers (GDGTs) patterns obviously different. The G1 with the higher GDGTs concentration, up to 0.37 ug/g (dry weight), and the isoprenoid GDGTs is dominantly, with a acyclic > monocyclic > bicyclic > tricyclic > tetracyclic biphytane distribution, the branch GDGTs is less than 2%. The G2 with the quite lower GDGTs concentration, varying from 0.025~0.063ug/g (dry weight), the isoprenoid GDGTs content is less than 70%, with a acyclic > tetracyclic > bicyclic > monocyclic > tricyclic biphytane distribution, the branch GDGT is more than 30%. The sediment associated with carbonate has the similar GDGTs pattern with the G2, but the GDGTs concentration is between G1 and G2. The molecular structure and their carbon isotopic composition suggest that the organism mainly derived from methane oxidizing archaea and more carbonate precipitation by AOM within the G1 carbonates. Meanwhile, partly organism derived from crenachaeol and terrestrial, some carbonate precipitation originated from water column within the G2 carbonates. The G2 carbonates contain the similar biomarkers as found in nearby sediments, suggesting that the organisms associated with carbonate precipitation are the similar

  6. Influence of loading forces on the vertical accuracy of interocclusal records.

    PubMed

    Ghazal, Muhamad; Kern, Matthias

    2010-02-01

    To evaluate the influence of loading forces on the vertical discrepancies caused by interocclusal recording materials. A custom-made apparatus was used to simulate the maxilla and mandible. Eight interocclusal records were made in each of the following groups: G1-Aluwax (aluminum wax; Aluwax), G2-Beauty Pink wax (hydrocarbon wax compound; Miltex), G3-Futar D, G4-Futar D Fast, G5-Futar Scan (polyvinyl siloxanes; Kettenbach), and G6-Ramitec (polyether; 3M ESPE). The vertical discrepancies were measured by an inductive displacement transducer connected to a carrier frequency amplifier after storage of the records for 1 hour at room temperature. Different compressive loading forces up to 1 kg were applied onto the upper part of the apparatus to evaluate the influence on the vertical discrepancies of the records. Two-way ANOVA was used for statistical analysis. The compressive loading force had a statistically significant influence on the vertical discrepancies (P<.01) (ie, higher forces reduced the vertical discrepancies). When a compressive force of 1 kg was applied to the upper part of the apparatus, the mean vertical discrepancies for G1 (11+/-3 microm) and G2 (12+/-3 microm) were statistically significantly higher than in groups G3 (1+/-1 microm), G4 (2+/-1 microm), G5 (0+/-1 microm), and G6 (-2+/-2 microm). A compressive force of 1 kg could be used to stabilize the cast during mounting procedures in an articulator using an interocclusal record made of polyvinyl siloxane without vertically changing the interocclusal relationships.

  7. LASER APPLICATIONS AND OTHER TOPICS IN QUANTUM ELECTRONICS: An optical boiler generating singlet oxygen O2 (a1Δg)

    NASA Astrophysics Data System (ADS)

    Lipatov, N. I.; Biryukov, A. S.; Gulyamova, E. S.

    2008-12-01

    An ecologically perfect generator of singlet oxygen O2 (a1Δg) is proposed which fundamentally differs from existing singlet-oxygen generators. Excited O2 (a1Δg) molecules are generated due to interaction of the O2 (X3Σ-g) molecules with a quasi-monochromatic field, which is supplied from an external source to a closed volume — an optical boiler containing oxygen. It is shown that, by pumping continuously the optical boiler by the light field of power ~3×105 W, it is possible to accumulate up to 40% of singlet oxygen (O2(b1Σ+g)) + (O2 (a1Δg)) in the boiler volume during ~10-2 s.

  8. The Bone-specific Expression of Runx2 Oscillates during the Cell Cycle to Support a G1-related Antiproliferative Function in Osteoblasts*

    PubMed Central

    Galindo, Mario; Pratap, Jitesh; Young, Daniel W.; Hovhannisyan, Hayk; Im, Hee-Jeong; Choi, Je-Yong; Lian, Jane B.; Stein, Janet L.; Stein, Gary S.; van Wijnen, Andre J.

    2010-01-01

    The Runx2 (CBFA1/AML3/PEBP2αA) transcription factor promotes skeletal cell differentiation, but it also has a novel cell growth regulatory activity in osteoblasts. We addressed here whether Runx2 activity is functionally linked to cell cycle-related mechanisms that control normal osteoblast proliferation and differentiation. We found that the levels of Runx2 gene transcription, mRNA and protein, are each up-regulated with cessation of cell growth (i.e. G0/G1 transition) in preconfluent MC3T3 osteoblastic cells that do not yet express mature bone phenotypic gene expression. Cell growth regulation of Runx2 is also observed in primary calvarial osteoblasts and other osteoblastic cells with relatively normal cell growth characteristics, but not in osteosarcoma cells (e.g. SAOS-2 and ROS17/2.8). Runx2 levels are cell cycle-regulated in MC3T3 cells with respect to the G1/S and M/G1 transitions: expression oscillates from maximal levels during early G1 to minimal levels during early S phase and mitosis. However, in normal or immortalized (e.g. ATDC5) chondrocytic cells, Runx2 expression is suppressed during quiescence, and Runx2 levels are not regulated during G1 and S phase in ATDC5 cells. Antisense or small interfering RNA-mediated reduction of the low physiological levels of Runx2 in proliferating MC3T3 cells does not accelerate cell cycle progression. However, forced expression of Runx2 suppresses proliferation of MC3T3 preosteoblasts or C2C12 mesenchymal cells which have osteogenic potential. Forced elevation of Runx2 in synchronized MC3T3 cells causes a delay in G1. We propose that Runx2 levels and function are biologically linked to a cell growth-related G1 transition in osteoblastic cells. PMID:15781466

  9. Gingival enlargement in orthodontic patients: Effect of treatment duration.

    PubMed

    Pinto, Alice Souza; Alves, Luana Severo; Zenkner, Júlio Eduardo do Amaral; Zanatta, Fabrício Batistin; Maltz, Marisa

    2017-10-01

    In this study, we aimed to assess the effect of the duration of fixed orthodontic treatment on gingival enlargement (GE) in adolescents and young adults. The sample consisted of 260 subjects (ages, 10-30 years) divided into 4 groups: patients with no fixed orthodontic appliances (G0) and patients undergoing orthodontic treatment for 1 year (G1), 2 years (G2), or 3 years (G3). Participants completed a structured questionnaire on sociodemographic characteristics and oral hygiene habits. Clinical examinations were conducted by a calibrated examiner and included the plaque index, the gingival index, and the Seymour index. Poisson regression models were used to assess the association between group and GE. We observed increasing means of plaque, gingivitis, and GE in G0, G1, and G2. No significant differences were observed between G2 and G3. Adjusted Poisson regression analysis showed that patients undergoing orthodontic treatment had a 20 to 28-fold increased risk for GE than did those without orthodontic appliances (G1, rate ratio [RR] = 20.2, 95% CI = 9.0-45.3; G2, RR = 27.0, 95% CI = 12.1-60.3; G3 = 28.1; 95% CI = 12.6-62.5). The duration of orthodontic treatment significantly influenced the occurrence of GE. Oral hygiene instructions and motivational activities should target adolescents and young adults undergoing orthodontic treatment. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

  10. Estimation of total glomerular number in stable renal transplants.

    PubMed

    Fulladosa, Xavier; Moreso, Francesc; Narváez, Jose A; Grinyó, Josep M; Serón, Daniel

    2003-10-01

    Glomerular number (N(g)) is considered a major determinant of renal function and outcome. In the dog, it has been shown that Ng can be estimated with reasonable precision in vivo by means of a renal biopsy and magnetic resonance imaging (MRI). Thus, this method was applied to study anatomoclinical correlations in stable human renal transplants. Thirty-nine stable renal transplants were included. A protocol renal allograft biopsy was done at 4 mo. Biopsies were evaluated according to Banff criteria. Glomerular volume fraction (Vv(glom/cortex)) was measured by means of a point-counting method, and mean glomerular volume (V(g)) was estimated by means of Weibel and Gomez (V(g)-W&G) and maximal profile area (V(g)-MPA) methods. MRI was used to estimate renal cortical volume (V(cortex)). N(g) was calculated as (Vv(glom/cortex) x V(cortex))/V(g). GFR was estimated by the inulin clearance. Ten age-matched donor biopsies served as controls for V(g). Histologic diagnosis was as follows: normal (n = 20), borderline (n = 7), acute rejection (n = 1), and chronic allograft nephropathy (n = 11). Vv(glom/cortex) was 3.4 +/- 1.1%, V(cortex) was 167 +/- 46 cm(3), V(g)-W&G was 3.2 +/- 1.2 x 10(6) micro m(3), and V(g)-MPA was 3.3 +/- 1.0 x 10(6) micro m(3). V(g)-W&G in donor and recipient biopsies was not different (3.6 +/- 1.1 versus 3.2 +/- 1.2 x 10(6) micro m(3)). Total glomerular number estimated by means of V(g)-W&G (N(g)-W&G) was 0.73 +/- 0.33 x 10(6) and by V(g)-MPA (N(g)-MPA) was 0.74 +/- 0.31 x 10(6). A positive correlation between GFR and N(g)-W&G (r = 0.47, P = 0.002) was observed. Furthermore, the older the donor, the higher V(g)-W&G (r = 0.37, P = 0.01) and the lower N(g)-W&G (r = -0.40, P = 0.01). Total glomerular number can be estimated in stable renal allografts by means of a renal biopsy and MRI. Our data show that N(g) depends on donor age and positively correlates with GFR.

  11. Visualizing Vpr-Induced G2 Arrest and Apoptosis

    PubMed Central

    Murakami, Tomoyuki; Aida, Yoko

    2014-01-01

    Vpr is an accessory protein of human immunodeficiency virus type 1 (HIV-1) with multiple functions. The induction of G2 arrest by Vpr plays a particularly important role in efficient viral replication because the transcriptional activity of the HIV-1 long terminal repeat is most active in G2 phase. The regulation of apoptosis by Vpr is also important for immune suppression and pathogenesis during HIV infection. However, it is not known whether Vpr-induced apoptosis depends on the ability of Vpr to induce G2 arrest, and the dynamics of Vpr-induced G2 arrest and apoptosis have not been visualized. We performed time-lapse imaging to examine the temporal relationship between Vpr-induced G2 arrest and apoptosis using HeLa cells containing the fluorescent ubiquitination-based cell cycle indicator2 (Fucci2). The dynamics of G2 arrest and subsequent long-term mitotic cell rounding in cells transfected with the Vpr-expression vector were visualized. These cells underwent nuclear mis-segregation after prolonged mitotic processes and then entered G1 phase. Some cells subsequently displayed evidence of apoptosis after prolonged mitotic processes and nuclear mis-segregation. Interestingly, Vpr-induced apoptosis was seldom observed in S or G2 phase. Likewise, visualization of synchronized HeLa/Fucci2 cells infected with an adenoviral vector expressing Vpr clearly showed that Vpr arrests the cell cycle at G2 phase, but does not induce apoptosis at S or G2 phase. Furthermore, time-lapse imaging of HeLa/Fucci2 cells expressing SCAT3.1, a caspase-3-sensitive fusion protein, clearly demonstrated that Vpr induces caspase-3-dependent apoptosis. Finally, to examine whether the effects of Vpr on G2 arrest and apoptosis were reversible, we performed live-cell imaging of a destabilizing domain fusion Vpr, which enabled rapid stabilization and destabilization by Shield1. The effects of Vpr on G2 arrest and subsequent apoptosis were reversible. This study is the first to characterize the dynamics of the morphological changes that occur during Vpr-induced G2 arrest and apoptosis. PMID:24466265

  12. A probabilistic intake model to estimate the impact of reformulation by the food industry among Irish consumers.

    PubMed

    Pigat, S; Connolly, A; Cushen, M; Cullen, M; O'Mahony, C

    2018-02-19

    This project quantified the impact that voluntary reformulation efforts of the food industry had on the Irish population's nutrient intake. Nutrient composition data on reformulated products were collected from 14 major food companies for two years, 2005 and 2012. Probabilistic intake assessments were performed using the Irish national food consumption surveys as dietary intake data. The nutrient data were weighted by market shares replacing existing food composition data for these products. The reformulation efforts assessed, significantly reduced mean energy intakes by up to 12 kcal/d (adults), 15 kcal/d (teens), 19 kcal/d (children) and 9 kcal/d (pre-schoolers). Mean daily fat intakes were reduced by up to 1.3 g/d, 1.3 g/d, 0.9 g/d and 0.6 g/d, saturated fat intakes by up to 1.7 g/d, 2.3 g/d, 1.8 g/d and 1 g/d, sugar intakes by up to 1 g/d, 2 g/d, 3.5 g/d and 1 g/d and sodium intakes by up to 0.6 g/d, 0.5 g/d, 0.2 g/d, 0.3 g/d for adults, teenagers, children and pre-school children, respectively. This model enables to assess the impact of industry reformulation amongst Irish consumers' nutrient intakes, using consumption, food composition and market share data.

  13. Condition Based Maintenance Technology Impacts Study for the Military Land Environment

    DTIC Science & Technology

    2014-08-01

    3a, 2g 3b,3m,3j,3e,3d,3f,3a,3c,3i 3c,3d,3h,3n 3d,3h 3e,3k,3i 3f,3h UNCLASSIFIED DSTO-RR-0404 UNCLASSIFIED 158 3g ,3c 3h,4b 3i,3m,3j,CBM...3e -> 3k 3i Egress of 2: 3n -> 3h 4b Egress of 2: 3k -> 3j 5c Egress of 2: 4d -> 3g 3c Egress of 1: 3a -> 2g Egress of 1: 1b -> 2g Egress...Ingress+Egress of 8: 2d 3b 3g 4d 4f -> 3c -> 3d 3h 3n Ingress+Egress of 7: 1b 2e 3a -> 2g -> 3b 2e 2c 2f Ingress+Egress of 7: 2a 2d 6b 6c -> 2b -> 3a

  14. High status of mercury and selenium in false killer whales (Pseudorca crassidens, Owen 1846) stranded on Southern South America: A possible toxicological concern?

    PubMed

    Cáceres-Saez, Iris; Haro, Daniela; Blank, Olivia; Aguayo Lobo, Anelio; Dougnac, Catherine; Arredondo, Cristóbal; Cappozzo, H Luis; Guevara, Sergio Ribeiro

    2018-05-01

    The study was carried out to determine Hg and Se concentrations in false killer whales stranded on the Estrecho de Magallanes, Chile, South America. Tissue samples of five mature specimens were analyzed (two females and three males). Mean Hg concentration in liver 1068 (234) μg g -1 dry weight (DW) (standard deviation in parenthesis) was markedly higher than those in kidney 272 (152) μg g -1 DW, lung 423 (325) μg g -1 DW, spleen 725 (696) μg g -1 DW, muscle 118 (94) μg g -1 DW and testicle 18.0 (2.8) μg g -1 DW. Mean Se concentration in liver, 398 (75) μg g -1 DW, was higher than those in kidney 162 (69) μg g -1 DW, lung 128 (84) μg g -1 DW, spleen 268 (245) μg g -1 DW, muscle 47 (38) μg g -1 DW and testicle 25.4 (2.1) μg g -1 DW. Positive correlations were found between Hg and Se molar concentrations in muscle, lung, spleen and kidney. Molar ratio of Se/Hg in liver, lung and muscle were <1, but those in kidney and testicle were markedly >1 suggesting a Se protection against Hg toxicity. In all the examined specimens Hg values exceeded the toxic thresholds defined for hepatic damage in marine mammals, with Se/Hg molar ratios below 1 implying limited protective action of Se. Generally, our results showed that individuals are carrying a significant burden, reflecting a high exposure to this toxic metal. This constitutes the first report on Hg and Se levels for a large subantarctic odontocete in South America region, providing insights into their contamination status and with information to the understanding of possible impacts on wild populations. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Aflatoxin (B1 , B2 , G1 , and G2 ) contamination in rice of Mexico and Spain, from local sources or imported.

    PubMed

    Suárez-Bonnet, Elena; Carvajal, Magda; Méndez-Ramírez, Ignacio; Castillo-Urueta, Pável; Cortés-Eslava, Josefina; Gómez-Arroyo, Sandra; Melero-Vara, José María

    2013-11-01

    Rice is an important cereal but it is often contaminated with aflatoxins (AFs). The purpose of this study was to identify and quantify AF (B1 , B2 , G1 , and G2 ) in 67 rice samples cultivated in Mexico and Spain, and from imported crops collected in 2008 and 2009. The methodology was validated, the rice samples were concentrated and purified with immunoaffinity columns and were quantified by high-pressure liquid chromatography (HPLC). The average total AF (AFt) in the Spanish rice was 37.3 μg/kg, the range was from 1.6 to 1383 μg/kg, the most contaminated samples being from San Juan de Aznalfarache, Sevilla (AFt = 138.6 μg/kg), from Tortosa, Tarragona (AFt = 104.6 μg/kg), and Calasparra, Murcia (AFt = 103.9 μg/kg). The rice imported from France to Spain had AFt of 26.6 μg/kg and from Pakistan AFt of 18.4 μg/kg, showing less AF contamination than the local one. The rice which originated from Mexico contained (AFt = 16.9 μg/kg), and those imported from the United States (AFt = 14.4 μg/kg) and Uruguay (AFt = 15.6 μg/kg). The imported rice had better quality in terms of the presence of AFs. © 2013 Institute of Food Technologists®

  16. Geohydrology of Test Well USW H-3, Yucca Mountain, Nye County, Nevada

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thordarson, W.; Rush, F.E.; Waddell, S.J.

    Test well USW H-3 is one of several test wells drilled in the southwestern part of the Nevada Test Site in cooperation with the US Department of Energy for investigations related to the isolation of high-level radioactive wastes. All rocks penetrated by the well to a total depth of 1219 meters are volcanic tuff of Tertiary age. The composite hydraulic head in the zone 751 to 1219 meters was 733 meters above sea level, and at a depth below land surface of 751 meters. Below a depth of 1190 meters, the hydraulic head was 754 meters above sea level ormore » higher, suggesting an upward component of groundwater flow at the site. The most transmissive part of the saturated zone is in the upper part of the Tram Member of the Crater Flat Tuff in the depth interval from 809 to 841 meters, with an apparent transmissivity of about 7 x 10{sup -1} meter squared per day. The remainder of the penetrated rocks in the saturated zone, 841 to 1219 meters, has an apparent transmissivity of about 4 x 10{sup -1} meter squared per day. The most transmissive part of the lower depth interval is in the bedded tuff and Lithic Ridge Tuff, in the depth interval from 1108 to 1120 meters. The apparent hydraulic conductivity of the rocks in the lower depth interval from 841 to 1219 meters commonly ranges from about 10{sup -1} to 10{sup -4} meter per day. 32 references, 20 figures, 4 tables.« less

  17. High resolution spectral analysis of oxygen. IV. Energy levels, partition sums, band constants, RKR potentials, Franck-Condon factors involving the X{sup 3}Σ{sub g}{sup −}, a{sup 1}Δ{sub g} and b{sup 1}Σ{sub g}{sup +} states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Shanshan, E-mail: shanshan.yu@jpl.nasa.gov; Drouin, Brian J.; Miller, Charles E.

    We have updated the isotopically invariant Dunham fit of O{sub 2} with newly reported literature transitions to derive (1) the energy levels, partition sums, band-by-band molecular constants, and RKR potentials for the X{sup 3}Σ{sub g}{sup −}, a{sup 1}Δ{sub g}, and b{sup 1}Σ{sub g}{sup +} states of the six O{sub 2} isotopologues: {sup 16}O{sup 16}O, {sup 16}O{sup 17}O, {sup 16}O{sup 18}O, {sup 17}O{sup 17}O, {sup 17}O{sup 18}O, and {sup 18}O{sup 18}O; (2) Franck-Condon factors for their a{sup 1}Δ{sub g}−X{sup 3}Σ{sub g}{sup −}, b{sup 1}Σ{sub g}{sup +}−X{sup 3}Σ{sub g}{sup −}, and a{sup 1}Δ{sub g}−b{sup 1}Σ{sub g}{sup +} band systems. This new spectroscopicmore » parameterization characterizes all known transitions within and between the X{sup 3}Σ{sub g}{sup −}, a{sup 1}Δ{sub g}, and b{sup 1}Σ{sub g}{sup +} states within experimental uncertainty and can be used for accurate predictions of as yet unmeasured transitions. All of these results are necessary to provide a consistent linelist of all transitions which will be reported in a followup paper.« less

  18. Developing recombinant HPA-1a–specific antibodies with abrogated Fcγ receptor binding for the treatment of fetomaternal alloimmune thrombocytopenia

    PubMed Central

    Ghevaert, Cedric; Wilcox, David A.; Fang, Juan; Armour, Kathryn L.; Clark, Mike R.; Ouwehand, Willem H.; Williamson, Lorna M.

    2008-01-01

    Fetomaternal alloimmune thrombocytopenia (FMAIT) is caused by maternal generation of antibodies specific for paternal platelet antigens and can lead to fetal intracranial hemorrhage. A SNP in the gene encoding integrin β3 causes a clinically important maternal-paternal antigenic difference; Leu33 generates the human platelet antigen 1a (HPA-1a), whereas Pro33 generates HPA-1b. As a potential treatment to prevent fetal intracranial hemorrhage in HPA-1a alloimmunized pregnancies, we generated an antibody that blocks the binding of maternal HPA-1a–specific antibodies to fetal HPA-1a1b platelets by combining a high-affinity human HPA-1a–specific scFv (B2) with an IgG1 constant region modified to minimize Fcγ receptor–dependent platelet destruction (G1Δnab). B2G1Δnab saturated HPA-1a+ platelets and substantially inhibited binding of clinical HPA-1a–specific sera to HPA-1a+ platelets. The response of monocytes to B2G1Δnab-sensitized platelets was substantially less than their response to unmodified B2G1, as measured by chemiluminescence. In addition, B2G1Δnab inhibited chemiluminescence induced by B2G1 and HPA-1a–specific sera. In a chimeric mouse model, B2G1 and polyclonal Ig preparations from clinical HPA-1a–specific sera reduced circulating HPA-1a+ platelets, concomitant with transient thrombocytopenia. As the Δnab constant region is uninformative in mice, F(ab′)2 B2G1 was used as a proof of principle blocking antibody and prevented the in vivo platelet destruction seen with B2G1 and polyclonal HPA-1a–specific antibodies. These results provide rationale for human clinical studies. PMID:18654666

  19. Chromium and zinc uptake by algae Gelidium and agar extraction algal waste: kinetics and equilibrium.

    PubMed

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2007-11-19

    Biosorption of chromium and zinc ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). Langmuir and Langmuir-Freundlich equilibrium models describe well the equilibrium data. The parameters of Langmuir equilibrium model at pH 5.3 and 20 degrees C were for the algae, q(L)=18 mg Cr(III)g(-1) and 13 mgZn(II)g(-1), K(L) = 0.021l mg(-1)Cr(III) and 0.026l mg(-1) Zn(II); for the algal waste, q(L)=12 mgCr(III)g(-1) and 7mgZn(II)g(-1), K(L)=0.033lmg(-1) Cr(III) and 0.042l mg(-1) Zn(II); for the composite material, q(L) = 9 mgCr(III)g(-1) and 6 mgZn(II)g(-1), K(L)=0.032l mg(-1)Cr(III) and 0.034l mg(-1)Zn(II). The biosorbents exhibited a higher preference for Cr(III) ions and algae Gelidium is the best one. The pseudo-first-order Lagergren and pseudo-second-order models fitted well the kinetic data for the two metal ions. Kinetic constants and equilibrium uptake concentrations given by the pseudo-second-order model for an initial Cr(III) and Zn(II) concentration of approximately 100 mgl(-1), at pH 5.3 and 20 degrees C were k(2,ads)=0.04 g mg(-1)Cr(III)min(-1) and 0.07 g mg(-1)Zn(II)min(-1), q(eq)=11.9 mgCr(III)g(-1) and 9.5 mgZn(II)g(-1) for algae; k(2,ads)=0.17 g mg(-1)Cr(III)min(-1) and 0.19 g mg(-1)Zn(II)min(-1), q(eq)=8.3 mgCr(III)g(-1) and 5.6 mgZn(II)g(-1) for algal waste; k(2,ads)=0.01 g mg(-1)Cr(III)min(-1) and 0.18 g mg(-1)Zn(II)min(-1), q(eq)=8.0 mgCr(III)g(-1) and 4.4 mgZn(II)g(-1) for composite material. Biosorption was modelled using a batch adsorber mass transfer kinetic model, which successfully predicts Cr(III) and Zn(II) concentration profiles. The calculated average homogeneous diffusivities, D(h), were 4.2 x 10(-8), 8.3 x 10(-8) and 1.4 x 10(-8)cm(2)s(-1) for Cr(III) and 4.8 x 10(-8), 9.7 x 10(-8) and 6.2 x 10(-8)cm(2)s(-1) for Zn(II), respectively, for Gelidium, algal waste and composite material. The algal waste has the lower intraparticle resistance.

  20. Li-Be-B Systematics of mantle Xenoliths from Harrat Uwayrid (Saudi Arabia)

    NASA Astrophysics Data System (ADS)

    Kaliwoda, M.; Altherr, R.

    2003-04-01

    The Harrat Uwayrid is a Late Miocene to Quaternary volcanic field located in the northwestern part of the Arabian plate and related to the opening of the Red Sea. Numerous cinder cones contain abundant mantle xenoliths. Based on mineralogy and textures, these xenoliths can be subdivided into 3 different groups. Group IA1 are "anhydrous" spinel lherzolites and harzburgites consisting of olivine (ol), orthopyroxene (opx), clinopyroxene (cpx) and spinel (spl). Group IA2 xenoliths represent group IA1 materials that were moderately metasomatized. In addition to cpx, opx, ol and spl these xenoliths contain subordinate amounts of Cr-pargasite (par). Group IB xenoliths were strongly metasomatized by fluids and fluid-rich melts resulting in newly formed Ba-phlogopite (phl), Ba-bearing pargasite, Ba-feldspar (celsian) and Ba-rich phonolitic glasses. Li-Be-B systematics of the different xenoliths were studied by secondary ion mass spectrometry (SIMS). The results show that the partitioning of Li, Be and B among the various minerals is virtually independent of pressure and temperature. The absolute abundances, however, depend on the degree of initial depletion and later metasomatic overprint. Group IA1 spinel lherzolites are characterized by Li(cpx) = 0.65-1.19 µg/g, Li(opx) = 1.29-1.63 µg/g and Li(ol) = 2.15-2.43 µg/g, while group IB xenoliths show much higher abundances of Li: Li(cpx) = 1.89-2.16 µg/g, Li(opx) = 1.88-2.83 µg/g, Li(ol) = 3.06-4.12 µg/g. Similar differences are observed for the abundances of B (IA1: B(cpx) = 0.46-0.83 µg/g, B(opx) = 0.047-0.189 µg/g, B(ol) = 0.16-1.15 µg/g; IB: B(cpx) = 0.16-1.15 µg/g, B(opx)= 1.01-1.47 µg/g, B(ol) = 0.44-0.55 µg/g). In marked contrast to Li and B, the abundances of Be were not changed during metasomatism. Group IA1 xenoliths are characterized by Be(cpx) = 0.09-0.13 µg/g, Be(opx) = 0.023-0.027 µg/g and Be(ol) = 0.002 µg/g and group IB xenoliths show Be(cpx) = 0.05-0.09 µg/g, Be(opx) = 0.03-0.08 µg/g and Be(ol) < 0.001 µg/g.

  1. Glucose 6-phosphate dehydrogenase deficiency enhances germ cell apoptosis and causes defective embryogenesis in Caenorhabditis elegans.

    PubMed

    Yang, H-C; Chen, T-L; Wu, Y-H; Cheng, K-P; Lin, Y-H; Cheng, M-L; Ho, H-Y; Lo, S J; Chiu, D T-Y

    2013-05-02

    Glucose 6-phosphate dehydrogenase (G6PD) deficiency, known as favism, is classically manifested by hemolytic anemia in human. More recently, it has been shown that mild G6PD deficiency moderately affects cardiac function, whereas severe G6PD deficiency leads to embryonic lethality in mice. How G6PD deficiency affects organisms has not been fully elucidated due to the lack of a suitable animal model. In this study, G6PD-deficient Caenorhabditis elegans was established by RNA interference (RNAi) knockdown to delineate the role of G6PD in animal physiology. Upon G6PD RNAi knockdown, G6PD activity was significantly hampered in C. elegans in parallel with increased oxidative stress and DNA oxidative damage. Phenotypically, G6PD-knockdown enhanced germ cell apoptosis (2-fold increase), reduced egg production (65% of mock), and hatching (10% of mock). To determine whether oxidative stress is associated with G6PD knockdown-induced reproduction defects, C. elegans was challenged with a short-term hydrogen peroxide (H2O2). The early phase egg production of both mock and G6PD-knockdown C. elegans were significantly affected by H2O2. However, H2O2-induced germ cell apoptosis was more dramatic in mock than that in G6PD-deficient C. elegans. To investigate the signaling pathways involved in defective oogenesis and embryogenesis caused by G6PD knockdown, mutants of p53 and mitogen-activated protein kinase (MAPK) pathways were examined. Despite the upregulation of CEP-1 (p53), cep-1 mutation did not affect egg production and hatching in G6PD-deficient C. elegans. Neither pmk-1 nor mek-1 mutation significantly affected egg production, whereas sek-1 mutation further decreased egg production in G6PD-deficient C. elegans. Intriguingly, loss of function of sek-1 or mek-1 dramatically rescued defective hatching (8.3- and 9.6-fold increase, respectively) induced by G6PD knockdown. Taken together, these findings show that G6PD knockdown reduces egg production and hatching in C. elegans, which are possibly associated with enhanced oxidative stress and altered MAPK pathways, respectively.

  2. A Comparison of the ab Initio Calculated and Experimental Conformational Energies of Alkylcyclohexanes

    NASA Astrophysics Data System (ADS)

    Freeman, Fillmore; Tsegai, Zufan M.; Kasner, Marc L.; Hehre, Warren J.

    2000-05-01

    Ab initio 6-31G(d) and MP2/6-31G(d)//6-31G(d) methods were used to calculate the energies of the rotamers of the chair conformers of alkylcyclohexanes and trimethylsilylcyclohexane. The MP2/6-31G(d)//6-31G(d) calculated conformational energies ( ? or A values, in kcal/mol) of the alkylcyclohexanes (Me = 1.96; Et = 1.80; Pr = 1.73 iso-Pr = 1.60; t-Bu = 5.45; neo-pent = 1.32) and trimethylsilylcyclohexane (SiMe3 = 2.69) are similar to the experimental values. Plots of the calculated conformational energies for the alkylcyclohexanes and trimethylsilylcyclohexane versus their experimental values are linear (slope = 1.253 and r = .993 for 6-31G(d) and slope = 1.114 and r = .982 for MP2/6-31G(d)//6-31G(d)). The conformational energies are determined primarily by steric effects which include gauche (synclinal) interactions and repulsive nonbonded interactions in both the axial and equatorial conformers.

  3. Characterisation of a natural quartz crystal as a reference material for microanalytical determination of Ti, Al, Li, Fe, Mn, Ga and Ge

    USGS Publications Warehouse

    Audetat, Andreas; Garbe-Schonberg, Dieter; Kronz, Andreas; Pettke, Thomas; Rusk, Brian G.; Donovan, John J.; Lowers, Heather

    2015-01-01

    A natural smoky quartz crystal from Shandong province, China, was characterised by laser ablation ICP-MS, electron probe microanalysis (EPMA) and solution ICP-MS to determine the concentration of twenty-four trace and ultra trace elements. Our main focus was on Ti quantification because of the increased use of this element for titanium-in-quartz (TitaniQ) thermobarometry. Pieces of a uniform growth zone of 9 mm thickness within the quartz crystal were analysed in four different LA-ICP-MS laboratories, three EPMA laboratories and one solution-ICP-MS laboratory. The results reveal reproducible concentrations of Ti (57 ± 4 μg g-1), Al (154 ± 15 μg g-1), Li (30 ± 2 μg g-1), Fe (2.2 ± 0.3 μg g-1), Mn (0.34 ± 0.04 μg g-1), Ge (1.7 ± 0.2 μg g-1) and Ga (0.020 ± 0.002 μg g-1) and detectable, but less reproducible, concentrations of Be, B, Na, Cu, Zr, Sn and Pb. Concentrations of K, Ca, Sr, Mo, Ag, Sb, Ba and Au were below the limits of detection of all three techniques. The uncertainties on the average concentration determinations by multiple techniques and laboratories for Ti, Al, Li, Fe, Mn, Ga and Ge are low; hence, this quartz can serve as a reference material or a secondary reference material for microanalytical applications involving the quantification of trace elements in quartz.

  4. Ubiquitin-fusion as a strategy to modulate protein half-life: A3G antiviral activity revisited

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cadima-Couto, Iris; Freitas-Vieira, Acilino; Instituto de Medicina Molecular, Lisboa

    2009-10-25

    The human APOBEC3G (A3G) is a potent inhibitor of HIV-1 replication and its activity is suppressed by HIV-1 virion infectivity factor (Vif). Vif neutralizes A3G mainly by inducing its degradation in the proteasome and blocking its incorporation into HIV-1 virions. Assessing the time needed for A3G incorporation into virions is, therefore, important to determine how quickly Vif must act to induce its degradation. We show that modelling the intracellular half-life of A3G can induce its Vif-independent targeting to the ubiquitin-proteasome system. By using various amino acids (X) in a cleavable ubiquitin-X-A3G fusion, we demonstrate that the half-life (t1/2) of X-A3Gmore » can be manipulated. We show that A3G molecules with a half-life of 13 min are incorporated into virions, whereas those with a half-life shorter than 5 min were not. The amount of X-A3G incorporated into virions increases from 13 min (Phe-A3G) to 85 min (Asn-A3G) and remains constant after this time period. Interestingly, despite the presence of similar levels of Arg-A3G (t1/2 = 28 min) and Asp-A3G (t1/2 = 65 min) into HIV-1 DELTAvif virions, inhibition of viral infectivity was only evident in the presence of A3G proteins with a longer half-life (t1/2 >= 65 min).« less

  5. Dynamics of asymmetric non-polymeric binary glass formers—A nuclear magnetic resonance and dielectric spectroscopy study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pötzschner, B.; Mohamed, F.; Lichtinger, A.

    2015-10-21

    We study a dynamically asymmetric binary glass former with the low-T{sub g} component m-tri-cresyl phosphate (m-TCP: T{sub g} = 206 K) and a spirobichroman derivative as a non-polymeric high-T{sub g} component (T{sub g} = 382 K) by means of {sup 1}H nuclear magnetic resonance (NMR), {sup 31}P NMR, and dielectric spectroscopy which allow component-selectively probing the dynamics. The entire concentration range is covered, and two main relaxation processes with two T{sub g} are identified, T{sub g1} and T{sub g2}. The slower one is attributed to the high-T{sub g} component (α{sub 1}-process), and the faster one is related to the m-TCPmore » molecules (α{sub 2}-process). Yet, there are indications that a small fraction of m-TCP is associated also with the α{sub 1}-process. While the α{sub 1}-relaxation only weakly broadens upon adding m-TCP, the α{sub 2}-relaxation becomes extremely stretched leading to quasi-logarithmic correlation functions at low m-TCP concentrations—as probed by {sup 31}P NMR stimulated echo experiments. Frequency-temperature superposition does not apply for the α{sub 2}-process and it reflects an isotropic, liquid-like motion which is observed even below T{sub g1}, i.e., in the matrix of the arrested high-T{sub g} molecules. As proven by 2D {sup 31}P NMR, the corresponding dynamic heterogeneities are of transient nature, i.e., exchange occurs within the distribution G(lnτ{sub α2}). At T{sub g1} a crossover is found for the temperature dependence of (mean) τ{sub α2}(T) from non-Arrhenius above to Arrhenius below T{sub g1} which is attributed to intrinsic confinement effects. This “fragile-to-strong” transition also leads to a re-decrease of T{sub g2}(c{sub m−TCP}) at low concentration c{sub m−TCP}, i.e., a maximum is observed in T{sub g2}(c{sub m−TCP}) while T{sub g1}(c{sub m−TCP}) displays the well-known plasticizer effect. Although only non-polymeric components are involved, we re-discover essentially all features previously reported for polymer-plasticizer systems.« less

  6. Fructose and Sucrose Intake Increase Exogenous Carbohydrate Oxidation during Exercise

    PubMed Central

    Trommelen, Jorn; Fuchs, Cas J.; Beelen, Milou; Lenaerts, Kaatje; Jeukendrup, Asker E.; Cermak, Naomi M.; van Loon, Luc J. C.

    2017-01-01

    Peak exogenous carbohydrate oxidation rates typically reach ~1 g·min−1 during exercise when ample glucose or glucose polymers are ingested. Fructose co-ingestion has been shown to further increase exogenous carbohydrate oxidation rates. The purpose of this study was to assess the impact of fructose co-ingestion provided either as a monosaccharide or as part of the disaccharide sucrose on exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. Ten trained male cyclists (VO2peak: 65 ± 2 mL·kg−1·min−1) cycled on four different occasions for 180 min at 50% Wmax during which they consumed a carbohydrate solution providing 1.8 g·min−1 of glucose (GLU), 1.2 g·min−1 glucose + 0.6 g·min−1 fructose (GLU + FRU), 0.6 g·min−1 glucose + 1.2 g·min−1 sucrose (GLU + SUC), or water (WAT). Peak exogenous carbohydrate oxidation rates did not differ between GLU + FRU and GLU + SUC (1.40 ± 0.06 vs. 1.29 ± 0.07 g·min−1, respectively, p = 0.999), but were 46% ± 8% higher when compared to GLU (0.96 ± 0.06 g·min−1: p < 0.05). In line, exogenous carbohydrate oxidation rates during the latter 120 min of exercise were 46% ± 8% higher in GLU + FRU or GLU + SUC compared with GLU (1.19 ± 0.12, 1.13 ± 0.21, and 0.82 ± 0.16 g·min−1, respectively, p < 0.05). We conclude that fructose co-ingestion (0.6 g·min−1) with glucose (1.2 g·min−1) provided either as a monosaccharide or as sucrose strongly increases exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. PMID:28230742

  7. Comparative DFT study of structure, reactivity and IR spectra of phosphorus-containing dendrons with Pdbnd Nsbnd Pdbnd S linkages, vinyl and azide functional groups

    NASA Astrophysics Data System (ADS)

    Furer, V. L.; Vandyukov, A. E.; Majoral, J. P.; Caminade, A. M.; Gottis, S.; Laurent, R.; Kovalenko, V. I.

    2015-07-01

    Fourier transform IR spectra of the first generation dendrons built from thiophosphoryl core with terminal Psbnd Cl groups, vinyl (G1) and azide (G2) functional group at the level of the core have been recorded. The optimized geometries of low energy isomers of G1 and G2 have been calculated by density functional (DFT) method at the PBE/TZ2P level of theory. DFT is used for analyzing the properties of each structural part (core, branches, surface). It was found that the repeated branching units of G1 and G2 contain planar sbnd Osbnd C6H4sbnd CHdbnd Nsbnd N(CH3)sbnd Prbond2 fragments. DFT results for the structure of G1 and G2 are in good agreement with X-ray diffraction measurements. A complete vibrational assignment is proposed for different parts of G1 and G2. The global and local reactivity descriptors have been used to characterize the reactivity pattern of the core functional and terminal groups. Natural bond orbital (NBO) analysis has been applied to comparative study of charge delocalization. Our study reveals why azide group linked to phosphorus has a different reactivity when compared to organic azides.

  8. The DNA binding site specificity and antiproliferative property of ternary Pt(II) and Zn(II) complexes of phenanthroline and N,N'-ethylenediaminediacetic acid.

    PubMed

    Nakamura, Yusuke; Taruno, Yoko; Sugimoto, Masashi; Kitamura, Yusuke; Seng, Hoi Ling; Kong, Siew Ming; Ng, Chew Hee; Chikira, Makoto

    2013-03-14

    The binding site specificity of the ternary complexes, [M(II)(phen)(edda)] (M(II) = Pt(2+) and Zn(2+); phen = 1,10-phenanthroline; edda = N,N'-ethylenediaminediacetic acid), for the self-complementary oligonucleotides (ODNs), ds(C(1)G(2)C(3)G(4)A(5)A(6)T(7)T(8)C(9)G(10)C(11)G(12))(2) (ODN1) and ds(C(1)G(2)C(3)G(4)T(5)A(6)T(7)A(8)C(9)G(10)C(11)G(12))(2) (ODN2), was studied by NMR measurements. The results indicated that [Pt(ii)(phen)(edda)] was partially intercalated between C(3)/G(10) and G(4)/C(9) base pairs of ODN1 and ODN2 in the major grooves, whereas [Zn(II)(phen)(edda)] was bound specifically to the TATA region of ODN2 in the minor groove and to the terminal G(2)/C(11) base pair of ODN1 in the major groove. The preference for the TATA sequence over the AATT sequence in the binding of [Zn(phen)(edda)] was attributed to the wider minor groove width of the TATA sequence. The bindings of the complexes to ct-DNA were also studied by UV, CD, and fluorescence spectroscopy. Additionally, the antiproliferative property of [Pt(II)(phen)(edda)] towards MCF7 breast cancer cells and normal MCF10-A cells was compared with that of [Zn(II)(phen)(edda)].

  9. Seasonal Equability in Late Cretaceous Central-Eastern Iberia? Inferences from Isotopic Data on Vertebrates

    NASA Astrophysics Data System (ADS)

    Domingo, L.; Barroso-Barcenilla, F.; Cambra-Moo, O.

    2013-12-01

    After the mid-Cretaceous thermal maximum, the latest Cretaceous witnessed a long-term cooling trend (Santonian-Maastrichtian). It has been proposed that seasonal equability (low mean annual range of temperatures) accompanied the mid-Cretaceous greenhouse period, but was it also a climatic feature of the colder latest Cretaceous? Terrestrial proxies have proven useful in understanding past seasonality and in this vein, we performed oxygen isotope analyses of the phosphate (δ18OPO4) on the rich and exceptionally well preserved late Campanian-early Maastrichtian vertebrate assemblage of 'Lo Hueco' fossil site (Cuenca, Spain). We analysed theropod and crocodilian tooth enamel, turtle shell, and gar ganoine with the aim of evaluating paleoclimatic conditions existing in the western area of the Tethys realm. The 'Lo Hueco' locality was situated at a paleo-latitude of 31°N and sedimentological and paleontological studies point to a coastal environment with distributary channels and sporadic sabkhas. Samples were collected from two different levels: G1 (proximal muddy floodplain) and G2 (distal muddy floodplain), with G1 being older. δ18OH2O values were calculated from theropod, crocodilian and turtle δ18OPO4 values using established equations and in all cases they are in good agreement with precipitation water from subtropical latest Cretaceous and modern settings. Theropods recorded consistently slightly lower δ18OH2O values (G1: -4.1×1.4‰, G2: -3.5×0.5‰) than crocodilians (G1: -3.6×0.6‰, G2: -2.7×0.6‰) and turtles (G1: -3.8×0.6‰, G2: -2.9×0.5‰). This may be due to terrestrial endothermic taxa, such as theropods, recording ingested water year round, meanwhile semiaquatic ectothermic taxa, such as crocodilians and turtles, would record δ18OH2O values representing local meteoric waters over the warm season, when conditions are favorable for apatite synthesis. With these δ18OH2O values, we used gar ganoine δ18OPO4 values as an independent proxy to calculate temperature values. As expected, temperature values estimated from theropods are lower (G1: 17.5×4.4°C, G2: 21.0×3.8°C), representing mean annual temperature (MAT), whereas temperature values yielded by crocodilians (G1: 19.6×4.4°C, G2: 24.4×3.8°C) and turtles (G1: 18.8×4.4°C, G2: 23.5×3.8°C) are slightly higher, reflecting the temperature of the warmest months (TWMs). Our record shows an increase in temperature values between G1 and G2, but they remain within expected temperature estimates based on other independent proxies (palynomorphs, vertebrates) and paleoclimatic models for the Late Cretaceous and the 'Lo Hueco' paleo-latitude. Maximum differences between TWMs and MAT are 2.1°C and 3.4°C for G1 and G2, respectively. These differences are in the low end-member of those observed in modern subtropical settings (~2.8-8.1°C) pointing to a slightly lower seasonal thermal varibility in central-eastern Iberia during the late Campanian-early Maastrichtian.

  10. A Dynamical Perspective on Additional Planets in 55 Cancri

    NASA Astrophysics Data System (ADS)

    Raymond, Sean N.; Barnes, Rory; Gorelick, Noel

    2008-12-01

    Five planets are known to orbit the star 55 Cancri. The recently discovered planet f at 0.78 AU (Fischer et al.) is located at the inner edge of a previously identified stable zone that separates the three close-in planets from planet d at 5.9 AU. Here we map the stability of the orbital space between planets f and d using a suite of n-body integrations that include an additional, yet-to-be-discovered planet g with a radial velocity amplitude of 5 ms-1 (planet mass = 0.5-1.2 Saturn masses). We find a large stable zone extending from 0.9 to 3.8 AU at eccentricities below 0.4. For each system we quantify the probability of detecting planets b-f on their current orbits given perturbations from hypothetical planet g, in order to further constrain the mass and orbit of an additional planet. We find that large perturbations are associated with specific mean motion resonances (MMRs) with planets f and d. We show that two MMRs, 3f:1g (the 1:3 MMR between planets g and f) and 4g:1d cannot contain a planet g. The 2f:1g MMR is unlikely to contain a planet more massive than ~20 M⊕. The 3g:1d and 5g:2d MMRs could contain a resonant planet but the resonant location is strongly confined. The 3f:2g, 2g:1d, and 3g:2d MMRs exert a stabilizing influence and could contain a resonant planet. Furthermore, we show that the stable zone may in fact contain 2-3 additional planets, if they are ~50 M⊕ each. Finally, we show that any planets exterior to planet d must reside beyond 10 AU.

  11. Kinetic behaviours of aggregate growth driven by time-dependent migration, birth and death

    NASA Astrophysics Data System (ADS)

    Zhu, Sheng-Qing; Yang, Shun-You; Ke, Jianhong; Lin, Zhenquan

    2008-12-01

    We propose a dynamic growth model to mimic some social phenomena, such as the evolution of cities' population, in which monomer migrations occur between any two aggregates and monomer birth/death can simultaneously occur in each aggregate. Considering the fact that the rate kernels of migration, birth and death processes may change with time, we assume that the migration rate kernel is ijf(t), and the self-birth and death rate kernels are ig1(t) and ig2(t), respectively. Based on the mean-field rate equation, we obtain the exact solution of this model and then discuss semi-quantitatively the scaling behaviour of the aggregate size distribution at large times. The results show that in the long-time limit, (i) if ∫t0g1(t') dt'/∫t0g2(t') dt' >= 1 or exp{∫t0[g2(t') - g1(t')] dt'}/∫t0f(t') dt' → 0, the aggregate size distribution ak(t) can obey a generalized scaling form; (ii) if ∫t0g1(t') dt'/∫t0g2(t') dt' → 0 and exp ∫t0[g2(t') - g1(t') dt'/∫t0f(t') dt' → ∞, ak(t) can take a scale-free form and decay exponentially in size k; (iii) ak(t) will satisfy a modified scaling law in the remaining cases. Moreover, the total mass of aggregates depends strongly on the net birth rate g1(t) - g2(t) and evolves exponentially as exp{∫t0[g1(t') - g2(t')] dt'}, which is in qualitative agreement with the evolution of the total population of a country in real world.

  12. Evaluation of the effects of two novel irrigants on intraradicular dentine erosion, debris and smear layer removal

    PubMed Central

    Görduysus, Melahat; Bayramgil, Nursel Pekel; Görduysus, Mehmet Ömer

    2015-01-01

    Objectives To evaluate the effects of copolymer of acrylic acid and maleic acid (Poly[AA-co-MA]) and calcium hypochlorite (Ca(OCl)2) on root canal dentin using scanning electron microscope (SEM). Materials and Methods Twenty-four single-rooted teeth were instrumented and the apical and coronal thirds of each root were removed, leaving the 5 mm middle thirds, which were then separated into two pieces longitudinally. The specimens were randomly divided into six groups and subjected to each irrigant for 5 min as follows: G1, Ca(OCl)2; G2, Poly(AA-co-MA); G3, Ca(OCl)2 + Poly(AA-co-MA); G4, sodium hypochlorite (NaOCl); G5, ethylenediaminetetraacetic acid (EDTA); G6, NaOCl+EDTA. The specimens were prepared for SEM evaluation. Smear layer, debris and erosion scores were recorded by two blinded examiners. One image from G3 was analyzed with energy dispersive spectroscopy (EDS) on suspicion of precipitate formation. Data were analyzed using the Kruskal-Wallis and Dunn tests. Results G1 and G4 showed the presence of debris and smear layer and they were statistically different from G2, G3, G5 and G6 where debris and smear layer were totally removed (p < 0.05). In G1 and G4, erosion evaluation could not be done because of debris and smear layer. G2, G3 and G5 showed no erosion, and there was no significant difference between them. G6 showed severe erosion and was statistically different from G2, G3 and G5 (p < 0.05). EDS microanalysis showed the presence of Na, P, and Ca elements on the surface. Conclusions Poly(AA-co-MA) is effective in removing the smear layer and debris without causing erosion either alone or with Ca(OCl)2. PMID:26295025

  13. Effects of clay after an aflatoxin challenge on aflatoxin clearance, milk production, and metabolism of Holstein cows.

    PubMed

    Sulzberger, S A; Melnichenko, S; Cardoso, F C

    2017-03-01

    Oral supplementation of clay to dairy cattle has been reported to reduce toxicity of aflatoxin (AF) in contaminated feed. The objective of this study was to determine the effects of 3 concentrations of dietary clay supplementation in response to an AF challenge. Ten multiparous rumen-cannulated Holstein cows [body weight (mean ± SD) = 669 ± 20 kg and 146 ± 69 d in milk], were assigned to 1 of 5 treatments in a randomized replicated 5 × 5 Latin square design balanced to measure carryover effects. Periods (21 d) were divided in an adaptation phase (d 1 to 14) and a measurement phase (d 15 to 21). From d 15 to 17, cows received an AF challenge. The challenge consisted of 100 μg of aflatoxin B 1 (AFB 1 )/kg of dietary dry matter intake (DMI). The material was fitted into 10-mL gelatin capsules and administered into the rumen through a rumen-cannula based on the average DMI obtained on d 12 to 14. Treatments were no clay plus an AF challenge (POS); 3 different concentrations of clay (0.5, 1, or 2% of dietary DMI) plus an AF challenge; and a control consisting of no clay and no AF challenge (C). Statistical analysis was performed using the MIXED procedure of SAS (SAS Institute Inc., Cary, NC). Two contrasts, CONT1 (POS vs. C) and CONT2 (POS vs. the average of 0.5, 1, and 2% clay), were compared along with the linear and quadratic treatment effects (POS, 0.5%, 1%, 2%). Cows supplemented with clay had lower AF excretion in milk as aflatoxin M 1 (AFM 1 ; 0.5% = 20.83 μg/d, 1% = 22.82 μg/d, and 2% = 16.51 μg/d) and AF transfer from rumen fluid to milk (AFM 1; 0.5% = 1.01%, 1% = 0.98%, and 2% = 0.74%) compared with cows in POS (AFM 1 = 27.81 μg/d and AF transfer = 1.37%, CONT2). Similarly, concentrations of AFM 1 in milk (0.5% = 0.35 μg/kg, 1% = 0.30 μg/kg, 2% = 0.25 μg/kg), AFB 1 in feces (0.5% = 1.79 μg/g, 1% = 1.52 μg/kg, 2% = 1.48 μg/kg), and AFB 1 in rumen fluid (0.5% = 0.05 μg/kg, 1% = 0.02 μg/kg, 2% = 0.02 μg/kg) were reduced in cows fed clay compared with POS (0.43 μg/kg, 2.78 μg/kg, and 0.10 μg/kg, respectively, CONT2). Cows supplemented with clay tended to have lower 3.5% fat-corrected milk [0.5% = 38.2 kg, 1% = 39.3 kg, 2% = 38.4 kg, standard error of the mean (SEM) = 1.8] than cows in POS (41.3 kg; SEM = 1.8; CONT2). Plasma superoxide dismutase (SOD) concentration tended to be lower for cows fed clay in the diet (0.5% = 2.16 U/mL, 1% = 1.90 U/mL, 2% = 2.3 U/mL; SEM = 0.3) than for cows in POS (2.72 U/mL; CONT2). Additionally, when cows were exposed to AF without clay in the diet, plasma concentrations of aspartate aminotransferase (AST) decreased from 84.23 (C) to 79.17 (POS) and glutamate dehydrogenase (GLDH) decreased from 91.02 (C) to 75.81 (POS). In conclusion, oral supplementation of clay reduced the transfer of AF from the rumen to milk and feces. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. Effect of Shilajit enriched diet on immunity, antioxidants, and disease resistance in Macrobrachium rosenbergii (de Man) against Aeromonas hydrophila.

    PubMed

    Musthafa, Mohamed Saiyad; Jawahar Ali, Abdul Rahman; Hyder Ali, Abdul Rahuman; Mohamed, Mohamed Jamal; War, Mehrajuddin; Naveed, Mohamed Saquib; Al-Sadoon, Mohammad K; Paray, Bilal Ahmad; Rani, Kuppusamy Umaa; Arockiaraj, Jesu; Balasundaram, Chellam; Harikrishnan, Ramasamy

    2016-10-01

    The effect of diet supplemented with Shilajit, a multi-component natural mineral substance on the antioxidant activity, immune response, and disease resistance in freshwater prawn, Macrobrachium rosenbergii (de Man) against Aeromonas hydrophila is reported. The total hemocyte count (THC) and phagocytic activity significantly increased with 2 g kg(-1) supplemented diet on first week and with other enriched diets on weeks 2 and 4. The respiratory burst (RB) activity and glutathione peroxidase (GPx) activity were significantly increased with 2 g kg(-1) supplemented diet on weeks 1 and 2 whereas 2 and 4 g kg(-1) diets on week 4. The phenoloxidase (PO) activity increased significantly with 2 g kg(-1) diet only on second week and with other enriched diets only on fourth week. The superoxide dismutase (SOD) activity increased significantly with any enriched diet during the experimental period except with 6 g kg(-1) diets on first week. However, the glutathione reductase (GR) activity was enhanced significantly only with 2 g kg(-1) enriched diets on weeks 2 and 4. The cumulative mortality of the prawn fed with 2 and 4 g kg(-1) enriched diets was 10% and 15% whereas with 6 g kg(-1) diet the mortality was 20%. The results suggest that diet enriched with Shilajit at 2 g kg(-1) or 4 g kg(-1) positively enhances the antioxidant activity, immunity, and disease resistance in M. rosenbergii against A. hydrophila. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. CCR5 chemokine receptor gene polymorphisms in ocular toxoplasmosis.

    PubMed

    de Faria Junior, Geraldo M; Ayo, Christiane M; de Oliveira, Amanda P; Lopes, Alessandro G; Frederico, Fábio B; Silveira-Carvalho, Aparecida P; Previato, Mariana; Barbosa, Amanda P; Murata, Fernando H A; de Almeida Junior, Gildásio Castello; Siqueira, Rubens Camargo; de Mattos, Luiz C; Brandão de Mattos, Cinara C

    2018-02-01

    CC chemokine receptor type 5 (CCR5) is a chemokine receptor that influences the immune response to infectious and parasitic diseases. This study aimed to determine whether the CCR5Δ32 and CCR5 59029 A/G polymorphisms are associated with the development of ocular toxoplasmosis in humans. Patients with positive serology for Toxoplasma gondii were analyzed and grouped as 'with ocular toxoplasmosis' (G1: n=160) or 'without ocular toxoplasmosis' (G2: n=160). A control group (G3) consisted of 160 individuals with negative serology. The characterization of the CCR5Δ32 and CCR5 59029 A/G polymorphisms was by PCR and by PCR-RFLP, respectively. The difference between the groups with respect to the mean age (G1: mean age: 47.3, SD±19.3, median: 46 [range: 18-95]; G2: mean age: 61.3, SD±13.7, median: 61 [range: 21-87]; G3: mean age: 38.8, SD±17.9, median: 34 [range: 18-80]) was statistically significant (G1 vs.G2: p-value <0.0001; t=7.21; DF=318; G1 vs.G3: p-value <0.0001; t=4.32; DF=318; G2 vs. G3: p-value <0.0001; t=9.62; DF=318). The Nagelkerke r 2 value was 0.040. There were statistically significant differences for the CCR5/CCR5 (p-value=0.008; OR=0.261), AA (p-value=0.007; OR=2.974) and AG genotypes (p-value=0.018; OR=2.447) between G1 and G2. Individuals with the CCR5/CCR5 genotype and simultaneously the CCR5-59029 AA or AG genotypes have a greater risk of developing ocular toxoplasmosis (4% greater), which may be associated with a strong and persistent inflammatory response in ocular tissue. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Clarithromycin Resistance Mutations in Helicobacter pylori in Association with Virulence Factors and Antibiotic Susceptibility of the Strains.

    PubMed

    Boyanova, Lyudmila; Markovska, Rumyana; Yordanov, Daniel; Gergova, Galina; Mitov, Ivan

    2016-04-01

    Antibiotic resistance is the major cause for Helicobacter pylori eradication failure. H. pylori clarithromycin resistance mutations were evaluated in 84 (82 phenotypically clarithromycin resistant and 2 intermediately susceptible) strains by allele-specific PCR and 3'-mismatched PCR. Many (57.1%) of these strains were metronidazole resistant. Prevalence of cagA(+), cagE(+), vacA s1a, m1, i1, and i2 strains was 76.2%, 58.0%, 82.1%, 35.7%, 50.0%, and 50.0%, respectively. A2143G, A2142G, A2142C, and A2143G+A2142G mutation rates were 64.3%, 23.8%, 1.2%, and 10.7%, respectively. Strains harboring the A2142G mutation showed 5.3-fold higher clarithromycin MIC50 than those harboring the A2143G mutation. The A2143G mutation alone was 1.7-fold more common in vacA i2 strains compared with vacA i1 strains, while the A2142G mutation alone was 3-fold more frequent in vacA i1 strains than vacA i2 strains and 3.1-fold more common in metronidazole-susceptible compared with metronidazole-resistant strains. Briefly, clarithromycin resistance mutations were significantly linked to vacA i allele and metronidazole susceptibility. This is the first report about associations between the A2143G mutation and less virulent vacA i2 strains, and between the A2142G mutation and more virulent vacA i1 strains. As the 2143G mutation often predicts eradication failure by clarithromycin-based regimens, the results may be linked to the better eradication of more virulent strains compared with the less virulent strains.

  17. Galactomannan from Schizolobium amazonicum seed and its sulfated derivatives impair metabolism in HepG2 cells.

    PubMed

    Cunha de Padua, Monique Meyenberg; Suter Correia Cadena, Silvia Maria; de Oliveira Petkowicz, Carmen Lucia; Martinez, Glaucia Regina; Rodrigues Noleto, Guilhermina

    2017-08-01

    This study evaluated the effects of native galactomannan from Schizolobium amazonicum seeds and its sulfated forms on certain metabolic parameters of HepG2 cells. Aqueous extraction from S. amazonicum seeds furnished galactomannan with 3.2:1 Man:Gal ratio (SAGM) and molar mass of 4.34×10 5 g/mol. The SAGM fraction was subjected to sulfation using chlorosulfonic acid to obtain SAGMS1 and SAGMS2 with DS of 0.4 and 0.6, respectively. Cytotoxicity of SAGM, SAGMS1, and SAGMS2 was evaluated in human hepatocellular carcinoma cells (HepG2). After 72h, SAGM decreased the viability of HepG2 cells by 50% at 250μg/mL, while SAGMS1 reduced it by 30% at the same concentration. SAGM, SAGMS1, and SAGMS2 promoted a reduction in oxygen consumption and an increase in lactate production in non-permeabilized HepG2 cells after 72h of treatment. These results suggest that SAGM, SAGMS1, and SAGMS2 could be recognized by HepG2 cells and might trigger alterations that impair its survival. These effects could be implicated in the modification of the oxidative phosphorylation process in HepG2 cells and activation of the glycolytic pathway. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Cooling and performance recovery of trained athletes: a meta-analytical review.

    PubMed

    Poppendieck, Wigand; Faude, Oliver; Wegmann, Melissa; Meyer, Tim

    2013-05-01

    Cooling after exercise has been investigated as a method to improve recovery during intensive training or competition periods. As many studies have included untrained subjects, the transfer of those results to trained athletes is questionable. Therefore, the authors conducted a literature search and located 21 peer-reviewed randomized controlled trials addressing the effects of cooling on performance recovery in trained athletes. For all studies, the effect of cooling on performance was determined and effect sizes (Hedges' g) were calculated. Regarding performance measurement, the largest average effect size was found for sprint performance (2.6%, g = 0.69), while for endurance parameters (2.6%, g = 0.19), jump (3.0%, g = 0.15), and strength (1.8%, g = 0.10), effect sizes were smaller. The effects were most pronounced when performance was evaluated 96 h after exercise (4.3%, g = 1.03). Regarding the exercise used to induce fatigue, effects after endurance training (2.4%, g = 0.35) were larger than after strength-based exercise (2.4%, g = 0.11). Cold-water immersion (2.9%, g = 0.34) and cryogenic chambers (3.8%, g = 0.25) seem to be more beneficial with respect to performance than cooling packs (-1.4%, g= -0.07). For cold-water application, whole-body immersion (5.1%, g = 0.62) was significantly more effective than immersing only the legs or arms (1.1%, g = 0.10). In summary, the average effects of cooling on recovery of trained athletes were rather small (2.4%, g = 0.28). However, under appropriate conditions (whole-body cooling, recovery from sprint exercise), postexercise cooling seems to have positive effects that are large enough to be relevant for competitive athletes.

  19. Composition and production rate of pharmaceutical and chemical waste from Xanthi General Hospital in Greece.

    PubMed

    Voudrias, Evangelos; Goudakou, Lambrini; Kermenidou, Marianthi; Softa, Aikaterini

    2012-07-01

    The objective of this work was to determine the composition and production rates of pharmaceutical and chemical waste produced by Xanthi General Hospital in Greece (XGH). This information is important to design and cost management systems for pharmaceutical and chemical waste, for safety and health considerations and for assessing environmental impact. A total of 233 kg pharmaceutical and 110 kg chemical waste was collected, manually separated and weighed over a period of five working weeks. The total production of pharmaceutical waste comprised 3.9% w/w of the total hazardous medical waste produced by the hospital. Total pharmaceutical waste was classified in three categories, vial waste comprising 51.1%, syringe waste with 11.4% and intravenous therapy (IV) waste with 37.5% w/w of the total. Vial pharmaceutical waste only was further classified in six major categories: antibiotics, digestive system drugs, analgesics, hormones, circulatory system drugs and "other". Production data below are presented as average (standard deviation in parenthesis). The unit production rates for total pharmaceutical waste for the hospital were 12.4 (3.90) g/patient/d and 24.6 (7.48) g/bed/d. The respective unit production rates were: (1) for vial waste 6.4 (1.6) g/patient/d and 13 (2.6) g/bed/d, (2) for syringe waste 1.4 (0.4) g/patient/d and 2.8 (0.8) g/bed/d and (3) for IV waste 4.6 (3.0) g/patient/d and 9.2 (5.9) g/bed/d. Total chemical waste was classified in four categories, chemical reagents comprising 18.2%, solvents with 52.3%, dyes and tracers with 18.2% and solid waste with 11.4% w/w of the total. The total production of chemical waste comprised 1.8% w/w of the total hazardous medical waste produced by the hospital. Thus, the sum of pharmaceutical and chemical waste was 5.7% w/w of the total hazardous medical waste produced by the hospital. The unit production rates for total chemical waste for the hospital were 5.8 (2.2) g/patient/d and 1.1 (0.4) g/exam/d. The respective unit production rates were: (1) for reagents 1.7 (2.4) g/patient/d and 0.3 (0.4) g/examination/d, (2) for solvents 248 (127) g/patient/d and 192 (101) g/examination/d, (3) for dyes and tracers 4.7 (1.4) g/patient/d and 2.5 (0.9) g/examination/d and (4) for solid waste 54 (28) g/patient/d and 42 (22) g/examination/d. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. High quality human immunoglobulin G purified from Cohn fractions by liquid chromatography.

    PubMed

    Tanaka, K; Sawatani, E; Dias, G A; Shigueoka, E M; Campos, T C; Nakao, H C; Arashiro, F

    2000-01-01

    In order to obtain intravenous immunoglobulin G (iv IgG) of high quality from F-I+II+III or F-II+III pastes prepared by the Cohn method, we developed a chromatography process using ion exchange gels, Q-Sepharose FF and CM-Sepharose FF, and Sephacryl S-300 gel filtration. Viral inactivation was performed by incubating the preparation with pepsin at pH 4.0 at 35 degrees C for 18 h. The characteristics of 28 batches produced by us were: yield 4.3 +/- 0.2 g/l plasma, i.e., a recovery of 39.1 +/- 1.8%; IgG subclasses distribution: IgG1 = 58.4%, IgG2 = 34.8%, IgG3 = 4.5% and IgG4 = 2. 3%; IgG size distribution was 98.4% monomers, 1.2% dimers and 0.4% polymers and protein aggregates; anticomplement activity was less than 0.5 CH50/mg IgG, and prekallikrein activator activity (PKA) was less than 5 IU/ml. These characteristics satisfied the requirements of the European Pharmacopoea edition, and the regulations of the Brazilian Health Ministry (M.S. Portaria No. 2, 30/10/1998).

  1. Soluble HLA-G dampens CD94/NKG2A expression and function and differentially modulates chemotaxis and cytokine and chemokine secretion in CD56bright and CD56dim NK cells.

    PubMed

    Morandi, Fabio; Ferretti, Elisa; Castriconi, Roberta; Dondero, Alessandra; Petretto, Andrea; Bottino, Cristina; Pistoia, Vito

    2011-11-24

    Soluble HLA-G (sHLA-G) inhibits natural killer (NK) cell functions. Here, we investigated sHLA-G-mediated modulation of (1) chemokine receptor and NK receptor expression and function and (2) cytokine and chemokine secretion in CD56bright and CD56dim NK cells. sHLA-G-treated or untreated peripheral blood (PB) and tonsil NK cells were analyzed for chemokine receptor and NK receptor expression by flow cytometry. sHLA-G down-modulated (1) CXCR3 on PB and tonsil CD56bright and CD56dim, (2) CCR2 on PB and tonsil CD56bright, (3) CX3CR1 on PB CD56dim, (4) CXCR5 on tonsil CD56dim, and (5) CD94/NKG2A on PB and tonsil CD56brigh) and CD56dim NK cells. Such sHLA-G-mediated down-modulations were reverted by adding anti-HLA-G or anti-ILT2 mAbs. sHLA-G inhibited chemotaxis of (1) PB NK cells toward CXCL10, CXCL11, and CX3CL1 and (2) PB CD56bright NK cells toward CCL2 and CXCL10. IFN-γ secretion induced by NKp46 engagement was inhibited by NKG2A engagement in untreated but not in sHLA-G-treated NK cells. sHLA-G up-regulated secretion of (1) CCL22 in CD56bright and CD56dim and (2) CCL2, CCL8, and CXCL2-CXCL3 in CD56dim PB NK cells. Signal transduction experiments showed sHLA-G-mediated down-modulation of Stat5 phosphorylation in PB NK cells. In conclusion, our data delineated novel mechanisms of sHLA-G-mediated inhibition of NK-cell functions.

  2. The effect of different dosages of guar gum on gastric emptying and small intestinal transit of a consumed semisolid meal.

    PubMed

    van Nieuwenhoven, M A; Kovacs, E M; Brummer, R J; Westerterp-Plantenga, M S; Brouns, F

    2001-02-01

    There is no consensus about the effect of guar gum supplementation on gastrointestinal transit. It has been suggested that guar gum slows gastric emptying and intestinal transit, thus inducing an increased feeling of satiety. To investigate whether addition of guar gum to a semisolid meal affects gastrointestinal transit. Eight male subjects were randomly studied four times. They consumed a standard semisolid test meal containing either 0 g, 2.5 g, 3.5 g, or 4.5 g of guar gum. The test meals contained 1 mCi 99mTc-hepatate for scintigraphy and 5 g lactulose for the H2-breath test. Scintigraphic scanning was performed for at least two hours, and gastric half-emptying time (T1/2) was calculated. Breath samples were collected at 15 minute intervals and analyzed for H2-enrichment. The orocecal transit time (OCTT) was then determined. A parameter of intestinal transit (PIT) was obtained by subtracting the T1/2 from the OCTT. There were no significant differences (in minutes) between the different tests in both T1/2 (0 g, t = 88.2 +/- 11, 2.5 g, t = 83.3 +/- 11.9, 3.5 g, t = 83.3 +/- 13.6, 4.5 g, t = 72.4 +/- 7.2, p = 0.86) and PIT (0 g, t = 149.9 +/- 26.6, 2.5 g, t = 145.5 +/- 25.6, t = 3.5 g, t = 175.3 +/- 17.6, t = 4.5 g, t = 152.6 +/- 22.4, p = 0.52). Addition of guar gum to a semisolid meal up to a dosage of 4.5 g does not affect gastrointestinal transit. Other mechanisms than gastrointestinal motility are involved in a possible satiating effect of guar gum supplementation.

  3. On Spaces of Commuting Elements in Lie Groups

    DTIC Science & Technology

    2014-02-25

    G given by θ(g, t) = gtg −1 = tg, with more details given in Section 2. Definition 1.6. Define Θ : G×NT Assoc(T )→ Comm(G) by the formula Θ(g, (t1...conjugation θn : G× Tn → Hom(Zn, G)1G g × (t1, . . . , tn) 7→ (tg1, . . . , tgn), ON SPACES OF COMMUTING ELEMENTS IN LIE GROUPS 11 where tg = gtg −1. An n

  4. 26 CFR 1.904(g)-1T - Overall domestic loss and the overall domestic loss account (temporary).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... loss account (temporary). 1.904(g)-1T Section 1.904(g)-1T Internal Revenue INTERNAL REVENUE SERVICE... Without the United States § 1.904(g)-1T Overall domestic loss and the overall domestic loss account... reductions from such accounts for purposes of section 904(g). Section 1.904(g)-2T provides rules for...

  5. 26 CFR 1.904(g)-1T - Overall domestic loss and the overall domestic loss account (temporary).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... loss account (temporary). 1.904(g)-1T Section 1.904(g)-1T Internal Revenue INTERNAL REVENUE SERVICE... Without the United States § 1.904(g)-1T Overall domestic loss and the overall domestic loss account... reductions from such accounts for purposes of section 904(g). Section 1.904(g)-2T provides rules for...

  6. 26 CFR 1.904(g)-1T - Overall domestic loss and the overall domestic loss account (temporary).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... loss account (temporary). 1.904(g)-1T Section 1.904(g)-1T Internal Revenue INTERNAL REVENUE SERVICE... United States § 1.904(g)-1T Overall domestic loss and the overall domestic loss account (temporary). (a... accounts for purposes of section 904(g). Section 1.904(g)-2T provides rules for recapturing the balance in...

  7. Development of TRPN dendrimer-modified disordered mesoporous silica for CO{sub 2} capture

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Xiaoyun; Zhang, Sisi; Qin, Hongyan

    2014-08-15

    Highlights: • A novel series of TRPN dendrimers are synthesized. • Structurally disordered mesoporous silica was used to develop the CO{sub 2} adsorbent. • The CO{sub 2} adsorption capacity is relatively high. • The sorbent exhibits a high stability after 12 cycling runs. • The sorbent achieves complete desorption at low temperature (60 °C). - Abstract: A novel series of tri(3-aminopropyl) amine (TRPN) dendrimers were synthesized and impregnated on structurally disordered mesoporous silica (DMS) to generate CO{sub 2} adsorbents (TS). The physicochemical and adsorption properties of the adsorbents before and after dendrimer modification were characterized by X-ray diffraction (XRD), thermogravimetricmore » analysis (TGA), Fourier transform infrared spectroscopy (FTIR), transmission electron microscopy (TEM) and N{sub 2} adsorption–desorption (N{sub 2}-BET) techniques. CO{sub 2} adsorption–desorption tests indicated that the sorbent demonstrates high CO{sub 2} adsorption capacity (138.1 mg g{sup −1} for G1 sample TS-G1-3CN-50 and 91.7 mg g{sup −1} for G2 sample TS-G2-6CN-50), and can completely desorb CO{sub 2} under vacuum at 60 °C. Its CO{sub 2} adsorption capacity at 25 °C increases with the amine loading, achieving the highest adsorption capacity (140.6 mg g{sup −1} for TS-G1-3CN) at 60%. The developed TS materials exhibited excellent cycling stability. After 12 consecutive adsorption–desorption runs, TS-G1-3CN-50 shows an adsorption capacity of 136.0 mg g{sup −1}, retaining 98.5% of its original value.« less

  8. D-Cloprostenol enhances estrus synchronization in tropical hair sheep.

    PubMed

    Ramírez, Alejandro Alavez; Villalvazo, Victor Manuel Meza; Arredondo, Emmanuel Sosa; Ramírez, Hugo Alonso Ramírez; Sevilla, Héctor Magaña

    2018-06-01

    To compare the effects of PGF2α (dinoprost tromethamine) and D-cloprostenol in a two-dose protocol for estrus synchronization in hair sheep during breeding season in Yucatán, México, two experiments were conducted. In experiment 1, 61 cyclic hair sheep were divided into two groups: G1 (control n = 30), two doses of 50 μg of dinoprost tromethamine IM with 12 days between applications, and G2 (n = 31), two doses of 50 μg of D-cloprostenol IM at the same time interval. For determination of progesterone levels, 16 ewes from each group were randomly selected. In experiment 2, 70 cyclic hair sheep were assigned at the same treatments (G1 and G2, n = 35) and 48 h after the second application, the ewes in estrus were detected by two vasectomized rams. Sheep with detected estrus were inseminated, and 45 days after, pregnant animals were identified by ultrasonography. An exact Fisher's test was performed for the analysis of ewes in estrus (experiments 1 and 2) and number of pregnant ewes (experiment 2); for the comparison of time between end of treatment-estrus presentation, a survival analysis was used. Duration of estrus in hours was analyzed using a generalized mixed model (GLM) ANOVA whereas plasma progesterone concentrations were analyzed by non-linear regression. There were significant differences (P < 0.05) in the proportion of ewes in estrus upon treatments (G1, 57% vs G2, 87% and G1, 37.1% vs G2, 65.7% in experiments 1 and 2, respectively), and between the end of treatment-onset estrus interval (P < 0.01), survival curves showed the highest number of sheep in estrus between 40 and 48 h (G1, 43.7 + 8.05 h vs G2, 42.9 + 6.7 h, experiment 1). There were no significant differences (P > 0.05) in duration of estrus (G1, 42 + 6.1 h, vs G2, 41.1 + 11.2 h, experiment 1) and pregnancy in the ewes that presented estrus, and were inseminated (G1, 38.4% vs 52.1%, experiment 2). With regard to concentrations of progesterone, significant differences (P < 0.01) were found between treatments, and progesterone levels before the second application of D-cloprostenol were higher. In consideration of the results, it can be concluded that in a two-dose protocol of a luteolytic agent, more ewes presented estrus in response to D-cloprostenol compared to dinoprost tromethamine with similar pregnancy rates.

  9. Structural basis of potassium activation in plant asparaginases.

    PubMed

    Ajewole, Ebenezer; Santamaria-Kisiel, Liliana; Pajak, Agnieszka; Jaskolski, Mariusz; Marsolais, Frédéric

    2018-04-01

    l-asparaginases (EC 3.5.1.1) play an important role in nitrogen mobilization in plants. Here, we investigated the biochemical and biophysical properties of potassium-dependent (PvAspG1) and potassium-independent (PvAspG-T2) l-asparaginases from Phaseolus vulgaris. Our previous studies revealed that PvAspG1 requires potassium for catalytic activation and its crystal structure suggested that Ser-118 in the activation loop plays a critical role in coordinating the metal cation. This amino acid residue is replaced by isoleucine in PvAspG-T2. Reciprocal mutants of the enzymes were produced and the effect of the amino acid substitution on the kinetic parameters, allosteric effector binding, secondary structure conformation, and pH profile were studied. Introduction of the serine residue conferred potassium activation in PvAspG-T2. Conversely, the PvAspG1-S118I mutant could no longer be activated by potassium. PvAspG1 and the PvAspG-T2-I117S mutant had a similar half-maximal effective concentration (EC 50 ) value for potassium activation, between 0.1 and 0.3 mm. Potassium binding elicited a similar conformational change in PvAspG1 and PvAspG-T2-I117S, as studied by circular dichroism. However, no change in conformation was observed for PvAspG-T2 and PvAspG1-S118I. Analysis of kinetic parameters in function of pH indicated that potassium activation mediated by Ser-118 influences the ionization of specific functional groups in the enzyme-substrate complex. Together, the results indicate that Ser-118 of PvAspG1 is essential and sufficient for potassium activation in plant l-asparaginases. ENZYME: l-Asparaginase (EC 3.5.1.1). © 2018 Federation of European Biochemical Societies.

  10. Efficacy of protein, symbiotic and probiotic supplementation on production performance and egg quality characteristics in molted layers.

    PubMed

    Anwar, Haseeb; Rahman, Zia Ur

    2016-10-01

    Two hundred white leg horn layers at 70 weeks of age were induced to molt with high dietary zinc (3 g/kg of feed); thereafter, birds were equally and randomly divided (n = 50 each) into four groups keeping G1 as control (CP 16 % diet, no other supplement), G2 (CP 18 % diet), G3 (CP 16 % diet + symbiotic; Perfectin® at 85 mg/L in drinking water daily), and G4 (CP 16 % diet + probiotic; Protexin® at 85 mg/L in drinking water daily). The egg production record was maintained throughout the experiment period, and egg quality parameters were performed at 5 %, peak, and end of post molt production stage. The overall egg production was highest in G2 (74.51 %) followed by G3 (64.95 %) and G4 (65.03 %) and lowest in G1 (58.51 %). The overall egg weight, length, diameter, weight and diameter of albumin and yolk, egg shell thickness as well as egg shell breaking strength increased (P ≤ 0.01) in G2 and G3 as compared to G1. The albumin height, yolk height, yolk index, and haugh unit score decreased (P ≤ 0.01) in G2 and G3 as compared to G1. FCR/12 eggs improved in all the supplemented groups as compared to control (G1). The bacterial contamination of eggs was seen in G1. Conclusively, it was observed in the current experiment that the supplementation with protein, probiotic, and symbiotic did improve the production quality and potential in molted layers.

  11. 40 CFR 721.9800 - Poly(substituted triazinyl) piperazine (generic name).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... triazinyl) piperazine (PMN P-88-436) is subject to reporting under this section for the significant new uses...), (g)(1) (statement-health effects not fully determined), (g)(2)(i), (g)(2)(ii), (g)(2)(iii), and (g)(5...) through (c), (g), and (h). (2) Limitations or revocation of certain notification requirements. The...

  12. 40 CFR 721.9800 - Poly(substituted triazinyl) piperazine (generic name).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... triazinyl) piperazine (PMN P-88-436) is subject to reporting under this section for the significant new uses...), (g)(1) (statement-health effects not fully determined), (g)(2)(i), (g)(2)(ii), (g)(2)(iii), and (g)(5...) through (c), (g), and (h). (2) Limitations or revocation of certain notification requirements. The...

  13. 40 CFR 721.9800 - Poly(substituted triazinyl) piperazine (generic name).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... triazinyl) piperazine (PMN P-88-436) is subject to reporting under this section for the significant new uses...), (g)(1) (statement-health effects not fully determined), (g)(2)(i), (g)(2)(ii), (g)(2)(iii), and (g)(5...) through (c), (g), and (h). (2) Limitations or revocation of certain notification requirements. The...

  14. 40 CFR 721.9800 - Poly(substituted triazinyl) piperazine (generic name).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... triazinyl) piperazine (PMN P-88-436) is subject to reporting under this section for the significant new uses...), (g)(1) (statement-health effects not fully determined), (g)(2)(i), (g)(2)(ii), (g)(2)(iii), and (g)(5...) through (c), (g), and (h). (2) Limitations or revocation of certain notification requirements. The...

  15. The effects of Pilates method on pelvic floor muscle strength in patients with post-prostatectomy urinary incontinence: A randomized clinical trial.

    PubMed

    Gomes, Cíntia S; Pedriali, Fabiana R; Urbano, Mariana R; Moreira, Eliane H; Averbeck, Marcio A; Almeida, Silvio Henrique M

    2018-01-01

    To assess the effects of a Pilates exercise program compared to conventional pelvic floor muscle training (PFMT) protocol on pelvic floor muscle strength (PFMS) in patients with post-prostatectomy urinary incontinence. Patients were randomized into three treatment groups (G1: Pilates, G2: electrical stimulation combined with PFMT, and G3: control group). Duration of therapy was 10 weeks. Baseline assessment included the 24 h pad-test and the ICI-Q questionnaire. PFMS was measured using a manometric perineometry device at baseline and 4 months after radical prostatectomy (RP). The level of significance was P < 0.05. One hundred twenty three patients were randomized and 104 patients completed the study protocol (G1: n = 34; G2: n = 35; G3: n = 35). Post-treatment assessment showed statistically significant improvements in maximum strength in G2, increased endurance in G1 and G2, and increment of muscle power in all three groups (P < 0.05). However, there were no significant differences in the mean changes of maximum strength, endurance, and muscle power between groups after treatment (P > 0.05). G1 and G2 achieved a higher number of fully continent patients than G3 (P < 0.05). At the end of treatment, 59% of patients in G1, 54% in G2, and 26% in G3 were continent (no pads/day). Improvements in PFMS parameters were distinct among active treatment groups versus controls, but did not predict recovery of urinary continence at final assessment. The Pilates method promoted similar outcomes in the proportion of fully continent patients when compared to conventional PFMT 4 months after RP. © 2017 Wiley Periodicals, Inc.

  16. Kinetics of nitrous oxide (N2O) formation and reduction by Paracoccus pantotrophus.

    PubMed

    Read-Daily, B L; Sabba, F; Pavissich, J P; Nerenberg, R

    2016-12-01

    Nitrous oxide (N 2 O) is a powerful greenhouse gas emitted from wastewater treatment, as well as natural systems, as a result of biological nitrification and denitrification. While denitrifying bacteria can be a significant source of N 2 O, they can also reduce N 2 O to N 2 . More information on the kinetics of N 2 O formation and reduction by denitrifying bacteria is needed to predict and quantify their impact on N 2 O emissions. In this study, kinetic parameters were determined for Paracoccus pantotrophus, a common denitrifying bacterium. Parameters included the maximum specific reduction rates, [Formula: see text], growth rates, [Formula: see text], and yields, Y, for reduction of NO 3 - (nitrate) to nitrite (NO 2 - ), NO 2 - to N 2 O, and N 2 O to N 2 , with acetate as the electron donor. The [Formula: see text] values were 2.9 gN gCOD -1 d -1 for NO 3 - to NO 2 - , 1.4 gN gCOD -1  d -1 for NO 2 - to N 2 O, and 5.3 gN gCOD -1  d -1 for N 2 O to N 2 . The [Formula: see text] values were 2.7, 0.93, and 1.5 d -1 , respectively. When N 2 O and NO 3 - were added concurrently, the apparent (extant) kinetics, [Formula: see text], assuming reduction to N 2 , were 6.3 gCOD gCOD -1  d -1 , compared to 5.4 gCOD gCOD -1  d -1 for NO 3 - as the sole added acceptor. The [Formula: see text] was 1.6 d -1 , compared to 2.5 d -1 for NO 3 - alone. These results suggest that NO 3 - and N 2 O were reduced concurrently. Based on this research, denitrifying bacteria like P. pantotrophus may serve as a significant sink for N 2 O. With careful design and operation, treatment plants can use denitrifying bacteria to minimize N 2 O emissions.

  17. Energy-efficient Data-intensive Computing with a Fast Array of Wimpy Nodes

    DTIC Science & Technology

    2011-10-01

    sleep states provided by the Intel Atom chipset (between 2– 4 W) to turn off machines and migrate workloads during idle periods and low utilization...are generated. 81 0 200 400 600 800 1000 1200 IO PS in T ho us an ds Threads 1 2 4 8 16 32 64 Solid = Multi, Dashed = Single QD/T = 1 QD/T = 2...600 700 800 900 1000 L a te n c y ( in u s ) K Lookups/sec R1G8 R2G8 R4G8 R8G8 R16G8 R32G8 R64G8 (a) Multiget=2 (b) Multiget= 4 (c) Multiget=8 0

  18. 14 CFR Appendix F to Part 91 - Helicopter Flight Recorder Specifications

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...-a) 1 25 to 150 ft. Magnetic Heading 360° ±5° 1 1° Vertical Acceleration −3g to +6g ±0.2g in addition to ±0.3g maximum datum 4 (or 1 per second where peaks, ref. to 1g are recorded) 0.05g. Longitudinal...

  19. Evaluation of gaseous chlorine dioxide for the inactivation of Tulane virus on blueberries.

    PubMed

    Kingsley, David H; Pérez-Pérez, Rafael E; Niemira, Brendan A; Fan, Xuetong

    2018-05-20

    To determine the effectiveness of gaseous chlorine dioxide (gClO 2 ) against a human norovirus surrogate on produce, gClO 2 was generated and applied to Tulane virus-coated blueberries in a 240 ml-treatment chamber. gClO 2 was produced by an acidifying sodium chlorite solution. Initial assessments indicated that blueberries treated with gClO 2 generated from ≤1 mg acidified sodium chlorite in the small chamber appeared unaffected while gClO 2 generated from ≥10 mg of acidified sodium chlorite solution altered the appearance and quality of the blueberries. Treatments of inoculated blueberries with gClO 2 generated from 0.1 mg sodium chlorite reduced the virus populations by >1 log after exposure for 30 to 330 min. For the 1 mg sodium chlorite treatments, the virus populations were reduced by >2.2 log after 15 min exposure and to non-detectable levels (>3.3 logs reductions) after 180 min exposure. Measured concentrations of gClO 2 peaked in the treatment chamber at 0.9 μg/l after 10 min for 0.1 mg treatments and 600 μg/l after around 20 min for 1 mg treatment. Overall results indicate that gClO 2 could be a feasible waterless intervention for blueberries and other produce. Published by Elsevier B.V.

  20. Mistletoe lectins enhance immune responses to intranasally co-administered herpes simplex virus glycoprotein D2

    PubMed Central

    Lavelle, E C; Grant, G; Pusztai, A; Pfüller, U; Leavy, O; McNeela, E; Mills, K H G; O'Hagan, D T

    2002-01-01

    The mucosal adjuvant properties of the three type 2 ribosome-inactivating proteins (RIPs) from the European mistletoe, Viscum album L., were investigated. Mistletoe lectins were compared with cholera toxin (CT) as adjuvants when delivered nasotracheally together with herpes simplex virus glycoprotein D2 (gD2). All three mistletoe lectins (MLI, MLII, MLIII) were potent mucosal adjuvants. Co-administration of MLI, MLII or MLIII with gD2 led to significantly higher levels of gD2-specific mucosal immunoglobulin A (IgA) and systemic immunoglobulin G (IgG) antibody than when the antigen was delivered alone. The levels of antibodies induced were similar to those generated in mice immunized with gD2 and the potent mucosal adjuvant CT. Administration of ML1 with gD2 enhanced the antigen-specific splenic T-cell proliferative response. Interleukin-5 (IL-5), but not interferon-γ (IFN-γ), was detected in supernatants from splenocytes stimulated in vitro with gD2. This indicates that MLI enhanced type 2 T-helper cell (Th2) responses to the bystander antigen, gD2. Analysis of the gD2- and lectin-specific IgG subclass titres in mice immunized with gD2 and MLI, MLII or MLIII revealed a high ratio of IgG1 : IgG2a, which is compatible with the selective induction of Th2-type immune responses. PMID:12383207

  1. The Vaporization of B2O3(l) to B2O3(g) and B2O2(g)

    NASA Technical Reports Server (NTRS)

    Jacobson, Nathan S.; Myers, Dwight L.

    2011-01-01

    The vaporization of B2O3 in a reducing environment leads to formation of both B2O3(g) and B2O2(g). While formation of B2O3(g) is well understood, many questions about the formation of B2O2(g) remain. Previous studies using B(s) + B2O3(l) have led to inconsistent thermodynamic data. In this study, it was found that after heating, B(s) and B2O3(l) appear to separate and variations in contact area likely led to the inconsistent vapor pressures of B2O2(g). To circumvent this problem, an activity of boron is fixed with a two-phase mixture of FeB and Fe2B. Both second and third law enthalpies of formation were measured for B2O2(g) and B2O3(g). From these the enthalpies of formation at 298.15 K are calculated to be -479.9 +/- 41.5 kJ/mol for B2O2(g) and -833.4 +/- 13.1 kJ/mol for B2O3(g). Ab initio calculations to determine the enthalpies of formation of B2O2(g) and B2O3(g) were conducted using the W1BD composite method and show good agreement with the experimental values.

  2. Assessment of the Adherence of Cardiologists to Guidelines for the Treatment of Atrial Fibrillation

    PubMed Central

    van der Sand, Cézar R.; Leiria, Tiago Luiz Luz; Kalil, Renato Abdala Karam

    2013-01-01

    Background No local studies evaluating the knowledge of cardiologists on the management of atrial fibrillation (AF) and their adherence to these guidelines are available. Objective To evaluate the knowledge of cardiologists on the guidelines and clinical practices for the treatment of AF, correlating it to the time since medical graduation. Methods Cross-sectional study randomly including cardiologists affiliated to the Society of Cardiology of the State of Rio Grande do Sul (Sociedade de Cardiologia do Estado do Rio Grande do Sul - SOCERGS). The physicians were divided into two groups, according to time since graduation: those graduated for more (G1) or less (G2) than 25 years. Results Of the 859 SOCERGS members, 150 were interviewed, and six refused to participate in the study. G1 comprised 71 physicians, and G2, 73. Differences were observed in regard to the following variables: use of betablockers as the first-choice drug for the control of AF response in 59.2% (G1) vs 91.8% (G2) (p<0.0001); use of digoxin as the preferred drug for the control of AF response in 19.7% (G1) vs 0% (G2) (p< 0.0001); warfarin as the preferred anticoagulant in 71.8% (G1) vs 93.2% (G2) (p=0.009); application of a risk score for anticoagulation in 73.2% (G1) vs 87.7% (G2) (p=0.02). In questions regarding the knowledge about the Brazilian Society of Cardiology's guideline for AF, the overall percentage of right answers was 82.3%. Conclusion Most of the clinical measures regarding the management of AF comply with the guidelines, and the clinical practice differs according with the time since graduation. PMID:23877745

  3. Cone Quasi-Concave Multi-Objective Programming Theory and Dominance Cone Constructions.

    DTIC Science & Technology

    1988-08-01

    generalized cone concavity and nondominated solutions for later use in our development. We also derive some properties of generalized cone concavity. A set S...A-quasiconcave on S" if g(.x 1+(1-X)x 2)-Min{g(x0), g(x 2)) e IntA forallxl*x 2 E SandX e (0,1), where (in ( gi (x’), gi (x2)) Min [g (0i), g (x2 ) - 1...will lead to elimination of the points of J3 by using the dominance cone W3 . Associated with W3 , only the points of J1 and J2 are nondominated, and

  4. A facile approach to nanoarchitectured three-dimensional graphene-based Li-Mn-O composite as high-power cathodes for Li-ion batteries.

    PubMed

    Zhang, Wenyu; Zeng, Yi; Xu, Chen; Xiao, Ni; Gao, Yiben; Li, Lain-Jong; Chen, Xiaodong; Hng, Huey Hoon; Yan, Qingyu

    2012-01-01

    We report a facile method to prepare a nanoarchitectured lithium manganate/graphene (LMO/G) hybrid as a positive electrode for Li-ion batteries. The Mn(2)O(3)/graphene hybrid is synthesized by exfoliation of graphene sheets and deposition of Mn(2)O(3) in a one-step electrochemical process, which is followed by lithiation in a molten salt reaction. There are several advantages of using the LMO/G as cathodes in Li-ion batteries: (1) the LMO/G electrode shows high specific capacities at high gravimetric current densities with excellent cycling stability, e.g., 84 mAh·g(-1) during the 500th cycle at a discharge current density of 5625 mA·g(-1) (~38.01 C capacity rating) in the voltage window of 3-4.5 V; (2) the LMO/G hybrid can buffer the Jahn-Teller effect, which depicts excellent Li storage properties at high current densities within a wider voltage window of 2-4.5 V, e.g., 93 mAh·g(-1) during the 300th cycle at a discharge current density of 5625 mA·g(-1) (~38.01 C). The wider operation voltage window can lead to increased theoretical capacity, e.g., 148 mAh·g(-1) between 3 and 4.5 V and 296 mAh·g(-1) between 2 and 4.5 V; (3) more importantly, it is found that the attachment of LMO onto graphene can help to reduce the dissolution of Mn(2+) into the electrolyte, as indicated by the inductively coupled plasma (ICP) measurements, and which is mainly attributed to the large specific surface area of the graphene sheets.

  5. Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

    PubMed

    Peng, Liu; Wei, He; Liren, Li

    2014-01-01

    To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

  6. First measurement of helium on Mars: Implications for the problem of radiogenic gases on the terrestrial planets

    NASA Technical Reports Server (NTRS)

    Bowyer, S.; Chakrabarti, S.; Gladstone, G. R.; Mcdonald, J. S.

    1994-01-01

    The 108 photons of the Martian He 584 A airglow detected by the Extreme Ultraviolet Explorer satellite during a two-day exposure (22-23 Jan. 1993) correspond to the effective disk average intensity of 43 (+/-) 10 Rayleigh. Radiative transfer calculations, using a model atmosphere appropriate to the conditions of the observation and having an exospheric temperature of 210 (+/-) 20 K, result in an He mixing ratio of 1.1 (+/-) 0.4 ppm in the lower atmosphere. Nonthermal escape of helium is due to the following: electron impact ionization and pickup of He(+) by the solar wind; collisions with hot oxygen atoms; and charge exchange with molecular species with corresponding column loss rates of 1.4 x 10(exp 5), 3 x 10(exp 4), and 7 x 10(exp 3) cm(exp -2)s(exp -1), respectively. The lifetime of helium on Mars is 5 x 10(exp 4) yr. The He outgassing rate, coupled with the Ar-40 atmospheric abundance and with the K:U:Th ratio measured in the surface rocks, is used as input to a simple two-reservoir degassing model which presumes the loss of all argon accumulated in the atmosphere during the first Byr by large-scale impacts. The model results in total planet mass ratios of 10(exp -5) g/g for K, 2.3 x 10(exp -9) g/g for U, 8.5 x 10(exp -9) g/g for Th, 4 x 10(exp -10) g/g for He, and 1.5 x 10(exp -9) g/g for Ar-40. The predicted radiogenic heat flux is 2 erg cm(exp -2)s(exp -1). Similar modeling for Venus results in total plant mass ratios of 4.7 x 10(exp -5) g/g for K, 6.7 x 10(exp -9) g/g for U, 2.2 x 10(exp -8) g/g for Th, 1.3 x 10(exp -9) for He, 6.7 x 10(exp -9) g/g for Ar-40, and a radiogenic heat flux of 15 erg cm(exp -2)s(exp -1). The implications of these results are discussed. The modeling shows that the radioactive elements were not distributed uniformly in the protoplanetary nebula, and their relative abundances differ very much in the terrestrial planets.

  7. Concentrations of and application protocols for hydrogen peroxide bleaching gels: effects on pulp cell viability and whitening efficacy.

    PubMed

    Soares, Diana Gabriela; Basso, Fernanda Gonçalves; Hebling, Josimeri; de Souza Costa, Carlos Alberto

    2014-02-01

    To assess the whitening effectiveness and the trans-enamel/trans-dentinal toxicity of experimental tooth-bleaching protocols on pulp cells. Enamel/dentine discs individually adapted to trans-well devices were placed on cultured odontoblast-like cells (MDPC-23) or human dental pulp cells (HDPCs). The following groups were formed: G1 - no treatment (control); G2 to G4 - 35% H2O2, 3 × 15, 1 × 15, and 1 × 5 min, respectively; and G5 to G7 - 17.5% H2O2, 3 × 15, 1 × 15, and 1 × 5 min, respectively. Cell viability and morphology were evaluated immediately after bleaching (T1) and 72 h thereafter (T2). Oxidative stress and cell membrane damage were also assessed (T1). The amount of H2O2 in culture medium was quantified (Mann-Whitney; α=5%) and colour change (ΔE) of enamel was analysed after 3 sessions (Tukey's test; α=5%). Cell viability reduction, H2O2 diffusion, cell morphology alteration, oxidative stress, and cell membrane damage occurred in a concentration-/time-dependent fashion. The cell viability reduction was significant in all groups for HDPCs and only for G2, G3, and G5 in MDPC-23 cells compared with G1. Significant cell viability and morphology recovery were observed in all groups at T2, except for G2 in HDPCs. The highest ΔE value was found in G2. However, all groups presented significant ΔE increases compared with G1. Shortening the contact time of a 35%-H2O2 gel for 5 min, or reducing its concentration to 17.5% and applying it for 45, 15, or 5 min produce gradual tooth colour change associated with reduced trans-enamel and trans-dentinal cytotoxicity to pulp cells. The experimental protocols tested in the present study provided significant tooth-bleaching improvement associated with decreased toxicity to pulp cells, which may be an interesting alternative to be tested in clinical situations intended to reduce tooth sensitivity and pulp damage. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Patient-Specific Neutralizing Antibody Responses to Herpes Simplex Virus Are Attributed to Epitopes on gD, gB, or Both and Can Be Type Specific.

    PubMed

    Cairns, Tina M; Huang, Zhen-Yu; Gallagher, John R; Lin, Yixin; Lou, Huan; Whitbeck, J Charles; Wald, Anna; Cohen, Gary H; Eisenberg, Roselyn J

    2015-09-01

    Herpes simplex virus 1 (HSV-1) and HSV-2 infect many humans and establish a latent infection in sensory ganglia. Although some infected people suffer periodic recurrences, others do not. Infected people mount both cell-mediated and humoral responses, including the production of virus-neutralizing antibodies (Abs) directed at viral entry glycoproteins. Previously, we examined IgGs from 10 HSV-seropositive individuals; all neutralized virus and were directed primarily against gD or gD+gB. Here, we expand our studies and examine 32 additional sera from HSV-infected individuals, 23 of whom had no recurrent disease. Using an Octet RED96 system, we screened all 32 serum samples directly for both glycoprotein binding and competition with known neutralizing anti-gD and -gB monoclonal Abs (MAbs). On average, the recurrent cohort exhibited higher binding to gD and gB and had higher neutralization titers. There were similar trends in the blocking of MAbs to critical gD and gB epitopes. When we depleted six sera of Abs to specific glycoproteins, we found different types of responses, but always directed primarily at gD and/or gB. Interestingly, in one dual-infected person, the neutralizing response to HSV-2 was due to gD2 and gB2, whereas HSV-1 neutralization was due to gD1 and gB1. In another case, virus neutralization was HSV-1 specific, with the Ab response directed entirely at gB1, despite this serum blocking type-common anti-gD and -gB neutralizing MAbs. These data are pertinent in the design of future HSV vaccines since they demonstrate the importance of both serotypes of gD and gB as immunogens. We previously showed that people infected with HSV produce neutralizing Abs directed against gD or a combination of gD+gB (and in one case, gD+gB+gC, which was HSV-1 specific). In this more extensive study, we again found that gD or gD+gB can account for the virus neutralizing response and critical epitopes of one or both of these proteins are represented in sera of naturally infected humans. However, we also found that some individuals produced a strong response against gB alone. In addition, we identified type-specific contributions to HSV neutralization from both gD and gB. Contributions from the other entry glycoproteins, gC and gH/gL, were minimal and limited to HSV-1 neutralization. Knowing the variations in how humans see and mount a response to HSV will be important to vaccine development. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. A detailed investigation of light-harvesting efficiency of blue color emitting divergent iridium dendrimers with peripheral phenylcarbazole units.

    PubMed

    Cho, Yang-Jin; Wee, Kyung-Ryang; Son, Ho-Jin; Cho, Dae Won; Kang, Sang Ook

    2014-03-14

    The increase in phosphorescence efficiency was estimated by the energy transfer mechanism for divergent iridium dendrimers with peripheral phenylcarbazole units. A series of Ir-core/phenylcarbazole-end dendrons of the type, Ir(dfppy)2(pic-Czn) (Gn, n = 0, 1, 2, and 3), was synthesized, where dfppy, pic, and Czn (n = 2, 4, and 8) are 2-(4,6-difluorophenyl)pyridine, picolinate substituted with Czn at the 3-position, and 4-(9-carbazolyl)phenyldendrons connected with 3,5-di(methyleneoxy)benzyloxy branches, respectively. Selective excitation of the Czn units of G1–G3 resulted in >90% quenching of the Cz fluorescence accompanied by the growth of phosphorescence from the Ir(dfppy)2(pic) core as a consequence of energy transfer from the excited-singlet Czn chromophore to the core. The rate constants of energy transfer were determined by steady-state and transient spectroscopic measurements to be 4.32 × 10(9) s(−1) (G1), 2.37 × 10(9) s(−1) (G2), and 1.46 × 10(9) s(−1) (G3), which were in good agreement with those calculated using the Förster model. The phosphorescence enhancements were 157 (G1), 213 (G2), and 264% (G3) when compared to the phosphorescence of the core Ir(dfppy)2(pic-Ph2) (G0), in which pic-Ph2 is 3-(3,5-dibenzyloxybenzyl)picolinate.

  10. The influence of time and cement type on push-out bond strength of fiber posts to root dentin.

    PubMed

    Leme, A A; Coutinho, M; Insaurralde, A F; Scaffa, P M C; da Silva, L M

    2011-01-01

    The bond strength of fiber posts luted with resin cements was evaluated after two storage times in different regions of a post space. A total of 40 single-rooted human teeth were endodontically treated and prepared for cementation of fiber posts (White Post DC). In groups 1 and 3 (G1 and G3, respectively), posts were luted with RelyX ARC, whereas the posts in groups 2 and 4 (G2 and G4, respectively) were luted with RelyX Unicem. After one month of storage at 100% humidity, G1 and G2 were transversally sectioned in 1.7-mm slices of the cervical (C), middle (M), and apical (A) thirds of the post space and submitted to push-out testing at 1 mm/min. After nine months of storage, the roots of G3 and G4 underwent the same process. Mean values were analyzed using the Mann-Whitney and Kruskal-Wallis tests (α=0.05). The bond strengths in G2 (C=4.26±2.29; M=4.67±3.54; A=7.27±4.30) were statistically higher than in G1 (C=3.81±1.07; M=1.57±1.62; A=1.99±1.60) in the middle and apical thirds (p=0.001). Bond strengths in G4 (C=3.36±1.39; M=4.49±2.17; A=3.83±1.92) were higher than in G3 (C=2.13±0.47; M=0.94±1.05; A=0.95±1.02) in all evaluated regions (p=0.02, p<0.001, and p<0.001, respectively). When comparing the root regions for each group, G1 had higher values in the cervical third than the middle third (p=0.02). The self-adhesive resin cement showed better results than the conventional resin cement at both storage times. For both materials a similar performance among the three root regions was found. Storage time did not influence the shear bond strength.

  11. IgG abnormality in narcolepsy and idiopathic hypersomnia.

    PubMed

    Tanaka, Susumu; Honda, Makoto

    2010-03-05

    A close association between narcolepsy and the Human Leukocyte Antigen (HLA)-DQB1*0602 allele suggests the involvement of the immune system, or possibly an autoimmune process. We investigated serum IgG levels in narcolepsy. We measured the serum total IgG levels in 159 Japanese narcolepsy-cataplexy patients positive for the HLA-DQB1*0602 allele, 28 idiopathic hypersomnia patients with long sleep time, and 123 healthy controls (the HLA-DQB1*0602 allele present in 45 subjects). The serum levels of each IgG subclass were subsequently measured. The distribution of serum IgG was significantly different among healthy controls negative for the HLA-DQB1*0602 allele (11.66+/-3.55 mg/ml), healthy controls positive for the HLA-DQB1*0602 allele (11.45+/-3.43), narcolepsy patients (9.67+/-3.38), and idiopathic hypersomnia patients (13.81+/-3.80). None of the following clinical variables, age, disease duration, Epworth Sleepiness Scale, smoking habit and BMI at the time of blood sampling, were associated with IgG levels in narcolepsy or idiopathic hypersomnia. Furthermore we found the decrease in IgG1 and IgG2 levels, stable expression of IgG3, and the increase in the proportion of IgG4 in narcolepsy patients with abnormally low IgG levels. The increase in the proportion of IgG4 levels was also found in narcolepsy patients with normal serum total IgG levels. Idiopathic hypersomnia patients showed a different pattern of IgG subclass distribution with high IgG3 and IgG4 level, low IgG2 level, and IgG1/IgG2 imbalance. Our study is the first to determine IgG abnormalities in narcolepsy and idiopathic hypersomnia by measuring the serum IgG levels in a large number of hypersomnia patients. The observed IgG abnormalities indicate humoral immune alterations in narcolepsy and idiopathic hypersomnia. Different IgG profiles suggest immunological differences between narcolepsy and idiopathic hypersomnia.

  12. Disentangling the body weight-bone mineral density association among breast cancer survivors: an examination of the independent roles of lean mass and fat mass

    PubMed Central

    2013-01-01

    Background Bone mineral density (BMD) and lean mass (LM) may both decrease in breast cancer survivors, thereby increasing risk of falls and fractures. Research is needed to determine whether lean mass (LM) and fat mass (FM) independently relate to BMD in this patient group. Methods The Health, Eating, Activity, and Lifestyle Study participants included 599 women, ages 29–87 years, diagnosed from 1995–1999 with stage 0-IIIA breast cancer, who underwent dual-energy X-ray absorptiometry scans approximately 6-months postdiagnosis. We calculated adjusted geometric means of total body BMD within quartiles (Q) of LM and FM. We also stratified LM-BMD associations by a fat mass index threshold that tracks with obesity (lower body fat: ≤12.9 kg/m2; higher body fat: >12.9 kg/m2) and stratified FM-BMD associations by appendicular lean mass index level corresponding with sarcopenia (non-sarcopenic: ≥ 5.45 kg/m2 and sarcopenic: < 5.45 kg/m2). Results Higher LM (Q4 vs. Q1) was associated with higher total body BMD overall (1.12 g/cm2 vs. 1.07 g/cm2, p-trend < 0.0001), and among survivors with lower body fat (1.13 g/cm2 vs. 1.07 g/cm2, p-trend < 0.0001) and higher body fat (1.15 g/cm2 vs. 1.08 g/cm2, p-trend = 0.004). Higher FM (Q4 vs. Q1) was associated with higher total body BMD overall (1.12 g/cm2 vs. 1.07 g/cm2, p-trend < 0.0001) and among non-sarcopenic survivors (1.15 g/cm2 vs. 1.08 g/cm2, p < 0.0001), but the association was not significant among sarcopenic survivors (1.09 g/cm2 vs. 1.04 g/cm2, p-trend = 0.18). Conclusion Among breast cancer survivors, higher LM and FM were independently related to higher total body BMD. Future exercise interventions to prevent bone loss among survivors should consider the potential relevance of increasing and preserving LM. PMID:24161130

  13. Pharmacokinetic comparison between quercetin and quercetin 3-O-β-glucuronide in rats by UHPLC-MS/MS

    NASA Astrophysics Data System (ADS)

    Yang, Le-Le; Xiao, Na; Li, Xiao-Wei; Fan, Yong; Alolga, Raphael N.; Sun, Xiao-Yue; Wang, Shi-Lei; Li, Ping; Qi, Lian-Wen

    2016-10-01

    Quercetin is a natural flavonoid widely distributed in human diet and functional foods. Quercetin 3-O-β-glucuronide (Q3G) is present in wine and some medicinal plants. Quercetin and Q3G may be metabolized from each other in vivo. While quercetin has been the subject of many studies, the pharmacokinetic profiles of quercetin and Q3G (in animals) have not yet been compared. Herein, we prepared a column-based method for rapid isolation of Q3G from Nelumbo nucifera. Then, we developed an UHPLC-MS/MS method to compare the pharmacokinetics of quercetin and Q3G. Our results showed that the plasma concentration-time curves of quercetin and Q3G show two maxima (Tmax1 ≈ 0.75 h, Tmax2 ≈ 5 h). After oral administration of 100 mg/kg quercetin or 100 mg/kg Q3G in rats, predominantly Q3G was detected in plasma with AUC at 39529.2 ± 6108.2 mg·h·L-1 or 24625.1 ± 1563.8 mg·h·L-1, 18-fold higher than quercetin with AUC at 1583.9 ± 583.3 mg·h·L-1 or 1394.6 ± 868.1 mg·h·L-1, respectively. After intravenous injection of 10 mg/kg in rats, Q3G showed extensive tissue uptake in kidney (409.2 ± 118.4 ng/g), liver (166.1 ± 52.9 ng/g), heart (97.7 ± 22.6 ng/g), and brain (5.8 ± 1.2 ng/g). In conclusion, we have shown that Q3G is a major active component in plasma and tissue for oral administration of quercetin or Q3G.

  14. Nickel cobaltite nanosheets strongly anchored on boron and nitrogen co-doped graphene for high-performance asymmetric supercapacitors

    NASA Astrophysics Data System (ADS)

    Jiao, Xinyan; Xia, Xifeng; Liu, Peng; Lei, Wu; Ouyang, Yu; Hao, Qingli

    2017-08-01

    Strongly coupled boron and nitrogen co-doped graphene (BN-G) hybrids with nickel cobaltite (NiCo2O4) nanosheets (NCO/BN-G) were fabricated by a facile soft-chemical method for asymmetric supercapacitors with high-performance. The strong interaction between BN-G and NiCo2O4 nanosheets are explored by various techniques. The effect of heteroatom doping on electrochemical properties of the hybrids is systematically investigated. The strong synergistic effect between NiCo2O4 and BN-G leads to a specific capacitance of 106.5 mA h g-1 at the current density of 0.5 A g-1 and capacitance retention of 96.8% after 10 000 cycles at 5 A g-1, much better than those of the pure NiCo2O4 and its hybrid with N-doped graphene. Moreover, an asymmetric supercapacitor device, assembled with NCO/BN-G and activated carbon (NCO/BN-G//AC), exhibits a maximum energy density of 45.6 Wh kg-1 and an excellent cycling stability. The improved electrochemical performance of the NCO/BN-G hybrid is attributed to the good conductivity of BN-G and the synergistic effect between NiCo2O4 nanosheets and BN-G combined together through a plane-to-plane contact mode.

  15. Comparison of efficacy of once daily multimatrix mesalazine 2.4 g/day and 4.8 g/day with other 5-aminosalicylic acid preparation in active ulcerative colitis: a randomized, double-blind study.

    PubMed

    Ogata, Haruhiko; Yokoyama, Tadashi; Mizushima, Seiichi; Hagino, Atsushi; Hibi, Toshifumi

    2018-04-01

    This study compared the efficacy of multimatrix mesalazine 2.4 g/day and 4.8 g/day with controlled-release mesalazine 2.25 g/day. In this multicenter, randomized, double-blind study, 251 patients with mildly to moderately active ulcerative colitis received multimatrix mesalazine 2.4 g/day once daily (Multimatrix-2.4), 4.8 g/day once daily (Multimatrix-4.8), or controlled-release (time-dependent) mesalazine 2.25 g/day 3 times daily (Time-2.25) for 8 weeks. The primary efficacy endpoint was the change in the ulcerative colitis-disease activity index (UC-DAI) score. The mean change in the UC-DAI score and standard deviation in the per protocol set was -1.9±2.5 for Multimatrix-2.4 and -2.4±2.8 for Time-2.25. The difference between Multimatrix-2.4 and Time-2.25 was 0.3 (two-sided 95% confidence interval [CI], -0.5 to 1.1), thus non-inferiority was not demonstrated based on the pre-defined non-inferiority margin (1.0). In the full analysis set, the difference between Multimatrix-4.8 and Time-2.25 was -1.2 (two-sided 95% CI, -2.0 to -0.5), and the mean change in UC-DAI score in the FAS was -3.3 (two-sided 95% CI, -3.9 to -2.8) for Multimatrix-4.8 and -1.9 (two-sided 95% CI, -2.5 to -1.3) for Multimatrix-2.4, indicating that Multimatrix-4.8 was more effective than Time-2.25 and Multimatrix-2.4. There was no difference among the treatment groups in terms of safety. This study showed that the efficacy of multimatrix mesalazine 2.4 g/day was comparable to controlled release mesalazine 2.25 g/day, although non-inferiority was not demonstrated. Importantly, this was the first study to indicate that multimatrix mesalazine 4.8 g/day was more effective than 2.4g/day with no associated safety concerns.

  16. Differential activation of G-proteins by mu-opioid receptor agonists.

    PubMed

    Saidak, Zuzana; Blake-Palmer, Katherine; Hay, Debbie L; Northup, John K; Glass, Michelle

    2006-03-01

    We investigated the ability of the activated mu-opioid receptor (MOR) to differentiate between myristoylated G(alphai1) and G(alphaoA) type G(alpha) proteins, and the maximal activity of a range of synthetic and endogenous agonists to activate each G(alpha) protein. Membranes from HEK293 cells stably expressing transfected MOR were chaotrope extracted to denature endogenous G-proteins and reconstituted with specific purified G-proteins. The G(alpha) subunits were generated in bacteria and were demonstrated to be recognised equivalently to bovine brain purified G(alpha) protein by CB(1) cannabinoid receptors. The ability of agonists to catalyse the MOR-dependent GDP/[(35)S]GTP(gamma)S exchange was then compared for G(alphai1) and G(alphaoA). Activation of MOR by DAMGO produced a high-affinity saturable interaction for G(alphaoA) (K(m)=20+/-1 nM) but a low-affinity interaction with G(alphai1) (K(m)=116+/-12 nM). DAMGO, met-enkephalin and leucine-enkephalin displayed maximal G(alpha) activation among the agonists evaluated. Endomorphins 1 and 2, methadone and beta-endorphin activated both G(alpha) to more than 75% of the maximal response, whereas fentanyl partially activated both G-proteins. Buprenorphine and morphine demonstrated a statistically significant difference between the maximal activities between G(alphai1) and G(alphaoA). Interestingly, DAMGO, morphine, endomorphins 1 and 2, displayed significant differences in the potencies for the activation of the two G(alpha). Differences in maximal activity and potency, for G(alphai1) versus G(alphaoA), are both indicative of agonist selective activation of G-proteins in response to MOR activation. These findings may provide a starting point for the design of drugs that demonstrate greater selectivity between these two G-proteins and therefore produce a more limited range of effects.

  17. ROTAVIRUS GENOTYPES CIRCULATING IN BRAZIL, 2007-2012: IMPLICATIONS FOR THE VACCINE PROGRAM

    PubMed Central

    LUCHS, Adriana; CILLI, Audrey; MORILLO, Simone Guadagnucci; CARMONA, Rita de Cássia Compagnoli; TIMENETSKY, Maria do Carmo Sampaio Tavares

    2015-01-01

    SUMMARY Regarding public health in Brazil, a new scenario emerged with the establishment of universal rotavirus (RV) vaccination programs. Herein, the data from the five years of surveillance (2007-2012) of G- and P-type RV strains isolated from individuals with acute gastroenteritis in Brazil are reported. A total of 6,196 fecal specimens were investigated by ELISA and RT-PCR. RVs were detected in 19.1% (1,181/6,196). The peak of RV incidence moved from June-August to September. RV was detected less frequently (19.5%) among children ≤ 5 years than in older children and adolescents (6-18 years) (40.6%). Genotype distribution showed a different profile for each year: G2P[4] strains were most prevalent during 2007-2010, G9P[8] in 2011, and G12P[8] in 2012. Mixed infections (G1+G2P[4], G2+G3P[4]+P[8], G2+G12P[8]), unusual combinations (G1P[4], G2P[6]), and rare strains (G3P[3]) were also identified throughout the study period. Widespread vaccination may alter the RV seasonal pattern. The finding of RV disease affecting older children and adolescents after vaccine implementation has been reported worldwide. G2P[4] emergence most likely follows a global trend seemingly unrelated to vaccination, and G12, apparently, is emerging in the Brazilian population. The rapidly changing RV genotype patterns detected during this study illustrate a dynamic population of co-circulating wildtype RVs in Brazil. PMID:26422154

  18. Analysis of permeability and morphology of root canal dentin after Er,Cr:YSGG laser irradiation.

    PubMed

    Silva, Anna Cristina Biella; Guglielmi, Camila; Meneguzzo, Daiane Thais; Aranha, Ana Cecília Corrêa; Bombana, Antônio Carlos; de Paula Eduardo, Carlos

    2010-02-01

    The aim of this study was to evaluate the morphology and permeability of root canal walls irradiated with Er,Cr:YSGG laser after conventional endodontic treatment. Laser irradiation can be used for dentinal tubule exposure, smear layer removal, and disinfection. Another potential, interesting application is as an adjunct to endodontic treatment, especially in the intracanal medication phase. Fifty-two single-rooted teeth had their crowns sectioned at the cementoenamel junction and were randomly divided into four groups (n = 13): G1: conventional preparation (CP) + irrigation with EDTA-T + rhodamine B dye solution associated with NDP (dexamethasone phosphate, paramonochlorophenol, polyethylenoglycol) (Rhod-NDP); G2: CP + EDTA-T + Er,Cr:YSGG laser irradiation 0.75 W + Rhod-NDP; G3: CP + EDTA-T + Er,Cr:YSGG 1.5 W + Rhod-NDP; G4: CP + EDTA-T + Er,Cr:YSGG 2.5 W + Rhod-NDP. For the permeability analysis (n = 9), teeth were transversely cut and two slices of each third were selected. The images were analyzed by ImageLab software (Softium Informática Ltda., São Paulo, SP, Brazil). Additional samples (n = 4) were examined by scanning electron microscopy. Data were analyzed statistically using the Kruskal-Wallis and Student-Newman-Keuls tests for the following areas: apical third (H = 23.4651): G1 (14.25)(a), G2 (17.66)(ab), G3 (26.50)(b), G4 (39.58)(c); medium (H = 23.1611): G1 (14.16)(a), G2 (16.66)(ab), G3 (28.83)(b), G4 (38.33)(b); and cervical (H = 32.4810): G1 (9.66)(a), G2 (20. 00)(ab), G3 (27.00)(b), G4 (41.33)(c), (p < 0.01). Despite the irregular aspect of laser irradiation along the canal walls, the parameters of 1.5 W and 2.5 W allowed morphologic modifications that increased dentinal permeability. Irradiation with Er,Cr:YSGG laser could be effective in endodontic treatment for increasing dentinal permeability.

  19. New Method of Calculating a Multiplication by using the Generalized Bernstein-Vazirani Algorithm

    NASA Astrophysics Data System (ADS)

    Nagata, Koji; Nakamura, Tadao; Geurdes, Han; Batle, Josep; Abdalla, Soliman; Farouk, Ahmed

    2018-06-01

    We present a new method of more speedily calculating a multiplication by using the generalized Bernstein-Vazirani algorithm and many parallel quantum systems. Given the set of real values a1,a2,a3,\\ldots ,aN and a function g:bf {R}→ {0,1}, we shall determine the following values g(a1),g(a2),g(a3),\\ldots , g(aN) simultaneously. The speed of determining the values is shown to outperform the classical case by a factor of N. Next, we consider it as a number in binary representation; M 1 = ( g( a 1), g( a 2), g( a 3),…, g( a N )). By using M parallel quantum systems, we have M numbers in binary representation, simultaneously. The speed of obtaining the M numbers is shown to outperform the classical case by a factor of M. Finally, we calculate the product; M1× M2× \\cdots × MM. The speed of obtaining the product is shown to outperform the classical case by a factor of N × M.

  20. Evaluation of the relation between lipid coat, transepidermal water loss, and skin pH.

    PubMed

    Algiert-Zielińska, Barbara; Batory, Mirella; Skubalski, Janusz; Rotsztejn, Helena

    2017-11-01

    The epidermis is an epidermal barrier which accumulates lipid substances and participates in skin moisturizing. An evaluation of the epidermal barrier efficiency can be made, among others, by the measurement of the following values: the lipid coat, the transepidermal water loss (TEWL) index, and pH. The study involved 50 Caucasian, healthy women aged 19-35 years (mean 20.56). Measurements were made using Courage & Khazaka Multi Probe Adapter MPA 580: Tewameter TM 300, pH-Meter PH 905, Sebumeter SM 815. The areas of measurements included forehead, nose, left cheek, right cheek, chin, and thigh. In the T-zone, the lipid coat was in the range between 0 and 270 μg/cm 2 (mean 128 μg/cm 2 ), TEWL between 1 and 55 g/m 2 /h (mean 11.1 g/m 2 /h), and pH 4.0-5.6 (mean 5.39). Lower values of the lipid coat up to 100 μg/cm 2 were accompanied by TEWL greater than 30 g/m 2 /h and less acidic pH of 5.6-9.0. In the U-zone the range of lipid coat was up to 200 μg/cm 2 (mean 65.2 μg/cm 2 ), the skin pH remained 4.0-5.6 (mean 5.47), and TEWL was in the range between 1 and 20 g/m 2 /h (mean 8.7 g/m 2 /h). Lower values of the lipid coat up to 100 μg/cm 2 were accompanied by TEWL between 1 and 20 g/m 2 /h and less acidic pH of 5.6-9.0. High values of the lipid coat between 180 and 200 μg/cm 2 were connected with TEWL of 1-15 g/m 2 /h. On the skin of the thigh, we observed a very thin lipid coat - 35 μg/cm 2 (mean 5.6 μg/cm 2 ), pH (mean 5.37), and TEWL (mean 8.5 g/m 2 /h) were considered by us to be within regular limits. In the T-zone, a thinner lipid coat resulted in relatively high TEWL and pH levels changing toward alkaline. In the U-zone, thinner lipid coat was accompanied by lower TEWL and pH changing toward alkaline. We also observed that lower values of lipid coat up to 100 μg/cm 2 were associated with higher pH values ranging toward the basic character pH 5.6-9.0). © 2017 The International Society of Dermatology.

Top