The low binding affinity of D-serine at the ionotropic glutamate receptor GluD2 can be attributed to the hinge region

PubMed Central

Tapken, Daniel; Steffensen, Thomas Bielefeldt; Leth, Rasmus; Kristensen, Lise Baadsgaard; Gerbola, Alexander; Gajhede, Michael; Jørgensen, Flemming Steen; Olsen, Lars; Kastrup, Jette Sandholm

2017-01-01

Ionotropic glutamate receptors (iGluRs) are responsible for most of the fast excitatory communication between neurons in our brain. The GluD2 receptor is a puzzling member of the iGluR family: It is involved in synaptic plasticity, plays a role in human diseases, e.g. ataxia, binds glycine and D-serine with low affinity, yet no ligand has been discovered so far that can activate its ion channel. In this study, we show that the hinge region connecting the two subdomains of the GluD2 ligand-binding domain is responsible for the low affinity of D-serine, by analysing GluD2 mutants with electrophysiology, isothermal titration calorimetry and molecular dynamics calculations. The hinge region is highly variable among iGluRs and fine-tunes gating activity, suggesting that in GluD2 this region has evolved to only respond to micromolar concentrations of D-serine. PMID:28387240

Interactions between Glu-1 and Glu-3 loci and associations of selected molecular markers with quality traits in winter wheat (Triticum aestivum L.) DH lines.

PubMed

Krystkowiak, Karolina; Langner, Monika; Adamski, Tadeusz; Salmanowicz, Bolesław P; Kaczmarek, Zygmunt; Krajewski, Paweł; Surma, Maria

2017-02-01

The quality of wheat depends on a large complex of genes and environmental factors. The objective of this study was to identify quantitative trait loci controlling technological quality traits and their stability across environments, and to assess the impact of interaction between alleles at loci Glu-1 and Glu-3 on grain quality. DH lines were evaluated in field experiments over a period of 4 years, and genotyped using simple sequence repeat markers. Lines were analysed for grain yield (GY), thousand grain weight (TGW), protein content (PC), starch content (SC), wet gluten content (WG), Zeleny sedimentation value (ZS), alveograph parameter W (APW), hectolitre weight (HW), and grain hardness (GH). A number of QTLs for these traits were identified in all chromosome groups. The Glu-D1 locus influenced TGW, PC, SC, WG, ZS, APW, GH, while locus Glu-B1 affected only PC, ZS, and WG. Most important marker-trait associations were found on chromosomes 1D and 5D. Significant effects of interaction between Glu-1 and Glu-3 loci on technological properties were recorded, and in all types of this interaction positive effects of Glu-D1 locus on grain quality were observed, whereas effects of Glu-B1 locus depended on alleles at Glu-3 loci. Effects of Glu-A3 and Glu-D3 loci per se were not significant, while their interaction with alleles present at other loci encoding HMW and LMW were important. These results indicate that selection of wheat genotypes with predicted good bread-making properties should be based on the allelic composition both in Glu-1 and Glu-3 loci, and confirm the predominant effect of Glu-D1d allele on technological properties of wheat grains.

Optimization of ECF bleaching of kraft pulp. Part 1, Optimal bleaching of hardwood pulps made with different alkali charges

Treesearch

Thomas J. McDonough; Shunichiro Uno; Alan W. Rudie; Charles E. Courchene

2008-01-01

In an earlier modeling study, we showed that when a hardwood kraft pulp is bleached in the D0(EO)D1ED2 sequence with a D0 stage kappa factor of 0.20, the brightness of the pulp emerging from the D2 stage can be accurately predicted from the brightness of the pulp entering that stage. The entering brightness, in turn is a well-defined function of the ratio of the D1...

Specific Roles of NMDA Receptor Subunits in Mental Disorders.

PubMed

Yamamoto, H; Hagino, Y; Kasai, S; Ikeda, K

2015-01-01

N-methyl-D-aspartate (NMDA) receptor plays important roles in learning and memory. NMDA receptors are a tetramer that consists of two glycine-binding subunits GluN1, two glutamate-binding subunits (i.e., GluN2A, GluN2B, GluN2C, and GluN2D), a combination of a GluN2 subunit and glycine-binding GluN3 subunit (i.e., GluN3A or GluN3B), or two GluN3 subunits. Recent studies revealed that the specific expression and distribution of each subunit are deeply involved in neural excitability, plasticity, and synaptic deficits. The present article summarizes reports on the dysfunction of NMDA receptors and responsible subunits in various neurological and psychiatric disorders, including schizophrenia, autoimmune-induced glutamatergic receptor dysfunction, mood disorders, and autism. A key role for the GluN2D subunit in NMDA receptor antagonist-induced psychosis has been recently revealed.

Presynaptic mGlu1 and mGlu5 autoreceptors facilitate glutamate exocytosis from mouse cortical nerve endings.

PubMed

Musante, Veronica; Neri, Elisa; Feligioni, Marco; Puliti, Aldamaria; Pedrazzi, Marco; Conti, Valerio; Usai, Cesare; Diaspro, Alberto; Ravazzolo, Roberto; Henley, Jeremy M; Battaglia, Giuseppe; Pittaluga, Anna

2008-09-01

The effects of mGlu1 and mGlu5 receptor activation on the depolarization-evoked release of [3H]d-aspartate ([3H]D-ASP) from mouse cortical synaptosomes were investigated. The mGlu1/5 receptor agonist 3,5-DHPG (0.1-100microM) potentiated the K+(12mM)-evoked [3H]D-ASP overflow. The potentiation occurred in a concentration-dependent manner showing a biphasic pattern. The agonist potentiated [3H]D-ASP exocytosis when applied at 0.3microM; the efficacy of 3,5-DHPG then rapidly declined and reappeared at 30-100microM. The fall of efficacy of agonist at intermediate concentration may be consistent with 3,5-DHPG-induced receptor desensitization. Facilitation of [3H]D-ASP exocytosis caused by 0.3microM 3,5-DHPG was prevented by the selective mGlu5 receptor antagonist MPEP, but was insensitive to the selective mGlu1 receptor antagonist CPCCOEt. In contrast, CPCCOEt prevented the potentiation by 50microM 3,5-DHPG, while MPEP had minimal effect. Unexpectedly, LY 367385 antagonized both the 3,5-DHPG-induced effects. A total of 0.3microM 3,5-DHPG failed to facilitate the K+-evoked [3H]D-ASP overflow from mGlu5 receptor knockout (mGlu5-/-) cortical synaptosomes, but not from nerve terminals prepared from the cortex of animals lacking the mGlu1 receptors, the crv4/crv4 mice. On the contrary, 50microM 3,5-DHPG failed to affect the [3H]D-ASP exocytosis from cortical synaptosomes obtained from crv4/crv4 and mGlu5-/-mice. Western blot analyses in subsynaptic fractions support the existence of both mGlu1 and mGlu5 autoreceptors located presynaptically, while immunocytochemistry revealed their presence at glutamatergic terminals. We propose that mGlu1 and mGlu5 autoreceptors exist on mouse glutamatergic cortical terminals; mGlu5 receptors may represent the "high affinity" binding sites for 3,5-DHPG, while mGlu1 autoreceptors represent the "low affinity" binding sites.

[Glycemic variability and short-term outcome in critically ill].

PubMed

Zhang, L P; Guo, Y B; Zhou, L H

2016-06-07

To analyze the association of blood glucose variability and short-term outcome in critically ill. The retrospective study including 552 patients admitted to the Affiliated Hospital of Inner Mongolia Medical University from January 2013 to March 2015. The initial blood glucose (GluAdm), the first 24 hours average blood glucose(GluMV1d) and glycemic lability index(GLI1d), 72-hour average blood glucose (GluMV3d) and glycemic lability index(GLI3d) were recorded. The receiver operating characteristic curve (ROC curve) was applied to evaluate the association between GluAdm, GLI1d, GLI3d and APACHE Ⅱ score and prognosis. The levels of APACHE Ⅱ, GluAdm, GLI 1d, GLI 3d of nonsurvivors were higher than those of survivors[(23.2±5.2) vs (16.7±4.4), (12.3±5.2)mmol/L vs(9.2±2.2)mmol/L, (23.3±12.2)vs(12.3±11.1), (21.6±19.3)vs(13.2±9.9), P<0.05]; there was no statistically significant difference between GluMV1d and GluMV3d; when ROC was applied, and the area under the curve (AUC) of APACHEⅡ, GLI1d and GLI3d were 0.826±0.035, 0.726±0.052 and 0.786±0.046, which were significantly higher than the GluMV1d and GluMV3d (0.412±0.031, 0.425±0.026, P<0.05) .It is correlated between GluAdm, GLI1d, GLI3d and the 28-day mortality, ICU days and total time of hospitalization. Blood glucose variability is closely related with the mortality in critical ill patients, GLI1d, GLI3d and APACHEⅡ score of critically ill patients have a similar predictive value in the short-term prognosis.

Ligand-specific Deactivation Time Course of GluN1/GluN2D NMDA Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

K Vance; N Simorowski; S Traynelis

2011-12-31

N-methyl-D-aspartate (NMDA) receptors belong to the family of ionotropic glutamate receptors that mediate a majority of excitatory synaptic transmission. One unique property of GluN1/GluN2D NMDA receptors is an unusually prolonged deactivation time course following the removal of L-glutamate. Here we show, using x-ray crystallography and electrophysiology, that the deactivation time course of GluN1/GluN2D receptors is influenced by the conformational variability of the ligand-binding domain (LBD) as well as the structure of the activating ligand. L-glutamate and L-CCG-IV induce significantly slower deactivation time courses compared with other agonists. Crystal structures of the isolated GluN2D LBD in complex with various ligands revealmore » that the binding of L-glutamate induces a unique conformation at the backside of the ligand-binding site in proximity to the region at which the transmembrane domain would be located in the intact receptors. These data suggest that the activity of the GluN1/GluN2D NMDA receptor is controlled distinctively by the endogenous neurotransmitter L-glutamate.« less

40 CFR 430.45 - New source performance standards (NSPS).

Code of Federal Regulations, 2012 CFR

2012-07-01

... GUIDELINES AND STANDARDS (CONTINUED) THE PULP, PAPER, AND PAPERBOARD POINT SOURCE CATEGORY Dissolving Sulfite... biocides: Subpart D [NSPS for dissolving sulfite pulp facilities where nitration grade pulp is produced... all times. Subpart D [NSPS for dissolving sulfite pulp facilities where viscose grade pulp is produced...

Role of NMDA receptor GluN2D subunit in the antidepressant effects of enantiomers of ketamine.

PubMed

Ide, Soichiro; Ikekubo, Yuiko; Mishina, Masayoshi; Hashimoto, Kenji; Ikeda, Kazutaka

2017-11-01

We investigated the rapid and sustained antidepressant effects of enantiomers of ketamine in N-methyl-d-aspartate (NMDA) receptor GluN2D subunit knockout (GluN2D-KO) mice. Intraperitoneal administration of ketamine or its enantiomers 10 min before the tail-suspension test exerted significant antidepressant effects on restraint stress-induced depression in both wildtype and GluN2D-KO mice. The antidepressant effects of (RS)-ketamine and (S)-ketamine were sustained 96 h after the injection in both wildtype and GluN2D-KO mice, but such sustained antidepressant effects of (R)-ketamine were only observed in wildtype mice. These data suggest that the GluN2D subunit is critical for the sustained antidepressant effects of (R)-ketamine. Copyright © 2017 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

[Analysis of diversity of Russian and Ukrainian bread wheat (Triticum aestivum L.) cultivars for high-molecular-weight glutenin subunits].

PubMed

Dobrotvorskaia, T V; Martynov, S P

2011-07-01

The allelic diversity of high-moleculat-weght glutenin subunits (H WIGS) in Russian and Ukrainian bread wheat cultivars was analyzed. The diversity of spring wheat cultivars for alleles of the Glu-1 loci is characterized by medium values of the polymorphism index (polymorphism information content, PlC), and in winter wheats it varies from high at the Glu-A1 locus to low at the Glu-D1 locus. The spring and winter cultivars differ significantly in the frequencies of alleles of the glutenin loci. The combination of the Glu-A1b, Glu-B1c, and Glu-D1a alleles prevails among the spring cultivars, and the combination of the Glu-A1a, Glu-B1c, and Glu-D1d alleles prevails among the winter cultivars. The distribution of the Glu-1 alleles significantly depends on the moisture and heat supply in the region of origin of the cultivars. Drought resistance is associated with the Glu-D1a allele in the spring wheat and with the Glu-B1b allele in the winter wheat. The sources of the Glu-1 alleles were identified in the spring and wheat cultivars. The analysis of independence of the distribution of the spring and winter cultivars by the market classes and by the alleles of the HMWGS loci showed a highly significant association of the alleles of three Glu-1 loci with the market classes in foreign cultivars and independence or a weak association in the Russian and Ukrainian cultivars. This seems to be due to the absence of a statistically substantiated system of classification of the domestic cultivars on the basis of their quality.

Loss of GluN2D subunit results in social recognition deficit, social stress, 5-HT2C receptor dysfunction, and anhedonia in mice.

PubMed

Yamamoto, Hideko; Kamegaya, Etsuko; Hagino, Yoko; Takamatsu, Yukio; Sawada, Wakako; Matsuzawa, Maaya; Ide, Soichiro; Yamamoto, Toshifumi; Mishina, Masayoshi; Ikeda, Kazutaka

2017-01-01

The N-methyl-d-aspartate (NMDA) receptor channel is involved in various physiological functions, including learning and memory. The GluN2D subunit of the NMDA receptor has low expression in the mature brain, and its role is not fully understood. In the present study, the effects of GluN2D subunit deficiency on emotional and cognitive function were investigated in GluN2D knockout (KO) mice. We found a reduction of motility (i.e., a depressive-like state) in the tail suspension test and a reduction of sucrose preference (i.e., an anhedonic state) in GluN2D KO mice that were group-housed with littermates. Despite apparently normal olfactory function and social interaction, GluN2D KO mice exhibited a decrease in preference for social novelty, suggesting a deficit in social recognition or memory. Golgi-Cox staining revealed a reduction of the complexity of dendritic trees in the accessory olfactory bulb in GluN2D KO mice, suggesting a deficit in pheromone processing pathway activation, which modulates social recognition. The deficit in social recognition may result in social stress in GluN2D KO mice. Isolation housing is a procedure that has been shown to reduce stress in mice. Interestingly, 3-week isolation and treatment with agomelatine or the 5-hydroxytryptamine-2C (5-HT 2C ) receptor antagonist SB242084 reversed the anhedonic-like state in GluN2D KO mice. In contrast, treatment with the 5-HT 2C receptor agonist CP809101 induced depressive- and anhedonic-like states in isolated GluN2D KO mice. These results suggest that social stress that is caused by a deficit in social recognition desensitizes 5-HT 2c receptors, followed by an anhedonic- and depressive-like state, in GluN2D KO mice. The GluN2D subunit of the NMDA receptor appears to be important for the recognition of individuals and development of normal emotionality in mice. 5-HT 2C receptor antagonism may be a therapeutic target for treating social stress-induced anhedonia. This article is part of the Special Issue entitled 'Ionotropic glutamate receptors'. Copyright © 2016 Elsevier Ltd. All rights reserved.

The influence of Glu-1 and Glu-3 loci on dough rheology and bread-making properties in wheat (Triticum aestivum L.) doubled haploid lines.

PubMed

Langner, Monika; Krystkowiak, Karolina; Salmanowicz, Bolesław P; Adamski, Tadeusz; Krajewski, Paweł; Kaczmarek, Zygmunt; Surma, Maria

2017-12-01

The major determinants of wheat quality are Glu-1 and Glu-3 glutenin loci and environmental factors. Additive effects of alleles at the Glu-1 and Glu-3 loci, as well as their interactions, were evaluated for dough rheology and baking properties in four groups of wheat doubled haploid lines differing in high- and low-molecular-weight glutenin composition. Flour quality, Reomixer (Reologica Instruments, Lund, Sweden), dough extension, Farinograph (Brabender GmbH, Duisburg, Germany) and baking parameters were determined. Groups of lines with the alleles Glu-A3b and Glu-B3d were characterized by higher values of dough and baking parameters compared to those with the Glu-A3e and Glu-B3a alleles. Effects of interactions between allelic variants at the Glu-1 and Glu-3 loci on Reomixer parameters, dough extension tests and baking parameters were significant, although additive effects of individual alleles were not always significant. The allelic variants at Glu-B3 had a much greater effect on dough rheological parameters than the variants at Glu-A3 or Glu-D3 loci. The effect of allelic variations at the Glu-D3 loci on rheological parameters and bread-making quality was non-significant, whereas their interactions with a majority of alleles at the other Glu-1 × Glu-3 loci were significant. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Buffel grass (Cenchrus ciliaria L.) substitution for orange pulp on intake, digestibility, and performance of hairsheep lambs.

PubMed

Macías-Cruz, Ulises; Quintero-Elisea, Juan A; Avendaño-Reyes, Leonel; Correa-Calderón, Abelardo; Alvarez-Valenzuela, Francisco D; Soto-Navarro, S A; Lucero-Magaña, F A; González-Reyna, Arnoldo

2010-02-01

Twenty Dorper x Pelibuey male lambs were used to evaluate the effect of substitution of forage with fresh orange pulp (FOP) in diets for fattening lambs on productive behavior, nutrient intake, apparent digestibility coefficient, and feeding costs. Lambs were divided into five groups (n = 4) and then housed in individual pens during 70 d. Treatments consisted of five levels of FOP (0, 25, 50, 75 and 100%) which substituted buffel grass hay on the base diet (40:60%, forage:concentrate). Additionally, changes in chemical composition of FOP stored in stack during 8 d were evaluated (from the day 1 until day 8). Daily feed intake expressed as kg/day and % live weight, lamb growth rate, feeding cost of each lamb per day and per fattening period, hemicellulose intake, and DM, OM, CP, NDF and hemicellulose digestibility showed a quadratic effect (P < 0.05), while DM, OM and CP intake presented a cubic effect (P < 0.05) with the increasing level of FOP. The maximum estimated value for those variables was observed at 75% of hay replacement with FOP. With respect to changes in chemical composition of pulp stored, DM content increased (P = 0.0011) from 210 to 310 g/kg FOP and OM, fiber fraction, and ash content were constant (P > 0.05) among storage days. Therefore, replacing around 75% of buffel grass hay with FOP in diets for fattening lambs resulted in the best growth rate and more efficient diet utilization. Fresh orange pulp stored in a stack did not change its chemical composition, and did not affect its utilization as a sheep feedstuff.

Dough properties and bread-making quality-related characteristics of Yumechikara near-isogenic wheat lines carrying different Glu-B3 alleles

PubMed Central

Ito, Miwako; Maruyama-Funatsuki, Wakako; Ikeda, Tatsuya M.; Nishio, Zenta; Nagasawa, Koichi; Tabiki, Tadashi

2015-01-01

We investigated the relationships of three allelic variations in Glu-B3 (ab, g, and h) with dough properties and bread-making quality-related characteristics using near-isogenic lines (NILs) of ‘Yumechikara’ that commonly carry Glu-A1a, Glu-B1b, Glu-D1d, Glu-A3f, Glu-B3ab and Glu-D3a. Measurement of peak time (PT) in a 2-g mixograph indicated that Glu-B3g was the most effective for a strong dough property, followed by Glu-B3ab, with Glu-B3h being the least effective. The results of measurement of mixing time during bread-making were similar to those for PTs, i.e., the lines carrying Glu-B3g showed the longest mixing time, followed by those of Glu-B3ab, and those of Glu-B3h showed the shortest mixing time. Since two parameters of bread-making quality, loaf volume (LV) and specific loaf volume (SLV), were affected by flour protein contents in all groups of the Glu-B3 genotype, we compared the effects of the three Glu-B3 alleles on those parameters using analysis of covariance (ANCOVA) to remove the effect of protein content. The results indicated that the Glu-B3h group showed the largest SLV, followed by the Glu-B3ab group, and the Glu-B3g group showed the smallest SLV. These results suggest that the introduction of Glu-B3h into ‘Yumechikara’ makes it possible to breed varieties with good bread-making quality-related characteristics. PMID:26175621

Engineering acidic Streptomyces rubiginosus D-xylose isomerase by rational enzyme design.

PubMed

Waltman, Mary Jo; Yang, Zamin Koo; Langan, Paul; Graham, David E; Kovalevsky, Andrey

2014-02-01

To maximize bioethanol production from lignocellulosic biomass, all sugars must be utilized. Yeast fermentation can be improved by introducing the d-xylose isomerase enzyme to convert the pentose sugar d-xylose, which cannot be fermented by Saccharomyces cerevisiae, into the fermentable ketose d-xylulose. The low activity of d-xylose isomerase, especially at the low pH required for optimal fermentation, limits its use. A rational enzyme engineering approach was undertaken, and seven amino acid positions were replaced to improve the activity of Streptomyces rubiginosus d-xylose isomerase towards its physiological substrate at pH values below 6. The active-site design was guided by mechanistic insights and the knowledge of amino acid protonation states at low pH obtained from previous joint X-ray/neutron crystallographic experiments. Tagging the enzyme with 6 or 12 histidine residues at the N-terminus resulted in a significant increase in the active-site affinity towards substrate at pH 5.8. Substituting an asparagine at position 215, which hydrogen bonded to the metal-bound Glu181 and Asp245, with an aspartate gave a variant with almost an order of magnitude lower KM than measured for the native enzyme, with a 4-fold increase in activity. Other studied variants showed similar (Asp57Asn, Glu186Gln/Asn215Asp), lower (Asp57His, Asn247Asp, Lys289His, Lys289Glu) or no (Gln256Asp, Asp287Asn, ΔAsp287) activity in acidic conditions relative to the native enzyme.

Dbo/Henji Modulates Synaptic dPAK to Gate Glutamate Receptor Abundance and Postsynaptic Response.

PubMed

Wang, Manyu; Chen, Pei-Yi; Wang, Chien-Hsiang; Lai, Tzu-Ting; Tsai, Pei-I; Cheng, Ying-Ju; Kao, Hsiu-Hua; Chien, Cheng-Ting

2016-10-01

In response to environmental and physiological changes, the synapse manifests plasticity while simultaneously maintains homeostasis. Here, we analyzed mutant synapses of henji, also known as dbo, at the Drosophila neuromuscular junction (NMJ). In henji mutants, NMJ growth is defective with appearance of satellite boutons. Transmission electron microscopy analysis indicates that the synaptic membrane region is expanded. The postsynaptic density (PSD) houses glutamate receptors GluRIIA and GluRIIB, which have distinct transmission properties. In henji mutants, GluRIIA abundance is upregulated but that of GluRIIB is not. Electrophysiological results also support a GluR compositional shift towards a higher IIA/IIB ratio at henji NMJs. Strikingly, dPAK, a positive regulator for GluRIIA synaptic localization, accumulates at the henji PSD. Reducing the dpak gene dosage suppresses satellite boutons and GluRIIA accumulation at henji NMJs. In addition, dPAK associated with Henji through the Kelch repeats which is the domain essential for Henji localization and function at postsynapses. We propose that Henji acts at postsynapses to restrict both presynaptic bouton growth and postsynaptic GluRIIA abundance by modulating dPAK.

Dbo/Henji Modulates Synaptic dPAK to Gate Glutamate Receptor Abundance and Postsynaptic Response

PubMed Central

Wang, Manyu; Chen, Pei-Yi; Wang, Chien-Hsiang; Lai, Tzu-Ting; Tsai, Pei-I; Cheng, Ying-Ju; Kao, Hsiu-Hua; Chien, Cheng-Ting

2016-01-01

In response to environmental and physiological changes, the synapse manifests plasticity while simultaneously maintains homeostasis. Here, we analyzed mutant synapses of henji, also known as dbo, at the Drosophila neuromuscular junction (NMJ). In henji mutants, NMJ growth is defective with appearance of satellite boutons. Transmission electron microscopy analysis indicates that the synaptic membrane region is expanded. The postsynaptic density (PSD) houses glutamate receptors GluRIIA and GluRIIB, which have distinct transmission properties. In henji mutants, GluRIIA abundance is upregulated but that of GluRIIB is not. Electrophysiological results also support a GluR compositional shift towards a higher IIA/IIB ratio at henji NMJs. Strikingly, dPAK, a positive regulator for GluRIIA synaptic localization, accumulates at the henji PSD. Reducing the dpak gene dosage suppresses satellite boutons and GluRIIA accumulation at henji NMJs. In addition, dPAK associated with Henji through the Kelch repeats which is the domain essential for Henji localization and function at postsynapses. We propose that Henji acts at postsynapses to restrict both presynaptic bouton growth and postsynaptic GluRIIA abundance by modulating dPAK. PMID:27736876

Site-directed mutagenesis at aspartate and glutamate residues of xylanase from Bacillus pumilus.

PubMed Central

Ko, E P; Akatsuka, H; Moriyama, H; Shinmyo, A; Hata, Y; Katsube, Y; Urabe, I; Okada, H

1992-01-01

To elucidate the reaction mechanism of xylanase, the identification of amino acids essential for its catalysis is of importance. Studies have indicated the possibility that the reaction mechanism of xylanase is similar to that of hen's egg lysozyme, which involves acidic amino acid residues. On the basis of this assumption, together with the three-dimensional structure of Bacillus pumilus xylanase and its amino acid sequence similarity to other xylanases of different origins, three acidic amino acids, namely Asp-21, Glu-93 and Glu-182, were selected for site-directed mutagenesis. The Asp residue was altered to either Ser or Glu, and the Glu residues to Ser or Asp. The purified mutant xylanases D21E, D21S, E93D, E93S, E182D and E182S showed single protein bands of about 26 kDa on SDS/PAGE. C.d. spectra of these mutant enzymes show no effect on the secondary structure of xylanase, except that of D21E, which shows a little variation. Furthermore, mutations of Glu-93 and Glu-182 resulted in a drastic decrease in the specific activity of xylanase as compared with mutation of Asp-21. On the basis of these results we propose that Glu-93 and Glu-182 are the best candidates for the essential catalytic residues of xylanase. Images Fig. 1. Fig. 4 Fig. 5 PMID:1359880

Identification of surface-exposed domains on the reducing side of photosystem I

NASA Technical Reports Server (NTRS)

Xu, Q.; Guikema, J. A.; Chitnis, P. R.; Spooner, B. S. (Principal Investigator)

1994-01-01

Photosystem I (PSI) is a multisubunit enzyme that catalyzes the light-driven oxidation of plastocyanin or cytochrome c6 and the concomitant photoreduction of ferredoxin or flavodoxin. To identify the surface-exposed domains in PSI of the cyanobacterium Synechocystis sp. PCC 6803, we mapped the regions in PsaE, PsaD, and PsaF that are accessible to proteases and N-hydroxysuccinimidobiotin (NHS-biotin). Upon exposure of PSI complexes to a low concentration of endoproteinase glutamic acid (Glu)-C, PsaE was cleaved to 7.1- and 6.6-kD N-terminal fragments without significant cleavage of other subunits. Glu63 and Glu67, located near the C terminus of PsaE, were the most likely cleavage sites. At higher protease concentrations, the PsaE fragments were further cleaved and an N-terminal 9.8-kD PsaD fragment accumulated, demonstrating the accessibility of Glu residue(s) in the C-terminal domain of PsaD to the protease. Besides these major, primary cleavage products, several secondary cleavage sites on PsaD, PsaE, and PsaF were also identified. PsaF resisted proteolysis when PsaD and PsaE were intact. Glu88 and Glu124 of PsaF became susceptible to endoproteinase Glu-C upon extensive cleavage of PsaD and PsaE. Modification of PSI proteins with NHS-biotin and subsequent cleavage by endoproteinase Glu-C or thermolysin showed that the intact PsaE and PsaD, but not their major degradation products lacking C-terminal domains, were heavily biotinylated. Therefore, lysine-74 at the C terminus of PsaE was accessible for biotinylation. Similarly, lysine-107, or lysine-118, or both in PsaD could be modified by NHS-biotin.

Essential Role of NMDA Receptor Channel ε4 Subunit (GluN2D) in the Effects of Phencyclidine, but Not Methamphetamine

PubMed Central

Hagino, Yoko; Kasai, Shinya; Han, Wenhua; Yamamoto, Hideko; Nabeshima, Toshitaka; Mishina, Masayoshi; Ikeda, Kazutaka

2010-01-01

Phencyclidine (PCP), a noncompetitive N-methyl-D-aspartate (NMDA) receptor antagonist, increases locomotor activity in rodents and causes schizophrenia-like symptoms in humans. Although activation of the dopamine (DA) pathway is hypothesized to mediate these effects of PCP, the precise mechanisms by which PCP induces its effects remain to be elucidated. The present study investigated the effect of PCP on extracellular levels of DA (DAex) in the striatum and prefrontal cortex (PFC) using in vivo microdialysis in mice lacking the NMDA receptor channel ε1 or ε4 subunit (GluRε1 [GluN2A] or GluRε4 [GluN2D]) and locomotor activity. PCP significantly increased DAex in wildtype and GluRε1 knockout mice, but not in GluRε4 knockout mice, in the striatum and PFC. Acute and repeated administration of PCP did not increase locomotor activity in GluRε4 knockout mice. The present results suggest that PCP enhances dopaminergic transmission and increases locomotor activity by acting at GluRε4. PMID:21060893

Positive Modulators of the N-Methyl-d-aspartate Receptor: Structure-Activity Relationship Study of Steroidal 3-Hemiesters.

PubMed

Krausova, Barbora; Slavikova, Barbora; Nekardova, Michaela; Hubalkova, Pavla; Vyklicky, Vojtech; Chodounska, Hana; Vyklicky, Ladislav; Kudova, Eva

2018-05-24

Here, we report the synthesis of pregn-5-ene and androst-5-ene dicarboxylic acid esters and explore the structure-activity relationship (SAR) for their modulation of N-methyl-d-aspartate receptors (NMDARs). All compounds were positive modulators of recombinant GluN1/GluN2B receptors (EC 50 varying from 1.8 to 151.4 μM and E max varying from 48% to 452%). Moreover, 10 compounds were found to be more potent GluN1/GluN2B receptor modulators than endogenous pregnenolone sulfate (EC 50 = 21.7 μM). The SAR study revealed a relationship between the length of the residues at carbon C-3 of the steroid molecule and the positive modulatory effect at GluN1/GluN2B receptors for various D-ring modifications. A selected compound, 20-oxo-pregnenolone hemiadipate, potentiated native NMDARs to a similar extent as GluN1/GluN2A-D receptors and inhibited AMPARs and GABA A R responses. These results provide a unique opportunity for the development of new steroid based drugs with potential use in the treatment of neuropsychiatric disorders involving hypofunction of NMDARs.

A biorefinery scheme to fractionate bamboo into high-grade dissolving pulp and ethanol.

PubMed

Yuan, Zhaoyang; Wen, Yangbing; Kapu, Nuwan Sella; Beatson, Rodger; Mark Martinez, D

2017-01-01

Bamboo is a highly abundant source of biomass which is underutilized despite having a chemical composition and fiber structure similar as wood. The main challenge for the industrial processing of bamboo is the high level of silica, which forms water-insoluble precipitates negetively affecting the process systems. A cost-competitive and eco-friendly scheme for the production of high-purity dissolving grade pulp from bamboo not only requires a process for silica removal, but also needs to fully utilize all of the materials dissolved in the process which includes lignin, and cellulosic and hemicellulosic sugars as well as the silica. Many investigations have been carried out to resolve the silica issue, but none of them has led to a commercial process. In this work, alkaline pretreatment of bamboo was conducted to extract silica prior to pulping process. The silica-free substrate was used to produce high-grade dissolving pulp. The dissolved silica, lignin, hemicellulosic sugars, and degraded cellulose in the spent liquors obtained from alkaline pretreatment and pulping process were recovered for providing high-value bio-based chemicals and fuel. An integrated process which combines dissolving pulp production with the recovery of excellent sustainable biofuel and biochemical feedstocks is presented in this work. Pretreatment at 95 °C with 12% NaOH charge for 150 min extracted all the silica and about 30% of the hemicellulose from bamboo. After kraft pulping, xylanase treatment and cold caustic extraction, pulp with hemicellulose content of about 3.5% was obtained. This pulp, after bleaching, provided a cellulose acetate grade dissolving pulp with α-cellulose content higher than 97% and hemicellulose content less than 2%. The amount of silica and lignin that could be recovered from the process corresponded to 95 and 77.86% of the two components in the original chips, respectively. Enzymatic hydrolysis and fermentation of the concentrated and detoxified sugar mixture liquor showed that an ethanol recovery of 0.46 g/g sugar was achieved with 93.2% of hydrolyzed sugars being consumed. A mass balance of the overall process showed that 76.59 g of solids was recovered from 100 g (o.d.) of green bamboo. The present work proposes an integrated biorefinery process that contains alkaline pre-extraction, kraft pulping, enzyme treatment and cold caustic extraction for the production of high-grade dissolving pulp and recovery of silica, lignin, and hemicellulose from bamboo. This process could alleviate the silica-associated challenges and provide feedstocks for bio-based products, thereby allowing the improvement and expansion of bamboo utilization in industrial processes.

Neurosteroid binding to the amino terminal and glutamate binding domains of ionotropic glutamate receptors.

PubMed

Cameron, Krasnodara; Bartle, Emily; Roark, Ryan; Fanelli, David; Pham, Melissa; Pollard, Beth; Borkowski, Brian; Rhoads, Sarah; Kim, Joon; Rocha, Monica; Kahlson, Martha; Kangala, Melinda; Gentile, Lisa

2012-06-01

The endogenous neurosteroids, pregnenolone sulfate (PS) and 3α-hydroxy-5β-pregnan-20-one sulfate (PREGAS), have been shown to differentially regulate the ionotropic glutamate receptor (iGluR) family of ligand-gated ion channels. Upon binding to these receptors, PREGAS decreases current flow through the channels. Upon binding to non-NMDA or NMDA receptors containing an GluN2C or GluN2D subunit, PS also decreases current flow through the channels, however, upon binding to NMDA receptors containing an GluN2A or GluN2B subunit, flow through the channels increases. To begin to understand this differential regulation, we have cloned the S1S2 and amino terminal domains (ATD) of the NMDA GluN2B and GluN2D and AMPA GluA2 subunits. Here we present results that show that PS and PREGAS bind to different sites in the ATD of the GluA2 subunit, which when combined with previous results from our lab, now identifies two binding domains for each neurosteroid. We also show both neurosteroids bind only to the ATD of the GluN2D subunit, suggesting that this binding is distinct from that of the AMPA GluA2 subunit, with both leading to iGluR inhibition. Finally, we provide evidence that both PS and PREGAS bind to the S1S2 domain of the NMDA GluN2B subunit. Neurosteroid binding to the S1S2 domain of NMDA subunits responsible for potentiation of iGluRs and to the ATD of NMDA subunits responsible for inhibition of iGluRs, provides an interesting option for therapeutic design. Copyright © 2012 Elsevier Inc. All rights reserved.

Increases in duodenal glutamic acid supply linearly increase small intestinal starch digestion but not nitrogen balance in cattle.

PubMed

Blom, E J; Anderson, D E; Brake, D W

2016-12-01

Small intestinal starch digestion (SISD) in cattle is often limited; however, greater postruminal flow of high-quality protein (e.g., casein) can increase SISD, and Glu can mimic responses to casein for SISD. We evaluated effects of increasing Glu flows to the duodenum on SISD and N retention in cattle. Cattle received (DM basis) continuous duodenal infusion of raw cornstarch (1.5 ± 0.08 kg/d) and 0, 30.9 ± 0.6, 62.4 ± 1.2, or 120.4 ± 3.4 g/d Glu or 387.9 ± 17.5 g/d casein. As expected, the positive control (i.e., casein) increased ( = 0.05) SISD. Interestingly, SISD linearly increased ( = 0.02) with increasing amounts of Glu. Starch flow to the ileum linearly decreased ( = 0.04) in response to greater postruminal Glu and tended to decrease ( = 0.07) with duodenal casein infusion. Ileal flow of ethanol-soluble starch was not affected by duodenal Glu ( = 0.16) or casein ( = 0.42). There was a tendency ( = 0.08) for a quadratic response to Glu for ileal glucose flow with greater flows for intermediate levels of Glu, but casein had no effect ( = 0.81) on glucose flows to the ileum. Greater postruminal supplies of Glu (linear, = 0.05) and casein ( = 0.02) decreased fecal starch flow. Postruminal starch digestion was increased by both casein ( = 0.03) and Glu (linear, = 0.05). Nitrogen intake from feed was not different among treatments ( ≥ 0.23). By design, infusate N increased from 0 to 13 ± 1.5 g/d with greater amounts of Glu, and casein provided 61 ± 1.3 g N/d. Urinary N excretion was not affected ( ≥ 0.30) by postruminal Glu flow, but urine N was increased by casein ( < 0.01). Glutamic acid did not affect N retention ( ≥ 0.34), but casein increased N retention ( < 0.01). However, N retained as a percent of N intake (26.7 ± 1.7%) was not different when cattle were provided Glu ( ≥ 0.16) or casein ( = 0.38).

Ionotropic glutamate receptor GluR2/3-immunoreactive neurons in the cat, rabbit, and hamster superficial superior colliculus.

PubMed

Park, Won-Mee; Kim, Min-Jeong; Jeon, Chang-Jin

2004-06-01

Ionotropic glutamate receptor (GluR) subtypes occur in various types of cells in the central nervous system. We studied the distribution of AMPA glutamate receptor subtype GluR2/3 in the superficial layers of cat, rabbit, and hamster superior colliculus (SC) with antibody immunocytochemistry and the effect of enucleation on this distribution. Furthermore, we compared this labeling to that of calbindin D28K and parvalbumin. Anti-GluR2/3-immunoreactive (IR) cells formed a dense band of labeled cells within the lower superficial gray layer (SGL) and upper optic layer (OL) in the cat SC. By contrast, GluR2/3-IR cells formed a dense band within the upper OL in the rabbit and within the OL in the hamster SC. Calbindin D28K-IR cells are located in three layers in the SC: one within the zonal layer (ZL) and the upper SGL in all three animals, a second within the lower OL and upper IGL in the cat, within the IGL in the rabbit and within the OL in the hamster, and a third within the deep gray layer (DGL) in all three animals. Many parvalbumin-IR neurons were found within the lower SGL and upper OL. Thus, the GluR2/3-IR band was sandwiched between the first and second layers of calbindin D28K-IR cells in the cat and rabbit SC while the distribution of GluR2/3-IR cells in the hamster matches the second layer of calbindin D28K-IR cells. The patterned distribution of GluR2/3-IR cells overlapped the tier of parvalbumin-IR neurons in cat, but only partially overlapped in hamster and rabbit. Two-color immunofluorescence revealed that more than half (55.1%) of the GluR2/3-IR cells in the hamster SC expressed calbindin D28K. By contrast, only 9.9% of GluR2/3-IR cells expressed calbindin D28K in the cat. Double-labeled cells were not found in the rabbit SC. Some (4.8%) GluR2/3-IR cells in the cat SC also expressed parvalbumin, while no GluR2/3-IR cells in rabbit and hamster SC expressed parvalbumin. In this dense band of GluR2/3, the majority of labeled cells were small to medium-sized round/oval or stellate cells. Immunoreactivity for the GluR2/3 was clearly reduced in the contralateral SC following unilateral enucleation in the hamster. By contrast, enucleation appeared to have had no effect on the GluR2/3 immunoreactivity in the cat and rabbit SC. The results indicate that neurons in the mammalian SC express GluR2/3 in specific layers, which does not correlate with the expression of calbindin D28K and parvalbumin among the animals.

Regulation of Fear Extinction in the Basolateral Amygdala by Dopamine D2 Receptors Accompanied by Altered GluR1, GluR1-Ser845 and NR2B Levels.

PubMed

Shi, Yan-Wei; Fan, Bu-Fang; Xue, Li; Wen, Jia-Ling; Zhao, Hu

2017-01-01

The amygdala, a critical structure for both Pavlovian fear conditioning and fear extinction, receives sparse but comprehensive dopamine innervation and contains dopamine D1 and D2 receptors. Fear extinction, which involves learning to suppress the expression of a previously learned fear, appears to require the dopaminergic system. The specific roles of D2 receptors in mediating associative learning underlying fear extinction require further study. Intra-basolateral amygdala (BLA) infusions of a D2 receptor agonist, quinpirole, and a D2 receptor antagonist, sulpiride, prior to fear extinction and extinction retention were tested 24 h after fear extinction training for long-term memory (LTM). LTM was facilitated by quinpirole and attenuated by sulpiride. In addition, A-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor glutamate receptor 1 (GluR1) subunit, GluR1 phospho-Ser845, and N -methyl-D-aspartic acid receptor NR2B subunit levels in the BLA were generally increased by quinpirole and down-regulated by sulpiride. The present study suggests that activation of D2 receptors facilitates fear extinction and that blockade of D2 receptors impairs fear extinction, accompanied by changes in GluR1, GluR1-Ser845 and NR2B levels in the amygdala.

Modulation of neurological deficits and expression of glutamate receptors during experimental autoimmune encephalomyelitis after treatment with selected antagonists of glutamate receptors.

PubMed

Sulkowski, Grzegorz; Dąbrowska-Bouta, Beata; Strużyńska, Lidia

2013-01-01

The aim of our investigation was to characterize the role of group I mGluRs and NMDA receptors in pathomechanisms of experimental autoimmune encephalomyelitis (EAE), the rodent model of MS. We tested the effects of LY 367385 (S-2-methyl-4-carboxyphenylglycine, a competitive antagonist of mGluR1), MPEP (2-methyl-6-(phenylethynyl)-pyridine, an antagonist of mGluR5), and the uncompetitive NMDA receptor antagonists amantadine and memantine on modulation of neurological deficits observed in rats with EAE. The neurological symptoms of EAE started at 10-11 days post-injection (d.p.i.) and peaked after 12-13 d.p.i. The protein levels of mGluRs and NMDA did not increase in early phases of EAE (4 d.p.i.), but starting from 8 d.p.i. to 25 d.p.i., we observed a significant elevation of mGluR1 and mGluR5 protein expression by about 20% and NMDA protein expression by about 10% over the control at 25 d.p.i. The changes in protein levels were accompanied by changes in mRNA expression of group I mGluRs and NMDARs. During the late disease phase (20-25 d.p.i.), the mRNA expression levels reached 300% of control values. In contrast, treatment with individual receptor antagonists resulted in a reduction of mRNA levels relative to untreated animals.

Insulin modulates hippocampally-mediated spatial working memory via glucose transporter-4.

PubMed

Pearson-Leary, J; Jahagirdar, V; Sage, J; McNay, E C

2018-02-15

The insulin-regulated glucose transporter, GluT4, is a key molecule in peripheral insulin signaling. Although GluT4 is abundantly expressed in neurons of specific brain regions such as the hippocampus, the functional role of neuronal GluT4 is unclear. Here, we used pharmacological inhibition of GluT4-mediated glucose uptake to determine whether GluT4 mediates insulin-mediated glucose uptake in the hippocampus. Consistent with previous reports, we found that glucose utilization increased in the dorsal hippocampus of male rats during spontaneous alternation (SA), a hippocampally-mediated spatial working memory task. We previously showed that insulin signaling within the hippocampus is required for processing this task, and that administration of exogenous insulin enhances performance. At baseline levels of hippocampal insulin, inhibition of GluT4-mediated glucose uptake did not affect SA performance. However, inhibition of an upstream regulator of GluT4, Akt, did impair SA performance. Conversely, when a memory-enhancing dose of insulin was delivered to the hippocampus prior to SA-testing, inhibition of GluT4-mediated glucose transport prevented cognitive enhancement. These data suggest that baseline hippocampal cognitive processing does not require functional hippocampal GluT4, but that cognitive enhancement by supra-baseline insulin does. Consistent with these findings, we found that in neuronal cell culture, insulin increases glucose utilization in a GluT4-dependent manner. Collectively, these data demonstrate a key role for GluT4 in transducing the procognitive effects of elevated hippocampal insulin. Copyright © 2017 Elsevier B.V. All rights reserved.

[Vital pulp therapy of damaged dental pulp].

PubMed

Xuedong, Zhou; Dingming, Huang; Jianguo, Liu; Zhengwei, Huang; Xin, Wei; Deqin, Yang; Jin, Zhao; Liming, Chen; Lin, Zhu; Yanhong, Li; Jiyao, Li

2017-08-01

The development of an expert consensus on vital pulp therapy can provide practical guidance for the improvement of pulp damage care in China. Dental pulp disease is a major type of illness that adversely affects human oral health. Pulp capping and pulpotomy are currently the main methods for vital pulp therapy. Along with the development of minimal invasion cosmetic dentistry, using different treatment technologies and materials reasonably, preserving healthy tooth tissue, and extending tooth save time have become urgent problems that call for immediate solution in dental clinics. This paper summarizes the experiences and knowledge of endodontic experts. We develop a clinical path of vital pulp therapy for clinical work by utilizing the nature, approach, and degree of pulp damage as references, defense and self-repairing ability of pulp as guidance, and modern technologies of diagnosis and treatment as means.

Potentiation of GluN2C/D NMDA receptor subtypes in the amygdala facilitates the retention of fear and extinction learning in mice.

PubMed

Ogden, Kevin K; Khatri, Alpa; Traynelis, Stephen F; Heldt, Scott A

2014-02-01

NMDA receptors are glutamate receptor ion channels that contribute to synaptic plasticity and are important for many forms of learning and memory. In the amygdala, NMDA receptors are critical for the acquisition, retention, and extinction of classically conditioned fear responses. Although the GluN2B subunit has been implicated in both the acquisition and extinction of conditioned fear, GluN2C-knockout mice show reduced conditioned fear responses. Moreover, D-cycloserine (DCS), which facilitates fear extinction, selectively enhances the activity of GluN2C-containing NMDA receptors. To further define the contribution of GluN2C receptors to fear learning, we infused the GluN2C/GluN2D-selective potentiator CIQ bilaterally into the basolateral amygdala (3, 10, or 30 μg/side) following either fear conditioning or fear extinction training. CIQ both increased the expression of conditioned fear 24 h later and enhanced the extinction of the previously conditioned fear response. These results support a critical role for GluN2C receptors in the amygdala in the consolidation of learned fear responses and suggest that increased activity of GluN2C receptors may underlie the therapeutic actions of DCS.

Integrating black liquor gasification with pulping - Process simulation, economics and potential benefits

NASA Astrophysics Data System (ADS)

Lindstrom, Erik Vilhelm Mathias

Gasification of black liquor could drastically increase the flexibility and improve the profit potential of a mature industry. The completed work was focused on research around the economics and benefits of its implementation, utilizing laboratory pulping experiments and process simulation. The separation of sodium and sulfur achieved through gasification of recovered black liquor, can be utilized in processes like modified continuous cooking, split sulfidity and green liquor pretreatment pulping, and polysulfide-anthraquinone pulping, to improve pulp yield and properties. Laboratory pulping protocols have been developed for these modified pulping technologies and different process options evaluated. The process simulation work around BLG has led to the development of a WinGEMS module for the low temperature MTCI steam reforming process, and case studies comparing a simulated conventional kraft process to different process options built around the implementation of a BLG unit operation into the kraft recovery cycle. Pulp yield increases of 1-3% points with improved product quality, and the potential for capital and operating cost savings relative to the conventional kraft process have been demonstrated. Process simulation work has shown that the net variable operating cost for a pulping process using BLGCC is highly dependent on the cost of lime kiln fuel and the selling price of green power to the grid. Under the assumptions taken in the performed case study, the BLGCC process combined with split sulfidity or PSAQ pulping operations had net variable operating cost 2-4% greater than the kraft reference. The influence of the sales price of power to the grid is the most significant cost factor. If a sales price increase to 6 ¢/KWh for green power could be achieved, cost savings of about $40/ODtP could be realized in all investigated BLG processes. Other alternatives to improve the process economics around BLG would be to modify or eliminate the lime kiln unit operations, utilizing high sulfidity green liquor pretreatment, PSAQ with auto-causticization, or converting the process to mini-sulfide sulfite-AQ.

Expression of NMDA receptor subunits in human blood lymphocytes: A peripheral biomarker in online computer game addiction.

PubMed

Sadat-Shirazi, Mitra-Sadat; Vousooghi, Nasim; Alizadeh, Bentolhoda; Makki, Seyed Mohammad; Zarei, Seyed Zeinolabedin; Nazari, Shahrzad; Zarrindast, Mohammad Reza

2018-05-23

Background and aims Repeated performance of some behaviors such as playing computer games could result in addiction. The NMDA receptor is critically involved in the development of behavioral and drug addictions. It has been claimed that the expression level of neurotransmitter receptors in the brain may be reflected in peripheral blood lymphocytes (PBLs). Methods Here, using a real-time PCR method, we have investigated the mRNA expression of GluN2A, GluN2D, GluN3A, and GluN3B subunits of the NMDA receptor in PBLs of male online computer game addicts (n = 25) in comparison with normal subjects (n = 26). Results Expression levels of GluN2A, GluN2D, and GluN3B subunits were not statistically different between game addicts and the control group. However, the mRNA expression of the GluN3A subunit was downregulated in PBLs of game addicts. Discussion and conclusions Transcriptional levels of GluN2A and GluN2D subunits in online computer game addicts are similar to our previously reported data of opioid addiction and are not different from the control group. However, unlike our earlier finding of drug addiction, the mRNA expression levels of GluN3A and GluN3B subunits in PBLs of game addicts are reduced and unchanged, respectively, compared with control subjects. It seems that the downregulated state of the GluN3A subunit of NMDA receptor in online computer game addicts is a finding that deserves more studies in the future to see whether it can serve as a peripheral biomarker in addiction studies, where the researcher wants to rule out the confusing effects of abused drugs.

Use of near-isogenic wheat lines to determine the glutenin composition and functionality requirements for flour tortillas.

PubMed

Mondal, Suchismita; Tilley, Michael; Alviola, Juma Novi; Waniska, Ralph D; Bean, Scott R; Glover, Karl D; Hays, Dirk B

2008-01-09

In wheat ( Triticum aestivum L), the synthesis of high molecular weight (HMW) glutenins (GS) is controlled by three heterologous genetic loci present on the long arms of group 1 wheat chromosomes. The loci Glu-A1, Glu-B1, and Glu-D1 and their allelic variants play important roles in the functional properties of wheat flour. This study focused on understanding the functionality of these protein subunits on tortilla quality. Near-isogenic wheat lines in which one or more of these loci were absent or deleted were used. Tortillas were prepared from each deletion line and the parent lines. The elimination of certain HMW-GS alleles alter distinct but critical aspects of tortilla quality such as diameter, shelf stability, and overall quality. Two deletion lines possessing HMW-GS 17 + 18 at Glu-B1 and deletions in Glu-A1 and Glu-D1 had significantly larger tortilla diameters, yet tortilla shelf life was compromised or unchanged from the parent lines used to develop the deletion lines or the commercial tortilla flour used as a control. Alternatively, a deletion line possessing Glu-A1 and Glu-D1 (HMW-GS 1, 5 + 10) and a deletion in Glu-B1 also significantly improved tortilla diameters. Whereas the increase in diameter was less than the line possessing only HMW-GS 17 + 18 at Glu-B1, the stability of the tortillas were, however, maintained and improved as compared to the parent lines containing a full compliment of HMW-GS. Thus, the presence of subunits 5 + 10 at Glu-D1 alone or in combination with subunit 1 at Glu-A1 appears to provide a compromise of improvement in dough extensibility for improved tortilla diameters while also providing sufficient gluten strength to maintain ideal shelf stability.

Design, Synthesis, and Structure–Activity Relationship of a Novel Series of GluN2C-Selective Potentiators

PubMed Central

2015-01-01

NMDA receptors are tetrameric complexes composed of GluN1 and GluN2A–D subunits that mediate a slow Ca2+-permeable component of excitatory synaptic transmission. NMDA receptors have been implicated in a wide range of neurological diseases and thus represent an important therapeutic target. We herein describe a novel series of pyrrolidinones that selectively potentiate only NMDA receptors that contain the GluN2C subunit. The most active analogues tested were over 100-fold selective for recombinant GluN2C-containing receptors over GluN2A/B/D-containing NMDA receptors as well as AMPA and kainate receptors. This series represents the first class of allosteric potentiators that are selective for diheteromeric GluN2C-containing NMDA receptors. PMID:24512267

No Evidence from FTIR Difference Spectroscopy that Glutamate-189 of the D1 Polypeptide Ligates a Mn Ion that Undergoes Oxidation During the S0 to S1, S1 to S2, or S2 to S3 Transitions in Photosystem II†

PubMed Central

Strickler, Melodie A.; Hillier, Warwick; Debus, Richard J.

2008-01-01

In the recent X-ray crystallographic structural models of photosystem II, Glu189 of the D1 polypeptide is assigned as a ligand of the oxygen-evolving Mn4 cluster. To determine if D1-Glu189 ligates a Mn ion that undergoes oxidation during one or more of the S0 → S1, S1 → S2, and S2 → S3 transitions, the FTIR difference spectra of the individual S state transitions in D1-E189Q and D1-E189R mutant PSII particles from the cyanobacterium Synechocystis sp. PCC 6803 were compared with those in wild-type PSII particles. Remarkably, the data show that neither mutation significantly alters the mid-frequency regions (1800 − 1200 cm−1) of any of the FTIR difference spectra. Importantly, neither mutation eliminates any specific symmetric or asymmetric carboxylate stretching mode that might have been assigned to D1-Glu189. The small spectral alterations that are observed are similar in amplitude to those that are observed in wild-type PSII particles that have been exchanged into FTIR analysis buffer by different methods or those that are observed in D2-H189Q mutant PSII particles (the residue D2-His189 is located > 25 Å from the Mn4 cluster and accepts a hydrogen bond from Tyr YD). The absence of significant mutation-induced spectral alterations in the D1-Glu189 mutants shows that the oxidation of the Mn4 cluster does not alter the frequencies of the carboxylate stretching modes of D1-Glu189 during the S0 → S1, S1 → S2, or S2 → S3 transitions. One explanation of these data is that D1-Glu189 ligates a Mn ion that does not increase its charge or oxidation state during any of these S state transitions. However, because the same conclusion was reached previously for D1-Asp170, and because the recent X-ray crystallographic structural models assign D1-Asp170 and D1-Glu189 as ligating different Mn ions, this explanation requires that (1) the extra positive charge that develops on the Mn4 cluster during the S1 → S2 transition be localized on the Mn ion that is ligated by the α-COO− group of D1-Ala344 and (2) any increase in positive charge that develops on the Mn4 cluster during the S0 → S1 and S2 → S3 transitions be localized on the one Mn ion that is not ligated by D1-Asp170, D1-Glu189, or D1-Ala344. An alternative explanation of the FTIR data is that D1-Glu189 does not ligate the Mn4 cluster. This conclusion would be consistent with earlier spectroscopic analyses of D1-Glu189 mutants, but would require that the proximity of D1-Glu189 to manganese in the X-ray crystallographic structural models be an artifact of the radiation-induced reduction of the Mn4 cluster that occurred during the collection of the X-ray diffraction data. PMID:16846223

Recruitment of dental pulp cells by dentine and pulp extracellular matrix components.

PubMed

Smith, J G; Smith, A J; Shelton, R M; Cooper, P R

2012-11-01

The present study aimed to determine whether dentine tissue and preparations of extracellular matrix (ECM) from pulp (pECM) and dentine (dECM), and breakdown products, influenced pulp cell migration. Chemotaxis transwell and agarose spot assays demonstrated that both dentine and pulp ECM molecules acted as chemoattractants for primary pulp cells. Chemoattractant activities of dECM and pECM were enhanced when subjected to acid and enzymatic breakdown, respectively. This enhanced activity following physiologically relevant breakdown may be pertinent to the disease environment. Pulp cell migration in response to dental ECMs was dependent on an active rho pathway. Recruited cells exhibited increased stem cell marker expression indicating that dental ECMs and their breakdown products selectively attract progenitor cells that contribute to repair processes. In conclusion, combined these results indicate that ECM molecules contribute to cell recruitment necessary for regeneration of the dentine-pulp complex after injury. Copyright © 2012 Elsevier Inc. All rights reserved.

GluN2C/GluN2D subunit-selective NMDA receptor potentiator CIQ reverses MK-801-induced impairment in prepulse inhibition and working memory in Y-maze test in mice

PubMed Central

Suryavanshi, P S; Ugale, R R; Yilmazer-Hanke, D; Stairs, D J; Dravid, S M

2014-01-01

Background and Purpose Despite ample evidence supporting the N-methyl-d-aspartate receptor (NMDAR) hypofunction hypothesis of schizophrenia, progress in the development of effective therapeutics based on this hypothesis has been limited. Facilitation of NMDA receptor function by co-agonists (d-serine or glycine) only partially alleviates the symptoms in schizophrenia; other means to facilitate NMDA receptors are required. NMDA receptor sub-types differ in their subunit composition, with varied GluN2 subunits (GluN2A-GluN2D) imparting different physiological, biochemical and pharmacological properties. CIQ is a positive allosteric modulator that is selective for GluN2C/GluN2D-containing NMDA receptors (Mullasseril et al.). Experimental Approach The effect of systemic administration of CIQ was tested on impairment in prepulse inhibition (PPI), hyperlocomotion and stereotypy induced by i.p. administration of MK-801 and methamphetamine. The effect of CIQ was also tested on MK-801-induced impairment in working memory in Y-maze spontaneous alternation test. Key Results We found that systemic administration of CIQ (20 mg·kg−1, i.p.) in mice reversed MK-801 (0.15 mg·kg−1, i.p.)-induced, but not methamphetamine (3 mg·kg−1, i.p.)-induced, deficit in PPI. MK-801 increased the startle amplitude to pulse alone, which was not reversed by CIQ. In contrast, methamphetamine reduced the startle amplitude to pulse alone, which was reversed by CIQ. CIQ also partially attenuated MK-801- and methamphetamine-induced hyperlocomotion and stereotyped behaviours. Additionally, CIQ reversed the MK-801-induced working memory deficit in spontaneous alternation in a Y-maze. Conclusion and Implications Together, these results suggest that facilitation of GluN2C/GluN2D-containing receptors may serve as an important therapeutic strategy for treating positive and cognitive symptoms in schizophrenia. PMID:24236947

Altered expression of genes involved in GABAergic transmission and neuromodulation of granule cell activity in the cerebellum of schizophrenia patients.

PubMed

Bullock, W Michael; Cardon, Karen; Bustillo, Juan; Roberts, Rosalinda C; Perrone-Bizzozero, Nora I

2008-12-01

Deficits in gamma-aminobutyric acid (GABA) signaling have been described in the prefrontal cortex, limbic system, and cerebellum in individuals with schizophrenia. The purpose of the present study was to further investigate cerebellar gene expression alterations as they relate to decreases in GABAergic transmission by examining the expression of GABAergic markers, N-methyl-d-aspartic-acid (NMDA) receptor subunits, and cerebellum neuromodulators in individuals with schizophrenia. Subjects were postmortem men with a diagnosis of schizophrenia (N=13) and a postmortem interval-matched non-psychiatric male comparison group (N=13). The authors utilized real-time-quantitative polymerase chain reaction (PCR) to measure mRNA levels of the following GABAergic markers: glutamic acid decarboxylase (GAD) 65 and 67; GABA plasma membrane transporter-1 (GAT-1); GABA type A (GABA(A)) receptor subunits alpha(6), beta(3), and delta; and parvalbumin. In addition, real-time-quantitative PCR was utilized to assess mRNA levels of the NMDA receptor (NR) subunits NR1, NR2-A, NR2-B, NR2-C, and NR2-D as well as the cerebellar neuromodulators glutamate receptor (GluR)-6, kainate-preferring glutamate receptor subunit-2 (KA2), metabotropic glutamate receptor (mGluR)-2 and mGluR3, and neuronal nitric oxide synthase. Measurements for mRNA levels were determined using lateral cerebellar hemisphere tissue from both schizophrenia and comparison subjects. Schizophrenia subjects showed significant decreases in mRNA levels of GAD(67), GAD(65), GAT-1, mGluR2, and neuronal nitric oxide synthase. Increases in GABA(A)-alpha(6 )and GABA(A)-delta as well as GluR6 and KA2 were also observed. Medication effects on the expression of the same genes were examined in rats treated with either haloperidol (Sprague-Dawley rats [N=16]) or clozapine (Long-Evans rats [N=20]). Both haloperidol and clozapine increased the levels of GAD(67) in the cerebellum and altered the expression of other cerebellar mRNAs. These findings suggest that GABA transmission is decreased in the cerebellar cortices in individuals with schizophrenia and additional gene expression changes may reflect an attempt to increase GABA neurotransmission at the cerebellar glomerulus.

Identification of a hepatoprotective peptide in wheat gluten hydrolysate against D-galactosamine-induced acute hepatitis in rats.

PubMed

Sato, Kenji; Egashira, Yukari; Ono, Shin; Mochizuki, Satoshi; Shimmura, Yuki; Suzuki, Yoshio; Nagata, Megumi; Hashimoto, Kaori; Kiyono, Tamami; Park, Eun Young; Nakamura, Yasushi; Itabashi, Mariko; Sakata, Yuka; Furuta, Seigo; Sanada, Hiroo

2013-07-03

A hepatoprotective peptide, pyroglutamyl leucine (pyroGlu-Leu), was identified in wheat gluten hydrolysate through an in vivo activity-guided fractionation approach based on D-galactosamine-induced acute hepatitis in rats and fractionation of peptides with large-scale preparative ampholine-free isoelectric focusing. The active acidic fraction predominantly consisted of pyroglutamyl peptides and free pyroglutamic acid. Pyroglutamyl peptides were derivatized with phenyl isothiocyanate after removal of a pyroglutamyl residue by pyroglutamate aminopeptidase. The derivatives were purified by reversed-phase HPLC and subjected to sequence analysis. The active fraction contained pyroGlu-Ile, pyroGlu-Leu, pyroGlu-Gln, pyroGlu-Gln-Gln, and free pyroGlu. Ingestion of pyroGlu-Leu at 20 mg/kg body weight significantly decreased serum aspartate and alanine aminotransferases to approximately 30% and 20% of those values of the vehicle group, respectively, which were near the normal levels. Thirty minutes after ingestion of pyroGlu-Leu at 20 mg/kg, the concentration of pyroGlu-Leu in portal blood plasma increased to approximately 2 μM.

Alaska birch for edge-glued panel production—considerations for wood products manufacturers

Treesearch

David Nicholls

2010-01-01

Edge-glued panels could become a natural extension for the birch (Betula papyrifera Marsh.) lumber industry in Alaska, resulting in greater utilization of the birch resource while allowing producers to explore a wider variety of products and markets. Key advantages of edge-glued panel production include the relatively low cost of equipment, the...

Evidence of intralocus recombination at the Glu-3 loci in bread wheat (Triticum aestivum L.)

USDA-ARS?s Scientific Manuscript database

The low-molecular weight glutenin subunits (LMW-GSs) are a class of wheat seed storage proteins that play a critical role in the determination of wheat flour bread-making quality. These proteins are encoded by multigene families located at the orthologous Glu-3 loci (Glu-A3, Glu-B3 and Glu-D3), on t...

Human dental pulp stem cells with highly angiogenic and neurogenic potential for possible use in pulp regeneration.

PubMed

Nakashima, Misako; Iohara, Koichiro; Sugiyama, Masahiko

2009-01-01

Dental caries is a common public health problem, causing early loss of dental pulp and resultant tooth loss. Dental pulp has important functions to sustain teeth providing nutrient and oxygen supply, innervation, reactionary/reparative dentin formation and immune response. Regeneration of pulp is an unmet need in endodontic therapy, and angiogenesis/vasculogenesis and neurogenesis are critical for pulp regeneration. Permanent and deciduous pulp tissue is easily available from teeth after extraction without ethical issues and has potential for clinical use. In this review, we introduce some stem cell subfractions, CD31(-)/CD146(-) SP cells and CD105(+) cells with high angiogenic and neurogenic potential, derived from human adult dental pulp tissue. Potential utility of these cells is addressed as a source of cells for treatment of cerebral and limb ischemia and pulp inflammation complete with angiogenesis and vasculogenesis.

Efficient utilization of red maple lumber in glued-laminated timber beams

Treesearch

J. J. Janowiak; H. B. Manbeck; R. Hernandez; R. C. Moody; P. R. Blankenhorn; P. Labosky

The feasibility of utilizing cant-sawn hardwood lumber, which would not usually be desired for furniture manufacture, was studied for the manufacture of structural glued-laminated (glulam) timber. Two red maple beam combinations were evaluated: (1) a glulam combination designed with E-rated lumber in 25 percent of the outer laminations (top and bottom) and No. 3 grade...

Behaviour of spirotetramat residues and its four metabolites in citrus marmalade during home processing.

PubMed

Liu, Yanyu; Su, Xuesu; Jian, Qiu; Chen, Weijun; Sun, Dali; Gong, Lei; Jiang, Liyan; Jiao, Bining

2016-01-01

The effect of home processing on the residues of spirotetramat and its four metabolites (B-enol, B-glu, B-mono and B-keto) in citrus marmalade is comprehensively investigated in this paper by ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS). A five-fold recommended dose of spirotetramat was applied to citrus fruit under field conditions and the processing included five steps: washing, peeling, pre-treatment for peel, mixing and boiling. The results showed that spirotetramat was the predominant component detected in unprocessed citrus, accounting for 64%. All the detected residues were primarily deposited on citrus peel, except for B-enol which was also present in the citrus pulp. Washing reduced spirotetramat, B-enol, B-glu and B-keto by 83%, 56%, 41% and 16%, respectively, and pre-treatment of the peel removed between 42% and 68% of the residues. Four compounds were all below the limit of detection after the mixing step. In the final product, only B-keto was detected at the concentration of 0.010 mg kg(-1). After the whole process, the processing factors for spirotetramat, B-enol, B-glu and B-keto were < 0.041, < 0.125, < 0.294 and 0.313, respectively, which indicated that home processing can significantly reduce residues of spirotetramat and its metabolites in citrus marmalade.

Importance of the GluN2B Carboxy-Terminal Domain for Enhancement of Social Memories

ERIC Educational Resources Information Center

Jacobs, Stephanie; Wei, Wei; Wang, Deheng; Tsien, Joe Z.

2015-01-01

The N-methyl-D-aspartate (NMDA) receptor is known to be necessary for many forms of learning and memory, including social recognition memory. Additionally, the GluN2 subunits are known to modulate multiple forms of memory, with a high GluN2A:GluN2B ratio leading to impairments in long-term memory, while a low GluN2A:GluN2B ratio enhances some…

Co-agonists differentially tune GluN2B-NMDA receptor trafficking at hippocampal synapses

PubMed Central

Ferreira, Joana S; Papouin, Thomas; Ladépêche, Laurent; Yao, Andrea; Langlais, Valentin C; Bouchet, Delphine; Dulong, Jérôme; Mothet, Jean-Pierre; Sacchi, Silvia; Pollegioni, Loredano; Paoletti, Pierre; Oliet, Stéphane Henri Richard; Groc, Laurent

2017-01-01

The subunit composition of synaptic NMDA receptors (NMDAR), such as the relative content of GluN2A- and GluN2B-containing receptors, greatly influences the glutamate synaptic transmission. Receptor co-agonists, glycine and D-serine, have intriguingly emerged as potential regulators of the receptor trafficking in addition to their requirement for its activation. Using a combination of single-molecule imaging, biochemistry and electrophysiology, we show that glycine and D-serine relative availability at rat hippocampal glutamatergic synapses regulate the trafficking and synaptic content of NMDAR subtypes. Acute manipulations of co-agonist levels, both ex vivo and in vitro, unveil that D-serine alter the membrane dynamics and content of GluN2B-NMDAR, but not GluN2A-NMDAR, at synapses through a process requiring PDZ binding scaffold partners. In addition, using FRET-based FLIM approach, we demonstrate that D-serine rapidly induces a conformational change of the GluN1 subunit intracellular C-terminus domain. Together our data fuels the view that the extracellular microenvironment regulates synaptic NMDAR signaling. DOI: http://dx.doi.org/10.7554/eLife.25492.001 PMID:28598327

Selective suppression of excessive GluN2C expression rescues early epilepsy in a tuberous sclerosis murine model

PubMed Central

Lozovaya, N.; Gataullina, S.; Tsintsadze, T.; Tsintsadze, V.; Pallesi-Pocachard, E.; Minlebaev, M.; Goriounova, N. A.; Buhler, E.; Watrin, F.; Shityakov, S.; Becker, A. J.; Bordey, A.; Milh, M.; Scavarda, D.; Bulteau, C.; Dorfmuller, G.; Delalande, O.; Represa, A.; Cardoso, C.; Dulac, O.; Ben-Ari, Y.; Burnashev, N.

2014-01-01

Tuberous sclerosis complex (TSC), caused by dominant mutations in either TSC1 or TSC2 tumour suppressor genes is characterized by the presence of brain malformations, the cortical tubers that are thought to contribute to the generation of pharmacoresistant epilepsy. Here we report that tuberless heterozygote Tsc1+/− mice show functional upregulation of cortical GluN2C-containing N-methyl-D-aspartate receptors (NMDARs) in an mTOR-dependent manner and exhibit recurrent, unprovoked seizures during early postnatal life (

Gene expression in the pulp of ripening bananas. Two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis of in vitro translation products and cDNA cloning of 25 different ripening-related mRNAs.

PubMed Central

Medina-Suárez, R; Manning, K; Fletcher, J; Aked, J; Bird, C R; Seymour, G B

1997-01-01

mRNA was extracted from the pulp and peel of preclimacteric (d 0) bananas (Musa AAA group, cv Grand Nain) and those exposed to ethylene gas for 24 h and stored in air alone for a further 1 (d 2) and 4 d (d 5). Two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis of in vitro translation products from the pulp and peel of these fruits revealed significant up-regulation of numerous transcripts during ripening. The majority of the changes were initiated by d 2, with the level of these messages increasing during the remainder of the ripening period. Pulp tissue from d 2 was used for the construction of a cDNA library. This library was differentially screened for ripening-related clones using cDNA from d-0 and d-2 pulp by a novel microtiter plate method. In the primary screen 250 up- and down-regulated clones were isolated. Of these, 59 differentially expressed clones were obtained from the secondary screen. All of these cDNAs were partially sequenced and grouped into families after database searches. Twenty-five nonredundant groups of pulp clones were identified. These encoded enzymes were involved in ethylene biosynthesis, respiration, starch metabolism, cell wall degradation, and several other key metabolic events. We describe the analysis of these clones and their possible involvement in ripening. PMID:9342865

Selective enrichment of a methanol-utilizing consortium using pulp & paper mill waste streams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gregory R. Mockos; William A. Smith; Frank J. Loge

Efficient utilization of carbon inputs is critical to the economic viability of the current forest products sector. Input carbon losses occur in various locations within a pulp mill, including losses as volatile organics and wastewater . Opportunities exist to capture this carbon in the form of value-added products such as biodegradable polymers. Waste activated sludge from a pulp mill wastewater facility was enriched for 80 days for a methanol-utilizing consortium with the goal of using this consortium to produce biopolymers from methanol-rich pulp mill waste streams. Five enrichment conditions were utilized: three high-methanol streams from the kraft mill foul condensatemore » system, one methanol-amended stream from the mill wastewater plant, and one methanol-only enrichment. Enrichment reactors were operated aerobically in sequencing batch mode at neutral pH and 25°C with a hydraulic residence time and a solids retention time of four days. Non-enriched waste activated sludge did not consume methanol or reduce chemical oxygen demand. With enrichment, however, the chemical oxygen demand reduction over 24 hour feed/decant cycles ranged from 79 to 89 %, and methanol concentrations dropped below method detection limits. Neither the non-enriched waste activated sludge nor any of the enrichment cultures accumulated polyhydroxyalkanoates (PHAs) under conditions of nitrogen sufficiency. Similarly, the non-enriched waste activated sludge did not accumulate PHAs under nitrogen limited conditions. By contrast, enriched cultures accumulated PHAs to nearly 14% on a dry weight basis under nitrogen limited conditions. This indicates that selectively-enriched pulp mill waste activated sludge can serve as an inoculum for PHA production from methanol-rich pulp mill effluents.« less

Review on Bamboo Utilization as Biocomposites, Pulp and Bioenergy

NASA Astrophysics Data System (ADS)

Yusuf, Sulaeman; Syamani, F. A.; Fatriasari, W.; Subyakto

2018-03-01

One of potential non wood bioresources utilized in industrial application is bamboos. Bamboos are include in graminae family which have high biomass productivity, easy and rapid production, wide avability and high holocellulose content. Indonesia has a huge potential of bamboos, more than 162 bamboo species are found however only some of them are planted that have a high economic value. Bamboos have some advantages such as can be harvested at 3 years, straight culm, high strength, easy to be processed, and relatively cheap. Research Center for Biomaterials has developed utilization of bamboo culm for ply bamboo product as alternative of plywood since 1995, using gombong bamboo, tali bamboo, sembilang bamboo, andong bamboo with PF resin as adhesive. Other biocomposite products from bamboos include particle board, cement board and polymer-bamboo fiber composites. In term of processing technique and final product quality, bamboo composites from ply bamboo are the most prospectable material to be utilized in industrial application. Yellow bamboo and betung bamboo have also been developed as pulp and paper. Biopulping using soda and kraft pulping after biological pretreatment using white rot fungi to remove lignin was used as pulping method in this conversion. Biokraft pulping with Trametes versicolor for 45 days with inoculum loading of 10% resulted better pulp quality compared to the other fungi. Betung bamboo had good morphological characteristics and chemical component content to be converted into bioenergy such as bioethanol. Several pretreatment methods have been developed in order to result high sugar yield. Microwave assisted acid hydrolysis was preferedin producing higher yield from the pretreated bamboo compared to enzymatic hydrolysis. By using this method, the bamboo pretreated by biological-microwave pretreatment results higher improvement to increase sugar yield.

Selective Enrichment of a Methanol-Utilizing Consortium Using Pulp and Paper Mill Waste Streams

NASA Astrophysics Data System (ADS)

Mockos, Gregory R.; Smith, William A.; Loge, Frank J.; Thompson, David N.

Efficient utilization of carbon inputs is critical to the economic viability of the current forest products sector. Input carbon losses occur in various locations within a pulp mill, including losses as volatile organics and wastewater. Opportunities exist to capture this carbon in the form of value-added products such as biodegradable polymers. Wasteactivated sludge from a pulp mill wastewater facility was enriched for 80 days for a methanol-utilizing consortium with the goal of using this consortium to produce biopolymers from methanol-rich pulp mill waste streams. Five enrichment conditions were utilized: three high-methanol streams from the kraft mill foul condensate system, one methanol-amended stream from the mill wastewater plant, and one methanol-only enrichment. Enrichment reactors were operated aerobically in sequencing batch mode at neutral pH and 25°C with a hydraulic residence time and a solids retention time of 4 days. Non-enriched waste activated sludge did not consume methanol or reduce chemical oxygen demand. With enrichment, however, the chemical oxygen demand reduction over 24-h feed/ decant cycles ranged from 79 to 89%, and methanol concentrations dropped below method detection limits. Neither the non-enriched waste-activated sludge nor any of the enrichment cultures accumulated polyhydroxyalkanoates (PHAs) under conditions of nitrogen sufficiency. Similarly, the non-enriched waste activated sludge did not accumulate PHAs under nitrogen-limited conditions. By contrast, enriched cultures accumulated PHAs to nearly 14% on a dry weight basis under nitrogen-limited conditions. This indicates that selectively enriched pulp mill waste activated sludge can serve as an inoculum for PHA production from methanol-rich pulp mill effluents.

Mill demonstration of TMP production from forest thinnings : pulp quality, refining energy, and handsheet properties

Treesearch

J.Y. Zhu; C. Tim Scott; Roland Gleisner; Doreen Mann; D.P. Dykstra; G. Holton Quinn; Louis L. Edwards

2007-01-01

High-value, large-volume utilization of forest thinning materials from U.S. National Forests is a potentially important contributor to sustainable forest health. This study demonstrated the utilization of wood chips produced from thinnings for the production of thermomechanical pulp (TMP). Both whole-log chips (primarily from small-diameter logs, tops, and reject logs...

Mill demonstration of TMP production from forest thinnings: pulp quality, refining energy, and handsheet properties

Treesearch

J.Y. Zhu; C. Tim Scott; Roland Gleisner; Doreen Mann; D.P. Dykstra; G. Holton Quinn; Louis L. Edwards

2007-01-01

High-value, large-volume utilization of forest thinning materials from U.S. national forests is a potentially important contributor to sustainable forest health. This study demonstrated the utilization of wood chips produced from thinnings for the production of thermomechanical pulp (TMP). Both whole-log chips (primarily from small-diameter logs, tops, and reject logs...

Crystal structures of D-tagatose 3-epimerase from Pseudomonas cichorii and its complexes with D-tagatose and D-fructose.

PubMed

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-11-23

Pseudomonas cichoriiid-tagatose 3-epimerase (P. cichoriid-TE) can efficiently catalyze the epimerization of not only d-tagatose to d-sorbose, but also d-fructose to d-psicose, and is used for the production of d-psicose from d-fructose. The crystal structures of P. cichoriid-TE alone and in complexes with d-tagatose and d-fructose were determined at resolutions of 1.79, 2.28, and 2.06 A, respectively. A subunit of P. cichoriid-TE adopts a (beta/alpha)(8) barrel structure, and a metal ion (Mn(2+)) found in the active site is coordinated by Glu152, Asp185, His211, and Glu246 at the end of the beta-barrel. P. cichoriid-TE forms a stable dimer to give a favorable accessible surface for substrate binding on the front side of the dimer. The simulated omit map indicates that O2 and O3 of d-tagatose and/or d-fructose coordinate Mn(2+), and that C3-O3 is located between carboxyl groups of Glu152 and Glu246, supporting the previously proposed mechanism of deprotonation/protonation at C3 by two Glu residues. Although the electron density is poor at the 4-, 5-, and 6-positions of the substrates, substrate-enzyme interactions can be deduced from the significant electron density at O6. The O6 possibly interacts with Cys66 via hydrogen bonding, whereas O4 and O5 in d-tagatose and O4 in d-fructose do not undergo hydrogen bonding to the enzyme and are in a hydrophobic environment created by Phe7, Trp15, Trp113, and Phe248. Due to the lack of specific interactions between the enzyme and its substrates at the 4- and 5-positions, P. cichoriid-TE loosely recognizes substrates in this region, allowing it to efficiently catalyze the epimerization of d-tagatose and d-fructose (C4 epimer of d-tagatose) as well. Furthermore, a C3-O3 proton-exchange mechanism for P. cichoriid-TE is suggested by X-ray structural analysis, providing a clear explanation for the regulation of the ionization state of Glu152 and Glu246.

Biochemical markers of striatal desensitization in cortical-limbic hyperglutamatergic TS- & OCD-like transgenic mice.

PubMed

O'Brien, Kylie B; Sharrief, Anjail Z; Nordstrom, Eric J; Travanty, Anthony J; Huynh, Mailee; Romero, Megan P; Bittner, Katie C; Bowser, Michael T; Burton, Frank H

2018-04-01

Tics and compulsions in comorbid Tourette's syndrome (TS) and obsessive-compulsive disorder (OCD) are associated with chronic hyperactivity of parallel cortico/amygdalo-striato-thalamo-cortical (CSTC) loop circuits. Comorbid TS- & OCD-like behaviors have likewise been observed in D1CT-7 mice, in which an artificial neuropotentiating transgene encoding the cAMP-elevating intracellular subunit of cholera toxin (CT) is chronically expressed selectively in somatosensory cortical & amygdalar dopamine (DA) D1 receptor-expressing neurons that activate cortico/amygdalo-striatal glutamate (GLU) output. We've now examined in D1CT-7 mice whether the chronic GLU output from their potentiated cortical/limbic CSTC subcircuit afferents associated with TS- & OCD-like behaviors elicits desensitizing neurochemical changes in the striatum (STR). Microdialysis-capillary electrophoresis and in situ hybridization reveal that the mice's chronic GLU-excited STR exhibits pharmacodynamic changes in three independently GLU-regulated measures of output neuron activation, co-excitation, and desensitization, signifying hyperactive striatal CSTC output and compensatory striatal glial and neuronal desensitization: 1) Striatal GABA, an output neurotransmitter induced by afferent GLU, is increased. 2) Striatal d-serine, a glial excitatory co-transmitter inhibited by afferent GLU, is decreased. 3) Striatal Period1 (Per1), which plays a non-circadian role in the STR as a GLU + DA D1- (cAMP-) dependent repressor thought to feedback-inhibit GLU + DA- triggered ultradian urges and motions, is transcriptionally abolished. These data imply that chronic cortical/limbic GLU excitation of the STR desensitizes its co-excitatory d-serine & DA inputs while freezing its GABA output in an active state to mediate chronic tics and compulsions - possibly in part by abolishing striatal Per1-dependent ultradian extinction of urges and motions. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

40 CFR 430.44 - Effluent limitations representing the degree of effluent reduction attainable by the application...

Code of Federal Regulations, 2011 CFR

2011-07-01

...) EFFLUENT GUIDELINES AND STANDARDS THE PULP, PAPER, AND PAPERBOARD POINT SOURCE CATEGORY Dissolving Sulfite... dissolving sulfite pulp facilities where nitration, viscose, or cellophane pulps are produced] Pollutant or... ton of product. Subpart D [BAT effluent limitations for dissolving sulfite pulp facilities where...

Synthesis and Structure Activity Relationship of Tetrahydroisoquinoline-based Potentiators of GluN2C and GluN2D Containing N-Methyl-D-Aspartate Receptors

PubMed Central

Santangelo Freel, Rose M.; Ogden, Kevin K.; Strong, Katie L.; Khatri, Alpa; Chepiga, Kathryn M.; Jensen, Henrik S.; Traynelis, Stephen F.; Liotta, Dennis C.

2015-01-01

We describe here the synthesis and evaluation of a series of tetrahydroisoquinolines that show subunit-selective potentiation of NMDA receptors containing the GluN2C or GluN2D subunits. Bischler-Napieralski conditions were employed in the key step for the conversion of acyclic amides to the corresponding tetrahydroisoquinoline containing analogs. Compounds were evaluated using both two electrode voltage clamp recordings from Xenopus laevis oocytes and imaging of mammalian BHK cells loaded with Ca2+-sensitive dyes. The most potent analogues had EC50 values of 300 nM and showed over 2-fold potentiation of the response to maximally effective concentrations of glutamate and glycine, but had no effect on responses from NMDA receptors containing the GluN2A or GluN2B subunits, AMPA, kainate, GABA, or glycine receptors or a variety of other potential targets. These compounds represent a potent class of small molecule subunit-selective potentiators of NMDA receptors. PMID:23627311

Clustered Genes Encoding 2-Keto-l-Gulonate Reductase and l-Idonate 5-Dehydrogenase in the Novel Fungal d-Glucuronic Acid Pathway

PubMed Central

Kuivanen, Joosu; Arvas, Mikko; Richard, Peter

2017-01-01

D-Glucuronic acid is a biomass component that occurs in plant cell wall polysaccharides and is catabolized by saprotrophic microorganisms including fungi. A pathway for D-glucuronic acid catabolism in fungal microorganisms is only partly known. In the filamentous fungus Aspergillus niger, the enzymes that are known to be part of the pathway are the NADPH requiring D-glucuronic acid reductase forming L-gulonate and the NADH requiring 2-keto-L-gulonate reductase that forms L-idonate. With the aid of RNA sequencing we identified two more enzymes of the pathway. The first is a NADPH requiring 2-keto-L-gulonate reductase that forms L-idonate, GluD. The second is a NAD+ requiring L-idonate 5-dehydrogenase forming 5-keto-gluconate, GluE. The genes coding for these two enzymes are clustered and share the same bidirectional promoter. The GluD is an enzyme with a strict requirement for NADP+/NADPH as cofactors. The kcat for 2-keto-L-gulonate and L-idonate is 21.4 and 1.1 s-1, and the Km 25.3 and 12.6 mM, respectively, when using the purified protein. In contrast, the GluE has a strict requirement for NAD+/NADH. The kcat for L-idonate and 5-keto-D-gluconate is 5.5 and 7.2 s-1, and the Km 30.9 and 8.4 mM, respectively. These values also refer to the purified protein. The gluD deletion resulted in accumulation of 2-keto-L-gulonate in the liquid cultivation while the gluE deletion resulted in reduced growth and cessation of the D-glucuronic acid catabolism. PMID:28261181

Brain pyroglutamate amyloid-β is produced by cathepsin B and is reduced by the cysteine protease inhibitor E64d, representing a potential Alzheimer's disease therapeutic.

PubMed

Hook, Gregory; Yu, Jin; Toneff, Thomas; Kindy, Mark; Hook, Vivian

2014-01-01

Pyroglutamate amyloid-β peptides (pGlu-Aβ) are particularly pernicious forms of amyloid-β peptides (Aβ) present in Alzheimer's disease (AD) brains. pGlu-Aβ peptides are N-terminally truncated forms of full-length Aβ peptides (flAβ(1-40/42)) in which the N-terminal glutamate is cyclized to pyroglutamate to generate pGlu-Aβ(3-40/42). β-secretase cleavage of amyloid-β precursor protein (AβPP) produces flAβ(1-40/42), but it is not yet known whether the β-secretase BACE1 or the alternative β-secretase cathepsin B (CatB) participate in the production of pGlu-Aβ. Therefore, this study examined the effects of gene knockout of these proteases on brain pGlu-Aβ levels in transgenic AβPPLon mice, which express AβPP isoform 695 and have the wild-type (wt) β-secretase activity found in most AD patients. Knockout or overexpression of the CatB gene reduced or increased, respectively, pGlu-Aβ(3-40/42), flAβ(1-40/42), and pGlu-Aβ plaque load, but knockout of the BACE1 gene had no effect on those parameters in the transgenic mice. Treatment of AβPPLon mice with E64d, a cysteine protease inhibitor of CatB, also reduced brain pGlu-Aβ(3-42), flAβ(1-40/42), and pGlu-Aβ plaque load. Treatment of neuronal-like chromaffin cells with CA074Me, an inhibitor of CatB, resulted in reduced levels of pGlu-Aβ(3-40) released from the activity-dependent, regulated secretory pathway. Moreover, CatB knockout and E64d treatment has been previously shown to improve memory deficits in the AβPPLon mice. These data illustrate the role of CatB in producing pGlu-Aβ and flAβ that participate as key factors in the development of AD. The advantages of CatB inhibitors, especially E64d and its derivatives, as alternatives to BACE1 inhibitors in treating AD patients are discussed.

Novel insights into the composition, variation, organization, and expression of the low-molecular-weight glutenin subunit gene family in common wheat

PubMed Central

Zhang, Xiaofei; Liu, Dongcheng; Zhang, Jianghua; Jiang, Wei; Luo, Guangbin; Yang, Wenlong; Sun, Jiazhu; Tong, Yiping; Cui, Dangqun; Zhang, Aimin

2013-01-01

Low-molecular-weight glutenin subunits (LMW-GS), encoded by a complex multigene family, play an important role in the processing quality of wheat flour. Although members of this gene family have been identified in several wheat varieties, the allelic variation and composition of LMW-GS genes in common wheat are not well understood. In the present study, using the LMW-GS gene molecular marker system and the full-length gene cloning method, a comprehensive molecular analysis of LMW-GS genes was conducted in a representative population, the micro-core collections (MCC) of Chinese wheat germplasm. Generally, >15 LMW-GS genes were identified from individual MCC accessions, of which 4–6 were located at the Glu-A3 locus, 3–5 at the Glu-B3 locus, and eight at the Glu-D3 locus. LMW-GS genes at the Glu-A3 locus showed the highest allelic diversity, followed by the Glu-B3 genes, while the Glu-D3 genes were extremely conserved among MCC accessions. Expression and sequence analysis showed that 9–13 active LMW-GS genes were present in each accession. Sequence identity analysis showed that all i-type genes present at the Glu-A3 locus formed a single group, the s-type genes located at Glu-B3 and Glu-D3 loci comprised a unique group, while high-diversity m-type genes were classified into four groups and detected in all Glu-3 loci. These results contribute to the functional analysis of LMW-GS genes and facilitate improvement of bread-making quality by wheat molecular breeding programmes. PMID:23536608

40 CFR 62.1104 - Identification of sources.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., Contra Costa County Pulp Mill. (b) Louisiana Pacific Corp., Samoa Complex. (c) Crown Simpson Pulp Company, Fairhaven. (d) Simpson Paper Company, Shasta County Pulp Mill. [47 FR 47385, Oct. 26, 1982] Landfill Gas...

40 CFR 62.1104 - Identification of sources.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., Contra Costa County Pulp Mill. (b) Louisiana Pacific Corp., Samoa Complex. (c) Crown Simpson Pulp Company, Fairhaven. (d) Simpson Paper Company, Shasta County Pulp Mill. [47 FR 47385, Oct. 26, 1982] Landfill Gas...

Analysis of Glu-1 deletion lines reveals the importance of high molecular weight glutenin subunits 7+9 Glu-B1 in wheat flour tortilla making

USDA-ARS?s Scientific Manuscript database

High molecular weight glutenin subunits (HMW-GS) play a significant role in the functional properties of wheat flour. Wheat lines in which one or more of the HMW-GS alleles were absent from Glu-A1, Glu-B1 or Glu-D1 loci (deletion lines) were compared with non-deletion lines for dough and tortilla ma...

S-Isovaline Contained in Meteorites, Induces Enantiomeric Excess in D,L-glutamic Acid During Recrystallization

NASA Astrophysics Data System (ADS)

Kojo, Shosuke

2015-06-01

S-Isovaline (S-Iva: 6.7 mmol) and D,L-glutamic acid (Glu: 2 mmol) were dissolved in 10 ml of hot water, and the resulting solution was divided in 5 vessels. After recrystallization, the crystals were collected from each vessel, and the enantiomeric excess (ee) of Glu was determined with chemical derivatization using 1-fluoro-2,4-dinitrophenyl- 5-L-leucinamide followed by high-performance liquid chromatography. Ten crystallizations provided all D-rich Glu with ee values of 2.69 % ± 0.81 % (mean ± standard deviation), and those using R-Iva provided all L-rich Glu with ee values of 6.24 % ± 2.20 %. Five recrystallizations of D,L-Glu alone provided ee values of 0.474 % ± 0.33 %. The differences among these three ee values were statistically significant, showing that S-Iva, which was present in meteorites caused a significant induction of ee in this physiological amino acid. This is the first outcome that S-Iva induced ee changes in a physiological amino acid. S-Iva did not induce any ee changes in D,L-asparagine, leucine, valine, methionine, phenylalanine, tryptophan, glutamine, tyrosine, aspartic acid, or histidine under similar recrystallizations.

Undifferentiated embryonic stem cells express ionotropic glutamate receptor mRNAs

PubMed Central

Pachernegg, Svenja; Joshi, Illah; Muth-Köhne, Elke; Pahl, Steffen; Münster, Yvonne; Terhag, Jan; Karus, Michael; Werner, Markus; Ma-Högemeier, Zhan-Lu; Körber, Christoph; Grunwald, Thomas; Faissner, Andreas; Wiese, Stefan; Hollmann, Michael

2013-01-01

Ionotropic glutamate receptors (iGluRs) do not only mediate the majority of excitatory neurotransmission in the vertebrate CNS, but also modulate pre- and postnatal neurogenesis. Most of the studies on the developmental role of iGluRs are performed on neural progenitors and neural stem cells (NSCs). We took a step back in our study by examining the role of iGluRs in the earliest possible cell type, embryonic stem cells (ESCs), by looking at the mRNA expression of the major iGluR subfamilies in undifferentiated mouse ESCs. For that, we used two distinct murine ES cell lines, 46C ESCs and J1 ESCs. Regarding 46C ESCs, we found transcripts of kainate receptors (KARs) (GluK2 to GluK5), AMPA receptors (AMPARs) (GluA1, GluA3, and GluA4), and NMDA receptors (NMDARs) (GluN1, and GluN2A to GluN2D). Analysis of 46C-derived cells of later developmental stages, namely neuroepithelial precursor cells (NEPs) and NSCs, revealed that the mRNA expression of KARs is significantly upregulated in NEPs and, subsequently, downregulated in NSCs. However, we could not detect any protein expression of any of the KAR subunits present on the mRNA level either in ESCs, NEPs, or NSCs. Regarding AMPARs and NMDARs, GluN2A is weakly expressed at the protein level only in NSCs. Matching our findings for iGluRs, all three cell types were found to weakly express pre- and postsynaptic markers of glutamatergic synapses only at the mRNA level. Finally, we performed patch-clamp recordings of 46C ESCs and could not detect any current upon iGluR agonist application. Similar to 46C ESCs, J1 ESCs express KARs (GluK2 to GluK5), AMPARs (GluA3), and NMDARs (GluN1, and GluN2A to GluN2D) at the mRNA level, but these transcripts are not translated into receptor proteins either. Thus, we conclude that ESCs do not contain functional iGluRs, although they do express an almost complete set of iGluR subunit mRNAs. PMID:24348335

Structure of L-Xylulose-5-Phosphate 3-Epimerase (UlaE) from the Anaerobic L-Ascorbate Utilization Pathway of Escherichia coli: Identification of a Novel Phosphate Binding Motif within a TIM Barrel Fold

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Rong; Pineda, Marco; Ajamian, Eunice

2009-01-15

Three catabolic enzymes, UlaD, UlaE, and UlaF, are involved in a pathway leading to fermentation of L-ascorbate under anaerobic conditions. UlaD catalyzes a {beta}-keto acid decarboxylation reaction to produce L-xylulose-5-phosphate, which undergoes successive epimerization reactions with UlaE (L-xylulose-5-phosphate 3-epimerase) and UlaF (L-ribulose-5-phosphate 4-epimerase), yielding D-xylulose-5-phosphate, an intermediate in the pentose phosphate pathway. We describe here crystallographic studies of UlaE from Escherichia coli O157:H7 that complete the structural characterization of this pathway. UlaE has a triosephosphate isomerase (TIM) barrel fold and forms dimers. The active site is located at the C-terminal ends of the parallel {beta}-strands. The enzyme binds Zn{sup 2+},more » which is coordinated by Glu155, Asp185, His211, and Glu251. We identified a phosphate-binding site formed by residues from the {beta}1/{alpha}1 loop and {alpha}3' helix in the N-terminal region. This site differs from the well-characterized phosphate-binding motif found in several TIM barrel superfamilies that is located at strands {beta}7 and {beta}8. The intrinsic flexibility of the active site region is reflected by two different conformations of loops forming part of the substrate-binding site. Based on computational docking of the L-xylulose 5-phosphate substrate to UlaE and structural similarities of the active site of this enzyme to the active sites of other epimerases, a metal-dependent epimerization mechanism for UlaE is proposed, and Glu155 and Glu251 are implicated as catalytic residues. Mutation and activity measurements for structurally equivalent residues in related epimerases supported this mechanistic proposal.« less

The HIV-1 viral protein Tat increases glutamate and decreases GABA exocytosis from human and mouse neocortical nerve endings.

PubMed

Musante, Veronica; Summa, Maria; Neri, Elisa; Puliti, Aldamaria; Godowicz, Tomasz T; Severi, Paolo; Battaglia, Giuseppe; Raiteri, Maurizio; Pittaluga, Anna

2010-08-01

Human immunodeficiency virus-1 (HIV-1)-encoded transactivator of transcription (Tat) potentiated the depolarization-evoked exocytosis of [(3)H]D-aspartate ([(3)H]D-ASP) from human neocortical terminals. The metabotropic glutamate (mGlu) 1 receptor antagonist 7-(hydroxyimino)cyclopropa[b]chromen-1a-carboxylate ethyl ester (CPCCOEt) prevented this effect, whereas the mGlu5 receptor antagonist 2-methyl-6-(phenylethynyl) pyridine hydrochloride (MPEP) was ineffective. Western blot analysis showed that human neocortex synaptosomes possess mGlu1 and mGlu5 receptors. Tat potentiated the K(+)-evoked release of [(3)H]D-ASP or of endogenous glutamate from mouse neocortical synaptosomes in a CPCCOEt-sensitive and MPEP-insensitive manner. Deletion of mGlu1 receptors (crv4/crv4 mice) or mGlu5 receptors (mGlu5(-/-)mouse) silenced Tat effects. Tat enhanced inositol 1,4,5-trisphosphate production in human and mouse neocortical synaptosomes, consistent with the involvement of group I mGlu receptors. Tat inhibited the K(+)-evoked release of [(3)H]gamma-aminobutyric acid ([(3)H]GABA) from human synaptosomes and that of endogenous GABA or [(3)H]GABA from mouse nerve terminals; the inhibition was insensitive to CPCCOEt or MPEP. Tat-induced effects were retained by Tat(37-72) but not by Tat(48-85). In mouse neocortical slices, Tat facilitated the K(+)- and the veratridine-induced release of [(3)H]D-ASP in a CPCCOEt-sensitive manner and was ineffective in crv4/crv4 mouse slices. These observations are relevant to the comprehension of the pathophysiological effects of Tat in central nervous system and may suggest new potential therapeutic approaches to the cure of HIV-1-associated dementia.

Changes in D-aspartic acid and D-glutamic acid levels in the tissues and physiological fluids of mice with various D-aspartate oxidase activities.

PubMed

Han, Hai; Miyoshi, Yurika; Koga, Reiko; Mita, Masashi; Konno, Ryuichi; Hamase, Kenji

2015-12-10

D-Aspartic acid (D-Asp) and D-glutamic acid (D-Glu) are currently paid attention as modulators of neuronal transmission and hormonal secretion. These two D-amino acids are metabolized only by D-aspartate oxidase (DDO) in mammals. Therefore, in order to design and develop new drugs controlling the D-Asp and D-Glu amounts via regulation of the DDO activities, changes in these acidic D-amino acid amounts in various tissues are expected to be clarified in model animals having various DDO activities. In the present study, the amounts of Asp and Glu enantiomers in 6 brain tissues, 11 peripheral tissues and 2 physiological fluids of DDO(+/+), DDO(+/-) and DDO(-/-) mice were determined using a sensitive and selective two-dimensional HPLC system. As a result, the amounts of D-Asp were drastically increased with the decrease in the DDO activity in all the tested tissues and physiological fluids. On the other hand, the amounts of D-Glu were almost the same among the 3 strains of mice. The present results are useful for designing new drug candidates, such as DDO inhibitors, and further studies are expected. Copyright © 2015 Elsevier B.V. All rights reserved.

The role of GluN2B-containing NMDA receptors in short- and long-term fear recall.

PubMed

Mikics, Eva; Toth, Mate; Biro, Laszlo; Bruzsik, Biborka; Nagy, Boglarka; Haller, Jozsef

2017-08-01

N-methyl-d-aspartate (NMDA) receptors are crucial synaptic elements in long-term memory formation, including the associative learning of fearful events. Although NMDA blockers were consistently shown to inhibit fear memory acquisition and recall, the clinical use of general NMDA blockers is hampered by their side effects. Recent studies revealed significant heterogeneity in the distribution and neurophysiological characteristics of NMDA receptors with different GluN2 (NR2) subunit composition, which may have differential role in fear learning and recall. To investigate the specific role of NMDA receptor subpopulations with different GluN2 subunit compositions in the formation of lasting traumatic memories, we contrasted the effects of general NMDA receptor blockade with GluN2A-, GluN2B-, and GluN2C/D subunit selective antagonists (MK-801, PEAQX, Ro25-6981, PPDA, respectively). To investigate acute and lasting consequences, behavioral responses were investigated 1 and 28days after fear conditioning. We found that MK-801 (0.05 and 0.1mg/kg) decreased fear recall at both time points. GluN2B receptor subunit blockade produced highly similar effects, albeit efficacy was somewhat smaller 28days after fear conditioning. Unlike MK-801, Ro25-6981 (3 and 10mg/kg) did not affect locomotor activity in the open-field. In contrast, GluN2A and GluN2C/D blockers (6 and 20mg/kg PEAQX; 3 and 10mg/kg PPDA, respectively) had no effect on conditioned fear recall at any time point and dose. This sharp contrast between GluN2B- and other subunit-containing NMDA receptor function indicates that GluN2B receptor subunits are intimately involved in fear memory formation, and may provide a novel pharmacological target in post-traumatic stress disorder or other fear-related disorders. Copyright © 2017 Elsevier Inc. All rights reserved.

The effect of the mGlu5 negative allosteric modulator MTEP and NMDA receptor partial agonist D-cycloserine on Pavlovian conditioned fear.

PubMed

Handford, Charlotte E; Tan, Shawn; Lawrence, Andrew J; Kim, Jee Hyun

2014-09-01

The metabotropic glutamate receptor 5 (mGlu5) and N-methyl-D-aspartate (NMDA) receptor are critical for processes underlying synaptic plasticity, such as long-term potentiation. mGlu5 signaling increases neuronal excitability and potentiates NMDA receptor currents in the amygdala and the hippocampus. The present study examined the involvement of mGlu5 in the acquisition and consolidation of conditioned fear to a tone and context in mice, and explored the functional relationship between mGlu5 and NMDA receptors in this regard. Experiment 1 showed that systemic administration of the mGlu5 negative allosteric modulator 3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP) prior to conditioning significantly attenuated cue-elicited freezing during fear conditioning, which suggests that mGlu5 is necessary for the formation of a tone-shock association. This effect was dose-related (Experiment 2) and not due to any effects of MTEP on shock sensitivity or state-dependency (Experiment 3). Post-conditioning injection of MTEP had no effects (Experiment 4). Although post-conditioning injection of the NMDA receptor partial agonist D-cycloserine (DCS) alone facilitated consolidation of conditioned fear (Experiment 6), it was not able to rescue the acquisition deficit caused by MTEP (Experiment 5). Taken together, these findings indicate a crucial role for mGlu5 signaling in acquisition and NMDA receptor signaling in consolidation of conditioned fear.

Hydrolytic cleavage of pyroglutamyl-peptide bond. V. selective removal of pyroglutamic acid from biologically active pyroglutamylpeptides in high concentrations of aqueous methanesulfonic acid.

PubMed

Kobayashi, Junko; Ohki, Kazuhiro; Okimura, Keiko; Hashimoto, Tadashi; Sakura, Naoki

2006-06-01

Application of aqueous methanesulfonic acid (MSA) for selective chemical removal of pyroglutamic acid (pGlu) residue from five biologically active pyroglutamyl-peptides (pGlu-X-peptides, X=amino acid residue at position 2) was examined. Gonadotropin releasing hormone (Gn-RH), dog neuromedin U-8 (d-NMU-8), physalaemin (PH), a bradykinin potentiating peptide (BPP-5a) and neurotensin (NT) as pGlu-X-peptides were incubated in either 70% or 90% aqueous MSA at 25 degrees C. HPLC analysis of the incubation solutions showed that the main decomposition product was H-X-peptide derived from each pGlu-X-peptide by the removal of pGlu. The results revealed that the pGlu-X peptide bond had higher susceptibility than various internal amide bonds in the five peptides examined, including the Trp-Ser bond in Gn-RH, the C-terminal Asn-NH(2) in d-NMU-8, and the Asp-Pro bond in PH, whose acid susceptibility is well known. Thus, mild hydrolysis with high concentrations of aqueous MSA may be applicable to chemically selective removal of pGlu from pGlu-X-peptides for structural examinations.

Artificial dental pulp exposure injury up-regulates antigen-presenting cell-related molecules in rat central nervous system.

PubMed

Kaneko, Tomoatsu; Kaneko, Mitsuhiro; Chokechanachaisakul, Uraiwan; Kawamura, Jun; Kaneko, Reika; Sunakawa, Mitsuhiro; Okiji, Takashi; Suda, Hideaki

2010-03-01

Bacterial infection and resulting inflammation of the dental pulp might not only trigger neuroimmune interactions in this tissue but also sensitize the central nervous system (CNS) such as the thalamus via nociceptive neurons. Thus, immunopathologic changes in the rat thalamus that take place after pulp inflammation were investigated. Pulp exposure was made in mandibular right first molars of 5-week-old Wistar rats. After 24 hours, the thalamus was retrieved and subjected to either immunohistochemistry for class II major histocompatibility complex (MHC) molecules and glial fibrillary acidic protein (GFAP) or mRNA expression analysis of antigen-presenting cell-related molecules and N-methyl-D-aspartate receptor 2D subunit (NR2D) by means of reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR. At 24 hours after pulp exposure, the density of class II MHC molecule-expressing and GFAP-expressing cells was increased in the contralateral thalamus. Gene expression analysis revealed the up-regulation of class II MHC molecules, CD80, CD83, CD86, and NR2D in the contralateral thalamus, as compared with the ipsilateral thalamus. These results suggest the signal of pulp inflammation induces neuronal activation in the CNS. Copyright (c) 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Anaerobic co-digestion of cyanide containing cassava pulp with pig manure.

PubMed

Glanpracha, Naraporn; Annachhatre, Ajit P

2016-08-01

Anaerobic co-digestion of cyanide-containing cassava pulp with pig manure was evaluated using laboratory scale mesophilic digester. The digester was operated in a semi-continuous mode with the mixed feedstock having C/N ratio of 35:1. Digester startup was accomplished in 60days with loading of 0.5-1kgVS/m(3)d. Subsequently, the loading to digester was increased step-wise from 2 to 9kgVS/m(3)d. Digester performance was stable at loading between 2 and 6kgVS/m(3)d with an average volatile solid removal and methane yield of 82% and 0.38m(3)/kgVSadded, respectively. However, beyond loading of 7kgVS/m(3)d, solubilization of particulate matter did not take place efficiently. Cyanide present in cassava pulp was successfully degraded indicating that anaerobic sludge in the digester was well acclimatized to cyanide. The results show that cassava pulp can be successfully digested anaerobically with pig manure as co-substrate without any inhibitory effect of cyanide present in the cassava pulp. Copyright © 2016 Elsevier Ltd. All rights reserved.

Mesophilic anaerobic digestion of pulp and paper industry biosludge-long-term reactor performance and effects of thermal pretreatment.

PubMed

Kinnunen, V; Ylä-Outinen, A; Rintala, J

2015-12-15

The pulp and paper industry wastewater treatment processes produce large volumes of biosludge. Limited anaerobic degradation of lignocellulose has hindered the utilization of biosludge, but the processing of biosludge using anaerobic digestion has recently regained interest. In this study, biosludge was used as a sole substrate in long-term (400 d) mesophilic laboratory reactor trials. Nine biosludge batches collected evenly over a period of one year from a pulp and paper industry wastewater treatment plant had different solid and nutrient (nitrogen, phosphorus, trace elements) characteristics. Nutrient characteristics may vary by a factor of 2-11, while biomethane potentials (BMPs) ranged from 89 to 102 NL CH4 kg(-1) VS between batches. The BMPs were enhanced by 39-88% with thermal pretreatments at 105-134 °C. Despite varying biosludge properties, stable operation was achieved in reactor trials with a hydraulic retention time (HRT) of 14 d. Hydrolysis was the process limiting step, ceasing gas production when the HRT was shortened to 10 days. However, digestion with an HRT of 10 days was feasible after thermal pretreatment of the biosludge (20 min at 121 °C) due to enhanced hydrolysis. The methane yield was 78 NL CH4 kg(-1) VS for untreated biosludge and was increased by 77% (138 NL CH4 kg(-1) VS) after pretreatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

Interaction partners of PSD-93 studied by X-ray crystallography and fluorescence polarization spectroscopy.

PubMed

Fiorentini, Monica; Bach, Anders; Strømgaard, Kristian; Kastrup, Jette S; Gajhede, Michael

2013-04-01

PSD-93 (chapsyn-110, DLG2) is a member of the family of membrane-associated guanylate kinase (MAGUK) proteins. The MAGUK proteins are involved in receptor localization and signalling pathways. The best characterized MAGUK protein, PSD-95, is known to be involved in NMDA receptor signalling via its PDZ domains. The PDZ domains of PSD-95 and PSD-93 are structurally very similar, but relatively little is known about the function of PSD-93. PSD-93 has been suggested to interact with GluD2 from the family of ionotropic glutamate receptors. Here, the interactions of four residues (GTSI) representing the extreme C-terminus of GluD2 with PSD-93 PDZ1 have been investigated in the crystalline phase. Two different binding modes of these residues were observed, suggesting that the peptide is not tightly bound to PSD-93 PDZ1. In accordance, the two N-terminal PSD-93 PDZ domains show no appreciable binding affinity for a GluD2-derived C-terminal octapeptide, whereas micromolar affinity was observed for a GluN2B-derived C-terminal octapeptide. This indicates that if present, the interactions between GluD2 and PSD-93 involve more than the extreme terminus of the receptor. In contrast, the tumour-suppressor protein SCRIB PDZ3 shows low micromolar affinity towards the GluD2-derived octapeptide, which is in agreement with previous findings using high-throughput assays.

Ethanol Inhibition of Constitutively Open N-Methyl-d-Aspartate Receptors

PubMed Central

Xu, Minfu; Smothers, C. Thetford; Trudell, James

2012-01-01

N-Methyl-d-aspartate (NMDA) receptors gate a slow and calcium-rich component of the postsynaptic glutamate response. Like all ionotropic glutamate receptors, NMDA subunits contain a highly conserved motif (SYTANLAAF) in the transmembrane (TM) 3 domain that is critically involved in channel gating. Mutation of an alanine in this domain (A7; underlined above) results in constitutively open receptors that show reduced sensitivity to several allosteric modulators. In this study, we examined the effects of ethanol, a substance that inhibits NMDA currents via an unknown mechanism, on tonically active NMDA receptors expressed in human embryonic kidney 293 cells. Ethanol (100 mM) inhibited currents from GluN1(A7R)/GluN2A and GluN1(A7R)/GluN2B receptors by approximately 50%, whereas those from GluN1/GluN2B(A7R) receptors were reduced by less than 10%. In cysteine-substituted GluN1 and GluN2 A7 mutants, estimated ethanol IC50 values for agonist-gated currents were 101, 117, 103, and 69 mM for GluN1(A7C)/GluN2A, GluN1(A7C)/GluN2B, GluN1/GluN2A(A7C), and GluN1/GluN2B(A7C) receptors, respectively. After exposure to the thiol-modifying reagent 2-(trimethylammonium)ethyl methanethiosulfonate (MTSET), A7C mutants showed robust agonist-independent currents and reduced sensitivity to ethanol (IC50 values of 371, 256, 715, and 958 mM, respectively, as above). In contrast, cysteine modification of the ligand-binding domain resulted in constitutively open receptors that showed robust ethanol inhibition. Ethanol inhibition of MTSET-treated GluN1(A7C) receptors was further reduced by TM3/TM4 mutations previously shown to reduce ethanol sensitivity of agonist-gated receptors. Overall, these results show that ethanol affects NMDA receptor function at a site distal from agonist binding and appears to exert greater effects via perturbation of GluN2 subunits. PMID:22005043

A desensitization-selective potentiator of AMPA-type glutamate receptors

PubMed Central

Sekiguchi, Masayuki; Nishikawa, Kaori; Aoki, Shunsuke; Wada, Keiji

2002-01-01

We examined the effects of PEPA, an allosteric potentiator of AMPA receptors, on AMPA receptor kinetics. PEPA did not affect the deactivation of glutamate responses but potently attenuated the extent of receptor desensitization without slowing the onset of desensitization in most of the recombinant AMPA receptors (GluR1-flip, GluR1-flop, GluR3-flip, GluR3-flip + GluR2-flip, and GluR3-flop + GluR2-flop) expressed in Xenopus oocytes. For the GluR3-flop subunit, PEPA attenuated the extent of desensitization and only weakly prolonged deactivation (1.3 fold). PEPA did not significantly affect recovery from desensitization in oocytes expressing GluR3-flip, GluR1-flop, and GluR1-flop, but weakly accelerated (2.6 fold) recovery from desensitization in oocytes expressing GluR3-flop. PEPA's effect on desensitization of GluR3-flop-containing receptors is unique in that onset is very slow. Simulation studies using simplified kinetic models for AMPA receptors are utilized to explore the differential effects of PEPA on GluR3-flip and -flop. It is possible to simulate the action on GluR3-flip by modulating two rate constants in a 12-state kinetic model. For simulation of the action on GluR3-flop, the 12-state kinetic model is not enough, and it is necessary to invoke a 13th state, a PEPA-bound receptor to which glutamate cannot bind. These results suggest that attenuation of extent of desensitization represents the principal mechanism underlying the potentiation of AMPA receptors by PEPA, and that PEPA exhibits different mechanisms with respect to GluR3-flip and GluR3-flop. PMID:12145103

Gluing silicon with silicone

NASA Astrophysics Data System (ADS)

Abt, I.; Fox, H.; Moshous, B.; Richter, R. H.; Riechmann, K.; Rietz, M.; Riedl, J.; Denis, R. St; Wagner, W.

1998-02-01

Problems and solutions concerning the gluing of silicon detectors are discussed. The R & D work for the HERA- B vertex detector system led to gluing studies with epoxy and silicone-based adhesives used on ceramics and carbon fibre. The HERA- B solution using a silicone glue is presented.

Concentration change of DA, DOPAC, Glu and GABA in brain tissues in schizophrenia developmental model rats induced by MK-801.

PubMed

Liu, Yong; Tang, Yamei; Pu, Weidan; Zhang, Xianghui; Zhao, Jingping

2011-08-01

To explore the related neurobiochemical mechanism by comparing the concentration change of dopamine (DA), dihydroxy-phenyl acetic acid (DOPAC), glutamate (Glu), and γ-aminobutyric acid (GABA) in the brain tissues in schizophrenia (SZ) developmental model rats and chronic medication model rats. A total of 60 neonatal male Spragur-Dawley (SD) rats were randomly assigned to 3 groups at the postnatal day 6: an SZ developmental rat model group (subcutaneous injection with MK-801 at the postnatal day 7-10, 0.1 mg/kg, Bid), a chronic medication model group (intraperitoneal injection at the postnatal day 47-60, 0.2 mg/kg,Qd), and a normal control group (injection with 0.9% normal saline during the corresponding periods). DA, DOPAC, Glu, and GABA of the tissue homogenate from the medial prefrontal cortex (mPFC) and hippocampus were examined with Coularray electrochemic detection by high performance liquid chromatogram technique. The utilization rate of DA and Glu was calculated. Compared with the normal control group, the concentration of DA and DOPAC in the mPFC and the hippocampus in the SZ developmental model group significantly decreased (P<0.05), and the GABA concentration and Glu utilization rate in the mPFC also decreased (P<0.05). Compared with the chronic medication model group, the DA concentration of the mPFC in the SZ developmental group decreased (P<0.05), and the DOPAC concentration and the utility rate of DA in the hippocampus also decreased (P<0.01, P<0.05, respectively). The activities of DA, Glu and GABA system decrease in the mPFC and the DA system function reduces in the hippocampus of SZ developmental rats.

High-molecular-weight glutenin subunit-deficient mutants induced by ion beam and the effects of Glu-1 loci deletion on wheat quality properties.

PubMed

Zhang, Lujun; Chen, Qiufang; Su, Mingjie; Yan, Biao; Zhang, Xiangqi; Jiao, Zhen

2016-03-15

High-molecular-weight glutenin subunits (HMW-GSs) play a critical role in determining the viscoelastic properties of wheat. Mutations induced by ion beam radiation have been applied to improve the yield and quality of crop. In this study, HMW-GS-deficient mutant lines were selected and the effects of Glu-1 loci deletion on wheat quality properties were illustrated according to the analysis of dry seeds of common wheat (Triticum aestivum L.) Xiaoyan 81 treated with a nitrogen ion beam. Three HMW-GS-deficient mutant lines were obtained and then detected by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Large-chromosome-fragment deletion resulted in specific deficiencies, and the deleted region sizes were determined using molecular markers. Agronomic characters, quantity and proportion of glutenins and dough microstructure of the deletion lines all proved to be quite different from those of wild-type Xiaoyan 81. Analysis of quality properties suggested that GluA1(-) had superior property parameters, while GluB1(-) and GluD1(-) both showed a significant decrease in quality properties compared with Xiaoyan 81. The effects of the three Glu-1 loci on flour and dough quality-related parameters should be Glu-D1 > Glu-B1 > Glu-A1. Ion beam radiation can be used as a mutagen to create new crop mutants. © 2015 Society of Chemical Industry.

Simultaneous production of bio-ethanol and bleached pulp from red algae.

PubMed

Yoon, Min Ho; Lee, Yoon Woo; Lee, Chun Han; Seo, Yung Bum

2012-12-01

The red algae, Gelidium corneum, was used to produce bleached pulp for papermaking and ethanol. Aqueous extracts obtained at 100-140 °C were subjected to saccharification, purification, fermentation, and distillation to produce ethanol. The solid remnants were bleached with chlorine dioxide and peroxide to make pulp. In the extraction process, sulfuric acid and sodium thiosulfate were added to increase the extract yield and to improve de-polymerization of the extracts, as well as to generate high-quality pulp. An extraction process incorporating 5% sodium thiosulfate by dry weight of the algae provided optimal production conditions for the production of both strong pulp and a high ethanol yield. These results suggest that it might be possible to utilize algae instead of trees and starch for pulp and ethanol production, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.

Molecular Recognition of Endocytic Codes in Receptor Tyrosine Kinases

DTIC Science & Technology

1999-06-01

and B), substitution of Glu for Thr at residue 508 failed to induce actin aggregation in COS-7 cells (Fig. 9, panels C and D), comparable to lack...of effects of the kinase inactive Kd3-D460N mutant (Fig. 9, panels G and H). In contrast, substitution of 2 Glu residues whose charge may more...studies of Mekl where substitution of an Asp or Glu residue for 1 serine phosphoryl- ation site partially activated the enzyme and substitution of 2

Synthesis, crystal structure, and magnetic properties of two-dimensional divalent metal glutarate/dipyridylamine coordination polymers, with a single crystal-to-single crystal transformation in the copper derivative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Montney, Matthew R.; Supkowski, Ronald M.; Staples, Richard J.

Hydrothermal reaction of divalent metal chlorides with glutaric acid and 4,4'-dipyridylamine (dpa) has afforded an isostructural family of coordination polymers with formulation [M(glu)(dpa)]{sub n} (M=Co (1), Ni (2), Cu (3); glu=glutarate). Square pyramidal coordination is seen in 1-3, with semi-ligation of a sixth donor to produce a '5+1' extended coordination sphere. Neighboring metal atoms are linked into 1D [M(glu)]{sub n} neutral chains through chelating/monodentate bridging glutarate moieties with a syn-anti binding mode, and semi-chelation of the pendant carboxylate oxygen. These chains further connect into 2D layers through dipodal dpa ligands. Neighboring layers stack into the pseudo 3D crystal structure ofmore » 1-3 through supramolecular hydrogen bonding between dpa amine units and the semi-chelated glutarate oxygen atoms. The variable temperature magnetic behavior of 1-3 was explored and modeled as infinite 1D Heisenberg chains. Notably, complex 3 undergoes a thermally induced single crystal-to-single crystal transformation between centric and acentric space groups, with a conformationally disordered unilayer structure at 293 K and an ordered bilayer structure at 173 K. All materials were further characterized via infrared spectroscopy and elemental and thermogravimetric analyses. - Graphical abstract: The coordination polymers [M(glu)(dpa)]{sub n} (M=Co (1), Ni (2), Cu (3); glu=glutarate, dpa=4,4'-dipyridylamine) exhibit 2D layer structures based on 1D [M(glu)]{sub n} chains linked through dpa tethers. Antiferromagnetic coupling is observed for 2 and 3, while ferromagnetism is predominant in 1. Compound 3 undergoes a thermally induced single crystal-to-single crystal transformation from an acentric to a centrosymmetric space group.« less

Comparative pharmacology of flatworm and roundworm glutamate-gated chloride channels: Implications for potential anthelmintics.

PubMed

Lynagh, Timothy; Cromer, Brett A; Dufour, Vanessa; Laube, Bodo

2014-12-01

Pharmacological targeting of glutamate-gated chloride channels (GluCls) is a potent anthelmintic strategy, evidenced by macrocyclic lactones that eliminate numerous roundworm infections by activating roundworm GluCls. Given the recent identification of flatworm GluCls and the urgent need for drugs against schistosomiasis, flatworm GluCls should be evaluated as potential anthelmintic targets. This study sought to identify agonists or modulators of one such GluCl, SmGluCl-2 from the parasitic flatworm Schistosoma mansoni. The effects of nine glutamate-like compounds and three monoterpenoid ion channel modulators were measured by electrophysiology at SmGluCl-2 recombinantly expressed in Xenopus laevis oocytes. For comparison with an established anthelmintic target, experiments were also performed on the AVR-14B GluCl from the parasitic roundworm Haemonchus contortus. l-Glutamate was the most potent agonist at both GluCls, but l-2-aminoadipate, d-glutamate and d-2-aminoadipate activated SmGluCl-2 (EC50 1.0 ± 0.1 mM, 2.4 ± 0.4 mM, 3.6 ± 0.7 mM, respectively) more potently than AVR-14B. Quisqualate activated only SmGluCl-2 whereas l-aspartate activated only AVR-14B GluCls. Regarding the monoterpenoids, both GluCls were inhibited by propofol, thymol and menthol, SmGluCl-2 most potently by thymol (IC50 484 ± 85 μM) and least potently by menthol (IC50 > 3 mM). Computational docking suggested that agonist and inhibitor potency is attributable to particular interactions with extracellular or membrane-spanning amino acid residues. These results reveal that flatworm GluCls are pharmacologically susceptible to numerous agonists and modulators and indicate that changes to the glutamate γ-carboxyl or to the propofol 6-isopropyl group can alter the differential pharmacology at flatworm and roundworm GluCls. This should inform the development of more potent compounds and in turn lead to novel anthelmintics.

Physicochemical properties and in vitro antioxidant activities of polysaccharide from Artocarpus heterophyllus Lam. pulp.

PubMed

Zhu, Kexue; Zhang, Yanjun; Nie, Shaoping; Xu, Fei; He, Shuzhen; Gong, Deming; Wu, Gang; Tan, Lehe

2017-01-02

A water-soluble polysaccharide from Artocarpus heterophyllus Lam. (jackfruit) pulp (JFP-Ps) was purified and its physicochemical properties were investigated. The in vitro antioxidant activities of JFP-Ps was evaluated by measuring DPPH and OH radicals scavenging activities, as well as reducing power. The results showed that JFP-Ps contained 79.12% of total sugar, 5.83% of protein, 15.65% of uronic acid, and 15 kinds of amino acids with high levels of Asp, Glu, Val, Leu and Lys. JFP-Ps was mainly composed of Rha, Ara, Gal, Glc, Xyl and GalA, with an average molecular weight of 1668kDa. FT-IR results showed the bands at the range of 1200-850cm -1 suggested the presence of carbohydrates in JFP-Ps. The results of antioxidant activities showed that JFP-Ps exhibited strong DPPH and OH radical scavenging activities, with a relatively lower reducing power, suggesting that JFP-Ps can be exploited as effective natural antioxidant applications in medical and food industries. Copyright © 2016 Elsevier Ltd. All rights reserved.

40 CFR 62.1104 - Identification of sources.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Section 62.1104 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS..., Contra Costa County Pulp Mill. (b) Louisiana Pacific Corp., Samoa Complex. (c) Crown Simpson Pulp Company, Fairhaven. (d) Simpson Paper Company, Shasta County Pulp Mill. [47 FR 47385, Oct. 26, 1982] Landfill Gas...

40 CFR 62.1104 - Identification of sources.

Code of Federal Regulations, 2012 CFR

2012-07-01

... Section 62.1104 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS..., Contra Costa County Pulp Mill. (b) Louisiana Pacific Corp., Samoa Complex. (c) Crown Simpson Pulp Company, Fairhaven. (d) Simpson Paper Company, Shasta County Pulp Mill. [47 FR 47385, Oct. 26, 1982] Landfill Gas...

40 CFR 62.1104 - Identification of sources.

Code of Federal Regulations, 2013 CFR

2013-07-01

... Section 62.1104 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS..., Contra Costa County Pulp Mill. (b) Louisiana Pacific Corp., Samoa Complex. (c) Crown Simpson Pulp Company, Fairhaven. (d) Simpson Paper Company, Shasta County Pulp Mill. [47 FR 47385, Oct. 26, 1982] Landfill Gas...

A comparison of the effects of substance P and shorter analogues on the synaptosomal ATPases activities in the rat brain.

PubMed

Lachowicz, L; Janiszewska, G

1987-01-01

The influence in vitro of SP and C-terminal fragments of analogues SP(5-11) (pyroGlu5, Tyr8); SP(6-11) (pyroGlu6, Tyr8); SP(6-11) (pyroGlu6, D-Phe7); SP(6-11) (pyroGlu6, D-Phe8) on the (Ca, Mg) and (Na, K) ATPases activities from synaptosomal membranes of cerebral cortex and hippocampus of rat brain were compared. The data obtained in this study indicate the following: 1. Substance P stimulates the activities of (Na, K) and (Ca, Mg) ATPases more effectively in synaptosomal membranes from hippocampus than cerebral cortex. 2. Heptapeptide SP(5-11) (pyroGlu5, Tyr8) causes a more distinct increase of (Ca, Mg) ATPase activity in cortical synaptosomal membranes than SP does. 3. The change of L-Phe conformation to D in position 7 in hexapeptide induces reduction of enzymes activities in hippocampus. 4. Especially important for the maintenance of biological activity of drugs is the replacement of Gln5 with pyroGlu6 and conformation of Phe residues. 5. SP and shorter analogues of fragments SP C-terminal SP regulate the active cation transport in synaptosomal membranes of cerebral cortex and hippocampus.

Functional role of striatal A2A, D2, and mGlu5 receptor interactions in regulating striatopallidal GABA neuronal transmission.

PubMed

Beggiato, Sarah; Tomasini, Maria Cristina; Borelli, Andrea Celeste; Borroto-Escuela, Dasiel Oscar; Fuxe, Kjell; Antonelli, Tiziana; Tanganelli, Sergio; Ferraro, Luca

2016-07-01

In this study, the functional role of individual striatal receptors for adenosine (A2AR), dopamine (D2R), and the metabotropic glutamate receptor mGlu5R in regulating rat basal ganglia activity was characterized in vivo using dual-probe microdialysis in freely moving rats. In particular, intrastriatal perfusion with the D2R agonist quinpirole (10 μM, 60 min) decreased ipsilateral pallidal GABA and glutamate levels, whereas intrastriatal CGS21680 (A2AR agonist; 1 μM, 60 min) was ineffective on either pallidal GABA and glutamate levels or the quinpirole-induced effects. Intrastriatal perfusion with the mGlu5R agonist (RS)-2-chloro-5-hydroxyphenylglycine (600 μM, 60 min), by itself ineffective on pallidal GABA and glutamate levels, partially counteracted the effects of quinpirole. When combined with CGS21680 (1 μM, 60 min), (RS)-2-chloro-5-hydroxyphenylglycine (CHPG; 600 μM, 60 min) fully counteracted the quinpirole (10 μM, 60 min)-induced reduction in ipsilateral pallidal GABA and glutamate levels. These effects were fully counteracted by local perfusion with the mGlu5R antagonist MPEP (300 μM) or the A2AR antagonist ZM 241385 (100 nM). These results suggest that A2ARs and mGlu5Rs interact synergistically in modulating the D2R-mediated control of striatopallidal GABA neurons. Using dual-probe microdialysis, we characterized the functional role of striatal adenosine A2A receptor (A2AR), dopamine D2 receptor (D2R), and metabotropic glutamate receptor 5 (mGluR5) interactions in regulating rat basal ganglia activity. The results suggest the possible usefulness of using an A2AR antagonist and mGluR5 antagonist combination in the treatment of Parkinson's disease to increase the inhibitory D2 signaling on striatopallidal GABA neurons. © 2016 International Society for Neurochemistry.

Evidence for a link between sphingolipid metabolism and expression of CD1d and MHC-class II: monocytes from Gaucher disease patients as a model.

PubMed

Balreira, Andrea; Lacerda, Lúcia; Miranda, Clara Sá; Arosa, Fernando A

2005-06-01

Gaucher disease (GD) is an autosomal recessive inherited defect of the lysosomal enzyme glucocerebrosidase (GluCerase) that leads to glucosylceramide (GluCer) accumulation. We previously demonstrated the existence of imbalances in certain lymphocyte populations in GD patients. We now show that GluCerase-deficient monocytes from GD patients or monocytes from healthy subjects treated with conduritol-B-epoxide (CBE), an irreversible inhibitor of GluCerase activity, display high levels of surface expression of the lipid-binding molecule CD1d. GluCerase-deficient monocytes from GD patients also showed increased surface expression of major histocompatibility complex (MHC)-class II, but not of other lysosomal trafficking molecules, such as CD63 and MHC-class I. However, CD1d and MHC-class II mRNA levels were not increased. GluCerase-deficient monocytes from GD patients undergoing enzyme replacement therapy also exhibited increased levels of CD1d and MHC-class II and imbalances in the percentage of CD4+, CD8+, and Valpha24+ T cells. Interestingly, follow-up studies revealed that enzyme replacement therapy induced a decrease in MHC-class II expression and partial correction of the CD4+ T cell imbalances. These results reveal a new link between sphingolipid accumulation in monocytes and the expression of certain MHC molecules that may result in imbalances of regulatory T cell subsets. These immunological anomalies may contribute to the clinical heterogeneity in GD patients.

MPX-004 and MPX-007: New Pharmacological Tools to Study the Physiology of NMDA Receptors Containing the GluN2A Subunit.

PubMed

Volkmann, Robert A; Fanger, Christopher M; Anderson, David R; Sirivolu, Venkata Ramana; Paschetto, Kathy; Gordon, Earl; Virginio, Caterina; Gleyzes, Melanie; Buisson, Bruno; Steidl, Esther; Mierau, Susanna B; Fagiolini, Michela; Menniti, Frank S

2016-01-01

GluN2A is the most abundant of the GluN2 NMDA receptor subunits in the mammalian CNS. Physiological and genetic evidence implicate GluN2A-containing receptors in susceptibility to autism, schizophrenia, childhood epilepsy and neurodevelopmental disorders such as Rett Syndrome. However, GluN2A-selective pharmacological probes to explore the therapeutic potential of targeting these receptors have been lacking. Here we disclose a novel series of pyrazine-containing GluN2A antagonists exemplified by MPX-004 (5-(((3-chloro-4-fluorophenyl)sulfonamido)methyl)-N-((2-methylthiazol-5-yl)methyl)pyrazine-2-carboxamide) and MPX-007 (5-(((3-fluoro-4-fluorophenyl)sulfonamido)methyl)-N-((2-methylthiazol-5-yl)methyl)methylpyrazine-2-carboxamide). MPX-004 and MPX-007 inhibit GluN2A-containing NMDA receptors expressed in HEK cells with IC50s of 79 nM and 27 nM, respectively. In contrast, at concentrations that completely inhibited GluN2A activity these compounds have no inhibitory effect on GluN2B or GluN2D receptor-mediated responses in similar HEK cell-based assays. Potency and selectivity were confirmed in electrophysiology assays in Xenopus oocytes expressing GluN2A-D receptor subtypes. Maximal concentrations of MPX-004 and MPX-007 inhibited ~30% of the whole-cell current in rat pyramidal neurons in primary culture and MPX-004 inhibited ~60% of the total NMDA receptor-mediated EPSP in rat hippocampal slices. GluN2A-selectivity at native receptors was confirmed by the finding that MPX-004 had no inhibitory effect on NMDA receptor mediated synaptic currents in cortical slices from GRIN2A knock out mice. Thus, MPX-004 and MPX-007 offer highly selective pharmacological tools to probe GluN2A physiology and involvement in neuropsychiatric and developmental disorders.

Variability in glutenin subunit composition of Mediterranean durum wheat germplasm and its relationship with gluten strength.

PubMed

Nazco, R; Peña, R J; Ammar, K; Villegas, D; Crossa, J; Moragues, M; Royo, C

2014-06-01

The allelic composition at five glutenin loci was assessed by one-dimensional sodium dodecyl sulphate polyacrylamide gel electrophoresis (1D SDS-PAGE) on a set of 155 landraces (from 21 Mediterranean countries) and 18 representative modern varieties. Gluten strength was determined by SDS-sedimentation on samples grown under rainfed conditions during 3 years in north-eastern Spain. One hundred and fourteen alleles/banding patterns were identified (25 at Glu-1 and 89 at Glu-2 / Glu-3 loci); 0·85 of them were in landraces at very low frequency and 0·72 were unreported. Genetic diversity index was 0·71 for landraces and 0·38 for modern varieties. All modern varieties exhibited medium to strong gluten type with none of their 13 banding patterns having a significant effect on gluten-strength type. Ten banding patterns significantly affected gluten strength in landraces. Alleles Glu-B1e (band 20), Glu-A3a (band 6), Glu-A3d (bands 6 + 11), Glu-B3a (bands 2 + 4+15 + 19) and Glu-B2a (band 12) significantly increased the SDS-value, and their effects were associated with their frequency. Two alleles, Glu-A3b (band 5) and Glu-B2b (null), significantly reduced gluten strength, but only the effect of the latter locus could be associated with its frequency. Only three rare banding patterns affected gluten strength significantly: Glu-B1a (band 7), found in six landraces, had a negative effect, whereas banding patterns 2 + 4+14 + 15 + 18 and 2 + 4+15 + 18 + 19 at Glu-B3 had a positive effect. Landraces with outstanding gluten strength were more frequent in eastern than in western Mediterranean countries. The geographical pattern displayed from the frequencies of Glu-A1c is discussed.

Fractionation of bamboo culms by autohydrolysis, organosolv delignification and extended delignification: understanding the fundamental chemistry of the lignin during the integrated process.

PubMed

Wen, Jia-Long; Sun, Shao-Ni; Yuan, Tong-Qi; Xu, Feng; Sun, Run-Cang

2013-12-01

Bamboo (Phyllostachys pubescens) was successfully fractionated using a three-step integrated process: (1) autohydrolysis pretreatment facilitating xylooligosaccharide (XOS) production (2) organosolv delignification with organic acids to obtain high-purity lignin, and (3) extended delignification with alkaline hydrogen peroxide (AHP) to produce purified pulp. The integrated process was comprehensively evaluated by component analysis, SEM, XRD, and CP-MAS NMR techniques. Emphatically, the fundamental chemistry of the lignin fragments obtained from the integrated process was thoroughly investigated by gel permeation chromatography and solution-state NMR techniques (quantitative (13)C, 2D-HSQC, and (31)P-NMR spectroscopies). It is believed that the integrated process facilitate the production of XOS, high-purity lignin, and purified pulp. Moreover, the enhanced understanding of structural features and chemical reactivity of lignin polymers will maximize their utilizations in a future biorefinery industry. Copyright © 2013 Elsevier Ltd. All rights reserved.

A Role for Prefrontal Cortical NMDA Receptors in Murine Alcohol-Heightened Aggression.

PubMed

Newman, Emily L; Terunuma, Miho; Wang, Tiffany L; Hewage, Nishani; Bicakci, Matthew B; Moss, Stephen J; DeBold, Joseph F; Miczek, Klaus A

2018-05-01

Alcohol is associated with nearly half of all violent crimes committed in the United States; yet, a potential neural basis for this type of pathological aggression remains elusive. Alcohol may act on N-methyl-d-aspartate receptors (NMDARs) within cortical circuits to impede processing and to promote aggression. Here, male mice were characterized as alcohol-heightened (AHAs) or alcohol non-heightened aggressors (ANAs) during resident-intruder confrontations after self-administering 1.0 g/kg alcohol (6% w/v) or water. Alcohol produced a pathological-like pattern of aggression in AHAs; these mice shifted their bites to more vulnerable locations on the body of a submissive animal, including the anterior back and ventrum after consuming alcohol. In addition, through immunoblotting, we found that AHAs overexpressed the NMDAR GluN2D subunit in the prefrontal cortex (PFC) as compared to ANAs while the two phenotypes expressed similar levels of GluN1, GluN2A and GluN2B. After identifying several behavioral and molecular characteristics that distinguish AHAs from ANAs, we tested additional mice for their aggression following preferential antagonism of GluN2D-containing NMDARs. In these experiments, groups of AHAs and ANAs self-administered 1.0 g/kg alcohol (6% w/v) or water before receiving intraperitoneal (i.p.) doses of ketamine or memantine, or infusions of memantine directly into the prelimbic (PLmPFC) or infralimbic medial PFC (ILmPFC). Moderate doses of IP ketamine, IP memantine, or intra-PLmPFC memantine increased aggression in AHAs, but only in the absence of alcohol. Prior alcohol intake blocked the pro-aggressive effects of ketamine or memantine. In contrast, only memantine, administered systemically or intra-PLmPFC, interacted with prior alcohol intake to escalate aggression in ANAs. Intra-ILmPFC memantine had no effect on aggression in either AHAs or ANAs. In sum, this work illustrates a potential role of GluN2D-containing NMDARs in the PLmPFC in alcohol-heightened aggression. GluN2D-containing NMDARs are highly expressed on cortical parvalbumin-containing interneurons, suggesting that, in a subset of individuals, alcohol may functionally alter signal integration within cortical microcircuits to dysregulate threat reactivity and promote aggression. This work suggests that targeting GluN2D-NMDARs may be of use in reducing the impact of alcohol-related violence in the human population.

Structure of an archaeal non-discriminating glutamyl-tRNA synthetase: a missing link in the evolution of Gln-tRNAGln formation.

PubMed

Nureki, Osamu; O'Donoghue, Patrick; Watanabe, Nobuhisa; Ohmori, Atsuhiko; Oshikane, Hiroyuki; Araiso, Yuhei; Sheppard, Kelly; Söll, Dieter; Ishitani, Ryuichiro

2010-11-01

The molecular basis of the genetic code relies on the specific ligation of amino acids to their cognate tRNA molecules. However, two pathways exist for the formation of Gln-tRNA(Gln). The evolutionarily older indirect route utilizes a non-discriminating glutamyl-tRNA synthetase (ND-GluRS) that can form both Glu-tRNA(Glu) and Glu-tRNA(Gln). The Glu-tRNA(Gln) is then converted to Gln-tRNA(Gln) by an amidotransferase. Since the well-characterized bacterial ND-GluRS enzymes recognize tRNA(Glu) and tRNA(Gln) with an unrelated α-helical cage domain in contrast to the β-barrel anticodon-binding domain in archaeal and eukaryotic GluRSs, the mode of tRNA(Glu)/tRNA(Gln) discrimination in archaea and eukaryotes was unknown. Here, we present the crystal structure of the Methanothermobacter thermautotrophicus ND-GluRS, which is the evolutionary predecessor of both the glutaminyl-tRNA synthetase (GlnRS) and the eukaryotic discriminating GluRS. Comparison with the previously solved structure of the Escherichia coli GlnRS-tRNA(Gln) complex reveals the structural determinants responsible for specific tRNA(Gln) recognition by GlnRS compared to promiscuous recognition of both tRNAs by the ND-GluRS. The structure also shows the amino acid recognition pocket of GluRS is more variable than that found in GlnRS. Phylogenetic analysis is used to reconstruct the key events in the evolution from indirect to direct genetic encoding of glutamine.

Rett-like Severe Encephalopathy Caused by a De Novo GRIN2B Mutation Is Attenuated by D-serine Dietary Supplement.

PubMed

Soto, David; Olivella, Mireia; Grau, Cristina; Armstrong, Judith; Alcon, Clara; Gasull, Xavier; Gómez de Salazar, Macarena; Gratacòs-Batlle, Esther; Ramos-Vicente, David; Fernández-Dueñas, Víctor; Ciruela, Francisco; Bayés, Àlex; Sindreu, Carlos; López-Sala, Anna; García-Cazorla, Àngels; Altafaj, Xavier

2018-01-15

N-Methyl-D-aspartate receptors (NMDARs) play pivotal roles in synaptic development, plasticity, neural survival, and cognition. Despite recent reports describing the genetic association between de novo mutations of NMDAR subunits and severe psychiatric diseases, little is known about their pathogenic mechanisms and potential therapeutic interventions. Here we report a case study of a 4-year-old Rett-like patient with severe encephalopathy carrying a missense de novo mutation in GRIN2B(p.P553T) coding for the GluN2B subunit of NMDAR. We generated a dynamic molecular model of mutant GluN2B-containing NMDARs. We expressed the mutation in cell lines and primary cultures, and we evaluated the putative morphological, electrophysiological, and synaptic plasticity alterations. Finally, we evaluated D-serine administration as a therapeutic strategy and translated it to the clinical practice. Structural molecular modeling predicted a reduced pore size of mutant NMDARs. Electrophysiological recordings confirmed this prediction and also showed gating alterations, a reduced glutamate affinity associated with a strong decrease of NMDA-evoked currents. Moreover, GluN2B(P553T)-expressing neurons showed decreased spine density, concomitant with reduced NMDA-evoked currents and impaired NMDAR-dependent insertion of GluA1 at stimulated synapses. Notably, the naturally occurring coagonist D-serine was able to attenuate hypofunction of GluN2B(p.P553T)-containing NMDARs. Hence, D-serine dietary supplementation was initiated. Importantly, the patient has shown remarkable motor, cognitive, and communication improvements after 17 months of D-serine dietary supplementation. Our data suggest that hypofunctional NMDARs containing GluN2B(p.P553T) can contribute to Rett-like encephalopathy and that their potentiation by D-serine treatment may underlie the associated clinical improvement. Copyright © 2017 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Dynorphin up-regulation in the dentate granule cell mossy fiber pathway following chronic inhibition of GluN2B-containing NMDAR is associated with increased CREB (Ser 133) phosphorylation, but is independent of BDNF/TrkB signaling pathways.

PubMed

Rittase, W Bradley; Dong, Yu; Barksdale, DaRel; Galdzicki, Zygmunt; Bausch, Suzanne B

2014-05-01

Emerging evidence suggests that neuronal responses to N-methyl-d-aspartate (NMDAR) activation/inactivation are influenced by subunit composition. For example, activation of synaptic NMDAR (comprised of GluN2A>GluN2B) phosphorylates cAMP-response-element-binding protein (CREB) at Ser 133, induces BDNF expression and promotes neuronal survival. Activation of extrasynaptic NMDAR (comprised of GluN2B>GluN2) dephosphorylates CREB (Ser 133), reduces BDNF expression and triggers neuronal death. These results led us to hypothesize that chronic inhibition of GluN2B-containing NMDAR would increase CREB (Ser 133) phosphorylation, increase BDNF levels and subsequently alter downstream dynorphin (DYN) and neuropeptide Y (NPY) expression. We focused on DYN and NPY because these neuropeptides can decrease excitatory neurotransmission and seizure occurrence and we reported previously that seizure-like events are reduced following chronic treatment with GluN2B antagonists. Consistent with our hypothesis, chronic treatment (17-21days) of hippocampal slice cultures with the GluN2B-selective antagonists ifenprodil or Ro25,6981 increased both CREB (Ser 133) phosphorylation and granule cell mossy fiber pathway DYN expression. Similar treatment with the non-subtype-selective NMDAR antagonists d-APV or memantine had no significant effect on either CREB (Ser 133) phosphorylation or DYN expression. In contrast to our hypothesis, BDNF levels were decreased following chronic treatment with Ro25,6981, but not ifenprodil, d-APV or memantine. Blockade of BDNF actions and TrkB activation did not significantly augment hilar DYN expression in vehicle-treated cultures and had no effect in Ro25,6981 treated cultures. These findings suggest that chronic exposure to GluN2B-selective NMDAR antagonists increased DYN expression through a putatively pCREB-dependent, but BDNF/TrkB-independent mechanism. Published by Elsevier Inc.

Evidence for a fragile X mental retardation protein-mediated translational switch in metabotropic glutamate receptor-triggered Arc translation and long-term depression.

PubMed

Niere, Farr; Wilkerson, Julia R; Huber, Kimberly M

2012-04-25

Group 1 metabotropic glutamate receptor (mGluR)-stimulated protein synthesis and long-term synaptic depression (mGluR-LTD) are altered in the mouse model of fragile X syndrome, Fmr1 knock-out (KO) mice. Fmr1 encodes fragile X mental retardation protein (FMRP), a dendritic RNA binding protein that functions, in part, as a translational suppressor. It is unknown whether and how FMRP acutely regulates LTD and/or the rapid synthesis of new proteins required for LTD, such as the activity-regulated cytoskeletal-associated protein (Arc). The protein phosphatase PP2A dephosphorylates FMRP, which contributes to translational activation of some target mRNAs. Here, we report that PP2A and dephosphorylation of FMRP at S500 are required for an mGluR-induced, rapid (5 min) increase in dendritic Arc protein and LTD in rat and mouse hippocampal neurons. In Fmr1 KO neurons, basal, dendritic Arc protein levels and mGluR-LTD are enhanced, but mGluR-triggered Arc synthesis is absent. Lentiviral-mediated expression of wild-type FMRP in Fmr1 KO neurons suppresses basal dendritic Arc levels and mGluR-LTD, and restores rapid mGluR-triggered Arc synthesis. A phosphomimic of FMRP (S500D) suppresses steady-state dendritic Arc levels but does not rescue mGluR-induced Arc synthesis. A dephosphomimic of FMRP (S500A) neither suppresses dendritic Arc nor supports mGluR-induced Arc synthesis. Accordingly, S500D-FMRP expression in Fmr1 KO neurons suppresses mGluR-LTD, whereas S500A-FMRP has no effect. These data support a model in which phosphorylated FMRP functions to suppress steady-state translation of Arc and LTD. Upon mGluR activation of PP2A, FMRP is rapidly dephosphorylated, which contributes to rapid new synthesis of Arc and mGluR-LTD.

An optimized fluorescent probe for visualizing glutamate neurotransmission.

PubMed

Marvin, Jonathan S; Borghuis, Bart G; Tian, Lin; Cichon, Joseph; Harnett, Mark T; Akerboom, Jasper; Gordus, Andrew; Renninger, Sabine L; Chen, Tsai-Wen; Bargmann, Cornelia I; Orger, Michael B; Schreiter, Eric R; Demb, Jonathan B; Gan, Wen-Biao; Hires, S Andrew; Looger, Loren L

2013-02-01

We describe an intensity-based glutamate-sensing fluorescent reporter (iGluSnFR) with signal-to-noise ratio and kinetics appropriate for in vivo imaging. We engineered iGluSnFR in vitro to maximize its fluorescence change, and we validated its utility for visualizing glutamate release by neurons and astrocytes in increasingly intact neurological systems. In hippocampal culture, iGluSnFR detected single field stimulus-evoked glutamate release events. In pyramidal neurons in acute brain slices, glutamate uncaging at single spines showed that iGluSnFR responds robustly and specifically to glutamate in situ, and responses correlate with voltage changes. In mouse retina, iGluSnFR-expressing neurons showed intact light-evoked excitatory currents, and the sensor revealed tonic glutamate signaling in response to light stimuli. In worms, glutamate signals preceded and predicted postsynaptic calcium transients. In zebrafish, iGluSnFR revealed spatial organization of direction-selective synaptic activity in the optic tectum. Finally, in mouse forelimb motor cortex, iGluSnFR expression in layer V pyramidal neurons revealed task-dependent single-spine activity during running.

Genetic control of wheat quality: interactions between chromosomal regions determining protein content and composition, dough rheology, and sponge and dough baking properties.

PubMed

Mann, Gulay; Diffey, Simon; Cullis, Brian; Azanza, Fermin; Martin, David; Kelly, Alison; McIntyre, Lynne; Schmidt, Adele; Ma, Wujun; Nath, Zena; Kutty, Ibrahim; Leyne, P Emmett; Rampling, Lynette; Quail, Ken J; Morell, Matthew K

2009-05-01

While the genetic control of wheat processing characteristics such as dough rheology is well understood, limited information is available concerning the genetic control of baking parameters, particularly sponge and dough (S&D) baking. In this study, a quantitative trait loci (QTL) analysis was performed using a population of doubled haploid lines derived from a cross between Australian cultivars Kukri x Janz grown at sites across different Australian wheat production zones (Queensland in 2001 and 2002 and Southern and Northern New South Wales in 2003) in order to examine the genetic control of protein content, protein expression, dough rheology and sponge and dough baking performance. The study highlighted the inconsistent genetic control of protein content across the test sites, with only two loci (3A and 7A) showing QTL at three of the five sites. Dough rheology QTL were highly consistent across the 5 sites, with major effects associated with the Glu-B1 and Glu-D1 loci. The Glu-D1 5 + 10 allele had consistent effects on S&D properties across sites; however, there was no evidence for a positive effect of the high dough strength Glu-B1-al allele at Glu-B1. A second locus on 5D had positive effects on S&D baking at three of five sites. This study demonstrated that dough rheology measurements were poor predictors of S&D quality. In the absence of robust predictive tests, high heritability values for S&D demonstrate that direct selection is the current best option for achieving genetic gain in this product category.

Preparation and properties of water and glycerol-plasticized sugar beet pulp plastics

USDA-ARS?s Scientific Manuscript database

Sugar beet pulp (SBP), the residue from sugar extraction, was compounded and turned into thermoplastic composite materials. The compounding was performed using a common twin screw compounding extruder and water and glycerol were used as plasticizers. The plasticization of SBP utilized the water-solu...

Gentiopicroside attenuates morphine rewarding effect through downregulation of GluN2B receptors in nucleus accumbens.

PubMed

Liu, Shui-Bing; Ma, Lan; Guo, Hong-Ju; Feng, Bin; Guo, Yan-Yan; Li, Xiao-Qiang; Sun, Wen-Ji; Zheng, Lian-He; Zhao, Ming-Gao

2012-08-01

Gentiopicroside (Gent) is one of the secoiridoid compound isolated from Gentiana lutea. This compound exhibits analgesic activities and inhibits the expression of GluN2B-containing N-methyl-D-aspartate (NMDA) receptors in the anterior cingulate cortex in mice. Nucleus accumbens (NAc) is a forebrain structure known for its role in drug addiction. However, little is known about the role of Gent on morphine dependence and synaptic transmission changes in the NAc. Conditioned place preference (CPP) test and behavioral sensitization of locomotor activity were used to investigate drug-seeking related behaviors. Brain slices containing NAc were prepared, and whole-cell patch-clamp recordings were performed to record the excitatory postsynaptic currents (EPSCs). Expression of proteins was detected by Western blot analysis. Systemic administration of Gent attenuated the CPP effect induced by morphine, but had no effect on morphine-induced behavioral sensitization. Gent significantly reversed overexpression of GluN2B-containing NMDA receptors and dopamine D2 receptors in NAc during the first week of morphine withdrawal. However, the compound did not affect the overexpression of GluN2A-containing NMDA receptors, GluA1, and dopamine D1 receptors. Lastly, Gent significantly reduced NMDA receptors-mediated EPSCs in the NAc. Our study provides strong evidence that Gent inhibits morphine dependence through downregulation of GluN2B-containing NMDA receptors in the NAc. © 2012 Blackwell Publishing Ltd.

Photosynthetic water oxidation in Synechocystis sp. PCC6803: mutations D1-E189K, R and Q are without influence on electron transfer at the donor side of photosystem II.

PubMed

Clausen, J; Winkler, S; Hays, A M; Hundelt, M; Debus, R J; Junge, W

2001-11-01

The oxygen-evolving manganese cluster (OEC) of photosynthesis is oxidised by the photochemically generated primary oxidant (P(+*)(680)) of photosystem II via a tyrosine residue (Y(Z), Tyr161 on the D1 subunit of Synechocystis sp. PCC6803). The redox span between these components is rather small and probably tuned by protonic equilibria. The very efficient electron transfer from Y(Z) to P(+*)(680) in nanoseconds requires the intactness of a hydrogen bonded network involving Y(Z), D1-His190, and presumably D1-Glu189. We studied photosystem II core particles from photoautotrophic mutants where the residue D1-E189 was replaced by glutamine, arginine and lysine which were expected to electrostatically differ from the glutamate in the wild-type (WT). Surprisingly, the rates of electron transfer from Y(Z) to P(+*)(680) as well as from the OEC to Y(ox)(Z) were the same as in the WT. With the generally assumed proximity between D1-His190 (and thus D1-Glu189) and Y(Z), the lack of any influence on the electron transfer around Y(Z) straightforwardly implies a strongly hydrophobic environment forcing Glu (acid) and Lys, Arg (basic) at position D1-189 into electro-neutrality. As one alternative, D1-Glu189 could be located at such a large distance from the OEC, Y(Z) and P(+*)(680) that a charge on D1-189X does not influence the electron transfer. This seems less likely in the light of the drastic influence of its direct neighbour, D1-His190, on Y(Z) function. Another alternative is that D1-Glu189 is negatively charged, but is located in a cluster of acid/base groups that compensates for an alteration of charge at position 189, leaving the overall net charge unchanged in the Gln, Lys, and Arg mutants.

Structure-Activity Relationship Study of Ionotropic Glutamate Receptor Antagonist (2S,3R)-3-(3-Carboxyphenyl)pyrrolidine-2-carboxylic Acid.

PubMed

Krogsgaard-Larsen, Niels; Storgaard, Morten; Møller, Charlotte; Demmer, Charles S; Hansen, Jeanette; Han, Liwei; Monrad, Rune N; Nielsen, Birgitte; Tapken, Daniel; Pickering, Darryl S; Kastrup, Jette S; Frydenvang, Karla; Bunch, Lennart

2015-08-13

Herein we describe the first structure-activity relationship study of the broad-range iGluR antagonist (2S,3R)-3-(3-carboxyphenyl)pyrrolidine-2-carboxylic acid (1) by exploring the pharmacological effect of substituents in the 4, 4', or 5' positions and the bioisosteric substitution of the distal carboxylic acid for a phosphonic acid moiety. Of particular interest is a hydroxyl group in the 4' position 2a which induced a preference in binding affinity for homomeric GluK3 over GluK1 (Ki = 0.87 and 4.8 μM, respectively). Two X-ray structures of ligand binding domains were obtained: 2e in GluA2-LBD and 2f in GluK1-LBD, both at 1.9 Å resolution. Compound 2e induces a D1-D2 domain opening in GluA2-LBD of 17.3-18.8° and 2f a domain opening in GluK1-LBD of 17.0-17.5° relative to the structures with glutamate. The pyrrolidine-2-carboxylate moiety of 2e and 2f shows a similar binding mode as kainate. The 3-carboxyphenyl ring of 2e and 2f forms contacts comparable to those of the distal carboxylate in kainate.

Drosophila fragile X mental retardation protein and metabotropic glutamate receptor A convergently regulate the synaptic ratio of ionotropic glutamate receptor subclasses.

PubMed

Pan, Luyuan; Broadie, Kendal S

2007-11-07

A current hypothesis proposes that fragile X mental retardation protein (FMRP), an RNA-binding translational regulator, acts downstream of glutamatergic transmission, via metabotropic glutamate receptor (mGluR) G(q)-dependent signaling, to modulate protein synthesis critical for trafficking ionotropic glutamate receptors (iGluRs) at synapses. However, direct evidence linking FMRP and mGluR function with iGluR synaptic expression is limited. In this study, we use the Drosophila fragile X model to test this hypothesis at the well characterized glutamatergic neuromuscular junction (NMJ). Two iGluR classes reside at this synapse, each containing common GluRIIC (III), IID and IIE subunits, and variable GluRIIA (A-class) or GluRIIB (B-class) subunits. In Drosophila fragile X mental retardation 1 (dfmr1) null mutants, A-class GluRs accumulate and B-class GluRs are lost, whereas total GluR levels do not change, resulting in a striking change in GluR subclass ratio at individual synapses. The sole Drosophila mGluR, DmGluRA, is also expressed at the NMJ. In dmGluRA null mutants, both iGluR classes increase, resulting in an increase in total synaptic GluR content at individual synapses. Targeted postsynaptic dmGluRA overexpression causes the exact opposite GluR phenotype to the dfmr1 null, confirming postsynaptic GluR subtype-specific regulation. In dfmr1; dmGluRA double null mutants, there is an additive increase in A-class GluRs, and a similar additive impact on B-class GluRs, toward normal levels in the double mutants. These results show that both dFMRP and DmGluRA differentially regulate the abundance of different GluR subclasses in a convergent mechanism within individual postsynaptic domains.

40 CFR 430.44 - Effluent limitations representing the degree of effluent reduction attainable by the application...

Code of Federal Regulations, 2012 CFR

2012-07-01

... Dissolving Sulfite Subcategory § 430.44 Effluent limitations representing the degree of effluent reduction... limitations for dissolving sulfite pulp facilities where nitration, viscose, or cellophane pulps are produced... discharged in kgal per ton of product. Subpart D [BAT effluent limitations for dissolving sulfite pulp...

Differences between Cryptococcus neoformans and Cryptococcus gattii in the Molecular Mechanisms Governing Utilization of D-Amino Acids as the Sole Nitrogen Source

PubMed Central

Chang, Yun C.; Khanal Lamichhane, Ami; Bradley, James; Rodgers, Laura; Ngamskulrungroj, Popchai; Kwon-Chung, Kyung J.

2015-01-01

The ability to grow on media containing certain D-amino acids as a sole nitrogen source is widely utilized to differentiate Cryptococcus gattii from C. neoformans. We used the C. neoformans H99 and C. gattii R265 strains to dissect the mechanisms of D-amino acids utilization. We identified three putative D-amino acid oxidase (DAO) genes in both strains and showed that each DAO gene plays different roles in D-amino acid utilization in each strain. Deletion of DAO2 retarded growth of R265 on eleven D-amino acids suggesting its prominent role on D-amino acid assimilation in R265. All three R265 DAO genes contributed to growth on D-Asn and D-Asp. DAO3 was required for growth and detoxification of D-Glu by both R265 and H99. Although growth of H99 on most D-amino acids was poor, deletion of DAO1 or DAO3 further exacerbated it on four D-amino acids. Overexpression of DAO2 or DAO3 enabled H99 to grow robustly on several D-amino acids suggesting that expression levels of the native DAO genes in H99 were insufficient for growth on D-amino acids. Replacing the H99 DAO2 gene with a single copy of the R265 DAO2 gene also enabled its utilization of several D-amino acids. Results of gene and promoter swaps of the DAO2 genes suggested that enzymatic activity of Dao2 in H99 might be lower compared to the R265 strain. A reduction in virulence was only observed when all DAO genes were deleted in R265 but not in H99 indicating a pathobiologically exclusive role of the DAO genes in R265. These results suggest that C. neoformans and C. gattii divergently evolved in D-amino acid utilization influenced by their major ecological niches. PMID:26132227

The structure of salt bridges between Arg(+) and Glu(-) in peptides investigated with 2D-IR spectroscopy: Evidence for two distinct hydrogen-bond geometries.

PubMed

Huerta-Viga, Adriana; Amirjalayer, Saeed; Domingos, Sérgio R; Meuzelaar, Heleen; Rupenyan, Alisa; Woutersen, Sander

2015-06-07

Salt bridges play an important role in protein folding and in supramolecular chemistry, but they are difficult to detect and characterize in solution. Here, we investigate salt bridges between glutamate (Glu(-)) and arginine (Arg(+)) using two-dimensional infrared (2D-IR) spectroscopy. The 2D-IR spectrum of a salt-bridged dimer shows cross peaks between the vibrational modes of Glu(-) and Arg(+), which provide a sensitive structural probe of Glu(-)⋯Arg(+) salt bridges. We use this probe to investigate a β-turn locked by a salt bridge, an α-helical peptide whose structure is stabilized by salt bridges, and a coiled coil that is stabilized by intra- and intermolecular salt bridges. We detect a bidentate salt bridge in the β-turn, a monodentate one in the α-helical peptide, and both salt-bridge geometries in the coiled coil. To our knowledge, this is the first time 2D-IR has been used to probe tertiary side chain interactions in peptides, and our results show that 2D-IR spectroscopy is a powerful method for investigating salt bridges in solution.

The structure of salt bridges between Arg+ and Glu- in peptides investigated with 2D-IR spectroscopy: Evidence for two distinct hydrogen-bond geometries

NASA Astrophysics Data System (ADS)

Huerta-Viga, Adriana; Amirjalayer, Saeed; Domingos, Sérgio R.; Meuzelaar, Heleen; Rupenyan, Alisa; Woutersen, Sander

2015-06-01

Salt bridges play an important role in protein folding and in supramolecular chemistry, but they are difficult to detect and characterize in solution. Here, we investigate salt bridges between glutamate (Glu-) and arginine (Arg+) using two-dimensional infrared (2D-IR) spectroscopy. The 2D-IR spectrum of a salt-bridged dimer shows cross peaks between the vibrational modes of Glu- and Arg+, which provide a sensitive structural probe of Glu-⋯Arg+ salt bridges. We use this probe to investigate a β-turn locked by a salt bridge, an α-helical peptide whose structure is stabilized by salt bridges, and a coiled coil that is stabilized by intra- and intermolecular salt bridges. We detect a bidentate salt bridge in the β-turn, a monodentate one in the α-helical peptide, and both salt-bridge geometries in the coiled coil. To our knowledge, this is the first time 2D-IR has been used to probe tertiary side chain interactions in peptides, and our results show that 2D-IR spectroscopy is a powerful method for investigating salt bridges in solution.

Building a comprehensive mill-level database for the Industrial Sectors Integrated Solutions (ISIS) model of the U.S. pulp and paper sector.

PubMed

Modak, Nabanita; Spence, Kelley; Sood, Saloni; Rosati, Jacky Ann

2015-01-01

Air emissions from the U.S. pulp and paper sector have been federally regulated since 1978; however, regulations are periodically reviewed and revised to improve efficiency and effectiveness of existing emission standards. The Industrial Sectors Integrated Solutions (ISIS) model for the pulp and paper sector is currently under development at the U.S. Environmental Protection Agency (EPA), and can be utilized to facilitate multi-pollutant, sector-based analyses that are performed in conjunction with regulatory development. The model utilizes a multi-sector, multi-product dynamic linear modeling framework that evaluates the economic impact of emission reduction strategies for multiple air pollutants. The ISIS model considers facility-level economic, environmental, and technical parameters, as well as sector-level market data, to estimate the impacts of environmental regulations on the pulp and paper industry. Specifically, the model can be used to estimate U.S. and global market impacts of new or more stringent air regulations, such as impacts on product price, exports and imports, market demands, capital investment, and mill closures. One major challenge to developing a representative model is the need for an extensive amount of data. This article discusses the collection and processing of data for use in the model, as well as the methods used for building the ISIS pulp and paper database that facilitates the required analyses to support the air quality management of the pulp and paper sector.

Building a Comprehensive Mill-Level Database for the Industrial Sectors Integrated Solutions (ISIS) Model of the U.S. Pulp and Paper Sector

PubMed Central

Modak, Nabanita; Spence, Kelley; Sood, Saloni; Rosati, Jacky Ann

2015-01-01

Air emissions from the U.S. pulp and paper sector have been federally regulated since 1978; however, regulations are periodically reviewed and revised to improve efficiency and effectiveness of existing emission standards. The Industrial Sectors Integrated Solutions (ISIS) model for the pulp and paper sector is currently under development at the U.S. Environmental Protection Agency (EPA), and can be utilized to facilitate multi-pollutant, sector-based analyses that are performed in conjunction with regulatory development. The model utilizes a multi-sector, multi-product dynamic linear modeling framework that evaluates the economic impact of emission reduction strategies for multiple air pollutants. The ISIS model considers facility-level economic, environmental, and technical parameters, as well as sector-level market data, to estimate the impacts of environmental regulations on the pulp and paper industry. Specifically, the model can be used to estimate U.S. and global market impacts of new or more stringent air regulations, such as impacts on product price, exports and imports, market demands, capital investment, and mill closures. One major challenge to developing a representative model is the need for an extensive amount of data. This article discusses the collection and processing of data for use in the model, as well as the methods used for building the ISIS pulp and paper database that facilitates the required analyses to support the air quality management of the pulp and paper sector. PMID:25806516

Initial assessment on the use of cocoa pulp in complete feed formulation: in vitro dry matter and organic matter digestibility

NASA Astrophysics Data System (ADS)

Natsir, A.; Mujnisa, A.; Mide, M. Z.; Purnomo, N.; Saade, M. F.

2018-05-01

Cocoa pulp is a by-product from cocoa industry which is produced in large quantity, but very limited study has been carried out in utilizing it as energy source in animal feed. The purpose of this study was to assess the in vitro dry matter (IVDMD) and in vitro organic matter digestibility (IVOMD) of complete feed containing different levels of cocoa pulp. The experiment was carried out according to completely randomised design consisting of four treatments and three replications. The treatments were P0 = Complete feed containing 0% cocoa pulp, P1 = Complete feed containing 5% cocoa pulp, P2 = Complete feed containing 10% cocoa pulp, and P3 = Complete feed containing 15% cocoa pulp on dry matter basis. The results of the study indicated that the average IVDMD was 567, 538, 566, and 526 g kg-1 DM, while the average IVOMD was 522, 491, 502, and 461 g/kg DM, respectively for treatment P0, P1, P2, and P3. Statistical analysis indicated that increasing levels of coca pulp in the feed significantly affected (P<0.05) the IVDMD and IVOMD of the feed. In conclusion, cocoa pulp is potential to be used up to 10% in complete feed with corn cobs as the fibre source.

The introduction of the fungal D-galacturonate pathway enables the consumption of D-galacturonic acid by Saccharomyces cerevisiae.

PubMed

Biz, Alessandra; Sugai-Guérios, Maura Harumi; Kuivanen, Joosu; Maaheimo, Hannu; Krieger, Nadia; Mitchell, David Alexander; Richard, Peter

2016-08-18

Pectin-rich wastes, such as citrus pulp and sugar beet pulp, are produced in considerable amounts by the juice and sugar industry and could be used as raw materials for biorefineries. One possible process in such biorefineries is the hydrolysis of these wastes and the subsequent production of ethanol. However, the ethanol-producing organism of choice, Saccharomyces cerevisiae, is not able to catabolize D-galacturonic acid, which represents a considerable amount of the sugars in the hydrolysate, namely, 18 % (w/w) from citrus pulp and 16 % (w/w) sugar beet pulp. In the current work, we describe the construction of a strain of S. cerevisiae in which the five genes of the fungal reductive pathway for D-galacturonic acid catabolism were integrated into the yeast chromosomes: gaaA, gaaC and gaaD from Aspergillus niger and lgd1 from Trichoderma reesei, and the recently described D-galacturonic acid transporter protein, gat1, from Neurospora crassa. This strain metabolized D-galacturonic acid in a medium containing D-fructose as co-substrate. This work is the first demonstration of the expression of a functional heterologous pathway for D-galacturonic acid catabolism in Saccharomyces cerevisiae. It is a preliminary step for engineering a yeast strain for the fermentation of pectin-rich substrates to ethanol.

Expression of messenger RNAs encoding ionotropic glutamate receptors in rat brain: regulation by haloperidol.

PubMed

Brené, S; Messer, C; Nestler, E J

1998-06-01

In situ hybridization was used to study the regional distribution of messenger RNAs encoding ionotropic glutamate receptor subtypes in the rat brain's dopaminergic cell body regions and their forebrain projection areas. Short oligonucleotide probes specific for the messenger RNAs encoding the flip or flop splice forms of the GluR1 and GluR2 AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate) receptor subunits, or for the messenger RNAs encoding the N-methyl-D-aspartate R1 subunit, were used. Significant differences were seen in the relative messenger RNA levels, and the distribution of the flip and flop splice forms, of GluR1 and GluR2. In the dopaminergic cell groups of the substantia nigra pars compacta and the ventral tegmental area, the flip form of both GluR1 and GluR2 dominated over the flop form. Similarly, in the core division of the nucleus accumbens, GluR1 and GluR2 flip forms dominated over the flop forms. In contrast, in the accumbens shell, the GluR1 and GluR2 flop forms dominated over the flip forms. As a comparison to the AMPA receptor subunits, N-methyl-D-aspartate R1 messenger RNA was relatively evenly distributed in all the regions analysed. The results demonstrate a heterogeneous distribution of the flip and flop splice forms of GluR1 and GluR2 in the brain's dopaminergic pathways, which could contribute to physiological differences in regulation of the pathways by glutamatergic neurotransmission. We also studied regulation of glutamate receptor subunit expression in these regions by antipsychotic drugs, based on previous reports of altered levels of subunit immunoreactivity after drug treatment. Chronic administration of the typical antipsychotic drug, haloperidol, caused a small but significant induction of GluR2 flip messenger RNA in the dorsolateral caudate putamen. This effect was not seen after chronic administration of the atypical antipsychotic drug, clozapine. Significant drug regulation of the other glutamate receptor subunits studied was not observed.

Analysis of Emission Reduction Strategies for Power Boilers in the US Pulp and Paper Industry.

EPA Science Inventory

The U.S. pulp and paper industry utilizes a variety of fuels to provide energy for process needs. Energy production results in air emissions of sulfur dioxide (SO2), nitrogen oxides (NOX), particulate matter (PM), and greenhouse gases such as carbon dioxide (CO2). Air emissions f...

Quantification of taurodontism: interests in the early diagnosis of hypohidrotic ectodermal dysplasia.

PubMed

Gros, C-I; Clauss, F; Obry, F; Manière, M C; Schmittbuhl, M

2010-04-01

The aim of this study was to provide a quantification of taurodontism in Hypohidrotic Ectodermal Dysplasia (HED) and to report its occurrence in a cohort of HED patients to assess phenotypic-genotypic correlations. Of 68 HED patients retrospectively reviewed, 16 patients aged 7-51 years were selected and compared with a control sample (n = 351). The pulp surface index of the first lower permanent molar was calculated from the panoramic radiograph of each individual, and statistical comparisons between the HED patients and the control sample were performed. Whatever the genetic disorder, 81.25% of the HED patients exhibited a relative enlargement (>or=1 s.d.) of the pulp. Major deviations (>5 s.d.) were respectively related to men affected by large deletion of the EDA gene or missense mutation. The autosomal recessive form was linked to a relative moderate pulp enlargement (3.44 s.d.). In NEMO forms, the increase of pulp size in men appeared to be less marked than in EDA mutations. This study provides for the first time an objective assessment of pulp enlargement in HED patients, and the various degrees of taurodontism depicted could be interesting dental phenotypic markers of HED forms.

Strategies for characterizing compositions of industrial pulp and paper sludge

NASA Astrophysics Data System (ADS)

Aslanzadeh, Solmaz; Kemal, Rahmat A.; Pribowo, Amadeus Y.

2018-01-01

The large quantities of waste sludge produced by the pulp and paper industry present significant environmental challenges. In order to minimize the amounts of waste, the pulp sludge should be utilized for productive applications. In order to find feasible solutions, the sludge need to be characterized. In this study, the potential of using acid pretreatment and ashing method to determine the chemical compositions of the sludge is investigated. This study shows that acid pretreatment could be used to dissolve and determine the composition of CaCO3 in the pulp sludge. CaCO3 removal also facilitates the measurement of fiber and ash (clay) contents by using the ashing method. The optimum acid concentration used to completely dissolve CaCO3 was determined using a titration method. Using this method, the measurement of the chemical composition of the sludge sample revealed that it consisted primarily of CaCO3 (55% w/w), clay (25%, w/w), and fibers (18%, w/w). Based on these chemical compositions, potential utilization for the sludge could be determined.

Differential effects of TM4 tryptophan mutations on inhibition of N-methyl-d-aspartate receptors by ethanol and toluene.

PubMed

Smothers, C Thetford; Woodward, John J

2016-11-01

The voluntary use and abuse of alcohol and inhalants is a recognized health problem throughout the world. Previous studies have shown that these agents affect brain function in a variety of ways including direct inhibition of key ion channels that regulate neuronal excitability. Among these, the N-methyl-d-aspartate (NMDA) receptor is particularly important given its key role in glutamatergic synaptic transmission, neuronal plasticity and learning and memory. Previous studies from this laboratory and others have identified key residues within transmembrane (TM) domains of the NMDA receptor that appear to regulate its sensitivity to alcohol and anesthetics. In this study, we extend these findings and examine the role of a TM4 residue in modulating sensitivity of recombinant NMDA receptors to ethanol and toluene. HEK293 cells were transfected with GluN1-1a and either wild-type or tryptophan-substituted GluN2(A-D) subunits and whole-cell currents were recorded using patch-clamp electrophysiology in the absence or presence of ethanol or toluene. Both ethanol (100 mM) and toluene (1 or 3 mM) reversibly inhibited glutamate-activated currents from wild-type NMDARs with GluN2B containing receptors showing heightened sensitivity to either agent. Substitution of tryptophan (W) at positions 825, 826, 823 or 850 in the TM4 domain of GluN2A, GluN2B, GluN2C or GluN2D subunits; respectively, significantly reduced the degree of inhibition by ethanol. In contrast, toluene inhibition of glutamate-activated currents in cells expressing the TM4-W mutants was not different from that of the wild-type controls. These data suggest that despite similarities in their action on NMDARs, ethanol and toluene may act at different sites to reduce ion flux through NMDA receptors. Copyright © 2016 Elsevier Inc. All rights reserved.

Differential Effects of TM4 Tryptophan Mutations on Inhibition of N-Methyl-D-Aspartate Receptors by Ethanol and Toluene

PubMed Central

Smothers, C. Thetford; Woodward, John J.

2017-01-01

The voluntary use and abuse of alcohol and inhalants is a recognized health problem throughout the world. Previous studies have shown that these agents affect brain function in a variety of ways including direct inhibition of key ion channels that regulate neuronal excitability. Among these, the N-methyl-D-aspartate (NMDA) receptor is particularly important given its key role in glutamatergic synaptic transmission, neuronal plasticity and learning and memory. Previous studies from this laboratory and others have identified key residues within transmembrane (TM) domains of the NMDA receptor that appear to regulate its sensitivity to alcohol and anesthetics. In this study, we extend these findings and examine the role of a TM4 residue in modulating sensitivity of recombinant NMDA receptors to ethanol and toluene. HEK293 cells were transfected with GluN1-1a and either wild-type or tryptophan-substituted GluN2(A–D) subunits and whole-cell currents were recorded using patch-clamp electrophysiology in the absence or presence of ethanol or toluene. Both ethanol (100 mM) and toluene (1 or 3 mM) reversibly inhibited glutamate-activated currents from wild-type NMDARs with GluN2B containing receptors showing heightened sensitivity to either agent. Substitution of tryptophan (W) at positions 825, 826, 823 or 850 in the TM4 domain of GluN2A, GluN2B, GluN2C or GluN2D subunits; respectively, significantly reduced the degree of inhibition by ethanol. In contrast, toluene inhibition of glutamate-activated currents in cells expressing the TM4-W mutants was not different from that of the wild-type controls. These data suggest that despite similarities in their action on NMDARs, ethanol and toluene may act at different sites to reduce ion flux through NMDA receptors. PMID:27814790

Effect of banana pulp and peel flour on physicochemical properties and in vitro starch digestibility of yellow alkaline noodles.

PubMed

Ramli, Saifullah; Alkarkhi, Abbas F M; Shin Yong, Yeoh; Min-Tze, Liong; Easa, Azhar Mat

2009-01-01

The present study describes the utilization of banana--Cavendish (Musa acuminata L., cv cavendshii) and Dream (Musa acuminata colla. AAA, cv 'Berangan')--pulp and peel flours as functional ingredients in yellow alkaline noodles. Noodles were prepared by partial substitution of wheat flour with ripe banana pulp or peel flours. In most cases, the starch hydrolysis index, predicted glycaemic index (pGI) and physicochemical properties of cooked noodles were affected by banana flour addition. In general, the pGI values of cooked noodles were in the order; banana peel noodles < banana pulp noodles < control noodles. Since the peel flour was higher in total dietary fibre but lower in resistant starch contents than the pulp flour, the low pGI of banana peel noodles was mainly due to its high dietary fibre content. In conclusion, banana pulp and peel flour could be useful for controlling starch hydrolysis of yellow noodles, even though some physicochemical properties of the noodles were altered.

Strength and stiffness of reinforced yellow-poplar glued-laminated beams

Treesearch

R. Hernandez; R. C. Moody

In bridge applications, it is often necessary to minimize the depth of the bridge structure to provide for the required hydraulic opening or reduce the volume of approach fill. For bridges that utilize structural glued-laminated (glulam) timber beams as stringers, reinforcement using thin strips of pultruded E-glass-fiber-reinforced plastic (GFRP) composites may permit...

Allosteric Modulation of Metabotropic Glutamate Receptors

PubMed Central

Sheffler, Douglas J.; Gregory, Karen J.; Rook, Jerri M.; Conn, P. Jeffrey

2013-01-01

The development of receptor subtype-selective ligands by targeting allosteric sites of G protein-coupled receptors (GPCRs) has proven highly successful in recent years. One GPCR family that has greatly benefited from this approach is the metabotropic glutamate receptors (mGlus). These family C GPCRs participate in the neuromodulatory actions of glutamate throughout the CNS, where they play a number of key roles in regulating synaptic transmission and neuronal excitability. A large number of mGlu subtype-selective allosteric modulators have been identified, the majority of which are thought to bind within the transmembrane regions of the receptor. These modulators can either enhance or inhibit mGlu functional responses and, together with mGlu knockout mice, have furthered the establishment of the physiologic roles of many mGlu subtypes. Numerous pharmacological and receptor mutagenesis studies have been aimed at providing a greater mechanistic understanding of the interaction of mGlu allosteric modulators with the receptor, which have revealed evidence for common allosteric binding sites across multiple mGlu subtypes and the presence for multiple allosteric sites within a single mGlu subtype. Recent data have also revealed that mGlu allosteric modulators can display functional selectivity toward particular signal transduction cascades downstream of an individual mGlu subtype. Studies continue to validate the therapeutic utility of mGlu allosteric modulators as a potential therapeutic approach for a number of disorders including anxiety, schizophrenia, Parkinson’s disease, and Fragile X syndrome. PMID:21907906

Kraft Pulp Bleaching and Delignification by Dikaryons and Monokaryons of Trametes versicolor

PubMed Central

Addleman, Katherine; Archibald, Frederick

1993-01-01

The ability of 10 dikaryotic and 20 monokaryotic strains of Trametes (Coriolus) versicolor to bleach and delignify hardwood and softwood kraft pulps was assessed. A dikaryon (52P) and two of its mating-compatible monokaryons (52J and 52D) derived via protoplasting were compared. All three regularly bleached hardwood kraft pulp more than 20 brightness points (International Standards Organization) in 5 days and softwood kraft pulp the same amount in 12 days. Delignification (kappa number reduction) by the dikaryon and the monokaryons was similar, but the growth of the monokaryons was slower. Insoluble dark pigments were commonly found in the mycelium, medium, and pulp of the dikaryon only. Laccase and manganese peroxidase (MnP) but not lignin peroxidase activities were secreted during bleaching by all three strains. Their laccase and MnP isozyme patterns were compared on native gels. No segregation of isozyme bands between the monokaryons was found. Hardwood kraft pulp appeared to adsorb several laccase isozyme bands. One MnP isozyme (pI, 3.2) was secreted in the presence of pulp by all three strains, but a second (pI, 4.9) was produced only by 52P. A lower level of soluble MnP activity in one monokaryon (52D) was associated with reduced bleaching ability and a lower level of methanol production. Since monokaryon 52J bleached pulp better than its parent dikaryon 52P, especially per unit of biomass, this genetically simpler monokaryon will be the preferred subject for further genetic manipulation and improvement of fungal pulp biological bleaching. Images PMID:16348851

Techno-environmental assessment of the green biorefinery concept: Combining process simulation and life cycle assessment at an early design stage.

PubMed

Corona, Andrea; Ambye-Jensen, Morten; Vega, Giovanna Croxatto; Hauschild, Michael Zwicky; Birkved, Morten

2018-09-01

The Green biorefinery (GBR) is a biorefinery concept that converts fresh biomass into value-added products. The present study combines a Process Flowsheet Simulation (PFS) and Life Cycle Assessment (LCA) to evaluate the technical and environmental performance of different GBR configurations and the cascading utilization of the GBR output. The GBR configurations considered in this study, test alternatives in the three main steps of green-biorefining: fractionation, precipitation, and protein separation. The different cascade utilization alternatives analyse different options for press-pulp utilization, and the LCA results show that the environmental profile of the GBR is highly affected by the utilization of the press-pulp and thus by the choice of conventional product replaced by the press-pulp. Furthermore, scenario analysis of different GBR configurations shows that higher benefits can be achieved by increasing product yields rather than lowering energy consumption. Green biorefining is shown to be an interesting biorefining concept, especially in a Danish context. Biorefining of green biomass is technically feasible and can bring environmental savings, when compared to conventional production methods. However, the savings will be determined by the processing involved in each conversion stage and on the cascade utilization of the different platform products. Copyright © 2018 Elsevier B.V. All rights reserved.

Glutamate transporter-dependent mTOR phosphorylation in Müller glia cells

PubMed Central

María López-Colomé, Ana; Martínez-Lozada, Zila; Guillem, Alain M; López, Edith; Ortega, Arturo

2012-01-01

Glu (glutamate), the excitatory transmitter at the main signalling pathway in the retina, is critically involved in changes in the protein repertoire through the activation of signalling cascades, which regulate protein synthesis at transcriptional and translational levels. Activity-dependent differential gene expression by Glu is related to the activation of ionotropic and metabotropic Glu receptors; however, recent findings suggest the involvement of Na+-dependent Glu transporters in this process. Within the retina, Glu uptake is aimed at the replenishment of the releasable pool, and for the prevention of excitotoxicity and is carried mainly by the GLAST/EAAT-1 (Na+-dependent glutamate/aspartate transporter/excitatory amino acids transporter-1) located in Müller radial glia. Based on the previous work showing the alteration of GLAST expression induced by Glu, the present work investigates the involvement of GLAST signalling in the regulation of protein synthesis in Müller cells. To this end, we explored the effect of D-Asp (D-aspartate) on Ser-2448 mTOR (mammalian target of rapamycin) phosphorylation in primary cultures of chick Müller glia. The results showed that D-Asp transport induces the time- and dose-dependent phosphorylation of mTOR, mimicked by the transportable GLAST inhibitor THA (threo-β-hydroxyaspartate). Signalling leading to mTOR phosphorylation includes Ca2+ influx, the activation of p60src, phosphatidylinositol 3-kinase, protein kinase B, mTOR and p70S6K. Interestingly, GLAST activity promoted AP-1 (activator protein-1) binding to DNA, supporting a function for transporter signalling in retinal long-term responses. These results add a novel receptor-independent pathway for Glu signalling in Müller glia, and further strengthen the critical involvement of these cells in the regulation of glutamatergic transmission in the retina. PMID:22817638

Metabotropic glutamate receptor 5 mediates the suppressive effect of 6-OHDA-induced model of Parkinson's disease on liver cancer.

PubMed

Xi, Shao-Song; Bai, Xiao-Xu; Gu, Li; Bao, Li-Hui; Yang, Hui-Min; An, Wei; Wang, Xiao-Min; Zhang, Hong

2017-07-01

Numerous epidemiological studies suggested that there is a variable cancer risk in patients with Parkinson's disease (PD). However, the underlying mechanisms remain unclear. In the present study, the role of metabotropic glutamate receptor 5 (mGluR5) has been investigated in 6-hydroxydopamine (6-OHDA)-induced PD combined with liver cancer both in vitro and in vivo. We found that PD cellular model from 6-OHDA-lesioned MN9D cells suppressed the growth, migration, and invasion of Hepa1-6 cells via down-regulation of mGluR5-mediated ERK and Akt pathway. The application of 2-methyl-6-(phenylethyl)-pyridine and knockdown of mGluR5 further decreased the effect on Hepa-1-6 cells when co-cultured with conditioned media. The effect was increased by (S)-3,5-dihydroxyphenylglycine and overexpression of mGluR5. Moreover, more release of glutamate from 6-OHDA-lesioned MN9D cells suppressed mGluR5-mediated effect of Hepa1-6 cells. Application of riluzole eliminated the increased glutamate release induced by 6-OHDA in MN9D cells and aggravated the suppressive effect on Hepa-1-6 cells. In addition, the growth of implanted liver cancer was inhibited in 6-OHDA induced PD-like rats, and was associated with increased glutamate release in the serum and down-regulation of mGluR5 in tumor tissue. Collectively, these results indicate that selective antagonism of glutamate and mGluR5 has a potentially beneficial effect in both liver cancer and PD, and thus may provide more understanding for the clinical investigation and further an additional therapeutic target for these two diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.

Frontal cortex and hippocampus neurotransmitter receptor complex level parallels spatial memory performance in the radial arm maze.

PubMed

Shanmugasundaram, Bharanidharan; Sase, Ajinkya; Miklosi, András G; Sialana, Fernando J; Subramaniyan, Saraswathi; Aher, Yogesh D; Gröger, Marion; Höger, Harald; Bennett, Keiryn L; Lubec, Gert

2015-08-01

Several neurotransmitter receptors have been proposed to be involved in memory formation. However, information on receptor complexes (RCs) in the radial arm maze (RAM) is missing. It was therefore the aim of this study to determine major neurotransmitter RCs levels that are modulated by RAM training because receptors are known to work in homo-or heteromeric assemblies. Immediate early gene Arc expression was determined by immunohistochemistry to show if prefrontal cortices (PFC) and hippocampi were activated following RAM training as these regions are known to be mainly implicated in spatial memory. Twelve rats per group, trained and untrained in the twelve arm RAM were used, frontal cortices and hippocampi were taken, RCs in membrane protein were quantified by blue-native PAGE immunoblotting. RCs components were characterised by co-immunoprecipitation followed by mass spectrometrical analysis and by the use of the proximity ligation assay. Arc expression was significantly higher in PFC of trained as compared to untrained rats whereas it was comparable in hippocampi. Frontal cortical levels of RCs containing AMPA receptors GluA1, GluA2, NMDA receptors GluN1 and GluN2A, dopamine receptor D1, acetylcholine nicotinic receptor alpha 7 (nAChR-α7) and hippocampal levels of RCs containing D1, GluN1, GluN2B and nAChR-α7 were increased in the trained group; phosphorylated dopamine transporter levels were decreased in the trained group. D1 and GluN1 receptors were shown to be in the same complex. Taken together, distinct RCs were paralleling performance in the RAM which is relevant for interpretation of previous and design of future work on RCs in memory studies. Copyright © 2015 Elsevier B.V. All rights reserved.

Crystal Structures of the Glutamate Receptor Ion Channel GluK3 and GluK5 Amino-Terminal Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Janesh; Mayer, Mark L.

2010-11-30

Ionotropic glutamate receptors (iGluRs) mediate the majority of fast excitatory synaptic neurotransmission in the central nervous system. The selective assembly of iGluRs into AMPA, kainate, and N-methyl-d-aspartic acid (NMDA) receptor subtypes is regulated by their extracellular amino-terminal domains (ATDs). Kainate receptors are further classified into low-affinity receptor families (GluK1-GluK3) and high-affinity receptor families (GluK4-GluK5) based on their affinity for the neurotoxin kainic acid. These two families share a 42% sequence identity for the intact receptor but only a 27% sequence identity at the level of ATD. We have determined for the first time the high-resolution crystal structures of GluK3 andmore » GluK5 ATDs, both of which crystallize as dimers but with a strikingly different dimer assembly at the R1 interface. By contrast, for both GluK3 and GluK5, the R2 domain dimer assembly is similar to those reported previously for other non-NMDA iGluRs. This observation is consistent with the reports that GluK4-GluK5 cannot form functional homomeric ion channels and require obligate coassembly with GluK1-GluK3. Our analysis also reveals that the relative orientation of domains R1 and R2 in individual non-NMDA receptor ATDs varies by up to 10{sup o}, in contrast to the 50{sup o} difference reported for the NMDA receptor GluN2B subunit. This restricted domain movement in non-NMDA receptor ATDs seems to result both from extensive intramolecular contacts between domain R1 and domain R2 and from their assembly as dimers, which interact at both R1 and R2 domains. Our results provide the first insights into the structure and function of GluK4-GluK5, the least understood family of iGluRs.« less

Central phencyclidine (PCP) receptor binding is glutamate dependent: evidence for a PCP/excitatory amino acid receptor (EAAR) complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loo, P.; Braunwalder, A.; Lehmann, J.

PCP and other dissociative anesthetica block the increase in neuronal firing rate evoked by the EAAR agonist, N-methyl-Daspartate. NMDA and other EAAs such as glutamate (glu) have not been previously shown to affect PCP ligand binding. In the present study, using once washed rat forebrain membranes, 10 ..mu..M-glu was found to increase the binding of (/sup 3/H)TCP, a PCP analog, to defined PCP recognition sites by 20%. Removal of glu and aspartate (asp) by extensive washing decreased TCP binding by 75-90%. In these membranes, 10 ..mu..M L-glu increased TCP binding 3-fold. This effect was stereospecific and evoked by other EAAsmore » with the order of activity, L-glu > D-asp > L- asp > NMDA > D-glu > quisqualate. Kainate, GABA, NE, DA, 5-HT, 2-chloroadenosine, oxotremorine and histamine had no effect on TCP binding at concentrations up to 100 ..mu..M. The effects of L-glu were attenuated by the NMDA-type receptor antagonist, 2-amino-7--phosphonoheptanoate (AP7; 10 ..mu..M-1 mM). These findings indicate that EAAS facilitate TCP binding, possibly through NMDA-type receptors. The observed interaction between the PCP receptor and EAARs may reflect the existence of a macromolecular receptor complex similar to that demonstrated for the benzodiazepines and GABA.« less

T227. THE METABOTROPIC GLUTAMATE RECEPTOR SUBTYPE 1 REGULATES STRIATAL DOPAMINE RELEASE VIA AN ENDOCANNABINOID-DEPENDENT MECHANISM: IMPLICATIONS FOR THE TREATMENT OF SCHIZOPHRENIA

PubMed Central

Yohn, Samantha; Covey, Daniel; Foster, Daniel; Moehle, Mark; Galbraith, Jordan; Cheer, Joseph; Lindsley, Craig; Jeffrey Conn, P

2018-01-01

Abstract Background Clinical and preclinical studies suggest that selective activators of the muscarinic M4 receptor have exciting potential as a novel approach for treatment of schizophrenia. M4 reduces striatal dopamine (DA) though release of endocannabinoids (eCB), providing a mechanism for local effects on DA signaling in the striatum. M4 signals through Gαi/o and does not couple to Gαq/11 or induce calcium (Ca++) mobilization. This raises the possibility that M4-induced eCB release and inhibition of DA release may require co-activation of another receptor that activates Gαq/11. If so, this receptor could provide a novel target that may be more proximal to inhibition of DA release. Interestingly, the group 1 metabotropic glutamate (mGlu) receptors (mGlu1 and Glu5), couple to Gαq/11 and activate eCB signaling in multiple brain regions. Methods We tested the hypothesis that M4-induced reductions in DA release and subsequent antipsychotic-effect requires co-activation of group 1 mGlu receptors. The effect of M4 activation on electrically-evoked DA release in striatal slices was assessed using fast-scan cyclic voltammetry (FSCV) in the absence or presence of selective negative allosteric modulators (NAMs) of group 1 mGlu receptor subtypes. To evaluate the potential role of mGlu1, we determined the effects of a selective mGlu1 positive allosteric modulators (PAMs) on striatal DA release and antipsychotic-like activity in rodent models that are dependent on increased DA transmission. Since reductions in DA signaling, including D1 signaling have been implicated in reduced motivation, we also determined the effects of an mGlu1 PAM, M4 PAM, and the typical antipsychotic haloperidol on motivational responding in a progressive ratio (PR) schedule. Results We now present exciting new data in which we found that activation of mGlu1 through application of exogenous agonists or selective stimulation of thalamostriatal afferents induces a reduction of striatal DA release and that selective mGlu1 PAMs have robust antipsychotic-like effects in rodent models. Interestingly, our studies also suggest that mGlu1 activation is required for M4 PAM-induced inhibition of DA release and antipsychotic-like effects. However, in contrast to available antipsychotic agents, the present results and previous studies suggest that mGlu1 and M4 PAMs reduce DA signaling through local release of an eCB from striatal SPNs and activation of CB2 receptors on neighboring DA terminals to reduce DA release. While these studies suggest that the effects of M4 PAMs on DA release require activation of mGlu1, we have also found that these targets have important differences. Most notably, M4 PAMs also directly inhibits D1 signaling in D1-SPN terminals in the substatnia nigra pars reticulata (SNr). Unlike M4, mGlu1 does not directly inhibit DA D1 receptor signaling and does not induce behavioral changes that could be associated with negative symptoms. Discussion Our findings are especially interesting in light of recent findings that multiple loss of function single nucleotide polymorphisms (SNPs) in the human gene encoding mGlu1 (GRM1) are associated with schizophrenia, and points to GRM1/mGlu1 as a gene within the “druggable genome” that could be targeted for treatment of schizophrenia. Recent clinical imaging studies suggesting that symptoms in schizophrenia patients are associated with selective increases in striatal DA signaling and while extrastriatal regions display hypo-dopaminergic function; thus, mGlu1 and M4 PAMs may provide a mechanism for selective inhibition of DA release in striatal regions that are important for antipsychotic efficacy, without further disruptions in extrastriatal DA signaling.

Fear Potentiated Startle Increases Phospholipase D (PLD) Expression/Activity and PLD-Linked Metabotropic Glutamate Receptor Mediated Post-Tetanic Potentiation in Rat Amygdala

PubMed Central

Krishnan, Balaji; Scott, Michael T.; Pollandt, Sebastian; Schroeder, Bradley; Kurosky, Alexander; Shinnick-Gallagher, Patricia

2016-01-01

Long-term memory (LTM) of fear stores activity dependent modifications that include changes in amygdala signaling. Previously, we identified an enhanced probability of release of glutamate mediated signaling to be important in rat fear potentiated startle (FPS), a well-established translational behavioral measure of fear. Here, we investigated short- and long-term synaptic plasticity in FPS involving metabotropic glutamate receptors (mGluRs) and associated downstream proteomic changes in the thalamic-lateral amygdala pathway (Th-LA). Aldolase A, an inhibitor of phospholipase D (PLD), expression was reduced, concurrent with significantly elevated PLD protein expression. Blocking the PLD-mGluR signaling significantly reduced PLD activity. While transmitter release probability increased in FPS, PLD-mGluR agonist and antagonist actions were occluded. In the unpaired group (UNP), blocking the PLD-mGluR increased while activating the receptor decreased transmitter release probability, consistent with decreased synaptic potentials during tetanic stimulation. FPS Post-tetanic potentiation (PTP) immediately following long-term potentiation (LTP) induction was significantly increased. Blocking PLD-mGluR signaling prevented PTP and reduced cumulative PTP probability but not LTP maintenance in both groups. These effects are similar to those mediated through mGluR7, which is co-immunoprecipitated with PLD in FPS. Lastly, blocking mGluR-PLD in the rat amygdala was sufficient to prevent behavioral expression of fear memory. Thus, our study in the Th-LA pathway provides the first evidence for PLD as an important target of mGluR signaling in amygdala fear-associated memory. Importantly, the PLD-mGluR provides a novel therapeutic target for treating maladaptive fear memories in posttraumatic stress and anxiety disorders. PMID:26748024

Shredded beet pulp substituted for corn silage in diets fed to dairy cows under ambient heat stress: Feed intake, total-tract digestibility, plasma metabolites, and milk production.

PubMed

Naderi, N; Ghorbani, G R; Sadeghi-Sefidmazgi, A; Nasrollahi, S M; Beauchemin, K A

2016-11-01

The effects of substituting increasing concentrations of dried, shredded beet pulp for corn silage on dry matter intake, nutrient digestibility, rumen fermentation, blood metabolites, and milk production of lactating dairy cows was evaluated under conditions of ambient heat stress. Four multiparous (126±13d in milk) and 4 primiparous (121±11d in milk) Holstein cows were used in a 4×4 Latin square design experiment with 4 periods of 21d. Each period had 14d of adaptation and 7d of sampling, and parity was the square. Dietary treatments were (dry matter basis): 16% of dietary dry matter as corn silage without BP (0BP, control diet); 8% corn silage and 8% beet pulp (8BP); 4% corn silage and 12% beet pulp (12BP); and 0% corn silage and 16% beet pulp (16BP). Alfalfa hay was included in all diets (24% dietary dry matter). Dietary concentrations of forage neutral detergent fiber and nonfiber carbohydrates were 21.3 and 39.2% (0BP), 16.5 and 40.9% (8BP), 14.1 and 42.2% (12BP), and 11.7 and 43.4% (16BP), respectively (dry matter basis). The ambient temperature-humidity index indicated that the cows were in heat stress for almost the entire duration of the study. Dry matter intake and nutrient digestibilities were similar across treatments and between multi- and primiparous cows. Mean rumen pH tended to decrease with increasing proportions of beet pulp in the diet. Also, increasing proportions of beet pulp in the diet linearly decreased acetate and butyrate concentrations in the rumen and increased propionate concentrations, leading to a linear decrease in acetate:propionate ratio. Milk yield linearly increased (38.5, 39.3, 40.9, and 39.6kg/d for 0BP, 8BP, 12BP, and 16BP, respectively), but fat content linearly decreased (3.46, 3.47, 3.27, and 2.99), such that we observed no effect on fat-corrected milk. Substituting beet pulp for corn silage increased the neutral detergent insoluble crude protein content of the diet, leading to a decrease in rumen concentration of ammonia-nitrogen and milk concentration of urea, corresponding to an increase in percentage of protein in milk. Compared with multiparous cows, primiparous cows had greater rumen pH, metabolite concentrations in plasma (glucose, cholesterol, urea nitrogen, total protein, and globulins), milk production, and concentrations of milk components. Substituting beet pulp for corn silage at up to 12% of dietary dry matter can be beneficial during heat stress conditions. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Melatonin attenuates inflammation of acute pulpitis subjected to dental pulp injury

PubMed Central

Li, Ji-Guo; Lin, Jia-Ji; Wang, Zhao-Ling; Cai, Wen-Ke; Wang, Pei-Na; Jia, Qian; Zhang, An-Sheng; Wu, Gao-Yi; Zhu, Guo-Xiong; Ni, Long-Xing

2015-01-01

Acute pulpitis (AP), one of the most common diseases in the endodontics, usually causes severe pain to the patients, which makes the search for therapeutic target of AP essential in clinic. Toll-like receptor 4 (TLR4) signaling is widely involved in the mechanism of pulp inflammation, while melatonin has been reported to have an inhibition for a various kinds of inflammation. We hereby studied whether melatonin can regulate the expression of TLR4/NF-ĸB signaling in the pulp tissue of AP and in human dental pulp cells (HDPCs). Two left dental pulps of the adult rat were drilled open to establish the AP model, and the serum levels of melatonin and pro-inflammatory cytokines, including interleukin 1β (IL-1β), interleukin 18 (IL-18) and tumor necrosis factor α (TNF-α), were assessed at 1, 3 and 5 d post injury. At the same time points, the expression of TLR4 signaling in the pulp was explored by quantitative real-time PCR and immunohistochemistry. The AP rats were administered an abdominal injection of melatonin to assess whether melatonin rescued AP and TLR4/NF-ĸB signaling. Dental pulp injury led to an approximately five-day period acute pulp inflammation and necrosis in the pulp and a significant up-regulation of IL-1β, IL-18 and TNF-α in the serum. ELISA results showed that the level of melatonin in the serum decreased due to AP, while an abdominal injection of melatonin suppressed the increase in serum cytokines and the percentage of necrosis at the 5 d of the injured pulp. Consistent with the inflammation in AP rats, TLR4, NF-ĸB, TNF-α and IL-1β in the pulp were increased post AP compared with the baseline expression. And melatonin showed an inhibition on TLR4/NF-ĸB signaling as well as IL-1β and TNF-α production in the pulp of AP rats. Furthermore, melatonin could also regulate the expression of TLR4/NF-ĸB signaling in LPS-stimulated HDPCs. These data suggested that dental pulp injury induced AP and reduced the serum level of melatonin and that supplementation with melatonin may have a protective effect on AP by modulating TLR4/NF-ĸB signaling in the pulp and in pulp cells. PMID:25755829

Utilization of steel, pulp and paper industry solid residues in forest soil amendment: relevant physicochemical properties and heavy metal availability.

PubMed

Mäkelä, Mikko; Watkins, Gary; Pöykiö, Risto; Nurmesniemi, Hannu; Dahl, Olli

2012-03-15

Industrial residue application to soil was investigated by integrating granulated blast furnace or converter steel slag with residues from the pulp and paper industry in various formulations. Specimen analysis included relevant physicochemical properties, total element concentrations (HCl+HNO3 digestion, USEPA 3051) and chemical speciation of chosen heavy metals (CH3COOH, NH2OH·HCl and H2O2+H2O2+CH3COONH4, the BCR method). Produced matrices showed liming effects comparable to commercial ground limestone and included significant quantities of soluble vital nutrients. The use of converter steel slag, however, led to significant increases in the total concentrations of Cr and V. Subsequently, total Cr was attested to occur as Cr(III) by Na2CO3+NaOH digestion followed by IC UV/VIS-PCR (USEPA 3060A). Additionally, 80.6% of the total concentration of Cr (370 mg kg(-1), d.w.) occurred in the residual fraction. However, 46.0% of the total concentration of V (2470 mg kg(-1), d.w.) occurred in the easily reduced fraction indicating potential bioavailability. Copyright © 2011 Elsevier B.V. All rights reserved.

40 CFR 430.00 - Applicability.

Code of Federal Regulations, 2012 CFR

2012-07-01

... subcategorization scheme Types of products covered in the subpart A Dissolving Kraft Dissolving pulp at kraft mills... unbleached kraft chemical recovery system (Va). D Dissolving Sulfite Pulp at dissolving sulfite mills for the...

40 CFR 430.00 - Applicability.

Code of Federal Regulations, 2014 CFR

2014-07-01

... subcategorization scheme Types of products covered in the subpart A Dissolving Kraft Dissolving pulp at kraft mills... unbleached kraft chemical recovery system (Va). D Dissolving Sulfite Pulp at dissolving sulfite mills for the...

40 CFR 430.00 - Applicability.

Code of Federal Regulations, 2013 CFR

2013-07-01

... subcategorization scheme Types of products covered in the subpart A Dissolving Kraft Dissolving pulp at kraft mills... unbleached kraft chemical recovery system (Va). D Dissolving Sulfite Pulp at dissolving sulfite mills for the...

Activity-induced synaptic delivery of the GluN2A-containing NMDA receptor is dependent on endoplasmic reticulum chaperone Bip and involved in fear memory

PubMed Central

Zhang, Xiao-min; Yan, Xun-yi; Zhang, Bin; Yang, Qian; Ye, Mao; Cao, Wei; Qiang, Wen-bin; Zhu, Li-jun; Du, Yong-lan; Xu, Xing-xing; Wang, Jia-sheng; Xu, Fei; Lu, Wei; Qiu, Shuang; Yang, Wei; Luo, Jian-hong

2015-01-01

The N-methyl-D-aspartate receptor (NMDAR) in adult forebrain is a heterotetramer mainly composed of two GluN1 subunits and two GluN2A and/or GluN2B subunits. The synaptic expression and relative numbers of GluN2A- and GluN2B-containing NMDARs play critical roles in controlling Ca2+-dependent signaling and synaptic plasticity. Previous studies have suggested that the synaptic trafficking of NMDAR subtypes is differentially regulated, but the precise molecular mechanism is not yet clear. In this study, we demonstrated that Bip, an endoplasmic reticulum (ER) chaperone, selectively interacted with GluN2A and mediated the neuronal activity-induced assembly and synaptic incorporation of the GluN2A-containing NMDAR from dendritic ER. Furthermore, the GluN2A-specific synaptic trafficking was effectively disrupted by peptides interrupting the interaction between Bip and GluN2A. Interestingly, fear conditioning in mice was disrupted by intraperitoneal injection of the interfering peptide before training. In summary, we have uncovered a novel mechanism for the activity-dependent supply of synaptic GluN2A-containing NMDARs, and demonstrated its relevance to memory formation. PMID:26088419

Comparison of fermented animal feed and mushroom growth media as two value-added options for waste Cassava pulp management.

PubMed

Trakulvichean, Sivalee; Chaiprasert, Pawinee; Otmakhova, Julia; Songkasiri, Warinthorn

2017-12-01

Cassava is one of the main processed crops in Thailand, but this generates large amounts (7.3 million tons in 2015) of waste cassava pulp (WCP). The solid WCP is sold directly to farmers or pulp-drying companies at a low cost to reduce the burden of on-site waste storage. Using an integrated direct and environmental cost model, fermented animal feed and mushroom growth media were compared as added-value waste management alternatives for WCP to mitigate environmental problems. Primary and secondary data were collected from the literature, field data, and case studies. Data boundaries were restricted to a gate-to-gate scenario with a receiving capacity of 500 t WCP/d, and based on a new production unit being set up at the starch factory. The total production cost of each WCP utilization option was analyzed from the economic and environmental costs. Fermented animal feed was an economically attractive scenario, giving a higher net present value (NPV), lower investment cost and environmental impact, and a shorter payback period for the 10-year operational period. The selling price of mushrooms was the most sensitive parameter regarding the NPV, while the NPV for the price of fermented animal feed had the highest value in the best-case scenario.

Cysteine Substitution of Transmembrane Domain Amino Acids Alters the Ethanol Inhibition of GluN1/GluN2A N-Methyl-d-Aspartate Receptors

PubMed Central

Xu, Minfu; Smothers, C. Thetford

2015-01-01

N-Methyl-d-aspartate receptors (NMDARs) are inhibited by behaviorally relevant concentrations of ethanol, and residues within transmembrane (TM) domains of NMDARs, including TM3 GluN1 phenylalanine 639 (F639), regulate this sensitivity. In the present study, we used cysteine (C) mutagenesis to determine whether there are additional residues within nearby TM domains that regulate ethanol inhibition on NMDARs. GluN1(F639C)/GluN2A receptors were less inhibited by ethanol than wild-type receptors, and inhibition was restored to wild-type levels following treatment with ethanol-like methanethiosulfonate reagents. Molecular modeling identified six residues in the GluN1 TM1 domain (valine V566; serine S569) and the GluN2A TM4 domain (methionine, M817; V820, F821, and leucine, L824) that were in close vicinity to the TM3 F639 residue, and these were individually mutated to cysteine and tested for ethanol inhibition and receptor function. The F639C-induced decrease in ethanol inhibition was blunted by coexpression of GluN1 TM1 mutants V566C and S569C, and statistically significant interactions were observed for ethanol inhibition among V566C, F639C, and GluN2A TM4 mutants V820C and F821C and S569C, F639C, and GluN2A TM4 mutants F821C and L824C. Ethanol inhibition was also reduced when either GluN1 TM1 mutant V566C or S569C was combined with GluN2A V820C, suggesting a novel TM1:TM4 intrasubunit site of action for ethanol. Cysteines substituted at TM3 and TM4 sites previously suggested to interact with ethanol had less dramatic effects on ethanol inhibition. Overall, the results from these studies suggest that interactions among TM1, TM3, and TM4 amino acids in NMDARs are important determinants of ethanol action at these receptors. PMID:25635140

Bioceramic/poly (glycolic)-poly (lactic acid) composite induces mineralized barrier after direct capping of rat tooth pulp tissue.

PubMed

Gala-Garcia, Alfonso; Teixeira, Karina Imaculada Rosa; Wykrota, Francisco Henrique Lana; Sinisterra, Rubén Dario; Cortés, Maria Esperanza

2010-01-01

The aim of this study was to observe the histopathological pulp response following direct pulp capping of mechanically exposed teeth in rats with a composite of beta-tricalcium phosphate-hydroxyapatite bioceramic (BC) and poly (glycolic)-poly (lactic acid) (PLGA) material or a calcium hydroxide [Ca(OH)2] material, compared to BC alone and a negative control of water. Pulp of the maxillary molars was exposed, followed by capping with the experimental material. The pulpal tissue response was assessed post-operatively at 1, 7, 14 and 30 d, followed by histological analysis. The Ca(OH)2 group exhibited severe acute inflammatory cell infiltration at day 14. However after 30 d, a new hard tissue with macro porous obliteration of the pulp chamber and a characteristic necrotic area had appeared. BC and Ca(OH)2 capping were associated with moderate inflammation and dentinal bridge similar. Meanwhile, in the BC/PLGA composite group, there was moderate inflammatory infiltrate and formation of a dense and complete dentinal bridge. In conclusion, the BC/PLGA composite material showed a large zone of tertiary dentin, and effectively reorganized the dentin-pulp complex.

Flavonoids from acai (euterpe oleracea mart.) Pulp and their antioxidant and anti-inflammatory activities

USDA-ARS?s Scientific Manuscript database

Five flavonoids, (2S,3S)-dihyrokaempferol 3-O-beta-D-glucoside (1) and its isomer (2R,3R)-dihydrokaempferol 3-O-'-D-glucoside (2) , isovitexin (3), velutin (4) and 5,4'-dihydroxy-7,3',5'-trimethoxyflavone (5), were isolated from acai (Euterpe oleracea Mart.) pulp. The structures of these compounds ...

Building a Comprehensive Mill-Level Database for the Industrial Sectors Integrated Solutions (ISIS) Model of the U.S. Pulp and Paper Sector

EPA Science Inventory

The Industrial Sectors Integrated Solutions (ISIS) model for the pulp and paper sector is currently under development at the U.S. Environmental Protection Agency (EPA), and can be utilized to facilitate multi-pollutant sector-based analyses that are performed in conjunction with ...

Value addition of wild apricot fruits grown in North-West Himalayan regions-a review.

PubMed

Sharma, Rakesh; Gupta, Anil; Abrol, G S; Joshi, V K

2014-11-01

Wild apricot (Prunus armeniaca L.) commonly known as chulli is a potential fruit widely distributed in North-West Himalayan regions of the world. The fruits are good source of carbohydrates, vitamins, minerals besides having attractive colour and typical flavour. Unlike table purpose varieties of apricots like New Castle, the fruits of wild apricot are unsuitable for fresh consumption because of its high acid and low sugar content. However, the fruits are traditionally utilized for open sun drying, pulping to prepare different products such as jams, chutney and naturally fermented and distilled liquor. But, scientific literature on processing and value addition of wild apricot is scanty. Preparation of jam with 25 % wild apricot +75 % apple showed maximum score for organoleptic characteristics due to better taste and colour. Osmotic dehydration has been found as a suitable method for drying of wild type acidic apricots. A good quality sauce using wild apricot pulp and tomato pulp in the ratio of 1:1 has been prepared, while chutney of good acceptability prepared from wild apricot pulp (100 %) has also been documented. Preparation of apricot-soy protein enriched products like apricot-soya leather, toffee and fruit bars has been reported, which are reported to meet the protein requirements of adult and children as per the recommendations of ICMR. Besides these processed products, preparation of alcoholic beverages like wine, vermouth and brandy from wild apricot fruits has also been reported by various researchers. Further, after utilization of pulp for preparation of value added products, the stones left over have been successfully utilized for oil extraction which has medicinal and cosmetic value. The traditional method of oil extraction has been reported to be unhygienic and result in low oil yield with poor quality, whereas improved mechanical method of oil extraction has been found to produce good quality oil. The apricot kernel oil and press cake have successfully been utilized for preparation of various value added products such as facial cream, lip balm, essential oil and protein isolate with good quality attributes and consumer acceptability. However, no scientific information on utilization of shells remained after kernel separation is available, but the shells are traditionally utilized for burning purpose during winters by the farmers. Therefore, it seems that every part of wild apricot can be utilized for conversion into value-added products and commercial utilization of this fruit will certainly add value to this underutilized fruit and also increase the economy of farmers.

Neonatal seizures alter NMDA glutamate receptor GluN2A and 3A subunit expression and function in hippocampal CA1 neurons

PubMed Central

Zhou, Chengwen; Sun, Hongyu; Klein, Peter M.; Jensen, Frances E.

2015-01-01

Neonatal seizures are commonly caused by hypoxic and/or ischemic injury during birth and can lead to long-term epilepsy and cognitive deficits. In a rodent hypoxic seizure (HS) model, we have previously demonstrated a critical role for seizure-induced enhancement of the AMPA subtype of glutamate receptor (GluA) in epileptogenesis and cognitive consequences, in part due to GluA maturational upregulation of expression. Similarly, as the expression and function of the N-Methyl-D-aspartate (NMDA) subtype of glutamate receptor (GluN) is also developmentally controlled, we examined how early life seizures during the critical period of synaptogenesis could modify GluN development and function. In a postnatal day (P)10 rat model of neonatal seizures, we found that seizures could alter GluN2/3 subunit composition of GluNs and physiological function of synaptic GluNs. In hippocampal slices removed from rats within 48–96 h following seizures, the amplitudes of synaptic GluN-mediated evoked excitatory postsynaptic currents (eEPSCs) were elevated in CA1 pyramidal neurons. Moreover, GluN eEPSCs showed a decreased sensitivity to GluN2B selective antagonists and decreased Mg2+ sensitivity at negative holding potentials, indicating a higher proportion of GluN2A and GluN3A subunit function, respectively. These physiological findings were accompanied by a concurrent increase in GluN2A phosphorylation and GluN3A protein. These results suggest that altered GluN function and expression could potentially contribute to future epileptogenesis following neonatal seizures, and may represent potential therapeutic targets for the blockade of future epileptogenesis in the developing brain. PMID:26441533

Simultaneous determination of D-aspartic acid and D-glutamic acid in rat tissues and physiological fluids using a multi-loop two-dimensional HPLC procedure.

PubMed

Han, Hai; Miyoshi, Yurika; Ueno, Kyoko; Okamura, Chieko; Tojo, Yosuke; Mita, Masashi; Lindner, Wolfgang; Zaitsu, Kiyoshi; Hamase, Kenji

2011-11-01

For a metabolomics study focusing on the analysis of aspartic and glutamic acid enantiomers, a fully automated two-dimensional HPLC system employing a microbore-ODS column and a narrowbore-enantioselective column was developed. By using this system, a detailed distribution of D-Asp and D-Glu besides L-Asp and L-Glu in mammals was elucidated. For the total analysis concept, the amino acids were first pre-column derivatized with 4-fluoro-7-nitro-2,1,3-benzoxadiazole (NBD-F) to be sensitively and fluorometrically detected. For the non-stereoselective separation of the analytes in the first dimension a monolithic ODS column (750 mm × 0.53 mm i.d.) was adopted, and a self-packed narrowbore-Pirkle type enantioselective column (Sumichiral OA-2500S, 250 mm × 1.5 mm i.d.) was selected for the second dimension. In the rat plasma, RSD values for intra-day and inter-day precision were less than 6.8%, and the accuracy ranged between 96.1% and 105.8%. The values of LOQ of D-Asp and D-Glu were 5 fmol/injection (0.625 nmol/g tissue). The present method was successfully applied to the simultaneous determination of free aspartic acid and glutamic acid enantiomers in 7 brain areas, 11 peripheral tissues, plasma and urine of Wistar rats. Biologically significant D-Asp values were found in various tissue samples whereas for D-Glu the values were very low possibly indicating less significance. Copyright © 2011 Elsevier B.V. All rights reserved.

A Novel Combinatorial Therapy With Pulp Stem Cells and Granulocyte Colony-Stimulating Factor for Total Pulp Regeneration

PubMed Central

Iohara, Koichiro; Murakami, Masashi; Takeuchi, Norio; Osako, Yohei; Ito, Masataka; Ishizaka, Ryo; Utunomiya, Shinji; Nakamura, Hiroshi; Matsushita, Kenji

2013-01-01

Treatment of deep caries with pulpitis is a major challenge in dentistry. Stem cell therapy represents a potential strategy to regenerate the dentin-pulp complex, enabling conservation and restoration of teeth. The objective of this study was to assess the efficacy and safety of pulp stem cell transplantation as a prelude for the impending clinical trials. Clinical-grade pulp stem cells were isolated and expanded according to good manufacturing practice conditions. The absence of contamination, abnormalities/aberrations in karyotype, and tumor formation after transplantation in an immunodeficient mouse ensured excellent quality control. After autologous transplantation of pulp stem cells with granulocyte-colony stimulating factor (G-CSF) in a dog pulpectomized tooth, regenerated pulp tissue including vasculature and innervation completely filled in the root canal, and regenerated dentin was formed in the coronal part and prevented microleakage up to day 180. Transplantation of pulp stem cells with G-CSF yielded a significantly larger amount of regenerated dentin-pulp complex compared with transplantation of G-CSF or stem cells alone. Also noteworthy was the reduction in the number of inflammatory cells and apoptotic cells and the significant increase in neurite outgrowth compared with results without G-CSF. The transplanted stem cells expressed angiogenic/neurotrophic factors. It is significant that G-CSF together with conditioned medium of pulp stem cells stimulated cell migration and neurite outgrowth, prevented cell death, and promoted immunosuppression in vitro. Furthermore, there was no evidence of toxicity or adverse events. In conclusion, the combinatorial trophic effects of pulp stem cells and G-CSF are of immediate utility for pulp/dentin regeneration, demonstrating the prerequisites of safety and efficacy critical for clinical applications. PMID:23761108

On understanding proton transfer to the biocatalytic [Fe-Fe](H) sub-cluster in [Fe-Fe]H(2)ases: QM/MM MD simulations.

PubMed

Hong, G; Cornish, A J; Hegg, E L; Pachter, R

2011-05-01

Proton transfer to the [Fe-Fe](H) sub-cluster in the Desulfovibrio desulfuricans (DdH) and Clostridium pasteurianum (CpI) [Fe-Fe] hydrogenases was investigated by a combination of first principles and empirical molecular dynamics simulations. Pathways that can be inferred from the X-ray crystal structures of DdH and CpI, i.e., (Glu159→Ser198→Glu156→water460→Cys178→DTMA([Fe-Fe](H)) and (Glu282→Ser319→Glu279→water612→Cys299), respectively, were considered. Proton transfer from Cys178 to DTMA in the [Fe-Fe](H) sub-cluster in DdH was readily observed in our results, specifically when [Fe-Fe](H) was in the reduced state ([Fe(I)-Fe(I)]) or in the mixed valence state for the protonated distal iron Fe(d) ([Fe(I)-Fe(II)-H(-)](H)). A concerted mechanism is proposed, where proton transfer in DdH from Glu159 to Glu156 via Ser198 and Glu156 to Cys178 via water460 readily occurred, as well as from Glu282 to Glu279 via Ser319 and Glu279 to Cys299 via water612 in CpI. The theoretical prediction of the proton transfer characteristics is consistent with the assumed biocatalytic mechanism of the [Fe-Fe] hydrogenases in which the proton binds at Fe(d), providing confirmation that has not been explored so far. The computational results were qualitatively validated by the agreement with experimental hydrogen production activity data for mutated CpI enzymes, relative to the wild-type protein. Finally, the insight provided by the simulations, combined, in part, with experimental validation, are important for establishing an approach in future exploration of proton transfer to the active site in this class of enzymes, and possibly also for biomimetic analogs. Published by Elsevier B.V.

Conformation change of tRNA/sub Glu/ in the complex with glutamyl-tRNA synthetase is required for the specific binding of L-glutamate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hara-Yokoyama, M.; Yokoyama, S.; Miyazawa, T.

1986-11-04

The binding of Thermus thermophilus glutamyl-tRNA synthetase (GluRS) with T. thermophilus tRNA/sup Glu/, Escherichia coli tRNA/sup Glu/, and amino acids was studied by fluorescence measurements. In the absence of tRNA/sup Glu/, GluRS binds with D-glutamate as well as L-glutamate. However, in the presence of E.coli tRNA/sup Glu/, GluRS binds specifically with L-glutamate. The KCl effects on the Michaelis constants (K/sub m/) for tRNA/sup Glu/, L-glutamate, and ATP were studied for the aminoacylation of the homologous tRNA/sup Glu/ and heterologous tRNA/sup Glu/ species. As the KCl concentration is raised from 0 to 100 mM, the K/sub m/ value for L-glutamate inmore » the heterologous system is remarkably increased whereas the K/sub m/ value for L-glutamate in the homologous system is only slightly increased. The circular dichroism analyses were made mainly of the bands due to the 2-thiouridine derivatives of tRNA/sup Glu/ in the complex. The conformation change of T. thermophilus tRNA/sup Glu/ upon complex formation with GluRS is not affected by addition of KCl. In contrast, the heterologous tRNA/sup Glu/GluRS complex is in equilibrium of two forms that depends on KCl concentration. The predominant form at low KCl concentration is closely related to the small K/sub m/ value for L-glutamate. In this form of the complex, the conformation of tRNA/sup Glu/ is appreciably different from that of free molecule. Accordingly, such a conformation change of tRNA/sup Glu/ in the complex with GluRS is required for the specific binding of L-glutamate as the substrate.« less

Effects of rhynchophylline on GluN1 and GluN2B expressions in primary cultured hippocampal neurons.

PubMed

He, Yan; Zeng, Sheng-Ya; Zhou, Shi-Wen; Qian, Gui-Sheng; Peng, Kang; Mo, Zhi-Xian; Zhou, Ji-Yin

2014-10-01

N-methyl-d-aspartate (NMDA) receptor subunits GluN1 and GluN2B in hippocampal neurons play key roles in anxiety. Our previous studies show that rhynchophylline, an active component of the Uncaria species, down-regulates GluN2B expression in the hippocampal CA1 area of amphetamine-induced rat. The effects of rhynchophylline on expressions of GluN1 and GluN2B in primary hippocampal neurons in neonatal rats in vitro were investigated. Neonatal hippocampal neurons were cultured with neurobasal-A medium. After incubation for 6h or 48 h with rhynchophylline (non-competitive NMDAR antagonist) and MK-801 (non-competitive NMDAR antagonist with anxiolytic effect, as the control drug) from day 6, neuron toxicity, mRNA and protein expressions of GluN1 and GluN2B were analyzed. GluN1 is mainly distributed on neuronal axons and dendritic trunks, cytoplasm and cell membrane near axons and dendrites. GluN2B is mainly distributed on the membrane, dendrites, and axon membranes. GluN1 and GluN2B are codistributed on dendritic trunks and dendritic spines. After 48 h incubation, a lower concentration of rhynchophylline (lower than 400 μmol/L) and MK-801 (lower than 200 μmol/L) have no toxicity on neonatal hippocampal neurons. Rhynchophylline up-regulated GluN1 mRNA expression at 6h and mRNA and protein expressions at 48h, but down-regulated GluN2B mRNA and protein expressions at 48 h. However, GluN1 and GluN2B mRNA expressions were down-regulated at 6h, and mRNA and protein expressions were both up-regulated by MK-801 at 48h. These findings show that rhynchophylline reciprocally regulates GluN1 and GluN2B expressions in hippocampal neurons, indicating a potential anxiolytic property for rhynchophylline. Copyright © 2014 Elsevier B.V. All rights reserved.

Association of vitamin D and vitamin D binding protein (DBP) gene polymorphism with susceptibility of type 2 diabetes mellitus in Bangladesh.

PubMed

Rahman, Md Mostafijur; Hosen, Md Bayejid; Faruk, Md Omar; Hasan, Md Mehedi; Kabir, Yearul; Howlader, M Zakir Hossain

2017-12-15

Polymorphism in vitamin D binding protein gene may have an impact on serum vitamin D transport and thus may have relation with type 2 diabetes mellitus. In our study, we investigated the association of serum vitamin D level and vitamin D-binding protein gene polymorphism with the onset of type 2 diabetes mellitus. Blood samples were collected from 104 type 2 diabetic patients and 107 healthy volunteers. Serum vitamin D was measured by high-performance liquid chromatography. Genetic analysis of vitamin D-binging protein gene was carried out by polymerase chain reaction - restriction fragment length polymorphism method. We found significantly (p<0.001) lower level of vitamin D in type 2 diabetic patients compared to control subjects. A significantly negative correlation (r=-0.25, p<0.05) between vitamin D level and fasting blood glucose level was found among type 2 diabetic subjects. The Glu/Glu at codon 416 (rs7041) (p<0.05) and Lys/Lys at codon 420 (rs4588) (p<0.01) variants of vitamin D binding protein gene was significantly higher in type 2 diabetic subjects than controls. The patients with Glu/Glu and Lys/Lys genotypes respectively at codon 416 (odds ratio=2.87; 95% confidence interval=1.19 to 6.95) and 420 (odds ratio=8.9; 95% confidence interval=1.89 to 41.99) were at high risk of developing type 2 diabetes. Our present study strongly suggests that there might have an association of vitamin D, and vitamin D-binding protein gene (codon 416 & 420) polymorphisms with the occurrence of type 2 diabetes mellitus. Copyright © 2017 Elsevier B.V. All rights reserved.

High-pressure dielectric studies on 1,6-anhydro-β -D-mannopyranose (plastic crystal) and 2,3,4-tri-O-acetyl-1,6-anhydro-β -D-glucopyranose (canonical glass)

NASA Astrophysics Data System (ADS)

Heczko, Dawid; Kamińska, Ewa; Minecka, Aldona; Dzienia, Andrzej; Jurkiewicz, Karolina; Tarnacka, Magdalena; Talik, Agnieszka; Kamiński, Kamil; Paluch, Marian

2018-05-01

Broadband Dielectric Spectroscopy was applied to investigate molecular dynamics of two anhydrosaccharides, i.e., 1,6-anhydro-β-D-mannopyranose, anhMAN (hydrogen-bonded system) and 2,3,4-tri-O-acetyl-1,6-anhydro-β-D-glucopyranose, ac-anhGLU (van der Waals material), at different thermodynamic conditions. Moreover, the reported data were compared with those recently published for two other H-bonded systems, i.e., 1,6-anhydro-β-D-glucopyranose (anhGLU) and D-glucose (D-GLU). A direct comparison of the dynamical behavior of the materials with a similar chemical structure but significantly differing by the degrees of freedom, complexity, and intermolecular interactions made it possible to probe the impact of compression on the fragility, Temperature-Pressure Superpositioning and pressure coefficient of the glassy crystal/glass transition temperatures (d Tg c/d p ; d Tg/d p ). Moreover, the correlation between d Tg c/d p determined experimentally from the high-pressure dielectric data and the Ehrenfest equation has been tested for the plastic crystals (anhGLU and anhMAN) for the first time. Interestingly, a satisfactory agreement was found between both approaches. It is a quite intriguing finding which can be rationalized by the fact that the studied materials are characterized by the low complexity (lower degrees of freedom with respect to the molecular mobility) as well as ordered internal structure. Therefore, one can speculate that in contrast to the ordinary glasses the dynamics of the plastic crystals might be described with the use of a single order parameter. However, to confirm this thesis further, pressure-volume-temperature (PVT) experiments enabling calculations of the Prigogine Defay ratio are required.

Mechanisms of dopamine D1 receptor-mediated ERK1/2 activation in the parkinsonian striatum and their modulation by metabotropic glutamate receptor type 5.

PubMed

Fieblinger, Tim; Sebastianutto, Irene; Alcacer, Cristina; Bimpisidis, Zisis; Maslava, Natallia; Sandberg, Sabina; Engblom, David; Cenci, M Angela

2014-03-26

In animal models of Parkinson's disease, striatal overactivation of ERK1/2 via dopamine (DA) D1 receptors is the hallmark of a supersensitive molecular response associated with dyskinetic behaviors. Here we investigate the pathways involved in D1 receptor-dependent ERK1/2 activation using acute striatal slices from rodents with unilateral 6-hydroxydopamine (6-OHDA) lesions. Application of the dopamine D1-like receptor agonist SKF38393 induced ERK1/2 phosphorylation and downstream signaling in the DA-denervated but not the intact striatum. This response was mediated through a canonical D1R/PKA/MEK1/2 pathway and independent of ionotropic glutamate receptors but blocked by antagonists of L-type calcium channels. Coapplication of an antagonist of metabotropic glutamate receptor type 5 (mGluR5) or its downstream signaling molecules (PLC, PKC, IP3 receptors) markedly attenuated SKF38393-induced ERK1/2 activation. The role of striatal mGluR5 in D1-dependent ERK1/2 activation was confirmed in vivo in 6-OHDA-lesioned animals treated systemically with SKF38393. In one experiment, local infusion of the mGluR5 antagonist MTEP in the DA-denervated rat striatum attenuated the activation of ERK1/2 signaling by SKF38393. In another experiment, 6-OHDA lesions were applied to transgenic mice with a cell-specific knockdown of mGluR5 in D1 receptor-expressing neurons. These mice showed a blunted striatal ERK1/2 activation in response to SFK38393 treatment. Our results reveal that D1-dependent ERK1/2 activation in the DA-denervated striatum depends on a complex interaction between PKA- and Ca(2+)-dependent signaling pathways that is critically modulated by striatal mGluR5.

Extraction optimization and nanoencapsulation of jujube pulp and seed for enhancing antioxidant activity.

PubMed

Han, Hye Jung; Lee, Ji-Soo; Park, Sun-Ah; Ahn, Jun-Bae; Lee, Hyeon Gyu

2015-06-01

The aim of this study was to optimize extraction conditions for jujube pulp and seed in order to obtain maximum active ingredient yield and antioxidant activity, as well as to prepare chitosan nanoparticles loaded with jujube pulp and seed extracts for enhancing stability. The extraction conditions, i.e. temperature, time, and ethanol concentration, were optimized at the following respective values: 61.2 °C, 38 h, and 60.4% for pulp, and 58 °C, 34 h, and 59.2% for seed. The jujube nanoparticle size significantly increased with a higher chitosan/sodium tripolyphosphate ratio and extract concentration. Entrapment efficiency was greater than 80% regardless of preparation conditions. The stabilities of jujube pulp and seed extract in terms of total phenolic content and antioxidant activity were effectively enhanced by nanoencapsulation. In conclusion, jujube pulp and seed extracts prepared using optimal conditions could be useful as a natural functional food ingredient with antioxidant activity, and nanoencapsulation can be used to improve the stability of jujube extract. Therefore, these results could be used to promote the utilization of not only jujube pulp but also seed, by product. Copyright © 2015 Elsevier B.V. All rights reserved.

Biomimetic extracellular matrix mediated somatic stem cell differentiation: applications in dental pulp tissue regeneration

PubMed Central

Ravindran, Sriram; George, Anne

2015-01-01

Dental caries is one of the most widely prevalent infectious diseases in the world. It affects more than half of the world's population. The current treatment for necrotic dental pulp tissue arising from dental caries is root canal therapy. This treatment results in loss of tooth sensitivity and vitality making it prone for secondary infections. Over the past decade, several tissue-engineering approaches have attempted regeneration of the dental pulp tissue. Although several studies have highlighted the potential of dental stem cells, none have transitioned into a clinical setting owing to limited availability of dental stem cells and the need for growth factor delivery systems. Our strategy is to utilize the intact ECM of pulp cells to drive lineage specific differentiation of bone marrow derived mesenchymal stem cells. From a clinical perspective, pulp ECM scaffolds can be generated using cell lines and patient specific somatic stem cells can be used for regeneration. Our published results have shown the feasibility of using pulp ECM scaffolds for odontogenic differentiation of non-dental mesenchymal cells. This focused review discusses the issues surrounding dental pulp tissue regeneration and the potential of our strategy to overcome these issues. PMID:25954205

Hb Beograd [beta121(GH4)Glu-->Val, GAA-->GTA] in the Turkish population.

PubMed

Atalay, Ayfer; Koyuncu, Hasan; Köseler, Aylin; Ozkan, Anzel; Atalay, Erol O

2007-01-01

Hb Beograd [beta121(GH4)Glu-->Val, GAA-->GTA] is a rare variant first reported in Yugoslavia and then in Turkey, Australia and New Zealand. We report two further unrelated cases from Turkey. The importance of identifying Hb Beograd at the molecular level, especially in regions where Hb D-Los Angeles [beta121(GH4)Glu-->Gln, GAA-->CAA] is prevalent, is emphasized.

A first look at the turnover dynamics of low molecular weight organic carbon in shallow and deep soils of coastal prairie grassland ecosystem.

NASA Astrophysics Data System (ADS)

Mcfarland, J. W.; Lawrence, C. R.; Creamer, C.; Conaway, C. H.; Haw, M.; Waldrop, M. P.

2016-12-01

The functional importance of low molecular weight organic compounds (LMWOC) is in disproportion to their abundance within soil organic carbon (SOC) pools. LMWOC are critical in driving microbial metabolism, though microbial utilization is likely dependent on C chemistry. In this study, we examined the fate of two important, often plant-derived, components of soluble SOC: sugars and carboxylic acids, through an extended soil profile. Our objective was to evaluate the short-term (9 d) and long-term (16 mo) turnover dynamics of LMWOC under varying physical, biological, and chemical conditions through the soil column. Our study area is a coastal prairie near Santa Cruz, CA; soils are classified as fine-loamy, mixed thermic typic Argixerolls. The long-term component of this study was conducted in situ and replicated in the laboratory to quantify the short-term dynamics. We injected 13C-labeled glucose (GLU), 13C-labeled oxalic acid (OA), or deionized water into the A, B (argillic), and B/C (mottled) horizons at depths of 25, 75, and 125 cm, respectively. We sampled soil gas for 13CO2 intensively in the lab and at increasingly graduated intervals in the field. At the conclusion of each experiment, soils were harvested to assess total recovery of 13C in soil pools. Measures of extractable C indicated a significant priming effect in the A horizon, and an increase in microbial biomass C (MBC) in the argillic horizon in response to GLU and OA. In all instances, residence time was lower for GLU than OA and increased with depth for both substrates. In the short-term OA- C was mineralized to a greater degree than GLU- C in the A and argillic horizons, but in the deepest (mottled) soil horizon recovery of OA- C was substantially higher, and likely resulted from enhanced organo-metal complexation. Dissolved Al3+, which forms strong aqueous complexes with OA, may limit the availability of OA at depth compared to shallower soils. Long-term recovery favored GLU- C, which increased with depth. GLU contains no significant functional groups for adsorption to the mineral phase, but immobilization within MBC was comparatively high, which suggests long-term retention of GLU-C is linked to mineral interaction with microbial residues following turnover.

Expression of a novel gene, gluP, is essential for normal Bacillus subtilis cell division and contributes to glucose export

PubMed Central

Mesak, Lili R; Mesak, Felix M; Dahl, Michael K

2004-01-01

Background The Bacillus subtilis glucokinase operon was predicted to be comprised of the genes, yqgP (now named gluP), yqgQ, and glcK. We have previously established a role for glcK in glucose metabolism. In the absence of enzymes that phosphorylate glucose, such as GlcK and/or enzyme IIGlc, accumulated cytoplasmic glucose can be transported out of the cell. Genes within the glucokinase operon were not previously known to play a role in glucose transport. Here we describe the expression of gluP and its function in glucose transport. Results We found that transcription of the glucokinase operon was regulated, putatively, by two promoters: σA and σH. Putative σA and σH-recognition sites were located upstream of and within gluP, respectively. Transcriptional glucokinase operon – lacZ fusions and Northern blotting were used to analyze the expression of gluP. GluP was predicted to be an integral membrane protein. Moreover, the prediction of GluP structure revealed interesting signatures: a rhomboid domain and two tetracopeptide repeat (TPR) motifs. Microscopic analysis showed that GluP minus cells were unable to divide completely, resulting in a filamentous phenotype. The cells were grown in either rich or minimal medium. We found GluP may be involved in glucose transport. [14C]-glucose uptake by the GluP minus strain was slightly less than in the wild type. On the other hand, trehalose-derived glucose in the growth medium of the GluP minus strain was detected in very low amounts. Experimental controls comprised of single or multiple genes mutations within the glucose transporting phosphotransferase system. Conclusions gluP seems to be regulated only by a putative σA-dependent promoter. The glucose uptake and export assays suggest that GluP is important for glucose export and may act as an exporter. This also supports the role of the glucokinase operon in glucose utilization. PMID:15050034

Molecular basis for subtype-specificity and high-affinity zinc inhibition in the GluN1-GluN2A NMDA receptor amino terminal domain

PubMed Central

Romero-Hernandez, Annabel; Simorowski, Noriko; Karakas, Erkan

2016-01-01

Summary Zinc is vastly present in the mammalian brain and controls functions of various cell surface receptors to regulate neurotransmission. A distinctive characteristic of N-methyl-D-aspartate (NMDA) receptors containing a GluN2A subunit is that their ion channel activity is allosterically inhibited by a nano-molar concentration of zinc that binds to an extracellular domain called an amino terminal domain (ATD). Despite physiological importance, the molecular mechanism underlying the high-affinity zinc inhibition has been incomplete due to lack of a GluN2A ATD structure. Here we show the first crystal structures of the heterodimeric GluN1-GluN2A ATD, which provide the complete map of the high-affinity zinc binding site and reveals distinctive features from the ATD of the GluN1-GluN2B subtype. Perturbation of hydrogen bond networks at the hinge of the GluN2A bi-lobe structure affects both zinc inhibition and open probability supporting the general model where the bi-lobe motion in ATD regulates the channel activity in NMDA receptors. PMID:27916457

Production of d-lactic acid from hardwood pulp by mechanical milling followed by simultaneous saccharification and fermentation using metabolically engineered Lactobacillus plantarum.

PubMed

Hama, Shinji; Mizuno, Shino; Kihara, Maki; Tanaka, Tsutomu; Ogino, Chiaki; Noda, Hideo; Kondo, Akihiko

2015-01-01

This study focused on the process development for the d-lactic acid production from cellulosic feedstocks using the Lactobacillus plantarum mutant, genetically modified to produce optically pure d-lactic acid from both glucose and xylose. The simultaneous saccharification and fermentation (SSF) using delignified hardwood pulp (5-15% loads) resulted in the lactic acid titers of 55.2-84.6g/L after 72h and increased productivities of 1.77-2.61g/L/h. To facilitate the enzymatic saccharification of high-load pulp at a fermentation temperature, short-term (⩽10min) pulverization of pulp was conducted, leading to a significantly improved saccharification with the suppressed formation of formic acid by-product. The short-term milling followed by SSF resulted in a lactic acid titer of 102.3g/L, an optical purity of 99.2%, and a yield of 0.879g/g-sugars without fed-batch process control. Therefore, the process presented here shows promise for the production of high-titer d-lactic acid using the L. plantarum mutant. Copyright © 2015 Elsevier Ltd. All rights reserved.

Induction and expression of GluA1 (GluR-A)-independent LTP in the hippocampus

PubMed Central

Romberg, Carola; Raffel, Joel; Martin, Lucy; Sprengel, Rolf; Seeburg, Peter H; Rawlins, J Nicholas P; Bannerman, David M; Paulsen, Ole

2009-01-01

Long-term potentiation (LTP) at hippocampal CA3–CA1 synapses is thought to be mediated, at least in part, by an increase in the postsynaptic surface expression of α-amino-3-hydroxy-5-methyl-4-isoxazole proprionic acid (AMPA) receptors induced by N-methyl-d-aspartate (NMDA) receptor activation. While this process was originally attributed to the regulated synaptic insertion of GluA1 (GluR-A) subunit-containing AMPA receptors, recent evidence suggests that regulated synaptic trafficking of GluA2 subunits might also contribute to one or several phases of potentiation. However, it has so far been difficult to separate these two mechanisms experimentally. Here we used genetically modified mice lacking the GluA1 subunit (Gria1−/− mice) to investigate GluA1-independent mechanisms of LTP at CA3–CA1 synapses in transverse hippocampal slices. An extracellular, paired theta-burst stimulation paradigm induced a robust GluA1-independent form of LTP lacking the early, rapidly decaying component characteristic of LTP in wild-type mice. This GluA1-independent form of LTP was attenuated by inhibitors of neuronal nitric oxide synthase and protein kinase C (PKC), two enzymes known to regulate GluA2 surface expression. Furthermore, the induction of GluA1-independent potentiation required the activation of GluN2B (NR2B) subunit-containing NMDA receptors. Our findings support and extend the evidence that LTP at hippocampal CA3–CA1 synapses comprises a rapidly decaying, GluA1-dependent component and a more sustained, GluA1-independent component, induced and expressed via a separate mechanism involving GluN2B-containing NMDA receptors, neuronal nitric oxide synthase and PKC. PMID:19302150

Cation-Size-Dependent Conformational Locking of Glutamic Acid by Alkali Ions: Infrared Photodissociation Spectroscopy of Cryogenic Ions.

PubMed

Klyne, Johanna; Bouchet, Aude; Ishiuchi, Shun-Ichi; Fujii, Masaaki; Dopfer, Otto

2018-03-01

Consolidated knowledge of conformation and stability of amino acids and their clusters is required to understand their biochemical recognition. Often, alkali ions interact with amino acids and proteins. Herein, infrared photodissociation (IRPD) spectra of cryogenic metalated glutamic acid ions (GluM + , M = Li-Cs) are systematically analyzed in the isomer-specific fingerprint and XH stretch ranges (1100-1900, 2600-3600 cm -1 ) to provide a direct measure for cation-size-dependent conformational locking. GluM + ions are generated by electrospray ionization and cooled down to 15 K in a cryogenic quadrupole ion trap. The assignment of the IRPD spectra is supported by density functional theory calculations at the dispersion-corrected B3LYP-D3/aug-cc-pVTZ level. In the global minimum of GluM + , the flexibility of Glu is strongly reduced by the formation of rigid ionic CO···M + ···OC metal bridges, corresponding to charge solvation. The M + binding energy decreases monotonically with increasing cation size from D 0 = 314 to 119 kJ/mol for Li-Cs. Whereas for Li and Na only the global minimum of GluM + is observed, for K-Cs at least three isomers exist at cryogenic temperature. The IRPD spectra of cold GluM + ions are compared to IR multiple-photon dissociation spectra measured at room temperature. Furthermore, we elucidate the differences of the impact of protonation and metalation on the structure and conformational locking of Glu.

Structural basis of subunit selectivity for competitive NMDA receptor antagonists with preference for GluN2A over GluN2B subunits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lind, Genevieve E.; Mou, Tung-Chung; Tamborini, Lucia

NMDA-type glutamate receptors are ligand-gated ion channels that contribute to excitatory neurotransmission in the central nervous system (CNS). Most NMDA receptors comprise two glycine-binding GluN1 and two glutamate-binding GluN2 subunits (GluN2A–D). We describe highly potent (S)-5-[(R)-2-amino-2-carboxyethyl]-4,5-dihydro-1H-pyrazole-3-carboxylic acid (ACEPC) competitive GluN2 antagonists, of which ST3 has a binding affinity of 52 nM at GluN1/2A and 782 nM at GluN1/2B receptors. This 15-fold preference of ST3 for GluN1/2A over GluN1/2B is improved compared with NVP-AAM077, a widely used GluN2A-selective antagonist, which we show has 11-fold preference for GluN1/2A over GluN1/2B. Crystal structures of the GluN1/2A agonist binding domain (ABD) heterodimer with boundmore » ACEPC antagonists reveal a binding mode in which the ligands occupy a cavity that extends toward the subunit interface between GluN1 and GluN2A ABDs. Mutational analyses show that the GluN2A preference of ST3 is primarily mediated by four nonconserved residues that are not directly contacting the ligand, but positioned within 12 Å of the glutamate binding site. Two of these residues influence the cavity occupied by ST3 in a manner that results in favorable binding to GluN2A, but occludes binding to GluN2B. Thus, we reveal opportunities for the design of subunit-selective competitive NMDA receptor antagonists by identifying a cavity for ligand binding in which variations exist between GluN2A and GluN2B subunits. This structural insight suggests that subunit selectivity of glutamate-site antagonists can be mediated by mechanisms in addition to direct contributions of contact residues to binding affinity.« less

Structural basis of subunit selectivity for competitive NMDA receptor antagonists with preference for GluN2A over GluN2B subunits

PubMed Central

Lind, Genevieve E.; Mou, Tung-Chung; Tamborini, Lucia; Pomper, Martin G.; De Micheli, Carlo; Conti, Paola; Pinto, Andrea

2017-01-01

NMDA-type glutamate receptors are ligand-gated ion channels that contribute to excitatory neurotransmission in the central nervous system (CNS). Most NMDA receptors comprise two glycine-binding GluN1 and two glutamate-binding GluN2 subunits (GluN2A–D). We describe highly potent (S)-5-[(R)-2-amino-2-carboxyethyl]-4,5-dihydro-1H-pyrazole-3-carboxylic acid (ACEPC) competitive GluN2 antagonists, of which ST3 has a binding affinity of 52 nM at GluN1/2A and 782 nM at GluN1/2B receptors. This 15-fold preference of ST3 for GluN1/2A over GluN1/2B is improved compared with NVP-AAM077, a widely used GluN2A-selective antagonist, which we show has 11-fold preference for GluN1/2A over GluN1/2B. Crystal structures of the GluN1/2A agonist binding domain (ABD) heterodimer with bound ACEPC antagonists reveal a binding mode in which the ligands occupy a cavity that extends toward the subunit interface between GluN1 and GluN2A ABDs. Mutational analyses show that the GluN2A preference of ST3 is primarily mediated by four nonconserved residues that are not directly contacting the ligand, but positioned within 12 Å of the glutamate binding site. Two of these residues influence the cavity occupied by ST3 in a manner that results in favorable binding to GluN2A, but occludes binding to GluN2B. Thus, we reveal opportunities for the design of subunit-selective competitive NMDA receptor antagonists by identifying a cavity for ligand binding in which variations exist between GluN2A and GluN2B subunits. This structural insight suggests that subunit selectivity of glutamate-site antagonists can be mediated by mechanisms in addition to direct contributions of contact residues to binding affinity. PMID:28760974

Regenerative endodontics--Creating new horizons.

PubMed

Dhillon, Harnoor; Kaushik, Mamta; Sharma, Roshni

2016-05-01

Trauma to the dental pulp, physical or microbiologic, can lead to inflammation of the pulp followed by necrosis. The current treatment modality for such cases is non-surgical root canal treatment. The damaged tissue is extirpated and the root canal system prepared. It is then obturated with an inert material such a gutta percha. In spite of advances in techniques and materials, 10%-15% of the cases may end in failure of treatment. Regenerative endodontics combines principles of endodontics, cell biology, and tissue engineering to provide an ideal treatment for inflamed and necrotic pulp. It utilizes mesenchymal stem cells, growth factors, and organ tissue culture to provide treatment. Potential treatment modalities include induction of blood clot for pulp revascularization, scaffold aided regeneration, and pulp implantation. Although in its infancy, successful treatment of damaged pulp tissue has been performed using principles of regenerative endodontics. This field is dynamic and exciting with the ability to shape the future of endodontics. This article highlights the fundamental concepts, protocol for treatment, and possible avenues for research in regenerative endodontics. © 2015 Wiley Periodicals, Inc.

Short-term sleep deprivation impairs spatial working memory and modulates expression levels of ionotropic glutamate receptor subunits in hippocampus.

PubMed

Xie, Meilan; Yan, Jie; He, Chao; Yang, Li; Tan, Gang; Li, Chao; Hu, Zhian; Wang, Jiali

2015-06-01

Hippocampus-dependent learning memory is sensitive to sleep deprivation (SD). Although the ionotropic glutamate receptors play a vital role in synaptic plasticity and learning and memory, however, whether the expression of these receptor subunits is modulated by sleep loss remains unclear. In the present study, western blotting was performed by probing with specific antibodies against the ionotropic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunits GluA1, GluA2, GluA3, and against the N-methyl-d-aspartate (NMDA) glutamate receptor subunits GluN1, GluN2A, GluN2B. In hippocampus, down regulation of surface GluA1 and GluN2A surface expression were observed in both SD groups. However, surface expression level of GluA2, GluA3, GluN1 and GluN2B was significantly up-regulated in 8h-SD rats when compared to the 4h-SD rats. In parallel with the complex changes in AMPA and NMDA receptor subunit expressions, we found the 8h-SD impaired rat spatial working memory in 30-s-delay T-maze task, whereas no impairment of spatial learning was observed in 4h-SD rats. These results indicate that sleep loss alters the relative expression levels of the AMPA and NMDA receptors, thus affects the synaptic strength and capacity for plasticity and partially contributes to spatial memory impairment. Copyright © 2015. Published by Elsevier B.V.

Anions mediate ligand binding in Adineta vaga glutamate receptor ion channels

PubMed Central

Lomash, Suvendu; Chittori, Sagar; Brown, Patrick; Mayer, Mark L.

2014-01-01

SUMMARY AvGluR1, a glutamate receptor ion channel from the primitive eukaryote Adineta vaga, is activated by alanine, cysteine, methionine and phenylalanine which produce lectin-sensitive desensitizing responses like those to glutamate, aspartate and serine. AvGluR1 LBD crystal structures reveal a novel scheme for binding dissimilar ligands that may be utilized by distantly related odorant/chemosensory receptors. Arginine residues in domain 2 coordinate the γ-carboxyl group of glutamate, while in the alanine, methionine and serine complexes a chloride ion acts as a surrogate ligand, replacing the γ-carboxyl group. Removal of Cl− lowers affinity for these ligands, but not for glutamate, aspartate or for phenylalanine which occludes the anion binding site and binds with low affinity. AvGluR1 LBD crystal structures and sedimentation analysis also provide insights into the evolutionary link between prokaryotic and eukaryotic iGluRs and reveal features unique to both classes, emphasizing the need for additional structure based studies on iGluR-ligand interactions. PMID:23434404

Comparison of non-volatile umami components in chicken soup and chicken enzymatic hydrolysate.

PubMed

Kong, Yan; Yang, Xiao; Ding, Qi; Zhang, Yu-Yu; Sun, Bao-Guo; Chen, Hai-Tao; Sun, Ying

2017-12-01

Umami taste is an important part to the taste of chicken. To isolate and identify non-volatile umami compounds, fractions from chicken soup and hydrolysate were prepared and analyzed. Amino acids were analyzed by amino acid analyzer. Organic acids and nucleotides were determined by ultra-performance liquid chromatography. Separation procedures utilizing ultrafiltration, Sephadex G-15 and reversed-phase high-performance liquid chromatography were used to isolate umami taste peptides. Combined with sensory evaluation and LC-Q-TOF-MS, the amino acid sequences of 12 oligopeptides were determined. The amount of taste compounds was higher in chicken enzymatic hydrolysate than that of chicken soup. Eight oligopeptides from chicken enzymatic hydrolysate were identified, including Ala-Asp, Ala-Met, His-Ser, Val-Glu, Ala-Glu, Asp-Ala-Gly, Glu-Asp and Ala-Glu-Ala. Four oligopeptides from chicken soup were identified, including Val-Thr, Ala-His, Ala-Phe and Thr-Glu. Copyright © 2017 Elsevier Ltd. All rights reserved.

Selective and interactive effects of D2 receptor antagonism and positive allosteric mGluR4 modulation on waiting impulsivity.

PubMed

Isherwood, Sarah N; Robbins, Trevor W; Nicholson, Janet R; Dalley, Jeffrey W; Pekcec, Anton

2017-09-01

Metabotropic glutamate receptor 4 (mGluR4) and dopamine D 2 receptors are specifically expressed within the indirect pathway neurons of the striato-pallidal-subthalamic pathway. This unique expression profile suggests that mGluR4 and D 2 receptors may play a cooperative role in the regulation and inhibitory control of behaviour. We investigated this possibility by testing the effects of a functionally-characterised positive allosteric mGluR4 modulator, 4-((E)-styryl)-pyrimidin-2-ylamine (Cpd11), both alone and in combination with the D 2 receptor antagonist eticlopride, on two distinct forms of impulsivity. Rats were trained on the five-choice serial reaction time task (5-CSRTT) of sustained visual attention and segregated according to low, mid, and high levels of motor impulsivity (LI, MI and HI, respectively), with unscreened rats used as an additional control group. A separate group of rats was trained on a delay discounting task (DDT) to assess choice impulsivity. Systemic administration of Cpd11 dose-dependently increased motor impulsivity and impaired attentional accuracy on the 5-CSRTT in all groups tested. Eticlopride selectively attenuated the increase in impulsivity induced by Cpd11, but not the accompanying attentional impairment, at doses that had no significant effect on behavioural performance when administered alone. Cpd11 also decreased choice impulsivity on the DDT (i.e. increased preference for the large, delayed reward) and decreased locomotor activity. These findings demonstrate that mGluR4s, in conjunction with D 2 receptors, affect motor- and choice-based measures of impulsivity, and therefore may be novel targets to modulate impulsive behaviour associated with a number of neuropsychiatric syndromes. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Usefulness of simultaneous and sequential monitoring of glucose level and electrocardiogram in monkeys treated with gatifloxacin under conscious and nonrestricted conditions.

PubMed

Yoshimatsu, Yu; Ishizaka, Tomomichi; Chiba, Katsuyoshi; Mori, Kazuhiko

2018-05-10

Drug-induced cardiac electrophysiological abnormalities accompanied by hypoglycemia or hyperglycemia increase the risk for life-threatening arrhythmia. To assess the drug-induced cardiotoxic potential associated with extraordinary blood glucose (GLU) levels, the effect of gatifloxacin (GFLX) which was frequently associated with GLU abnormality and QT/QTc prolongations in the clinic on blood GLU and electrocardiogram (ECG) parameters was investigated in cynomolgus monkeys (n=4) given GFLX orally in an ascending dose regimen (10, 30, 60 and 100 mg/kg). Simultaneous and sequential GLU and ECG monitoring with a continuous GLU monitoring system and Holter ECG, respectively, were conducted for 24 h under free-moving conditions. Consequently, GFLX at 30 and 60 mg/kg dose-dependently induced a transient decrease in GLU without any ECG abnormality 2-4 h postdose. Highest dose of 100 mg/kg caused severe hypoglycemia with a mean GLU of <30 mg/dL, accompanied by remarkable QT/QTc prolongations by 20-30% in all animals. In contrast, hyperglycemia without QT/QTc prolongations was noted 24 h after dosing in one animal. A close correlation between GLU and QTc values was observed in animals treated with 100 mg/kg, suggesting that GFLX-induced hypoglycemia enhanced QT/QTc prolongations. Furthermore, the 24-h sequential GLU monitoring data clearly distinguished between GFLX-induced GLU abnormality and physiological GLU changes influenced by feeding throughout the day. In conclusion, the combined assessment of continuous GLU and ECG monitoring is valuable in predicting the drug-induced cardio-electrophysiological risk associated with both GLU and ECG abnormalities.

X-ray structure, symmetry and mechanism of an AMPA-subtype glutamate receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sobolevsky, Alexander I.; Rosconi, Michael P.; Gouaux, Eric

2010-02-02

Ionotropic glutamate receptors mediate most excitatory neurotransmission in the central nervous system and function by opening a transmembrane ion channel upon binding of glutamate. Despite their crucial role in neurobiology, the architecture and atomic structure of an intact ionotropic glutamate receptor are unknown. Here we report the crystal structure of the {alpha}-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA)-sensitive, homotetrameric, rat GluA2 receptor at 3.6 {angstrom} resolution in complex with a competitive antagonist. The receptor harbours an overall axis of two-fold symmetry with the extracellular domains organized as pairs of local dimers and with the ion channel domain exhibiting four-fold symmetry. A symmetry mismatchmore » between the extracellular and ion channel domains is mediated by two pairs of conformationally distinct subunits, A/C and B/D. Therefore, the stereochemical manner in which the A/C subunits are coupled to the ion channel gate is different from the B/D subunits. Guided by the GluA2 structure and site-directed cysteine mutagenesis, we suggest that GluN1 and GluN2A NMDA (N-methyl-D-aspartate) receptors have a similar architecture, with subunits arranged in a 1-2-1-2 pattern. We exploit the GluA2 structure to develop mechanisms of ion channel activation, desensitization and inhibition by non-competitive antagonists and pore blockers.« less

tRNAGlu Increases the Affinity of Glutamyl-tRNA Synthetase for Its Inhibitor Glutamyl-Sulfamoyl-Adenosine, an Analogue of the Aminoacylation Reaction Intermediate Glutamyl-AMP: Mechanistic and Evolutionary Implications

PubMed Central

Blais, Sébastien P.; Kornblatt, Jack A.; Barbeau, Xavier; Bonnaure, Guillaume; Lagüe, Patrick; Chênevert, Robert; Lapointe, Jacques

2015-01-01

For tRNA-dependent protein biosynthesis, amino acids are first activated by aminoacyl-tRNA synthetases (aaRSs) yielding the reaction intermediates aminoacyl-AMP (aa-AMP). Stable analogues of aa-AMP, such as aminoacyl-sulfamoyl-adenosines, inhibit their cognate aaRSs. Glutamyl-sulfamoyl-adenosine (Glu-AMS) is the best known inhibitor of Escherichia coli glutamyl-tRNA synthetase (GluRS). Thermodynamic parameters of the interactions between Glu-AMS and E. coli GluRS were measured in the presence and in the absence of tRNA by isothermal titration microcalorimetry. A significant entropic contribution for the interactions between Glu-AMS and GluRS in the absence of tRNA or in the presence of the cognate tRNAGlu or of the non-cognate tRNAPhe is indicated by the negative values of –TΔSb, and by the negative value of ΔCp. On the other hand, the large negative enthalpy is the dominant contribution to ΔGb in the absence of tRNA. The affinity of GluRS for Glu-AMS is not altered in the presence of the non-cognate tRNAPhe, but the dissociation constant K d is decreased 50-fold in the presence of tRNAGlu; this result is consistent with molecular dynamics results indicating the presence of an H-bond between Glu-AMS and the 3’-OH oxygen of the 3’-terminal ribose of tRNAGlu in the Glu-AMS•GluRS•tRNAGlu complex. Glu-AMS being a very close structural analogue of Glu-AMP, its weak binding to free GluRS suggests that the unstable Glu-AMP reaction intermediate binds weakly to GluRS; these results could explain why all the known GluRSs evolved to activate glutamate only in the presence of tRNAGlu, the coupling of glutamate activation to its transfer to tRNA preventing unproductive cleavage of ATP. PMID:25860020

Duodenal supply of glutamate and casein both improve intestinal starch digestion in cattle but by apparently different mechanisms.

PubMed

Brake, D W; Titgemeyer, E C; Anderson, D E

2014-09-01

Greater postruminal flows of protein increase small intestinal starch digestion in cattle. Our objective was to determine if small intestinal starch digestion is increased by duodenal supplementation of AA. We fed 5 duodenally and ileally cannulated steers a low-starch soybean hull-based diet in 5 × 5 Latin square designs and provided continuous duodenal infusion of raw cornstarch in combination with AA or casein and measured small intestinal starch digestion. In Exp. 1 treatments were continuous duodenal infusion of 1) no supplement (control), 2) casein (400 g/d), 3) crystalline AA similar in amount and AA composition to the casein (CASAA), 4) crystalline nonessential AA similar to those provided by casein, or 5) crystalline essential AA similar to those provided by casein. In Exp. 2 treatments were continuous duodenal infusion of 1) no supplement (control), 2) casein (400 g/d), 3) Glu (133 g/d), 4) Phe and Trp plus Met (30.4, 6.5, and 17.5 g/d, respectively; PTM), or 5) a combination of Glu and PTM. Duodenal infusion of casein increased (P ≤ 0.05) small intestinal starch digestion. When CASAA was infused, small intestinal starch digestion was similar (P = 0.30) to casein infusion. Infusion of only nonessential AA tended to increase (P = 0.14) small intestinal starch digestion relative to the control, but infusion of essential AA alone did not affect (P = 0.84) small intestinal starch digestion. In addition, infusion of casein or CASAA increased ileal flows of ethanol-soluble starch (small-chain α-glycosides), but nonessential AA alone were not different than the control. Duodenal infusion of Glu increased (P ≤ 0.05) small intestinal starch digestion, whereas PTM did not. Neither Glu nor PTM increased ileal flow of ethanol-soluble starch, but Glu and PTM provided together tended (P = 0.07) to increase ileal flows of small chain α-glycosides. Our data suggest that Glu alone can increase small intestinal starch digestion in cattle similar to casein, but increases in small intestinal starch digestion in response to Glu are not associated with an increase in ileal flows of small chain α-glycosides.

Metabotropic glutamate receptor-mediated use-dependent down-regulation of synaptic excitability involves the fragile X mental retardation protein.

PubMed

Repicky, Sarah; Broadie, Kendal

2009-02-01

Loss of the mRNA-binding protein FMRP results in the most common inherited form of both mental retardation and autism spectrum disorders: fragile X syndrome (FXS). The leading FXS hypothesis proposes that metabotropic glutamate receptor (mGluR) signaling at the synapse controls FMRP function in the regulation of local protein translation to modulate synaptic transmission strength. In this study, we use the Drosophila FXS disease model to test the relationship between Drosophila FMRP (dFMRP) and the sole Drosophila mGluR (dmGluRA) in regulation of synaptic function, using two-electrode voltage-clamp recording at the glutamatergic neuromuscular junction (NMJ). Null dmGluRA mutants show minimal changes in basal synapse properties but pronounced defects during sustained high-frequency stimulation (HFS). The double null dfmr1;dmGluRA mutant shows repression of enhanced augmentation and delayed onset of premature long-term facilitation (LTF) and strongly reduces grossly elevated post-tetanic potentiation (PTP) phenotypes present in dmGluRA-null animals. Null dfmr1 mutants show features of synaptic hyperexcitability, including multiple transmission events in response to a single stimulus and cyclic modulation of transmission amplitude during prolonged HFS. The double null dfmr1;dmGluRA mutant shows amelioration of these defects but does not fully restore wildtype properties in dfmr1-null animals. These data suggest that dmGluRA functions in a negative feedback loop in which excess glutamate released during high-frequency transmission binds the glutamate receptor to dampen synaptic excitability, and dFMRP functions to suppress the translation of proteins regulating this synaptic excitability. Removal of the translational regulator partially compensates for loss of the receptor and, similarly, loss of the receptor weakly compensates for loss of the translational regulator.

Low-protein diet supplemented with keto acids is associated with suppression of small-solute peritoneal transport rate in peritoneal dialysis patients.

PubMed

Jiang, Na; Qian, Jiaqi; Lin, Aiwu; Fang, Wei; Zhang, Weiming; Cao, Liou; Wang, Qin; Ni, Zhaohui; Yao, Qiang

2011-01-01

Objective. We investigate whether low-protein diet would show benefits in suppressing peritoneal transport rate in peritoneal dialysis (PD) patients. Methods. This is a supplemented analysis of our previously published trial, which randomized 60 PD patients to receive low- (LP: dietary protein intake of 0.6-0.8 g/kg/d), keto-acid-supplemented low- (sLP: 0.6-0.8 g/kg/d with 0.12 g/kg/d of keto acids), or high- (HP: 1.0-1.2 g/kg/d) protein diet and lasted for one year. In this study, the variations of peritoneal transport rate were assessed. Results. While baseline D/P(cr) (dialysate-to-plasma concentration ratio for creatinine at 4 hour) and D/D0(glu) (dialysate glucose at 4 hour to baseline dialysate glucose concentration ratio) were similar, D/P(cr) in group sLP was lower, and D/D0(glu) was higher than those in the other two groups (P < 0.05) at 12th month. D/D0(glu) increased (P < 0.05), and D/P(cr) tended to decrease, (P = 0.071) in group sLP. Conclusions. Low-protein diet with keto acids may benefit PD patients by maintaining peritoneum at a lower transport rate.

Separate Intramolecular Targets for Protein Kinase A Control N-Methyl-d-aspartate Receptor Gating and Ca2+ Permeability*

PubMed Central

Aman, Teresa K.; Maki, Bruce A.; Ruffino, Thomas J.; Kasperek, Eileen M.; Popescu, Gabriela K.

2014-01-01

Protein kinase A (PKA) enhances synaptic plasticity in the central nervous system by increasing NMDA receptor current amplitude and Ca2+ flux in an isoform-dependent yet poorly understood manner. PKA phosphorylates multiple residues on GluN1, GluN2A, and GluN2B subunits in vivo, but the functional significance of this multiplicity is unknown. We examined gating and permeation properties of recombinant NMDA receptor isoforms and of receptors with altered C-terminal domain (CTDs) prior to and after pharmacological inhibition of PKA. We found that PKA inhibition decreased GluN1/GluN2B but not GluN1/GluN2A gating; this effect was due to slower rates for receptor activation and resensitization and was mediated exclusively by the GluN2B CTD. In contrast, PKA inhibition reduced NMDA receptor-relative Ca2+ permeability (PCa/PNa) regardless of the GluN2 isoform and required the GluN1 CTD; this effect was due primarily to decreased unitary Ca2+ conductance, because neither Na+ conductance nor Ca2+-dependent block was altered substantially. Finally, we show that both the gating and permeation effects can be reproduced by changing the phosphorylation state of a single residue: GluN2B Ser-1166 and GluN1 Ser-897, respectively. We conclude that PKA effects on NMDA receptor gating and Ca2+ permeability rely on distinct phosphorylation sites located on the CTD of GluN2B and GluN1 subunits. This separate control of NMDA receptor properties by PKA may account for the specific effects of PKA on plasticity during synaptic development and may lead to drugs targeted to alter NMDA receptor gating or Ca2+ permeability. PMID:24847051

High Methotrexate Triglutamate Level Is an Independent Predictor of Adverse Effects in Asian Indian Rheumatoid Arthritis Patients-A Preliminary Study.

PubMed

Sandhu, Amit; Dhir, Varun; Bhatnagar, Archana; Dhawan, Veena; Kaur, Jasbinder; Sood, Ankita; Naidu, Shankar; Ahmad, Shabeer; Varma, Neelam; Sharma, Aman; Sharma, Shefali

2017-04-01

It is unclear whether erythrocyte methotrexate polyglutamate levels (MTX-glun) are associated with response or adverse effects to methotrexate in rheumatoid arthritis. This preliminary study evaluated their utility in Asian Indian patients over 24 weeks. Rheumatoid arthritis patients were started on oral methotrexate at a dose of 15 mg/wk, which was escalated to 25 mg by 12 weeks and continued till 24 weeks. Erythrocyte (RBC) MTX-glu1 to MTX-glu5 levels (nmol/L RBC) were determined at 4, 8, 16, and 24 weeks by using reverse-phase high-performance liquid chromatography. Area under the concentration curve (AUC) of MTX-glu1-5, MTX-glu3-5, and MTX-glu3 levels was compared between groups with regards to response and adverse effects. This study included 117 patients with mean (SD) age of 42.7 (±11.9) years and disease duration of 2.0 (1.7) years. Mean (SD) RBC MTX-glu1-5 levels at 4, 8, 16, and 24 weeks were 93 (±29), 129 (±46), 143 (±49), and 159 (±65) nmol/L RBC; the highest individual polyglutamate was MTX-glu3 (40%). There was significant correlation between MTX-glu1-5 (r = 0.38, P < 0.001) and MTX-glu3 (r = 0.49, P < 0.001) with methotrexate dose. There was no significant difference of AUC MTX-glun between responders and nonresponders. However, AUC MTX-glu3 was significantly (P = 0.03) higher in patients with adverse effects. On logistic regression, AUC of MTX-glu3 [odds ratio = 1.004 (95% confidence interval 1.002-1.007)] and methotrexate dose at 24 weeks were independent predictors of adverse effects. In this preliminary study, higher levels of RBC MTX-glu3 were found to be the independent predictors for adverse effects in rheumatoid arthritis patients.

Glutamate promotes neural stem cell proliferation by increasing the expression of vascular endothelial growth factor of astrocytes in vitro.

PubMed

Liu, C X; Xu, X; Chen, X L; Yang, P B; Zhang, J S; Liu, Y

2015-09-20

The high levels of glutamate might involve in neurogenesis after brain injuries. However, the mechanisms are not fully understood. In this study, we investigated the effect of glutamate on the proliferation of rat embryonic neural stem/progenitor cells (NSCs) through regulating the vascular endothelial growth factor (VEGF) expression of astrocytes (ASTs) in vitro, and the cyclin D1 expression of NSCs. The results showed that glutamate promoted the expression and secretion of VEGF of rat astrocytes by activating group I mGluRs. Astrocyte conditioned medium-containing Glu [ACM (30%)] promoted the proliferation of embryonic NSCs compared with normal astrocyte conditioned medium+Glu [N-ACM (30%)+Glu (30 μM)] by increasing cell activity, diameter of neurospheres, bromodeoxyuridine (BrdU) incorporation and cell division; while ACM+VEGF neutralizing antibody [ACM (30%)+VEGF NAb (15 μg/ml)] significantly inhibited the proliferation of embryonic NSCs compared with ACM (30%). ACM (30%) increased the expressions of cyclin D1 and decreased cell death compared with N-ACM (30%)+Glu (30 μM). ACM (30%)+VEGF NAb (15 μg/ml) decreased the expressions of cyclin D1 and increased cell death compared with ACM (30%). These results demonstrated that glutamate could also indirectly promote the proliferation of rat embryonic NSCs through inducing the VEGF expression of ASTs in vitro, and VEGF may increase the expression of cyclin D1. These finding suggest that glutamate may be a major molecule for regulating embryonic NSC proliferation and facilitate neural repair in the process of NSC transplants after brain injuries.

Disruption of GluA2 phosphorylation potentiates stress responsivity.

PubMed

Ellis, Alexandra S; Fosnocht, Anne Q; Lucerne, Kelsey E; Briand, Lisa A

2017-08-30

Cocaine addiction is characterized by persistent craving and addicts frequently relapse even after long periods of abstinence. Exposure to stress can precipitate relapse in humans and rodents. Stress and drug use can lead to common alterations in synaptic plasticity and these commonalities may contribute to the ability of stress to elicit relapse. These common changes in synaptic plasticity are mediated, in part, by alterations in the trafficking and stabilization of AMPA receptors. Exposure to both cocaine and stress can lead to alterations in protein kinase C-mediated phosphorylation of GluA2 AMPA subunits and thus alter the trafficking of GluA2-containing AMPARs. However, it is not clear what role AMPAR trafficking plays in the interactions between stress and cocaine. The current study utilized a mouse with a point mutation within the GluA2 subunit c-terminus resulting in a disruption of PKC-mediated GluA2 phosphorylation to examine stress responsivity. Although no differences were seen in the response to a forced swim stress in naïve mice, GluA2 K882A knock-in mice exhibited an increased stress response following cocaine self-administration. Furthermore, we demonstrated that disrupting GluA2 phosphorylation increases vulnerability to stress-induced reinstatement of both cocaine seeking and cocaine-conditioned reward. Finally, GluA2 K882A knock-in mice exhibit an increased vulnerability to social defeat as indicated by increased social avoidance. Taken together these results indicate that disrupting GluA2 phosphorylation leads to increased responsivity to acute stress following cocaine exposure and increased vulnerability to chronic stress. These results highlight the GluA2 phosphorylation site as a novel target for the stress-related disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

Separate Ionotropic and Metabotropic Glutamate Receptor Functions in Depotentiation vs. LTP: A Distinct Role for Group1 mGluR Subtypes and NMDARs

PubMed Central

Latif-Hernandez, Amira; Faldini, Enrico; Ahmed, Tariq; Balschun, Detlef

2016-01-01

Depotentiation (DP) is a mechanism by which synapses that have recently undergone long-term potentiation (LTP) can reverse their synaptic strengthening within a short time-window after LTP induction. Group 1 metabotropic glutamate receptors (mGluRs) were shown to be involved in different forms of LTP and long-term depression (LTD), but little is known about their roles in DP. Here, we generated DP by applying low-frequency stimulation (LFS) at 5 Hz after LTP had been induced by a single train of theta-burst-stimulation (TBS). While application of LFS for 2 min (DP2′) generated only a short-lasting DP that was independent of the activation of N-methyl-D-aspartate receptors (NMDARs) and group 1 mGluRs, LFS given for 8 min (DP8′) induced a robust DP that was maintained for at least 2 h. This strong form of DP was contingent on NMDAR activation. Interestingly, DP8′ appears to include a metabotropic NMDAR function because it was blocked by the competitive NMDAR antagonist D-AP5 but not by the use-dependent inhibitor MK-801 or high Mg2+. Furthermore, DP8′ was enhanced by application of the mGluR1 antagonist (YM 298198, 1 μM). The mGluR5 antagonist 2-Methyl-6(phenylethynyl) pyridine (MPEP, 40 μM), in contrast, failed to affect it. The induction of LTP, in turn, was NMDAR dependent (as tested with D-AP5), and blocked by MPEP but not by YM 298198. These results indicate a functional dissociation of mGluR1 and mGluR5 in two related and consecutively induced types of NMDAR-dependent synaptic plasticity (LTP → DP) with far-reaching consequences for their role in plasticity and learning under normal and pathological conditions. PMID:27872582

Separate Ionotropic and Metabotropic Glutamate Receptor Functions in Depotentiation vs. LTP: A Distinct Role for Group1 mGluR Subtypes and NMDARs.

PubMed

Latif-Hernandez, Amira; Faldini, Enrico; Ahmed, Tariq; Balschun, Detlef

2016-01-01

Depotentiation (DP) is a mechanism by which synapses that have recently undergone long-term potentiation (LTP) can reverse their synaptic strengthening within a short time-window after LTP induction. Group 1 metabotropic glutamate receptors (mGluRs) were shown to be involved in different forms of LTP and long-term depression (LTD), but little is known about their roles in DP. Here, we generated DP by applying low-frequency stimulation (LFS) at 5 Hz after LTP had been induced by a single train of theta-burst-stimulation (TBS). While application of LFS for 2 min (DP2') generated only a short-lasting DP that was independent of the activation of N -methyl-D-aspartate receptors (NMDARs) and group 1 mGluRs, LFS given for 8 min (DP8') induced a robust DP that was maintained for at least 2 h. This strong form of DP was contingent on NMDAR activation. Interestingly, DP8' appears to include a metabotropic NMDAR function because it was blocked by the competitive NMDAR antagonist D-AP5 but not by the use-dependent inhibitor MK-801 or high Mg 2+ . Furthermore, DP8' was enhanced by application of the mGluR1 antagonist (YM 298198, 1 μM). The mGluR5 antagonist 2-Methyl-6(phenylethynyl) pyridine (MPEP, 40 μM), in contrast, failed to affect it. The induction of LTP, in turn, was NMDAR dependent (as tested with D-AP5), and blocked by MPEP but not by YM 298198. These results indicate a functional dissociation of mGluR1 and mGluR5 in two related and consecutively induced types of NMDAR-dependent synaptic plasticity (LTP → DP) with far-reaching consequences for their role in plasticity and learning under normal and pathological conditions.

Psychostimulant drug effects on glutamate, Glx, and creatine in the anterior cingulate cortex and subjective response in healthy humans.

PubMed

White, Tara L; Monnig, Mollie A; Walsh, Edward G; Nitenson, Adam Z; Harris, Ashley D; Cohen, Ronald A; Porges, Eric C; Woods, Adam J; Lamb, Damon G; Boyd, Chelsea A; Fekir, Sinda

2018-06-01

Prescription psychostimulants produce rapid changes in mood, energy, and attention. These drugs are widely used and abused. However, their effects in human neocortex on glutamate and glutamine (pooled as Glx), and key neurometabolites such as N-acetylaspartate (tNAA), creatine (tCr), choline (Cho), and myo-inositol (Ins) are poorly understood. Changes in these compounds could inform the mechanism of action of psychostimulant drugs and their abuse potential in humans. We investigated the acute impact of two FDA-approved psychostimulant drugs on neurometabolites using magnetic resonance spectroscopy ( 1 H MRS). Single clinically relevant doses of d-amphetamine (AMP, 20 mg oral), methamphetamine (MA, 20 mg oral; Desoxyn®), or placebo were administered to healthy participants (n = 26) on three separate test days in a placebo-controlled, double-blinded, within-subjects crossover design. Each participant experienced all three conditions and thus served as his/her own control. 1 H MRS was conducted in the dorsal anterior cingulate cortex (dACC), an integrative neocortical hub, during the peak period of drug responses (140-150 m post ingestion). D-amphetamine increased the level of Glu (p = .0001), Glx (p = .003), and tCr (p = .0067) in the dACC. Methamphetamine increased Glu in females, producing a significant crossover interaction pattern with gender (p = .02). Drug effects on Glu, tCr, and Glx were positively correlated with subjective drug responses, predicting both the duration of AMP liking (Glu: r = +.49, p = .02; tCr: r = +.41, p = .047) and the magnitude of peak drug high to MA (Glu: r = +.52, p = .016; Glx: r = +.42, p = .049). Neither drug affected the levels of tNAA, Cho, or Ins after correction for multiple comparisons. We conclude that d-amphetamine increased the concentration of glutamate, Glx, and tCr in the dACC in male and female volunteers 2 1 / 2 hours after drug consumption. There was evidence that methamphetamine differentially affects dACC Glu levels in women and men. These findings provide the first experimental evidence that specific psychostimulants increase the level of glutamatergic compounds in the human brain, and that glutamatergic changes predict the extent and magnitude of subjective responses to psychostimulants.

Effects of dimethylaminoethanol pyroglutamate (DMAE p-Glu) against memory deficits induced by scopolamine: evidence from preclinical and clinical studies.

PubMed

Blin, Olivier; Audebert, Christine; Pitel, Séverine; Kaladjian, Arthur; Casse-Perrot, Catherine; Zaim, Mohammed; Micallef, Joelle; Tisne-Versailles, Jacky; Sokoloff, Pierre; Chopin, Philippe; Marien, Marc

2009-12-01

Dimethylaminoethanol pyroglutamate (DMAE p-Glu) is a compound resulting from the reaction between dimethylaminoethanol (an indirect precursor of acetylcholine) and pyroglutamic acid (a cyclic derivative of glutamic acid having procholinergic properties and promnesic effects in both animals and man). The present study undertook preclinical and clinical evaluations to test a potential therapeutic utility for DMAE p-Glu in cognitive impairments related to central cholinergic deficit. In preclinical study, DMAE p-Glu was studied in rats by intracerebral microdialysis in conscious freely moving animals, on performance of rats in the Morris water maze test of spatial memory, and on the deficit in passive avoidance behavior induced by scopolamine. The clinical study examined the effect of DMAE p-Glu on cognitive deficits induced by an intravenous injection of scopolamine in healthy young male subjects. In rat experiments, DMAE p-Glu increased the extracellular levels of choline and acetylcholine in the medial prefrontal cortex, as assessed by intracerebral microdialysis, improved performance in a test of spatial memory, and reduced scopolamine-induced memory deficit in passive avoidance behavior. Clinical study results show that scopolamine induced a memory deficit and that DMAE p-Glu produced a significant positive effect on scores in the Buschke test, as well as a slight but significant difference on choice reaction time. These results indicate that DMAE p-Glu reduces the deleterious effect of scopolamine on long-term memory in healthy volunteers and suggest that DMAE p-Glu might be effective in reducing memory deficits in patients with cognitive impairment.

Recycling agroindustrial waste by lactic fermentations: coffee pulp silage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carrizales, V.; Ferrer, J.

1985-04-03

This UNIDO publication on lactic acid fermentation of coffee pulp for feed production covers (1) a process which can be adapted to existing coffee processing plants for drying the product once harvesting time has finished (2) unit operations involved: pressing (optional), silaging, liming and drying (3) experiments, results and discussion, bibliography, process statistics, and diagrams. Additional references: storage, biotechnology, lime, agricultural wastes, recycling, waste utilization.

Malaria vaccine research.

PubMed

Ballou, W R; Diggs, C L; Landry, S; Hall, B F

1994-12-16

In our report "Activation of Raf as a result of recruitment to the plasma membrane" (3 June, p. 1463) (1), panels E and F of figure 1 on page 1464 were incorrect. The correct photographs appear below. In addition, the [See figure in the PDF file] second sentence of the legend to figure 1 should have read, "The Raf constructs were tagged at the COOH-terminus with a Glu-Glu epitope (MEYMPME) (24) for c-Raf, or at the NH(2)-terminus with both the Glu-Glu and the Myc (MEQKLISEEDL) (23) epitopes for RafCAAX"; the next-to-the-last sentence of the legend to figure 1 should have read, "The c-Raf constructs in (A through D) are Glu-Glu-tagged and were detected by using an anti Glu-Glu antibody, and the RafCAAX and Raf6QCAAX constructs used in E and F were detected by using the antibody to Raf COOH-terminal peptide"; and the third sentence of note 26 should have read, "After blocking with 5% milk in phosphate-buffered saline (M-PBS), cells were incubated with a mouse monoclonal antibody to Glu-Glu or a rabbit polyclonal antibody to a 20-amino acid COOH-terminal peptide of Raf-1 (Santa Cruz Biotechnology, Santa Cruz, California), washed, and incubated with donkey antibodies to mouse or rabbit IgG combined with Texas Red (Jackson) in M-PBS, washed, and mounted in FITC-Guard (Testog)."

Presynaptic establishment of the synaptic cleft extracellular matrix is required for post-synaptic differentiation

PubMed Central

Rohrbough, Jeffrey; Rushton, Emma; Woodruff, Elvin; Fergestad, Tim; Vigneswaran, Krishanthan; Broadie, Kendal

2007-01-01

Formation and regulation of excitatory glutamatergic synapses is essential for shaping neural circuits throughout development. In a Drosophila genetic screen for synaptogenesis mutants, we identified mind the gap (mtg), which encodes a secreted, extracellular N-glycosaminoglycan-binding protein. MTG is expressed neuronally and detected in the synaptic cleft, and is required to form the specialized transsynaptic matrix that links the presynaptic active zone with the post-synaptic glutamate receptor (GluR) domain. Null mtg embryonic mutant synapses exhibit greatly reduced GluR function, and a corresponding loss of localized GluR domains. All known post-synaptic signaling/scaffold proteins functioning upstream of GluR localization are also grossly reduced or mislocalized in mtg mutants, including the dPix–dPak–Dock cascade and the Dlg/PSD-95 scaffold. Ubiquitous or neuronally targeted mtg RNA interference (RNAi) similarly reduce post-synaptic assembly, whereas post-synaptically targeted RNAi has no effect, indicating that presynaptic MTG induces and maintains the post-synaptic pathways driving GluR domain formation. These findings suggest that MTG is secreted from the presynaptic terminal to shape the extracellular synaptic cleft domain, and that the cleft domain functions to mediate transsynaptic signals required for post-synaptic development. PMID:17901219

A conserved carboxylic acid group mediates light-dependent proton uptake and signaling by rhodopsin.

PubMed

Arnis, S; Fahmy, K; Hofmann, K P; Sakmar, T P

1994-09-30

A carboxylic acid residue is conserved at the cytoplasmic border of the third transmembrane segment among nearly all G protein-coupled receptors. In the visual receptor rhodopsin, replacement of the conserved Glu134 by a neutral glutamine results in enhanced transducin activation. Here we show that a key event in forming the active state of rhodopsin is proton uptake by Glu134 in the metarhodopsin II (MII) photoproduct. Site-directed mutants E134D and E134Q were studied by flash photolysis, where formation rates of their photoproducts and rates of pH change could be monitored simultaneously. Both mutants showed normal MII formation rates. However, E134D displayed a slowed rate of proton uptake and E134Q displayed a loss of light-induced uptake of two protons from the aqueous phase. Thus, Glu134 mediates light-dependent proton uptake by MII. We propose that receptor activation requires a light-induced conformational change that allows protonation of Glu134 and subsequent protonation of a second group. The strong conservation of Glu134 in G protein-coupled receptors implies a general requirement for a proton acceptor group at this position to allow light- or ligand-dependent receptor activation.

Regeneration of dental pulp by stem cells.

PubMed

Nakashima, M; Iohara, K

2011-07-01

Angiogenesis/vasculogenesis and neurogenesis are essential for pulp regeneration. Two subfractions of side-population (SP) cells, CD31(-)/CD146(-) SP cells and CD105(+) cells with angiogenic and neurogenic potential, were isolated by flow cytometry from canine dental pulp. In an experimental model of mouse hindlimb ischemia, transplantation of these cell populations resulted in an increase in blood flow, including high-density capillary formation. In a model of rat cerebral ischemia, stem cell transplantations enhanced neuronal regeneration and recovery from motor disability. Autologous transplantation of the CD31(-)/CD146(-) SP cells into an in vivo model of amputated pulp resulted in complete regeneration of pulp tissue with vascular and neuronal processes within 14 days. The transplanted cells expressed pro-angiogenic factors, implying trophic action on endothelial cells. Autologous transplantation of CD31(-)/CD146(-) SP cells or CD105(+) cells with stromal-cell-derived factor-1 (SDF-1) into root canals after whole pulp removal of mature teeth resulted in complete regeneration of pulp replete with nerves and vasculature by day 14, followed by dentin formation along the dentinal wall by day 35. Therefore, the potential utility of fractionated SP cells and CD105(+) cells in angiogenesis and neurogenesis was demonstrated by treatment of limb and cerebral ischemia following pulpotomy and pulpectomy.

A Reaction Path Study of the Catalysis and Inhibition of the Bacillus anthracis CapD gamma-Glutamyl Transpeptidase

DTIC Science & Technology

2014-10-21

lases.11,30,31 The first bound structure of CapD [Protein Data Bank ( PDB ) entry 3G9K] was determined with a di-α-L-Glu ligand.29 The di-α-L-Glu ligand...Article dx.doi.org/10.1021/bi500623c | Biochemistry 2014, 53, 6954−69676956 into the CapD structure ( PDB entry 3G9K29) identified two principal...in capsule anchoring and remodeling makes the enzyme a promising target for anthrax medical countermeasures. Although the structure of CapD is known

Responses of shortfin eel (Anguilla australis) exposed in situ to pulp and paper effluent.

PubMed

van den Heuvel, Michael R; Landman, Michael J; Tremblay, Louis A

2006-10-01

The responses of shortfin eel (Anguilla australis) to discharges from two pulp and paper mills, municipal wastewater, and a geothermal power plant wastewater were examined. Eels were caged at 3 sites along the Tarawera River, North Island, New Zealand, to explore effects of a 3-wk exposure down a contamination gradient (Ref --> D1 --> D2). Most of the observed effects were seen in eels caged at the furthest downstream site (D2), below all the discharge areas. General hematology in eels was unaffected, as measures did not differ markedly at the two downstream sites compared with the reference site. At D2, eels were significantly lighter per unit length (reduced condition factor), although liver and spleen size (LSI and SSI) were unaffected. Significantly elevated circulating sex steroid concentrations (testosterone and estradiol) were measured in D2 eels and increasing sex steroid levels at both sites downstream of the reference site were observed. Significant ethoxyresorufin O-deethylase (EROD) activity induction was seen in D2 eels and bile chemistry showed significant accumulation of pyrene and retene equivalents. However, significantly greater concentrations of total resin acids were found in the bile of eels from the intermediate site (D1), between the two pulp and paper mills. The higher polycyclic aromatic hydrocarbon (PAH) equivalents found in the bile of D2 eels suggest that resin acid neutrals, particularly retene, are responsible for some of the effects observed in eels at the furthest downstream exposure site. Levels of pulp and paper mill extractives in sediment, including the PAH retene, support this conclusion.

Fractionating spatial memory with glutamate receptor subunit-knockout mice.

PubMed

Bannerman, David M

2009-12-01

In recent years, the contribution that different glutamate receptor subtypes and subunits make to spatial learning and memory has been studied extensively using genetically modified mice in which key proteins are knocked out. This has revealed dissociations between different aspects of spatial memory that were not previously apparent from lesion studies. For example, studies with GluA1 AMPAR [AMPA (alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid) receptor] subunit-knockout mice have revealed the presence of a GluA1-dependent, non-associative short-term memory mechanism that is important for performance on spatial working memory tasks, and a GluA1-independent, long-term associative memory mechanism which underlies performance on spatial reference memory tasks. Within this framework we have also studied the contributions of different GluN2-containing NMDARs [NMDA (N-methyl-D-aspartate) receptors] to spatial memory. Studies with GluN2 NMDAR mutants have revealed different contributions from GluN2A- and GluN2B-containing NMDARs to spatial learning. Furthermore, comparison of forebrain- and hippocampus-specific GluN2B-knockout mice has demonstrated that both hippocampal and extra-hippocampal NMDARs make important contributions to spatial memory performance.

Clean Air Act Section 112(d)(6) Technology Review for Pulping and Papermaking Processes Memorandum

EPA Pesticide Factsheets

The purpose of this November 2011 document is to present the results of a review of available information on developments in practices, processes, and control technologies that apply to pulping and papermaking processes.

Solid-state, triboelectrostatic and dissolution characteristics of spray-dried piroxicam-glucosamine solid dispersions.

PubMed

Adebisi, Adeola O; Kaialy, Waseem; Hussain, Tariq; Al-Hamidi, Hiba; Nokhodchi, Ali; Conway, Barbara R; Asare-Addo, Kofi

2016-10-01

This work explores the use of both spray drying and d-glucosamine HCl (GLU) as a hydrophilic carrier to improve the dissolution rate of piroxicam (PXM) whilst investigating the electrostatic charges associated with the spray drying process. Spray dried PXM:GLU solid dispersions were prepared and characterised (XRPD, DSC, SEM). Dissolution and triboelectric charging were also conducted. The results showed that the spray dried PXM alone, without GLU produced some PXM form II (DSC results) with no enhancement in solubility relative to that of the parent PXM. XRPD results also showed the spray drying process to decrease the crystallinity of GLU and solid dispersions produced. The presence of GLU improved the dissolution rate of PXM. Spray dried PXM: GLU at a ratio of 2:1 had the most improved dissolution. The spray drying process generally yielded PXM-GLU spherical particles of around 2.5μm which may have contributed to the improved dissolution. PXM showed a higher tendency for charging in comparison to the carrier GLU (-3.8 versus 0.5nC/g for untreated material and -7.5 versus 3.1nC/g for spray dried materials). Spray dried PXM and spray dried GLU demonstrated higher charge densities than untreated PXM and untreated GLU, respectively. Regardless of PXM:GLU ratio, all spray dried PXM:GLU solid dispersions showed a negligible charge density (net-CMR: 0.1-0.3nC/g). Spray drying of PXM:GLU solid dispersions can be used to produce formulation powders with practically no charge and thereby improving handling as well as dissolution behaviour of PXM. Copyright © 2016 Elsevier B.V. All rights reserved.

Evolution of Enzymatic Activities int he Enolase Superfamily: L-Talarate/Galactarate Dehydratase from Salmonella typhimurium LT2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yew,W.; Fedorov, A.; Fedorov, E.

2007-01-01

We assigned L-talarate dehydratase (TalrD) and galactarate dehydratase (GalrD) functions to a group of orthologous proteins in the mechanistically diverse enolase superfamily, focusing our characterization on the protein encoded by the Salmonella typhimurium LT2 genome (GI:16766982; STM3697). Like the homologous mandelate racemase, L-fuconate dehydratase, and D-tartrate dehydratase, the active site of TalrD/GalrD contains a general acid/base Lys 197 at the end of the second {beta}-strand in the ({beta}/{alpha}){sub 7}{beta}-barrel domain, Asp 226, Glu 252, and Glu 278 as ligands for the essential Mg{sup 2+} at the ends of the third, fourth, and fifth {sup {beta}}-strands, a general acid/base His 328-Aspmore » 301 dyad at the ends of the seventh and sixth {beta}-strands, and an electrophilic Glu 348 at the end of the eighth {beta}-strand. We discovered the function of STM3697 by screening a library of acid sugars; it catalyzes the efficient dehydration of both L-talarate (k{sub cat} = 2.1 s{sup -1}, k{sub cat}/K{sub m} = 9.1 x 10{sup 3} M{sup -1} s{sup -1}) and galactarate (k{sub cat} = 3.5 s{sup -1}, k{sub cat}/K{sub m} = 1.1 x 10{sup 4} M{sup -1} s{sup -1}). Because L-talarate is a previously unknown metabolite, we demonstrated that S. typhimurium LT2 can utilize L-talarate as carbon source. Insertional disruption of the gene encoding STM3697 abolishes this phenotype; this disruption also diminishes, but does not eliminate, the ability of the organism to utilize galactarate as carbon source. The dehydration of L-talarate is accompanied by competing epimerization to galactarate; little epimerization to L-talarate is observed in the dehydration of galactarate. On the basis of (1) structures of the wild type enzyme complexed with L-lyxarohydroxamate, an analogue of the enolate intermediate, and of the K197A mutant complexed with L-glucarate, a substrate for exchange of the {alpha}-proton, and (2) incorporation of solvent deuterium into galactarate in competition with dehydration, we conclude that Lys 197 functions as the galactarate-specific base and His 328 functions as the L-talarate-specific base. The epimerization of L-talarate to galactarate that competes with dehydration can be rationalized by partitioning of the enolate intermediate between dehydration (departure of the 3-OH group catalyzed by the conjugate acid of His 328) and epimerization (protonation on C2 by the conjugate acid of Lys 197). The promiscuous catalytic activities discovered for STM3697 highlight the evolutionary potential of a 'conserved' active site architecture.« less

Computationally Discovered Potentiating Role of Glycans on NMDA Receptors

NASA Astrophysics Data System (ADS)

Sinitskiy, Anton V.; Stanley, Nathaniel H.; Hackos, David H.; Hanson, Jesse E.; Sellers, Benjamin D.; Pande, Vijay S.

2017-04-01

N-methyl-D-aspartate receptors (NMDARs) are glycoproteins in the brain central to learning and memory. The effects of glycosylation on the structure and dynamics of NMDARs are largely unknown. In this work, we use extensive molecular dynamics simulations of GluN1 and GluN2B ligand binding domains (LBDs) of NMDARs to investigate these effects. Our simulations predict that intra-domain interactions involving the glycan attached to residue GluN1-N440 stabilize closed-clamshell conformations of the GluN1 LBD. The glycan on GluN2B-N688 shows a similar, though weaker, effect. Based on these results, and assuming the transferability of the results of LBD simulations to the full receptor, we predict that glycans at GluN1-N440 might play a potentiator role in NMDARs. To validate this prediction, we perform electrophysiological analysis of full-length NMDARs with a glycosylation-preventing GluN1-N440Q mutation, and demonstrate an increase in the glycine EC50 value. Overall, our results suggest an intramolecular potentiating role of glycans on NMDA receptors.

d-Aspartate oxidase influences glutamatergic system homeostasis in mammalian brain.

PubMed

Cristino, Luigia; Luongo, Livio; Squillace, Marta; Paolone, Giovanna; Mango, Dalila; Piccinin, Sonia; Zianni, Elisa; Imperatore, Roberta; Iannotta, Monica; Longo, Francesco; Errico, Francesco; Vescovi, Angelo Luigi; Morari, Michele; Maione, Sabatino; Gardoni, Fabrizio; Nisticò, Robert; Usiello, Alessandro

2015-05-01

We have investigated the relevance of d-aspartate oxidase, the only enzyme known to selectively degrade d-aspartate (d-Asp), in modulating glutamatergic system homeostasis. Interestingly, the lack of the Ddo gene, by raising d-Asp content, induces a substantial increase in extracellular glutamate (Glu) levels in Ddo-mutant brains. Consistent with an exaggerated and persistent N-methyl-d-aspartate receptor (NMDAR) stimulation, we documented in Ddo knockouts severe age-dependent structural and functional alterations mirrored by expression of active caspases 3 and 7 along with appearance of dystrophic microglia and reactive astrocytes. In addition, prolonged elevation of d-Asp triggered in mutants alterations of NMDAR-dependent synaptic plasticity associated to reduction of hippocampal GluN1 and GluN2B subunits selectively located at synaptic sites and to increase in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-to-N-methyl-d-aspartate ratio. These effects, all of which converged on a progressive hyporesponsiveness at NMDAR sites, functionally resulted in a greater vulnerability to phencyclidine-induced prepulse inhibition deficits in mutants. In conclusion, our results indicate that d-aspartate oxidase, by strictly regulating d-Asp levels, impacts on the homeostasis of glutamatergic system, thus preventing accelerated neurodegenerative processes. Copyright © 2015 Elsevier Inc. All rights reserved.

Interaction between the mu-agonist dermorphin and the delta-agonist [D-Ala2, Glu4]deltorphin in supraspinal antinociception and delta-opioid receptor binding.

PubMed Central

Negri, L.; Improta, G.; Lattanzi, R.; Potenza, R. L.; Luchetti, F.; Melchiorri, P.

1995-01-01

1. In rats, the interaction between the mu-opioid agonist dermorphin and the delta-opioid agonist [D-Ala2, Glu4]deltorphin was studied in binding experiments to delta-opioid receptors and in the antinociceptive test to radiant heat. 2. When injected i.c.v., doses of [D-Ala2, Glu4]deltorphin higher than 20 nmol produced antinociception in the rat tail-flick test to radiant heat. Lower doses were inactive. None of the doses tested elicited the maximum achievable response. This partial antinociception was accomplished with an in vivo occupancy of more than 97% of brain delta-opioid receptors and of 17% of mu-opioid receptors. Naloxone (0.1 mg kg-1, s.c.), and naloxonazine (10 mg kg-1, i.v., 24 h before), but not the selective delta-opioid antagonist naltrindole, antagonized the antinociception. 3. In vitro competitive inhibition studies in rat brain membranes showed that [D-Ala2, Glu4]deltorphin displaced [3H]-naltrindole from two delta-binding sites of high and low affinity. The addition of 100 microM Gpp[NH]p produced a three fold increase in the [D-Ala2, Glu4]deltorphin Ki value for both binding sites. The addition of 10 nM dermorphin increased the Ki value of the delta-agonist for the high affinity site five times. When Gpp[NH]p was added to the incubation medium together with 10 nM dermorphin, the high affinity Ki of the delta-agonist increased 15 times. 4. Co-administration into the rat brain ventricles of subanalgesic doses of dermorphin and [D-Ala2, Glu4]deltorphin resulted in synergistic antinociceptive responses. 5. Pretreatment with naloxone or with the non-equilibrium mu-antagonists naloxonazine and beta-funaltrexamine completely abolished the antinociceptive response of the mu-delta agonist combinations. 6. Pretreatment with the delta-opioid antagonists naltrindole and DALCE reduced the antinociceptive response of the dermorphin-[D-Ala2, Glu4]deltorphin combinations to a value near that observed after the mu-agonist alone. At the dosage used, naltrindole occupied more than 98% of brain delta-opioid receptors without affecting mu-opioid-receptors. 7. These data suggest that in the rat tail-flick test to radiant heat, mu- and delta-opioid agonists co-operate positively in evoking an antinociceptive response. Although interactions between different opioid pathways cannot be excluded, in vitro binding results indicate that this co-operative antinociception is probably mediated by co-activation of the delta-opioid receptors at the cellular level by the mu- and delta-agonist. PMID:8680727

DYRK1A-mediated phosphorylation of GluN2A at Ser(1048) regulates the surface expression and channel activity of GluN1/GluN2A receptors.

PubMed

Grau, Cristina; Arató, Krisztina; Fernández-Fernández, José M; Valderrama, Aitana; Sindreu, Carlos; Fillat, Cristina; Ferrer, Isidre; de la Luna, Susana; Altafaj, Xavier

2014-01-01

N-methyl-D-aspartate glutamate receptors (NMDARs) play a pivotal role in neural development and synaptic plasticity, as well as in neurological disease. Since NMDARs exert their function at the cell surface, their density in the plasma membrane is finely tuned by a plethora of molecules that regulate their production, trafficking, docking and internalization in response to external stimuli. In addition to transcriptional regulation, the density of NMDARs is also influenced by post-translational mechanisms like phosphorylation, a modification that also affects their biophysical properties. We previously described the increased surface expression of GluN1/GluN2A receptors in transgenic mice overexpressing the Dual specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A), suggesting that DYRK1A regulates NMDARs. Here we have further investigated whether the density and activity of NMDARs were modulated by DYRK1A phosphorylation. Accordingly, we show that endogenous DYRK1A is recruited to GluN2A-containing NMDARs in the adult mouse brain, and we identify a DYRK1A phosphorylation site at Ser(1048) of GluN2A, within its intracellular C-terminal domain. Mechanistically, the DYRK1A-dependent phosphorylation of GluN2A at Ser(1048) hinders the internalization of GluN1/GluN2A, causing an increase of surface GluN1/GluN2A in heterologous systems, as well as in primary cortical neurons. Furthermore, GluN2A phosphorylation at Ser(1048) increases the current density and potentiates the gating of GluN1/GluN2A receptors. We conclude that DYRK1A is a direct regulator of NMDA receptors and we propose a novel mechanism for the control of NMDAR activity in neurons.

DYRK1A-mediated phosphorylation of GluN2A at Ser1048 regulates the surface expression and channel activity of GluN1/GluN2A receptors

PubMed Central

Grau, Cristina; Arató, Krisztina; Fernández-Fernández, José M.; Valderrama, Aitana; Sindreu, Carlos; Fillat, Cristina; Ferrer, Isidre; de la Luna, Susana; Altafaj, Xavier

2014-01-01

N-methyl-D-aspartate glutamate receptors (NMDARs) play a pivotal role in neural development and synaptic plasticity, as well as in neurological disease. Since NMDARs exert their function at the cell surface, their density in the plasma membrane is finely tuned by a plethora of molecules that regulate their production, trafficking, docking and internalization in response to external stimuli. In addition to transcriptional regulation, the density of NMDARs is also influenced by post-translational mechanisms like phosphorylation, a modification that also affects their biophysical properties. We previously described the increased surface expression of GluN1/GluN2A receptors in transgenic mice overexpressing the Dual specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A), suggesting that DYRK1A regulates NMDARs. Here we have further investigated whether the density and activity of NMDARs were modulated by DYRK1A phosphorylation. Accordingly, we show that endogenous DYRK1A is recruited to GluN2A-containing NMDARs in the adult mouse brain, and we identify a DYRK1A phosphorylation site at Ser1048 of GluN2A, within its intracellular C-terminal domain. Mechanistically, the DYRK1A-dependent phosphorylation of GluN2A at Ser1048 hinders the internalization of GluN1/GluN2A, causing an increase of surface GluN1/GluN2A in heterologous systems, as well as in primary cortical neurons. Furthermore, GluN2A phosphorylation at Ser1048 increases the current density and potentiates the gating of GluN1/GluN2A receptors. We conclude that DYRK1A is a direct regulator of NMDA receptors and we propose a novel mechanism for the control of NMDAR activity in neurons. PMID:25368549

DNA methylcytosine dioxygenase ten-eleven translocation 2 enhances lipopolysaccharide-induced cytokine expression in human dental pulp cells by regulating MyD88 hydroxymethylation.

PubMed

Wang, Xinxuan; Feng, Zhihui; Li, Qimeng; Yi, Baicheng; Xu, Qiong

2018-04-13

Dental pulp inflammation is a bacterially driven inflammation process characterized by the local accumulation of cytokines/chemokines that participate in destructive processes in the pulp. Multiple mechanisms are involved in dental pulp inflammation, including epigenetic events, such as DNA methylation/demethylation. Ten-eleven translocation 2 (TET2) is a recently discovered DNA methylcytosine dioxygenase that plays important roles in inflammatory disease. However, its role in the inflammatory response of dental pulp is unknown. We observed elevated mRNA and protein levels of TET2 after lipopolysaccharide (LPS) stimulation in human dental pulp cells (hDPCs). To identify the effects of TET2 on cytokine expression, TET2 was knocked down and cytokines were detected using a cytokine antibody array after LPS stimulation. The protein expression of GM-CSF, IL-6, IL-8 and RANTES decreased in the LPS-induced hDPCs following TET2 knockdown. The downregulated expression levels of IL-6 and IL-8 were further confirmed by real-time quantitative polymerase chain reaction (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA). Additionally, the phosphorylation levels of IKK-α/β, p65 and IκBα of the NF-κB signaling pathway were decreased in the TET2-silenced group. Furthermore, the global 5-hydroxymethylcytosine (5hmC) level was significantly decreased and the genomic 5-methylcytosine (5mC) level was increased in the TET2-deficient hDPCs; TET2 depletion resulted in a decrease in the 5hmC level of the MyD88 promoter following LPS stimulation. These findings indicate that TET2 knockdown inhibits LPS-induced inflammatory response in hDPCs by downregulating MyD88 hydroxymethylation. Thus, TET2-dependent DNA demethylation might play an important role in dental pulp inflammation as an epigenetic regulator.

The diagnosis and conservative treatment of a complex type 3 dens invaginatus using cone beam computed tomography (CBCT) and 3D plastic models.

PubMed

Kfir, A; Telishevsky-Strauss, Y; Leitner, A; Metzger, Z

2013-03-01

To investigate the use of 3D plastic models, printed from cone beam computed tomography (CBCT) data, for accurate diagnosis and conservative treatment of a complex case of dens invaginatus. A chronic apical abscess with a draining sinus tract was diagnosed during the treatment planning stage of orthodontic therapy. Radiographic examination revealed a large radiolucent area associated with an invaginated right maxillary central incisor, which was found to contain a vital pulp. The affected tooth was strategic in the dental arch. Conventional periapical radiographs provided only partial information about the invagination and its relationship with the main root canal and with the periapical tissues. A limited-volume CBCT scan of the maxilla did not show evidence of communication between the infected invagination and the pulp in the main root canal, which could explain the pulp vitality. A novel method was adopted to allow for instrumentation, disinfection and filling of the invagination, without compromising the vitality of the pulp in the complex root canal system. The CBCT data were used to produce precise 3D plastic models of the tooth. These models facilitated the treatment planning process and the trial of treatment approaches. This approach allowed the vitality of the pulp to be maintained in the complex root canal space of the main root canal whilst enabling the healing of the periapical tissues. Even when extensive periapical pathosis is associated with a tooth with type III dens invaginatus, pulp sensibility tests should be performed. CBCT is a diagnostic tool that may allow for the management of such teeth with complex anatomy. 3D printed plastic models may be a valuable aid in the process of assessing and planning effective treatment modalities and practicing them ex vivo before actually performing the clinical procedure. Unconventional technological approaches may be required for detailed treatment planning of complex cases of dens invaginatus. © 2012 International Endodontic Journal. Published by Blackwell Publishing Ltd.

Oxidative stability of pork emulsion containing tomato products and pink guava pulp during refrigerated aerobic storage.

PubMed

Joseph, Serlene; Chatli, Manish K; Biswas, Ashim K; Sahoo, Jhari

2014-11-01

Lipid oxidation-induced quality problems can be minimized with the use of natural antioxidants. Antioxidant potential of tomato puree (10 %; T-1), tomato pulp (12.5 %; T-2), lyophilized tomato peel (6 %; T-3), and pink guava pulp (10 %; T-4) was evaluated in raw pork emulsion during refrigerated storage for 9 days under aerobic packaging. The lycopene and β-carotene content varied in pork emulsion as T-3 > T-1 > T-2 > T-4 and decreased (P < 0.05) during storage. The surface redness (a* value) increased (P < 0.05) with the incorporation of tomato products and pink guava pulp. Furthermore, metmyoglobin formation and lipid oxidation were lower (P < 0.05) in tomato- and guava-treated emulsions than in control. Overall, incorporation of tomato products and pink guava pulp improved the visual colour and odour scores of raw pork emulsion. These results indicated that tomato products and guava pulp can be utilized as sources of natural antioxidants in raw pork products to minimize lipid oxidation, off-odour development, and surface discolouration.

Characterization of active paper packaging incorporated with ginger pulp oleoresin

NASA Astrophysics Data System (ADS)

Wiastuti, T.; Khasanah, L. U.; Atmaka Kawiji, W.; Manuhara, G. J.; Utami, R.

2016-02-01

Utilization of ginger pulp waste from herbal medicine and instant drinks industry in Indonesia currently used for fertilizer and fuel, whereas the ginger pulp still contains high oleoresin. Active paper packaging were developed incorporated with ginger pulp oleoresin (0%, 2%, 4%, and 6% w/w). Physical (thickness, tensile strength, and folding endurance, moisture content), sensory characteristics and antimicrobial activity of the active paper were evaluated. Selected active paper then were chemically characterized (functional groups). The additional of ginger pulp oleoresin levels are reduced tensile strength, folding endurance and sensory characteristic (color, texture and overall) and increased antimicrobial activity. Due to physical, sensory characteristic and antimicrobial activity, active paper with 2% ginger pulp oleoresin incorporation was selected. Characteristics of selected paper were 9.93% of water content; 0.81 mm of thickness; 0.54 N / mm of tensile strength; 0.30 of folding endurance; 8.43 mm inhibits the growth of Pseudomonas fluorescence and 27.86 mm inhibits the growth of Aspergillus niger (antimicrobial activity) and neutral preference response for sensory properties. For chemical characteristic, selected paper had OH functional group of ginger in 3422.83 cm-1 of wave number and indicated contain red ginger active compounds.

Performance deficits of mGluR8 knockout mice in learning tasks: the effects of null mutation and the background genotype.

PubMed

Gerlai, R; Adams, B; Fitch, T; Chaney, S; Baez, M

2002-08-01

mGluR8 is a G-protein coupled metabotropic glutamate receptor expressed in the mammalian brain. Members of the mGluR family have been shown to be modulators of neural plasticity and learning and memory. Here we analyze the consequences of a null mutation at the mGluR8 gene locus generated using homologous recombination in embryonic stem cells by comparing the learning performance of the mutants with that of wild type controls in the Morris water maze (MWM) and the context and cue dependent fear conditioning (CFC). Our results revealed robust performance deficits associated with the genetic background, the ICR outbred strain, in both mGluR8 null mutant and the wild type control mice. Mice of this strain origin suffered from impaired vision as compared to CD1 or C57BL/6 mice, a significant impediment in MWM, a visuo-spatial learning task. The CFC task, being less dependent on visual cues, allowed us to reveal subtle performance deficits in the mGluR8 mutants: novelty induced hyperactivity and temporally delayed and blunted responding to shocks and temporally delayed responding to contextual stimuli were detected. The role of mGluR8 as a presynaptic autoreceptor and its contribution to cognitive processes are hypothesized and the utility of gene targeting as compared to pharmacological methods is discussed.

Alkaline peroxide treatment of ECF bleached softwood kraft pulps. Part 1. characterizing the effect of alkaline peroxide treatment on carboxyl groups of fibers

Treesearch

Zheng Dang; Thomas Elder; Arthur J. Ragauskas

2007-01-01

The influence of alkaline peroxide treatment has been characterized on elementally chlorine-free (ECF) bleached softwood (SW) kraft pulp. The results indicate that fiber charge increased with an increase in peroxide charge: a maximum fiber charge increment of 16.6% was obtained with 8.0% more peroxide charge on oven-dried (0.d.) pulp at 60.0°C. Two primary bleaching...

Pulp and paper demand deteriorates as global economic crisis takes hold : markets for paper, paperboard and woodpulp, 2008-2009

Treesearch

Peter J. Ince; Eduard L. Akim; Bernard Lombard; Tomas Parik

2009-01-01

Pulp and paper production and consumption in both Europe and North America declined in 2008 and 2009 as the global economic crisis took hold. In early 2009, leading trade associations were reporting year-over-year declines of 17% in total paper and paperboard production in both Europe and the United States, considerably more than the 2008 drop. Capacity-utilization...

Low-Protein Diet Supplemented with Keto Acids Is Associated with Suppression of Small-Solute Peritoneal Transport Rate in Peritoneal Dialysis Patients

PubMed Central

Jiang, Na; Qian, Jiaqi; Lin, Aiwu; Fang, Wei; Zhang, Weiming; Cao, Liou; Wang, Qin; Ni, Zhaohui; Yao, Qiang

2011-01-01

Objective. We investigate whether low-protein diet would show benefits in suppressing peritoneal transport rate in peritoneal dialysis (PD) patients. Methods. This is a supplemented analysis of our previously published trial, which randomized 60 PD patients to receive low- (LP: dietary protein intake of 0.6–0.8 g/kg/d), keto-acid-supplemented low- (sLP: 0.6–0.8 g/kg/d with 0.12 g/kg/d of keto acids), or high- (HP: 1.0–1.2 g/kg/d) protein diet and lasted for one year. In this study, the variations of peritoneal transport rate were assessed. Results. While baseline D/Pcr (dialysate-to-plasma concentration ratio for creatinine at 4 hour) and D/D0glu (dialysate glucose at 4 hour to baseline dialysate glucose concentration ratio) were similar, D/Pcr in group sLP was lower, and D/D0glu was higher than those in the other two groups (P < 0.05) at 12th month. D/D0glu increased (P < 0.05), and D/Pcr tended to decrease, (P = 0.071) in group sLP. Conclusions. Low-protein diet with keto acids may benefit PD patients by maintaining peritoneum at a lower transport rate. PMID:21747999

Aggregation and network formation in self-assembly of protein (H3.1) by a coarse-grained Monte Carlo simulation.

PubMed

Pandey, R B; Farmer, B L

2014-11-07

Multi-scale aggregation to network formation of interacting proteins (H3.1) are examined by a knowledge-based coarse-grained Monte Carlo simulation as a function of temperature and the number of protein chains, i.e., the concentration of the protein. Self-assembly of corresponding homo-polymers of constitutive residues (Cys, Thr, and Glu) with extreme residue-residue interactions, i.e., attractive (Cys-Cys), neutral (Thr-Thr), and repulsive (Glu-Glu), are also studied for comparison with the native protein. Visual inspections show contrast and similarity in morphological evolutions of protein assembly, aggregation of small aggregates to a ramified network from low to high temperature with the aggregation of a Cys-polymer, and an entangled network of Glu and Thr polymers. Variations in mobility profiles of residues with the concentration of the protein suggest that the segmental characteristic of proteins is altered considerably by the self-assembly from that in its isolated state. The global motion of proteins and Cys polymer chains is enhanced by their interacting network at the low temperature where isolated chains remain quasi-static. Transition from globular to random coil transition, evidenced by the sharp variation in the radius of gyration, of an isolated protein is smeared due to self-assembly of interacting networks of many proteins. Scaling of the structure factor S(q) with the wave vector q provides estimates of effective dimension D of the mass distribution at multiple length scales in self-assembly. Crossover from solid aggregates (D ∼ 3) at low temperature to a ramified fibrous network (D ∼ 2) at high temperature is observed for the protein H3.1 and Cys polymers in contrast to little changes in mass distribution (D ∼ 1.6) of fibrous Glu- and Thr-chain configurations.

Aggregation and network formation in self-assembly of protein (H3.1) by a coarse-grained Monte Carlo simulation

NASA Astrophysics Data System (ADS)

Pandey, R. B.; Farmer, B. L.

2014-11-01

Multi-scale aggregation to network formation of interacting proteins (H3.1) are examined by a knowledge-based coarse-grained Monte Carlo simulation as a function of temperature and the number of protein chains, i.e., the concentration of the protein. Self-assembly of corresponding homo-polymers of constitutive residues (Cys, Thr, and Glu) with extreme residue-residue interactions, i.e., attractive (Cys-Cys), neutral (Thr-Thr), and repulsive (Glu-Glu), are also studied for comparison with the native protein. Visual inspections show contrast and similarity in morphological evolutions of protein assembly, aggregation of small aggregates to a ramified network from low to high temperature with the aggregation of a Cys-polymer, and an entangled network of Glu and Thr polymers. Variations in mobility profiles of residues with the concentration of the protein suggest that the segmental characteristic of proteins is altered considerably by the self-assembly from that in its isolated state. The global motion of proteins and Cys polymer chains is enhanced by their interacting network at the low temperature where isolated chains remain quasi-static. Transition from globular to random coil transition, evidenced by the sharp variation in the radius of gyration, of an isolated protein is smeared due to self-assembly of interacting networks of many proteins. Scaling of the structure factor S(q) with the wave vector q provides estimates of effective dimension D of the mass distribution at multiple length scales in self-assembly. Crossover from solid aggregates (D ˜ 3) at low temperature to a ramified fibrous network (D ˜ 2) at high temperature is observed for the protein H3.1 and Cys polymers in contrast to little changes in mass distribution (D ˜ 1.6) of fibrous Glu- and Thr-chain configurations.

Anions mediate ligand binding in Adineta vaga glutamate receptor ion channels.

PubMed

Lomash, Suvendu; Chittori, Sagar; Brown, Patrick; Mayer, Mark L

2013-03-05

AvGluR1, a glutamate receptor ion channel from the primitive eukaryote Adineta vaga, is activated by alanine, cysteine, methionine, and phenylalanine, which produce lectin-sensitive desensitizing responses like those to glutamate, aspartate, and serine. AvGluR1 LBD crystal structures reveal an unusual scheme for binding dissimilar ligands that may be utilized by distantly related odorant/chemosensory receptors. Arginine residues in domain 2 coordinate the γ-carboxyl group of glutamate, whereas in the alanine, methionine, and serine complexes a chloride ion acts as a surrogate ligand, replacing the γ-carboxyl group. Removal of Cl(-) lowers affinity for these ligands but not for glutamate or aspartate nor for phenylalanine, which occludes the anion binding site and binds with low affinity. AvGluR1 LBD crystal structures and sedimentation analysis also provide insights into the evolutionary link between prokaryotic and eukaryotic iGluRs and reveal features unique to both classes, emphasizing the need for additional structure-based studies on iGluR-ligand interactions. Copyright © 2013 Elsevier Ltd. All rights reserved.

Developmental Hypothyroxinemia and Hypothyroidism Reduce Parallel Fiber-Purkinje Cell Synapses in Rat Offspring by Downregulation of Neurexin1/Cbln1/GluD2 Tripartite Complex.

PubMed

Wang, Yuan; Dong, Jing; Wang, Yi; Wei, Wei; Song, Binbin; Shan, Zhongyan; Teng, Weiping; Chen, Jie

2016-10-01

Iodine is a significant micronutrient. Iodine deficiency (ID)-induced hypothyroxinemia and hypothyroidism during developmental period can cause cerebellar dysfunction. However, mechanisms are still unclear. Therefore, the present research aims to study effects of developmental hypothyroxinemia caused by mild ID and hypothyroidism caused by severe ID or methimazole (MMZ) on parallel fiber-Purkinje cell (PF-PC) synapses in filial cerebellum. Maternal hypothyroxinemia and hypothyroidism models were established in Wistar rats using ID diet and deionized water supplemented with different concentrations of potassium iodide or MMZ water. Birth weight and cerebellum weight were measured. We also examined PF-PC synapses using immunofluorescence, and western blot analysis was conducted to investigate the activity of Neurexin1/cerebellin1 (Cbln1)/glutamate receptor d2 (GluD2) tripartite complex. Our results showed that hypothyroxinemia and hypothyroidism decreased birth weight and cerebellum weight and reduced the PF-PC synapses on postnatal day (PN) 14 and PN21. Accordingly, the mean intensity of vesicular glutamate transporter (VGluT1) and Calbindin immunofluorescence was reduced in mild ID, severe ID, and MMZ groups. Moreover, maternal hypothyroxinemia and hypothyroidism reduced expression of Neurexin1/Cbln1/GluD2 tripartite complex. Our study supports the hypothesis that developmental hypothyroxinemia and hypothyroidism reduce PF-PC synapses, which may be attributed to the downregulation of Neurexin1/Cbln1/GluD2 tripartite complex.

Effects of citrus pulp, fish by-product and Bacillus subtilis fermentation biomass on growth performance, nutrient digestibility, and fecal microflora of weanling pigs.

PubMed

Noh, Hyun Suk; Ingale, Santosh Laxman; Lee, Su Hyup; Kim, Kwang Hyun; Kwon, Ill Kyong; Kim, Young Hwa; Chae, Byung Jo

2014-01-01

An experiment was conducted to investigate the effects of dietary supplementation with citrus pulp, fish by-product, and Bacillus subtilis fermentation biomass on the growth performance, apparent total tract digestibility (ATTD) of nutrients, and fecal microflora of weanling pigs. A total of 180 weaned piglets (Landrace × Yorkshire × Duroc) were randomly allotted to three treatments on the basis of body weight (BW). There were six replicate pens in each treatment with 10 piglets per pen. Dietary treatments were corn-soybean meal-based basal diet supplemented with 0 (control), 2.5, and 5.0% citrus pulp, fish by-product, and B. subtilis fermentation biomass. The isocaloric and isoproteineous experimental diets were fed in mash form in two phases (d 0 ~ 14, phase I and d 15 ~ 28, phase II). Dietary treatments had significant linear effects on gain to feed ratio (G:F) in all periods, whereas significant linear effects on ATTD of dry matter (DM), gross energy (GE), and ash were only observed in phase I. Piglets fed diet supplemented with 5.0% citrus pulp, fish by-product, and B. subtilis fermentation biomass showed greater (p < 0.05) G:F (phase I, phase II, and overall) as well as ATTD of DM, GE, and ash (phase I) than pigs fed control diet. Dietary treatments also had significant linear effects on total anaerobic bacteria populations by d 14 and 28. In addition, piglets fed diet supplemented with 5.0% citrus pulp, fish by-product and B. subtilis fermentation biomass showed greater (p < 0.05) fecal total anaerobic bacteria populations (d 14 and 28) than pigs fed control diet. Dietary treatments had no significant effects (linear or quadratic) on average daily gain (ADG), average dial feed intake (ADFI; phase I, phase II, and overall), or fecal populations of Bifidobacterium spp., Clostridium spp., and coliforms (d 14 and 28). These results indicate that dietary supplementation with 5.0% citrus pulp, fish by-product, and B. subtilis fermentation biomass has the potential to improve the feed efficiency, nutrient digestibility, and fecal microflora of weanling pigs.

NMDA receptor subunits change in the prefrontal cortex of pure-opioid and multi-drug abusers: a post-mortem study.

PubMed

Daneshparvar, Hamidreza; Sadat-Shirazi, Mitra-Sadat; Fekri, Monir; Khalifeh, Solmaz; Ziaie, Ali; Esfahanizadeh, Nasrin; Vousooghi, Nasim; Zarrindast, Mohammad-Reza

2018-05-16

Addiction is a chronic relapsing disorder and is one of the most important issues in the world. Changing the level of neurotransmitters and the activities of their receptors, play a major role in the pathophysiology of substance abuse disorders. It is well-established that N-methyl-D-aspartate receptors (NMDARs) play a significant role in the molecular basis of addiction. NMDAR has two obligatory GluN1 and two regionally localized GluN2 subunits. This study investigated changes in the protein level of GluN1, GluN2A, and GluN2B in the prefrontal cortex of drug abusers. The medial prefrontal cortex (mPFC), lateral prefrontal cortex (lPFC), and orbitofrontal cortex (OFC) were dissected from the brain of 101 drug addicts brains and were compared with the brains of non-addicts (N = 13). Western blotting technique was used to show the alteration in NMDAR subunits level. Data obtained using Western blotting technique showed a significant increase in the level of GluN1 and GluN2B, but not in GluN2A subunits in all the three regions (mPFC, lPFC, and OFC) of men whom suffered from addiction as compared to the appropriate controls. These findings showed a novel role for GluN1, GluN2B subunits, rather than the GluN2A subunit of NMDARs, in the pathophysiology of addiction and suggested their role in the drug-induced plasticity of NMDARs.

The levels of the GluN2A NMDA receptor subunit are modified in both the neonatal and adult rat brain by an early experience involving denial of maternal contact.

PubMed

Manatos, V; Stylianopoulou, F; Stamatakis, A

2016-01-26

The composition of the N-methyl-d-aspartate receptor receptor in GluN2A/GluN2B subunits is important in determining its characteristics and its role in plasticity, a property of the brain which is known to be critically affected by early experiences. In the present work we employed an early experience model involving either receipt (RER) or denial (DER) of the expected reward of maternal contact within the context of learning by the pups of a T-maze on postnatal days (PND) 10-13. We investigated the effects of the RER and DER early experiences on GluN1, GluN2A and GluN2B levels in the prefrontal cortex (PFC), hippocampus and amygdala of the rat. We show that on PND13 the DER animals had lower GluN2A levels in the PFC. In adulthood DER males had higher GluN2A levels in the hippocampus, both under basal conditions and after exposure to a novel environment. The early experiences did not affect the response to the novelty. After exposure to a novel environment animals of all three groups (DER, RER, Control) responded with an increase in GluN2A levels in the brain areas examined. We did not detect any effects on GluN1 or GluN2B levels. The alterations in GluN2A levels observed in the DER animals could in part be responsible for their behavioral phenotype, described previously, which includes an increased susceptibility for the expression of depressive-like behavior. Copyright © 2015. Published by Elsevier Ireland Ltd.

Immunohistochemical localization of ionotropic glutamate receptors in the rat red nucleus

PubMed Central

Minbay, Zehra; Kocoglu, Sema Serter; Yurtseven, Duygu Gok; Eyigor, Ozhan

2017-01-01

In this study, we aimed to determine the presence as well as the diverse distribution of N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor subunits in the rat red nucleus. Using adult Sprague-Dawley rats as the experimental animals, immunohistochemistry was performed on 30 µm thick coronal brain sections with antibodies against α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (GluA1-4), kainate (GluK1, GluK2/3, and GluK5), and NMDA (GluN1 and GluN2A) receptor subunits. The results showed that all ionotropic glutamate receptor subunits are expressed in the red nucleus. Specific staining was localized in the neuron bodies and processes. However, the pattern of immunoreactivity and the number of labeled neurons changed depending on the type of ionotropic glutamate receptor subunits and the localization of neurons in the red nucleus. The neurons localized in the magnocellular part of the red nucleus were particularly immunopositive for GluA2, GluA4, GluK2/3, GluK5, GluN1, and GluN2A receptor proteins. In the parvocellular part of the red nucleus, ionotropic glutamate receptor subunit immunoreactivity of variable intensity (lightly to moderately stained) was detected in the neurons. These results suggest that red nucleus neurons in rat heterogeneously express ionotropic glutamate receptor subunits to form functional receptor channels. In addition, the likelihood of the coexpression of different subunits in the same subgroup of neurons suggests the formation of receptor channels with diverse structure by way of different subunit combination, and the possibility of various neuronal functions through these channels in the red nucleus. PMID:28027456

Immunohistochemical localization of ionotropic glutamate receptors in the rat red nucleus.

PubMed

Minbay, Zehra; Serter Kocoglu, Sema; Gok Yurtseven, Duygu; Eyigor, Ozhan

2017-02-21

In this study, we aimed to determine the presence as well as the diverse distribution of N-methyl-D-aspartate (NMDA) and non-NMDA glutamate receptor subunits in the rat red nucleus. Using adult Sprague-Dawley rats as the experimental animals, immunohistochemistry was performed on 30 µm thick coronal brain sections with antibodies against α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (GluA1-4), kainate (GluK1, GluK2/3, and GluK5), and NMDA (GluN1 and GluN2A) receptor subunits. The results showed that all ionotropic glutamate receptor subunits are expressed in the red nucleus. Specific staining was localized in the neuron bodies and processes. However, the pattern of immunoreactivity and the number of labeled neurons changed depending on the type of ionotropic glutamate receptor subunits and the localization of neurons in the red nucleus. The neurons localized in the magnocellular part of the red nucleus were particularly immunopositive for GluA2, GluA4, GluK2/3, GluK5, GluN1, and GluN2A receptor proteins. In the parvocellular part of the red nucleus, ionotropic glutamate receptor subunit immunoreactivity of variable intensity (lightly to moderately stained) was detected in the neurons. These results suggest that red nucleus neurons in rat heterogeneously express ionotropic glutamate receptor subunits to form functional receptor channels. In addition, the likelihood of the coexpression of different subunits in the same subgroup of neurons suggests the formation of receptor channels with diverse structure by way of different subunit combination, and the possibility of various neuronal functions through these channels in the red nucleus.

Metabolism of oxybenzone in a hairy root culture: Perspectives for phytoremediation of a widely used sunscreen agent.

PubMed

Chen, Feiran; Huber, Christian; May, Robert; Schröder, Peter

2016-04-05

Oxybenzone (OBZ), known as Benzophenone-3, is a commonly used UV filter in sun tans and skin protectants, entering aquatic systems either directly during recreational activities or indirectly through wastewater treatment plants discharge. To study the potential degradation capacity of plants for OBZ in phytotreatment, a well-established hairy root culture (Armoracia rusticana) was treated with OBZ. More than 20% of spiked OBZ (100μM) was eliminated from the medium by hairy roots after 3h of exposure. Two metabolites were identified as oxybenzone-glucoside (OBZ-Glu) and oxybenzone-(6-O-malonyl)-glucoside (OBZ-Mal-Glu) by LC-MS/MS and TOF-MS. Formation of these metabolites was confirmed by enzymatic synthesis, as well as enzymatic and alkaline hydrolysis. Incubation with O-glucosyltransferase (O-GT) extracted from roots formed OBZ-Glu; whereas β-d-Glucosidase hydrolyzed OBZ-Glu. However, alkaline hydrolysis led to cleavage of OBZ-Mal-Glu and yielded OBZ-Glu. In the hairy root culture, an excretion of OBZ-Glu into the growth medium was observed while the corresponding OBZ-Mal-Glu remained stored in root cells over the incubation time. We propose that metabolism of oxybenzone in plants involves initial conjugation with glucose to form OBZ-Glu followed by malonylation to yield OBZ-Mal-Glu. To our best knowledge this first finding presenting the potential of plants to degrade benzophenone type UV filters by phytoremediation. Copyright © 2015 Elsevier B.V. All rights reserved.

Experimental study on the strength of double shear timber connection using bamboo dowel fastener

NASA Astrophysics Data System (ADS)

Anshari, Buan; Sugiartha, Wayan; Mahmud, Fathmah; Rofaida, Aryani; Pathurrahman

2017-11-01

Utilization of timber and bamboo as building materials was very promising for now and future. As renewable resources they have high mechanical properties, lightweight, environmentally friendly and economic. Utilization of bamboo as connector was rarely published. Therefore, this study focused on utilization of non-metal material as connector in timber structure especially for beam and column. This research was conducted in the laboratory to examine the strength of double shear timber connection by using glued in rods (bamboo dowel) as connector with variation of adhesive thickness. As control specimen was used bamboo dowel Ø14 mm without adhesive in double shear connection. The results showed that the strength of double shear timber connection by using glued in rods (bamboo dowel) as connector could increased by 41% to resist axial force higher than the control one.

Establishing the 3-D finite element solid model of femurs in partial by volume rendering.

PubMed

Zhang, Yinwang; Zhong, Wuxue; Zhu, Haibo; Chen, Yun; Xu, Lingjun; Zhu, Jianmin

2013-01-01

It remains rare to report three-dimensional (3-D) finite element solid model of femurs in partial by volume rendering method, though several methods of femoral 3-D finite element modeling are already available. We aim to analyze the advantages of the modeling method by establishing the 3-D finite element solid model of femurs in partial by volume rendering. A 3-D finite element model of the normal human femurs, made up of three anatomic structures: cortical bone, cancellous bone and pulp cavity, was constructed followed by pretreatment of the CT original image. Moreover, the finite-element analysis was carried on different material properties, three types of materials given for cortical bone, six assigned for cancellous bone, and single for pulp cavity. The established 3-D finite element of femurs contains three anatomical structures: cortical bone, cancellous bone, and pulp cavity. The compressive stress primarily concentrated in the medial surfaces of femur, especially in the calcar femorale. Compared with whole modeling by volume rendering method, the 3-D finite element solid model created in partial is more real and fit for finite element analysis. Copyright © 2013 Surgical Associates Ltd. Published by Elsevier Ltd. All rights reserved.

Utilization of by-products from the tequila industry. Part 2: Potential value of Agave tequilana Weber azul leaves.

PubMed

Iñiguez-Covarrubias, G; Díaz-Teres, R; Sanjuan-Dueñas, R; Anzaldo-Hernández, J; Rowell, R M

2001-04-01

The leaves of the agave plant are left in the field after harvesting the heads for tequila production. Different types of agave leaves were isolated, classified, and their content in the total plant determined. The usable fractions were collected and their properties determined. Of the total wet weight of the agave plant, 54% corresponds to the agave head, 32% corresponds to materials which could be usable for sugar and fiber production which leaves 14% of the wet plant without apparent utility. The fractions with higher total reducing sugars (TRS) content were the fresh fraction of partially dry leaves stuck to the head and the leaf bases with a TRS content of 16.1% and 13.1%, respectively. The highest TRS concentration (16-28%) is in the agave head which is used for tequila production. The leaves are 90-120 cm long and 8-12 cm wide and contain fiber bundles that are 23-52 cm long and 0.6-13 mm wide. The ultimate fiber length is approximately 1.6 mm with an average width of 25 microns. There are several types of leaf fibers that can be utilized depending on what part of the plant they come from and what product is desired. Agave leaf fibers were pulped using a soda pulping process and the pulp was hand formed into test sheets. Test sheets made from pulped agave leaf fibers had a breaking length comparable to paper made from both pine and eucalyptus fibers, but the tear index and burst index were lower than the other two papers.

Involvement of GluD2 in Fear-Conditioned Bradycardia in Mice

PubMed Central

Kotajima-Murakami, Hiroko; Narumi, Sakae; Yuzaki, Michisuke; Yanagihara, Dai

2016-01-01

Lesions in the cerebellar vermis abolish acquisition of fear-conditioned bradycardia in animals and human patients. The δ2 glutamate receptor (GluD2) is predominantly expressed in cerebellar Purkinje cells. The mouse mutant ho15J carries a spontaneous mutation in GluD2 and these mice show a primary deficiency in parallel fiber-Purkinje cell synapses, multiple innervations of Purkinje cells by climbing fibers, and impairment of long-term depression. In the present study, we used ho15J mice to investigate the role of the cerebellum in fear-conditioned bradycardia. We recorded changes in heart rate of ho15J mice induced by repeated pairing of an acoustic (conditioned) stimulus (CS) with an aversive (unconditioned) stimulus (US). The mice acquired conditioned bradycardia on Day 1 of the CS-US phase, similarly to wild-type mice. However, the magnitude of the conditioned bradycardia was not stable in the mutant mice, but rather was exaggerated on Days 2–5 of the CS-US phase. We examined the effects of reversibly inactivating the cerebellum by injection of an antagonist against the α-amino-3-hydroxy-5-methyl-4-isoxazole propionate receptor (AMPAR). The antagonist abolished expression of conditioned responses in both wild-type and ho15J mice. We conclude that the GluD2 mutation in the ho15J mice affects stable retention of the acquired conditioned bradycardia. PMID:27820843

Involvement of GluD2 in Fear-Conditioned Bradycardia in Mice.

PubMed

Kotajima-Murakami, Hiroko; Narumi, Sakae; Yuzaki, Michisuke; Yanagihara, Dai

2016-01-01

Lesions in the cerebellar vermis abolish acquisition of fear-conditioned bradycardia in animals and human patients. The δ2 glutamate receptor (GluD2) is predominantly expressed in cerebellar Purkinje cells. The mouse mutant ho15J carries a spontaneous mutation in GluD2 and these mice show a primary deficiency in parallel fiber-Purkinje cell synapses, multiple innervations of Purkinje cells by climbing fibers, and impairment of long-term depression. In the present study, we used ho15J mice to investigate the role of the cerebellum in fear-conditioned bradycardia. We recorded changes in heart rate of ho15J mice induced by repeated pairing of an acoustic (conditioned) stimulus (CS) with an aversive (unconditioned) stimulus (US). The mice acquired conditioned bradycardia on Day 1 of the CS-US phase, similarly to wild-type mice. However, the magnitude of the conditioned bradycardia was not stable in the mutant mice, but rather was exaggerated on Days 2-5 of the CS-US phase. We examined the effects of reversibly inactivating the cerebellum by injection of an antagonist against the α-amino-3-hydroxy-5-methyl-4-isoxazole propionate receptor (AMPAR). The antagonist abolished expression of conditioned responses in both wild-type and ho15J mice. We conclude that the GluD2 mutation in the ho15J mice affects stable retention of the acquired conditioned bradycardia.

NMDA-induced potentiation of mGluR5 is mediated by activation of protein phosphatase 2B/calcineurin

PubMed Central

Alagarsamy, Sudar; Saugstad, Julie; Warren, Lee; Mansuy, Isabelle M.; Gereau, Robert W.; Conn, P. Jeffrey

2010-01-01

Previous reports have shown that activation of N-methyl-D-aspartate (NMDA) receptors potentiates responses to activation of the group I metabotropic glutamate receptor mGluR5 by reversing PKC-mediated desensitization of this receptor. NMDA-induced reversal of mGluR5 desensitization is dependent on activation of protein phosphatases. However, the specific protein phosphatase involved and the precise mechanism by which NMDA receptor activation reduces mGluR desensitization are not known. We have performed a series of molecular, biochemical, and genetic studies to show that NMDA-induced regulation of mGluR5 is dependent on activation of calcium-dependent protein phosphatase 2B/calcineurin (PP2B/CaN). Furthermore, we report that purified calcineurin directly dephosphorylates the C-terminal tail of mGluR5 at sites that are phosphorylated by PKC. Finally, immunoprecipitation and GST fusion protein pull-down experiments reveal that calcineurin interacts with mGluR5, suggesting that these proteins could be colocalized in a signaling complex. Taken together with previous studies, these data suggest that activation of NMDA receptors leads to activation of calcineurin and that calcineurin modulates mGluR5 function by directly dephosphorylating mGluR5 at PKC sites that are involved in desensitization of this receptor. 2005 Elsevier Ltd. All rights reserved. PMID:16005030

Separate intramolecular targets for protein kinase A control N-methyl-D-aspartate receptor gating and Ca2+ permeability.

PubMed

Aman, Teresa K; Maki, Bruce A; Ruffino, Thomas J; Kasperek, Eileen M; Popescu, Gabriela K

2014-07-04

Protein kinase A (PKA) enhances synaptic plasticity in the central nervous system by increasing NMDA receptor current amplitude and Ca(2+) flux in an isoform-dependent yet poorly understood manner. PKA phosphorylates multiple residues on GluN1, GluN2A, and GluN2B subunits in vivo, but the functional significance of this multiplicity is unknown. We examined gating and permeation properties of recombinant NMDA receptor isoforms and of receptors with altered C-terminal domain (CTDs) prior to and after pharmacological inhibition of PKA. We found that PKA inhibition decreased GluN1/GluN2B but not GluN1/GluN2A gating; this effect was due to slower rates for receptor activation and resensitization and was mediated exclusively by the GluN2B CTD. In contrast, PKA inhibition reduced NMDA receptor-relative Ca(2+) permeability (PCa/PNa) regardless of the GluN2 isoform and required the GluN1 CTD; this effect was due primarily to decreased unitary Ca(2+) conductance, because neither Na(+) conductance nor Ca(2+)-dependent block was altered substantially. Finally, we show that both the gating and permeation effects can be reproduced by changing the phosphorylation state of a single residue: GluN2B Ser-1166 and GluN1 Ser-897, respectively. We conclude that PKA effects on NMDA receptor gating and Ca(2+) permeability rely on distinct phosphorylation sites located on the CTD of GluN2B and GluN1 subunits. This separate control of NMDA receptor properties by PKA may account for the specific effects of PKA on plasticity during synaptic development and may lead to drugs targeted to alter NMDA receptor gating or Ca(2+) permeability. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Memory in aged mice is rescued by enhanced expression of the GluN2B subunit of the NMDA receptor

PubMed Central

Brim, B. L.; Haskell, R.; Awedikian, R.; Ellinwood, N.M.; Jin, L.; Kumar, A.; Foster, T.C.; Magnusson, K.

2012-01-01

The GluN2B subunit of the N-methyl-D-aspartate (NMDA) receptor shows age-related declines in expression across the frontal cortex and hippocampus. This decline is strongly correlated to age-related memory declines. This study was designed to determine if increasing GluN2B subunit expression in the frontal lobe or hippocampus would improve memory in aged mice. Mice were injected bilaterally with either the GluN2B vector, containing cDNA specific for the GluN2B subunit and enhanced Green Fluorescent Protein (eGFP); a control vector or vehicle. Spatial memory, cognitive flexibility, and associative memory were assessed using the Morris water maze. Aged mice, with increased GluN2B subunit expression, exhibited improved long-term spatial memory, comparable to young mice. However, memory was rescued on different days in the Morris water maze; early for hippocampal GluN2B subunit enrichment and later for the frontal lobe. A higher concentration of the GluN2B antagonist, Ro 25-6981, was required to impair long-term spatial memory in aged mice with enhanced GluN2B expression, as compared to aged controls, suggesting there was an increase in the number of GluN2B-containing NMDA receptors. In addition, hippocampal slices from aged mice with increased GluN2B subunit expression exhibited enhanced NMDA receptor-mediated excitatory post-synaptic potentials (EPSP). Treatment with Ro 25-6981 showed that a greater proportion of the NMDA receptor-mediated EPSP was due to the GluN2B subunit in these animals, as compared to aged controls. These results suggest that increasing the production of the GluN2B subunit in aged animals enhances memory and synaptic transmission. Therapies that enhance GluN2B subunit expression within the aged brain may be useful for ameliorating age-related memory declines. PMID:23103326

Curcumin Modulates the NMDA Receptor Subunit Composition Through a Mechanism Involving CaMKII and Ser/Thr Protein Phosphatases.

PubMed

Mallozzi, Cinzia; Parravano, Mariacristina; Gaddini, Lucia; Villa, Marika; Pricci, Flavia; Malchiodi-Albedi, Fiorella; Matteucci, Andrea

2018-05-30

Curcumin is one of the major compounds contained in turmeric, the powdered rhizome of Curcuma longa. Results obtained in various experimental models indicate that curcumin has the potential to treat a large variety of neuronal diseases. Excitotoxicity, the toxicity due to pathological glutamate receptors stimulation, has been considered to be involved in several ocular pathologies including ischemia, glaucoma, and diabetic retinopathy. The NMDA receptor (NMDAR), a heteromeric ligand-gated ion channel, is composed of GluN1 and GluN2 subunits. There are four GluN2 subunits (GluN2A-D), which are major determinants of the functional properties of NMDARs. It is widely accepted that GluN2B has a pivotal role in excitotoxicity while the role of GluN2A remains controversial. We previously demonstrated that curcumin is neuroprotective against NMDA-induced excitotoxicity with a mechanism involving an increase of GluN2A subunit activity. In this paper, we investigate the mechanisms involved in curcumin-induced GluN2A increase in retinal cultures. Our results show that curcumin treatment activated CaMKII with a time-course that paralleled those of GluN2A increase. Moreover, KN-93, a CaMKII inhibitor, was able to block the effect of curcumin on GluN2A expression. Finally, in our experimental model, curcumin reduced ser/thr phosphatases activity. Using okadaic acid, a specific PP1 and PP2A blocker, we observed an increase in GluN2A levels in cultures. The ability of okadaic acid to mimic the effect of curcumin on GluN2A expression suggests that curcumin might regulate GluN2A expression through a phosphatase-dependent mechanism. In conclusion, our findings indicate curcumin modulation of CaMKII and/or ser/thr phosphatases activities as a mechanism involved in GluN2A expression and neuroprotection against excitotoxicity.

Temporal dynamics of anxiety phenotypes in a dental pulp injury model.

PubMed

Shang, Lin; Xu, Tian-Le; Li, Fei; Su, Jiansheng; Li, Wei-Guang

2015-06-30

Accumulating clinical and preclinical evidence indicates that chronic pain is often comorbid with persistent low mood and anxiety. However, the mechanisms underlying pain-induced anxiety, such as its causality, temporal progression, and relevant neural networks are poorly understood, impeding the development of efficacious therapeutic approaches. Here, we have identified the sequential emergence of anxiety phenotypes in mice subjected to dental pulp injury (DPI), a prototypical model of orofacial pain that correlates with human toothache. Compared with sham controls, mice subjected to DPI by mechanically exposing the pulp to the oral environment exhibited significant signs of anxiogenic effects, specifically, altered behaviors on the elevated plus maze (EPM), novelty-suppressed feeding (NSF) tests at 1 but not 3 days after the surgery. Notably, at 7 and 14 days, the DPI mice again avoided the open arm, center area, and novelty environment in the EPM, open field, and NSF tests, respectively. In particular, DPI-induced social phobia and increased repetitive grooming did not occur until 14 days after surgery, suggesting that DPI-induced social anxiety requires a long time. Moreover, oral administration of an anti-inflammatory drug, ibuprofen, or an analgesic agent, ProTx-II, which is a selective inhibitor of NaV1.7 sodium channels, both significantly alleviated DPI-induced avoidance in mice. Finally, to investigate the underlying central mechanisms, we pharmacologically blocked a popular form of synaptic plasticity with a GluA2-derived peptide, long-term depression, as that treatment significantly prevented the development of anxiety phenotype upon DPI. Together, these results suggest a temporally progressive causal relationship between orofacial pain and anxiety, calling for more in-depth mechanistic studies on concomitant pain and anxiety disorders.

Regulation of taste-active components of meat by dietary branched-chain amino acids; effects of branched-chain amino acid antagonism.

PubMed

Imanari, M; Kadowaki, M; Fujimura, S

2008-05-01

1. The effects of dietary branched-chain amino acids (BCAAs) including leucine (Leu), isoleucine (Ile) and valine (Val) on taste-active components, especially free glutamate (Glu), in meat were investigated. 2. Broiler chickens (28 d old) were given varied dietary BCAA levels for 10 d before marketing. Dietary BCAA content ratios were either 100:100:100 (Low Leu group), 150:100:100 (Control group) or 150:150:150 (High Ile + Val group) for Leu:Ile:Val (% of each BCAA requirement according to NRC, 1994). Taste-related components of meat (free amino acids and ATP metabolites) and sensory scores of meat soup were estimated. 3. Free Glu content, the main taste-active component of meat, was significantly increased by dietary BCAA. Compared to the Control group, free Glu content increased by 30% in the High Ile + Val group. However, the inosine monophosphate (IMP) content in meat did not change among groups. 4. Sensory evaluation of meat soups showed that Control and High Ile + Val groups had different meat flavours. The sensory score of overall taste intensity was significantly higher in the High Ile + Val group. 5. These results suggest that dietary BCAA concentrations regulate free Glu in meat. Increasing dietary Ile + Val induces an increase in free Glu content of meat, improves meat taste and is more effective for increasing free Glu content in meat than decreasing dietary Leu level.

Effects of mutations of thermolysin, as N116 to asp and asp150 to glu, on salt-induced activation and stabilization.

PubMed

Menach, Evans; Yasukawa, Kiyoshi; Inouye, Kuniyo

2013-01-01

Neutral salts activate and stabilize thermolysin. We previously found that two single mutations, Asn116→Asp and Asp150→Glu, increase the activity of thermolysin. In the present study, we examined their effects on NaCl-induced activation and stabilization. In the hydrolysis of N-[3-(2-furyl)acryloyl]-glycyl-L-leucine amide, the relative activities (the ratios of the specificity constant, kcat/Km, at x M NaCl to that at 0 M NaCl) at 0.5-4.0 M NaCl of D150E and N116D/D150E were lower than those of wild-type thermolysin (WT) and N116D, respectively. In thermal inactivation at 70 °C, the relative stabilities (the ratios of the first-order rate constant, kobs, at 0 M NaCl to that at x M NaCl) at 0.5-4.0 M NaCl of D150E and N116D/D150E were lower than those of WT and N116D, respectively. These results indicate that unlike Asn116→Asp, Asp150→Glu reduced NaCl-induced activation and stabilization, suggesting that the binding of ions with certain residues of thermolysin is involved in the activation and stabilization.

N-linked glycosylation of cortical N-methyl-D-aspartate and kainate receptor subunits in schizophrenia.

PubMed

Tucholski, Janusz; Simmons, Micah S; Pinner, Anita L; McMillan, Laurence D; Haroutunian, Vahram; Meador-Woodruff, James H

2013-08-21

Dysfunctional glutamate neurotransmission has been implicated in the pathophysiology of schizophrenia. Abnormal expressions in schizophrenia of ionotropic glutamate receptors (iGluRs) and the proteins that regulate their trafficking have been found to be region and subunit specific in brain, suggesting that abnormal trafficking of iGluRs may contribute toward altered glutamatergic neurotransmission. The post-translational modification N-glycosylation of iGluR subunits can be used as a proxy for their intracellular localization. Receptor complexes assemble in the lumen of the endoplasmic reticulum, where N-glycosylation begins with the addition of N-linked oligomannose glycans, and is subsequently trimmed and replaced by more elaborate glycans while trafficking through the Golgi apparatus. Previously, we found abnormalities in N-glycosylation of the GluR2 AMPA receptor subunit in schizophrenia. Here, we investigated N-glycosylation of N-methyl-D-aspartate and kainate (KA) receptor subunits in the dorsolateral prefrontal cortex from patients with schizophrenia and a comparison group. We used enzymatic deglycosylation with two glycosidases: endoglycosidase H (Endo H), which removes immature high mannose-containing sugars, and peptide-N-glycosidase F (PNGase F), which removes all N-linked sugars. The NR1, NR2A, NR2B, GluR6, and KA2 subunits were all sensitive to treatment with Endo H and PNGase F. The GluR6 KA receptor subunit was significantly more sensitive to Endo H-mediated deglycosylation in schizophrenia, suggesting a larger molecular mass of N-linked high mannose and/or hybrid sugars on GluR6. This finding, taken with our previous work, suggests that a cellular mechanism underlying abnormal glutamate neurotransmission in schizophrenia may involve abnormal trafficking of both AMPA and KA receptors.

Simultaneous quantification of glutamate and glutamine by J-modulated spectroscopy at 3 Tesla.

PubMed

Zhang, Yan; Shen, Jun

2016-09-01

The echo time (TE) averaged spectrum is the one-dimensional (1D) cross-section of the J-resolved spectrum at J = 0. In multiecho TE-averaged spectroscopy, glutamate (Glu) is differentiated from glutamine (Gln) at 3 Tesla (T). This method, however, almost entirely suppresses Gln resonance lines around 2.35 ppm, leaving Gln undetermined. This study presents a novel method for quantifying both Glu and Gln using multi-echo spectral data. A 1D cross-section of J-resolved spectroscopy at J = 7.5 Hz-referred to as J-modulated spectroscopy-was developed to simultaneously quantify Glu and Gln levels in the human brain. The transverse relaxation times (T2 s) of metabolites were first determined using conventional TE-averaged spectroscopy with different starting echo time and then incorporated into the spectral model for fitting J-modulated data. Simulation and in vivo data showed that the resonance signals of Glu and Gln were clearly separated around 2.35 ppm in J-modulated spectroscopy. In the anterior cingulate cortex, both Glu and Gln levels were found to be significantly higher in gray matter than in white matter in healthy subjects (P < 10(-10) and < 10(-5) , respectively). Gln resonances can be clearly separated from Glu and N-acetyl-aspartate around 2.35 ppm using J-modulated spectroscopy. This method can be used to quantitatively measure Glu and Gln simultaneously at 3T. Magn Reson Med 76:725-732, 2016. Published 2015. This article is a U.S. Government work and is in the public domain in the USA. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

The plasticity of the association between mu-opioid receptor and glutamate ionotropic receptor N in opioid analgesic tolerance and neuropathic pain.

PubMed

Sánchez-Blázquez, Pilar; Rodríguez-Muñoz, Maria; Berrocoso, Esther; Garzón, Javier

2013-09-15

Multiple groups have reported the functional cross-regulation between mu-opioid (MOP) receptor and glutamate ionotropic receptor N (GluN), and the post-synaptic association of these receptors has been implicated in the transmission and modulation of nociceptive signals. Opioids, such as morphine, disrupt the MOP receptor-GluN receptor complex to stimulate the activity of GluN receptors via protein kinase C (PKC)/Src. This increased GluN receptor activity opposes MOP receptor signalling, and via neural nitric oxide synthase (nNOS) and calcium and calmodulin regulated kinase II (CaMKII) induces the phosphorylation and uncoupling of the opioid receptor, which results in the development of morphine analgesic tolerance. Both experimental in vivo activation of GluN receptors and neuropathic pain separate the MOP receptor-GluN receptor complex via protein kinase A (PKA) and reduce the analgesic capacity of morphine. The histidine triad nucleotide-binding protein 1 (HINT1) associates with the MOP receptor C-terminus and connects the activities of MOP receptor and GluN receptor. In HINT1⁻/⁻ mice, morphine promotes enhanced analgesia and produces tolerance that is not related to GluN receptor activity. In these mice, the GluN receptor agonist N-methyl-D-aspartate acid (NMDA) does not antagonise the analgesic effects of morphine. Treatments that rescue morphine from analgesic tolerance, such as GluN receptor antagonism or PKC, nNOS and CaMKII inhibitors, all induce MOP receptor-GluN receptor re-association and reduce GluN receptor/CaMKII activity. In mice treated with NMDA or suffering from neuropathic pain (induced by chronic constriction injury, CCI), GluN receptor antagonists, PKA inhibitors or certain antidepressants also diminish CaMKII activity and restore the MOP receptor-GluN receptor association. Thus, the HINT1 protein stabilises the association between MOP receptor and GluN receptor, necessary for the analgesic efficacy of morphine, and this coupling is reduced following the activation of GluN receptors, similar to what is observed in neuropathic pain. © 2013 Elsevier B.V. All rights reserved.

Antimicrobial activities of pomelo (Citrus maxima) seed and pulp ethanolic extract

NASA Astrophysics Data System (ADS)

Sahlan, Muhamad; Damayanti, Vina; Tristantini, Dewi; Hermansyah, Heri; Wijanarko, Anondho; Olivia, Yuko

2018-02-01

Grapefruit (Citrus paradisi) seed extract is generally used as naturopathic medications, supplements, antiseptic and disinfecting agents and also as preservatives in food and cosmetics products. In vitro studies have demonstrated that grapefruit seed extract has anti bacterial properties against a range of gram-positive and gram-negative organisms. Indonesian grapefruit, known as pomelo (C. maxima), has similar characteristics, contents and is under the same genus (Citrus) as grapefruit; however it has not been completely utilized as a preservative. In this work we analyze the antimicrobial activities of ethanolic extract of Indonesian pomelo (C. maxima) seeds and pulp compared to the grapefruit (C. paradisi) seeds and pulp ethanolic extract. Ethanolic extracts of pomelo and grapefruit seeds and pulp are investigated for activities against Bacillus subtilis, Staphylococcus aureus, Escherichia coli and Candida albicans. The level of antimicrobial effects is established using agar diffusion method. Both of the ethanolic do not show any antimicrobial activities against C. albicans. The ethanolic extract of pomelo seeds and pulp used in this research give positive results with growth inhibition effect on B. subtilis, S. aureus and E. coli. The zones of inhibition ranges from 22 - 30 mm in diameter, which is higher to grapefruit seeds and pulp ethanolic extract (17 - 25 mm). Ethanolic extract of pomelo seeds and pulp has an antimicrobial effect, which makes it a natural preparation for use as an alternative preservative for food and cosmetic.

Linked Production of Pyroglutamate-Modified Proteins via Self-Cleavage of Fusion Tags with TEV Protease and Autonomous N-Terminal Cyclization with Glutaminyl Cyclase In Vivo

PubMed Central

Shih, Yan-Ping; Chou, Chi-Chi; Chen, Yi-Ling; Huang, Kai-Fa; Wang, Andrew H.- J.

2014-01-01

Overproduction of N-terminal pyroglutamate (pGlu)-modified proteins utilizing Escherichia coli or eukaryotic cells is a challenging work owing to the fact that the recombinant proteins need to be recovered by proteolytic removal of fusion tags to expose the N-terminal glutaminyl or glutamyl residue, which is then converted into pGlu catalyzed by the enzyme glutaminyl cyclase. Herein we describe a new method for production of N-terminal pGlu-containing proteins in vivo via intracellular self-cleavage of fusion tags by tobacco etch virus (TEV) protease and then immediate N-terminal cyclization of passenger target proteins by a bacterial glutaminyl cyclase. To combine with the sticky-end PCR cloning strategy, this design allows the gene of target proteins to be efficiently inserted into the expression vector using two unique cloning sites (i.e., SnaB I and Xho I), and the soluble and N-terminal pGlu-containing proteins are then produced in vivo. Our method has been successfully applied to the production of pGlu-modified enhanced green fluorescence protein and monocyte chemoattractant proteins. This design will facilitate the production of protein drugs and drug target proteins that possess an N-terminal pGlu residue required for their physiological activities. PMID:24733552

PKMζ Differentially Utilized between Sexes for Remote Long-Term Spatial Memory

PubMed Central

Sebastian, Veronica; Vergel, Tatyana; Baig, Raheela; Schrott, Lisa M.; Serrano, Peter A.

2013-01-01

It is well established that male rats have an advantage in acquiring place-learning strategies, allowing them to learn spatial tasks more readily than female rats. However many of these differences have been examined solely during acquisition or in 24h memory retention. Here, we investigated whether sex differences exist in remote long-term memory, lasting 30d after training, and whether there are differences in the expression pattern of molecular markers associated with long-term memory maintenance. Specifically, we analyzed the expression of protein kinase M zeta (PKMζ) and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit GluA2. To adequately evaluate memory retention, we used a robust training protocol to attenuate sex differences in acquisition and found differential effects in memory retention 1d and 30d after training. Female cohorts tested for memory retention 1d after 60 training trials outperformed males by making significantly fewer reference memory errors at test. In contrast, male cohorts tested 30d after 60 training trials outperformed females of the same condition, making fewer reference memory errors and achieving significantly higher retention test scores. Furthermore, given 60 training trials, females tested 30d later showed significantly worse memory compared to females tested 1d later, while males tested 30d later did not differ from males tested 1d later. Together these data suggest that with robust training males do no retain spatial information as well as females do 24h post-training but maintain this spatial information for longer. Males also showed a significant increase in synaptic PKMζ expression and a positive correlation with retention test scores, while females did not. Interestingly, both sexes showed a positive correlation between retention test scores and synaptic GluA2 expression. Furthermore, the increased expression of synaptic PKMζ, associated with male memory but not with female memory, identifies another potential sex-mediated difference in memory processing. PMID:24244733

ABA Renewal Involves Enhancements in Both GluA2-Lacking AMPA Receptor Activity and GluA1 Phosphorylation in the Lateral Amygdala

PubMed Central

Park, Sungmo; Kim, Jihye; An, Bobae; Lee, Hyun Woo; Lee, Seungbok; Kim, Hyun; Lee, Justin C.; Lee, Sukwon; Choi, Sukwoo

2014-01-01

Fear renewal, the context-specific relapse of fear following fear extinction, is a leading animal model of post-traumatic stress disorders (PTSD) and fear-related disorders. Although fear extinction can diminish fear responses, this effect is restricted to the context where the extinction is carried out, and the extinguished fear strongly relapses when assessed in the original acquisition context (ABA renewal) or in a context distinct from the conditioning and extinction contexts (ABC renewal). We have previously identified Ser831 phosphorylation of GluA1 subunit in the lateral amygdala (LA) as a key molecular mechanism for ABC renewal. However, molecular mechanisms underlying ABA renewal remain to be elucidated. Here, we found that both the excitatory synaptic efficacy and GluA2-lacking AMPAR activity at thalamic input synapses onto the LA (T-LA synapses) were enhanced upon ABA renewal. GluA2-lacking AMPAR activity was also increased during low-threshold potentiation, a potential cellular substrate of renewal, at T-LA synapses. The microinjection of 1-naphtylacetyl-spermine (NASPM), a selective blocker of GluA2-lacking AMPARs, into the LA attenuated ABA renewal, suggesting a critical role of GluA2-lacking AMPARs in ABA renewal. We also found that Ser831 phosphorylation of GluA1 in the LA was increased upon ABA renewal. We developed a short peptide mimicking the Ser831-containing C-tail region of GluA1, which can be phosphorylated upon renewal (GluA1S); thus, the phosphorylated GluA1S may compete with Ser831-phosphorylated GluA1. This GluA1S peptide blocked the low-threshold potentiation when dialyzed into a recorded neuron. The microinjection of a cell-permeable form of GluA1S peptide into the LA attenuated ABA renewal. In support of the GluA1S experiments, a GluA1D peptide (in which the serine at 831 is replaced with a phosphomimetic amino acid, aspartate) attenuated ABA renewal when microinjected into the LA. These findings suggest that enhancements in both the GluA2-lacking AMPAR activity and GluA1 phosphorylation at Ser831 are required for ABA renewal. PMID:24925360

ABA renewal involves enhancements in both GluA2-lacking AMPA receptor activity and GluA1 phosphorylation in the lateral amygdala.

PubMed

Park, Kyungjoon; Song, Beomjong; Kim, Jeongyeon; Hong, Ingie; Song, Sangho; Lee, Junuk; Park, Sungmo; Kim, Jihye; An, Bobae; Lee, Hyun Woo; Lee, Seungbok; Kim, Hyun; Lee, Justin C; Lee, Sukwon; Choi, Sukwoo

2014-01-01

Fear renewal, the context-specific relapse of fear following fear extinction, is a leading animal model of post-traumatic stress disorders (PTSD) and fear-related disorders. Although fear extinction can diminish fear responses, this effect is restricted to the context where the extinction is carried out, and the extinguished fear strongly relapses when assessed in the original acquisition context (ABA renewal) or in a context distinct from the conditioning and extinction contexts (ABC renewal). We have previously identified Ser831 phosphorylation of GluA1 subunit in the lateral amygdala (LA) as a key molecular mechanism for ABC renewal. However, molecular mechanisms underlying ABA renewal remain to be elucidated. Here, we found that both the excitatory synaptic efficacy and GluA2-lacking AMPAR activity at thalamic input synapses onto the LA (T-LA synapses) were enhanced upon ABA renewal. GluA2-lacking AMPAR activity was also increased during low-threshold potentiation, a potential cellular substrate of renewal, at T-LA synapses. The microinjection of 1-naphtylacetyl-spermine (NASPM), a selective blocker of GluA2-lacking AMPARs, into the LA attenuated ABA renewal, suggesting a critical role of GluA2-lacking AMPARs in ABA renewal. We also found that Ser831 phosphorylation of GluA1 in the LA was increased upon ABA renewal. We developed a short peptide mimicking the Ser831-containing C-tail region of GluA1, which can be phosphorylated upon renewal (GluA1S); thus, the phosphorylated GluA1S may compete with Ser831-phosphorylated GluA1. This GluA1S peptide blocked the low-threshold potentiation when dialyzed into a recorded neuron. The microinjection of a cell-permeable form of GluA1S peptide into the LA attenuated ABA renewal. In support of the GluA1S experiments, a GluA1D peptide (in which the serine at 831 is replaced with a phosphomimetic amino acid, aspartate) attenuated ABA renewal when microinjected into the LA. These findings suggest that enhancements in both the GluA2-lacking AMPAR activity and GluA1 phosphorylation at Ser831 are required for ABA renewal.

Ionotropic and metabotropic glutamate receptor mediation of glucocorticoid-induced apoptosis in hippocampal cells and the neuroprotective role of synaptic N-methyl-D-aspartate receptors.

PubMed

Lu, J; Goula, D; Sousa, N; Almeida, O F X

2003-01-01

Glutamate receptors have been proposed to mediate the apoptotic actions of glucocorticoids in hippocampal cells. To further analyze the role of glutamate receptors in this process, we pretreated primary hippocampal cells from neonatal (postnatal day 4) rats with antagonists of ionotropic glutamate receptor (iGluR) and metabotropic glutamate receptor (mGluR) antagonists before exposure to the specific glucocorticoid receptor agonist dexamethasone (DEX) at a dose of 1 microM. Dizocilpine (MK801; a general N-methyl-D-aspartic acid [NMDA] receptor antagonist, NMDAR antagonist) and ifenprodil (a specific ligand of the NMDAR 2B subunit, NR2B), were used to block iGluR; (RS)-alpha-ethyl-4-carboxyphenylglycine (E4CPG) and (RS)-alpha-cyclopropyl-4-phosphonophenyl-glycine (CPPG) were employed as I/II (E4CPG) and II/III (CPPG) mGluR antagonists. Blockade of iGluR resulted in a significant attenuation of DEX-induced cell death; the finding that ifenprodil exerted a similar potency to MK801 demonstrates the involvement of NR2B receptors in glucocorticoid-induced cell death. Apoptosis accounted for a significant amount of the cell loss observed, as detected by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling histochemistry for the in situ labeling of DNA breaks; apoptotic cells were distinguished from necrosis on the basis of morphological criteria, including chromatin condensation, membrane blebbing and presence of apoptotic bodies. Treatment with E4CPG and CPPG completely abolished the apoptotic response to DEX, thus showing the additional contribution of mGluR to the phenomenon. Further, dose-response studies with NMDA revealed that whereas high (10 microM) doses of NMDA themselves elicit cytotoxic responses, low (1-5 microM) concentrations of NMDA can effectively oppose DEX-induced cell death. Interestingly, the neuroprotective actions of low dose NMDA stimulation were abolished when either synaptic or extrasynaptic NMDA receptors were blocked with MK801 in combination with the GABA receptor antagonist bicuculline (synaptic) or ifenprodil (extrasynaptic). In summary, the present data show that both iGluR and mGluR mediate the neurotoxic effects of glucocorticoids on hippocampal cells and that pre-treatment with low doses of NMDA, by acting on synaptic and extrasynaptic receptors, render hippocampal cells less vulnerable to glucocorticoid insults.

The Potential in Bioethanol Production From Waste Fiber Sludges in Pulp Mill-Based Biorefineries

NASA Astrophysics Data System (ADS)

Sjöde, Anders; Alriksson, Björn; Jönsson, Leif J.; Nilvebrant, Nils-Olof

Industrial production of bioethanol from fibers that are unusable for pulp production in pulp mills offers an approach to product diversification and more efficient exploitation of the raw material. In an attempt to utilize fibers flowing to the biological waste treatment, selected fiber sludges from three different pulp mills were collected, chemically analyzed, enzymatically hydrolyzed, and fermented for bioethanol production. Another aim was to produce solid residues with higher heat values than those of the original fiber sludges to gain a better fuel for combustion. The glucan content ranged between 32 and 66% of the dry matter. The lignin content varied considerably (1-25%), as did the content of wood extractives (0.2-5.8%). Hydrolysates obtained using enzymatic hydrolysis were found to be readily fermentable using Saccharomyces cerevisiae. Hydrolysis resulted in improved heat values compared with corresponding untreated fiber sludges. Oligomeric xylan fragments in the solid residue obtained after enzymatic hydrolysis were identified using matrix-assisted laser desorption ionization-time of flight and their potential as a new product of a pulp mill-based biorefinery is discussed.

The potential in bioethanol production from waste fiber sludges in pulp mill-based biorefineries.

PubMed

Sjöde, Anders; Alriksson, Björn; Jönsson, Leif J; Nilvebrant, Nils-Olof

2007-04-01

Industrial production of bioethanol from fibers that are unusable for pulp production in pulp mills offers an approach to product diversification and more efficient exploitation of the raw material. In an attempt to utilize fibers flowing to the biological waste treatment, selected fiber sludges from three different pulp mills were collected, chemically analyzed, enzymatically hydrolyzed, and fermented for bioethanol production. Another aim was to produce solid residues with higher heat values than those of the original fiber sludges to gain a better fuel for combustion. The glucan content ranged between 32 and 66% of the dry matter. The lignin content varied considerably (1-25%), as did the content of wood extractives (0.2-5.8%). Hydrolysates obtained using enzymatic hydrolysis were found to be readily fermentable using Saccharomyces cerevisiae. Hydrolysis resulted in improved heat values compared with corresponding untreated fiber sludges. Oligomeric xylan fragments in the solid residue obtained after enzymatic hydrolysis were identified using matrix-assisted laser desorption ionization-time of flight and their potential as a new product of a pulp mill-based biorefinery is discussed.

NMDA receptor GluN2A subunit deletion protects against dependence-like ethanol drinking.

PubMed

Jury, Nicholas J; Radke, Anna K; Pati, Dipanwita; Kocharian, Adrina; Mishina, Masayoshi; Kash, Thomas L; Holmes, Andrew

2018-06-25

The N-methyl- D -aspartate receptor (NMDAR) is mechanistically involved in the behavioral and neurophysiological effects of alcohol, but the specific role of the GluN2A subunit remains unclear. Here, we exposed mice with constitutive GluN2A gene knockout (KO) to chronic intermittent ethanol vapor (CIE) and tested for EtOH consumption/preference using a two-bottle choice paradigm, as well as NMDAR-mediated transmission at basolateral amygdala synapses via ex vivo slice electrophysiology. Results showed that GluN2A KO mice attained comparable blood EtOH levels in response to CIE exposure, but did not exhibit the significant increase in EtOH drinking that was observed in CIE-exposed wildtypes. GluN2A KO mice also showed no alterations in BLA NMDAR-mediated synaptic transmission after CIE, relative to air-exposed, whereas C57BL/6 J mice showed an attenuated synaptic response to GluN2B antagonism. Taken together, these data add to mounting evidence supporting GluN2A-containing NMDARs as a mechanism underlying relative risk for developing EtOH dependence after repeated EtOH exposure. Copyright © 2018. Published by Elsevier B.V.

A new multi-wavelength optical-plethysmograph for quantitative determination of pulpal hemoglobin content and oxygen level using green and near-infrared LEDs

NASA Astrophysics Data System (ADS)

Kakino, S.; Miwa, Z.; Kirimoto, A.; Ohuchi, K.; Takatani, S.; Takagi, Y.

2007-02-01

A new multi-wavelength optical-plethysmograph has been designed to study the relation between the transmitted optical density (OD) of the tooth vs. hemoglobin (Hb) content and oxygen saturation (SO II) of the pulpal blood using the 467, 506, 522 and 810 nm light emitting diodes (LEDs). The experimental model utilized the extracted human upper incisor where the pulp cavity was filled with the blood having various values of Hb and SO II. A resin cap was made to fit the tooth crown and optical fibers for transmission measurement. The LEDs were pulsed sequentially at 520 Hz with the pulse duration of 240 μs. The OD as a function of Hb for the isosbestic wavelengths of 506 and 522 nm increased almost linearly from 8.0 to 11.0 for Hb changing from 0.0 (saline control) to 2.5 g/dL, but beyond 2.5 g/dL no change was observed. At 810 nm, the OD increased linearly till Hb of 13.4 g/dL, but its change was much smaller with 1.0 OD per 13.4 g/dL. As for SO II, the OD at 467 nm with Hb of 1.0 g/dL that simulated the mean pulpal Hb content in vivo varied by about 1.0 for SO II changing from 100 to 40%. The OD change with respect to Hb change at 506 and 522 nm showed better sensitivity than that at 810 nm. The combination of 467 and 506 or 522 nm wavelengths can provide a noninvasive measurement of both pulpal Hb content and SO II to diagnose pulp vitality of teeth in vivo.

Opiate withdrawal induces dynamic expressions of AMPA receptors and its regulatory molecule CaMKIIalpha in hippocampal synapses.

PubMed

Zhong, Weixia; Dong, Zhifang; Tian, Meng; Cao, Jun; Xu, Tianle; Xu, Lin; Luo, Jianhong

2006-07-24

Adaptive changes in brain areas following drug withdrawal are believed to contribute to drug seeking and relapse. Cocaine withdrawal alters the expression of GluR1 and GluR2/3 subunits of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors in nucleus accumbens or amygdala, but the influence of drug withdrawal on hippocampus is little known. Here, we have examined the expression of GluR1 and GluR2/3 in hippocampal membrane and synaptic fractions following repeated morphine exposure and subsequent withdrawal. Repeated morphine exposure for 12 d increased GluR1 and GluR2/3 in synaptosome but not in membrane fraction. Interestingly, CaMKIIalpha, known to be able to regulate the function of AMPA receptors, was decreased in synaptosome but not in membrane fraction; pCaMKIIalpha, the phosphorylated form of CaMKIIalpha, was increased in both fractions. However, during opiate withdrawal, GluR1 was generally reduced while GluR2/3 was prominently increased in both fractions; pCaMKIIalpha was strongly decreased immediately after withdrawal, but detectably increased in late phase of morphine withdrawal in both fractions. Importantly, the opiate withdrawal-induced increase in GluR2/3 was dependent on the activation of glucocorticoid receptors and NMDA receptors, as it was prevented by the glucocorticoid receptor antagonist RU38486, or intrahippocampal injection of the NMDA receptor antagonist AP-5 or the antagonist to NR2B-containing NMDA receptors, Ro25-6981. These findings indicate that opiate withdrawal induces dynamic expression of GluR1 and GluR2/3 subunits of AMPA receptors in hippocampal synapses, possibly revealing an adaptive process of the hippocampal functions following opiate withdrawal.

Iron depletion strategy for targeted cancer therapy: utilizing the dual roles of neutrophil gelatinase-associated lipocalin protein.

PubMed

Tang, Hsin-Chieh; Chang, Pei-Chun; Chen, Yu-Chian

2016-01-01

Decreasing iron uptake and increasing iron efflux may result in cell death by oxidative inactivation of vital enzymes. Applying the dual function of neutrophil gelatinase-associated lipocalin (NGAL) could achieve the goal of iron depletion in the cancer cells. Tyr106, Lys125 or Lys134 was the key binding site for NGAL protein to sequester iron-chelating siderophores. In this study, we employed all bioactive peptides in peptide databank to dock with the siderophore-binding sites of NGAL protein by virtual screening. In addition, we performed molecular dynamics (MD) simulation to observe the molecular character and structural variation of ligand-protein interaction. Glu-Glu-Lys-Glu (EEKE), Glu-Glu-Asp-Cys-Lys (EEDCK), and Gly-Glu-Glu-Cys-Asp (GEECD) were selected preliminarily by rigorous scoring functions for further investigation. GEECD was excluded due to higher binding total energy than the others. Moreover, we also excluded EEKE due to larger influence to the stability of binding residues by the information of root mean square fluctuation (RMSF) and principal component analysis (PCA). Thus, we suggested that EEDCK was the potential bioactive peptide which had been proved to inhibit malignant cells for targeted cancer therapy. Graphical Abstract Perspective drug design of occupying the siderophore-binding sites of NGAL outside the cell temporarily by a potential short peptide until NGAL enters into the cell, and releasing the siderophore-binding sites inside the cell.

Expression of specific ionotropic glutamate and GABA-A receptor subunits is decreased in central amygdala of alcoholics.

PubMed

Jin, Zhe; Bhandage, Amol K; Bazov, Igor; Kononenko, Olga; Bakalkin, Georgy; Korpi, Esa R; Birnir, Bryndis

2014-01-01

The central amygdala (CeA) has a role for mediating fear and anxiety responses. It is also involved in emotional imbalance caused by alcohol abuse and dependence and in regulating relapse to alcohol abuse. Growing evidences suggest that excitatory glutamatergic and inhibitory γ-aminobutyric acid-ergic (GABAergic) transmissions in the CeA are affected by chronic alcohol exposure. Human post-mortem CeA samples from male alcoholics (n = 9) and matched controls (n = 9) were assayed for the expression level of ionotropic glutamate and GABA-A receptors subunit mRNAs using quantitative real-time reverse transcription-PCR (RT-qPCR). Our data revealed that out of the 16 ionotropic glutamate receptor subunits, mRNAs encoding two AMPA [2-amino-3-(3-hydroxy-5-methyl-isoxazol-4-yl)propanoic acid] receptor subunits GluA1 and GluA4; one kainate receptor subunit GluK2; one NMDA (N-methyl-D-aspartate) receptor subunit GluN2D and one delta receptor subunit GluD2 were significantly decreased in the CeA of alcoholics. In contrast, of the 19 GABA-A receptor subunits, only the mRNA encoding the α2 subunit was significantly down-regulated in the CeA of the alcoholics as compared with control subjects. Our findings imply that the down-regulation of specific ionotropic glutamate and GABA-A receptor subunits in the CeA of alcoholics may represent one of the molecular substrates underlying the new balance between excitatory and inhibitory neurotransmission in alcohol dependence.

Expression of specific ionotropic glutamate and GABA-A receptor subunits is decreased in central amygdala of alcoholics

PubMed Central

Jin, Zhe; Bhandage, Amol K.; Bazov, Igor; Kononenko, Olga; Bakalkin, Georgy; Korpi, Esa R.; Birnir, Bryndis

2014-01-01

The central amygdala (CeA) has a role for mediating fear and anxiety responses. It is also involved in emotional imbalance caused by alcohol abuse and dependence and in regulating relapse to alcohol abuse. Growing evidences suggest that excitatory glutamatergic and inhibitory γ-aminobutyric acid-ergic (GABAergic) transmissions in the CeA are affected by chronic alcohol exposure. Human post-mortem CeA samples from male alcoholics (n = 9) and matched controls (n = 9) were assayed for the expression level of ionotropic glutamate and GABA-A receptors subunit mRNAs using quantitative real-time reverse transcription-PCR (RT-qPCR). Our data revealed that out of the 16 ionotropic glutamate receptor subunits, mRNAs encoding two AMPA [2-amino-3-(3-hydroxy-5-methyl-isoxazol-4-yl)propanoic acid] receptor subunits GluA1 and GluA4; one kainate receptor subunit GluK2; one NMDA (N-methyl-D-aspartate) receptor subunit GluN2D and one delta receptor subunit GluD2 were significantly decreased in the CeA of alcoholics. In contrast, of the 19 GABA-A receptor subunits, only the mRNA encoding the α2 subunit was significantly down-regulated in the CeA of the alcoholics as compared with control subjects. Our findings imply that the down-regulation of specific ionotropic glutamate and GABA-A receptor subunits in the CeA of alcoholics may represent one of the molecular substrates underlying the new balance between excitatory and inhibitory neurotransmission in alcohol dependence. PMID:25278838

Surface expression of hippocampal NMDA GluN2B receptors regulated by fear conditioning determines its contribution to memory consolidation in adult rats.

PubMed

Sun, Yan-Yan; Cai, Wei; Yu, Jie; Liu, Shu-Su; Zhuo, Min; Li, Bao-Ming; Zhang, Xue-Han

2016-08-04

The number and subtype composition of N-methyl-d-aspartate receptor (NMDAR) at synapses determines their functional properties and role in learning and memory. Genetically increased or decreased amount of GluN2B affects hippocampus-dependent memory in the adult brain. But in some experimental conditions (e.g., memory elicited by a single conditioning trial (1 CS-US)), GluN2B is not a necessary factor, which indicates that the precise role of GluN2B in memory formation requires further exploration. Here, we examined the role of GluN2B in the consolidation of fear memory using two training paradigms. We found that GluN2B was only required for the consolidation of memory elicited by five conditioning trials (5 CS-US), not by 1 CS-US. Strikingly, the expression of membrane GluN2B in CA1was training-strength-dependently increased after conditioning, and that the amount of membrane GluN2B determined its involvement in memory consolidation. Additionally, we demonstrated the increases in the activities of cAMP, ERK, and CREB in the CA1 after conditioning, as well as the enhanced intrinsic excitability and synaptic efficacy in CA1 neurons. Up-regulation of membrane GluN2B contributed to these enhancements. These studies uncover a novel mechanism for the involvement of GluN2B in memory consolidation by its accumulation at the cell surface in response to behavioral training.

GRIN1 mutation associated with intellectual disability alters NMDA receptor trafficking and function.

PubMed

Chen, Wenjuan; Shieh, Christine; Swanger, Sharon A; Tankovic, Anel; Au, Margaret; McGuire, Marianne; Tagliati, Michele; Graham, John M; Madan-Khetarpal, Suneeta; Traynelis, Stephen F; Yuan, Hongjie; Pierson, Tyler Mark

2017-06-01

N-methyl-d-aspartate receptors (NMDARs) play important roles in brain development and neurological disease. We report two individuals with similar dominant de novo GRIN1 mutations (c.1858 G>A and c.1858 G>C; both p.G620R). Both individuals presented at birth with developmental delay and hypotonia associated with behavioral abnormalities and stereotypical movements. Recombinant NMDARs containing the mutant GluN1-G620R together with either GluN2A or GluN2B were evaluated for changes in their trafficking to the plasma membrane and their electrophysiological properties. GluN1-G620R/GluN2A complexes showed a mild reduction in trafficking, a ~2-fold decrease in glutamate and glycine potency, a strong decrease in sensitivity to Mg 2+ block, and a significant reduction of current responses to a maximal effective concentration of agonists. GluN1-G620R/GluN2B complexes showed significantly reduced delivery of protein to the cell surface associated with similarly altered electrophysiology. These results indicate these individuals may have suffered neurodevelopmental deficits as a result of the decreased presence of GluN1-G620R/GluN2B complexes on the neuronal surface during embryonic brain development and reduced current responses of GluN1-G620R-containing NMDARs after birth. These cases emphasize the importance of comprehensive functional characterization of de novo mutations and illustrates how a combination of several distinct features of NMDAR expression, trafficking and function can be present and influence phenotype.

Adenosine A2A receptors are required for glutamate mGluR5- and dopamine D1 receptor-evoked ERK1/2 phosphorylation in rat hippocampus: involvement of NMDA receptor.

PubMed

Krania, Paraskevi; Dimou, Eleni; Bantouna, Maria; Kouvaros, Stylianos; Tsiamaki, Eirini; Papatheodoropoulos, Costas; Sarantis, Konstantinos; Angelatou, Fevronia

2018-05-01

Interaction between mGluR5 and NMDA receptors (NMDAR) is vital for synaptic plasticity and cognition. We recently demonstrated that stimulation of mGluR5 enhances NMDAR responses in hippocampus by phosphorylating NR2B(Tyr1472) subunit, and this reaction was enabled by adenosine A 2A receptors (A 2A R) (J Neurochem, 135, 2015, 714). In this study, by using in vitro phosphorylation and western blot analysis in hippocampal slices of male Wistar rats, we show that mGluR5 stimulation or mGluR5/NMDARs co-stimulation synergistically activate ERK1/2 signaling leading to c-Fos expression. Interestingly, both reactions are under the permissive control of endogenous adenosine acting through A 2A Rs. Moreover, mGluR5-mediated ERK1/2 phosphorylation depends on NMDAR, which however exhibits a metabotropic way of function, since no ion influx through its ion channel is required. Furthermore, our results demonstrate that mGluR5 and mGluR5/NMDAR-evoked ERK1/2 activation correlates well with the mGluR5/NMDAR-evoked NR2B(Tyr1472) phosphorylation, since both phenomena coincide temporally, are Src dependent, and are both enabled by A 2A Rs. This indicates a functional involvement of NR2B(Tyr1472) phosphorylation in the ERK1/2 activation. Our biochemical results are supported by electrophysiological data showing that in CA1 region of hippocampus, the theta burst stimulation (TBS)-induced long-term potentiation coincides temporally with an increase in ERK1/2 activation and both phenomena are dependent on the tripartite A 2A , mGlu5, and NMDARs. Furthermore, we show that the dopamine D1 receptors evoked ERK1/2 activation as well as the NR2B(Tyr1472) phosphorylation are also regulated by endogenous adenosine and A 2A Rs. In conclusion, our results highlight the A 2A Rs as a crucial regulator not only for NMDAR responses, but also for regulating ERK1/2 signaling and its downstream pathways, leading to gene expression, synaptic plasticity, and memory consolidation. © 2017 International Society for Neurochemistry.

The role of enzyme distortion in the single displacement mechanism of family 19 chitinases

PubMed Central

Brameld, Ken A.; Goddard, William A.

1998-01-01

By using molecular dynamics simulations, we have examined the binding of a hexaNAG substrate and two potential hydrolysis intermediates (an oxazoline ion and an oxocarbenium ion) to a family 19 barley chitinase. We find the hexaNAG substrate binds with all sugars in a chair conformation, unlike the family 18 chitinase which causes substrate distortion. Glu 67 is in a position to protonate the anomeric oxygen linking sugar residues D and E whereas Asn 199 serves to hydrogen bond with the C2′ N-acetyl group of sugar D, thus preventing the formation of an oxazoline ion intermediate. In addition, Glu 89 is part of a flexible loop region allowing a conformational change to occur within the active site to bring the oxocarbenium ion intermediate and Glu 89 closer by 4–5 Å. A hydrolysis product with inversion of the anomeric configuration occurs because of nucleophilic attack by a water molecule that is coordinated by Glu 89 and Ser 120. Issues important for the design of inhibitors specific to family 19 chitinases over family 18 chitinases also are discussed. PMID:9539727

Metabotropic and ionotropic glutamate receptors mediate the modulation of acetylcholine release at the frog neuromuscular junction.

PubMed

Tsentsevitsky, Andrei; Nurullin, Leniz; Nikolsky, Evgeny; Malomouzh, Artem

2017-07-01

There is some evidence that glutamate (Glu) acts as a signaling molecule at vertebrate neuromuscular junctions where acetylcholine (ACh) serves as a neurotransmitter. In this study, performed on the cutaneous pectoris muscle of the frog Rana ridibunda, Glu receptor mechanisms that modulate ACh release processes were analyzed. Electrophysiological experiments showed that Glu reduces both spontaneous and evoked quantal secretion of ACh and synchronizes its release in response to electrical stimulation. Quisqualate, an agonist of ionotropic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic receptors and metabotropic Group I mGlu receptors, also exerted Glu-like inhibitory effects on the secretion of ACh but had no effect on the kinetics of quantal release. Quisqualate's inhibitory effect did not occur when a blocker of Group I mGlu receptors (LY 367385) or an inhibitor of phospholipase C (U73122) was present. An increase in the degree of synchrony of ACh quantal release, such as that produced by Glu, was obtained after application of N-methyl-D-aspartic acid (NMDA). The presence of Group I mGlu and NMDA receptors in the neuromuscular synapse was confirmed by immunocytochemistry. Thus, the data suggest that both metabotropic Group I mGlu receptors and ionotropic NMDA receptors are present at the neuromuscular synapse of amphibians, and that the activation of these receptors initiates different mechanisms for the regulation of ACh release from motor nerve terminals. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Cell-wall preparation containing poly-γ-D-glutamate covalently linked to peptidoglycan, a straightforward extractable molecule, protects mice against experimental anthrax infection.

PubMed

Candela, Thomas; Dumetz, Fabien; Tosi-Couture, Evelyne; Mock, Michèle; Goossens, Pierre L; Fouet, Agnès

2012-12-17

Bacillus anthracis is the causative agent of anthrax that is characterized by septicemia and toxemia. Many vaccine strategies were described to counteract anthrax infection. In contrast with veterinary live vaccines, currently human vaccines are acellular with the protective antigen, a toxin component, as the main constituent. However, in animal models this vaccine is less efficient than the live vaccine. In this study, we analyzed the protection afforded by a single extractable surface element. The poly-γ-D-glutamate capsule is covalently linked to the peptidoglycan. A preparation of peptidoglycan-linked poly-γ-D-glutamate (GluPG) was tested for its immunogenicity and its protective effect. GluPG injection, in mice, elicited the production of specific antibodies directed against poly-glutamate and partially protected the animals against lethal challenges with a non-toxinogenic strain. When combined to protective antigen, GluPG immunization conferred full protection against cutaneous anthrax induced with a fully virulent strain. Copyright © 2012 Elsevier Ltd. All rights reserved.

Influence of feeding supplements of almond hulls and ensiled citrus pulp on the milk production, milk composition, and methane emissions of dairy cows.

PubMed

Williams, S R O; Chaves, A V; Deighton, M H; Jacobs, J L; Hannah, M C; Ribaux, B E; Morris, G L; Wales, W J; Moate, P J

2018-03-01

Almond hulls and citrus pulp have been fed to dairy cows with variable responses for milk production, but no information exists on their effect on enteric methane emissions. This experiment examined the effects of dietary supplementation with either almond hulls or ensiled citrus pulp on the milk yield, milk composition, and enteric methane emissions of dairy cows. Thirty-two Holstein dairy cows in mid lactation were offered 1 of 3 diets over a 28-d experiment. Twelve cows received a control (CON) diet, 10 cows a diet containing almond hulls (ALH), and 10 cows a diet containing ensiled citrus pulp (CIT). All cows were offered 6.0 kg of dry matter (DM)/d of crushed corn, 2.0 kg of DM/d of cold-pressed canola, and 0.2 kg of DM/d of a mineral mix. In addition, cows fed the CON diet were offered 14.5 kg of DM/d of alfalfa cubes; cows fed the ALH diet were offered 10.5 kg of DM/d of alfalfa cubes and 4.0 kg of DM/d of almond hulls; and cows on the CIT diet were offered 11.5 kg of DM/d of alfalfa cubes and 3.0 kg of DM/d of ensiled citrus pulp. Milk yield was measured daily and milk composition was measured on 4 d of each week. Individual cow methane emissions were measured by a sulfur hexafluoride tracer technique on d 24 to 28 of the experiment. The mean milk yield of cows fed the CON diet (27.4 kg/d) was greater than the mean milk yield of cows fed the ALH diet (24.6 kg/cow per day), whereas the mean milk yield of cows fed the CIT diet (26.2 kg/cow per day) was not different from the mean milk yield from cows fed the other 2 diets. Dietary treatment did not influence the concentrations of milk fat, protein, and lactose or fat yields, but the mean protein yield from cows fed the CON diet (0.87 kg/d) was greater than that from cows fed the ALH diet (0.78 kg/d) but not different to those fed the CIT diet (0.85 kg/d). In general, we found no differences in the proportion of individual fatty acids in milk. The mean pH of ruminal fluid from cows offered the CON diet was not different to the pH in the ruminal fluids of cows offered the ALH or the CIT diets. The mean methane emissions (g/d) and yields (g/kg of DM intake) were not influenced by dietary treatment. These findings indicate that, although almond hulls and ensiled citrus pulp can be used as a low-cost feed supplement, almond hulls did negatively affect milk production and neither inhibited enteric methane emissions. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

The endocannabinoid 2-arachidonoylglycerol mediates D1 and D2 receptor cooperative enhancement of rat nucleus accumbens core neuron firing.

PubMed

Seif, T; Makriyannis, A; Kunos, G; Bonci, A; Hopf, F W

2011-10-13

Many motivated and addiction-related behaviors are sustained by activity of both dopamine D1- and D2-type receptors (D1Rs and D2Rs) as well as CB1 receptors (CB1Rs) in the nucleus accumbens (NAc). Here, we use in vitro whole-cell patch-clamp electrophysiology to describe an endocannabinoid (eCB)-dopamine receptor interaction in adult rat NAc core neurons. D1R and D2R agonists in combination enhanced firing, with no effect of a D1R or D2R agonist alone. This D1R+D2R-mediated firing increase required CB1Rs, since it was prevented by the CB1R antagonists AM251 and Rimonabant. The D1R+D2R firing increase also required phospholipase C (PLC), the major synthesis pathway for the eCB 2-arachidonoylglycerol (2-AG) and one of several pathways for anandamide. Further, inhibition of 2-AG hydrolysis with the monoglyceride lipase (MGL) inhibitor JZL184 allowed subthreshold levels of D1R+D2R receptor agonists to enhance firing, while inhibition of anandamide hydrolysis with the fatty acid amide hydrolase (FAAH) inhibitors URB597 or AM3506 did not. Filling the postsynaptic neuron with 2-AG enabled subthreshold D1R+D2R agonists to increase firing, and the 2AG+D1R+D2R increase in firing was prevented by a CB1R antagonist. Also, the metabotropic glutamate receptor 5 (mGluR5) blocker MPEP prevented the ability of JZL184 to promote subthreshold D1R+D2R enhancement of firing, while the 2-AG+D1R+D2R increase in firing was not prevented by the mGluR5 blocker, suggesting that mGluR5s acted upstream of 2-AG production. Thus, our results taken together are consistent with the hypothesis that NAc core eCBs mediate dopamine receptor (DAR) enhancement of firing, perhaps providing a cellular mechanism underlying the central role of NAc core D1Rs, D2Rs, CB1Rs, and mGluR5s during many drug-seeking behaviors. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

THE ENDOCANNABINOID 2-ARACHIDONOYLGLYCEROL MEDIATES D1 AND D2 RECEPTOR COOPERATIVE ENHANCEMENT OF RAT NUCLEUS ACCUMBENS CORE NEURON FIRING

PubMed Central

Seif, T.; Makriyannis, A.; Kunos, G.; Bonci, A.; Hopf, F. W.

2011-01-01

Many motivated and addiction-related behaviors are sustained by activity of both dopamine D1- and D2-type receptors (D1Rs and D2Rs) as well as CB1 receptors (CB1Rs) in the nucleus accumbens (NAc). Here, we use in vitro whole-cell patch-clamp electrophysiology to describe an endocannabinoid (eCB)–dopamine receptor interaction in adult rat NAc core neurons. D1R and D2R agonists in combination enhanced firing, with no effect of a D1R or D2R agonist alone. This D1R+D2R-mediated firing increase required CB1Rs, since it was prevented by the CB1R antagonists AM251 and Rimonabant. The D1R+D2R firing increase also required phospholipase C (PLC), the major synthesis pathway for the eCB 2-arachidonoylglycerol (2-AG) and one of several pathways for anandamide. Further, inhibition of 2-AG hydrolysis with the monoglyceride lipase (MGL) inhibitor JZL184 allowed subthreshold levels of D1R+D2R receptor agonists to enhance firing, while inhibition of anandamide hydrolysis with the fatty acid amide hydrolase (FAAH) inhibitors URB597 or AM3506 did not. Filling the postsynaptic neuron with 2-AG enabled subthreshold D1R+D2R agonists to increase firing, and the 2AG+D1R+D2R increase in firing was prevented by a CB1R antagonist. Also, the metabotropic glutamate receptor 5 (mGluR5) blocker MPEP prevented the ability of JZL184 to promote subthreshold D1R+D2R enhancement of firing, while the 2-AG+D1R+D2R increase in firing was not prevented by the mGluR5 blocker, suggesting that mGluR5s acted upstream of 2-AG production. Thus, our results taken together are consistent with the hypothesis that NAc core eCBs mediate dopamine receptor (DAR) enhancement of firing, perhaps providing a cellular mechanism underlying the central role of NAc core D1Rs, D2Rs, CB1Rs, and mGluR5s during many drug-seeking behaviors. PMID:21821098

Cupuassu (Theobroma grandiflorum) pulp, probiotic, and prebiotic: Influence on color, apparent viscosity, and texture of goat milk yogurts.

PubMed

Costa, Marion P; Frasao, Beatriz S; Silva, Adriana Cristina O; Freitas, Mônica Q; Franco, Robson M; Conte-Junior, Carlos A

2015-09-01

Cupuassu is an acidic fruit that has a characteristic aroma, flavor, and texture; its fiber-rich pulp can provide a different consistency than other fruit pulps. Goat milk is an excellent source of amino acids, fatty acids, and minerals, and is widely used for processing fermented milks, such as yogurt. However, compared with cow milk yogurts, it is difficult to make goat milk yogurts with a good consistency. Therefore, it is necessary to use certain technological strategies. This study was carried out to investigate the possibility of adding cupuassu pulp, probiotic (Lactobacillus acidophilus LA-5), and prebiotic (inulin) to improve the texture of goat milk yogurt. A total of 6 treatments were performed: natural (N), probiotic (Pro), prebiotic (Pre), synbiotic (S), cupuassu (C), and probiotic with cupuassu (PC). The viability of probiotic in yogurts (Pro, S, and PC) was evaluated. In addition, instrumental analyses (pH, color, apparent viscosity, and texture) were performed to evaluate the influence of these different ingredients on goat milk yogurts. The probiotic bacteria remained viable (≥7 log cfu·mL(-1)) throughout the 28d of refrigerated storage, which exceeded the minimum count required to confer probiotic physiological benefits. The pH levels of the yogurts inoculated with L. acidophilus (Pro, S, and PC) were lower than others yogurts (N, Pre, and C). However, all yogurt samples underwent gradual decreases in pH until 7 to 14d of storage. The lightness (L*) was affected initially by addition of all ingredients (cupuassu pulp, probiotic, and prebiotic). The addition of cupuassu pulp (C and PC) increased the L* during the period of storage. Apparent viscosity and firmness decreased in the PC yogurt. The consistency was highest in the yogurts with added prebiotic (Pre and S) than the other yogurts (N, Pro, C, and PC) at the end of the storage period (d 28). The cohesiveness remained constant in all yogurts (N, Pro, Pre, S, C, and PC). Based on the results obtained from the current study, it was concluded that cupuassu pulp addition improves the texture of goat milk yogurts. Therefore, this pulp could be an important technological strategy for the dairy goat industry. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Impaired discrimination learning in interneuronal NMDAR-GluN2B mutant mice.

PubMed

Brigman, Jonathan L; Daut, Rachel A; Saksida, Lisa; Bussey, Timothy J; Nakazawa, Kazu; Holmes, Andrew

2015-06-17

Previous studies have established a role for N-methyl-D-aspartate receptor (NMDAR) containing the GluN2B subunit in efficient learning behavior on a variety of tasks. Recent findings have suggested that NMDAR on GABAergic interneurons may underlie the modulation of striatal function necessary to balance efficient action with cortical excitatory input. Here we investigated how loss of GluN2B-containing NMDAR on GABAergic interneurons altered corticostriatal-mediated associative learning. Mutant mice (floxed-GluN2B×Ppp1r2-Cre) were generated to produce loss of GluN2B on forebrain interneurons and phenotyped on a touchscreen-based pairwise visual learning paradigm. We found that the mutants showed normal performance during Pavlovian and instrumental pretraining, but were significantly impaired on a discrimination learning task. Detailed analysis of the microstructure of discrimination performance revealed reduced win→stay behavior in the mutants. These results further support the role of NMDAR, and GluN2B in particular, on modulation of striatal function necessary for efficient choice behavior and suggest that NMDAR on interneurons may play a critical role in associative learning.

43.1 GENETIC INSIGHTS LEAD TO DISCOVERY OF SELECTIVE ACTIVATORS OF MGLU1 AND MGLU3 METABOTROPIC GLUTAMATE RECEPTORS AS POTENTIAL TREATMENTS FOR SCHIZOPHRENIA

PubMed Central

Conn, P Jeffrey; Yohn, Samantha; Stansley, Branden; Foster, Dan; Plumley, Hyekyung; Lindsley, Craig

2018-01-01

Abstract Background A large number of clinical and preclinical studies suggest that dysfunction at synapses for the excitatory neurotransmitter glutamate may play a critical role in the pathophysiological changes that underlie each of the major symptom clusters observed in schizophrenia patients. Interestingly, recent genetic studies identified multiple nonsynonymous single nucleotide polymorphisms (SNPs) in the human genes encoding two specific subtypes of metabotropic glutamate (mGlu) receptors that are associated with schizophrenia. These include GRM1 and GRM3, the genes encoding for the mGlu1 and mGlu3 receptor subtypes respectively. Furthermore, postmortem studies suggest that expression of these mGlu receptor subtypes is altered brains of schizophrenia patients compared to controls. Mutations in GRM1 were identified a range of schizophrenia patients, whereas SNPs in the human gene encoding mGlu3 (GRM3) are selectively associated with poor performance on cognitive tests that are dependent on function of the prefrontal cortex (PFC) and hippocampus. These studies raise the possibility that disrupted signaling of mGlu1 and/or mGlu3 could contribute to the symptoms of schizophrenia and that selective modulators of these receptors could provide a novel approach to treatment of this disorder. Methods Wild-type and mutant forms of mGlu receptors were expressed in cell lines and used for discovery and optimization of highly selective positive allosteric modulators (PAMs) of mGlu1 and mGlu3. Optimized mGlu1 and mGlu3 PAMs were then used along with mouse genetic studies to evaluate the roles of these receptors in specific basal ganglia and forebrain circuits that have been implicated in schizophrenia. Finally, these compounds were used in animal models to assess potential efficacy in rodent models that are relevant for reducing positive, negative, and cognitive symptoms that are observed in schizophrenia patients. Results GRM1 mutations associated with schizophrenia were found to reduce mGlu1 signaling, suggesting that loss of function of this receptor could contribute to symptoms associated with schizophrenia. Furthermore, we found that highly selective mGlu1 PAMs reverse deficits in mGlu1 signaling observed in these mutant receptors, induced a profound reduction in dopamine release in striatal areas implicated in schizophrenia, and have robust antipsychotic-like effects that are mediated by localized inhibition of dopamine release in striatum. In contrast to existing antipsychotic medications, selective mGlu1 PAMs also improve motivation and reduce anhedonia in animal models. Interestingly, selective mGlu3 PAMs have multiple effects in the prefrontal cortex and hippocampus that would be expected to improve cognitive function. Consistent with this, highly selective mGlu3 PAMs have robust cognition-enhancing effects in rodent models that are relevant for the cognitive deficits observed in schizophrenia patients. Discussion These studies provide exciting new evidence that highly selective activators of two glutamate receptors identified in human genetic studies have potential utility in treatment of positive (mGLu1), negative (mGlu1), and cognitive (mGlu3) symptoms of schizophrenia patients. Furthermore, the novel mGlu1 and mGlu3 PAMs discovered in these studies provide excellent drug leads for further optimization and ultimate clinical testing.

[Effect of an introgression from Aegilops cylindrica host on manifestation of productivity traits in winter common wheat F2 plants].

PubMed

Kozub, N A; Sozinov, I A; sozinov, A A

2004-12-01

The effect of introgression of a chromosome 1D segment from Aegilops cylindrica to winter common wheat on productivity traits in F2 plants was studied using storage protein loci as genetic markers. An allele of the gliadin-coding Gli-D1 locus served as a marker of the introgression. Using of two- and three-locus interaction models, it was shown that the introgression tagged with Gli-D1 affected the manifestation of productivity traits (productive tillering, grain weight per plant and grain number per plant) through interaction with other marker storage protein loci: Glu-B1, Glu-D1, and Gli-B2.

FBXL5 interacts with p150 {sup Glued} and regulates its ubiquitination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang Ning; Liu Jing; Ding Xia

2007-07-20

The microtubule motor cytoplasmic dynein and its activator dynactin drive vesicular transport and mitotic spindle organization. p150 {sup Glued} is the dynactin subunit responsible for binding to dynein and microtubules. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which governs phosphorylation-dependent ubiquitination and subsequent proteolysis. Our recent study showed that the proteolysis of mitotic kinesin CENP-E is mediated by SCF via a direct Skp1 link [D. Liu, N. Zhang, J. Du, X. Cai, M. Zhu, C. Jin, Z. Dou, C. Feng, Y. Yang, L. Liu, K. Takeyasu, W. Xie, X. Yao,more » Interaction of Skp1 with CENP-E at the midbody is essential for cytokinesis, Biochem. Biophys. Res. Commun. 345 (2006) 394-402]. Here we show that F-box protein FBXL5 interacts with p150 {sup Glued} and orchestrates its turnover via ubiquitination. FBXL5 binds to p150 {sup Glued} in vitro and in vivo. FBXL5 and p150 {sup Glued} co-localize primarily in the cytoplasm with peri-nuclear enrichment in HeLa cells. Overexpression of FBXL5 promotes poly-ubiquitination of p150 {sup Glued} and protein turnover of p150 {sup Glued} . Our findings provide a potential mechanism by which p150 {sup Glued} protein function is regulated by SCFs.« less

Ghrelin upregulates the phosphorylation of the GluN2B subunit of the NMDA receptor by activating GHSR1a and Fyn in the rat hippocampus.

PubMed

Berrout, Liza; Isokawa, Masako

2018-01-01

Ghrelin and its receptor GHSR1a have been shown to exert numerous physiological functions in the brain, in addition to the well-established orexigenic role in the hypothalamus. Earlier work indicated that ghrelin stimulated the phosphorylation of the GluN1 subunit of the NMDA receptor (NMDAR) and enhanced synaptic transmission in the hippocampus. In the present study, we report that the exogenous application of ghrelin increased GluN2B phosphorylation. This increase was independent of GluN2B subunit activity or NMDAR channel activity. However, it depended on the activation of GHSR1a and Fyn as it was blocked by D-Lys3-GHRP-6 and PP2, respectively. Inhibitors for G-protein-regulated second messengers, such as Rp-cAMP, H89, TBB, ryanodine, and thapsigargin, unexpectedly enhanced GluN2B phosphorylation, suggesting that cAMP, PKA, casein kinase II, and cytosolic calcium signaling may oppose to the effect of ghrelin on the phosphorylation of GluN2B. Our findings suggest that 1) GluN2B is likely a molecular target of ghrelin and GHSR1a-driven signaling cascades, and 2) the ghrelin-mediated phosphorylation of GluN2B depends on Fyn activation under complex negative regulation by other second messengers. Copyright © 2017 Elsevier B.V. All rights reserved.

Production of pyroglutamic acid by thermophilic lactic acid bacteria in hard-cooked mini-cheeses.

PubMed

Mucchetti, G; Locci, F; Massara, P; Vitale, R; Neviani, E

2002-10-01

Pyroglutamic acid is present in high amounts (0.5g/ 100g) in many cheese varieties-and particularly in extensively ripened Italian cheeses such as Grana Padano and Parmigiano Reggiano. An in vivo model system for cooked mini-cheese production and ripening acceleration was set up to demonstrate the ability of thermophilic lactic acid bacteria, used as a starter, to produce pyroglutamic acid (pGlu). In mini-cheeses stored at 38 and 30 degrees C for up to 45 d, all starters tested produced different amounts of pGlu. In descending order of pGlu production, the bacteria analyzed were: Lactobacillus helveticus, Lactobacillus delbrueckii subsp. bulgaricus, Streptococcus thermophilus, and Lactobacillus delbrueckii subsp. lactis. Evidence for the presence of glutamine to pGlu cyclase activity in lactic acid bacteria was provided. Cell lysates obtained from cultures of L. helveticus, L. delbrueckii subsp. bulgaricus, L. delbrueckii subsp. lactis, and S. thermophilus showed the ability to cyclize glutamine to pGlu, resulting in processing yields from 1.4 to 30.3%, depending on the subspecies. Formation of pGlu from free glutamine appeared to be similar to that observed using a glutamine-glutamine dipeptide substrate. Under the experimental conditions applied, pGlu aminopeptidase activity was only detected in L. helveticus. Thus, pGlu formation in long-ripened cooked cheese may depend on the activity of thermophilic lactic acid bacteria.

Oxygen-Inducible Glutamate Oxaloacetate Transaminase as Protective Switch Transforming Neurotoxic Glutamate to Metabolic Fuel During Acute Ischemic Stroke

PubMed Central

Rink, Cameron; Gnyawali, Surya; Peterson, Laura

2011-01-01

Abstract This work rests on our previous report (J Cereb Blood Flow Metab 30: 1275–1287, 2010) recognizing that glutamate (Glu) oxaloacetate transaminase (GOT) is induced when brain tissue hypoxia is corrected during acute ischemic stroke (AIS). GOT can metabolize Glu into tricarboxylic acid cycle intermediates and may therefore be useful to harness excess neurotoxic extracellular Glu during AIS as a metabolic substrate. We report that in cultured neural cells challenged with hypoglycemia, extracellular Glu can support cell survival as long as there is sufficient oxygenation. This effect is abrogated by GOT knockdown. In a rodent model of AIS, supplemental oxygen (100% O2 inhaled) during ischemia significantly increased GOT expression and activity in the stroke-affected brain tissue and prevented loss of ATP. Biochemical analyses and in vivo magnetic resonance spectroscopy during stroke demonstrated that such elevated GOT decreased Glu levels at the stroke-affected site. In vivo lentiviral gene delivery of GOT minimized lesion volume, whereas GOT knockdown worsened stroke outcomes. Thus, brain tissue GOT emerges as a novel target in managing stroke outcomes. This work demonstrates that correction of hypoxia during AIS can help clear extracellular neurotoxic Glu by enabling utilization of this amino acid as a metabolic fuel to support survival of the hypoglycemic brain tissue. Strategies to mitigate extracellular Glu-mediated neurodegeneration via blocking receptor-mediated excitotoxicity have failed in clinical trials. We introduce the concept that under hypoglycemic conditions extracellular Glu can be transformed from a neurotoxin to a survival factor by GOT, provided there is sufficient oxygen to sustain cellular respiration. Antioxid. Redox Signal. 14, 1777–1785. PMID:21361730

Human dental pulp stem cells produce mineralized matrix in 2D and 3D cultures

PubMed Central

Riccio, M.; Resca, E.; Maraldi, T.; Pisciotta, A.; Ferrari, A.; Bruzzesi, G.; De Pol, A.

2010-01-01

The aim of this study was to characterize the in vitro osteogenic differentiation of dental pulp stem cells (DPSCs) in 2D cultures and 3D biomaterials. DPSCs, separated from dental pulp by enzymatic digestion, and isolated by magnetic cell sorting were differentiated toward osteogenic lineage on 2D surface by using an osteogenic medium. During differentiation process, DPSCs express specific bone proteins like Runx-2, Osx, OPN and OCN with a sequential expression, analogous to those occurring during osteoblast differentiation, and produce extracellular calcium deposits. In order to differentiate cells in a 3D space that mimes the physiological environment, DPSCs were cultured in two distinct bioscaffolds, Matrigel™ and Collagen sponge. With the addition of a third dimension, osteogenic differentiation and mineralized extracellular matrix production significantly improved. In particular, in Matrigel™ DPSCs differentiated with osteoblast/osteocyte characteristics and connected by gap junction, and therefore formed calcified nodules with a 3D intercellular network. Furthermore, DPSCs differentiated in collagen sponge actively secrete human type I collagen micro-fibrils and form calcified matrix containing trabecular-like structures. These neo-formed DPSCs-scaffold devices may be used in regenerative surgical applications in order to resolve pathologies and traumas characterized by critical size bone defects. PMID:21263745

The role of GluN2A and GluN2B NMDA receptor subunits in AgRP and POMC neurons on body weight and glucose homeostasis.

PubMed

Üner, Aykut; Gonçalves, Gabriel H M; Li, Wenjing; Porceban, Matheus; Caron, Nicole; Schönke, Milena; Delpire, Eric; Sakimura, Kenji; Bjørbæk, Christian

2015-10-01

Hypothalamic agouti-related peptide (AgRP) and pro-opiomelanocortin (POMC) expressing neurons play critical roles in control of energy balance. Glutamatergic input via n-methyl-d-aspartate receptors (NMDARs) is pivotal for regulation of neuronal activity and is required in AgRP neurons for normal body weight homeostasis. NMDARs typically consist of the obligatory GluN1 subunit and different GluN2 subunits, the latter exerting crucial differential effects on channel activity and neuronal function. Currently, the role of specific GluN2 subunits in AgRP and POMC neurons on whole body energy and glucose balance is unknown. We used the cre-lox system to genetically delete GluN2A or GluN2B only from AgRP or POMC neurons in mice. Mice were then subjected to metabolic analyses and assessment of AgRP and POMC neuronal function through morphological studies. We show that loss of GluN2B from AgRP neurons reduces body weight, fat mass, and food intake, whereas GluN2B in POMC neurons is not required for normal energy balance control. GluN2A subunits in either AgRP or POMC neurons are not required for regulation of body weight. Deletion of GluN2B reduces the number of AgRP neurons and decreases their dendritic length. In addition, loss of GluN2B in AgRP neurons of the morbidly obese and severely diabetic leptin-deficient Lep (ob/ob) mice does not affect body weight and food intake but, remarkably, leads to full correction of hyperglycemia. Lep (ob/ob) mice lacking GluN2B in AgRP neurons are also more sensitive to leptin's anti-obesity actions. GluN2B-containing NMDA receptors in AgRP neurons play a critical role in central control of body weight homeostasis and blood glucose balance via mechanisms that likely involve regulation of AgRP neuronal survival and structure, and modulation of hypothalamic leptin action.

Two peptide receptor ligands (99m)Tc-EDDA/HYNIC-Tyr(3)-octreotide and (99m)Tc-EDDA/HYNIC-(D)Glu-octagastrin for scintigraphy of medullary thyroid carcinoma.

PubMed

Kosowicz, Jerzy; Mikołajczak, Renata; Czepczyński, Rafał; Ziemnicka, Katarzyna; Gryczyńska, Maria; Sowiński, Jerzy

2007-10-01

Somatostatin and gastrin receptors are overexpressed in medullary thyroid carcinoma (MTC) cells; hence, both of them are potential targets for peptide receptor scintigraphy and radiotherapy. Therefore, the aim of our study was to assess the clinical value of two technetium-99m-labeled peptides, a new gastrin analog, the EDDA/HYNIC-(D)Glu-octagastrin and a somatostatin analog, EDDA/HYNIC-Tyr(3)-octreotide (EDDA/HYNIC-TOC) for scintigraphy in patients with MTC to detect recurrences and metastases and select patients for peptide receptor radiotherapy. Thirty (30) patients, 20 females and 10 males, 22-83 years of age (mean, 52.7) with the diagnosis of MTC in different stages of the disease (preoperative, postsurgery, remission, recurrence, or metastatic disease) were included in this study. Before surgery, in all patients serum calcitonin concentrations were elevated. The diagnosis of MTC was confirmed in all cases by histopathology of the removed tumor and immunohistochemical staining giving positive reactions for calcitonin and chromogranin A. Imaging studies using (99m)Tc-EDDA/HYNIC-TOC and a new minigastrin analog, (99m)Tc-EDDA/HYNIC-(D)Glu-octagastrin, were performed in each patient and the results compared with each other and with other imaging methods. Scans of the whole body, head, neck, and chest were performed 2 and 4 hours after injections of the tracer, 500-600 MBq in each case, using a double-head Varicam (Elscint, Israel) gamma camera. (99m)Tc-EDDA/HYNIC-TOC detected somatostatin receptor-positive lesions in 20 patients with MTC, whereas (99m)Tc-EDDA/HYNIC-(D)Glu-octagastrin displayed gastrin receptors in 11 patients. In 9 cases, the scans were positive in both methods, although in 2 cases different pathologic foci were visualized. In 12 cases, only (99m)Tc-EDDA/HYNIC-TOC scintigraphy was positive, whereas in 3 other cases only (99m)Tc-EDDA/HYNIC-(D)Glu-octagastrin revealed pathologic lesions. Scintigraphy using (99m)Tc-HYNIC-TOC permits the visualization of somatostatin receptor-positive MTC in the majority of cases. The new gastrin analog, (99m)Tc-HYNIC-(D)Glu-octagastrin, is well tolerated, shows no renal retention, and in some cases of MTC, provides additional information on the expression of gastrin receptors. However, inferior quality of octagastrin scans indicates the need for further improvement of this radiopeptide.

Prenatal chronic mild stress induces depression-like behavior and sex-specific changes in regional glutamate receptor expression patterns in adult rats.

PubMed

Wang, Y; Ma, Y; Hu, J; Cheng, W; Jiang, H; Zhang, X; Li, M; Ren, J; Li, X

2015-08-20

Chronic stress during critical periods of human fetal brain development is associated with cognitive, behavioral, and mood disorders in later life. Altered glutamate receptor (GluR) expression has been implicated in the pathogenesis of stress-dependent disorders. To test whether prenatal chronic mild stress (PCMS) enhances offspring's vulnerability to stress-induced behavioral and neurobiological abnormalities and if this enhanced vulnerability is sex-dependent, we measured depression-like behavior in the forced swimming test (FST) and regional changes in GluR subunit expression in PCMS-exposed adult male and female rats. Both male and female PCMS-exposed rats exhibited stronger depression-like behavior than controls. Males and females exhibited unique regional changes in GluR expression in response to PCMS alone, FST alone (CON-FST), and PCMS with FST (PCMS-FST). In females, PCMS alone did not alter N-methyl-d-aspartate receptor (NMDAR) or metabotropic glutamate receptor (mGluR) expression, while in PCMS males, higher mGluR2/3, mGluR5, and NR1 expression levels were observed in the prefrontal cortex. In addition, PCMS altered the change in GluR expression induced by acute stress (the FST test), and this too was sex-specific. Male PCMS-FST rats expressed significantly lower mGluR5 levels in the hippocampus, lower mGluR5, NR1, postsynaptic density protein (PSD)95, and higher mGluR2/3 in the prefrontal cortex, and higher mGluR5 and PSD95 in the amygdala than male CON-FST rats. Female PCMS-FST rats expressed lower NR1 in the hippocampus, lower NR2B and PSD95 in the prefrontal cortex, lower mGluR2/3 in the amygdala, and higher PSD95 in the amygdala than female CON-FST rats. PCMS may increase the offspring's vulnerability to depression by altering sex-specific stress-induced changes in glutamatergic signaling. Copyright © 2015. Published by Elsevier Ltd.

The role of thermal energy storage in industrial energy conservation

NASA Technical Reports Server (NTRS)

Duscha, R. A.; Masica, W. J.

1979-01-01

Thermal Energy Storage for Industrial Applications is a major thrust of the Department of Energy's Thermal Energy Storage Program. Utilizing Thermal Energy Storage (TES) with process or reject heat recovery systems is shown to be extremely beneficial for several applications. Recent system studies resulting from contracts awarded by the Department of Energy (DOE) identified four especially significant industries where TES appears attractive - food processing, paper and pulp, iron and steel, and cement. Potential annual fuel savings with large scale implementation of near term TES systems for these industries is over 9,000,000 bbl of oil. This savings is due to recuperation and storage in the food processing industry, direct fuel substitution in the paper and pulp industry and reduction in electric utility peak fuel use through inplant production of electricity from utilization of reject heat in the steel and cement industries.

Feed intake, digestibility and energy partitioning in beef cattle fed diets with cassava pulp instead of rice straw.

PubMed

Kongphitee, Kanokwan; Sommart, Kritapon; Phonbumrung, Thamrongsak; Gunha, Thidarat; Suzuki, Tomoyuki

2018-03-13

This study was conducted to assess the effects of replacing rice straw with different proportions of cassava pulp on growth performance, feed intake, digestibility, rumen microbial population, energy partitioning and efficiency of metabolizable energy utilization in beef cattle. Eighteen yearling Thai native beef cattle (Bos indicus) with an average initial body weight of 98.3 ± 12.8 kg were allocated to one of three dietary treatments and fed ad libitum for 149 days in a randomized complete block design. Three dietary treatments using different proportions of cassava pulp (100, 300 and 500 g/kg dry matter basis) instead of rice straw as a base in a fermented total mixed ration were applied. Animals were placed in a metabolic pen equipped with a ventilated head box respiration system to determine total digestibility and energy balance. The average daily weight gain, digestible intake and apparent digestibility of dry matter, organic matter and non-fiber carbohydrate, total protozoa, energy intake, energy retention and energy efficiency increased linearly (p < 0.05) with an increasing proportion of cassava pulp in the diet, whereas the three main types of fibrolytic bacteria and energy excretion in the urine (p < 0.05) decreased. The metabolizable energy requirement for the maintenance of yearling Thai native cattle, determined by a linear regression analysis, was 399 kJ/kg BW0.75, with an efficiency of metabolizable energy utilization for growth of 0.86. Our results demonstrated that increasing the proportion of cassava pulp up to 500 g/kg of dry matter as a base in a fermented total mixed ration is an effective strategy for improving productivity in zebu cattle.

[Biochemical study of the dental pulp in the calf].

PubMed

Vernole, B; Caprioglio, D; Mincione, E; Vannini, V; Tomasi, A; Bini, A; Franceschini, V

1990-01-01

A biochemical study of dental pulp of calves has been performed concerning: a) peroxydability b) A, E, C vitamins content c) glutation (GSH) content d) presence of paramagnetic compounds e) phosphorylation ratio The dental pulp from incisors of 5-months-old calves has been preserved. Immediately after decapitation the pulp was immersed in liquid nitrogen. Chromatographic (HPLC) and spectroscopic (NMR-ESR) techniques have been used. GSH in dental pulp are present and dosable (4.56 +/- 0.08 n moles/mg prot.) and GSSG (1.05 +/- 0.01 n moles/mg prot.). Because of blood traces in the extracted pulps, the AA. have determined the hemoglobin (Hb) dosage and GSH of erythrocytic derivation (Fig. 1). After deduction of GSH of erythrocytic derivation, the GSH really present in the pulp was 4.41 n moles/mg prot. and the GSSG was 0.90 n moles/mg prot. Peroxydability of the dental pulp has been evaluated with Lowry method with dental pulp homogenate and rat liver homogenate (see Table 1). The ESR spectre shows 4 resonances with the following values: g. 2.24-2.04-2.00-1.97; there are some free intermediary radicals (gr.-2.00) (Fig.2). The NMR spectre shows the presence of ATP (0.22 n moles/g) of inorganic phosphate (16.58 n moles g) (Fig.3). The pulp seems to have a lot of antioxidant factors. The next researches will be to study E, A and C vitamins concentrations. This high presence of GSH and GSSG may be an embryonic peculiarity.

Subunit Arrangement and Phenylethanolamine Binding in GluN1/GluN2B NMDA Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

E Karakas; N Simorowski; H Furukawa

2011-12-31

Since it was discovered that the anti-hypertensive agent ifenprodil has neuroprotective activity through its effects on NMDA (N-methyl-D-aspartate) receptors, a determined effort has been made to understand the mechanism of action and to develop improved therapeutic compounds on the basis of this knowledge. Neurotransmission mediated by NMDA receptors.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bayr, S., E-mail: suvi.bayr@jyu.fi; Ojanperä, M.; Kaparaju, P.

Highlights: • Rendering wastes’ mono-digestion and co-digestion with potato pulp were studied. • CSTR process with OLR of 1.5 kg VS/m{sup 3} d, HRT of 50 d was unstable in mono-digestion. • Free NH{sub 3} inhibited mono-digestion of rendering wastes. • CSTR process with OLR of 1.5 kg VS/m{sup 3} d, HRT of 50 d was stable in co-digestion. • Co-digestion increased methane yield somewhat compared to mono-digestion. - Abstract: In this study, mono-digestion of rendering wastes and co-digestion of rendering wastes with potato pulp were studied for the first time in continuous stirred tank reactor (CSTR) experiments at 55more » °C. Rendering wastes have high protein and lipid contents and are considered good substrates for methane production. However, accumulation of digestion intermediate products viz., volatile fatty acids (VFAs), long chain fatty acids (LCFAs) and ammonia nitrogen (NH{sub 4}-N and/or free NH{sub 3}) can cause process imbalance during the digestion. Mono-digestion of rendering wastes at an organic loading rate (OLR) of 1.5 kg volatile solids (VS)/m{sup 3} d and hydraulic retention time (HRT) of 50 d was unstable and resulted in methane yields of 450 dm{sup 3}/kg VS{sub fed}. On the other hand, co-digestion of rendering wastes with potato pulp (60% wet weight, WW) at the same OLR and HRT improved the process stability and increased methane yields (500–680 dm{sup 3}/kg VS{sub fed}). Thus, it can be concluded that co-digestion of rendering wastes with potato pulp could improve the process stability and methane yields from these difficult to treat industrial waste materials.« less

Separate functional properties of NMDARs regulate distinct aspects of spatial cognition.

PubMed

Sanders, Erin M; Nyarko-Odoom, Akua O; Zhao, Kevin; Nguyen, Michael; Liao, Hong Hong; Keith, Matthew; Pyon, Jane; Kozma, Alyssa; Sanyal, Mohima; McHail, Daniel G; Dumas, Theodore C

2018-06-01

N -methyl-d-aspartate receptors (NMDARs) at excitatory synapses are central to activity-dependent synaptic plasticity and learning and memory. NMDARs act as ionotropic and metabotropic receptors by elevating postsynaptic calcium concentrations and by direct intracellular protein signaling. In the forebrain, these properties are controlled largely by the auxiliary GluN2 subunits, GluN2A and GluN2B. While calcium conductance through NMDAR channels and intracellular protein signaling make separate contributions to synaptic plasticity, it is not known if these properties individually influence learning and memory. To address this issue, we created chimeric GluN2 subunits containing the amino-terminal domain and transmembrane domains from GluN2A or GluN2B fused to the carboxy-terminal domain of GluN2B (termed ABc) or GluN2A ATD (termed BAc), respectively, and expressed these mutated GluN2 subunits in transgenic mice. Expression was confirmed at the mRNA level and protein subunit translation and translocation into dendrites were observed in forebrain neurons. In the spatial version of the Morris water maze, BAc mice displayed signs of a learning deficit. In contrast, ABc animals performed similarly to wild-types during training, but showed a more direct approach to the goal location during a long-term memory test. There was no effect of ABc or BAc expression in a nonspatial water escape task. Since background expression is predominantly GluN2A in mature animals, the results suggest that spatial learning is more sensitive to manipulations of the amino-terminal domain and transmembrane domains (calcium conductance) and long-term memory is regulated more by the carboxy-terminal domain (intracellular protein signaling). © 2018 Sanders et al.; Published by Cold Spring Harbor Laboratory Press.

NMDA receptor subunits and associated signaling molecules mediating antidepressant-related effects of NMDA-GluN2B antagonism

PubMed Central

Kiselycznyk, Carly; Jury, Nicholas; Halladay, Lindsay; Nakazawa, Kazu; Mishina, Masayoshi; Sprengel, Rolf; Grant, Seth G.N.; Svenningsson, Per; Holmes, Andrew

2015-01-01

Drugs targeting the glutamate N-methyl-D-aspartate receptor (NMDAR) may be efficacious for treating mood disorders, as exemplified by the rapid antidepressant effects produced by single administration of the NMDAR antagonist ketamine. Though the precise mechanisms underlying the antidepressant-related effects of NMDAR antagonism remain unclear, recent studies implicate specific NMDAR subunits, including GluN2A and GluN2B, as well as the alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor (AMPAR) subunit glutamate receptor interacting molecule, PSD-95. Here, integrating mutant and pharmacological in mice, we investigated the contribution of these subunits and molecules to antidepressant-related behaviors and the antidepressant-related effects of the GluN2B blocker, Ro 25-6981. We found that global deletion of GluA1 or PSD-95 reduced forced swim test (FST) immobility, mimicking the antidepressant-related effect produced by systemically administered Ro 25-6981 in C57BL/6J mice. Moreover, the FST antidepressant-like effects of systemic Ro 25-6981 were intact in mutants with global GluA1 deletion or GluN1 deletion in forebrain interneurons, but were absent in mutants constitutively lacking GluN2A or PSD-95. Next, we found that microinfusing Ro 25-6981 into the medial prefrontal cortex (mPFC), but not basolateral amygdala, of C57BL/6J mice was sufficient to produce an antidepressant-like effect. Together, these findings extend and refine current understanding of the mechanisms mediating antidepressant-like effects produced by NMDAR-GluN2B antagonists, and may inform the development of a novel class of medications for treating depression that target the GluN2B subtype of NMDAR. PMID:25800971

Development of Yoghurt with Juçara Pulp (Euterpe edulis M.) and the Probiotic Lactobacillus acidophilus La5.

PubMed

Geraldi, Marina V; Tulini, Fabricio L; Souza, Vanessa M; De Martinis, Elaine C P

2018-03-01

Yoghurts are dairy products consumed worldwide and can be supplemented with substances that provide extra health benefits as well as probiotic strains. In this context, the present study aimed to prepare a yoghurt added of juçara (Euterpe edulis M.) pulp and the commercial probiotic strain Lactobacillus acidophilus La5. Moreover, the probiotic survival during storage and after in vitro exposure to simulated gastric and enteric conditions was evaluated. Four formulations of yoghurt were prepared: (a) natural yoghurt, (b) yoghurt added of probiotic, (c) yoghurt added of juçara pulp, and (d) yoghurt added of probiotic culture and juçara pulp. The preparations were evaluated for survival of probiotic strain during storage and its tolerance to gastric and enteric conditions in vitro. The probiotic population in yoghurt remained unchanged during 28 days of storage. In addition, juçara pulp increased the probiotic resistance to simulated gastric and enteric conditions in the first day of storage. These data indicate that juçara pulp is a potential ingredient for the production of probiotic yoghurts.

Extinction of Contextual Cocaine Memories Requires Cav1.2 within D1R-Expressing Cells and Recruits Hippocampal Cav1.2-Dependent Signaling Mechanisms

PubMed Central

Lee, Anni S.; Fischer, Delaney K.; Van Kempen, Tracey A.; Mudragel, Vladimir; Glass, Michael J.

2017-01-01

Exposure to cocaine-associated contextual cues contributes significantly to relapse. Extinction of these contextual associations, which involves a new form of learning, reduces cocaine-seeking behavior; however, the molecular mechanisms underlying this process remain largely unknown. We report that extinction, but not acquisition, of cocaine conditioned place preference (CPP) in male mice increased Cav1.2 L-type Ca2+ channel mRNA and protein in postsynaptic density (PSD) fractions of the hippocampus, a brain region involved in drug–context associations. Moreover, viral-mediated deletion of Cav1.2 in the dorsal hippocampus attenuated extinction of cocaine CPP. Molecular studies examining downstream Cav1.2 targets revealed that extinction recruited calcium/calmodulin (Ca2+/CaMK)-dependent protein kinase II (CaMKII) to the hippocampal PSD. This occurred in parallel with an increase in phosphorylation of the AMPA GluA1 receptor subunit at serine 831 (S831), a CaMKII site, along with an increase in total PSD GluA1. The necessity of S831 GluA1 was further demonstrated by the lack of extinction in S831A GluA1 phosphomutant mice. Of note hippocampal GluA1 levels remained unaltered at the PSD, but were reduced near the PSD and at perisynaptic sites of dendritic spines in extinction-resistant S831A mutant mice. Finally, conditional knock-out of Cav1.2 in dopamine D1 receptor (D1R)-expressing cells resulted in attenuation of cocaine CPP extinction and lack of extinction-dependent changes in hippocampal PSD CaMKII expression and S831 GluA1 phosphorylation. In summary, we demonstrate an essential role for the hippocampal Cav1.2/CaMKII/S831 GluA1 pathway in cocaine CPP extinction, with data supporting contribution of hippocampal D1R-expressing cells in this process. These findings demonstrate a novel role for Cav1.2 channels in extinction of contextual cocaine-associated memories. SIGNIFICANCE STATEMENT Continued drug-seeking behavior, a defining characteristic of cocaine addiction, can be precipitated by contextual cues, yet the molecular mechanisms required for extinction of these context-specific memories remain poorly understood. Here, we have uncovered a novel and selective role of the Cav1.2 L-type Ca2+ channel and its downstream signaling pathway in the hippocampus that mediate extinction of cocaine conditioned place preference (CPP). We additionally provide evidence that supports a role of Cav1.2 within dopamine D1 receptor-expressing cells of the hippocampus for extinction of cocaine CPP. Therefore, these findings reveal a previously unknown role of Cav1.2 channels within the hippocampus and in D1 receptor-expressing cells in extinction of cocaine-associated memories, providing a framework for further exploration of mechanisms underlying extinction of cocaine-seeking behavior. PMID:29089442

Assessing and monitoring the ecotoxicity of pulp and paper wastewater for irrigating reed fields using the polyurethane foam unit method based on monitoring protozoal communities.

PubMed

Ding, Cheng; Chen, Tianming; Li, Zhaoxia; Yan, Jinlong

2015-05-01

Using the standardized polyurethane foam unit (PFU) method, a preliminary investigation was carried out on the bioaccumulation and the ecotoxic effects of the pulp and paper wastewater for irrigating reed fields. Static ectoxicity test had shown protozoal communities were very sensitive to variations in toxin time and effective concentration (EC) of the pulp and paper wastewater. Shannon-Wiener diversity index (H) was a more suitable indicator of the extent of water pollution than Gleason and Margalef diversity index (d), Simpson's diversity index (D), and Pielou's index (J). The regression equation between S eq and EC was S eq  = - 0.118EC + 18.554. The relatively safe concentration and maximum acceptable toxicant concentration (MATC) of the wastewater for the protozoal communities were about 20 % and 42 %, respectively. To safely use this wastewater for irrigation, more than 58 % of the toxins must be removed or diluted by further processing. Monitoring of the wastewater in representative irrigated reed fields showed that the regularity of the protozoal colonization process was similar to the static ectoxicity, indicating that the toxicity of the irrigating pulp and paper wastewater was not lethal to protozoal communities in the reed fields. This study demonstrated the applicability of the PFU method in monitoring the ecotoxic effects of pulp and paper wastewater on the level of microbial communities and may guide the supervision and control of pulp and paper wastewater irrigating within the reed fields ecological system (RFES).

mGlu5 positive allosteric modulation normalizes synaptic plasticity defects and motor phenotypes in a mouse model of Rett syndrome

PubMed Central

Gogliotti, Rocco G.; Senter, Rebecca K.; Rook, Jerri M.; Ghoshal, Ayan; Zamorano, Rocio; Malosh, Chrysa; Stauffer, Shaun R.; Bridges, Thomas M.; Bartolome, Jose M.; Daniels, J. Scott; Jones, Carrie K.; Lindsley, Craig W.; Conn, P. Jeffrey; Niswender, Colleen M.

2016-01-01

Rett syndrome (RS) is a neurodevelopmental disorder that shares many symptomatic and pathological commonalities with idiopathic autism. Alterations in protein synthesis-dependent synaptic plasticity (PSDSP) are a hallmark of a number of syndromic forms of autism; in the present work, we explore the consequences of disruption and rescue of PSDSP in a mouse model of RS. We report that expression of a key regulator of synaptic protein synthesis, the metabotropic glutamate receptor 5 (mGlu5) protein, is significantly reduced in both the brains of RS model mice and in the motor cortex of human RS autopsy samples. Furthermore, we demonstrate that reduced mGlu5 expression correlates with attenuated DHPG-induced long-term depression in the hippocampus of RS model mice, and that administration of a novel mGlu5 positive allosteric modulator (PAM), termed VU0462807, can rescue synaptic plasticity defects. Additionally, treatment of Mecp2-deficient mice with VU0462807 improves motor performance (open-field behavior and gait dynamics), corrects repetitive clasping behavior, as well as normalizes cued fear-conditioning defects. Importantly, due to the rationale drug discovery approach used in its development, our novel mGlu5 PAM improves RS phenotypes and synaptic plasticity defects without evoking the overt adverse effects commonly associated with potentiation of mGlu5 signaling (i.e. seizures), or affecting cardiorespiratory defects in RS model mice. These findings provide strong support for the continued development of mGlu5 PAMs as potential therapeutic agents for use in RS, and, more broadly, for utility in idiopathic autism. PMID:26936821

Synergism of virtual screening and medicinal chemistry: identification and optimization of allosteric antagonists of metabotropic glutamate receptor 1.

PubMed

Noeske, Tobias; Trifanova, Dina; Kauss, Valerjans; Renner, Steffen; Parsons, Christopher G; Schneider, Gisbert; Weil, Tanja

2009-08-01

We report the identification of novel potent and selective metabotropic glutamate receptor 1 (mGluR1) antagonists by virtual screening and subsequent hit optimization. For ligand-based virtual screening, molecules were represented by a topological pharmacophore descriptor (CATS-2D) and clustered by a self-organizing map (SOM). The most promising compounds were tested in mGluR1 functional and binding assays. We identified a potent chemotype exhibiting selective antagonistic activity at mGluR1 (functional IC(50)=0.74+/-0.29 microM). Hit optimization yielded lead structure 16 with an affinity of K(i)=0.024+/-0.001 microM and greater than 1000-fold selectivity for mGluR1 versus mGluR5. Homology-based receptor modelling suggests a binding site compatible with previously reported mutation studies. Our study demonstrates the usefulness of ligand-based virtual screening for scaffold-hopping and rapid lead structure identification in early drug discovery projects.

Direct interaction enables cross-talk between ionotropic and group I metabotropic glutamate receptors.

PubMed

Perroy, Julie; Raynaud, Fabrice; Homburger, Vincent; Rousset, Marie-Claude; Telley, Ludovic; Bockaert, Joël; Fagni, Laurent

2008-03-14

Functional interplay between ionotropic and metabotropic receptors frequently involves complex intracellular signaling cascades. The group I metabotropic glutamate receptor mGlu5a co-clusters with the ionotropic N-methyl-d-aspartate (NMDA) receptor in hippocampal neurons. In this study, we report that a more direct cross-talk can exist between these types of receptors. Using bioluminescence resonance energy transfer in living HEK293 cells, we demonstrate that mGlu5a and NMDA receptor clustering reflects the existence of direct physical interactions. Consequently, the mGlu5a receptor decreased NMDA receptor current, and reciprocally, the NMDA receptor strongly reduced the ability of the mGlu5a receptor to release intracellular calcium. We show that deletion of the C terminus of the mGlu5a receptor abolished both its interaction with the NMDA receptor and reciprocal inhibition of the receptors. This direct functional interaction implies a higher degree of target-effector specificity, timing, and subcellular localization of signaling than could ever be predicted with complex signaling pathways.

Synthesis of Dendronized Poly(l-Glutamate) via Azide-Alkyne Click Chemistry

PubMed Central

Perdih, Peter; Kržan, Andrej; Žagar, Ema

2016-01-01

Poly(l-glutamate) (PGlu) was modified with a second-generation dendron to obtain the dendronized polyglutamate, P(Glu-D). Synthesized P(Glu-D) exhibited a degree of polymerization (DPn) of 46 and a 43% degree of dendronization. Perfect agreement was found between the P(Glu-D) expected structure and the results of nuclear magnetic resonance spectroscopy (NMR) and size-exclusion chromatography coupled to a multi-angle light-scattering detector (SEC-MALS) analysis. The PGlu precursor was modified by coupling with a bifunctional building block (N3-Pr-NH2) in the presence of 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM) coupling reagent. The second-generation polyamide dendron was prepared by a stepwise procedure involving the coupling of propargylamine to the l-lysine carboxyl group, followed by attaching the protected 2,2-bis(methylol)propionic acid (bis-MPA) building block to the l-lysine amino groups. The hydroxyl groups of the resulting second-generation dendron were quantitatively deprotected under mild acidic conditions. The deprotected dendron with an acetylene focal group was coupled to the pendant azide groups of the modified linear copolypeptide, P(Glu-N3), in a Cu(I) catalyzed azide-alkyne cycloaddition reaction to form a 1,4-disubstituted triazole. The dendronization reaction proceeded quantitatively in 48 hours in aqueous medium as confirmed by 1H NMR and Fourier transform infrared spectroscopy (FT-IR) spectroscopy. PMID:28773369

Odontogenic Differentiation of Human Dental Pulp Stem Cells Stimulated by the Calcium Phosphate Porous Granules

PubMed Central

Nam, Sunyoung; Won, Jong-Eun; Kim, Cheol-Hwan; Kim, Hae-Won

2011-01-01

Effects of three-dimensional (3D) calcium phosphate (CaP) porous granules on the growth and odontogenic differentiation of human dental pulp stem cells (hDPSCs) were examined for dental tissue engineering. hDPSCs isolated from adult human dental pulps were cultured for 3-4 passages, and populated on porous granules. Cell growth on the culture dish showed an ongoing increase for up to 21 days, whereas the growth on the 3D granules decreased after 14 days. This reduction in proliferative potential on the 3D granules was more conspicuous under the osteogenic medium conditions, indicating that the 3D granules may induce the odontogenic differentiation of hDPSCs. Differentiation behavior on the 3D granules was confirmed by the increased alkaline phosphatase activity, up-regulation of odontoblast-specific genes, including dentin sialophosphoprotein (DSPP) and dentin matrix protein 1 (DMP1) by quantitative polymerase chain reaction, and greater level of dentin sialoprotein synthesis by western blot. Moreover, the cellular mineralization, as assessed by Alizarin red S and calcium quantification, was significantly higher in the 3D CaP granules than in the culture dish. Taken all, the 3D CaP porous granules should be useful for dental tissue engineering in combination with hDPSCs by providing favorable 3D substrate conditions for cell growth and odontogenic development. PMID:21772958

Proline Accumulation in Maize (Zea mays L.) Primary Roots at Low Water Potentials. II. Metabolic Source of Increased Proline Deposition in the Elongation Zone1

PubMed Central

Verslues, Paul E.; Sharp, Robert E.

1999-01-01

The proline (Pro) concentration increases greatly in the growing region of maize (Zea mays L.) primary roots at low water potentials (ψw), largely as a result of an increased net rate of Pro deposition. Labeled glutamate (Glu), ornithine (Orn), or Pro was supplied specifically to the root tip of intact seedlings in solution culture at high and low ψw to assess the relative importance of Pro synthesis, catabolism, utilization, and transport in root-tip Pro deposition. Labeling with [3H]Glu indicated that Pro synthesis from Glu did not increase substantially at low ψw and accounted for only a small fraction of the Pro deposition. Labeling with [14C]Orn showed that Pro synthesis from Orn also could not be a substantial contributor to Pro deposition. Labeling with [3H]Pro indicated that neither Pro catabolism nor utilization in the root tip was decreased at low ψw. Pro catabolism occurred at least as rapidly as Pro synthesis from Glu. There was, however, an increase in Pro uptake at low ψw, which suggests increased Pro transport. Taken together, the data indicate that increased transport of Pro to the root tip serves as the source of low-ψw-induced Pro accumulation. The possible significance of Pro catabolism in sustaining root growth at low ψw is also discussed. PMID:10198094

Activation of NMDA receptors reduces metabotropic glutamate receptor-induced long-term depression in the nucleus accumbens via a CaMKII-dependent mechanism.

PubMed

Huang, Chiung-Chun; Hsu, Kuei-Sen

2012-12-01

Glutamate is the major excitatory neurotransmitter in the brain and exerts its actions through two distinct types of receptors, ionotropic and metabotropic glutamate receptors (mGluR). Although functional interplay between ionotropic N-methyl-d-aspartate receptors (NMDAR) and mGluR has been convincingly demonstrated in native and recombinant systems, the mechanism by which NMDAR activation leads to modulation of mGluR function has yet to be elucidated. Using whole-cell patch-clamp recordings in mouse nucleus accumbens (NAc) slices, we found that tetanic stimulation (TS) of excitatory afferents with a naturally occurring frequency (10 min at 13 Hz) reliably induces a mGluR1/5-dependent long-term depression (mGluR1/5-LTD) of excitatory synaptic transmission. Blockade of NMDAR during but not after TS showed enhanced mGluR1/5-LTD induction, which is associated with its antagonism of TS-induced calcium/calmodulin-dependent protein kinase II (CaMKII) activation. The ability of NMDAR antagonists to promote mGluR1/5-LTD induction was mimicked by a selective CaMKII inhibitor KN-62. However, the induction of mGluR1/5-LTD by bath-applied agonist (S)-3,5-dihydrophenylglycine was not affected by NMDAR blockade. We also observed that NMDAR or CaMKII blockade during TS significantly blunted TS-induced increased serine/threonine phosphorylation of the scaffold protein Homer1b/c and resulted in an increased interaction of mGluR5 with the Homer1b/c. These results indicate that synaptically released glutamate during TS of excitatory afferents can activate both NMDAR and mGluR1/5 in NAc neurons concomitantly and that activation of NMDAR may stimulate CaMKII-mediated phosphorylation of Homer1b/c and impair the interaction between mGluR5 and Homer1b/c, thereby attenuating mGluR1/5-LTD induction. This study provides a novel molecular mechanism by which NMDAR could regulate mGluR5 function. Copyright © 2012 Elsevier Ltd. All rights reserved.

Identification of Novel 14-3-3 Residues That Are Critical for Isoform-specific Interaction with GluN2C to Regulate N-Methyl-d-aspartate (NMDA) Receptor Trafficking*

PubMed Central

Chung, Connie; Wu, Wei-Hua; Chen, Bo-Shiun

2015-01-01

The 14-3-3 family of proteins is widely distributed in the CNS where they are major regulators of essential neuronal functions. There are seven known mammalian 14-3-3 isoforms (ζ,, τ, ϵ, η, β, and σ), which generally function as adaptor proteins. Previously, we have demonstrated that 14-3-3ϵ isoform dynamically regulates forward trafficking of GluN2C-containing NMDA receptors (NMDARs) in cerebellar granule neurons, that when expressed on the surface, promotes neuronal survival following NMDA-induced excitotoxicity. Here, we report 14-3-3 isoform-specific binding and functional regulation of GluN2C. In particular, we show that GluN2C C-terminal domain (CTD) binds to all 14-3-3 isoforms except 14-3-3σ, and binding is dependent on GluN2C serine 1096 phosphorylation. Co-expression of 14-3-3 (ζ and ϵ) and GluN1/GluN2C promotes the forward delivery of receptors to the cell surface. We further identify novel residues serine 145, tyrosine 178, and cysteine 189 on α-helices 6, 7, and 8, respectively, within ζ-isoform as part of the GluN2C binding motif and independent of the canonical peptide binding groove. Mutation of these conserved residues abolishes GluN2C binding and has no functional effect on GluN2C trafficking. Reciprocal mutation of alanine 145, histidine 180, and isoleucine 191 on 14-3-3σ isoform promotes GluN2C binding and surface expression. Moreover, inhibiting endogenous 14-3-3 using a high-affinity peptide inhibitor, difopein, greatly diminishes GluN2C surface expression. Together, these findings highlight the isoform-specific structural and functional differences within the 14-3-3 family of proteins, which determine GluN2C binding and its essential role in targeting the receptor to the cell surface to facilitate glutamatergic neurotransmission. PMID:26229101

Failure pressures after repairs of 2-cm × 2.5-cm rhinologic dural defects in a porcine ex vivo model.

PubMed

Lin, Ryan P; Weitzel, Erik Kent; Chen, Philip G; McMains, Kevin Christopher; Chang, Daniel R; Braxton, Ernest E; Majors, Jacob; Bunegin, Leon

2016-10-01

The objective of this study was to determine failure pressures of 6 rhinologic repair techniques of large skull base/dural defects in a controlled, ex vivo model. Failure pressures of 6 dural repairs in a porcine model were studied using a closed testing apparatus; 24-mm × 19-mm dural defects were created; 40-mm × 34-mm grafts composed of porcine Duragen (Integra), fascia lata, and Biodesign (Cook) were used either with or without Tisseel (Baxter International Inc.) to create 6 repairs: Duragen/no glue (D/NG), Duragen/Tisseel (D/T), fascia lata/no glue (FL/NG), fascia lata/Tisseel (FL/T), Biodesign/no glue (B/NG), and Biodesign/Tisseel (B/T). Saline was infused at 30 mL/hour, applying even force to the underside of the graft until repair failure. Five trials were performed per repair type for a total of 30 repairs. Mean failure pressures were as follows: D/NG 1.361 ± 0.169 cmH 2 O; D/T 9.127 ± 1.805 cmH 2 O; FL/NG 0.200 ± 0.109 cmH 2 O; FL/T 7.833 ± 2.657 cmH 2 O; B/NG 0.299 ± 0.109 cmH 2 O; and B/T 2.67 ± 0.619 cmH 2 O. There were statistically significant differences between glued (Tisseel) and non-glued repairs for each repair category (p < 0.05). All glued repairs performed better than non-glued repairs. Both D/T and FL/T repairs performed better than B/T repairs. No repair tolerated pressures throughout the full range of adult supine intracranial pressure. © 2016 ARS-AAOA, LLC.

Oscillatory Synchronous Inhibition in the Basolateral Amygdala and its Primary Dependence on NR2A-containing NMDA Receptors.

PubMed

Aroniadou-Anderjaska, Vassiliki; Pidoplichko, Volodymyr I; Figueiredo, Taiza H; Braga, Maria F M

2018-03-01

Synchronous, rhythmic firing of GABAergic interneurons is a fundamental mechanism underlying the generation of brain oscillations, and evidence suggests that NMDA receptors (NMDARs) play a key role in oscillatory activity by regulating the activity of interneurons. Consistent with this, derangement of brain rhythms in certain neuropsychiatric disorders, notably schizophrenia and autism, is associated with NMDAR hypofunction and loss of inhibitory interneurons. In the basolateral amygdala (BLA)-dysfunction of which is involved in a host of neuropsychiatric diseases-, principal neurons display spontaneous, rhythmic "bursts" of inhibitory activity, which could potentially be involved in the orchestration of oscillations in the BLA network; here, we investigated the role of NMDARs in these inhibitory oscillations. Rhythmic bursts of spontaneous IPSCs (0.5 Hz average burst frequency) recorded from rat BLA principal cells were blocked or significantly suppressed by D-AP5, and could be driven by NMDAR activation alone. BLA interneurons generated spontaneous bursts of suprathreshold EPSCs at a similar frequency, which were also blocked or reduced by D-AP5. PEAQX (GluN2A-NMDAR antagonist; 0.4 μM) or Ro-25-6981 (GluN2B-NMDAR antagonist; 5 μM) suppressed the IPSC and EPSC bursts; suppression by PEAQX was significantly greater than that by Ro-25-6981. Immunohistochemical labeling revealed the presence of both GluN2A- and GluN2B-NMDARs on GABAergic BLA interneurons, while, functionally, GluN2A-NMDARs have the dominant role, as suggested by a greater reduction of NMDA-evoked currents by PEAQX versus Ro-25-6981. Entrainment of BLA principal neurons in an oscillatory generation of inhibitory activity depends primarily on activation of GluN2A-NMDARs, and interneuronal GluN2A-NMDARs may play a significant role. Published by Elsevier Ltd.

Production of lactic acid from hemicellulose extracts by Bacillus coagulans MXL-9

USDA-ARS?s Scientific Manuscript database

Bacillus coagulans MXL-9 was found capable of growing on pre-pulping hemicellulose extracts, utilizing all of the principle monosugars found in woody biomass. This organism is a moderate thermophile isolated from compost for its pentose utilizing capabilities. It was found to have high tolerance f...

1997 Hardwood Research Award Winner: "Automatic Color Sorting of Hardwood Edge-Glued Panel Parts"

Treesearch

D. Earl Kline; Richard Conners; Qiang Lu; Philip A. Araman

1997-01-01

The National Hardwood Lumber Association's 1997 Hardwood Research Award was presented to D. Earl Kline, Richard Conners, Qiang Lu and Philip Araman at the 25th Annual Hardwood Symposium for developing an automatic system for color sorting hardwood edge-glued panel parts. The researchers comprise a team from Virginia Tech University and the USDA Forest Service in...

Synaptic GluN2A and GluN2B Containing NMDA Receptors within the Superficial Dorsal Horn Activated following Primary Afferent Stimulation

PubMed Central

MacDermott, Amy B.

2014-01-01

NMDA receptors are important elements in pain signaling in the spinal cord dorsal horn. They are heterotetramers, typically composed of two GluN1 and two of four GluN2 subunits: GluN2A-2D. Mice lacking some of the GluN2 subunits show deficits in pain transmission yet functional synaptic localization of these receptor subtypes in the dorsal horn has not been fully resolved. In this study, we have investigated the composition of synaptic NMDA receptors expressed in monosynaptic and polysynaptic pathways from peripheral sensory fibers to lamina I neurons in rats. We focused on substance P receptor-expressing (NK1R+) projection neurons, critical for expression of hyperalgesia and allodynia. EAB-318 and (R)-CPP, GluN2A/B antagonists, blocked both monosynaptic and polysynaptic NMDA EPSCs initiated by primary afferent activation by ∼90%. Physiological measurements exploiting the voltage dependence of monosynaptic EPSCs similarly indicated dominant expression of GluN2A/B types of synaptic NMDA receptors. In addition, at synapses between C fibers and NK1R+ neurons, NMDA receptor activation initiated a secondary, depolarizing current. Ifenprodil, a GluN2B antagonist, caused modest suppression of monosynaptic NMDA EPSC amplitudes, but had a widely variable, sometimes powerful, effect on polysynaptic responses following primary afferent stimulation when inhibitory inputs were blocked to mimic neuropathic pain. We conclude that GluN2B subunits are moderately expressed at primary afferent synapses on lamina I NK1R+ neurons, but play more important roles for polysynaptic NMDA EPSCs driven by primary afferents following disinhibition, supporting the view that the analgesic effect of the GluN2B antagonist on neuropathic pain is at least in part, within the spinal cord. PMID:25122884

Mutations on M3 helix of Plutella xylostella glutamate-gated chloride channel confer unequal resistance to abamectin by two different mechanisms.

PubMed

Wang, Xingliang; Puinean, Alin M; O Reilly, Andrias O; Williamson, Martin S; Smelt, Charles L C; Millar, Neil S; Wu, Yidong

2017-07-01

Abamectin is one of the most widely used avermectins for agricultural pests control, but the emergence of resistance around the world is proving a major threat to its sustained application. Abamectin acts by directly activating glutamate-gated chloride channels (GluCls) and modulating other Cys-loop ion channels. To date, three mutations occurring in the transmembrane domain of arthropod GluCls are associated with target-site resistance to abamectin: A309V in Plutella xylostella GluCl (PxGluCl), G323D in Tetranychus urticae GluCl1 (TuGluCl1) and G326E in TuGluCl3. To compare the effects of these mutations in a single system, A309V/I/G and G315E (corresponding to G323 in TuGluCl1 and G326 in TuGluCl3) substitutions were introduced individually into the PxGluCl channel. Functional analysis using Xenopus oocytes showed that the A309V and G315E mutations reduced the sensitivity to abamectin by 4.8- and 493-fold, respectively. In contrast, the substitutions A309I/G show no significant effects on the response to abamectin. Interestingly, the A309I substitution increased the channel sensitivity to glutamate by one order of magnitude (∼12-fold). Analysis of PxGluCl homology models indicates that the G315E mutation interferes with abamectin binding through a steric hindrance mechanism. In contrast, the structural consequences of the A309 mutations are not so clear and an allosteric modification of the binding site is the most likely mechanism. Overall the results show that both A309V and G315E mutations may contribute to target-site resistance to abamectin and may be important for the future prediction and monitoring of abamectin resistance in P. xylostella and other arthropod pests. Copyright © 2017 Elsevier Ltd. All rights reserved.

Influence of high-molecular-weight glutenin subunit composition at Glu-A1 and Glu-D1 loci on secondary and micro structures of gluten in wheat (Triticum aestivum L.).

PubMed

Li, Xuejun; Liu, Tianhong; Song, Lijun; Zhang, Heng; Li, Liqun; Gao, Xin

2016-12-15

As one of critical gluten proteins, high-molecular-weight glutenin subunits (HMW-GS) mainly affect the rheological behaviour of wheat dough. The influence of HMW-GS variations at the Glu-A1 and Glu-D1 loci on both secondary and micro structures of gluten and rheological properties of wheat dough was investigated in this study. Results showed that the Amide I bands of the three near-isogenic lines (NILs) shifted slightly, but the secondary structures differed significantly. The micro structure of gluten in NIL 4 (Ax null) showed bigger apertures and less connection, compared to that in Xinong 1330 (Ax1). The micro structure of gluten in NIL 5 (Dx5+Dy10) showed more compact than that in Xinong 1330 (Dx2+Dy12). Correlation analysis demonstrated that the content of β-sheets and disulfide bonds in gluten has a significant relationship with dough properties. The secondary structures of native gluten are suggested to be used as predictors of wheat quality. Copyright © 2016 Elsevier Ltd. All rights reserved.

Production of {sup 177}Lu, a potential radionuclide for diagnostic and therapeutic applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khandaker, Mayeen Uddin; Kassim, Hasan Abu; Haba, Hiromitsu

2015-04-24

{sup 177g}Lu (T{sub 1/2}=6.647d; E{sub β{sup −max}}=498.3KeV, I{sub β{sup −total}}=100%; E{sub γ} = 112.9498 keV, I{sub γ} = 6.17%; E{sub γ} = 208.3662 keV, I {sub γ} = 10.36%) is widely used in many clinical procedures due to its excellent decay characteristics. Production cross-sections of the {sup nat}Yb(d,x){sup 177g}Lu reactions have been measured from a 24-MeV deuteron energy down to the threshold by using a stacked-foil activation technique combined with high resolution γ-ray spectrometry. An overall good agreement is found with some of the earlier measurements, whereas a partial agreement is obtained with the theoretical data extracted from the TENDL-2013 library.more » Physical thick target yield for the {sup 177g}Lu radionuclide was deduced using the measured cross-sections. The deduced yield curves indicate that a low energy (<11 MeV) cyclotron and a highly enriched {sup 176}Yb target could be used to obtain {sup 177g}Lu with negligible impurity from {sup 177m}Lu.« less

Effect of D-cycloserine in conjunction with fear extinction training on extracellular signal-regulated kinase activation in medial prefrontal cortex and amygdala in rat

PubMed Central

Gupta, Subhash C.; Hillman, Brandon G.; Prakash, Anand; Ugale, Rajesh R; Stairs, Dustin J.; Dravid, Shashank M.

2013-01-01

D-cycloserine (DCS) is currently under clinical trials for a number of neuropsychiatric conditions and has been found to augment fear extinction in rodents and exposure therapy in humans. However, the molecular mechanism of DCS action in these multiple modalities remains unclear. Here, we describe the effect of DCS administration, alone or in conjunction with extinction training, on neuronal activity (c-fos) and neuronal plasticity (phospho-extracellular signal-regulated kinase, pERK) markers using immunohistochemistry. We found that intraperitoneal administration of DCS in untrained young rats (24–28 days old) increased c-fos and pERK-stained neurons in both the prelimbic (PL) and infralimbic (IL) division of the medial prefrontal cortex (mPFC) and reduced pERK levels in the lateral nucleus (CeL) of the central amygdala (CeA). Moreover, DCS administration significantly increased GluA1, GluN1, GluN2A, and GluN2B expression in mPFC. In a separate set of animals, we found that DCS facilitated fear extinction and increased pERK levels in IL, PL, intercalated cells and CeL, compared to saline control. In synaptoneurosomal preparation, we found that extinction training increased iGluR protein expression in the mPFC, compared to context animals. No significant difference in protein expression was observed between extinction-saline and extinction-DCS groups in the mPFC. In contrast, in the amygdala DCS in conjunction with extinction training led to an increase in iGluR subunit expression, compared to extinction-saline group. Our data suggest that the efficacy of DCS in neuropsychiatric disorders may be partly due to its ability to affect neuronal activity and signaling in the mPFC and amygdala subnuclei. PMID:23551217

Structure and organization of heteromeric AMPA-type glutamate receptors.

PubMed

Herguedas, Beatriz; García-Nafría, Javier; Cais, Ondrej; Fernández-Leiro, Rafael; Krieger, James; Ho, Hinze; Greger, Ingo H

2016-04-29

AMPA-type glutamate receptors (AMPARs), which are central mediators of rapid neurotransmission and synaptic plasticity, predominantly exist as heteromers of the subunits GluA1 to GluA4. Here we report the first AMPAR heteromer structures, which deviate substantially from existing GluA2 homomer structures. Crystal structures of the GluA2/3 and GluA2/4 N-terminal domains reveal a novel compact conformation with an alternating arrangement of the four subunits around a central axis. This organization is confirmed by cysteine cross-linking in full-length receptors, and it permitted us to determine the structure of an intact GluA2/3 receptor by cryogenic electron microscopy. Two models in the ligand-free state, at resolutions of 8.25 and 10.3 angstroms, exhibit substantial vertical compression and close associations between domain layers, reminiscent of N-methyl-D-aspartate receptors. Model 1 resembles a resting state and model 2 a desensitized state, thus providing snapshots of gating transitions in the nominal absence of ligand. Our data reveal organizational features of heteromeric AMPARs and provide a framework to decipher AMPAR architecture and signaling. Copyright © 2016, American Association for the Advancement of Science.

Dietary monosodium glutamate enhances gastric secretion.

PubMed

Khropycheva, Raisa; Uneyama, Hisayuki; Torii, Kunio; Zolotarev, Vasiliy

2009-01-01

Dietary L-glutamate (Glu), an amino acid abundant in many foodstuffs in a free form, is able to modulate physiological functions in the stomach, including secretion and motility. Recently, specific receptors for Glu were identified in the apical membrane of chief cells in the lower region of fundic glands and in the somatostatin-secreting D-cell fraction of the gastric mucosa. This Glu-sensing system in the stomach is linked to activation of the vagal afferents. Among 20 kinds of amino acid, luminal Glu alone activated the vagal afferents in the stomach through a paracrine cascade led by nitric oxide and followed by serotonin (5-HT). In dogs with Pavlov pouches, found that supplementation of an amino acid-rich diet lacking Glu with monosodium Glu (MSG) enhanced the secretion of acid, pepsinogen, and fluid. However, MSG did not affect these secretions induced by a carbohydrate-rich diet and it had no effect on basal secretion when MSG was applied alone without the diet. Enhancement of gastric secretion by MSG was abolished by blockage of the gastric afferents using intra-gastric applied lidocaine. This effect of MSG was due in part to stimulation of 5-HT(3) receptors in the gastric mucosa.

Native chemical ligation at Asx-Cys, Glx-Cys: chemical synthesis and high-resolution X-ray structure of ShK toxin by racemic protein crystallography.

PubMed

Dang, Bobo; Kubota, Tomoya; Mandal, Kalyaneswar; Bezanilla, Francisco; Kent, Stephen B H

2013-08-14

We have re-examined the utility of native chemical ligation at -Gln/Glu-Cys- [Glx-Cys] and -Asn/Asp-Cys- [Asx-Cys] sites. Using the improved thioaryl catalyst 4-mercaptophenylacetic acid (MPAA), native chemical ligation could be performed at -Gln-Cys- and Asn-Cys- sites without side reactions. After optimization, ligation at a -Glu-Cys- site could also be used as a ligation site, with minimal levels of byproduct formation. However, -Asp-Cys- is not appropriate for use as a site for native chemical ligation because of formation of significant amounts of β-linked byproduct. The feasibility of native chemical ligation at -Gln-Cys- enabled a convergent total chemical synthesis of the enantiomeric forms of the ShK toxin protein molecule. The D-ShK protein molecule was ~50,000-fold less active in blocking the Kv1.3 channel than the L-ShK protein molecule. Racemic protein crystallography was used to obtain high-resolution X-ray diffraction data for ShK toxin. The structure was solved by direct methods and showed significant differences from the previously reported NMR structures in some regions of the ShK protein molecule.

Oil goldenberry (Physalis peruviana L.).

PubMed

Ramadan, Mohamed F; Mörsel, Jörg-T

2003-02-12

Whole berries, seeds, and pulp/peel of goldenberry (Physalis peruviana L.) were compared in terms of fatty acids, lipid classes, triacylglyerols, phytosterols, fat-soluble vitamins, and beta-carotene. The total lipid contents in the whole berries, seeds, and seedless parts were 2.0, 1.8, and 0.2% (on a fresh weight basis), respectively. Linoleic acid was the dominating fatty acid followed by oleic acid as the second major fatty acid. Palmitic and stearic acids were the major saturates. In pulp/peel oil, the fatty acid profile was characterized by higher amounts of saturates, monoenes, and trienes than in whole berry and seed oils. Neutral lipids comprised >95% of total lipids in whole berry oil and seed oil, while neutral lipids separated in lower level in pulp/peel oil. Triacylglycerols were the predominant neutral lipid subclass and constituted ca. 81.6, 86.6, and 65.1% of total neutral lipids in whole berry, seed, and pulp/peel oils, respectively. Nine triacylglycerol molecular species were detected, wherein three species, C54:3, C52:2, and C54:6, were presented to the extent of approximately 91% or above. The highest level of phytosterols was estimated in pulp/peel oil that contained the highest level of unsaponifiables. In both whole berry and seed oils, campesterol and beta-sitosterol were the sterol markers, whereas Delta5-avenasterol and campesterol were the main 4-desmethylsterols in pulp/peel oil. The tocopherols level was much higher in pulp/peel oil than in whole berry and seed oils. beta- and gamma-tocopherols were the major components in whole berry and seed oils, whereas gamma- and alpha-tocopherols were the main constituents in pulp/peel oil. beta-Carotene and vitamin K(1) were also measured in markedly high levels in pulp/peel oil followed by whole berry oil and seed oil, respectively. Information provided by the present work is of importance for further chemical investigation of goldenberry oil and industrial utilization of the berries as a raw material of oils and functional foods.

Glucose uptake in Azotobacter vinelandii occurs through a GluP transporter that is under the control of the CbrA/CbrB and Hfq-Crc systems.

PubMed

Quiroz-Rocha, Elva; Moreno, Renata; Hernández-Ortíz, Armando; Fragoso-Jiménez, Juan Carlos; Muriel-Millán, Luis Felipe; Guzmán, Josefina; Espín, Guadalupe; Rojo, Fernando; Núñez, Cinthia

2017-04-12

Azotobacter vinelandii, a strict aerobic, nitrogen fixing bacterium in the Pseudomonadaceae family, exhibits a preferential use of acetate over glucose as a carbon source. In this study, we show that GluP (Avin04150), annotated as an H + -coupled glucose-galactose symporter, is the glucose transporter in A. vinelandii. This protein, which is widely distributed in bacteria and archaea, is uncommon in Pseudomonas species. We found that expression of gluP was under catabolite repression control thorugh the CbrA/CbrB and Crc/Hfq regulatory systems, which were functionally conserved between A. vinelandii and Pseudomonas species. While the histidine kinase CbrA was essential for glucose utilization, over-expression of the Crc protein arrested cell growth when glucose was the sole carbon source. Crc and Hfq proteins from either A. vinelandii or P. putida could form a stable complex with an RNA A-rich Hfq-binding motif present in the leader region of gluP mRNA. Moreover, in P. putida, the gluP A-rich Hfq-binding motif was functional and promoted translational inhibition of a lacZ reporter gene. The fact that gluP is not widely distributed in the Pseudomonas genus but is under control of the CbrA/CbrB and Crc/Hfq systems demonstrates the relevance of these systems in regulating metabolism in the Pseudomonadaceae family.

Alterations in GluR2 AMPA receptor phosphorylation at serine 880 following group I metabotropic glutamate receptor stimulation in the rat dorsal striatum.

PubMed

Ahn, Sung Min; Choe, Eun Sang

2010-04-01

Phosphorylation of ionotropic glutamate receptors in the brain plays a crucial role in the regulation of synaptic plasticity. In this study, we investigated the regulation of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor phosphorylation by the stimulation of group I metabotropic glutamate receptors (mGluRs) in the dorsal striatum in vivo. The results showed that intrastriatal infusion of the group I mGluR agonist, (RS)-3,5-dihydroxyphenylglycine (DHPG, 250 nmol), enhanced the sensitivity of GluR2 subunit in its phosphorylation at serine 880 (S880) in the dorsal striatum. This enhancement of the sensitivity of GluR2-S880 phosphorylation was reduced by blocking group I mGluRs and N-methyl-D-aspartate (NMDA) receptors. Similar reduction of the enhancement was also induced by inhibiting phospholipase C (PLC), calcium/calmodulin-dependent protein kinase (CaMK), c-Jun N-terminal kinase (JNK), and protein kinase C (PKC). Inhibition of protein phosphatase (PP) 1/2A and calcineurin (PP2B) alone enhanced GluR2-S880 phosphorylation in the dorsal striatum, whereas inhibition of these phosphatases did not further enhance the S880 phosphorylation by DHPG stimulation. In addition, inhibition of PP1/2A or PP2B also enhanced the phosphorylation of CaMKII, JNK and PKC. These data suggest that the phosphorylation of AMPA receptor GluR2 subunit at S880 is subject to the upregulation by the stimulation of group I mGluRs. Interactions among glutamate receptors, protein kinases, and PPs participate in this upregulation. (c) 2009 Wiley-Liss, Inc.

Regulation of Akt and Wnt signaling by the group II metabotropic glutamate receptor antagonist LY341495 and agonist LY379268.

PubMed

Sutton, Laurie P; Rushlow, Walter J

2011-06-01

Metabotropic glutamate receptors 2/3 (mGlu(2/3)) have been implicated in schizophrenia and as a novel treatment target for schizophrenia. The current study examined whether mGlu(2/3) regulates Akt (protein kinase B) and Wnt (Wingless/Int-1) signaling, two cascades associated with schizophrenia and modified by antipsychotics. Western blotting revealed increases in phosphorylated Akt (pAkt) and phosphorylated glycogen synthase kinase-3 (pGSK-3) following acute and repeated treatment of LY379268 (mGlu(2/3) agonist), whereas increases in dishevelled-2 (Dvl-2), dishevelled-3 (Dvl-3), GSK-3 and β-catenin were only observed following repeated treatment. LY341495 (mGlu(2/3) antagonist) induced the opposite response compared with LY379268. Co-immunoprecipitation experiments showed an association between the mGlu(2/3) complex and Dvl-2 providing a possible mechanism to explain how the mGlu(2/3) can mediate changes in Wnt signaling. However, there was no association between the mGlu(2/3) complex and Akt suggesting that changes in Akt signaling following LY341495 and LY379268 treatments may not be directly mediated by the mGlu(2/3) . Finally, an increase in locomotor activity induced by LY341495 treatment correlated with increased pAkt and pGSK-3 levels and was attenuated by the administration of the GSK-3 inhibitor, SB216763. Overall, the results suggest that mGlu(2/3) regulates Akt and Wnt signaling and LY379268 treatment has overlapping effects with D(2) dopamine receptor antagonists (antipsychotic drugs). © 2011 The Authors. Journal of Neurochemistry © 2011 International Society for Neurochemistry.

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Stem/Progenitor Cell–Mediated De Novo Regeneration of Dental Pulp with Newly Deposited Continuous Layer of Dentin in an In Vivo Model

PubMed Central

Yamaza, Takayoshi; Shea, Lonnie D.; Djouad, Farida; Kuhn, Nastaran Z.; Tuan, Rocky S.; Shi, Songtao

2010-01-01

The ultimate goal of this study is to regenerate lost dental pulp and dentin via stem/progenitor cell–based approaches and tissue engineering technologies. In this study, we tested the possibility of regenerating vascularized human dental pulp in emptied root canal space and producing new dentin on existing dentinal walls using a stem/progenitor cell–mediated approach with a human root fragment and an immunocompromised mouse model. Stem/progenitor cells from apical papilla and dental pulp stem cells were isolated, characterized, seeded onto synthetic scaffolds consisting of poly-D,L-lactide/glycolide, inserted into the tooth fragments, and transplanted into mice. Our results showed that the root canal space was filled entirely by a pulp-like tissue with well-established vascularity. In addition, a continuous layer of dentin-like tissue was deposited onto the canal dentinal wall. This dentin-like structure appeared to be produced by a layer of newly formed odontoblast-like cells expressing dentin sialophosphoprotein, bone sialoprotein, alkaline phosphatase, and CD105. The cells in regenerated pulp-like tissue reacted positively to anti-human mitochondria antibodies, indicating their human origin. This study provides the first evidence showing that pulp-like tissue can be regenerated de novo in emptied root canal space by stem cells from apical papilla and dental pulp stem cells that give rise to odontoblast-like cells producing dentin-like tissue on existing dentinal walls. PMID:19737072

Investigation of the biotransformation of pentachlorophenol and pulp paper mill effluent decolorisation by the bacterial strains in a mixed culture.

PubMed

Singh, Shail; Chandra, R; Patel, D K; Reddy, M M K; Rai, Vibhuti

2008-09-01

Mixed culture of two bacterial strains Bacillus sp. and Serratia marcescens showed potential pentachlorophenol (PCP) degradation and decolorisation of pulp paper mill effluent. The physico-chemical quality of pulp paper mill effluent has been analyzed after 168 h incubation period degraded by mixed culture. The study revealed that it has decreased high load of BOD, COD, TS, TDS, TSS, sulphate, phosphate, total nitrogen, total phenols, metals and different salts (i.e. chloride, sodium, nitrate, potassium) at 168 h incubation period. PCP degradation in pulp paper mill effluent was confirmed by HPLC analysis. Mixed culture was found to degrade PCP up to (94%) present in pulp paper mill effluent with 1% glucose and 0.5% peptone (w/v) at 30+/-1 degrees C, pH 8.0+/-0.2 at 120 rpm in 168 h incubation period. The simultaneous release of chloride ion up to 1,200 mg/l at 168 h emphasized the bacterial dechlorination in the medium. The pulp paper mill effluent degradation was also supported by decline in pH, AOX (absorbable organic halides), color, D.O., BOD, COD and PCP. The analysis of pulp paper mill effluent degradation products by GC-MS analysis revealed the formation of low molecular weight compound like 2-chlorophenol (RT=3.8 min) and tetrachlorohydroquinone (RT=11.86 min) from PCP extracted degraded sample. Further, mixed culture may be used for bioremediation of PCP containing pulp paper mill waste in the environment.

Aminomonas paucivorans gen. nov., sp. nov., a mesophilic, anaerobic, amino-acid-utilizing bacterium.

PubMed

Baena, S; Fardeau, M L; Ollivier, B; Labat, M; Thomas, P; Garcia, J L; Patel, B K

1999-07-01

A novel, asaccharolytic, amino-acid-degrading bacterium, designated strain GLU-3T, was isolated from an anaerobic lagoon of a dairy wastewater treatment plant. Strain GLU-3T stained Gram-negative and was an obligately anaerobic, non-spore-forming, slightly curved, rod-shaped bacterium (0.3 x 4.0-6.0 microns) which existed singly or in pairs. The DNA G+C content was 43 mol%. Optimum growth occurred at 35 degrees C and pH 7.5 on arginine with a generation time of 16 h. Good growth was obtained on arginine, histidine, threonine and glycine. Acetate was the end-product formed from all these substrates, but in addition, a trace of formate was detected from arginine and histidine, and ornithine was produced from arginine. Strain GLU-3T grew slowly on glutamate and produced acetate, carbon dioxide, formate, hydrogen and traces of propionate as the end-products. In syntrophic association with Methanobacterium formicicum, strain GLU-3T oxidized arginine, histidine and glutamate to give propionate as the major product; acetate, carbon dioxide and methane were also produced. Strain GLU-3T did not degrade alanine and the branched-chain amino acids valine, leucine and isoleucine either in pure culture or in association with M. formicicum. The nearest phylogenetic relative of strain GLU-3T was the thermophile Selenomonas acidaminovorans (similarity value of 89.5%). As strain GLU-3T is phylogenetically, physiologically and genotypically different from other amino-acid-degrading genera, it is proposed that it should be designated a new species of a new genus Aminomonas paucivorans gen. nov., sp. nov. (DSM 12260T).

SELECTIVE POTENTIATION OF THE METABOTROPIC GLUTAMATE RECEPTOR SUBTYPE 2 BLOCKS PHENCYCLIDINE-INDUCED HYPERLOCOMOTION AND BRAIN ACTIVATION

PubMed Central

HACKLER, E. A.; BYUN, N. E.; JONES, C. K.; WILLIAMS, J. M.; BAHEZA, R.; SENGUPTA, S.; GRIER, M. D.; AVISON, M.; CONN, P. J.; GORE, J. C.

2013-01-01

Previous preclinical and clinical studies have demonstrated the efficacy of group II metabotropic glutamate receptor (mGluR) agonists as potential antipsychotics. Recent studies utilizing mGluR2-, mGluR3-, and double knockout mice support that the antipsychotic effects of those compounds are mediated by mGluR2. Indeed, biphenyl indanone-A (BINA), an allosteric potentiator of mGluR2, is effective in experimental models of psychosis, blocking phencyclidine (PCP)-induced hyperlocomotion and prepulse inhibition deficits in mice. In this study, we administered the NMDA receptor antagonist PCP (5.6 mg/kg i.p.) to rats, an established animal model predictive of schizophrenia. Here, we show that BINA (32 mg/kg i.p.) attenuated PCP-induced locomotor activity in rats. Using behaviorally relevant doses of BINA and PCP, we performed pharmacological magnetic resonance imaging (phMRI) to assess the specific brain regions that underlie the psychotomimetic effects of PCP, and examined how BINA modulated the PCP-induced functional changes in vivo. In anesthetized rats, acute administration of PCP produced robust, sustained blood oxygenation level-dependent (BOLD) activation in specific cortical, limbic, thalamic, and striatal regions. Pretreatment with BINA suppressed the amplitude of the BOLD response to PCP in the prefrontal cortex, caudaute–putamen, nucleus accumbens, and mediodorsal thalamus. Our results show key brain structures underlying PCP-induced behaviors in a preclinical model of schizophrenia, and, importantly, its reversal by potentiation of mGluR2 by BINA, revealing specific brain regions functionally involved in its pharmacological action. Finally, our findings bolster the growing body of evidence that mGluR2 is a viable target for the treatment of schizophrenia. PMID:20350588

A new target ligand Ser-Glu for PEPT1-overexpressing cancer imaging.

PubMed

Dai, Tongcheng; Li, Na; Zhang, Lingzhi; Zhang, Yuanxing; Liu, Qin

2016-01-01

Nanoparticles functionalized with active target ligands have been widely used for tumor-specific diagnosis and therapy. The target ligands include antibodies, peptides, proteins, small molecules, and nucleic acid aptamers. Here, we utilize dipeptide Ser-Glu (DIP) as a new ligand to functionalize polymer-based fluorescent nanoparticles (NPs) for pancreatic cancer target imaging. We demonstrate that in the first step, Ser-Glu-conjugated NPs (NPs-DIP) efficiently bind to AsPC-1 and in the following NPs-DIP are internalized into AsPC-1 in vitro. The peptide transporter 1 inhibition experiment reveals that the targeting effects mainly depend on the specific binding of DIP to peptide transporter 1, which is remarkably upregulated in pancreatic cancer cells compared with varied normal cells. Furthermore, NPs-DIP specifically accumulate in the site of pancreatic tumor xenograft and are further internalized into the tumor cells in vivo after intravenous administration, indicating that DIP successfully enhanced nanoparticles internalization efficacy into tumor cells in vivo. This work establishes Ser-Glu to be a new tumor-targeting ligand and provides a promising tool for future tumor diagnostic or therapeutic applications.

Mullinamides A and B, New Cyclopeptides Produced by the Ruth Mullins Coal Mine Fire Isolate Streptomyces sp. RM-27-46

PubMed Central

Wang, Xiachang; Shaaban, Khaled A.; Elshahawi, Sherif I.; Ponomareva, Larissa V.; Sunkara, Manjula; Copley, Gregory C.; Hower, James C.; Morris, Andrew J.; Kharel, Madan K.; Thorson, Jon S.

2014-01-01

Two new cyclopeptides, mullinamides A [cyclo-(-l-Gly-l-Glu-l-Val-l-Ile-l-Pro-)] and B [cyclo-(-l-Glu-l-Met-l-Pro-)] were isolated from the crude extract of terrestrial Streptomyces sp. RM-27-46 along with the three known cyclopeptides surugamide A [cyclo-(-l-Ile-d-Ile-l-Lys-l-Ile-d-Phe-d-Leu-l-Ile-d-Ala-)], cyclo-(-l-Pro-l-Phe-) and cyclo-(-l-Pro-l-Leu-). The structures of the new compounds were elucidated by the cumulative analyses of NMR spectroscopy and high resolution mass spectrometry. While mullinamides A and B displayed no appreciable antimicrobial/fungal activity or cytotoxicity, this study highlights the first reported antibacterial activity of surugamide A. PMID:24713874

Methanol Expression Regulator 1 (Mxr1p) Is Essential for the Utilization of Amino Acids as the Sole Source of Carbon by the Methylotrophic Yeast, Pichia pastoris.

PubMed

Sahu, Umakant; Rangarajan, Pundi N

2016-09-23

Unlike Saccharomyces cerevisiae, the methylotrophic yeast Pichia pastoris can assimilate amino acids as the sole source of carbon and nitrogen. It can grow in media containing yeast extract and peptone (YP), yeast nitrogen base (YNB) + glutamate (YNB + Glu), or YNB + aspartate (YNB + Asp). Methanol expression regulator 1 (Mxr1p), a zinc finger transcription factor, is essential for growth in these media. Mxr1p regulates the expression of several genes involved in the utilization of amino acids as the sole source of carbon and nitrogen. These include the following: (i) GDH2 encoding NAD-dependent glutamate dehydrogenase; (ii) AAT1 and AAT2 encoding mitochondrial and cytosolic aspartate aminotransferases, respectively; (iii) MDH1 and MDH2 encoding mitochondrial and cytosolic malate dehydrogenases, respectively; and (iv) GLN1 encoding glutamine synthetase. Synthesis of all these enzymes is regulated by Mxr1p at the level of transcription except GDH2, whose synthesis is regulated at the level of translation. Mxr1p activates the transcription of AAT1, AAT2, and GLN1 in cells cultured in YP as well as in YNB + Glu media, whereas transcription of MDH1 and MDH2 is activated in cells cultured in YNB + Glu but not in YP. A truncated Mxr1p composed of 400 N-terminal amino acids activates transcription of target genes in cells cultured in YP but not in YNB + Glu. Mxr1p binds to Mxr1p response elements present in the promoters of AAT2, MDH2, and GLN1 We conclude that Mxr1p is essential for utilization of amino acids as the sole source of carbon and nitrogen, and it is a global regulator of multiple metabolic pathways in P. pastoris. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

D-Lactic acid biosynthesis from biomass-derived sugars via Lactobacillus delbrueckii fermentation.

PubMed

Zhang, Yixing; Vadlani, Praveen V

2013-12-01

Poly-lactic acid (PLA) derived from renewable resources is considered to be a good substitute for petroleum-based plastics. The number of poly L-lactic acid applications is increased by the introduction of a stereocomplex PLA, which consists of both poly-L and D-lactic acid and has a higher melting temperature. To date, several studies have explored the production of L-lactic acid, but information on biosynthesis of D-lactic acid is limited. Pulp and corn stover are abundant, renewable lignocellulosic materials that can be hydrolyzed to sugars and used in biosynthesis of D-lactic acid. In our study, saccharification of pulp and corn stover was done by cellulase CTec2 and sugars generated from hydrolysis were converted to D-lactic acid by a homofermentative strain, L. delbrueckii, through a sequential hydrolysis and fermentation process (SHF) and a simultaneous saccharification and fermentation process (SSF). 36.3 g L(-1) of D-lactic acid with 99.8 % optical purity was obtained in the batch fermentation of pulp and attained highest yield and productivity of 0.83 g g(-1) and 1.01 g L(-1) h(-1), respectively. Luedeking-Piret model described the mixed growth-associated production of D-lactic acid with a maximum specific growth rate 0.2 h(-1) and product formation rate 0.026 h(-1), obtained for this strain. The efficient synthesis of D-lactic acid having high optical purity and melting point will lead to unique stereocomplex PLA with innovative applications in polymer industry.

The puzzle box as a simple and efficient behavioral test for exploring impairments of general cognition and executive functions in mouse models of schizophrenia.

PubMed

Ben Abdallah, Nada M-B; Fuss, Johannes; Trusel, Massimo; Galsworthy, Michael J; Bobsin, Kristin; Colacicco, Giovanni; Deacon, Robert M J; Riva, Marco A; Kellendonk, Christoph; Sprengel, Rolf; Lipp, Hans-Peter; Gass, Peter

2011-01-01

Deficits in executive functions are key features of schizophrenia. Rodent behavioral paradigms used so far to find animal correlates of such deficits require extensive effort and time. The puzzle box is a problem-solving test in which mice are required to complete escape tasks of increasing difficulty within a limited amount of time. Previous data have indicated that it is a quick but highly reliable test of higher-order cognitive functioning. We evaluated the use of the puzzle box to explore executive functioning in five different mouse models of schizophrenia: mice with prefrontal cortex and hippocampus lesions, mice treated sub-chronically with the NMDA-receptor antagonist MK-801, mice constitutively lacking the GluA1 subunit of AMPA-receptors, and mice over-expressing dopamine D2 receptors in the striatum. All mice displayed altered executive functions in the puzzle box, although the nature and extent of the deficits varied between the different models. Deficits were strongest in hippocampus-lesioned and GluA1 knockout mice, while more subtle deficits but specific to problem solving were found in the medial prefrontal-lesioned mice, MK-801-treated mice, and in mice with striatal overexpression of D2 receptors. Data from this study demonstrate the utility of the puzzle box as an effective screening tool for executive functions in general and for schizophrenia mouse models in particular. Published by Elsevier Inc.

Effects of an Er, Cr:YSGG laser on canine oral hard tissues

NASA Astrophysics Data System (ADS)

Rizoiu, Ioana-Mihaela; Kimmel, Andrew I.; Eversole, Lewis R.

1996-12-01

Beagle dogs were utilized to assess the biologic effects of an Er, Cr:YSGG hard tissue cutting laser and results were compared with conventional mechanical preparations of enamel and dentin. Intraoperative pulpal temperature fluctuations were recorded with thermocouples. The laser cuts failed to induce inflammation in the pulps except in teeth with intentional pulp exposures for both methods. No increase in temperature was detected with the laser. It is concluded that this laser system may be safely employed for tooth preparations without causing adverse pulpal effects.

Lignin carbon fiber: The path for quality

DOE PAGES

Yuan, Joshua S.; Li, Qiang; Ragauskas, Arthur J.

2017-03-01

Lignin represents an abundant biopolymer and a major waste from lignocellulosic processing plants, yet the utilization of lignin for fungible products remains one of the most challenging technical barriers for pulp mills and the modern biorefinery industry. In recent decades, lignin has been sought after as a precursor polymer for carbon fiber due to the high carbon content (up to 60%). Furthermore lignin carbon fiber is expected to be compatible with the market size of the pulp and paper industry and may have transformative impact on petroleum-based carbon fiber.

Effects of short- and long-term aripiprazole treatment on Group I mGluRs in the nucleus accumbens: Comparison with haloperidol.

PubMed

Lum, Jeremy S; Pan, Bo; Deng, Chao; Huang, Xu-Feng; Ooi, Lezanne; Newell, Kelly A

2017-11-21

The D2 receptor partial agonist, aripiprazole, has shown increased therapeutic efficacy for schizophrenia, autism and Tourette's syndrome compared to traditional antipsychotics such as the D2 receptor antagonist, haloperidol. Recent evidence suggests this superior profile may be associated with downstream effects on glutamatergic synapses. Group 1 metabotropic glutamate receptors (mGluRs) and their endogenous modulators, Norbin and Homer1, are regulated by D2 receptor activity, particularly within the nucleus accumbens (NAc), a target region of aripiprazole and haloperidol. This study sought to evaluate the effects of aripiprazole on Group 1 mGluRs, Norbin and Homer1 in the NAc, in comparison to haloperidol. Sprague-Dawley rats were orally administered daily doses of aripiprazole (2.25mg/kg), haloperidol (0.3mg/kg) or vehicle for 1 or 10-weeks. Immunoblot analyses revealed Group 1 mGluR protein levels were not altered following 1-week and 10-week aripiprazole or haloperidol treatment, compared to vehicle treated rodents. However, 1-week aripiprazole and haloperidol treatment significantly elevated Homer1a and Norbin protein expression, respectively. After 10 weeks of treatment, aripiprazole, but not haloperidol, significantly increased Norbin expression. These findings indicate the antipsychotics, aripiprazole and haloperidol, exert differential temporal effects on Norbin and Homer1 expression that may have consequences on synaptic glutamatergic transmission underlying their therapeutic profile. Copyright © 2017 Elsevier B.V. All rights reserved.

Extinction of Contextual Cocaine Memories Requires Cav1.2 within D1R-Expressing Cells and Recruits Hippocampal Cav1.2-Dependent Signaling Mechanisms.

PubMed

Burgdorf, Caitlin E; Schierberl, Kathryn C; Lee, Anni S; Fischer, Delaney K; Van Kempen, Tracey A; Mudragel, Vladimir; Huganir, Richard L; Milner, Teresa A; Glass, Michael J; Rajadhyaksha, Anjali M

2017-12-06

Exposure to cocaine-associated contextual cues contributes significantly to relapse. Extinction of these contextual associations, which involves a new form of learning, reduces cocaine-seeking behavior; however, the molecular mechanisms underlying this process remain largely unknown. We report that extinction, but not acquisition, of cocaine conditioned place preference (CPP) in male mice increased Ca v 1.2 L-type Ca 2+ channel mRNA and protein in postsynaptic density (PSD) fractions of the hippocampus, a brain region involved in drug-context associations. Moreover, viral-mediated deletion of Ca v 1.2 in the dorsal hippocampus attenuated extinction of cocaine CPP. Molecular studies examining downstream Ca v 1.2 targets revealed that extinction recruited calcium/calmodulin (Ca 2+ /CaMK)-dependent protein kinase II (CaMKII) to the hippocampal PSD. This occurred in parallel with an increase in phosphorylation of the AMPA GluA1 receptor subunit at serine 831 (S831), a CaMKII site, along with an increase in total PSD GluA1. The necessity of S831 GluA1 was further demonstrated by the lack of extinction in S831A GluA1 phosphomutant mice. Of note hippocampal GluA1 levels remained unaltered at the PSD, but were reduced near the PSD and at perisynaptic sites of dendritic spines in extinction-resistant S831A mutant mice. Finally, conditional knock-out of Ca v 1.2 in dopamine D1 receptor (D1R)-expressing cells resulted in attenuation of cocaine CPP extinction and lack of extinction-dependent changes in hippocampal PSD CaMKII expression and S831 GluA1 phosphorylation. In summary, we demonstrate an essential role for the hippocampal Ca v 1.2/CaMKII/S831 GluA1 pathway in cocaine CPP extinction, with data supporting contribution of hippocampal D1R-expressing cells in this process. These findings demonstrate a novel role for Ca v 1.2 channels in extinction of contextual cocaine-associated memories. SIGNIFICANCE STATEMENT Continued drug-seeking behavior, a defining characteristic of cocaine addiction, can be precipitated by contextual cues, yet the molecular mechanisms required for extinction of these context-specific memories remain poorly understood. Here, we have uncovered a novel and selective role of the Ca v 1.2 L-type Ca 2+ channel and its downstream signaling pathway in the hippocampus that mediate extinction of cocaine conditioned place preference (CPP). We additionally provide evidence that supports a role of Ca v 1.2 within dopamine D1 receptor-expressing cells of the hippocampus for extinction of cocaine CPP. Therefore, these findings reveal a previously unknown role of Ca v 1.2 channels within the hippocampus and in D1 receptor-expressing cells in extinction of cocaine-associated memories, providing a framework for further exploration of mechanisms underlying extinction of cocaine-seeking behavior. Copyright © 2017 the authors 0270-6474/17/3711895-18$15.00/0.

Impaired activity-dependent FMRP translation and enhanced mGluR-dependent LTD in Fragile X premutation mice

PubMed Central

Iliff, Adam J.; Renoux, Abigail J.; Krans, Amy; Usdin, Karen; Sutton, Michael A.; Todd, Peter K.

2013-01-01

Fragile X premutation-associated disorders, including Fragile X-associated Tremor Ataxia Syndrome, result from unmethylated CGG repeat expansions in the 5′ untranslated region (UTR) of the FMR1 gene. Premutation-sized repeats increase FMR1 transcription but impair rapid translation of the Fragile X mental retardation protein (FMRP), which is absent in Fragile X Syndrome (FXS). Normally, FMRP binds to RNA and regulates metabotropic glutamate receptor (mGluR)-mediated synaptic translation, allowing for dendritic synthesis of several proteins. FMRP itself is also synthesized at synapses in response to mGluR activation. However, the role of activity-dependent translation of FMRP in synaptic plasticity and Fragile X-premutation-associated disorders is unknown. To investigate this question, we utilized a CGG knock-in mouse model of the Fragile X premutation with 120–150 CGG repeats in the mouse Fmr1 5′ UTR. These mice exhibit increased Fmr1 mRNA production but impaired FMRP translational efficiency, leading to a modest reduction in basal FMRP expression. Cultured hippocampal neurons and synaptoneurosomes derived from CGG KI mice demonstrate impaired FMRP translation in response to the group I mGluR agonist 3,5-dihydroxyphenylglycine. Electrophysiological analysis reveals enhanced mGluR-mediated long-term depression (mGluR-LTD) at CA3–CA1 synapses in acute hippocampal slices prepared from CGG KI mice relative to wild-type littermates, similar to Fmr1 knockout mice. However, unlike mGluR-LTD in mice completely lacking FMRP, mGluR-LTD in CGG knock-in mice remains dependent on new protein synthesis. These studies demonstrate partially overlapping synaptic plasticity phenotypes in mouse models of FXS and Fragile X premutation disorders and support a role for activity-dependent synthesis of FMRP in enduring forms of synaptic plasticity. PMID:23250915

Urban air pollutants reduce synaptic function of CA1 neurons via an NMDA/NO• pathway in vitro

PubMed Central

Davis, David A.; Akopian, Garnik; Walsh, John P.; Sioutas, Constantinos; Morgan, Todd E.; Finch, Caleb E.

2013-01-01

Airborne particulate matter (PM) from urban vehicular aerosols altered glutamate receptor functions and induced glial inflammatory responses in rodent models after chronic exposure. Potential neurotoxic mechanisms were analyzed in vitro. In hippocampal slices, 2 h exposure to aqueous nanosized PM (nPM) selectively altered postsynaptic proteins in CA1 neurons: increased GluA1, GluN2A, and GluN2B, but not GluA2, GluN1 or mGlur5; increased PSD95 and spinophilin, but not synaptophysin, while dentate gyrus (DG) neurons were unresponsive. In hippocampal slices and neurons, MitoSOX red fluorescence was increased by nPM, implying free radical production. Specifically, NO• production by slices was increased within 15 min of exposure to nPM with dose dependence, 1–10 µg/ml. Correspondingly, CA1 neurons exhibited increased nitrosylation of the GluN2A receptor and dephosphorylation of GluN2B (S1303) and of GluA1 (S831 & S845). Again, DG neurons were unresponsive to nPM. The induction of NO• and nitrosylation were inhibited by AP5, an NMDA receptor antagonist, which also protects neurite outgrowth in vitro from inhibition by nPM. Membrane injury (EthidiumD-1 uptake) showed parallel specificity. Finally, nPM decreased evoked excitatory postsynaptic currents (EPSCs) of CA1 neurons. These findings further document the selective impact of nPM on glutamatergic functions and identify novel responses of NMDA receptor-stimulated NO• production and nitrosylation reactions during nPM-mediated neurotoxicity. PMID:23927064

Differential effects of the metabotropic glutamate 2/3 receptor agonist LY379268 on nicotine versus cocaine self-administration and relapse in squirrel monkeys.

PubMed

Justinova, Zuzana; Le Foll, Bernard; Redhi, Godfrey H; Markou, Athina; Goldberg, Steven R

2016-05-01

Group II metabotropic glutamate receptors (mGluR2 and mGluR3) have been suggested to play an important role in mediation of drug-reinforced behaviors, as well as in the mechanisms underlying relapse in abstinent subjects. The prototypical mGluR2/3 agonist, LY379268, has been shown to attenuate nicotine reinforcement and cue-induced reinstatement of drug seeking in rats, as well as reinstatement induced by drug-associated stimuli and contexts across different drugs of abuse (i.e., cocaine, heroin, and methamphetamine). However, in primates, LY379268 has been shown to produce conflicting results on abuse-related effects of cocaine, and there are no data available for nicotine. To explore the therapeutic potential of mGluR2/3 agonists, we compared the effects of LY379268 (0.03-1.0 mg/kg) on nicotine, cocaine, and food self-administration under a fixed-ratio (FR10) schedule in three separate groups of squirrel monkeys. Moreover, we studied the effects of LY379268 on nicotine/cocaine priming-induced and cue-induced reinstatement of drug-seeking behavior in nicotine- and cocaine-experienced groups of animals. LY379268 blocked nicotine, but not cocaine, self-administration in monkeys. There was a partial overlap between doses that affected nicotine and food self-administration. In abstinent monkeys, LY379268 dose-dependently blocked nicotine, but not cocaine, priming-induced reinstatement of drug seeking. In both cocaine-experienced and nicotine-experienced groups of animals, LY379268 potently reduced cue-induced reinstatement of drug-seeking behavior. The present findings provide strong support for the potential utility of mGlu2/3 receptor agonists for the treatment of nicotine dependence and suggest their utility for prevention of relapse induced by environmental cues associated with drug taking.

Differences in kainate receptor involvement in hippocampal mossy fibre long-term potentiation depending on slice orientation.

PubMed

Sherwood, John L; Amici, Mascia; Dargan, Sheila L; Culley, Georgia R; Fitzjohn, Stephen M; Jane, David E; Collingridge, Graham L; Lodge, David; Bortolotto, Zuner A

2012-09-01

Long-term potentiation (LTP) is a well-established experimental model used to investigate the synaptic basis of learning and memory. LTP at mossy fibre - CA3 synapses in the hippocampus is unusual because it is normally N-methyl-d-aspartate (NMDA) receptor-independent. Instead it seems that the trigger for mossy fibre LTP involves kainate receptors (KARs). Although it is generally accepted that pre-synaptic KARs play an essential role in frequency facilitation and LTP, their subunit composition remains a matter of significant controversy. We have reported previously that both frequency facilitation and LTP can be blocked by selective antagonism of GluK1 (formerly GluR5/Glu(K5))-containing KARs, but other groups have failed to reproduce this effect. Moreover, data from receptor knockout and mRNA expression studies argue against a major role of GluK1, supporting a more central role for GluK2 (formerly GluR6/Glu(K6)). A potential reason underlying the controversy in the pharmacological experiments may reside in differences in the preparations used. Here we show differences in pharmacological sensitivity of synaptic plasticity at mossy fibre - CA3 synapses depend critically on slice orientation. In transverse slices, LTP of fEPSPs was invariably resistant to GluK1-selective antagonists whereas in parasagittal slices LTP was consistently blocked by GluK1-selective antagonists. In addition, there were pronounced differences in the magnitude of frequency facilitation and the sensitivity to the mGlu2/3 receptor agonist DCG-IV. Using anterograde labelling of granule cells we show that slices of both orientations possess intact mossy fibres and both large and small presynaptic boutons. Transverse slices have denser fibre tracts but a smaller proportion of giant mossy fibre boutons. These results further demonstrate a considerable heterogeneity in the functional properties of the mossy fibre projection. Copyright © 2012 Elsevier Ltd. All rights reserved.

L-pyroglutamic acid protects rat cortical neurons against sodium glutamate-induced injury.

PubMed

Xiao, X Q; Liu, G Q

1999-08-01

To evaluate the effects of L-pyroglutamic acid (L-PGA, L-5-oxo-2-pyrrolidinecaroxylic acid) on sodium glutamate-induced neurotoxicity in rat cortical neurons. In primary cortical cultures from 16-d-old fetal rat, neuronal viability and contents of nitrite in the bathing medium after transient exposure to sodium glutamate (Glu) were measured; with Fura 2-AM as an intracellular calcium indicator, AR-CM-MIC cation measurement system was used to examine cytosolic free calcium ([Ca2+]i). L-PGA 10-80 mumol.L-1, inhibited Glu (500 mumol.L-1)-induced neuronal loss in a concentration-dependent manner with IC50 value of (41 +/- 9) mumol.L-1 (95% confidence limits: 30.3-54.7 mumol.L-1). L-PGA also attenuated Glu-induced NO release. L-PGA 1, 3, 10, 30, and 100 mumol.L-1 depressed Glu-caused [Ca2+]i elevation by 20.5%, 34.4%, 47.7%, 70.6%, and 80.4%, respectively. L-PGA protects cortical neurons against Glu-induced neurotoxity which may be related to inhibition of NO formation or suppression of the rise in [Ca2+]i.

Direct binding of Toll-like receptor 4 to ionotropic glutamate receptor N-methyl-D-aspartate subunit 1 induced by lipopolysaccharide in microglial cells N9 and EOC 20.

PubMed

Cui, Jie; Yu, Siyuan; Li, Yihui; Li, Pan; Liu, Feng

2018-03-01

Microglia, the primary immune cells in the brain, are the predominant cells regulating inflammation-mediated neuronal damage. In response to immunological challenges, such as lipopolysaccharide (LPS), microglia are activated and the inflammatory process is subsequently initiated. The aim of the present study was to determine whether LPS induces interactions between the Toll-like receptor 4 (TLR4) and the ionotropic glutamate receptor N-methyl-D‑aspartate subunit 1 (GluN1) in N9 and EOC 20 microglial cells. Immunocytochemistry demonstrated co-localization of TLR4 and GluN1 in response to LPS, and the direct binding of TLR4 and GluN1 was further validated by antibody-based Fluorescence Resonance Energy Transfer technology. Inhibition of the group I metabotropic glutamate receptor 5 with its selective antagonist, MTEP, abolished LPS-induced direct binding of TLR4 to GluN1. Therefore, these data demonstrated that GluN1 and TLR4 act reciprocally in response to LPS in N9 and EOC 20 microglial cells.

Fiber stress values for design of glulam timber utility structures

Treesearch

R. Hernandez; R. C. Moody; R. H. Falk

In this study, we developed a simple equation to calculate average fiber stress values for design of glued-laminated (glulam) timber utility structures as a function of design bending stress. We took design stress in bending values specified by the American Institute of Timber Construction (AITC) for various combinations of glulam timber, applied appropriate end-use...

Catalytic site of human protein-glucosylgalactosylhydroxylysine glucosidase: Three crucial carboxyl residues were determined by cloning and site-directed mutagenesis.

PubMed

Hamazaki, Hideaki; Hamazaki, Michiko Horikawa

2016-01-15

Protein-glucosylgalactosylhydroxylysine glucosidase (PGGHG; EC3.2.1.107) cleaves glucose from disaccharide unit (Glc-α1,2-Gal) linked to hydroxylysine residues of collagen. In the present paper we first show that PGGHG is the product of ATHL1 gene as follows. (1) PGGHG was purified from chick embryos and digested with trypsin. LC-MS/MS analysis suggested the tryptic-peptides were from the ATHL1 gene product. (2) Chick embryo ATHL1 cDNA was cloned to a cloning and expression vector and two plasmid clones with different ATHL1 CDS insert were obtained. (3) Each plasmid DNA was transformed into Escherichia coli cells for expression and two isoforms of chicken PGGHG were obtained. (4) Both isoforms effectively released glucose from type IV collagen. Next, we searched for carboxyl residues crucial for catalytic activity as follows; human ATHL1 cDNA was cloned into a cloning and expression vector and 18 mutants were obtained by site-directed mutagenesis for 15 carboxyl residues conserved in ATHL1 of jawed vertebrates. The expression analysis indicated that substitutions of Asp301, Glu430 and Glu574 with sterically conservative (D301N, E430Q, E574Q) or functionally conservative (D301E, E430D, E574D) residues led to the complete elimination of enzyme activity. These findings lead us to the conclusion that PGGHG is encoded by ATHL1 and three carboxyl residues (corresponding to Asp301, Glu430 and Glu574 of human PGGHG) might be involved in the catalytic site of PGGHG. Copyright © 2015 Elsevier Inc. All rights reserved.

Resin in bisulfite pulp from Pinus radiata wood and its relationship to pitch troubles

Treesearch

P.J. Nelson; Richard W. Hemingway

1971-01-01

The resin content of bisulfite pulp from Pinus radiata D. Don was determined at various stages in its manufacture and the changes in the composition of the resin studied. About 50% of the resin present in the wood was removed during cooking, an additional 11% by blowpit washing, and a further 8% by screening. Resin acids and fatty acids were...

Oral administration of citrus pulp reduces gasrointestinal recovery of orally dosed Escherichia coli F18 in weaned pigs

USDA-ARS?s Scientific Manuscript database

The effects of citrus pulp (CTP), on the immune and cortisol responses to E. coli F18 inoculation and subsequent E. coli recovery were evaluated in newly weaned pigs (23.3 + 1.8 d of age). Barrows were assigned to 1 of 2 treatment groups; with (CTP; n = 15) and without (Control; n = 15) the in-feed ...

Improvement in rice straw pulp bleaching effluent quality by incorporating oxygen delignification stage prior to elemental chlorine-free bleaching.

PubMed

Kaur, Daljeet; Bhardwaj, Nishi K; Lohchab, Rajesh Kumar

2017-10-01

Environmental degradation by industrial and other developmental activities is alarming for imperative environmental management by process advancements of production. Pulp and paper mills are now focusing on using nonwood-based raw materials to protect forest resources. In present study, rice straw was utilized for pulp production as it is easily and abundantly available as well as rich in carbohydrates (cellulose and hemicelluloses). Soda-anthraquinone method was used for pulp production as it is widely accepted for agro residues. Bleaching process during paper production is the chief source of wastewater generation. The chlorophenolic compounds generated during bleaching are highly toxic, mutagenic, and bioaccumulative in nature. The objectives of study were to use oxygen delignification (ODL) stage prior to elemental chlorine-free (ECF) bleaching to reduce wastewater load and to study its impact on bleached pulp characteristics. ODL stage prior to ECF bleaching improved the optical properties of pulp in comparison to only ECF bleaching. When ODL stage was incorporated prior to bleaching, the tensile index and folding endurance of the pulp were found to be 56.6 ± 1.5 Nm/g and 140, respectively, very high in comparison to ECF alone. A potential reduction of 51, 57, 43, and 53% in BOD 3 , COD, color, and AOX, respectively was observed on adding the ODL stage compared to ECF only. Generation of chlorophenolic compounds was reduced significantly. Incorporation of ODL stage prior to bleaching was found to be highly promising for reducing the toxicity of bleaching effluents and may lead to better management of nearby water resources. Graphical abstract ᅟ.

Successful nonsurgical endodontic outcome of a severely affected permanent maxillary canine with dens invaginatus Oehlers type 3.

PubMed

Brooks, John K; Ribera, Michael J

2014-10-01

The morphogenic complexities of dens invaginatus (DI) Oehlers type 3 in maxillary canines offer significant endodontic challenges. A case report is provided of a 14-year-old female patient who presented with an anomalous-looking permanent maxillary canine associated with a sinus tract. Pulp testing revealed a normal response on the distal aspect of the tooth, whereas the mesial segment tested nonresponsive. A radiolucent lesion was seen on the mesiolateral radicular area adjacent to the severely distended pulp chamber. A gutta-percha point inserted into the sinus tract traced to this same region. The diagnosis was normal pulp coincident with DI Oehlers type 3 with pulp necrosis and chronic apical abscess. Despite a concerted effort to limit the root canal therapy to only the necrotic canal, its proximity to the normal canal obviated this possibility, entailing endodontic treatment of the entire root canal system. The necrotic pulp space was subjected to sustained irrigation with 5.25% sodium hypochlorite and then completed with 17% ethylenediaminetetraacetic acid. A bolus of gutta-percha was used to create an apical barrier, and then the remainder of the enlarged pulp space was obturated with injectable thermoplasticized gutta-percha. At a 4.5-year recall, there was no clinical and radiographic evidence of infection. Endodontic success was accomplished with meticulous efforts of disinfection. Thermoplasticized gutta-percha can offer utility for obturation of anatomically complicated pulp spaces. The use of the dental operating microscope is an invaluable aid for discernment of the intricacies of teeth affected with DI type 3 variant and can enhance clinical outcomes. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Age estimation by pulp-to-tooth area ratio using cone-beam computed tomography: A preliminary analysis.

PubMed

Rai, Arpita; Acharya, Ashith B; Naikmasur, Venkatesh G

2016-01-01

Age estimation of living or deceased individuals is an important aspect of forensic sciences. Conventionally, pulp-to-tooth area ratio (PTR) measured from periapical radiographs have been utilized as a nondestructive method of age estimation. Cone-beam computed tomography (CBCT) is a new method to acquire three-dimensional images of the teeth in living individuals. The present study investigated age estimation based on PTR of the maxillary canines measured in three planes obtained from CBCT image data. Sixty subjects aged 20-85 years were included in the study. For each tooth, mid-sagittal, mid-coronal, and three axial sections-cementoenamel junction (CEJ), one-fourth root level from CEJ, and mid-root-were assessed. PTR was calculated using AutoCAD software after outlining the pulp and tooth. All statistical analyses were performed using an SPSS 17.0 software program. Linear regression analysis showed that only PTR in axial plane at CEJ had significant age correlation ( r = 0.32; P < 0.05). This is probably because of clearer demarcation of pulp and tooth outline at this level.

Formulation and acceptability of foam mat dried seabuckthorn (Hippophae salicifolia) leather.

PubMed

Kaushal, Manisha; Sharma, P C; Sharma, Rakesh

2013-02-01

Technology for utilization of seabuckthorn berries for preparation of fruit leather/bar was optimized by modifying the foam mat drying technique. The conversion of seabuckthorn juice/pulp into foam was standardized by whipping the pulp after addition of CMC @ 0-3% at 5 °C and drying the resultant foam in dehydrator (55 ± 2 °C) to a moisture content of about 12-14%. The fruit bar prepared from sulphited juice/pulp wrapped in a butter paper followed by packing in polyethylene pouches (20 g) and stored at ambient temperature (14.6-26.1 °C) experienced least changes in quality attributes like ascorbic acid (1045.7 mg/100 g vs 997.5 mg/100 g) and carotenoids (80.4 mg/100 g vs 72.3 mg/100 g) as compared to the leather made from the unsulphited pulp. Storage studies indicate that fruit bars are mildly hygroscopic (0.46-0.65) and can be stored within the RH of 46-65% at room temperature.

Investigation on Quantitative Structure Activity Relationships and Pharmacophore Modeling of a Series of mGluR2 Antagonists

PubMed Central

Zhang, Meng-Qi; Zhang, Xiao-Le; Li, Yan; Fan, Wen-Jia; Wang, Yong-Hua; Hao, Ming; Zhang, Shu-Wei; Ai, Chun-Zhi

2011-01-01

MGluR2 is G protein-coupled receptor that is targeted for diseases like anxiety, depression, Parkinson’s disease and schizophrenia. Herein, we report the three-dimensional quantitative structure–activity relationship (3D-QSAR) studies of a series of 1,3-dihydrobenzo[ b][1,4]diazepin-2-one derivatives as mGluR2 antagonists. Two series of models using two different activities of the antagonists against rat mGluR2, which has been shown to be very similar to the human mGluR2, (activity I: inhibition of [3H]-LY354740; activity II: mGluR2 (1S,3R)-ACPD inhibition of forskolin stimulated cAMP.) were derived from datasets composed of 137 and 69 molecules respectively. For activity I study, the best predictive model obtained from CoMFA analysis yielded a Q2 of 0.513, R2 ncv of 0.868, R2 pred = 0.876, while the CoMSIA model yielded a Q2 of 0.450, R2 ncv = 0.899, R2 pred = 0.735. For activity II study, CoMFA model yielded statistics of Q2 = 0.5, R2 ncv = 0.715, R2 pred = 0.723. These results prove the high predictability of the models. Furthermore, a combined analysis between the CoMFA, CoMSIA contour maps shows that: (1) Bulky substituents in R7, R3 and position A benefit activity I of the antagonists, but decrease it when projected in R8 and position B; (2) Hydrophilic groups at position A and B increase both antagonistic activity I and II; (3) Electrostatic field plays an essential rule in the variance of activity II. In search for more potent mGluR2 antagonists, two pharmacophore models were developed separately for the two activities. The first model reveals six pharmacophoric features, namely an aromatic center, two hydrophobic centers, an H-donor atom, an H-acceptor atom and an H-donor site. The second model shares all features of the first one and has an additional acceptor site, a positive N and an aromatic center. These models can be used as guidance for the development of new mGluR2 antagonists of high activity and selectivity. This work is the first report on 3D-QSAR modeling of these mGluR2 antagonists. All the conclusions may lead to a better understanding of the mechanism of antagonism and be helpful in the design of new potent mGluR2 antagonists. PMID:22016641

Investigation on quantitative structure activity relationships and pharmacophore modeling of a series of mGluR2 antagonists.

PubMed

Zhang, Meng-Qi; Zhang, Xiao-Le; Li, Yan; Fan, Wen-Jia; Wang, Yong-Hua; Hao, Ming; Zhang, Shu-Wei; Ai, Chun-Zhi

2011-01-01

MGluR2 is G protein-coupled receptor that is targeted for diseases like anxiety, depression, Parkinson's disease and schizophrenia. Herein, we report the three-dimensional quantitative structure-activity relationship (3D-QSAR) studies of a series of 1,3-dihydrobenzo[ b][1,4]diazepin-2-one derivatives as mGluR2 antagonists. Two series of models using two different activities of the antagonists against rat mGluR2, which has been shown to be very similar to the human mGluR2, (activity I: inhibition of [(3)H]-LY354740; activity II: mGluR2 (1S,3R)-ACPD inhibition of forskolin stimulated cAMP.) were derived from datasets composed of 137 and 69 molecules respectively. For activity I study, the best predictive model obtained from CoMFA analysis yielded a Q(2) of 0.513, R(2) (ncv) of 0.868, R(2) (pred) = 0.876, while the CoMSIA model yielded a Q(2) of 0.450, R(2) (ncv) = 0.899, R(2) (pred) = 0.735. For activity II study, CoMFA model yielded statistics of Q(2) = 0.5, R(2) (ncv) = 0.715, R(2) (pred) = 0.723. These results prove the high predictability of the models. Furthermore, a combined analysis between the CoMFA, CoMSIA contour maps shows that: (1) Bulky substituents in R(7), R(3) and position A benefit activity I of the antagonists, but decrease it when projected in R(8) and position B; (2) Hydrophilic groups at position A and B increase both antagonistic activity I and II; (3) Electrostatic field plays an essential rule in the variance of activity II. In search for more potent mGluR2 antagonists, two pharmacophore models were developed separately for the two activities. The first model reveals six pharmacophoric features, namely an aromatic center, two hydrophobic centers, an H-donor atom, an H-acceptor atom and an H-donor site. The second model shares all features of the first one and has an additional acceptor site, a positive N and an aromatic center. These models can be used as guidance for the development of new mGluR2 antagonists of high activity and selectivity. This work is the first report on 3D-QSAR modeling of these mGluR2 antagonists. All the conclusions may lead to a better understanding of the mechanism of antagonism and be helpful in the design of new potent mGluR2 antagonists.

Exploring neuroprotective potential of Withania somnifera phytochemicals by inhibition of GluN2B-containing NMDA receptors: An in silico study.

PubMed

Kumar, Gaurav; Patnaik, Ranjana

2016-07-01

N-methyl-d-aspartate receptors (NMDARs) mediated excitotoxicity has been implicated in multi-neurodegenerative diseases. Due to lack of efficacy and adverse effects of NMDA receptor antagonists, search for herbal remedies that may act as therapeutic agents is an active area of research to combat these diseases. Withania somnifera (WS) is being used for centuries as a nerve tonic and Nootropic agents. The present study targets the in silico evaluation of the neuroprotective efficacy of W. somnifera phytochemicals by inhibition of NMDA receptor-mediated excitotoxicity through allosteric inhibition of the GluN2B containing NMDARs. We predict Blood Brain Barrier (BBB) penetration, mutagenicity, drug-likeness and Human Intestinal Absorption properties of 25 WS phytochemicals. Further, molecular docking was performed to know whether these phytochemicals inhibit the GluN2B containing NMDARs or not. The results suggest that Anaferine, Beta-Sitosterol, Withaferin A, Withanolide A, Withanolide B and Withanolide D inhibit GluN2B containing NMDARs through allosteric mode similar to the well-known selective antagonist Ifenprodil. These phytochemicals have potential as an essentially useful oral drug to counter NMDARs mediated excitotoxicity and to treat multi-neurodegenerative diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

Phylogenetic analysis of ionotropic L-glutamate receptor genes in the Bilateria, with special notes on Aplysia californica.

PubMed

Greer, Justin B; Khuri, Sawsan; Fieber, Lynne A

2017-01-11

The neurotransmitter L-Glutamate (L-Glu) acting at ionotropic L-Glu receptors (iGluR) conveys fast excitatory signal transmission in the nervous systems of all animals. iGluR-dependent neurotransmission is a key component of the synaptic plasticity that underlies learning and memory. During learning, two subtypes of iGluR, α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPAR) and N-methyl-D-aspartate receptors (NMDAR), are dynamically regulated postsynaptically in vertebrates. Invertebrate organisms such as Aplysia californica (Aplysia) are well-studied models for iGluR-mediated function, yet no studies to date have analyzed the evolutionary relationships between iGluR genes in these species and those in vertebrates, to identify genes that may mediate plasticity. We conducted a thorough phylogenetic analysis spanning Bilateria to elucidate these relationships. The expression status of iGluR genes in the Aplysia nervous system was also examined. Our analysis shows that ancestral genes for both NMDAR and AMPAR subtypes were present in the common bilaterian ancestor. NMDAR genes show very high conservation in motifs responsible for forming the conductance pore of the ion channel. The number of NMDAR subunits is greater in vertebrates due to an increased number of splice variants and an increased number of genes, likely due to gene duplication events. AMPAR subunits form an orthologous group, and there is high variability in the number of AMPAR genes in each species due to extensive taxon specific gene gain and loss. qPCR results show that all 12 Aplysia iGluR subunits are expressed in all nervous system ganglia. Orthologous NMDAR subunits in all species studied suggests conserved function across Bilateria, and potentially a conserved mechanism of neuroplasticity and learning. Vertebrates display an increased number of NMDAR genes and splice variants, which may play a role in their greater diversity of physiological responses. Extensive gene gain and loss of AMPAR genes may result in different physiological properties that are taxon specific. Our results suggest a significant role for L-Glu mediated responses throughout the Aplysia nervous system, consistent with L-Glu's role as the primary excitatory neurotransmitter.

Characterization of ionotropic glutamate receptors in human lymphocytes

PubMed Central

Lombardi, Grazia; Dianzani, Chiara; Miglio, Gianluca; Canonico, Pier Luigi; Fantozzi, Roberto

2001-01-01

The effect of L-glutamate (Glu) on human lymphocyte function was studied by measuring anti-CD3 monoclonal antibody (mAb) or phytohaemagglutinin (PHA)-induced intracellular Ca2+ ([Ca2+]i) rise (Fura-2 method), and cell proliferation (MTT assay). Glu (0.001 – 100 μM) did not modify basal lymphocyte [Ca2+]i, but significantly potentiated the effects of anti-CD3 mAb or PHA. Maximal [Ca2+]i rises over resting cells were: 165±8 and 247±10 nM at 3.0×10−2 mg ml−1 anti-CD3 mAb; 201±4 and 266±9 nM at 5.0×10−2 mg ml−1 PHA, in the absence or presence of 1 μM Glu, respectively. The Glu effect showed a bell-shape concentration-dependent relationship, with a maximum (+90±3% for anti-CD3 mAb and +57±2% for PHA over Glu-untreated cells) at 1 μM. Non-NMDA receptor agonists (1 μM) showed a greater efficacy (+76±2% for (S)-AMPA; +78±4% for KA), if compared to NMDA (+46±2%), or Glu itself. Ionotropic Glu receptor antagonists completely inhibited the effects of the corresponding specific receptor agonists (1 μM). The IC50 values calculated were: 0.9 μM for D-AP5; 0.6 μM for (+)-MK801; 0.3 μM for NBQX. Both NBQX and KYNA were able to abolish Glu effect. The IC50s calculated were: 3.4 μM for NBQX; 0.4 μM for KYNA. Glu (0.1 – 1 mM) did not change the resting cell proliferation, whereas Glu (1 mM) significant inhibited (−27±4%) PHA (1.0×10−2 mg ml−1)-induced lymphocyte proliferation at 72 h. In conclusion, human lymphocytes express ionotropic Glu receptors functionally operating as modulators of cell activation. PMID:11454668

Sacrificial adsorbate for surfactants utilized in chemical floods of enhanced oil recovery operations

DOEpatents

Johnson, Jr., James S.; Westmoreland, Clyde G.

1982-01-01

The present invention is directed to a sacrificial or competitive adsorbate for surfactants contained in chemical flooding emulsions for enhanced oil recovery operations. The adsorbate to be utilized in the method of the present invention is a caustic effluent from the bleach stage or the weak black liquor from the digesters and pulp washers of the kraft pulping process. This effluent or weak black liquor is injected into an oil-bearing subterranean earth formation prior to or concurrent with the chemical flood emulsion and is adsorbed on the active mineral surfaces of the formation matrix so as to effectively reduce adsorption of surfactant in the chemical flood. Alternatively, the effluent or liquor can be injected into the subterranean earth formation subsequent to a chemical flood to displace the surfactant from the mineral surfaces for the recovery thereof.

Sacrificial adsorbate for surfactants utilized in chemical floods of enhanced oil recovery operations

DOEpatents

Johnson, J.S. Jr.; Westmoreland, C.G.

1980-08-20

The present invention is directed to a sacrificial or competitive adsorbate for surfactants contained in chemical flooding emulsions for enhanced oil recovery operations. The adsorbate to be utilized in the method of the present invention is a caustic effluent from the bleach stage or the weak black liquor from the digesters and pulp washers of the kraft pulping process. This effluent or weak black liquor is injected into an oil-bearing subterranean earth formation prior to or concurrent with the chemical flood emulsion and is adsorbed on the active mineral surfaces of the formation matrix so as to effectively reduce adsorption of surfactant in the chemical flood. Alternatively, the effluent or liquor can be injected into the subterranean earth formation subsequent to a chemical flood to displace the surfactant from the mineral surfaces for the recovery thereof.

Modulation of nociceptive dural input to the trigeminocervical complex through GluK1 kainate receptors.

PubMed

Andreou, Anna P; Holland, Philip R; Lasalandra, Michele P; Goadsby, Peter J

2015-03-01

Migraine is a common and disabling neurologic disorder, with important psychiatric comorbidities. Its pathophysiology involves activation of neurons in the trigeminocervical complex (TCC). Kainate receptors carrying the glutamate receptor subunit 5 (GluK1) are present in key brain areas involved in migraine pathophysiology. To study the influence of kainate receptors on trigeminovascular neurotransmission, we determined the presence of GluK1 receptors within the trigeminal ganglion and TCC with immunohistochemistry. We performed in vivo electrophysiologic recordings from TCC neurons and investigated whether local or systemic application of GluK1 receptor antagonists modulated trigeminovascular transmission. Microiontophoretic application of a selective GluK1 receptor antagonist, but not of a nonspecific ionotropic glutamate receptor antagonist, markedly attenuated cell firing in a subpopulation of neurons activated in response to dural stimulation, consistent with selective inhibition of postsynaptic GluK1 receptor-evoked firing seen in all recorded neurons. In contrast, trigeminovascular activation was significantly facilitated in a different neuronal population. The clinically active kainate receptor antagonist LY466195 attenuated trigeminovascular activation in all neurons. In addition, LY466195 demonstrated an N-methyl-d-aspartate receptor-mediated effect. This study demonstrates a differential role of GluK1 receptors in the TCC, antagonism of which can inhibit trigeminovascular activation through postsynaptic mechanisms. Furthermore, the data suggest a novel, possibly presynaptic, modulatory role of trigeminocervical kainate receptors in vivo. Differential activation of kainate receptors suggests unique roles for this receptor in pro- and antinociceptive mechanisms in migraine pathophysiology.

Triclosan-Evoked Neurotoxicity Involves NMDAR Subunits with the Specific Role of GluN2A in Caspase-3-Dependent Apoptosis.

PubMed

Szychowski, Konrad A; Wnuk, Agnieszka; Rzemieniec, Joanna; Kajta, Małgorzata; Leszczyńska, Teresa; Wójtowicz, Anna K

2018-04-19

Triclosan (TCS) is an antimicrobial agent that is used extensively in personal care and in sanitising products. A number of studies have shown the presence of TCS in different human tissues such as blood, adipose tissue, the liver, brain as well as in breast milk and urine. N-Methyl-D-aspartate receptors (NMDARs) are glutamate-gated ion channels that are widely expressed in the central nervous system and which play key roles in excitatory synaptic transmission. There is, however, no data on the involvement of NMDAR subunits in the apoptotic and neurotoxic effects of TCS. Our experiments are the first to show that TCS used at environmentally relevant concentrations evoked NMDA-dependent effects in neocortical neurons in primary cultures, as MK-801, an uncompetitive NMDA receptor antagonist, reduced the levels of TCS-induced ROS production as well as caspase-3 activity and LDH release. TCS caused a decrease in protein expression of all the studied NMDA receptor subunits (GluN1, GluN2A, GluN2B) that were measured at 3, 6 and 24 h post-treatment. However, at 48 h of the experiment, the level of the GluN1 subunit returned to the control level, and the levels of the other subunits showed a tendency to increase. In TCS-treated neocortical cells, protein profiles of NMDAR subunits measured up to 24 h were similar to mRNA expression of GluN1 and GluN2A, but not to GluN2B mRNA. In this study, cells transiently transfected with GluN1, GluN2A or GluN2B siRNA exhibited reduced levels of LDH release, which suggests the involvement of all of the studied NMDAR subunits in the neurotoxic action of TCS. According to our data, GluN1 and GluN2A were mainly responsible for neuronal cell death as evidenced by neutral red uptake, whereas GluN2A was involved in TCS-induced caspase-3-dependent apoptosis. We suggest that TCS-evoked apoptosis and neurotoxicity could be related to transient degradation of NMDAR subunits in mouse neurons. Furthermore, recycling of NMDAR subunits in response to TCS is possible. Because transfections with specific siRNA did not completely abolish the effects of TCS as compared to cells transfected with negative siRNA in this study, other NMDAR-independent mechanisms of TCS action are also possible.

An in vitro evaluation of the degree of pulp tissue dissolution through different root canal irrigation protocols.

PubMed

Amato, Massimo; Pantaleo, Giuseppe; Abtellatif, Dina; Blasi, Andrea; Gagliani, Massimo; Iandolo, Alfredo

2018-01-01

The aim of this study is to evaluate in vitro , using artificial lateral canals, the rate of dissolution of the pulp tissue through different protocols of canal irrigation. One hundred artificial canals provided with lateral canals have been used. Each lateral canal was filled with pulp tissue and calibrated to 0.002 mg. All canals were irrigated using five different protocols. Five groups have been used for the experiment: Group A, distilled water (control); Group B, preheated NaOCl; Group C, NaOCl heated inside the canal; Group D, NaOCl ultrasonically activated; and Group E, NaOCl heated inside the canal with ultrasonic activation. All samples were weighed through professional microbalance in three different phases: before insertion of the pulp tissue into the lateral canal, after insertion of the pulp tissue and, finally, after different protocols of irrigation. A statistical analysis with Kruskal-Wallis test and Mann-Whitney test was performed. The partial dissolution of the pulp tissue inside the artificial lateral canal occurs only using the protocol with NaOCl heated inside the canal with ultrasonic activation. Other irrigation protocols are not able to dissolve the pulp tissue. The main objective of endodontic therapy is the removal of damaged tissues and bacteria. Modern literature highlights that it is impossible to remove all the pulp tissues and bacteria from the whole endodontic space. Hence, to achieve excellence and get positive results in the short and long term, it is necessary to use techniques and technologies that may increase the degree of root canal detersion.

Candidate chemosensory ionotropic receptors in a Lepidoptera.

PubMed

Olivier, V; Monsempes, C; François, M-C; Poivet, E; Jacquin-Joly, E

2011-04-01

A new family of candidate chemosensory ionotropic receptors (IRs) related to ionotropic glutamate receptors (iGluRs) was recently discovered in Drosophila melanogaster. Through Blast analyses of an expressed sequenced tag library prepared from male antennae of the noctuid moth Spodoptera littoralis, we identified 12 unigenes encoding proteins related to D. melanogaster and Bombyx mori IRs. Their full length sequences were obtained and the analyses of their expression patterns suggest that they were exclusively expressed or clearly enriched in chemosensory organs. The deduced protein sequences were more similar to B. mori and D. melanogaster IRs than to iGluRs and showed considerable variations in the predicted ligand-binding domains; none have the three glutamate-interacting residues found in iGluRs, suggesting different binding specificities. Our data suggest that we identified members of the insect IR chemosensory receptor family in S. littoralis and we report here the first demonstration of IR expression in Lepidoptera. © 2010 The Authors. Insect Molecular Biology © 2010 The Royal Entomological Society.

Simple and Versatile 3D Printed Microfluidics Using Fused Filament Fabrication.

PubMed

Morgan, Alex J L; Hidalgo San Jose, Lorena; Jamieson, William D; Wymant, Jennifer M; Song, Bing; Stephens, Phil; Barrow, David A; Castell, Oliver K

2016-01-01

The uptake of microfluidics by the wider scientific community has been limited by the fabrication barrier created by the skills and equipment required for the production of traditional microfluidic devices. Here we present simple 3D printed microfluidic devices using an inexpensive and readily accessible printer with commercially available printer materials. We demonstrate that previously reported limitations of transparency and fidelity have been overcome, whilst devices capable of operating at pressures in excess of 2000 kPa illustrate that leakage issues have also been resolved. The utility of the 3D printed microfluidic devices is illustrated by encapsulating dental pulp stem cells within alginate droplets; cell viability assays show the vast majority of cells remain live, and device transparency is sufficient for single cell imaging. The accessibility of these devices is further enhanced through fabrication of integrated ports and by the introduction of a Lego®-like modular system facilitating rapid prototyping whilst offering the potential for novices to build microfluidic systems from a database of microfluidic components.

Simple and Versatile 3D Printed Microfluidics Using Fused Filament Fabrication

PubMed Central

Morgan, Alex J. L.; Hidalgo San Jose, Lorena; Jamieson, William D.; Wymant, Jennifer M.; Song, Bing; Stephens, Phil

2016-01-01

The uptake of microfluidics by the wider scientific community has been limited by the fabrication barrier created by the skills and equipment required for the production of traditional microfluidic devices. Here we present simple 3D printed microfluidic devices using an inexpensive and readily accessible printer with commercially available printer materials. We demonstrate that previously reported limitations of transparency and fidelity have been overcome, whilst devices capable of operating at pressures in excess of 2000 kPa illustrate that leakage issues have also been resolved. The utility of the 3D printed microfluidic devices is illustrated by encapsulating dental pulp stem cells within alginate droplets; cell viability assays show the vast majority of cells remain live, and device transparency is sufficient for single cell imaging. The accessibility of these devices is further enhanced through fabrication of integrated ports and by the introduction of a Lego®-like modular system facilitating rapid prototyping whilst offering the potential for novices to build microfluidic systems from a database of microfluidic components. PMID:27050661

[The effect of overdose fluoride on the expression of TGF-beta1 in rat's dental pulps].

PubMed

Wu, Yu; He, Ke-xing; Yang, Yi-ping; Cao, Yang; Liang, Zhi-feng

2006-04-01

To observe the effect of overdose fluoride on the expression of TGF-beta1 in rat's dental pulps. 20 wister rats were divided into two groups. In the control group, equal dose distilled water were given to the rats. In the experimental group, 20 mg.kg(-1).d(-1) NaF were given. After 8 weeks of treatment, immunohistochemical staining was adopted for detection of the expression of TGF-beta1 in dental pulps of the rats. SPSS10.0 software package was used for Student's t test. Image analysis results showed that the expression of TGF-beta1 in the dental pulp and inner dentin were inhibited in the experimental group as compared with the control group (P<0.01). The overdose fluoride will inhibit the secretion of TGF-beta1, which leads to abnormal development of the teeth.

Alpha-Synuclein Produces Early Behavioral Alterations via Striatal Cholinergic Synaptic Dysfunction by Interacting With GluN2D N-Methyl-D-Aspartate Receptor Subunit.

PubMed

Tozzi, Alessandro; de Iure, Antonio; Bagetta, Vincenza; Tantucci, Michela; Durante, Valentina; Quiroga-Varela, Ana; Costa, Cinzia; Di Filippo, Massimiliano; Ghiglieri, Veronica; Latagliata, Emanuele Claudio; Wegrzynowicz, Michal; Decressac, Mickael; Giampà, Carmela; Dalley, Jeffrey W; Xia, Jing; Gardoni, Fabrizio; Mellone, Manuela; El-Agnaf, Omar Mukhtar; Ardah, Mustafa Taleb; Puglisi-Allegra, Stefano; Björklund, Anders; Spillantini, Maria Grazia; Picconi, Barbara; Calabresi, Paolo

2016-03-01

Advanced Parkinson's disease (PD) is characterized by massive degeneration of nigral dopaminergic neurons, dramatic motor and cognitive alterations, and presence of nigral Lewy bodies, whose main constituent is α-synuclein (α-syn). However, the synaptic mechanisms underlying behavioral and motor effects induced by early selective overexpression of nigral α-syn are still a matter of debate. We performed behavioral, molecular, and immunohistochemical analyses in two transgenic models of PD, mice transgenic for truncated human α-synuclein 1-120 and rats injected with the adeno-associated viral vector carrying wild-type human α-synuclein. We also investigated striatal synaptic plasticity by electrophysiological recordings from spiny projection neurons and cholinergic interneurons. We found that overexpression of truncated or wild-type human α-syn causes partial reduction of striatal dopamine levels and selectively blocks the induction of long-term potentiation in striatal cholinergic interneurons, producing early memory and motor alterations. These effects were dependent on α-syn modulation of the GluN2D-expressing N-methyl-D-aspartate receptors in cholinergic interneurons. Acute in vitro application of human α-syn oligomers mimicked the synaptic effects observed ex vivo in PD models. We suggest that striatal cholinergic dysfunction, induced by a direct interaction between α-syn and GluN2D-expressing N-methyl-D-aspartate receptors, represents a precocious biological marker of the disease. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Imaging for metabotropic glutamate receptor subtype 1 in rat and monkey brains using PET with [18F]FITM.

PubMed

Yamasaki, Tomoteru; Fujinaga, Masayuki; Maeda, Jun; Kawamura, Kazunori; Yui, Joji; Hatori, Akiko; Yoshida, Yuichiro; Nagai, Yuji; Tokunaga, Masaki; Higuchi, Makoto; Suhara, Tetsuya; Fukumura, Toshimitsu; Zhang, Ming-Rong

2012-04-01

In this study, we evaluate the utility of 4-[(18)F]fluoro-N-[4-[6-(isopropylamino)pyrimidin-4-yl]-1,3-thiazol-2-yl]-N-methylbenzamide ([(18)F]FITM) as a positron emission tomography (PET) ligand for imaging of the metabotropic glutamate receptor subtype 1 (mGluR1) in rat and monkey brains. In vivo distribution of [(18)F]FITM in brains was evaluated by PET scans with or without the mGluR1-selective antagonist (JNJ16259685). Kinetic parameters of monkey PET data were obtained using the two-tissue compartment model with arterial blood sampling. In PET studies in rat and monkey brains, the highest uptake of radioactivity was in the cerebellum, followed by moderate uptake in the thalamus, hippocampus and striatum. The lowest uptake of radioactivity was detected in the pons. These uptakes in all brain regions were dramatically decreased by pre-administration of JNJ16259685. In kinetic analysis of monkey PET, the highest volume of distribution (V(T)) was detected in the cerebellum (V(T) = 11.5). [(18)F]FITM has an excellent profile as a PET ligand for mGluR1 imaging. PET with [(18)F]FITM may prove useful for determining the regional distribution and density of mGluR1 and the mGluR1 occupancy of drugs in human brains.

Crystal structure of Bacillus anthracis transpeptidase enzyme CapD.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, R.; Richter, S.; Zhang, R.

2009-09-04

Bacillus anthracis elaborates a poly-{gamma}-d-glutamic acid capsule that protects bacilli from phagocytic killing during infection. The enzyme CapD generates amide bonds with peptidoglycan cross-bridges to anchor capsular material within the cell wall envelope of B. anthracis. The capsular biosynthetic pathway is essential for virulence during anthrax infections and can be targeted for anti-infective inhibition with small molecules. Here, we present the crystal structures of the {gamma}-glutamyltranspeptidase CapD with and without {alpha}-l-Glu-l-Glu dipeptide, a non-hydrolyzable analog of poly-{gamma}-d-glutamic acid, in the active site. Purified CapD displays transpeptidation activity in vitro, and its structure reveals an active site broadly accessible for poly-{gamma}-glutamatemore » binding and processing. Using structural and biochemical information, we derive a mechanistic model for CapD catalysis whereby Pro{sup 427}, Gly{sup 428}, and Gly{sup 429} activate the catalytic residue of the enzyme, Thr{sup 352}, and stabilize an oxyanion hole via main chain amide hydrogen bonds.« less

Stiffness analysis of glued connection of the timber-concrete structure

NASA Astrophysics Data System (ADS)

Daňková, Jana; Mec, Pavel; Majstríková, Tereza

2016-01-01

This paper presents results of experimental and mathematical analysis of stiffness characteristics of a composite timber-concrete structure. The composite timberconcrete structure presented herein is non-typical compared to similar types of building structures. The interaction between the timber and concrete part of the composite cross-section is not based on metal connecting elements, but it is ensured by a glued-in perforated mesh made of plywood. The paper presents results of experimental and mathematical analysis for material alternatives of the solution of the glued joint. The slip modulus values were determined experimentally. Data obtained from the experiment evaluated by means of regression analysis. Test results were also used as input data for the compilation of a 3D model of a composite structure by means of the 3D finite element model. On the basis of result evaluation, it can be stated that the stress-deformation behaviour at shear loading of this specific timber-concrete composite structure can be affected by the type of glue used. Parameters of the 3D model of both alternative of the structure represent well the behaviour of the composite structure and the model can be used for predicting design parameters of a building structure.

Effects of Ibuprofen on Cognition and NMDA Receptor Subunit Expression Across Aging

PubMed Central

Loza, Alejandra Márquez; Elias, Valerie; Wong, Carmen P.; Ho, Emily; Bermudez, Michelle; Magnusson, Kathy R.

2017-01-01

Age-related declines in long- and short-term memory show relationships to decreases in N-methyl-D-aspartate (NMDA) receptor expression, which may involve inflammation. This study was designed to determine effects of an anti-inflammatory drug, ibuprofen, on cognitive function and NMDA receptor expression across aging. Male C57BL/6 mice (ages 5, 14, 20, and 26 months) were fed ibuprofen (375 ppm) in NIH31 diet or diet alone for 6 weeks prior to testing. Behavioral testing using the Morris water maze showed that older mice performed significantly worse than younger in spatial long-term memory, reversal, and short-term memory tasks. Ibuprofen enhanced overall performance in the short-term memory task, but this appeared to be more related to improved executive function than memory. Ibuprofen induced significant decreases over all ages in the mRNA densities for GluN2B subunit, all GluN1 splice variants, and GluN1-1 splice forms in the frontal cortex and in protein expression of GluN2A, GluN2B and GluN1 C2′ cassettes in the hippocampus. GluN1-3 splice form mRNA and C2′ cassette protein were significantly increased across ages in frontal lobes of ibuprofen-treated mice. Ibuprofen did not alter expression of pro-inflammatory cytokines IL-1β and TNFα, but did reduce the area of reactive astrocyte immunostaining in frontal cortex of aged mice. Enhancement in executive function showed a relationship to increased GluN1-3 mRNA and decreased gliosis. These findings suggest that inflammation may play a role in executive function declines in aged animals, but other effects of ibuprofen on NMDA receptors appeared to be unrelated to aging or inflammation. PMID:28057539

CORM-A1 prevents blood-brain barrier dysfunction caused by ionotropic glutamate receptor-mediated endothelial oxidative stress and apoptosis.

PubMed

Basuroy, Shyamali; Leffler, Charles W; Parfenova, Helena

2013-06-01

In cerebral microvascular endothelial cells (CMVEC) of newborn pigs, glutamate at excitotoxic concentrations (mM) causes apoptosis mediated by reactive oxygen species (ROS). Carbon monoxide (CO) produced by CMVEC or delivered by a CO-releasing molecule, CORM-A1, has antioxidant properties. We tested the hypothesis that CORM-A1 prevents cerebrovascular endothelial barrier dysfunction caused by glutamate excitotoxicity. First, we identified the glutamate receptors (GluRs) and enzymatic sources of ROS involved in the mechanism of endothelial apoptosis. In glutamate-exposed CMVEC, ROS formation and apoptosis were blocked by rotenone, 2-thenoyltrifluoroacetone (TTFA), and antimycin, indicating that mitochondrial complexes I, II, and III are the major sources of oxidative stress. Agonists of ionotropic GluRs (iGluRs) N-methyl-D-aspartate (NMDA), cis-ACPD, AMPA, and kainate increased ROS production and apoptosis, whereas iGluR antagonists exhibited antiapoptotic properties, suggesting that iGluRs mediate glutamate-induced endothelial apoptosis. The functional consequences of endothelial injury were tested in the model of blood-brain barrier (BBB) composed of CMVEC monolayer on semipermeable membranes. Glutamate and iGluR agonists reduced transendothelial electrical resistance and increased endothelial paracellular permeability to 3-kDa dextran. CORM-A1 exhibited potent antioxidant and antiapoptotic properties in CMVEC and completely prevented BBB dysfunction caused by glutamate and iGluR agonists. Overall, the endothelial component of the BBB is a cellular target for excitotoxic glutamate that, via a mechanism involving a iGluR-mediated activation of mitochondrial ROS production and apoptosis, leads to BBB opening that may be prevented by the antioxidant and antiapoptotic actions of CORMs. Antioxidant CORMs therapy may help preserve BBB functional integrity in neonatal cerebrovascular disease.

Oral administration of citrus pulp reduces gastrointestinal recovery of orally dosed Escherichia coli F18 in weaned pigs

USDA-ARS?s Scientific Manuscript database

The effects of citrus pulp (CTP) on the immune and cortisol responses to E. coli F18 inoculation and subsequent E. coli recovery were evaluated in newly weaned pigs (23.3 + 1.8 d of age). Barrows were assigned to 1 of 2 treatment groups; with (CTP; n = 15) and without (Control; n = 15) the in-feed i...

Long-term thermophilic mono-digestion of rendering wastes and co-digestion with potato pulp.

PubMed

Bayr, S; Ojanperä, M; Kaparaju, P; Rintala, J

2014-10-01

In this study, mono-digestion of rendering wastes and co-digestion of rendering wastes with potato pulp were studied for the first time in continuous stirred tank reactor (CSTR) experiments at 55°C. Rendering wastes have high protein and lipid contents and are considered good substrates for methane production. However, accumulation of digestion intermediate products viz., volatile fatty acids (VFAs), long chain fatty acids (LCFAs) and ammonia nitrogen (NH4-N and/or free NH3) can cause process imbalance during the digestion. Mono-digestion of rendering wastes at an organic loading rate (OLR) of 1.5 kg volatile solids (VS)/m(3)d and hydraulic retention time (HRT) of 50 d was unstable and resulted in methane yields of 450 dm(3)/kg VS(fed). On the other hand, co-digestion of rendering wastes with potato pulp (60% wet weight, WW) at the same OLR and HRT improved the process stability and increased methane yields (500-680 dm(3)/kg VS(fed)). Thus, it can be concluded that co-digestion of rendering wastes with potato pulp could improve the process stability and methane yields from these difficult to treat industrial waste materials. Copyright © 2014 Elsevier Ltd. All rights reserved.

Effect of D-cycloserine in conjunction with fear extinction training on extracellular signal-regulated kinase activation in the medial prefrontal cortex and amygdala in rat.

PubMed

Gupta, Subhash C; Hillman, Brandon G; Prakash, Anand; Ugale, Rajesh R; Stairs, Dustin J; Dravid, Shashank M

2013-06-01

D-cycloserine (DCS) is currently under clinical trials for a number of neuropsychiatric conditions and has been found to augment fear extinction in rodents and exposure therapy in humans. However, the molecular mechanism of DCS action in these multiple modalities remains unclear. Here, we describe the effect of DCS administration, alone or in conjunction with extinction training, on neuronal activity (c-fos) and neuronal plasticity [phospho-extracellular signal-regulated kinase (pERK)] markers using immunohistochemistry. We found that intraperitoneal administration of DCS in untrained young rats (24-28 days old) increased c-fos- and pERK-stained neurons in both the prelimbic and infralimbic division of the medial prefrontal cortex (mPFC) and reduced pERK levels in the lateral nucleus of the central amygdala. Moreover, DCS administration significantly increased GluA1, GluN1, GluN2A, and GluN2B expression in the mPFC. In a separate set of animals, we found that DCS facilitated fear extinction and increased pERK levels in the infralimbic prefrontal cortex, prelimbic prefrontal cortex intercalated cells and lateral nucleus of the central amygdala, compared with saline control. In the synaptoneurosomal preparation, we found that extinction training increased iGluR protein expression in the mPFC, compared with context animals. No significant difference in protein expression was observed between extinction-saline and extinction-DCS groups in the mPFC. In contrast, in the amygdala DCS, the conjunction with extinction training led to an increase in iGluR subunit expression, compared with the extinction-saline group. Our data suggest that the efficacy of DCS in neuropsychiatric disorders may be partly due to its ability to affect neuronal activity and signaling in the mPFC and amygdala subnuclei. © 2013 Federation of European Neuroscience Societies and Blackwell Publishing Ltd.

Strength and stiffness of small glued-laminated beams with different qualities of tension laminations

Treesearch

Catherine M. Marx; Russell C. Moody

1981-01-01

A total of 180 small Douglas Fir–Larch (DF-L) or Southern Pine (SP) glued-laminated beams were evaluated to determine the tension lamination quality necessary to obtain desired design stresses. The test beams had either the regular laminating grades of L1 DF-L/No. 1D SP or the special 302-24 laminating grade as tension laminations. Because an initial set of SP beams...

Presentation of Ligands on Hydroxylapatite

NASA Technical Reports Server (NTRS)

Chu, Barbara C. F.; Orgel, Leslie E.

1997-01-01

Conjugates of biotin with the decamer of glutamic acid (glu(sub 10)) and the trimer of D,L-2-amino-5-phosphonovaleric acid (I) have been synthesized, and it has been shown that they mediate the binding of avidin to hydroxylapatite. In a similar way a conjugate of methotrexate with glu(sub 10) mediates the binding of dihydrofolate reductase to the mineral. The presentation of ligands on the hydroxylapatite component of bone may find applications in clinical medicine.

A High Order Discontinuous Galerkin Method for 2D Incompressible Flows

NASA Technical Reports Server (NTRS)

Liu, Jia-Guo; Shu, Chi-Wang

1999-01-01

In this paper we introduce a high order discontinuous Galerkin method for two dimensional incompressible flow in vorticity streamfunction formulation. The momentum equation is treated explicitly, utilizing the efficiency of the discontinuous Galerkin method The streamfunction is obtained by a standard Poisson solver using continuous finite elements. There is a natural matching between these two finite element spaces, since the normal component of the velocity field is continuous across element boundaries. This allows for a correct upwinding gluing in the discontinuous Galerkin framework, while still maintaining total energy conservation with no numerical dissipation and total enstrophy stability The method is suitable for inviscid or high Reynolds number flows. Optimal error estimates are proven and verified by numerical experiments.

Intra-hippocampal D-cycloserine rescues decreased social memory, spatial learning reversal, and synaptophysin levels in aged rats.

PubMed

Portero-Tresserra, Marta; Martí-Nicolovius, Margarita; Tarrés-Gatius, Mireia; Candalija, Ana; Guillazo-Blanch, Gemma; Vale-Martínez, Anna

2018-05-01

Aging is characterized by a decrease in N-methyl-D-aspartate receptors (NMDARs) in the hippocampus, which might be one of the factors involved in the age-dependent cognitive decline. D-Cycloserine (DCS), a partial agonist of the NMDAR glycine recognition site, could improve memory deficits associated to neurodegenerative disorders and cognitive deficits observed in normal aging. The aim of the present study was to explore whether DCS would reverse age-dependent memory deficits and decreases in NMDA receptor subunits (GluN1, GluN2A, and GluN2B) and the presynaptic protein synaptophysin in Wistar rats. We investigated the effects of pre-training infusions of DCS (10 μg/hemisphere) in the ventral hippocampus on two hippocampal-dependent learning tasks, the social transmission of food preference (STFP), and the Morris water maze (MWM). The results revealed that infusions of DCS administered before the acquisition sessions rescued deficits in the STFP retention and MWM reversal learning in old rats. DCS also significantly increased the hippocampal levels of synaptophysin in old rats, which correlated with STFP and MWM performance in all tests. Moreover, although the levels of the GluN1 subunit correlated with the MWM acquisition and reversal, DCS did not enhance the expression of such synaptic protein. The present behavioral results support the role of DCS as a cognitive enhancer and suggest that enhancing the function of NMDARs and synaptic plasticity in the hippocampus may be related to improvement in social memory and spatial learning reversal in aged animals.

Structure characteristics of an acidic polysaccharide purified from banana (Musa nana Lour.) pulp and its enzymatic degradation.

PubMed

Liu, Huiling; Jiang, Yueming; Yang, Hongshun; Yang, Bao

2017-08-01

Banana is one of the most important fruits over the world. The chemical composition is critical for the organoleptic properties and health benefits. As one of the leading bioactive components in banana pulp, the polysaccharides may contribute to the beneficial health effects. However, their precise structure information remains unknown. A leading acidic polysaccharide (ABPP) of banana pulp was purified and identified by nuclear magnetic resonnance spectroscopy (NMR) and gas chromatography-mass spectrometry (GC-MS). →4-α-d-GalpA-1→ and →4-α-d-GalpAMe-1→ constituted the backbone. No branch chains were detected. The molecular weight was determined to be 8.9kDa by gel permeation chromatography, which was smaller than previously reported fruit-derived polygalacturonic acids. The precise structure was identified as below. Digestion by enzyme would lead to production of oligogalacturonic acids and quick accumulation of 5000-7000Da fraction. Copyright © 2017 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

Billerud signed a contract recently with the Societe d'Etudes de la Celulose du Congo (SECC) to conduct a feasibility study for a projected eucalyptus-based pulp plant for the production of bleached marketing pulp in The People's Republic of The Congo. SECC is a consortium of financial institutions, the Congolese government and Billerud. The Congolese government has been planning for the construction of a eucalyptus-based pulp plant for a long time, and in 1978, full-scale eucalyptus plantations were started. These plantations are based on fast growing hybrid species of eucalyptus developed by the Centre Technique Forestier Tropical in the Congo andmore » are ready for harvesting after only about seven years growing time.« less

Combined computational and biochemical study reveals the importance of electrostatic interactions between the "pH sensor" and the cation binding site of the sodium/proton antiporter NhaA of Escherichia coli.

PubMed

Olkhova, Elena; Kozachkov, Lena; Padan, Etana; Michel, Hartmut

2009-08-15

Sodium proton antiporters are essential enzymes that catalyze the exchange of sodium ions for protons across biological membranes. The crystal structure of NhaA has provided a basis to explore the mechanism of ion exchange and its unique regulation by pH. Here, the mechanism of the pH activation of the antiporter is investigated through functional and computational studies of several variants with mutations in the ion-binding site (D163, D164). The most significant difference found computationally between the wild type antiporter and the active site variants, D163E and D164N, are low pK(a) values of Glu78 making them insensitive to pH. Although in the variant D163N the pK(a) of Glu78 is comparable to the physiological one, this variant cannot demonstrate the long-range electrostatic effect of Glu78 on the pH-dependent structural reorganization of trans-membrane helix X and, hence, is proposed to be inactive. In marked contrast, variant D164E remains sensitive to pH and can be activated by alkaline pH shift. Remarkably, as expected computationally and discovered here biochemically, D164E is viable and active in Na(+)/H(+) exchange albeit with increased apparent K(M). Our results unravel the unique electrostatic network of NhaA that connect the coupled clusters of the "pH sensor" with the binding site, which is crucial for pH activation of NhaA. 2009 Wiley-Liss, Inc.

ADX-47273, a mGlu5 receptor positive allosteric modulator, attenuates deficits in cognitive flexibility induced by withdrawal from 'binge-like' ethanol exposure in rats.

PubMed

Marszalek-Grabska, Marta; Gibula-Bruzda, Ewa; Bodzon-Kulakowska, Anna; Suder, Piotr; Gawel, Kinga; Talarek, Sylwia; Listos, Joanna; Kedzierska, Ewa; Danysz, Wojciech; Kotlinska, Jolanta H

2018-02-15

Repeated exposure to and withdrawal from ethanol induces deficits in spatial reversal learning. Data indicate that metabotropic glutamate 5 (mGlu5) receptors are implicated in synaptic plasticity and learning and memory. These receptors functionally interact with N-methyl-d-aspartate (NMDA) receptors, and activation of one type results in the activation of the other. We examined whether (S)-(4-fluorophenyl)(3-(3-(4-fluorophenyl)-1,2,4-oxadiazol-5-yl)-piperidin-1-yl (ADX-47273), a positive allosteric modulator (PAM) of mGlu5 receptor, attenuates deficits in reversal learning induced by withdrawal (11-13days) from 'binge-like' ethanol input (5.0g/kg, i.g. for 5days) in the Barnes maze (a spatial learning) task in rats. We additionally examined the effects of ADX-47273 on the expression of the NMDA receptors subunit, GluN2B, in the hippocampus and prefrontal cortex, on the 13th day of ethanol withdrawal. Herein, withdrawal from repeated ethanol administration impaired reversal learning, but not the probe trial. Moreover, ADX-47273 (30mg/kg, i.p.) given prior to the first reversal learning trial for 3days in the Barnes maze, significantly enhanced performance in the ethanol-treated group. The 13th day of ethanol abstinence decreased the expression of the GluN2B subunit in the selected brain regions, but ADX-47273 administration increased it. In conclusion, positive allosteric modulation of mGlu5 receptors recovered spatial reversal learning impairment induced by withdrawal from 'binge-like' ethanol exposure. Such effect seems to be correlated with the mGlu5 receptors mediated potentiation of GluN2B-NMDA receptor mediated responses in the hippocampus and prefrontal cortex. Thus, our results emphasize the role of mGlu5 receptor PAM in the adaptive learning impaired by ethanol exposure. Copyright © 2017 Elsevier B.V. All rights reserved.

Porous microscaffolds for 3D culture of dental pulp mesenchymal stem cells.

PubMed

Bhuptani, Ronak S; Patravale, Vandana B

2016-12-30

The collective power of stem cells due to their evident advantages is incessantly investigated in regenerative medicine to be the next generation exceptional remedy for tissue regeneration and treatment of diseases. Stem cells are highly sensitive and a 3D culture environment is a requisite for its successful transplantation and integration with tissues. Porous microscaffolds can create a 3D microenvironment for growing stems cells, controlling their fate both in vitro and in vivo. In the present study, interconnected porous PLGA microscaffolds were fabricated, characterized and employed to propagate human dental pulp mesenchymal stem cells (DPMSCs) in vitro. The porous topography was investigated by scanning electron microscopy and the pore size was controlled by fabrication conditions such as the concentration of porogen. DPMSCs were cultured on microscaffolds and were evaluated for their morphology, attachment, proliferation, cell viability via MTT and molecular expression (RT-PCR). DPMSCs were adequately proliferated and adhered over the microscaffolds forming a 3D cell-microscaffold construct. The average number of DPMSCs grown on PLGA microscaffolds was significantly higher than monolayer 2D culture during 5th and 7th day. Moreover, cell viability and gene expression results together corroborated that microscaffolds maintained the viability, stemness and plasticity of the cultured dental pulp mesenchymal stem cells. The novel porous microscaffold developed acts as promising scaffold for 3D culture and survival and transplantation of stem cells for tissue engineering. Copyright © 2016 Elsevier B.V. All rights reserved.

The effect of different treatments for early-lactation hyperketonemia on blood β-hydroxybutyrate, plasma nonesterified fatty acids, glucose, insulin, and glucagon in dairy cattle.

PubMed

Mann, S; Yepes, F A Leal; Behling-Kelly, E; McArt, J A A

2017-08-01

Despite increased efforts in preventing the occurrence of metabolic disorders in transition cows, hyperketonemia remains a frequent early-lactation metabolic disease affecting an average of 40% of cows in herds in the United States. Despite the demonstrated economic effect of this disorder, controlled clinical trials comparing different treatment strategies in affected cows are lacking. The objective of our study was to investigate the effect of treatment with intravenous glucose, oral propylene glycol, or a combination of both on the reduction in blood β-hydroxybutyrate (BHB) concentrations of early-lactation hyperketonemic dairy cows. Multiparous Holstein cows between 3 to 9 d in milk were screened for hyperketonemia using a handheld meter 3 times per week, and enrolled at whole blood BHB concentration ≥1.2 mmol/L to 1 of 4 treatment groups: (1) 500 mL of a 50% dextrose solution i.v. once daily for 3 d (GLU, n = 9), (2) 300 mL of propylene glycol as a drench once daily for 3 d (PG, n = 9), (3) a combination treatment of a 500 mL of 50% dextrose solution i.v. and 300 mL of propylene glycol orally once daily for 3 d (GLU+PG, n = 8), or (4) an untreated control group (CTRL, n = 8). Blood samples were collected immediately before as well as at 1, 2, 4, 8, 12, 24, 36, 48, 60, and 72 h after administration of the first treatment through a jugular catheter and 3 times per week thereafter from coccygeal vessels. Concentrations of BHB were measured in whole blood, and plasma samples were analyzed for glucose, fatty acid (NEFA), insulin, glucagon, and electrolyte concentrations. The EDTA-anticoagulated blood samples were assessed for red blood cell indices, and smears were made for evaluation of red blood cell morphology. Outcomes were analyzed using repeated measures analysis. Overall least squares means (95% CI) of whole blood BHB concentrations between 1 h and d 11 relative to first treatment were 1.11 (0.95 to 1.30), 1.26 (1.07 to 1.47), 0.96 (0.81 to 1.13), and 1.53 (1.30 to 1.80) mmol/L for the GLU, PG, GLU+PG, and CTRL groups, respectively. Treatment with both glucose and propylene glycol led to a greater magnitude and more prolonged decrease in BHB concentrations compared with individual treatments. The NEFA and glucagon concentrations were lower immediately after treatment in GLU and GLU+PG groups compared with CTRL, and treatment with both glucose and propylene glycol was associated with a greater increase in glucose and insulin concentrations immediately after treatment compared with CTRL and GLU treatment alone. Treatments did not lead to differences in plasma mineral concentrations. We conclude that treatments varied in the magnitude of decreasing blood BHB concentrations in hyperketonemic postpartum cows, with the greatest decline after treatment with a combination of intravenous glucose and oral propylene glycol. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Trichoderma Reesei single cell protein production from rice straw pulp in solid state fermentation

NASA Astrophysics Data System (ADS)

Zaki, M.; Said, S. D.

2018-04-01

The dependency on fish meal as a major protein source for animal feed can lead toit priceinstability in line with the increasing in meat production and consumption in Indonesia. In order todeal with this problem, an effort to produce an alternative protein sources production is needed. This scenario is possible due to the abundantavailability of agricultural residues such as rice straw whichcould be utilized as substrate for production of single cell proteins as an alternative proteinsource. This work investigated the potential utilization of rice straw pulp and urea mixture as substrate for the production of local Trichoderma reesei single cell protein in solid state fermentation system. Some parameters have been analyzed to evaluate the effect of ratio of rice straw pulp to urea on mixed single cell protein biomass (mixed SCP biomass) composition, such as total crude protein (analyzed by kjedhal method) and lignin content (TAPPI method).The results showed that crude protein content in mixed SCP biomassincreases with the increasing in fermentation time, otherwise it decreases with the increasing insubstrate carbon to nitrogen (C/N) ratio. Residual lignin content in mixed SCP biomass decreases from 7% to 0.63% during fermentationproceeded of 21 days. The highest crude protein content in mixed SCP biomasswas obtained at substrate C/N ratio 20:1 of 25%.

Effects of lead exposure on hippocampal metabotropic glutamate receptor subtype 3 and 7 in developmental rats.

PubMed

Xu, Jian; Yan, Huai C; Yang, Bo; Tong, Lu S; Zou, Yu X; Tian, Ying

2009-04-20

A complete explanation of the mechanisms by which Pb2+ exerts toxic effects on developmental central nervous system remains unknown. Glutamate is critical to the developing brain through various subtypes of ionotropic or metabotropic glutamate receptors (mGluRs). Ionotropic N-methyl-D-aspartate receptors have been considered as a principal target in lead-induced neurotoxicity. The relationship between mGluR3/mGluR7 and synaptic plasticity had been verified by many recent studies. The present study aimed to examine the role of mGluR3/mGluR7 in lead-induced neurotoxicity. Twenty-four adult and female rats were randomly selected and placed on control or 0.2% lead acetate during gestation and lactation. Blood lead and hippocampal lead levels of pups were analyzed at weaning to evaluate the actual lead content at the end of the exposure. Impairments of short -term memory and long-term memory of pups were assessed by tests using Morris water maze and by detection of hippocampal ultrastructural alterations on electron microscopy. The impact of lead exposure on mGluR3 and mGluR7 mRNA expression in hippocampal tissue of pups were investigated by quantitative real-time polymerase chain reaction and its potential role in lead neurotoxicity were discussed. Lead levels of blood and hippocampi in the lead-exposed rats were significantly higher than those in the controls (P < 0.001). In tests using Morris Water Maze, the overall decrease in goal latency and swimming distance was taken to indicate that controls had shorter latencies and distance than lead-exposed rats (P = 0.001 and P < 0.001 by repeated-measures analysis of variance). On transmission electron microscopy neuronal ultrastructural alterations were observed and the results of real-time polymerase chain reaction showed that exposure to 0.2% lead acetate did not substantially change gene expression of mGluR3 and mGluR7 mRNA compared with controls. Exposure to lead before and after birth can damage short-term and long-term memory ability of young rats and hippocampal ultrastructure. However, the current study does not provide evidence that the expression of rat hippocampal mGluR3 and mGluR7 can be altered by systemic administration of lead during gestation and lactation, which are informative for the field of lead-induced developmental neurotoxicity noting that it seems not to be worthwhile to include mGluR3 and mGluR7 in future studies.

Efficiency in wood and fiber utilization in OECD countries

Treesearch

Hiroko Kando; Joseph Buongiorno

2009-01-01

Utilization efficiency has been defined as the ratio of the amount of industrial roundwood (or wood pulp) consumed in a country and year to the amount that would have been consumed to produce the same output with a reference technology.  The reference technology was described by the average input-output relationships in countries of the Organization for Economic...

Dietary supplementation with arginine and glutamic acid modifies growth performance, carcass traits, and meat quality in growing-finishing pigs.

PubMed

Hu, C J; Jiang, Q Y; Zhang, T; Yin, Y L; Li, F N; Deng, J P; Wu, G Y; Kong, X F

2017-06-01

Sixty Duroc × Large White × Landrace pigs with an average initial BW of 77.1 ± 1.3 kg were used to investigate the effects of dietary supplementation with arginine and glutamic acid on growth performance, carcass traits, and meat quality in growing-finishing pigs. The animals were randomly assigned to 1 of 5 treatment groups (12 pigs/group, male:female ratio 1:1). The pigs in the control group were fed a basal diet (basal diet group), and those in the experimental groups were fed the basal diet supplemented with 2.05% -alanine (isonitrogenous group), 1.0% -arginine (Arg group), 1% glutamic acid + 1.44% -alanine (Glu group), or 1.0% -arginine + 1.0% glutamic acid (Arg+Glu group). After a 60-d period of supplementation, growth performance, carcass traits, and meat quality were evaluated. The results showed no significant differences ( > 0.05) in growth performance and carcass traits of the pigs in the Arg group relative to the basal diet group; however, the longissimus dorsi (LD) muscle and back fat showed a decrease ( < 0.05) in the percentage of SFA. In the Glu group, the final BW, phase 1 (d 1 to 30) and phase 2 (d 31 to 60) ADFI, and average back fat thickness of the pigs decreased ( < 0.05) by 7.14%, 23.43%, 8.03%, and 33.88%, respectively, when compared with the basal diet group. Dietary Arg+Glu supplementation had no effect ( > 0.05) on the final BW, phase 2 ADFI, and average daily weight gain in pigs but decreased ( < 0.05) their phase 1 ADFI, average back fat thickness, and percentage of SFA in the LD muscle and back fat, and increased ( < 0.05) the i.m. fat (IMF) content of the LD and biceps femoris muscles when compared with the basal diet group. Furthermore, a 16% decrease in yellowness (b* value; < 0.05) was observed in the Arg+Glu group pigs when compared with the isonitrogenous group. These findings suggest that dietary supplementation with both Arg and Glu beneficially increases the IMF deposition and improves the meat color and fatty acid composition without affecting growth performance and s.c. fat in pigs, providing a novel strategy to enhance meat quality in growing-finishing pigs.

Preclinical evaluation of the antipsychotic potential of the mGlu2-positive allosteric modulator JNJ-40411813

PubMed Central

Lavreysen, Hilde; Langlois, Xavier; Donck, Luc Ver; Nuñez, José María Cid; Pype, Stefan; Lütjens, Robert; Megens, Anton

2015-01-01

JNJ-40411813/ADX71149 (1-butyl-3-chloro-4-(4-phenylpiperidin-1-yl) pyridin-2(1H)-one) is a positive allosteric modulator (PAM) of the mGlu2 receptor, which also displays 5-Hydroxytryptamine (5HT2A) antagonism after administration in rodents due to a rodent-specific metabolite. JNJ-40411813 was compared with the orthosteric mGlu2/3 agonist LY404039 (4-amino-2-thiabicyclo [3.1.0] hexane-4,6-dicarboxylic acid 2,2-dioxide), the selective mGlu2 PAM JNJ-42153605 (3-(cyclopropylmethyl)-7-(4-phenylpiperidin-1-yl)-8-(trifluoromethyl)[1,2,4]triazolo[4,3-a]pyridine) and the 5HT2A antagonist ritanserin in rodent models for antipsychotic activity and potential side effects, attempting to differentiate between the various compounds and mechanisms of action. In mice, JNJ-40411813, JNJ-42153605, and LY404039 inhibited spontaneous locomotion and phencyclidine- and scopolamine-induced but not d-amphetamine-induced hyperlocomotion; the 5HT2A antagonist ritanserin inhibited only spontaneous locomotion and phencyclidine-induced hyperlocomotion. As measured by 2-deoxyglucose uptake, all compounds reversed memantine-induced brain activation in mice. The two mGlu2 PAMs and LY404039, but not ritanserin, inhibited conditioned avoidance behavior in rats. Like ritanserin, the mGlu2 ligands antagonized 2,5-dimethoxy-4-methylamphetamine-induced head twitches in rats. LY404039 but not the mGlu2 PAMs impaired rotarod performance in rats and increased the acoustic startle response in mice. Our results show that although 5HT2A antagonism has effect in some models, mGlu2 receptor activation is sufficient for activity in several animal models of antipsychotic activity. The mGlu2 PAMs mimicked the in vivo pharmacodynamic effects observed with LY404039 except for effects on the rotarod and acoustic startle, suggesting that they produce a primary activity profile similar to that of the mGlu2/3 receptor agonist while they can be differentiated based on their secondary activity profile. The results are discussed in light of clinical data available for some of these molecules, in particular JNJ-40411813. PMID:25692027

Cortical GluN2B deletion attenuates punished suppression of food reward-seeking.

PubMed

Radke, Anna K; Nakazawa, Kazu; Holmes, Andrew

2015-10-01

Compulsive behavior, which is a hallmark of psychiatric disorders such as addiction and obsessive-compulsive disorder, engages corticostriatal circuits. Previous studies indicate a role for corticostriatal N-methyl-D-aspartate receptors (NMDARs) in mediating compulsive-like responding for drugs of abuse, but the specific receptor subunits controlling reward-seeking in the face of punishment remain unclear. The current study assessed the involvement of corticostriatal GluN2B-containing NMDARs in measures of persistent and punished food reward-seeking. Mice with genetic deletion of GluN2B in one of three distinct neuronal populations, cortical principal neurons, forebrain interneurons, or striatal medium spiny neurons, were tested for (1) sustained food reward-seeking when reward was absent, (2) reward-seeking under a progressive ratio schedule of reinforcement, and (3) persistent reward-seeking after a footshock punishment. Mutant mice with genetic deletion of GluN2B in cortical principal neurons demonstrated attenuated suppression of reward-seeking during punishment. These mice performed normally on other behavioral measures, including an assay for pain sensitivity. Mutants with interneuronal or striatal GluN2B deletions were normal on all behavioral assays. Current findings offer novel evidence that loss of GluN2B-containing NMDARs expressed on principal neurons in the cortex results in reduced punished food reward-seeking. These data support the involvement of GluN2B subunit in cortical circuits regulating cognitive flexibility in a variety of settings, with implications for understanding the basis of inflexible behavior in neuropsychiatric disorders including obsessive-compulsive disorders (OCD) and addictions.

Ultrafast glutamate sensors resolve high-frequency release at Schaffer collateral synapses.

PubMed

Helassa, Nordine; Dürst, Céline D; Coates, Catherine; Kerruth, Silke; Arif, Urwa; Schulze, Christian; Wiegert, J Simon; Geeves, Michael; Oertner, Thomas G; Török, Katalin

2018-05-22

Glutamatergic synapses display a rich repertoire of plasticity mechanisms on many different time scales, involving dynamic changes in the efficacy of transmitter release as well as changes in the number and function of postsynaptic glutamate receptors. The genetically encoded glutamate sensor iGluSnFR enables visualization of glutamate release from presynaptic terminals at frequencies up to ∼10 Hz. However, to resolve glutamate dynamics during high-frequency bursts, faster indicators are required. Here, we report the development of fast (iGlu f ) and ultrafast (iGlu u ) variants with comparable brightness but increased K d for glutamate (137 μM and 600 μM, respectively). Compared with iGluSnFR, iGlu u has a sixfold faster dissociation rate in vitro and fivefold faster kinetics in synapses. Fitting a three-state model to kinetic data, we identify the large conformational change after glutamate binding as the rate-limiting step. In rat hippocampal slice culture stimulated at 100 Hz, we find that iGlu u is sufficiently fast to resolve individual glutamate release events, revealing that glutamate is rapidly cleared from the synaptic cleft. Depression of iGlu u responses during 100-Hz trains correlates with depression of postsynaptic EPSPs, indicating that depression during high-frequency stimulation is purely presynaptic in origin. At individual boutons, the recovery from depression could be predicted from the amount of glutamate released on the second pulse (paired pulse facilitation/depression), demonstrating differential frequency-dependent filtering of spike trains at Schaffer collateral boutons. Copyright © 2018 the Author(s). Published by PNAS.

Microinjection of l-glutamate into the nucleus ambiguus partially inhibits gastric motility through the NMDA receptor - nitric oxide pathway.

PubMed

Sun, Hong-Zhao; Zhao, Shu-Zhen; Ai, Hong-Bin

2014-06-01

We have previously reported that both l-glutamate (l-Glu) and nitric oxide (NO) modulate gastric motility in the nucleus ambiguus (NA). The aim of this study is to explore the potential correlation between the l-Glu and NO. A latex balloon connected to a pressure transducer was inserted into the pylorus through the fundus of anesthetized male Wistar rats to continuously record changes in gastric smooth muscle contractile curves. Pretreatment with the NO-synthase inhibitor N-nitro-l-arginine methylester (l-NAME) did not completely abolish the inhibitory effect of l-Glu on gastric motility, but intravenous injection of the ganglionic blocker hexamethonium bromide (Hb) did. By using a specific N-methyl-d-aspartic acid (NMDA) receptor antagonist, we blocked the inhibitory effect of the NO-donor sodium nitroprusside (SNP) on gastric motility. These results suggest that microinjections of l-Glu into the NA inhibits gastric motility by activating the cholinergic preganglionic neurons, partially through the NMDA receptor - NO pathway.

Genome-wide identification, characterization and classification of ionotropic glutamate receptor genes (iGluRs) in the malaria vector Anopheles sinensis (Diptera: Culicidae).

PubMed

Wang, Ting-Ting; Si, Feng-Ling; He, Zheng-Bo; Chen, Bin

2018-01-15

Ionotropic glutamate receptors (iGluRs) are conserved ligand-gated ion channel receptors, and ionotropic receptors (IRs) were revealed as a new family of iGluRs. Their subdivision was unsettled, and their characteristics are little known. Anopheles sinensis is a major malaria vector in eastern Asia, and its genome was recently well sequenced and annotated. We identified iGluR genes in the An. sinensis genome, analyzed their characteristics including gene structure, genome distribution, domains and specific sites by bioinformatic methods, and deduced phylogenetic relationships of all iGluRs in An. sinensis, Anopheles gambiae and Drosophila melanogaster. Based on the characteristics and phylogenetics, we generated the classification of iGluRs, and comparatively analyzed the intron number and selective pressure of three iGluRs subdivisions, iGluR group, Antenna IR and Divergent IR subfamily. A total of 56 iGluR genes were identified and named in the whole-genome of An. sinensis. These genes were located on 18 scaffolds, and 31 of them (29 being IRs) are distributed into 10 clusters that are suggested to form mainly from recent gene duplication. These iGluRs can be divided into four groups: NMDA, non-NMDA, Antenna IR and Divergent IR based on feature comparison and phylogenetic analysis. IR8a and IR25a were suggested to be monophyletic, named as Putative in the study, and moved from the Antenna subfamily in the IR family to the non-NMDA group as a sister of traditional non-NMDA. The generated iGluRs of genes (including NMDA and regenerated non-NMDA) are relatively conserved, and have a more complicated gene structure, smaller ω values and some specific functional sites. The iGluR genes in An. sinensis, An. gambiae and D. melanogaster have amino-terminal domain (ATD), ligand binding domain (LBD) and Lig_Chan domains, except for IR8a that only has the LBD and Lig_Chan domains. However, the new concept IR family of genes (including regenerated Antenna IR, and Divergent IR), especially for Divergent IR are more variable, have a simpler gene structure (intron loss phenomenon) and larger ω values, and lack specific functional sites. These IR genes have no other domains except for Antenna IRs that only have the Lig_Chan domain. This study provides a comprehensive information framework for iGluR genes in An. sinensis, and generated the classification of iGluRs by feature and bioinformatics analyses. The work lays the foundation for further functional study of these genes.

Loss of object recognition memory produced by extended access to methamphetamine self-administration is reversed by positive allosteric modulation of metabotropic glutamate receptor 5.

PubMed

Reichel, Carmela M; Schwendt, Marek; McGinty, Jacqueline F; Olive, M Foster; See, Ronald E

2011-03-01

Chronic methamphetamine (meth) abuse can lead to persisting cognitive deficits. Here, we utilized a long-access meth self-administration (SA) protocol to assess recognition memory and metabotropic glutamate receptor (mGluR) expression, and the possible reversal of cognitive impairments with the mGluR5 allosteric modulator, 3-cyano-N-(1,3-diphenyl-1H-pyrazol-5-yl) benzamide (CDPPB). Male, Long-Evans rats self-administered i.v. meth (0.02 mg/infusion) on an FR1 schedule of reinforcement or received yoked-saline infusions. After seven daily 1-h sessions, rats were switched to 6-h daily sessions for 14 days, and then underwent drug abstinence. Rats were tested for object recognition memory at 1 week after meth SA at 90 min and 24 h retention intervals. In a separate experiment, rats underwent the same protocol, but received either vehicle or CDPPB (30 mg/kg) after familiarization. Rats were killed on day 8 or 14 post-SA and brain tissue was obtained. Meth intake escalated over the extended access period. Additionally, meth-experienced rats showed deficits in both short- and long-term recognition memory, demonstrated by a lack of novel object exploration. The deficit at 90 min was reversed by CDPPB treatment. On day 8, meth intake during SA negatively correlated with mGluR expression in the perirhinal and prefrontal cortex, and mGluR5 receptor expression was decreased 14 days after discontinuation of meth. This effect was specific to mGluR5 levels in the perirhinal cortex, as no differences were identified in the hippocampus or in mGluR2/3 receptors. These results from a clinically-relevant animal model of addiction suggest that mGluR5 receptor modulation may be a potential treatment of cognitive dysfunction in meth addiction.

Mechanistic model to predict colostrum intake based on deuterium oxide dilution technique data and impact of gestation and prefarrowing diets on piglet intake and sow yield of colostrum.

PubMed

Theil, P K; Flummer, C; Hurley, W L; Kristensen, N B; Labouriau, R L; Sørensen, M T

2014-12-01

The aims of the present study were to quantify colostrum intake (CI) of piglets using the D2O dilution technique, to develop a mechanistic model to predict CI, to compare these data with CI predicted by a previous empirical predictive model developed for bottle-fed piglets, and to study how composition of diets fed to gestating sows affected piglet CI, sow colostrum yield (CY), and colostrum composition. In total, 240 piglets from 40 litters were enriched with D2O. The CI measured by D2O from birth until 24 h after the birth of first-born piglet was on average 443 g (SD 151). Based on measured CI, a mechanistic model to predict CI was developed using piglet characteristics (24-h weight gain [WG; g], BW at birth [BWB; kg], and duration of CI [D; min]: CI, g=-106+2.26 WG+200 BWB+0.111 D-1,414 WG/D+0.0182 WG/BWB (R2=0.944). This model was used to predict the CI for all colostrum suckling piglets within the 40 litters (n=500, mean=437 g, SD=153 g) and was compared with the CI predicted by a previous empirical predictive model (mean=305 g, SD=140 g). The previous empirical model underestimated the CI by 30% compared with that obtained by the new mechanistic model. The sows were fed 1 of 4 gestation diets (n=10 per diet) based on different fiber sources (low fiber [17%] or potato pulp, pectin residue, or sugarbeet pulp [32 to 40%]) from mating until d 108 of gestation. From d 108 of gestation until parturition, sows were fed 1 of 5 prefarrowing diets (n=8 per diet) varying in supplemented fat (3% animal fat, 8% coconut oil, 8% sunflower oil, 8% fish oil, or 4% fish oil+4% octanoic acid). Sows fed diets with pectin residue or sugarbeet pulp during gestation produced colostrum with lower protein, fat, DM, and energy concentrations and higher lactose concentrations, and their piglets had greater CI as compared with sows fed potato pulp or the low-fiber diet (P<0.05), and sows fed pectin residue had a greater CY than potato pulp-fed sows (P<0.05). Prefarrowing diets affected neither CI nor CY, but the prefarrowing diet with coconut oil decreased lactose and increased DM concentrations of colostrum compared with other prefarrowing diets (P<0.05). In conclusion, the new mechanistic predictive model for CI suggests that the previous empirical predictive model underestimates CI of sow-reared piglets by 30%. It was also concluded that nutrition of sows during gestation affected CY and colostrum composition.

Atom-based 3D-QSAR, induced fit docking, and molecular dynamics simulations study of thieno[2,3-b]pyridines negative allosteric modulators of mGluR5.

PubMed

Vijaya Prabhu, Sitrarasu; Singh, Sanjeev Kumar

2018-05-28

Atom-based three dimensional-quantitative structure-activity relationship (3D-QSAR) model was developed on the basis of 5-point pharmacophore hypothesis (AARRR) with two hydrogen bond acceptors (A) and three aromatic rings for the derivatives of thieno[2,3-b]pyridine, which modulates the activity to inhibit the mGluR5 receptor. Generation of a highly predictive 3D-QSAR model was performed using the alignment of predicted pharmacophore hypothesis for the training set (R 2  = 0.84, SD = 0.26, F = 45.8, N = 29) and test set (Q 2  = 0.74, RMSE = 0.235, Pearson-R = 0.94, N = 9). The best pharmacophore hypothesis AARRR was selected, and developed three dimensional-quantitative structure activity relationship (3D-QSAR) model also supported the outcome of this study by means of favorable and unfavorable electron withdrawing group and hydrophobic regions of most active compound 42d and least active compound 18b. Following, induced fit docking and binding free energy calculations reveals the reliable binding orientation of the compounds. Finally, molecular dynamics simulations for 100 ns were performed to depict the protein-ligand stability. We anticipate that the resulted outcome could be supportive to discover potent negative allosteric modulators for metabotropic glutamate receptor 5 (mGluR5).

Implication of Genes for the N-Methyl-D-Aspartate (NMDA) Receptor in Substance Addictions.

PubMed

Chen, Jiali; Ma, Yunlong; Fan, Rongli; Yang, Zhongli; Li, Ming D

2018-02-10

Drug dependence is a chronic brain disease with harmful consequences for both individual users and society. Glutamate is a primary excitatory neurotransmitter in the brain, and both in vivo and in vitro experiments have implicated N-methyl-D-aspartate (NMDA) receptor, a glutamate receptor, as an element in various types of addiction. Recent findings from genetics-based approaches such as genome-wide linkage, candidate gene association, genome-wide association (GWA), and next-generation sequencing have demonstrated the significant association of NMDA receptor subunit genes such as GluN3A, GluN2B, and GluN2A with various addiction-related phenotypes. Of these genes, GluN3A has been the most studied, and it has been revealed to play crucial roles in the etiology of addictions. In this communication, we provide an updated view of the genetic effects of NMDA receptor subunit genes and their functions in the etiology of addictions based on the findings from investigation of both common and rare variants as well as SNP-SNP interactions. To better understand the molecular mechanisms underlying addiction-related behaviors and to promote the development of specific medicines for the prevention and treatment of addictions, current efforts aim not only to identify more causal variants in NMDA receptor subunits by using large independent samples but also to reveal the molecular functions of these variants in addictions.

The role of metabotropic glutamate receptor mGlu5 in control of micturition and bladder nociception.

PubMed

Hu, Youmin; Dong, Li; Sun, Biying; Guillon, Marlene A; Burbach, Leah R; Nunn, Philip A; Liu, Xingrong; Vilenski, Olga; Ford, Anthony P D W; Zhong, Yu; Rong, Weifang

2009-01-23

In micturition control, the roles of ionotropic glutamate (iGlu) receptors NMDA and AMPA are well established, whereas little is known about the function of metabotropic glutamate (mGlu) receptors. Since antagonists for mGlu5 receptors are efficacious in animal models of inflammatory and neuropathic pain, we examined whether mGlu5 receptors play a role in the voiding reflex and bladder nociception and, if so, via centrally or peripherally localized receptors. The mGlu5 receptor antagonist MPEP dose-dependently increased the micturition threshold (MT) volume in the volume-induced micturition reflex (VIMR) model in anesthetized rats. Following doses of 5.2, 15.5 and 51.7micromol/kg of MPEP (intraduodenal), the MT was increased by 24.7+/-5.0%, 97.2+/-12.5% (P<0.01) and 128.0+/-28.3% (P<0.01) from the baseline, respectively (n=4-5; compared with 0.8+/-9.1% in the vehicle group). Infusing MPEP (0.3, 1mM) directly into the bladder also raised MT. However, the efficacious plasma concentrations of MPEP following intravesical dosing were similar to that after intraduodenal dosing (EC(50) of 0.11 and 0.27microM, respectively, P>0.05). MPEP also dose-dependently attenuated the visceromotor responses (VMR, total number of abdominal EMG spikes during phasic bladder distension) in anesthetized rats. The VMR was decreased to 1332.4+/-353.9 from control of 2886.5+/-692.2 spikes/distension (n=6, P<0.01) following MPEP (10micromol/kg, iv). Utilizing the isolated mouse bladder/pelvic nerve preparation, we found that neither MPEP (up to 3microM) nor MTEP (up to 10microM) affected afferent discharge in response to bladder distension (n=4-6). In contrast, MPEP attenuated the responses of the mesenteric nerves to distension of the mouse jejunum in vitro. These data suggest that mGlu5 receptors play facilitatory roles in the processing of afferent input from the urinary bladder, and that central rather than peripheral mGlu5 receptors appear to be responsible.

High pressure studies on structural and secondary relaxation dynamics in silyl derivative of D-glucose

NASA Astrophysics Data System (ADS)

Minecka, Aldona; Kamińska, Ewa; Tarnacka, Magdalena; Dzienia, Andrzej; Madejczyk, Olga; Waliłko, Patrycja; Kasprzycka, Anna; Kamiński, Kamil; Paluch, Marian

2017-08-01

In this paper, broadband dielectric spectroscopy was applied to investigate molecular dynamics of 1,2,3,4,6-penta-O-(trimethylsilyl)-D-glucopyranose (S-GLU) at ambient and elevated pressures. Our studies showed that apart from the structural relaxation, one well resolved asymmetric secondary process (initially labeled as β) is observed in the spectra measured at p = 0.1 MPa. Analysis with the use of the coupling model and criterion proposed by Ngai and Capaccioli indicated that the β-process in S-GLU is probably a Johari-Goldstein relaxation of intermolecular origin. Further high pressure experiments demonstrated that there are in fact two secondary processes contributing to the β-relaxation. Therefore, one can postulate that the coupling model is a necessary, but not sufficient criterion to identify the true nature of the given secondary relaxation process. The role of pressure experiments in better understanding of the molecular origin of local mobility seems to be much more important. Interestingly, our research also revealed that the structural relaxation in S-GLU is very sensitive to compression. It was reflected in an extremely high pressure coefficient of the glass transition temperature (dTg/dp = 412 K/GPa). According to the literature data, such a high value of dTg/dp has not been obtained so far for any H-bonded, van der Waals, or polymeric glass-formers.

Prolonged ketamine exposure induces increased activity of the GluN2B-containing N-methyl-d-aspartate receptor in the anterior cingulate cortex of neonatal rats.

PubMed

Kokane, Saurabh S; Gong, Kerui; Jin, Jianhui; Lin, Qing

2017-09-01

Ketamine is a commonly used anesthetic among pediatric patients due to its high efficacy. However, it has been demonstrated by several preclinical studies that, widespread accelerated programmed death of neurons (neuroapoptosis) occurs due to prolonged or repeated exposure to ketamine specifically in the neonatal brain. Therefore, an emphasis on understanding the molecular mechanisms underlying this selective vulnerability of the neonatal brain to ketamine-induced neuroapoptosis becomes important in order to identify potential therapeutic targets, which would help prevent or at least ameliorate this neuroapoptosis. In this study, we demonstrated that repeated ketamine administration (6 injections of 20mg/kg dose given over 12h time period) in neonatal (postnatal day 7; PND 7) Sprague-Dawley rats induced a progressive increase in N-methyl-d-aspartate receptor (NMDAR)-mediated excitatory postsynaptic currents (EPSCs) in the neurons of the anterior cingulate cortex (ACC) for up to 6h after the last ketamine dose. Specifically, we observed that the increased EPSCs were largely mediated by GluN2B-containing NMDARs in the neurons of the ACC. Along with increased synaptic transmission, there was also a significant increase in the expression of the GluN2B-containing NMDARs as well. Taken together, these results showed that after repeated exposure to ketamine, the synaptic transmission mediated by GluN2B-containing NMDARs was significantly increased in the neonatal brain. This was significant as it showed for the first time that ketamine had subunit-specific effects on GluN2B-containing NMDARs, potentially implicating the involvement of these subunits in the increased vulnerability of immature neurons of the neonatal brain to ketamine-induced neuroapoptosis. Copyright © 2017 Elsevier Inc. All rights reserved.

GluN2B N-methyl-D-aspartate receptor and excitatory amino acid transporter 3 are upregulated in primary sensory neurons after 7 days of morphine administration in rats: implication for opiate-induced hyperalgesia.

PubMed

Gong, Kerui; Bhargava, Aditi; Jasmin, Luc

2016-01-01

The contribution of the peripheral nervous system to opiate-induced hyperalgesia (OIH) is not well understood. In this study, we determined the changes in excitability of primary sensory neurons after sustained morphine administration for 7 days. Changes in the expression of glutamate receptors and glutamate transporters after morphine administration were ascertained in dorsal root ganglions. Patch clamp recordings from intact dorsal root ganglions (ex vivo preparation) of morphine-treated rats showed increased excitability of small diameter (≤30 μm) neurons with respect to rheobase and membrane threshold, whereas the excitability of large diameter (>30 μm) neurons remained unchanged. Small diameter neurons also displayed increased responses to glutamate, which were mediated mainly by GluN2B containing N-methyl-D-aspartate (NMDA) receptors, and to a lesser degree by the neuronal excitatory amino acid transporter 3/excitatory amino acid carrier 1. Coadministration in vivo of the GluN2B selective antagonist Ro 25-6981 with morphine for 7 days prevented the appearance of OIH and increased morphine-induced analgesia. Administration of morphine for 7 days led to an increased expression of GluN2B and excitatory amino acid transporter 3/excitatory amino acid carrier 1, but not of the α-amino-3-hydroxy-5-methyl-4-isoxazole propionate, kainate, or group I metabotropic glutamate receptors, or of the vesicular glutamate transporter 2. These results suggest that peripheral glutamatergic neurotransmission contributes to OIH and that GluN2B subunit of NMDA receptors in the periphery may be a target for therapy.

Age estimation by pulp-to-tooth area ratio using cone-beam computed tomography: A preliminary analysis

PubMed Central

Rai, Arpita; Acharya, Ashith B.; Naikmasur, Venkatesh G.

2016-01-01

Background: Age estimation of living or deceased individuals is an important aspect of forensic sciences. Conventionally, pulp-to-tooth area ratio (PTR) measured from periapical radiographs have been utilized as a nondestructive method of age estimation. Cone-beam computed tomography (CBCT) is a new method to acquire three-dimensional images of the teeth in living individuals. Aims: The present study investigated age estimation based on PTR of the maxillary canines measured in three planes obtained from CBCT image data. Settings and Design: Sixty subjects aged 20–85 years were included in the study. Materials and Methods: For each tooth, mid-sagittal, mid-coronal, and three axial sections—cementoenamel junction (CEJ), one-fourth root level from CEJ, and mid-root—were assessed. PTR was calculated using AutoCAD software after outlining the pulp and tooth. Statistical Analysis Used: All statistical analyses were performed using an SPSS 17.0 software program. Results and Conclusions: Linear regression analysis showed that only PTR in axial plane at CEJ had significant age correlation (r = 0.32; P < 0.05). This is probably because of clearer demarcation of pulp and tooth outline at this level. PMID:28123269

Current Advance and Future Prospects of Tissue Engineering Approach to Dentin/Pulp Regenerative Therapy

PubMed Central

Gong, Ting; Heng, Boon Chin; Lo, Edward Chin Man; Zhang, Chengfei

2016-01-01

Recent advances in biomaterial science and tissue engineering technology have greatly spurred the development of regenerative endodontics. This has led to a paradigm shift in endodontic treatment from simply filling the root canal systems with biologically inert materials to restoring the infected dental pulp with functional replacement tissues. Currently, cell transplantation has gained increasing attention as a scientifically valid method for dentin-pulp complex regeneration. This multidisciplinary approach which involves the interplay of three key elements of tissue engineering—stem cells, scaffolds, and signaling molecules—has produced an impressive number of favorable outcomes in preclinical animal studies. Nevertheless, many practical hurdles need to be overcome prior to its application in clinical settings. Apart from the potential health risks of immunological rejection and pathogenic transmission, the lack of a well-established banking system for the isolation and storage of dental-derived stem cells is the most pressing issue that awaits resolution and the properties of supportive scaffold materials vary across different studies and remain inconsistent. This review critically examines the classic triad of tissue engineering utilized in current regenerative endodontics and summarizes the possible techniques developed for dentin/pulp regeneration. PMID:27069484

Spatial differentiation of gene expression in Aspergillus niger colony grown for sugar beet pulp utilization

PubMed Central

Benoit, Isabelle; Zhou, Miaomiao; Vivas Duarte, Alexandra; Downes, Damien J.; Todd, Richard B.; Kloezen, Wendy; Post, Harm; Heck, Albert J. R.; Maarten Altelaar, A. F.; de Vries, Ronald P.

2015-01-01

Degradation of plant biomass to fermentable sugars is of critical importance for the use of plant materials for biofuels. Filamentous fungi are ubiquitous organisms and major plant biomass degraders. Single colonies of some fungal species can colonize massive areas as large as five soccer stadia. During growth, the mycelium encounters heterogeneous carbon sources. Here we assessed whether substrate heterogeneity is a major determinant of spatial gene expression in colonies of Aspergillus niger. We analyzed whole-genome gene expression in five concentric zones of 5-day-old colonies utilizing sugar beet pulp as a complex carbon source. Growth, protein production and secretion occurred throughout the colony. Genes involved in carbon catabolism were expressed uniformly from the centre to the periphery whereas genes encoding plant biomass degrading enzymes and nitrate utilization were expressed differentially across the colony. A combined adaptive response of carbon-catabolism and enzyme production to locally available monosaccharides was observed. Finally, our results demonstrate that A. niger employs different enzymatic tools to adapt its metabolism as it colonizes complex environments. PMID:26314379

Spatial differentiation of gene expression in Aspergillus niger colony grown for sugar beet pulp utilization.

PubMed

Benoit, Isabelle; Zhou, Miaomiao; Vivas Duarte, Alexandra; Downes, Damien J; Todd, Richard B; Kloezen, Wendy; Post, Harm; Heck, Albert J R; Maarten Altelaar, A F; de Vries, Ronald P

2015-08-28

Degradation of plant biomass to fermentable sugars is of critical importance for the use of plant materials for biofuels. Filamentous fungi are ubiquitous organisms and major plant biomass degraders. Single colonies of some fungal species can colonize massive areas as large as five soccer stadia. During growth, the mycelium encounters heterogeneous carbon sources. Here we assessed whether substrate heterogeneity is a major determinant of spatial gene expression in colonies of Aspergillus niger. We analyzed whole-genome gene expression in five concentric zones of 5-day-old colonies utilizing sugar beet pulp as a complex carbon source. Growth, protein production and secretion occurred throughout the colony. Genes involved in carbon catabolism were expressed uniformly from the centre to the periphery whereas genes encoding plant biomass degrading enzymes and nitrate utilization were expressed differentially across the colony. A combined adaptive response of carbon-catabolism and enzyme production to locally available monosaccharides was observed. Finally, our results demonstrate that A. niger employs different enzymatic tools to adapt its metabolism as it colonizes complex environments.

A Profile of Tax Subsidies and Investment Behavior in Six Major Polluting Industries (1997)

EPA Pesticide Factsheets

Reviews investment trends in pollution control technology to determine existing patterns and to highlight the likely investment incentives that six industries, metals mining, petroleum, primary metals, pulp and paper, chemicals, and electric utilities.

40 CFR 52.1783 - Original identification of plan section.

Code of Federal Regulations, 2013 CFR

2013-07-01

... of Particulates from Hot Mix Asphalt Plants 2D.0507—Particulates from Chemical Fertilizer Manufacturing Plants 2D.0508—Control of Particulates from Pulp and Paper Mills 2D.0509—Particulates from Mica or... Emissions from Bulk Gasoline Terminals 2D.0918—Can Coating 2D.0919—Coil Coating 2D.0920—Paper Coating 2D...

40 CFR 52.1783 - Original identification of plan section.

Code of Federal Regulations, 2012 CFR

2012-07-01

... of Particulates from Hot Mix Asphalt Plants 2D.0507—Particulates from Chemical Fertilizer Manufacturing Plants 2D.0508—Control of Particulates from Pulp and Paper Mills 2D.0509—Particulates from Mica or... Emissions from Bulk Gasoline Terminals 2D.0918—Can Coating 2D.0919—Coil Coating 2D.0920—Paper Coating 2D...

40 CFR 52.1783 - Original identification of plan section.

Code of Federal Regulations, 2011 CFR

2011-07-01

... of Particulates from Hot Mix Asphalt Plants 2D.0507—Particulates from Chemical Fertilizer Manufacturing Plants 2D.0508—Control of Particulates from Pulp and Paper Mills 2D.0509—Particulates from Mica or... Emissions from Bulk Gasoline Terminals 2D.0918—Can Coating 2D.0919—Coil Coating 2D.0920—Paper Coating 2D...

Structure and assembly mechanism for heteromeric kainate receptors.

PubMed

Kumar, Janesh; Schuck, Peter; Mayer, Mark L

2011-07-28

Native glutamate receptor ion channels are tetrameric assemblies containing two or more different subunits. NMDA receptors are obligate heteromers formed by coassembly of two or three divergent gene families. While some AMPA and kainate receptors can form functional homomeric ion channels, the KA1 and KA2 subunits are obligate heteromers which function only in combination with GluR5-7. The mechanisms controlling glutamate receptor assembly involve an initial step in which the amino terminal domains (ATD) assemble as dimers. Here, we establish by sedimentation velocity that the ATDs of GluR6 and KA2 coassemble as a heterodimer of K(d) 11 nM, 32,000-fold lower than the K(d) for homodimer formation by KA2; we solve crystal structures for the GluR6/KA2 ATD heterodimer and heterotetramer assemblies. Using these structures as a guide, we perform a mutant cycle analysis to probe the energetics of assembly and show that high-affinity ATD interactions are required for biosynthesis of functional heteromeric receptors. Copyright © 2011 Elsevier Inc. All rights reserved.

Receptor-receptor interactions within receptor mosaics. Impact on neuropsychopharmacology.

PubMed

Fuxe, K; Marcellino, D; Rivera, A; Diaz-Cabiale, Z; Filip, M; Gago, B; Roberts, D C S; Langel, U; Genedani, S; Ferraro, L; de la Calle, A; Narvaez, J; Tanganelli, S; Woods, A; Agnati, L F

2008-08-01

Future therapies for diseases associated with altered dopaminergic signaling, including Parkinson's disease, schizophrenia and drug addiction or drug dependence may substantially build on the existence of intramembrane receptor-receptor interactions within dopamine receptor containing receptor mosaics (RM; dimeric or high-order receptor oligomers) where it is believed that the dopamine D(2) receptor may operate as the 'hub receptor' within these complexes. The constitutive adenosine A(2A)/dopamine D(2) RM, located in the dorsal striato-pallidal GABA neurons, are of particular interest in view of the demonstrated antagonistic A(2A)/D(2) interaction within these heteromers; an interaction that led to the suggestion and later demonstration that A(2A) antagonists could be used as novel anti-Parkinsonian drugs. Based on the likely existence of A(2A)/D(2)/mGluR5 RM located both extrasynaptically on striato-pallidal GABA neurons and on cortico-striatal glutamate terminals, multiple receptor-receptor interactions within this RM involving synergism between A(2A)/mGluR5 to counteract D(2) signaling, has led to the proposal of using combined mGluR5 and A(2A) antagonists as a future anti-Parkinsonian treatment. Based on the same RM in the ventral striato-pallidal GABA pathways, novel strategies for the treatment of schizophrenia, building on the idea that A(2A) agonists and/or mGluR5 agonists will help reduce the increased dopaminergic signaling associated with this disease, have been suggested. Such treatment may ensure the proper glutamatergic drive from the mediodorsal thalamic nucleus to the prefrontal cortex, one which is believed to be reduced in schizophrenia due to a dominance of D(2)-like signaling in the ventral striatum. Recently, A(2A) receptors also have been shown to counteract the locomotor and sensitizing actions of cocaine and increases in A(2A) receptors have also been observed in the nucleus accumbens after extended cocaine self-administration, probably representing a compensatory up-regulation to counteract the cocaine-induced increases in dopamine D(2) and D(3) signaling. Therefore, A(2A) agonists, through antagonizing D(2) and D(3) signaling within A(2A)/D(2) and A(2A)/D(3) RM heteromers in the nucleus accumbens, may be found useful as a treatment for cocaine dependence. Furthermore, antagonistic cannabinoid CB(1)/D(2) interactions requiring A(2A) receptors have also been discovered and possibly operate in CB(1)/D(2)/A(2A) RM located principally on striatal glutamate terminals but also on some ventral striato-pallidal GABA neurons, thereby opening up a new mechanism for the integration of endocannabinoid, DA and adenosine mediated signals. Thus, A(2A), mGluR5 and/or CB(1) receptors can form integrative units with D(2) receptors within RM displaying different compositions, topography and localization. Also galaninR/5-HT(1A) RM probably participates in the transmission of the ascending 5-hydroxytryptamine neurons, where galanin receptors antagonize 5-HT(1A) recognition and signaling. Subtype specific galanin receptor antagonists may therefore represent novel antidepressant drugs. These results suggest the importance of a complete understanding of the function of these RM with regard to disease. Ultimately receptor-receptor interactions within RM that modify dopaminergic and serotonergic signaling may give new strategies for treatment of a wide range of diseases associated with altered dopaminergic and serotonergic signaling.

Effect of narcotic pain reliever on pulp tests in women.

PubMed

Kardelis, Anthony C; Meinberg, Trudy A; Sulte, Heather R; Gound, Tom G; Marx, David B; Reinhardt, Richard A

2002-07-01

The purpose of this study was to determine the effect of one dose of a common narcotic-based pain reliever (Vicodin) on a battery of oral sensitivity tests across time in women. Fifteen Caucasian women randomly were given an oral dose of 10 mg of hydrocodone/1000 mg of acetaminophen or placebo in a double-blind, cross-over design. At baseline (before drug) and after 2, 4, and 8 h each subject was evaluated for sensitivity thresholds with four tests around an experimental tooth: (a) electric pulp tester applied to exposed root; (b) electric pulp tester on adjacent mucosa; (c) increasing probe pressure (grams) on adjacent mucosa; and (d) decreasing cold probe (degrees C) on the exposed root. The outcomes of all tests were not statistically different between drug and placebo treatments at any time point (p > 0.05). These results suggest that a systemic dose of hydrocodone/acetaminophen has little impact on healthy pulp or mucosa sensitivity in women as measured by common diagnostic tests.

Safe Gene Therapy for Type 1 Diabetes

DTIC Science & Technology

2010-10-01

Baltimore, Maryland, USA. Skeletal muscle development, nutrient uptake, and nutrient utilization is largely coordinated by growth hor- mone (GH) and its...one of the many means the immune system utilizes to ensure self-recognition and maintenance of tolerance. In central lymphoid organ, the thymus, PTA...largely present in the marginal zone bordering the white pulp. Such geometrical location are consistent with a tolerogenic role of Aire-expressing cells

Cytoplasmic peptidoglycan intermediate levels in Staphylococcus aureus.

PubMed

Vemula, Harika; Ayon, Navid J; Gutheil, William G

2016-02-01

Intracellular cytoplasmic peptidoglycan (PG) intermediate levels were determined in Staphylococcus aureus during log-phase growth in enriched media. Levels of UDP-linked intermediates were quantitatively determined using ion pairing LC-MS/MS in negative mode, and amine intermediates were quantitatively determined stereospecifically as their Marfey's reagent derivatives in positive mode. Levels of UDP-linked intermediates in S. aureus varied from 1.4 μM for UDP-GlcNAc-Enolpyruvyate to 1200 μM for UDP-MurNAc. Levels of amine intermediates (L-Ala, D-Ala, D-Ala-D-Ala, L-Glu, D-Glu, and L-Lys) varied over a range of from 860 μM for D-Ala-D-Ala to 30-260 mM for the others. Total PG was determined from the D-Glu content of isolated PG, and used to estimate the rate of PG synthesis (in terms of cytoplasmic metabolite flux) as 690 μM/min. The total UDP-linked intermediates pool (2490 μM) is therefore sufficient to sustain growth for 3.6 min. Comparison of UDP-linked metabolite levels with published pathway enzyme characteristics demonstrates that enzymes on the UDP-branch range from >80% saturation for MurA, Z, and C, to <5% saturation for MurB. Metabolite levels were compared with literature values for Escherichia coli, with the major difference in UDP-intermediates being the level of UDP-MurNAc, which was high in S. aureus (1200 μM) and low in E. coli (45 μM). Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Distinctive Klf4 mutants determine preference for DNA methylation status

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hashimoto, Hideharu; Wang, Dongxue; Steves, Alyse N.

Reprogramming of mammalian genome methylation is critically important but poorly understood. Klf4, a transcription factor directing reprogramming, contains a DNA binding domain with three consecutive C2H2 zinc fingers. Klf4 recognizes CpG or TpG within a specific sequence. Mouse Klf4 DNA binding domain has roughly equal affinity for methylated CpG or TpG, and slightly lower affinity for unmodified CpG. The structural basis for this key preference is unclear, though the side chain of Glu446 is known to contact the methyl group of 5-methylcytosine (5mC) or thymine (5-methyluracil). We examined the role of Glu446 by mutagenesis. Substituting Glu446 with aspartate (E446D) resultedmore » in preference for unmodified cytosine, due to decreased affinity for 5mC. In contrast, substituting Glu446 with proline (E446P) increased affinity for 5mC by two orders of magnitude. Structural analysis revealed hydrophobic interaction between the proline's aliphatic cyclic structure and the 5-methyl group of the pyrimidine (5mC or T). As in wild-type Klf4 (E446), the proline at position 446 does not interact directly with either the 5mC N4 nitrogen or the thymine O4 oxygen. In contrast, the unmethylated cytosine's exocyclic N4 amino group (NH2) and its ring carbon C5 atom hydrogen bond directly with the aspartate carboxylate of the E446D variant. Both of these interactions would provide a preference for cytosine over thymine, and the latter one could explain the E446D preference for unmethylated cytosine. Finally, we evaluated the ability of these Klf4 mutants to regulate transcription of methylated and unmethylated promoters in a luciferase reporter assay.« less

Sensitivity of human dental pulp cells to eighteen chemical agents used for endodontic treatments in dentistry.

PubMed

Kobayashi, Morio; Tsutsui, Takeo W; Kobayashi, Tomoko; Ohno, Maki; Higo, Yukari; Inaba, Tomohiro; Tsutsui, Takeki

2013-01-01

To determine the adverse effects against human dental pulp tissue, the sensitivity of human dental pulp cells (D824 cells) to 18 chemical agents used for endodontic treatments in dentistry was examined. The cytotoxicity, as determined by a decrease in colony-forming ability of cells treated with the chemical agents, increased as the concentration increased. As a quantitative measure of the cytotoxic effect, LC(50), the concentration which induces a 50% lethality, was extrapolated from the concentration-response curves. The rank of the chemical agents according to their cytotoxic effect (LC(50)) was sodium arsenite > formaldehyde > hydrogen peroxide > zinc oxide > thymol ≈ iodoform ≈ eugenol > guaiacol > ethylenediaminetetraacetic acid ≈ iodine > procaine > lidocaine ≈ chloramphenicol ≈ m-cresol > calcium hydroxide ≈ sodium hypochlorite ≈ phenol ≈ p-phenolsulfonic acid. To compare the cytotoxicity and the levels of apoptosis and mRNA expression of five genes related to the function of dental pulp tissue, D824 cells treated with the LC(50) concentrations of chemical agents were assayed by the TUNEL method and quantitative reverse transcription polymerase chain reaction analysis, respectively. The inducibility of apoptotic cells and the level of mRNA expression of the genes varied with the chemical agents, indicating that both effects occurred independent of the rank of cytotoxic effect of the chemical agents. The results not only provide information concerning cytotoxicity of various chemical agents to human dental pulp cells, but also show an insight into the diversity of the pharmacodynamic action of the chemical agents.

Dental pulp of the third molar: a new source of pluripotent-like stem cells.

PubMed

Atari, Maher; Gil-Recio, Carlos; Fabregat, Marc; García-Fernández, Dani; Barajas, Miguel; Carrasco, Miguel A; Jung, Han-Sung; Alfaro, F Hernández; Casals, Nuria; Prosper, Felipe; Ferrés-Padró, Eduard; Giner, Luis

2012-07-15

Dental pulp is particularly interesting in regenerative medicine because of the accessibility and differentiation potential of the tissue. Dental pulp has an early developmental origin with multi-lineage differentiation potential as a result of its development during childhood and adolescence. However, no study has previously identified the presence of stem cell populations with embryonic-like phenotypes in human dental pulp from the third molar. In the present work, we describe a new population of dental pulp pluripotent-like stem cells (DPPSCs) that were isolated by culture in medium containing LIF, EGF and PDGF. These cells are SSEA4(+), OCT3/4(+), NANOG(+), SOX2(+), LIN28(+), CD13(+), CD105(+), CD34(-), CD45(-), CD90(+), CD29(+), CD73(+), STRO1(+) and CD146(-), and they show genetic stability in vitro based on genomic analysis with a newly described CGH technique. Interestingly, DPPSCs were able to form both embryoid-body-like structures (EBs) in vitro and teratoma-like structures that contained tissues derived from all three embryonic germ layers when injected in nude mice. We examined the capacity of DPPSCs to differentiate in vitro into tissues that have similar characteristics to mesoderm, endoderm and ectoderm layers in both 2D and 3D cultures. We performed a comparative RT-PCR analysis of GATA4, GATA6, MIXL1, NANOG, OCT3/4, SOX1 and SOX2 to determine the degree of similarity between DPPSCs, EBs and human induced pluripotent stem cells (hIPSCs). Our analysis revealed that DPPSCs, hIPSC and EBs have the same gene expression profile. Because DPPSCs can be derived from healthy human molars from patients of different sexes and ages, they represent an easily accessible source of stem cells, which opens a range of new possibilities for regenerative medicine.

Physicochemical, nutritional, and functional characterization of fruits xoconostle (Opuntia matudae) pears from Central-México Region.

PubMed

Guzmán-Maldonado, Salvador H; Morales-Montelongo, Ana L; Mondragón-Jacobo, Candelario; Herrera-Hernández, Guadalupe; Guevara-Lara, Fidel; Reynoso-Camacho, Rosalia

2010-08-01

Xoconostle cv. Cuaresmeño (Opuntia matudae) has attracted domestic and international industry attention; however, variations of composition from xoconostle structures have not been evaluated. Industries discard the pulp (endocarp) and peel (pericarp) as wastes and utilize the skin (mesocarp), which is the edible portion. The physicochemical, nutritional, and functional characterization of structures from xoconostle pear from 3 major sites of production in Mexico were assessed. Skin yield ranged from 58% to 64% and was higher to that of peel (22% to 24%) and pulp (12% to 18%) yields. pH, degrees Brix, and acidity were similar among xoconostle structures. Total fiber showed by peel (18.23% to 20.37%) was 2-fold higher than that of skin. Protein and ether extract were higher in xoconostle pulp compared to that showed by peel and skin. Iron content of xoconostle peel (6 to 9.6 mg/100 g, DWB) was higher to that of skin and pulp and prickly pear pulp. Soluble phenols of peel (840 to 863 mg GAE/100 g, DWB) were almost similar to that of skin (919 to 986 mg GAE/100 g, dry weigh basis); meanwhile, ascorbic acid concentration of skin was 2-fold higher compared to that of peel. The phenolic fraction of xoconostle structures consisted of gallic, vanillic, and 4-hydroxybenzoic acids; catechin, epicatechin, and vanillin were also identified by high-performance liquid chromatography-didoe array detection (HPLC-DAD). Xoconostle peel showed higher antioxidant activity (TEAC) compared to that of skin (2-fold) and pulp (6-fold) of commonly consumed fruits and vegetables. The potential of xoconostle peel and pulp for the production of feed or food is promissory. Practical Application: Outstanding nutritional and functional properties of xoconostle cv. Cuaresmeño fruits are demonstrated. Increased consumption could contribute positively to improve the diet of rural and urban consumers. The high fiber, mineral, and antioxidant components of xoconostle peel and pulp suggest that these fruit structures, which are currently discarded as waste, have promissory use as feed or food by industry.

Chemical and microbiological changes during vermicomposting of coffee pulp using exotic (Eudrilus eugeniae) and native earthworm (Perionyx ceylanesis) species.

PubMed

Raphael, Kurian; Velmourougane, K

2011-06-01

Coffee pulp is the main solid residue from the wet processing of coffee berries. Due to presence of anti-physiological and anti-nutritional factors, coffee pulp is not considered as adequate substrate for bioconversion process by coffee farmers. Recent stringent measures by Pollution Control authorities, made it mandatory to treat all the solid and liquid waste emanating from the coffee farms. A study was conducted to evaluate the efficiency of an exotic (Eudrilus eugeniae) and a native earthworm (Perionyx ceylanesis) from coffee farm for decomposition of coffee pulp into valuable vermicompost. Exotic earthworms were found to degrade the coffee pulp faster (112 days) as compared to the native worms (165 days) and the vermicomposting efficiency (77.9%) and vermicompost yield (389 kg) were found to significantly higher with native worms. The multiplication rate of earthworms (280%) and worm yield (3.78 kg) recorded significantly higher with the exotic earthworms. The percentage of nitrogen, phosphorous, potassium, calcium and magnesium in vermicompost was found to increase while C:N ratio, pH and total organic carbon declined as a function of the vermicomposting. The plant nutrients, nitrogen (80.6%), phosphorus (292%) and potassium (550%) content found to increase significantly in the vermicompost produced using native earthworms as compared to the initial values, while the calcium (85.7%) and magnesium (210%) content found to increase significantly in compost produced utilizing exotic worms. Vermicompost and vermicasts from native earthworms recorded significantly higher functional microbial group's population as compared to the exotic worms. The study reveals that coffee pulp can be very well used as substrate for vermicomposting using exotic (Eudrilus eugeniae) and native earthworm (Perionyx ceylanesis).

Inhibition of TGF-β Signaling in SHED Enhances Endothelial Differentiation.

PubMed

Xu, J G; Gong, T; Wang, Y Y; Zou, T; Heng, B C; Yang, Y Q; Zhang, C F

2018-02-01

Low efficiency of deriving endothelial cells (ECs) from adult stem cells hampers their utilization in tissue engineering studies. The purpose of this study was to investigate whether suppression of transforming growth factor beta (TGF-β) signaling could enhance the differentiation efficiency of dental pulp-derived stem cells into ECs. We initially used vascular endothelial growth factor A (VEGF-A) to stimulate 2 dental pulp-derived stem cells (dental pulp stem cells and stem cells from human exfoliated deciduous teeth [SHED]) and compared their differentiation capacity into ECs. We further evaluated whether the vascular endothelial growth factor receptor I (VEGF-RI)-specific ligand placental growth factor-1 (PlGF-1) could mediate endothelial differentiation. Finally, we investigated whether the TGF-β signaling inhibitor SB-431542 could enhance the inductive effect of VEGF-A on endothelial differentiation, as well as the underlying mechanisms involved. ECs differentiated from dental pulp-derived stem cells exhibited the typical phenotypes of primary ECs, with SHED possessing a higher endothelial differentiation potential than dental pulp stem cells. VEGFR1-specific ligand-PLGF exerted a negligible effect on SHED-ECs differentiation. Compared with VEGF-A alone, the combination of VEGF-A and SB-431542 significantly enhanced the endothelial differentiation of SHED. The presence of SB-431542 inhibited the phosphorylation of Suppressor of Mothers Against Decapentaplegic 2/3 (SMAD2/3), allowing for VEGF-A-dependent phosphorylation and upregulation of VEGFR2. Our results indicate that the combination of VEGF-A and SB-431542 could enhance the differentiation of dental pulp-derived stem cells into endothelial cells, and this process is mediated through enhancement of VEGF-A-VEGFR2 signaling and concomitant inhibition of TGF-β-SMAD2/3 signaling.

Potent and selective agonists of alpha-melanotropin (alphaMSH) action at human melanocortin receptor 5; linear analogs of alpha-melanotropin.

PubMed

Bednarek, Maria A; MacNeil, Tanya; Tang, Rui; Fong, Tung M; Cabello, M Angeles; Maroto, Marta; Teran, Ana

2007-05-01

Alpha-melanotropin, Ac-Ser(1)-Tyr-Ser-Met-Glu-His(6)-Phe(7)-Arg(8)-Trp(9)-Gly-Lys-Pro-Val(13)-NH(2)(1), is a non-selective endogenous agonist for the melanocortin receptor 5; the receptor present in various peripheral tissues and in the brain, cortex and cerebellum. Most of the synthetic analogs of alphaMSH, including a broadly used and more potent the NDP-alphaMSH peptide, Ac-Ser(1)-Tyr-Ser-Nle(4)-Glu-His(6)-D-Phe(7)-Arg(8)-Trp(9)-Gly-Lys-Pro-Val(13)-NH(2), are also not particularly selective for MC5R. To elucidate physiological functions of the melanocortin receptor 5 in rodents and humans, the receptor subtype selective research tools are needed. We report herein syntheses and pharmacological evaluation in vitro of several analogs of NDP-alphaMSH which are highly potent and specific agonists for the human MC5R. The new linear peptides, of structures and solubility properties similar to those of the endogenous ligand alphaMSH, are exemplified by compound 7, Ac-Ser(1)-Tyr-Ser-Met-Glu-Oic(6)-D-4,4'-Bip(7)-Pip(8)-Trp(9)-Gly-Lys-Pro-Val(13)-NH(2) (Oic: octahydroindole-2-COOH, 4,4'-Bip: 4,4'-biphenylalanine, Pip: pipecolic acid), shortly NODBP-alphaMSH, which has an IC(50)=0.74 nM (binding assay) and EC(50)=0.41 (cAMP production assay) at hMC5R nM and greater than 3500-fold selectivity with respect to the melanocortin receptors 1b, 3 and 4. A shorter peptide derived from NODBP-alphaMSH: Ac-Nle-Glu-Oic(6)-D-4,4'-Bip(7)-Pip(8)-Trp(9) -NH(2) (17) was measured to be an agonist only 10-fold less potent at hMC5R than the full length parent peptide. In the structure of this smaller analog, the Nle-Glu-Oic(6)-D-4,4'-Bip(7)-Pip(8) segment was found to be critical for high agonist potency, while the C-terminal Trp(9) residue was shown to be required for high hMC5R selectivity versus hMC1b,3,4R.

Studies on identifying the binding sites of folate and its derivatives in Lactobacillus casei thymidylate synthase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maley, F.; Maley, G.F.

1983-01-01

It was shown that folate and its derivatives have a profound effect on stabilizing thymidylate synthase in vitro and in vivo, as a consequence of ternary formation between the folate, dUMP, or FdUMP, and the synthase. The degree to which complex formation is affected can be revealed qualitatively by circular dichroism and quantitatively by equilibrium dialysis using the Lactobacillus casei synthase. In contrast to the pteroylmonoglutamates, the pteroylpolyglutamates bind to thymidylate synthase in the absence of dUMP, but even their binding affinity is increased greatly by this nucleotide or its analogues. Similarly, treatment of the synthase with carboxypeptidase A preventsmore » the binding of the pteroylmonoglutamates and reduces the binding of the polyglutamates without affecting dUMP binding. The latter does not protect against carboxypeptidase inactivation but does potentiate the protective effect of the pteroylpolyglutamates. To determine the region of the synthase involved in the binding of the glutamate residues, Pte(/sup 14/C)GluGlu6 was activated by a water soluble carbodiimide in the presence and absence of dUMP. This folate derivative behaved as a competitive inhibitor of 5,10-CH/sub 2/H/sub 4/PteGlu, in contrast to methotrexate which was non-competitive. Separation of the five cyanogen bromide peptides from the L. casei synthase revealed 80% of the radioactivity to be associated with CNBr-2 and about 15% with CNBr-4. Chymotrypsin treatment of CNBr-2 yielded two /sup 14/C-labeled peaks on high performance liquid chromatography, with the slower migrating one being separated further into two peaks by Bio-gel P2 chromatography. All three peptides came from the same region of CNBr-2, encompassing residues 47-61 of the enzyme. From these studies it would appear that the residues most probably involved in the fixation of PteGlu7 are lysines 50 and 58. In contrast, methotrexate appeared to bind to another region of CNBr-2.« less

QTL detection for wheat kernel size and quality and the responses of these traits to low nitrogen stress.

PubMed

Cui, Fa; Fan, Xiaoli; Chen, Mei; Zhang, Na; Zhao, Chunhua; Zhang, Wei; Han, Jie; Ji, Jun; Zhao, Xueqiang; Yang, Lijuan; Zhao, Zongwu; Tong, Yiping; Wang, Tao; Li, Junming

2016-03-01

QTLs for kernel characteristics and tolerance to N stress were identified, and the functions of ten known genes with regard to these traits were specified. Kernel size and quality characteristics in wheat (Triticum aestivum L.) ultimately determine the end use of the grain and affect its commodity price, both of which are influenced by the application of nitrogen (N) fertilizer. This study characterized quantitative trait loci (QTLs) for kernel size and quality and examined the responses of these traits to low-N stress using a recombinant inbred line population derived from Kenong 9204 × Jing 411. Phenotypic analyses were conducted in five trials that each included low- and high-N treatments. We identified 109 putative additive QTLs for 11 kernel size and quality characteristics and 49 QTLs for tolerance to N stress, 27 and 14 of which were stable across the tested environments, respectively. These QTLs were distributed across all wheat chromosomes except for chromosomes 3A, 4D, 6D, and 7B. Eleven QTL clusters that simultaneously affected kernel size- and quality-related traits were identified. At nine locations, 25 of the 49 QTLs for N deficiency tolerance coincided with the QTLs for kernel characteristics, indicating their genetic independence. The feasibility of indirect selection of a superior genotype for kernel size and quality under high-N conditions in breeding programs designed for a lower input management system are discussed. In addition, we specified the functions of Glu-A1, Glu-B1, Glu-A3, Glu-B3, TaCwi-A1, TaSus2, TaGS2-D1, PPO-D1, Rht-B1, and Ha with regard to kernel characteristics and the sensitivities of these characteristics to N stress. This study provides useful information for the genetic improvement of wheat kernel size, quality, and resistance to N stress.

MK-801, but not naloxone, attenuates high-dose dextromethorphan-induced convulsive behavior: Possible involvement of the GluN2B receptor.

PubMed

Tran, Hai-Quyen; Chung, Yoon Hee; Shin, Eun-Joo; Tran, The-Vinh; Jeong, Ji Hoon; Jang, Choon-Gon; Nah, Seung-Yeol; Yamada, Kiyofumi; Nabeshima, Toshitaka; Kim, Hyoung-Chun

2017-11-01

Dextromethorphan (DM) is a dextrorotatory isomer of levorphanol, a typical morphine-like opioid. When administered at supra-antitussive doses, DM produces psychotoxic and neurotoxic effects in humans. Although DM abuse has been well-documented, few studies have examined the effects of high-dose DM. The present study aimed to explore the effects of a single high dose of DM on mortality and seizure occurrence. After intraperitoneal administration with a high dose of DM (80mg/kg), Sprague-Dawley rats showed increased seizure occurrence and intensity. Hippocampal expression levels of N-methyl-d-aspartate (NMDA) receptor subunits (GluN1

Attenuation of reserpine-induced pain/depression dyad by gentiopicroside through downregulation of GluN2B receptors in the amygdala of mice.

PubMed

Liu, Shui-bing; Zhao, Rong; Li, Xu-sheng; Guo, Hong-ju; Tian, Zhen; Zhang, Nan; Gao, Guo-dong; Zhao, Ming-gao

2014-06-01

Epidemiological studies demonstrate that pain frequently occurs comorbid with depression. Gentiopicroside (Gent) is a secoiridoid compound isolated from Gentiana lutea that exhibits analgesic properties and inhibits the expression of GluN2B-containing N-methyl-D-aspartate (NMDA) receptors in the anterior cingulate cortex of mice. However, the effects of Gent on the reserpine-induced pain/depression dyad and its underlying mechanisms are unclear. Reserpine administration (1 mg/kg subcutaneous daily for 3 days) caused a significant decrease in the nociceptive threshold as evidenced by the reduced paw withdrawal latency in response to a radiant heat source and mechanical allodynia. Behavioral detection indicated a significant increase in immobility time during a forced swim test, as well as decreased time in the central area and total travel distance in an open field test. Furthermore, reserpinized animals exhibited increased oxidative stress. Systemic Gent administration dose-dependently ameliorated the behavioral deficits associated with reserpine-induced pain/depression dyad. At the same time, the decrease in biogenic amine levels (norepinephrine, dopamine, and serotonin) was integrated with the increase in caspase-3 levels and GluN2B-containing NMDA receptors in the amygdala of the reserpine-injected mice. Gent significantly reversed the changes in the levels of biogenic amines, caspase-3, and GluN2B-containing NMDA receptors in amygdala. However, Gent did not affect the expression of GluN2A-containing NMDA receptors. The inhibitory effects of Gent on oxidative stress were occluded by simultaneous treatment of GluN2B receptors antagonist Ro25-6981. Our study provides strong evidence that Gent inhibits reserpine-induced pain/depression dyad by downregulating GluN2B receptors in the amygdala.

Deficits in morphofunctional maturation of hippocampal mossy fiber synapses in a mouse model of intellectual disability.

PubMed

Lanore, Frederic; Labrousse, Virginie F; Szabo, Zsolt; Normand, Elisabeth; Blanchet, Christophe; Mulle, Christophe

2012-12-05

The grik2 gene, coding for the kainate receptor subunit GluK2 (formerly GluR6), is associated with autism spectrum disorders and intellectual disability. Here, we tested the hypothesis that GluK2 could play a role in the appropriate maturation of synaptic circuits involved in learning and memory. We show that both the functional and morphological maturation of hippocampal mossy fiber to CA3 pyramidal cell (mf-CA3) synapses is delayed in mice deficient for the GluK2 subunit (GluK2⁻/⁻). In GluK2⁻/⁻ mice this deficit is manifested by a transient reduction in the amplitude of AMPA-EPSCs at a critical time point of postnatal development, whereas the NMDA component is spared. By combining multiple probability peak fluctuation analysis and immunohistochemistry, we have provided evidence that the decreased amplitude reflects a decrease in the quantal size per mf-CA3 synapse and in the number of active synaptic sites. Furthermore, we analyzed the time course of structural maturation of CA3 synapses by confocal imaging of YFP-expressing cells followed by tridimensional (3D) anatomical reconstruction of thorny excrescences and presynaptic boutons. We show that major changes in synaptic structures occur subsequently to the sharp increase in synaptic transmission, and more importantly that the course of structural maturation of synaptic elements is impaired in GluK2⁻/⁻ mice. This study highlights how a mutation in a gene linked to intellectual disability in the human may lead to a transient reduction of synaptic strength during postnatal development, impacting on the proper formation of neural circuits linked to memory.

Input- and subunit-specific AMPA receptor trafficking underlying long-term potentiation at hippocampal CA3 synapses.

PubMed

Kakegawa, Wataru; Tsuzuki, Keisuke; Yoshida, Yukari; Kameyama, Kimihiko; Ozawa, Seiji

2004-07-01

Hippocampal CA3 pyramidal neurons receive synaptic inputs from both mossy fibres (MFs) and associational fibres (AFs). Long-term potentiation (LTP) at these synapses differs in its induction sites and N-methyl-D-aspartate receptor (NMDAR) dependence. Most evidence favours the presynaptic and postsynaptic mechanisms for induction of MF LTP and AF LTP, respectively. This implies that molecular and functional properties differ between MF and AF synapses at both presynaptic and postsynaptic sites. In this study, we focused on the difference in the postsynaptic trafficking of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) between these synapses. To trace the subunit-specific trafficking of AMPARs at each synapse, GluR1 and GluR2 subunits were introduced into CA3 pyramidal neurons in hippocampal organotypic cultures using the Sindbis viral expression system. The electrophysiologically-tagged GluR2 AMPARs, produced by the viral-mediated transfer of the unedited form of GluR2 (GluR2Q), were inserted into both MF and AF postsynaptic sites in a neuronal activity-independent manner. Endogenous Ca(2+)-impermeable AMPARs at these synapses were replaced with exogenous Ca(2+)-permeable receptors, and Ca(2+) influx via the newly expressed postsynaptic AMPARs induced NMDAR-independent LTP at AF synapses. In contrast, no GluR1 AMPAR produced by the gene transfer was constitutively incorporated into AF postsynaptic sites, and only a small amount into MF postsynaptic sites. The synaptic trafficking of GluR1 AMPARs was triggered by the activity of Ca(2+)/calmodulin-dependent kinase II or high-frequency stimulation to induce LTP at AF synapses, but not at MF synapses. These results indicate that MF and AF postsynaptic sites possess distinct properties for AMPAR trafficking in CA3 pyramidal neurons.

A glucose-targeted mixed micellar formulation outperforms Genexol in breast cancer cells.

PubMed

Moretton, Marcela A; Bernabeu, Ezequiel; Grotz, Estefanía; Gonzalez, Lorena; Zubillaga, Marcela; Chiappetta, Diego A

2017-05-01

Breast cancer represents the top cancer among women, accounting 521.000 deaths per year. Development of targeted nanomedicines to breast cancer tissues represents a milestone to reduce chemotherapy side effects. Taking advantage of the over-expression of glucose (Glu) membrane transporters in breast cancer cells, we aim to expand the potential of a paclitaxel (PTX)-loaded mixed micellar formulation based on polyvinyl caprolactam-polyvinylacetate-polyethylene glycol graft copolymer (Soluplus®) and D-α-tocopheryl polyethylene glycol 1000 succinate (TPGS) by its surface decoration with Glu moieties. The glycopolymer (Soluplus(Glu)) was obtained by microwave-assisted ring opening reaction of δ-gluconolactone initiated by Soluplus®. The glycosylation was confirmed by 1 H NMR and by agglutination assays employing Concanavalin A. The hydrodynamic diameter of Soluplus(Glu) micelles was characterized by dynamic light scattering (100.3±3.8nm) as well as the critical micellar concentration value (0.0151% w/v). Then, a mixed micelle formulation employing Soluplus®, Soluplus(Glu) and TPGS (3:1:1wt ratio) loaded with PTX (4mg/mL) was developed as a multifunctional nanocarrier. Its in vitro anticancer performance in MCF-7 (1.6-fold) and MDA-MB-231 (14.1-fold) was significantly enhanced (p<0.05) versus the unique commercially available micellar-based PTX-nanoformulation (Genexol®). Furthermore, the in vitro PTX cellular uptake assays revealed that the drug intracellular/cell content was significantly (p<0.05) higher for the Glu-containing mixed micelles versus Genexol® after 6h of incubation with MCF-7 (30.5-fold) and MDA-MB-231 (5-fold). Overall, results confirmed the potential of our Glu-decorated mixed colloidal formulation as an intelligent nanocarrier for PTX-targeted breast cancer chemotherapy. Copyright © 2017 Elsevier B.V. All rights reserved.

Variations of L- and D-amino acid levels in the brain of wild-type and mutant mice lacking D-amino acid oxidase activity.

PubMed

Du, Siqi; Wang, Yadi; Weatherly, Choyce A; Holden, Kylie; Armstrong, Daniel W

2018-05-01

D-amino acids are now recognized to be widely present in organisms and play essential roles in biological processes. Some D-amino acids are metabolized by D-amino acid oxidase (DAO), while D-Asp and D-Glu are metabolized by D-aspartate oxidase (DDO). In this study, levels of 22 amino acids and the enantiomeric compositions of the 19 chiral proteogenic entities have been determined in the whole brain of wild-type ddY mice (ddY/DAO +/+ ), mutant mice lacking DAO activity (ddY/DAO -/- ), and the heterozygous mice (ddY/DAO +/- ) using high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS). No significant differences were observed for L-amino acid levels among the three strains except for L-Trp which was markedly elevated in the DAO +/- and DAO -/- mice. The question arises as to whether this is an unknown effect of DAO inactivity. The three highest levels of L-amino acids were L-Glu, L-Asp, and L-Gln in all the three strains. The lowest L-amino acid level was L-Cys in ddY/DAO +/- and ddY/DAO -/- mice, while L-Trp showed the lowest level in ddY/DAO +/+ mice. The highest concentration of D-amino acid was found to be D-Ser, which also had the highest % D value (~ 25%). D-Glu had the lowest % D value (~ 0.01%) in all the three strains. Significant differences of D-Leu, D-Ala, D-Ser, D-Arg, and D-Ile were observed in ddY/DAO +/- and ddY/DAO -/- mice compared to ddY/DAO +/+ mice. This work provides the most complete baseline analysis of L- and D-amino acids in the brains of ddY/DAO +/+ , ddY/DAO +/- , and ddY/DAO -/- mice yet reported. It also provides the most effective and efficient analytical approach for measuring these analytes in biological samples. This study provides fundamental information on the role of DAO in the brain and may be relevant for future development involving novel drugs for DAO regulation.

Effects of ibuprofen on cognition and NMDA receptor subunit expression across aging.

PubMed

Márquez Loza, Alejandra; Elias, Valerie; Wong, Carmen P; Ho, Emily; Bermudez, Michelle; Magnusson, Kathy R

2017-03-06

Age-related declines in long- and short-term memory show relationships to decreases in N-methyl-d-aspartate (NMDA) receptor expression, which may involve inflammation. This study was designed to determine effects of an anti-inflammatory drug, ibuprofen, on cognitive function and NMDA receptor expression across aging. Male C57BL/6 mice (ages 5, 14, 20, and 26months) were fed ibuprofen (375ppm) in NIH31 diet or diet alone for 6weeks prior to testing. Behavioral testing using the Morris water maze showed that older mice performed significantly worse than younger in spatial long-term memory, reversal, and short-term memory tasks. Ibuprofen enhanced overall performance in the short-term memory task, but this appeared to be more related to improved executive function than memory. Ibuprofen induced significant decreases over all ages in the mRNA densities for GluN2B subunit, all GluN1 splice variants, and GluN1-1 splice forms in the frontal cortex and in protein expression of GluN2A, GluN2B and GluN1 C2' cassettes in the hippocampus. GluN1-3 splice form mRNA and C2' cassette protein were significantly increased across ages in frontal lobes of ibuprofen-treated mice. Ibuprofen did not alter expression of pro-inflammatory cytokines IL-1β and TNFα, but did reduce the area of reactive astrocyte immunostaining in frontal cortex of aged mice. Enhancement in executive function showed a relationship to increased GluN1-3 mRNA and decreased gliosis. These findings suggest that inflammation may play a role in executive function declines in aged animals, but other effects of ibuprofen on NMDA receptors appeared to be unrelated to aging or inflammation. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

A postmortem analysis of NMDA ionotropic and group 1 metabotropic glutamate receptors in the nucleus accumbens in schizophrenia.

PubMed

Lum, Jeremy S; Millard, Samuel J; Huang, Xu-Feng; Ooi, Lezanne; Newell, Kelly A

2018-03-01

The nucleus accumbens (NAcc) has been implicated in the pathology and treatment of schizophrenia. Recent postmortem evidence suggests a hyperglutamatergic state in the NAcc. With the present study we aimed to explore possible glutamatergic alterations in the NAcc of a large schizophrenia cohort. We performed immunoblots on postmortem NAcc samples from 30 individuals who had schizophrenia and 30 matched controls. We examined the protein expression of primary glutamatergic receptors, including the N -methyl-D-aspartate (NMDA) receptor (NR1, NR2A and NR2B subunits) and the group 1 metabotropic glutamate receptor (mGluR1 and mGluR5; dimeric and monomeric forms). In addition, we measured the group 1 mGluR endogenous regulators, neurochondrin and Homer1b/c, which have recently been implicated in the pathophysiology of schizophrenia. Protein levels of glutamatergic receptors and endogenous regulators were not significantly different between the controls and individuals who had schizophrenia. Furthermore, mGluR5, but not mGluR1, showed a positive association with NMDA receptor subunits, suggesting differential interactions between these receptors in this brain region. Investigation of these proteins in antipsychotic-naive individuals, in addition to the subregions of the NAcc and subcellular fractions, will strengthen future studies. The present study does not provide evidence for glutamatergic abnormalities within the NAcc of individuals with schizophrenia. Taken together with the results of previous studies, these findings suggest NMDA receptors and group 1 mGluRs are altered in a brain region-dependent manner in individuals with schizophrenia. The differential associations between mGluR1, mGluR5 and NMDA receptors observed in this study warrant further research into the interactions of these proteins and the implications for the therapeutic and adverse effect profile of glutamatergic-based novel therapeutics.

A postmortem analysis of NMDA ionotropic and group 1 metabotropic glutamate receptors in the nucleus accumbens in schizophrenia.

PubMed

Lum, Jeremy S; Millard, Samuel J; Huang, Xu-Feng; Ooi, Lezanne; Newell, Kelly A

2017-10-06

The nucleus accumbens (NAcc) has been implicated in the pathology and treatment of schizophrenia. Recent postmortem evidence suggests a hyperglutamatergic state in the NAcc. With the present study we aimed to explore possible glutamatergic alterations in the NAcc of a large schizophrenia cohort. We performed immunoblots on postmortem NAcc samples from 30 individuals who had schizophrenia and 30 matched controls. We examined the protein expression of primary glutamatergic receptors, including the N -methyl-D-aspartate (NMDA) receptor (NR1, NR2A and NR2B subunits) and the group 1 metabotropic glutamate receptor (mGluR1 and mGluR5; dimeric and monomeric forms). In addition, we measured the group 1 mGluR endogenous regulators, neurochondrin and Homer1b/c, which have recently been implicated in the pathophysiology of schizophrenia. Protein levels of glutamatergic receptors and endogenous regulators were not significantly different between the controls and individuals who had schizophrenia. Furthermore, mGluR5, but not mGluR1, showed a positive association with NMDA receptor subunits, suggesting differential interactions between these receptors in this brain region. Investigation of these proteins in antipsychotic-naive individuals, in addition to the subregions of the NAcc and subcellular fractions, will strengthen future studies. The present study does not provide evidence for glutamatergic abnormalities within the NAcc of individuals with schizophrenia. Taken together with the results of previous studies, these findings suggest NMDA receptors and group 1 mGluRs are altered in a brain region-dependent manner in individuals with schizophrenia. The differential associations between mGluR1, mGluR5 and NMDA receptors observed in this study warrant further research into the interactions of these proteins and the implications for the therapeutic and adverse effect profile of glutamatergic-based novel therapeutics.

Pharmacological interference with metabotropic glutamate receptor subtype 7 but not subtype 5 differentially affects within- and between-session extinction of Pavlovian conditioned fear.

PubMed

Toth, Iulia; Dietz, Monika; Peterlik, Daniel; Huber, Sabine E; Fendt, Markus; Neumann, Inga D; Flor, Peter J; Slattery, David A

2012-03-01

Fear extinction is defined as the attenuation of a conditioned-fear memory by re-exposing animals to the conditioned stimulus without the aversive stimulus. This process is known to be effectively enhanced via administration of D-cycloserine (DCS), a partial NMDA-receptor agonist. However, other glutamatergic mechanisms, such as interference with metabotropic glutamate receptor (mGluR) subtypes 5 and 7 in the extinction of aversive memories are insufficiently understood. Using the allosteric mGluR5 receptor antagonist 2-methyl-6-(phenylethynyl)-pyridine (MPEP), the mGluR7 allosteric agonist N,N'-dibenzyhydryl-ethane-1,2-diamine dihydrochloride (AMN082), and DCS for comparison, we aimed to study how pharmacological blockade of mGluR5 and activation of mGluR7 influenced within- and between-session conditioned-fear extinction training and extinction retention in rats. We show that when injected before extinction training, mGluR7 activation with AMN082 enhanced freezing and thereby attenuated within-session fear extinction, whereas both DCS and the mGluR5 receptor antagonist MPEP had no effect on this process. However, these differential drug effects were not long lasting, as no difference in extinction retention were observed 24 h later. Therefore, we assessed whether the compounds affect 24 h consolidation of extinction training following incomplete extinction training (between-session extinction). Similar to DCS, AMN082- but not MPEP-treated rats showed facilitated extinction retention, as exhibited by decreased freezing. Finally, using fluoxetine, we provide evidence that the effect of AMN082 on between-session extinction retention is most likely not via increasing 5-HT transmission. These findings demonstrate that mGluR7 activation differentially modulates conditioned-fear extinction, in dependence on the protocol employed, and suggests drugs with AMN082-like mechanisms as potential add-on drugs following exposure-based psychotherapy for fear-related human disorders. Copyright © 2011 Elsevier Ltd. All rights reserved.

Jejunal Infusion of Glucose Decreases Energy Intake to a Greater Extent than Fructose in Adult Male Rats12

PubMed Central

Moghadam, Alexander A; Moran, Timothy H; Dailey, Megan J

2016-01-01

Background: Intestinal nutrient infusions result in variable decreases in energy intake and body weight based on nutrient type and specific intestinal infusion site. Objective: The objective was to test whether an intrajejunal fructose infusion (FRU) would lower energy intake and body weight and induce similar increases in gut hormones as those found after intrajejunal glucose infusions (GLU). Methods: Male Sprague-Dawley rats received an intrajejunal infusion of either an equal kilocalorie load of glucose or fructose (11.4 kcal) or saline (SAL) for 5 d while intake of a standard rodent diet was continuously recorded; body weight was measured daily. Immediately after the infusion on the final day, rats were killed and plasma was collected to measure hormones. Results: Daily energy intake was significantly lower in the GLU group than in the SAL group, but the FRU group did not differ from the GLU or SAL groups when the 11.4 kcal of the infusate was included as energy intake. Lower energy intake was due to smaller meal sizes during the infusion period in the GLU group than in the FRU and SAL groups; the FRU and SAL groups did not differ. The percentage of change in body weight was lower in the GLU group than in the FRU and SAL groups. Plasma glucagon-like-peptide 1 (GLP-1) concentrations were greater in the GLU group than in the SAL group; the FRU group did not differ from the GLU or SAL groups. The plasma insulin concentration was greater in the FRU group than in both the GLU and SAL groups. Conclusion: These results demonstrate that glucose induces a greater decrease in energy intake and increase in GLP-1 at distal intestinal sites than fructose in rats, which may explain differential effects of these monosaccharides between studies when delivered orally or along the proximal to distal axis of the intestine. PMID:27581579

Differential Structural Plasticity of Corticostriatal and Thalamostriatal Axo-Spinous Synapses in MPTP-Treated Parkinsonian Monkeys

PubMed Central

Villalba, Rosa M.; Smith, Yoland

2011-01-01

Striatal spine loss is a key pathological feature of Parkinson's disease (PD). Knowing that striatal glutamatergic afferents target dendritic spines, these data appear difficult to reconcile with evidence for an increased expression of the vesicular glutamate transporter 1 (vGluT1) in the striatum of PD patients and 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-treated monkeys, as well as in some electrophysiological studies showing overactivity of the corticostriatal glutamatergic system in models of parkinsonism. To address the possibility that structural changes in glutamatergic afferents may underlie these discrepancies, we undertook an ultrastructural analysis of vGluT1-positive (i.e., corticostriatal) and vGluT2-positive (i.e., mostly thalamostriatal) axo-spinous glutamatergic synapses using a 3D electron microscopic approach in normal and MPTP-treated monkeys. Three main conclusions can be drawn: 1) spines contacted by vGluT1-containing terminals have larger volume and harbor significantly larger postsynaptic densities (PSDs) than those contacted by vGluT2-immunoreactive boutons; 2) a subset of vGluT2-, but not vGluT1-immunoreactive, terminals display a pattern of multisynaptic connectivity in normal and MPTP-treated monkeys; and 3) VGluT1- and vGluT2-positive axo-spinous synapses undergo ultrastructural changes (larger spine volume, larger PSDs, increased PSD perforations, larger presynaptic terminal) indicative of increased synaptic activity in parkinsonian animals. Furthermore, spines contacted by cortical terminals display an increased volume of their spine apparatus in MPTP-treated monkeys, suggesting an increased protein synthesis at corticostriatal synapses. These findings demonstrate that corticostriatal and thalamostriatal glutamatergic axo-spinous synapses display significantly different ultrastructural features, and that both systems undergo complex morphological changes that could underlie the pathophysiology of corticostriatal and thalamostriatal systems in PD. PMID:21280048

Ionotropic glutamate receptor antagonists and cancer therapy: time to think out of the box?

PubMed

Ribeiro, Mariana P C; Custódio, José B A; Santos, Armanda E

2017-02-01

Glutamate has a trophic function in the development of the central nervous system, regulating the proliferation and migration of neuronal progenitors. The resemblance between neuronal embryonic and tumor cells has paved the way for the investigation of the effects of glutamate on tumor cells. Indeed, tumor cells derived from neuronal tissue express ionotropic glutamate receptor (iGluRs) subunits and iGluR antagonists decrease cell proliferation. Likewise, iGluRs subunits are expressed in several peripheral cancer cells and blockade of the N-methyl-D-aspartate (NMDA) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) ionotropic glutamate receptor subtypes decreases their proliferation and migration. Although these mechanisms are still being investigated, the inhibition of the mitogen-activated protein kinase pathway was shown to play a key role in the antiproliferative activity of iGluR antagonists. Importantly, MK-801, a NMDAR channel blocker, was effective and well tolerated in animal models of melanoma, lung, and breast cancers, suggesting that the blockade of iGluR signaling may represent a new strategy for cancer treatment. In this review, we focus on the significance of NMDA and AMPA receptor expression in tumor cells, as well as possible therapeutic strategies targeting these receptors.

Comparing Plant and Animal Glutamate Receptors: Common Traits but Different Fates?

PubMed

Wudick, Michael M; Michard, Erwan; Oliveira Nunes, Custódio; Feijó, José A

2018-04-19

Animal ionotropic glutamate receptors (iGluRs) are ligand-gated channels whose evolution is intimately linked to the one of the nervous system, where the agonist glutamate and co-agonists glycine/D-serine act as neuro-transmitters or -modulators. While iGluRs are specialized in neuronal communication, plant glutamate receptor-like (GLR) homologues have evolved many plant-specific physiological functions, such as sperm signaling in moss, pollen tube growth, root meristem proliferation, innate immune and wound responses. GLRs have been associated with Ca2+ signaling by directly channeling its extracellular influx into the cytosol. Nevertheless, very limited information on functional properties of GLRs is available, and we mostly rely on structure/function data obtained for animal iGluRs to interpret experimental results obtained for plant GLRs. Yet, a deeper characterization and better understanding of plant GLRs is progressively unveiling original and different mode of functions when compared to their mammalian counterparts. Here, we review the function of plant GLRs comparing their predicted structure and physiological roles to the well-documented ones of iGluRs. We conclude that interpreting GLR function based on comparison to their animal counterparts calls for caution, especially when presuming physiological roles and mode of action for plant GLRs from comparison to iGluRs in peripheral, non-neuronal tissues.

Rabphilin 3A: A novel target for the treatment of levodopa-induced dyskinesias.

PubMed

Stanic, Jennifer; Mellone, Manuela; Napolitano, Francesco; Racca, Claudia; Zianni, Elisa; Minocci, Daiana; Ghiglieri, Veronica; Thiolat, Marie-Laure; Li, Qin; Longhi, Annalisa; De Rosa, Arianna; Picconi, Barbara; Bezard, Erwan; Calabresi, Paolo; Di Luca, Monica; Usiello, Alessandro; Gardoni, Fabrizio

2017-12-01

N-methyl-d-aspartate receptor (NMDAR) subunit composition strictly commands receptor function and pharmacological responses. Changes in NMDAR subunit composition have been documented in brain disorders such as Parkinson's disease (PD) and levodopa (L-DOPA)-induced dyskinesias (LIDs), where an increase of NMDAR GluN2A/GluN2B subunit ratio at striatal synapses has been observed. A therapeutic approach aimed at rebalancing NMDAR synaptic composition represents a valuable strategy for PD and LIDs. To this, the comprehension of the molecular mechanisms regulating the synaptic localization of different NMDAR subtypes is required. We have recently demonstrated that Rabphilin 3A (Rph3A) is a new binding partner of NMDARs containing the GluN2A subunit and that it plays a crucial function in the synaptic stabilization of these receptors. Considering that protein-protein interactions govern the synaptic retention of NMDARs, the purpose of this work was to analyse the role of Rph3A and Rph3A/NMDAR complex in PD and LIDs, and to modulate Rph3A/GluN2A interaction to counteract the aberrant motor behaviour associated to chronic L-DOPA administration. Thus, an array of biochemical, immunohistochemical and pharmacological tools together with electron microscopy were applied in this study. Here we found that Rph3A is localized at the striatal postsynaptic density where it interacts with GluN2A. Notably, Rph3A expression at the synapse and its interaction with GluN2A-containing NMDARs were increased in parkinsonian rats displaying a dyskinetic profile. Acute treatment of dyskinetic animals with a cell-permeable peptide able to interfere with Rph3A/GluN2A binding significantly reduced their abnormal motor behaviour. Altogether, our findings indicate that Rph3A activity is linked to the aberrant synaptic localization of GluN2A-expressing NMDARs characterizing LIDs. Thus, we suggest that Rph3A/GluN2A complex could represent an innovative therapeutic target for those pathological conditions where NMDAR composition is significantly altered. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Microscopic study of dental hard tissues in primary teeth with Dentinogenesis Imperfecta Type II: Correlation of 3D imaging using X-ray microtomography and polarising microscopy.

PubMed

Davis, Graham R; Fearne, Janice M; Sabel, Nina; Norén, Jörgen G

2015-07-01

The aim of this study was to examine the histological appearance of dental hard tissues in primary teeth from children with DI using conventional polarised light microscopy and correlate that with 3D imaging using X-ray microtomograpy (XMT) to gain a further understanding of the dentine structure of teeth diagnosed with dentinogenesis imperfecta. Undecalcified sections of primary teeth from patients diagnosed with Dentinogenesis Imperfecta Type II were examined using polarised light microscopy. XMT was employed for 3D-imaging and analysis of the dentine. The polarised light microscopy and XMT revealed tubular structures in the dentine seen as vacuoles coinciding with the path of normal dentinal tubules but not continuous tubules. The size of the tubules was close to that of capillaries. The largest tubular structures had a direction corresponding to where the pulp tissue would have been located during primary dentine formation. The dysfunctional mineralisation of the dentine and obliteration of the pulp evidently leaves blood vessels in the dentine which have in the main been tied off and, in the undecalcified sections, appear as vacuoles. Although from radiographs, the pulp in teeth affected by Dentinogenesis Imperfect type II appears to be completely obliterated, a network of interconnected vessels may remain. The presence of large dentinal tubules and blood vessels, or the remnants of blood vessels, could provide a pathway for bacteria from the oral cavity. This might account for why some of these teeth develop periapical abscesses in spite of apparently having no pulp. Copyright © 2015 Elsevier Ltd. All rights reserved.

Identification and computational annotation of genes differentially expressed in pulp development of Cocos nucifera L. by suppression subtractive hybridization

PubMed Central

2014-01-01

Background Coconut (Cocos nucifera L.) is one of the world’s most versatile, economically important tropical crops. Little is known about the physiological and molecular basis of coconut pulp (endosperm) development and only a few coconut genes and gene product sequences are available in public databases. This study identified genes that were differentially expressed during development of coconut pulp and functionally annotated these identified genes using bioinformatics analysis. Results Pulp from three different coconut developmental stages was collected. Four suppression subtractive hybridization (SSH) libraries were constructed (forward and reverse libraries A and B between stages 1 and 2, and C and D between stages 2 and 3), and identified sequences were computationally annotated using Blast2GO software. A total of 1272 clones were obtained for analysis from four SSH libraries with 63% showing similarity to known proteins. Pairwise comparing of stage-specific gene ontology ids from libraries B-D, A-C, B-C and A-D showed that 32 genes were continuously upregulated and seven downregulated; 28 were transiently upregulated and 23 downregulated. KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis showed that 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT), phospholipase D, acetyl-CoA carboxylase carboxyltransferase beta subunit, 3-hydroxyisobutyryl-CoA hydrolase-like and pyruvate dehydrogenase E1 β subunit were associated with fatty acid biosynthesis or metabolism. Triose phosphate isomerase, cellulose synthase and glucan 1,3-β-glucosidase were related to carbohydrate metabolism, and phosphoenolpyruvate carboxylase was related to both fatty acid and carbohydrate metabolism. Of 737 unigenes, 103 encoded enzymes were involved in fatty acid and carbohydrate biosynthesis and metabolism, and a number of transcription factors and other interesting genes with stage-specific expression were confirmed by real-time PCR, with validation of the SSH results as high as 66.6%. Based on determination of coconut endosperm fatty acids content by gas chromatography–mass spectrometry, a number of candidate genes in fatty acid anabolism were selected for further study. Conclusion Functional annotation of genes differentially expressed in coconut pulp development helped determine the molecular basis of coconut endosperm development. The SSH method identified genes related to fatty acids, carbohydrate and secondary metabolites. The results will be important for understanding gene functions and regulatory networks in coconut fruit. PMID:25084812

Identification and computational annotation of genes differentially expressed in pulp development of Cocos nucifera L. by suppression subtractive hybridization.

PubMed

Liang, Yuanxue; Yuan, Yijun; Liu, Tao; Mao, Wei; Zheng, Yusheng; Li, Dongdong

2014-08-02

Coconut (Cocos nucifera L.) is one of the world's most versatile, economically important tropical crops. Little is known about the physiological and molecular basis of coconut pulp (endosperm) development and only a few coconut genes and gene product sequences are available in public databases. This study identified genes that were differentially expressed during development of coconut pulp and functionally annotated these identified genes using bioinformatics analysis. Pulp from three different coconut developmental stages was collected. Four suppression subtractive hybridization (SSH) libraries were constructed (forward and reverse libraries A and B between stages 1 and 2, and C and D between stages 2 and 3), and identified sequences were computationally annotated using Blast2GO software. A total of 1272 clones were obtained for analysis from four SSH libraries with 63% showing similarity to known proteins. Pairwise comparing of stage-specific gene ontology ids from libraries B-D, A-C, B-C and A-D showed that 32 genes were continuously upregulated and seven downregulated; 28 were transiently upregulated and 23 downregulated. KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis showed that 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT), phospholipase D, acetyl-CoA carboxylase carboxyltransferase beta subunit, 3-hydroxyisobutyryl-CoA hydrolase-like and pyruvate dehydrogenase E1 β subunit were associated with fatty acid biosynthesis or metabolism. Triose phosphate isomerase, cellulose synthase and glucan 1,3-β-glucosidase were related to carbohydrate metabolism, and phosphoenolpyruvate carboxylase was related to both fatty acid and carbohydrate metabolism. Of 737 unigenes, 103 encoded enzymes were involved in fatty acid and carbohydrate biosynthesis and metabolism, and a number of transcription factors and other interesting genes with stage-specific expression were confirmed by real-time PCR, with validation of the SSH results as high as 66.6%. Based on determination of coconut endosperm fatty acids content by gas chromatography-mass spectrometry, a number of candidate genes in fatty acid anabolism were selected for further study. Functional annotation of genes differentially expressed in coconut pulp development helped determine the molecular basis of coconut endosperm development. The SSH method identified genes related to fatty acids, carbohydrate and secondary metabolites. The results will be important for understanding gene functions and regulatory networks in coconut fruit.

N-Methyl-D-Aspartate Receptor Activation May Contribute to Glufosinate Neurotoxicity

EPA Science Inventory

N-Methyl-D-aspartate Receptor Activation May Contribute to Glufosinate Neurotoxicity Glufosinate (GLF) at high levels in mammals causes convulsions through a mechanism that is not completely understood. The structural similarity of GLF to glutamate (GLU) implicates the glutamate...

Resistant Starch but Not Enzymatically Modified Waxy Maize Delays Development of Diabetes in Zucker Diabetic Fatty Rats.

PubMed

Hedemann, Mette Skou; Hermansen, Kjeld; Pedersen, Sven; Bach Knudsen, Knud Erik

2017-05-01

Background: The incidence of type 2 diabetes (T2D) is increasing worldwide, and nutritional management of circulating glucose may be a strategic tool in the prevention of T2D. Objective: We studied whether enzymatically modified waxy maize with an increased degree of branching delayed the onset of diabetes in male Zucker diabetic fatty (ZDF) rats. Methods: Forty-eight male ZDF rats, aged 5 wk, were divided into 4 groups and fed experimental diets for 9 wk that contained 52.95% starch: gelatinized corn starch (S), glucidex (GLU), resistant starch (RS), or enzymatically modified starch (EMS). Blood glucose after feed deprivation was assessed every second week; blood samples taken at run-in and at the end of the experiment were analyzed for glycated hemoglobin (HbA1c) and plasma glucose, insulin, and lipids. During weeks 2 and 8, urine was collected for metabolomic analysis. Results: Based on blood glucose concentrations in feed-deprived rats, none of the groups developed diabetes. However, in week 9, plasma glucose after feed deprivation was significantly lower in rats fed the S and RS diets (13.5 mmol/L) than in rats fed the GLU and EMS diets (17.0-18.9 mmol/L), and rats fed RS had lower HbA1c (4.9%) than rats fed the S, GLU, and EMS (5.6-6.1%) diets. The homeostasis model assessment of insulin resistance was significantly lower in rats fed RS than in rats fed the other diets (185 compared with 311-360), indicating that rats fed the S, GLU, and EMS diets were diabetic, and a 100% higher urine excretion during week 8 in rats fed the GLU and EMS diets than that of rats fed S and RS showed that they were diabetic. Urinary nontargeted metabolomics revealed that the diabetic state of rats fed S, GLU, and EMS diets influenced microbial metabolism, as well as amino acid, lipid, and vitamin metabolism. Conclusions: EMS did not delay the onset of diabetes in ZDF rats, whereas rats fed RS showed no signs of diabetes. © 2017 American Society for Nutrition.

Effects of oral glucose on exercise thermoregulation in men after water immersion

NASA Technical Reports Server (NTRS)

Dearborn, Alan S.; Ertl, Andrew C.; Greenleaf, John E.; Barnes, Paul R.; Jackson, Catherine G. R.; Breckler, Jennifer L.

1994-01-01

To test the hypothesis elevated blood glucose would attenuate the rise in exercise rectal temperature, six men age 35 plus or minus S.D. 7 years participated in each of three trials by 4-hr water immersion to the neck: (1) 2.0 g/kg body wt of oral glucose (33.8 percent wt./vol.) was consumed followed by 80 min controlled rest (Glu/Rest), and 70 min horizontal supine cycle exercise at 62.8 percent plus or minus S.E. 0.5 percent (1.97 plus or minus 0.02 L/min) of peak O2 uptake followed by 10 min recovery (2) with (Glu/Ex) and (3) without prior flucose (No Glu/Ex). Blood samples were taken at -25, 0, 15, 45, and 68 min of exercise and after plus 10 min of recovery for measurement of hemoglobin, hematocrit, and blood glucose. Both mean skin (T sub sk) (from six sites) and rectal temperatures (T sub re) were monitored continuously. Sweat rate was measured by resistanc hygrometry. The mean of delta PV for the exercise trials was -12.2 plus or minus 2.1 percent. Mean blood glucose for the Glu/Ex trial was higher than that of the No Glu/Ex trial was (108.4 equal or minus 3.9 and 85.6 plus or minus 1.6 mg/dl, respectively, P less than 0.05. At the end of exercise T(sub sk) for the Glu/Ex trial was lower than for No Glu/Ex(32.0 plus or minus 0.3 and 32.4 equals or minus 0.2 C, respectively, P less than 0.05); T(sub re) for the Glu/Ex trial was lower than for No Glu/Es (38.22 plus or minus 0.17 and 38.60 plus or minus 0.11 C, respectively, P less than 0.05); and forearm sweat rate for the Glu/Ex trial (0.34 plus or minus 0.04 and 0.43 plus or minus g/sq cm, respectively, P less than 0.05). These data suggest that elevation of blood glucose prior to horizontal exercise following hypohydration attenuates the increase in body temperature without altering heat production or exercise hypovolemia.

Direct determination of protonation states and visualization of hydrogen bonding in a glycoside hydrolase with neutron crystallography.

PubMed

Wan, Qun; Parks, Jerry M; Hanson, B Leif; Fisher, Suzanne Zoe; Ostermann, Andreas; Schrader, Tobias E; Graham, David E; Coates, Leighton; Langan, Paul; Kovalevsky, Andrey

2015-10-06

Glycoside hydrolase (GH) enzymes apply acid/base chemistry to catalyze the decomposition of complex carbohydrates. These ubiquitous enzymes accept protons from solvent and donate them to substrates at close to neutral pH by modulating the pKa values of key side chains during catalysis. However, it is not known how the catalytic acid residue acquires a proton and transfers it efficiently to the substrate. To better understand GH chemistry, we used macromolecular neutron crystallography to directly determine protonation and ionization states of the active site residues of a family 11 GH at multiple pD (pD=pH+0.4) values. The general acid glutamate (Glu) cycles between two conformations, upward and downward, but is protonated only in the downward orientation. We performed continuum electrostatics calculations to estimate the pKa values of the catalytic Glu residues in both the apo- and substrate-bound states of the enzyme. The calculated pKa of the Glu increases substantially when the side chain moves down. The energy barrier required to rotate the catalytic Glu residue back to the upward conformation, where it can protonate the glycosidic oxygen of the substrate, is 4.3 kcal/mol according to free energy simulations. These findings shed light on the initial stage of the glycoside hydrolysis reaction in which molecular motion enables the general acid catalyst to obtain a proton from the bulk solvent and deliver it to the glycosidic oxygen.

Possible cleavage sites of glutelin partial degradation confirmed by immunological analysis in globulin-less mutants of rice (Oryza sativa L.).

PubMed

Khan, Nadar; Yamaguchi, Satoru; Katsube-Tanaka, Tomoyuki

2017-10-01

Proteolytic cleavage or partial degradation of proteins is one of the important post-translational modifications for various biological processes, but it is difficult to analyze. Previously, we demonstrated that some subunits of the major rice (Oryza sativa L.) seed storage protein glutelin are partially degraded to produce newly identified polypeptides X1-X5 in mutants in which another major seed storage protein globulin is absent. In this study, the new polypeptides X3 and X4/X5 were immunologically confirmed to be derived from GluA3 and GluA1/GluA2 subunits, respectively. Additionally, the new polypeptides X1 and X2 were at least in part the α polypeptides of the GluB4 subunit partially degraded at the C-terminus. Simulated 2D-PAGE migration patterns of intact and partially degraded α polypeptides based on the calculation of their MWs and pIs enabled us to narrow or predict the possible locations of cleavage sites. The predicted cleavage sites were also verified by the comparison of 2D-PAGE patterns between seed-extracted and E. coli-expressed proteins of the intact and truncated α polypeptides. The results and methodologies demonstrated here would be useful for analyses of partial degradation of proteins and the structure-function relationships of rice seed protein bodies. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Direct determination of protonation states and visualization of hydrogen bonding in a glycoside hydrolase with neutron crystallography

PubMed Central

Wan, Qun; Parks, Jerry M.; Hanson, B. Leif; Fisher, Suzanne Zoe; Ostermann, Andreas; Schrader, Tobias E.; Graham, David E.; Coates, Leighton; Langan, Paul; Kovalevsky, Andrey

2015-01-01

Glycoside hydrolase (GH) enzymes apply acid/base chemistry to catalyze the decomposition of complex carbohydrates. These ubiquitous enzymes accept protons from solvent and donate them to substrates at close to neutral pH by modulating the pKa values of key side chains during catalysis. However, it is not known how the catalytic acid residue acquires a proton and transfers it efficiently to the substrate. To better understand GH chemistry, we used macromolecular neutron crystallography to directly determine protonation and ionization states of the active site residues of a family 11 GH at multiple pD (pD = pH + 0.4) values. The general acid glutamate (Glu) cycles between two conformations, upward and downward, but is protonated only in the downward orientation. We performed continuum electrostatics calculations to estimate the pKa values of the catalytic Glu residues in both the apo- and substrate-bound states of the enzyme. The calculated pKa of the Glu increases substantially when the side chain moves down. The energy barrier required to rotate the catalytic Glu residue back to the upward conformation, where it can protonate the glycosidic oxygen of the substrate, is 4.3 kcal/mol according to free energy simulations. These findings shed light on the initial stage of the glycoside hydrolysis reaction in which molecular motion enables the general acid catalyst to obtain a proton from the bulk solvent and deliver it to the glycosidic oxygen. PMID:26392527

Direct determination of protonation states and visualization of hydrogen bonding in a glycoside hydrolase with neutron crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wan, Qun; Parks, Jerry M.; Hanson, B. Leif

Glycoside hydrolase (GH) enzymes apply acid/base chemistry to catalyze the decomposition of complex carbohydrates. These ubiquitous enzymes accept protons from solvent and donate them to substrates at close to neutral pH by modulating the pK a values of key side chains during catalysis. However, it is not known how the catalytic acid residue acquires a proton and transfers it efficiently to the substrate. To better understand GH chemistry, we used macromolecular neutron crystallography to directly determine protonation and ionization states of the active site residues of a family 11 GH at multiple pD (pD = pH + 0.4) values. Themore » general acid glutamate (Glu) cycles between two conformations, upward and downward, but is protonated only in the downward orientation. We performed continuum electrostatics calculations to estimate the pK a values of the catalytic Glu residues in both the apo- and substrate-bound states of the enzyme. The calculated pK a of the Glu increases substantially when the side chain moves down. The energy barrier required to rotate the catalytic Glu residue back to the upward conformation, where it can protonate the glycosidic oxygen of the substrate, is 4.3 kcal/mol according to free energy simulations. Lastly, these findings shed light on the initial stage of the glycoside hydrolysis reaction in which molecular motion enables the general acid catalyst to obtain a proton from the bulk solvent and deliver it to the glycosidic oxygen.« less

Direct determination of protonation states and visualization of hydrogen bonding in a glycoside hydrolase with neutron crystallography

DOE PAGES

Wan, Qun; Parks, Jerry M.; Hanson, B. Leif; ...

2015-09-21

Glycoside hydrolase (GH) enzymes apply acid/base chemistry to catalyze the decomposition of complex carbohydrates. These ubiquitous enzymes accept protons from solvent and donate them to substrates at close to neutral pH by modulating the pK a values of key side chains during catalysis. However, it is not known how the catalytic acid residue acquires a proton and transfers it efficiently to the substrate. To better understand GH chemistry, we used macromolecular neutron crystallography to directly determine protonation and ionization states of the active site residues of a family 11 GH at multiple pD (pD = pH + 0.4) values. Themore » general acid glutamate (Glu) cycles between two conformations, upward and downward, but is protonated only in the downward orientation. We performed continuum electrostatics calculations to estimate the pK a values of the catalytic Glu residues in both the apo- and substrate-bound states of the enzyme. The calculated pK a of the Glu increases substantially when the side chain moves down. The energy barrier required to rotate the catalytic Glu residue back to the upward conformation, where it can protonate the glycosidic oxygen of the substrate, is 4.3 kcal/mol according to free energy simulations. Lastly, these findings shed light on the initial stage of the glycoside hydrolysis reaction in which molecular motion enables the general acid catalyst to obtain a proton from the bulk solvent and deliver it to the glycosidic oxygen.« less

BIOLOGICAL TREATMENT, EFFLUENT REUSE, AND SLUDGE HANDLING FOR THE SIDE LEATHER TANNING INDUSTRY

EPA Science Inventory

An evaluation of the treatability of unsegregated, unequalized, and unneutralized wastewaters from a side-leather tanning industry utilizing the hair pulping process by primary and secondary biological and gravity separation in clarifier-thickeners, whereas the secondary treatmen...

24 CFR 3280.304 - Materials.

Code of Federal Regulations, 2012 CFR

2012-04-01

...—Structural Glued Laminated Timber—ANSI/AITC A190.1-1992. Construction and Industrial Plywood (With Typical... shall comply with these requirements. (3) Engineering analysis and testing methods contained in these references shall be utilized to judge conformance with accepted engineering practices required in § 3280.303...

24 CFR 3280.304 - Materials.

Code of Federal Regulations, 2011 CFR

2011-04-01

...—Structural Glued Laminated Timber—ANSI/AITC A190.1-1992. Construction and Industrial Plywood (With Typical... shall comply with these requirements. (3) Engineering analysis and testing methods contained in these references shall be utilized to judge conformance with accepted engineering practices required in § 3280.303...

Effect of different exposed lights on quercetin and quercetin glucoside content in onion (Allium cepa L.)

PubMed Central

Ko, Eun Young; Nile, Shivraj Hariram; Sharma, Kavita; Li, Guan Hao; Park, Se Won

2014-01-01

Quercetin and quercetin glucosides are the major flavonols present in onion (Allium cepa L.) and are predominantly present as quercetin, quercetin-3,4′-diglucoside and quercetin-4′-glucoside. Effect of different light wavelengths on onion after harvest and storage, with fluorescent, blue, red and ultra violet light influenced the quercetin and quercetin glucosides profile. In a peeled onion, all the light treatments elevated quercetin content in bulb. Among them, particularly fluorescent light effect was more eminent which stimulates the maximum synthesis of quercetin in onion. In case of whole onion bulb, skin and pulp showed different responses to light treatment, respectively. The pulp had the highest quercetin glucosides under blue light, whereas the lowest under fluorescent light. Onion skin showed nearly opposite pattern as compared to the pulp. In particular, light treatment proved to be a better way to increase the level of quercetin content in onions which might be utilized for industrial production of bioactive compounds from onion and onion waste products. PMID:26150744

Effect of different exposed lights on quercetin and quercetin glucoside content in onion (Allium cepa L.).

PubMed

Ko, Eun Young; Nile, Shivraj Hariram; Sharma, Kavita; Li, Guan Hao; Park, Se Won

2015-07-01

Quercetin and quercetin glucosides are the major flavonols present in onion (Allium cepa L.) and are predominantly present as quercetin, quercetin-3,4'-diglucoside and quercetin-4'-glucoside. Effect of different light wavelengths on onion after harvest and storage, with fluorescent, blue, red and ultra violet light influenced the quercetin and quercetin glucosides profile. In a peeled onion, all the light treatments elevated quercetin content in bulb. Among them, particularly fluorescent light effect was more eminent which stimulates the maximum synthesis of quercetin in onion. In case of whole onion bulb, skin and pulp showed different responses to light treatment, respectively. The pulp had the highest quercetin glucosides under blue light, whereas the lowest under fluorescent light. Onion skin showed nearly opposite pattern as compared to the pulp. In particular, light treatment proved to be a better way to increase the level of quercetin content in onions which might be utilized for industrial production of bioactive compounds from onion and onion waste products.

A combined acidification/PEO flocculation process to improve the lignin removal from the pre-hydrolysis liquor of kraft-based dissolving pulp production process.

PubMed

Shi, Haiqiang; Fatehi, Pedram; Xiao, Huining; Ni, Yonghao

2011-04-01

The presence of lignin impairs the utilization of the hemicelluloses dissolved in the pre-hydrolysis liquor (PHL) of the kraft-based dissolving pulp production process. In this paper, a novel process was developed by combining the acidification and poly ethylene oxide (PEO) flocculation concepts to improve the lignin removal. The results showed that the lignin removal was improved by the addition of PEO to the acidified PHL, particularly at a low pH of 1.5. The main mechanisms involved are the lignin/PEO complex formation and the bridging of the formed complexes. This hypothesis was supported by the turbidity, FTIR and particle size measurements. Interestingly, the hemicelluloses removal from the acidification/PEO flocculation was marginal, which would be beneficial for the down-stream ethanol production from the PHL. Additionally, a process flow diagram was proposed that incorporates this new concept into the existing configuration of kraft-based dissolving pulp production process. Copyright © 2011 Elsevier Ltd. All rights reserved.

Murine study of portal hypertension associated endothelin-1 hypo-response.

PubMed

Theodorakis, Nicholas; Maluccio, Mary; Skill, Nicholas

2015-04-28

To investigate endothelin-1 hypo-responsive associated with portal hypertension in order to improve patient treatment outcomes. Wild type, eNOS(-/-) and iNOS(-/-) mice received partial portal vein ligation surgery to induce portal hypertension or sham surgery. Development of portal hypertension was determined by measuring the splenic pulp pressure, abdominal aortic flow and portal systemic shunting. To measure splenic pulp pressure, a microtip pressure transducer was inserted into the spleen pulp. Abdominal aortic flow was measured by placing an ultrasonic Doppler flow probe around the abdominal aorta between the diaphragm and celiac artery. Portal systemic shunting was calculated by injection of fluorescent microspheres in to the splenic vein and determining the percentage accumulation of spheres in liver and pulmonary beds. Endothelin-1 hypo-response was evaluated by measuring the change in abdominal aortic flow in response to endothelin-1 intravenous administration. In addition, thoracic aorta endothelin-1 contraction was measured in 5 mm isolated thoracic aorta rings ex-vivo using an ADI small vessel myograph. In wild type and iNOS(-/-) mice splenic pulp pressure increased from 7.5 ± 1.1 mmHg and 7.2 ± 1 mmHg to 25.4 ± 3.1 mmHg and 22 ± 4 mmHg respectively. In eNOS(-/-) mice splenic pulp pressure was increased after 1 d (P = NS), after which it decreased and by 7 d was not significantly elevated when compared to 7 d sham operated controls (6.9 ± 0.6 mmHg and 7.3 ± 0.8 mmHg respectively, P = 0.3). Abdominal aortic flow was increased by 80% and 73% in 7 d portal vein ligated wild type and iNOS when compared to shams, whereas there was no significant difference in 7 d portal vein ligated eNOS(-/-) mice when compared to shams. Endothelin-1 induced a rapid reduction in abdominal aortic blood flow in wild type, eNOS(-/-) and iNOS(-/-) sham mice (50% ± 8%, 73% ± 9% and 47% ± 9% respectively). Following portal vein ligation endothelin-1 reduction in blood flow was significantly diminished in each mouse group. Abdominal aortic flow was reduced by 19% ± 9%, 32% ± 10% and 9% ± 9% in wild type, eNOS(-/-) and iNOS(-/-) mice respectively. Aberrant endothelin-1 response in murine portal hypertension is NOS isoform independent. Moreover, portal hypertension in the portal vein ligation model is independent of ET-1 function.

Roles of Fragile X Mental Retardation Protein in Dopaminergic Stimulation-induced Synapse-associated Protein Synthesis and Subsequent α-Amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) Receptor Internalization*

PubMed Central

Wang, Hansen; Kim, Susan S.; Zhuo, Min

2010-01-01

Fragile X syndrome, the most common form of inherited mental retardation, is caused by the absence of the RNA-binding protein fragile X mental retardation protein (FMRP). FMRP regulates local protein synthesis in dendritic spines. Dopamine (DA) is involved in the modulation of synaptic plasticity. Activation of DA receptors can regulate higher brain functions in a protein synthesis-dependent manner. Our recent study has shown that FMRP acts as a key messenger for DA modulation in forebrain neurons. Here, we demonstrate that FMRP is critical for DA D1 receptor-mediated synthesis of synapse-associated protein 90/PSD-95-associated protein 3 (SAPAP3) in the prefrontal cortex (PFC). DA D1 receptor stimulation induced dynamic changes of FMRP phosphorylation. The changes in FMRP phosphorylation temporally correspond with the expression of SAPAP3 after D1 receptor stimulation. Protein phosphatase 2A, ribosomal protein S6 kinase, and mammalian target of rapamycin are the key signaling molecules for FMRP linking DA D1 receptors to SAPAP3. Knockdown of SAPAP3 did not affect surface expression of α-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) GluR1 receptors induced by D1 receptor activation but impaired their subsequent internalization in cultured PFC neurons; the subsequent internalization of GluR1 was also impaired in Fmr1 knock-out PFC neurons, suggesting that FMRP may be involved in subsequent internalization of GluR1 through regulating the abundance of SAPAP3 after DA D1 receptor stimulation. Our study thus provides further insights into FMRP involvement in DA modulation and may help to reveal the molecular mechanisms underlying impaired learning and memory in fragile X syndrome. PMID:20457613

Roles of fragile X mental retardation protein in dopaminergic stimulation-induced synapse-associated protein synthesis and subsequent alpha-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) receptor internalization.

PubMed

Wang, Hansen; Kim, Susan S; Zhuo, Min

2010-07-09

Fragile X syndrome, the most common form of inherited mental retardation, is caused by the absence of the RNA-binding protein fragile X mental retardation protein (FMRP). FMRP regulates local protein synthesis in dendritic spines. Dopamine (DA) is involved in the modulation of synaptic plasticity. Activation of DA receptors can regulate higher brain functions in a protein synthesis-dependent manner. Our recent study has shown that FMRP acts as a key messenger for DA modulation in forebrain neurons. Here, we demonstrate that FMRP is critical for DA D1 receptor-mediated synthesis of synapse-associated protein 90/PSD-95-associated protein 3 (SAPAP3) in the prefrontal cortex (PFC). DA D1 receptor stimulation induced dynamic changes of FMRP phosphorylation. The changes in FMRP phosphorylation temporally correspond with the expression of SAPAP3 after D1 receptor stimulation. Protein phosphatase 2A, ribosomal protein S6 kinase, and mammalian target of rapamycin are the key signaling molecules for FMRP linking DA D1 receptors to SAPAP3. Knockdown of SAPAP3 did not affect surface expression of alpha-amino-3-hydroxyl-5-methyl-4-isoxazole-4-propionate (AMPA) GluR1 receptors induced by D1 receptor activation but impaired their subsequent internalization in cultured PFC neurons; the subsequent internalization of GluR1 was also impaired in Fmr1 knock-out PFC neurons, suggesting that FMRP may be involved in subsequent internalization of GluR1 through regulating the abundance of SAPAP3 after DA D1 receptor stimulation. Our study thus provides further insights into FMRP involvement in DA modulation and may help to reveal the molecular mechanisms underlying impaired learning and memory in fragile X syndrome.

Disease-associated missense mutations in GluN2B subunit alter NMDA receptor ligand binding and ion channel properties.

PubMed

Fedele, Laura; Newcombe, Joseph; Topf, Maya; Gibb, Alasdair; Harvey, Robert J; Smart, Trevor G

2018-03-06

Genetic and bioinformatic analyses have identified missense mutations in GRIN2B encoding the NMDA receptor GluN2B subunit in autism, intellectual disability, Lennox Gastaut and West Syndromes. Here, we investigated several such mutations using a near-complete, hybrid 3D model of the human NMDAR and studied their consequences with kinetic modelling and electrophysiology. The mutants revealed reductions in glutamate potency; increased receptor desensitisation; and ablation of voltage-dependent Mg 2+ block. In addition, we provide new views on Mg 2+ and NMDA channel blocker binding sites. We demonstrate that these mutants have significant impact on excitatory transmission in developing neurons, revealing profound changes that could underlie their associated neurological disorders. Of note, the NMDAR channel mutant GluN2B V618G unusually allowed Mg 2+ permeation, whereas nearby N615I reduced Ca 2+ permeability. By identifying the binding site for an NMDAR antagonist that is used in the clinic to rescue gain-of-function phenotypes, we show that drug binding may be modified by some GluN2B disease-causing mutations.

Intrinsic motions in the N-terminal domain of an ionotropic glutamate receptor detected by fluorescence correlation spectroscopy.

PubMed

Jensen, Mette H; Sukumaran, Madhav; Johnson, Christopher M; Greger, Ingo H; Neuweiler, Hannes

2011-11-18

Ionotropic glutamate receptors (iGluRs) mediate excitatory neurotransmission in the central nervous system and play key roles in brain development and disease. iGluRs have two distinct extracellular domains, but the functional role of the distal N-terminal domain (NTD) is poorly understood. Crystal structures of the NTD from some non-N-methyl-d-aspartate (NMDA) iGluRs are consistent with a rigid body that facilitates receptor assembly but suggest an additional dynamic role that could modulate signaling. Here, we moved beyond spatial and temporal limitations of conventional protein single-molecule spectroscopy by employing correlation analysis of extrinsic oxazine fluorescence fluctuations. We observed nanosecond (ns)-to-microsecond (μs) motions of loop segments and helices within a region of an AMPA-type iGluR NTD, which has been identified previously to be structurally variable. Our data reveal that the AMPA receptor NTD undergoes rapid conformational fluctuations, suggesting an inherent allosteric capacity for this domain in addition to its established assembly function. Copyright © 2011 Elsevier Ltd. All rights reserved.

Evaluation of 11C-Me-NB1 as a Potential PET Radioligand for Measuring GluN2B-Containing NMDA Receptors, Drug Occupancy, and Receptor Cross Talk.

PubMed

Krämer, Stefanie D; Betzel, Thomas; Mu, Linjing; Haider, Ahmed; Herde, Adrienne Müller; Boninsegni, Anna K; Keller, Claudia; Szermerski, Marina; Schibli, Roger; Wünsch, Bernhard; Ametamey, Simon M

2018-04-01

Clinical and preclinical research with modulators at the N -methyl-d-aspartate (NMDA) receptor GluN2B N-terminal domain (NTD) aims for the treatment of various neurologic diseases. The interpretation of the results is hampered by the lack of a suitable NMDA PET tracer for assessing the receptor occupancy of potential drugs. We have developed 11 C-Me-NB1 as a PET tracer for imaging GluN1/GluN2B-containing NMDA receptors and used it to investigate in rats the dose-dependent receptor occupancy of eliprodil, a GluN2B NTD modulator. Methods: 11 C-Me-NB1 was synthesized and characterized by in vitro displacement binding experiments with rat brain membranes, in vitro autoradiography, and blocking and displacement experiments by PET and PET kinetic modeling. Receptor occupancy by eliprodil was studied by PET with 11 C-Me-NB1. Results: 11 C-Me-NB1 was synthesized at 290 ± 90 GBq/μmol molar activity, 7.4 ± 1.9 GBq total activity at the end of synthesis ( n = 17), and more than 99% radiochemical purity. 11 C-Me-NB1 binding in rat brain was blocked in vitro and in vivo by the NTD modulators Ro-25-6981 and eliprodil. Half-maximal receptor occupancy by eliprodil occurred at 1.5 μg/kg. At 1 mg/kg of eliprodil, a dose with reported neuroprotective effects, more than 99.5% of binding sites were occupied. In vitro, 11 C-Me-NB1 binding was independent of the σ-1 receptor (Sigma1R), and the Sigma1R agonist (+)-pentazocine did not compete for high-affinity binding. In vivo, a 2.5 mg/kg dose of (+)-pentazocine abolished 11 C-Me-NB1-specific binding, indicating an indirect effect of Sigma1R on 11 C-Me-NB1 binding. Conclusion: 11 C-Me-NB1 is suitable for the in vivo imaging of NMDA GluN1/GluN2B receptors and the assessment of receptor occupancy by NTD modulators. GluN1/GluN2B NMDA receptors are fully occupied at neuroprotective doses of eliprodil. Furthermore, 11 C-Me-NB1 enables imaging of GluN1/GluN2B NMDA receptor cross talk. © 2018 by the Society of Nuclear Medicine and Molecular Imaging.

Rational redesign of a cation···π···π stacking at cardiovascular Fbw7-Skp1 complex interface and its application for deriving self-inhibitory peptides to disrupt the complex interaction.

PubMed

Zhou, Jing; Wang, Yao-Sheng

2017-09-26

The Fbw7-Skp1 complex is an essential component in the formation and development of the mammalian cardiovascular system; the complex interaction is mediated through binding of Skp1 C-terminal peptide (qGlu-peptide) to the F-box domain of Fbw7. By visually examining the crystal structure, we identified a typical cation ···π···π stacking system at the complex interface, which is formed by the Trp1159 residue of qGlu-peptide with the Lys2299 and His2359 residues of Fbw7 F-box domain. Both hybrid quantum mechanics/molecular mechanics (QM/MM) analysis of the real domain-peptide complex and electron-correlation ab initio calculation of the stacking system model suggested that the cation···π···π plays an important role in stabilizing the complex; substitution of peptide Trp1159 residue with aromatic Phe and Tyr would not cause a considerable effect on the configuration and energetics of cation···π···π stacking system, whereas His substitution seems to largely destabilize the system. Subsequently, the qGlu-peptide was stripped from the full-length Skp1 protein to define a so-called self-inhibitory peptide, which may rebind to the domain-peptide complex interface and thus disrupt the complex interaction. Fluorescence polarization (FP) assays revealed that the Trp1159Phe and Trp1159Tyr variants have a comparable or higher affinity (K d  = 41 and 62 μM) than the wild-type qGlu-peptide (K d  = 56 μM), while the Trp1159His mutation would largely impair the binding potency of qGlu-peptide to Fbw7 F-box domain (K d  = 280 μM), confirming that the cation···π···π confers both affinity and specificity to the domain-peptide recognition, which can be reshaped by rational molecular design of the nonbonded interaction system. Graphical abstract Stereoview of the complex structure of Fbw7 with Skp1 (PDB: 2ovp), where the Trp1159 residue of Skp1 qGlu-peptide can form a cation···π···π stacking system with the Lys2299 and His2359 residues of Fbw7 F-box domain.

Gluing interface qualification test results and gluing process development of the EUCLID near-infrared spectro-photometer optical assembly

NASA Astrophysics Data System (ADS)

Mottaghibonab, A.; Thiele, H.; Gubbini, E.; Dubowy, M.; Gal, C.; Mecsaci, A.; Gawlik, K.; Vongehr, M.; Grupp, F.; Penka, D.; Wimmer, C.; Bender, R.

2016-07-01

The Near Infrared Spectro-Photometer Optical assembly (NIOA) of EUCLID satellite requires high precision large lens holders with different lens materials, shapes and diameters. The aspherical lenses are glued into their separate CTE matched lens holder. The gluing of the lenses in their holder with 2K epoxy is selected as bonding process to minimize the stress in the lenses to achieve the required surface form error (SFE) performance (32nm) and lens position stability (+/-10μm) due to glue shrinkage. Adhesive shrinkage stress occurs during the glue curing at room temperature and operation in cryogenic temperatures, which might overstress the lens, cause performance loss, lens breakage or failure of the gluing interface. The selection of the suitable glue and required bonding parameters, design and qualification of the gluing interface, development and verification of the gluing process was a great challenge because of the low TRL and heritage of the bonding technology. The different material combinations (CaF2 to SS316L, LF5G15 and S-FTM16 to Titanium, SUPRASIL3001 to Invar M93), large diameter (168mm) and thin edge of the lenses, cryogenic nonoperational temperature (100K) and high performance accuracy of the lenses were the main design driver of the development. The different coefficients of thermal expansion (CTE) between lens and lens holder produce large local mechanical stress. As hygroscopic crystal calcium fluoride (CaF2) is very sensitive to moisture therefore an additional surface treatment of the gluing area is necessary. Extensive tests e.g glue handling and single lap shear tests are performed to select the suitable adhesive. Interface connection tests are performed to verify the feasibility of selected design (double pad design), injection channel, the roughness and treatment of the metal and lens interfaces, glue thickness, glue pad diameter and the gluing process. CTE and dynamic measurements of the glue, thermal cycling, damp- heat, connection shear and tension tests with all material combinations at RT and 100K are carried out to qualify the gluing interface. The gluing interface of the glued lenses in their mounts is also qualified with thermal cycling, 3D coordinate measurements before and after environmental tests, Polarimetry and vibration test of the lens assemblies. A multi-function double pad gluing tool and lens mounting tool is designed, manufactured and verified to meet the lens positioning and alignment performance of the lens in the holder which provides the possibility to glue lenses, filters, mirrors with different diameters, shapes and thickness with +/-10μm accuracy in plane, out of plane and +/-10 arcsec in tip/tilt with respect to the lens holder interface. The paper presents the glue interface qualification results, the qualification/verification methods, the developed ground support equipment and the gluing process of the EUCLID high precision large cryogenic lens mounts. Test results achieved in the test campaign demonstrate the suitability of the selected adhesive, glue pad design, interface parameters and the processes for the precise gluing of the lenses in lens holders for all lenses. The qualification models of the NIOA are successfully glued and qualified. The developed process can also be used for other glass materials e.g. MaF2 and optical black coated metallic surfaces.

Gene expression of ionotropic glutamate receptor subunits in the tectofugal pathway of the pigeon.

PubMed

Atoji, Y

2016-03-01

The tectofugal pathway in birds consists of four stations, the retina, optic tectum, rotundal nucleus, and entopallium, and it conveys visual information via three ascending pathways. These pathways consist of retino-tectal, tecto-rotundal and rotundo-entopallial cells, all of which are glutamatergic. The present study examined the localization of ionotropic glutamate receptors (iGluRs) to identify the target areas of glutamatergic projections in the tectofugal pathway in pigeons. Nine subunits of iGluRs were analyzed using in situ hybridization as follows: AMPA receptors (GluA1, GluA2, GluA3, and GluA4), kainate receptors (GluK1, GluK2, and GluK4), and NMDA receptors (GluN1 and GluN2A). Hybridization signals of subunits showed various intensities in different cells. In the optic tectum, a strong to moderate expression was observed in layer 10 (GluA2, GluA3, GluK4, and GluN1) and layer 13 (GluA2, GluK4, GluN1, and GluN2A). The rotundal nucleus intensely expressed GluA3, GluA4, GluK1, and GluK4. In the entopallium, an intense to moderate expression of GluK1 and GluK4, and a moderate to weak expression of AMPA and NMDA receptors were observed. Furthermore, the parvocellular and magnocellular parts of the isthmic nuclei showed a strong expression of GluA2, GluA3, GluK4, and GluN1. The present findings demonstrate the expression of iGluRs in glutamatergic projection targets of the tectofugal pathway in birds and suggest a diversity of iGluRs in the transmission of visual information. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

Vesicular glutamate release from central axons contributes to myelin damage.

PubMed

Doyle, Sean; Hansen, Daniel Bloch; Vella, Jasmine; Bond, Peter; Harper, Glenn; Zammit, Christian; Valentino, Mario; Fern, Robert

2018-03-12

The axon myelin sheath is prone to injury associated with N-methyl-D-aspartate (NMDA)-type glutamate receptor activation but the source of glutamate in this context is unknown. Myelin damage results in permanent action potential loss and severe functional deficit in the white matter of the CNS, for example in ischemic stroke. Here, we show that in rats and mice, ischemic conditions trigger activation of myelinic NMDA receptors incorporating GluN2C/D subunits following release of axonal vesicular glutamate into the peri-axonal space under the myelin sheath. Glial sources of glutamate such as reverse transport did not contribute significantly to this phenomenon. We demonstrate selective myelin uptake and retention of a GluN2C/D NMDA receptor negative allosteric modulator that shields myelin from ischemic injury. The findings potentially support a rational approach toward a low-impact prophylactic therapy to protect patients at risk of stroke and other forms of excitotoxic injury.

Low Mass MS/MS Fragments of Protonated Amino Acids Used for Distinction of Their 13C- Isotopomers in Metabolic Studies

NASA Astrophysics Data System (ADS)

Ma, Xin; Dagan, Shai; Somogyi, Árpád; Wysocki, Vicki H.; Scaraffia, Patricia Y.

2013-04-01

Glu, Gln, Pro, and Ala are the main amino acids involved in ammonia detoxification in mosquitoes. In order to develop a tandem mass spectrometry method (MS2) to monitor each carbon of the above isotopically-labeled 13C-amino acids for metabolic studies, the compositions and origins of atoms in fragments of the protonated amino acid should be first elucidated. Thus, various electrospray (ESI)-based MS2 tools were employed to study the fragmentation of these unlabeled and isotopically-labeled amino acids and better understand their dissociation pathways. A broad range of fragments, including previously-undescribed low m/z fragments was revealed. The formulae of the fragments (from m/z 130 down to m/z 27) were confirmed by their accurate masses. The structures and conformations of the larger fragments of Glu were also explored by ion mobility mass spectrometry (IM-MS) and gas-phase hydrogen/deuterium exchange (HDX) experiments. It was found that some low m/z fragments ( m/z 27-30) are common to Glu, Gln, Pro, and Ala. The origins of carbons in these small fragments are discussed and additional collision induced dissociation (CID) MS2 fragmentation pathways are proposed for them. It was also found that small fragments (≤ m/z 84) of protonated, methylated Glu, and methylated Gln are the same as those of the underivatized Glu and Gln. Taken together, the new approach of utilizing low m/z fragments can be applied to distinguish, identify, and quantify 13C-amino acids labeled at various positions, either in the backbone or side chain.

The Role of Polyphenoloxidase, Peroxidase, and β-Glucosidase in Phenolics Accumulation in Olea europaea L. Fruits under Different Water Regimes

PubMed Central

Cirilli, Marco; Caruso, Giovanni; Gennai, Clizia; Urbani, Stefania; Frioni, Eleonora; Ruzzi, Maurizio; Servili, Maurizio; Gucci, Riccardo; Poerio, Elia; Muleo, Rosario

2017-01-01

Olive fruits and oils contain an array of compounds that contribute to their sensory and nutritional properties. Phenolic compounds in virgin oil and olive-derived products have been proven to be highly beneficial for human health, eliciting increasing attention from the food industry and consumers. Although phenolic compounds in olive fruit and oil have been extensively investigated, allowing the identification of the main classes of metabolites and their accumulation patterns, knowledge of the molecular and biochemical mechanisms regulating phenolic metabolism remains scarce. We focused on the role of polyphenoloxidase (PPO), peroxidase (PRX) and β-glucosidase (β-GLU) gene families and their enzyme activities in the accumulation of phenolic compounds during olive fruit development (35–146 days after full bloom), under either full irrigation (FI) or rain-fed (RF) conditions. The irrigation regime affected yield, maturation index, mesocarp oil content, fruit size, and pulp-to-pit ratio. Accumulation of fruit phenolics was higher in RF drupes than in FI ones. Members of each gene family were developmentally regulated, affected by water regime, and their transcript levels were correlated with the respective enzyme activities. During the early phase of drupe growth (35–43 days after full bloom), phenolic composition appeared to be linked to β-GLU and PRX activities, probably through their effects on oleuropein catabolism. Interestingly, a higher β-GLU activity was measured in immature RF drupes, as well as a higher content of the oleuropein derivate 3,4-DHPEA-EDA and verbascoside. Activity of PPO enzymes was slightly affected by the water status of trees during ripening (from 120 days after full bloom), but was not correlated with phenolics content. Overall, the main changes in phenolics content appeared soon after the supply of irrigation water and remained thereafter almost unchanged until maturity, despite fruit growth and the progressive decrease in pre-dawn leaf water potential. We suggest that enzymes involved in phenolic catabolism in the olive fruit have a differential sensitivity to soil water availability depending on fruit developmental stage. PMID:28536589

Biochemical characterisation of the chlamydial MurF ligase, and possible sequence of the chlamydial peptidoglycan pentapeptide stem.

PubMed

Patin, Delphine; Bostock, Julieanne; Chopra, Ian; Mengin-Lecreulx, Dominique; Blanot, Didier

2012-06-01

Chlamydiaceae are obligate intracellular bacteria that do not synthesise detectable peptidoglycan although they possess an almost complete arsenal of genes encoding peptidoglycan biosynthetic activities. In this paper, the murF gene from Chlamydia trachomatis was shown to be capable of complementing a conditional Escherichia coli mutant impaired in UDP-MurNAc-tripeptide:D-Ala-D-Ala ligase activity. Recombinant MurF from C. trachomatis was overproduced and purified from E. coli. It exhibited ATP-dependent UDP-MurNAc-X-γ-D-Glu-meso-A(2)pm:D-Ala-D-Ala ligase activity in vitro. No significant difference of kinetic parameters was seen when X was L-Ala, L-Ser or Gly. The L-Lys-containing UDP-MurNAc-tripeptide was a poorer substrate as compared to the meso-A(2)pm-containing one. Based on the respective substrate specificities of the chlamydial MurC, MurE, MurF and Ddl enzymes, a sequence L-Ala/L-Ser/Gly-γ-D-Glu-meso-A(2)pm-D-Ala-D-Ala is expected for the chlamydial pentapeptide stem, with Gly at position 1 being less likely.

Hematopoietic Stem Cells as a Novel Source of Dental Tissue Cells.

PubMed

Wilson, Katie R; Kang, In-Hong; Baliga, Uday; Xiong, Ying; Chatterjee, Shilpak; Moore, Emily; Parthiban, Beneta; Thyagarajan, Krishnamurthy; Borke, James L; Mehrotra, Shikhar; Kirkwood, Keith L; LaRue, Amanda C; Ogawa, Makio; Mehrotra, Meenal

2018-05-23

While earlier studies have suggested that cells positive for hematopoietic markers can be found in dental tissues, it has yet to be confirmed. To conclusively demonstrate this, we utilized a unique transgenic model in which all hematopoietic cells are green fluorescent protein + (GFP + ). Pulp, periodontal ligament (PDL) and alveolar bone (AvB) cell culture analysis demonstrated numerous GFP + cells, which were also CD45 + (indicating hematopoietic origin) and co-expressed markers of cellular populations in pulp (dentin matrix protein-1, dentin sialophosphoprotein, alpha smooth muscle actin [ASMA], osteocalcin), in PDL (periostin, ASMA, vimentin, osteocalcin) and in AvB (Runx-2, bone sialoprotein, alkaline phosphatase, osteocalcin). Transplantation of clonal population derived from a single GFP + hematopoietic stem cell (HSC), into lethally irradiated recipient mice, demonstrated numerous GFP + cells within dental tissues of recipient mice, which also stained for markers of cell populations in pulp, PDL and AvB (used above), indicating that transplanted HSCs can differentiate into cells in dental tissues. These hematopoietic-derived cells deposited collagen and can differentiate in osteogenic media, indicating that they are functional. Thus, our studies demonstrate, for the first time, that cells in pulp, PDL and AvB can have a hematopoietic origin, thereby opening new avenues of therapy for dental diseases and injuries.

Photoacoustic microscopy of human teeth

NASA Astrophysics Data System (ADS)

Rao, Bin; Cai, Xin; Favazza, Christopher; Yao, Junjie; Li, Li; Duong, Steven; Liaw, Lih-Huei; Holtzman, Jennifer; Wilder-Smith, Petra; Wang, Lihong V.

2011-03-01

Photoacoustic microscopy (PAM) utilizes short laser pulses to deposit energy into light absorbers and sensitively detects the ultrasonic waves the absorbers generate in response. PAM directly renders a three-dimensional spatial distribution of sub-surface optical absorbers. Unlike other optical imaging technologies, PAM features label-free optical absorption contrast and excellent imaging depths. Standard dental imaging instruments are limited to X-ray and CCD cameras. Subsurface optical dental imaging is difficult due to the highly-scattering enamel and dentin tissue. Thus, very few imaging methods can detect dental decay or diagnose dental pulp, which is the innermost part of the tooth, containing the nerves, blood vessels, and other cells. Here, we conducted a feasibility study on imaging dental decay and dental pulp with PAM. Our results showed that PAM is sensitive to the color change associated with dental decay. Although the relative PA signal distribution may be affected by surface contours and subsurface reflections from deeper dental tissue, monitoring changes in the PA signals (at the same site) over time is necessary to identify the progress of dental decay. Our results also showed that deep-imaging, near-infrared (NIR) PAM can sensitively image blood in the dental pulp of an in vitro tooth. In conclusion, PAM is a promising tool for imaging both dental decay and dental pulp.

Efficient exfoliation of layered materials by waste liquor

NASA Astrophysics Data System (ADS)

Ding, Jiheng; Zhao, Hongran; Zheng, Yan; Wang, Qiaolei; Chen, Hao; Dou, Huimin; Yu, Haibin

2018-03-01

Based on their unique material properties, two-dimensional (2D) nanomaterials such as graphene, molybdenum disulfide (MoS2), and boron nitride (BN) have been attracting increased research interest. The potential of 2D materials, in the form of nanoplatelets that are used as new materials, will be important to both nanomaterials and advanced materials. Water is usually considered to be the ideal dispersed medium, and the essential hydrophobicity and limitations to mass production of 2D nanoplatelets have become quite serious obstacles to their usage in various fields. In this paper, pulping black liquor was used as dispersant, with high concentration of lignin to get single- and few-layered nanoplatelets. The whole process required only the high-shear mixing of 2D layered materials and pulping waste liquor. This method was not only simple and efficient but also environmentally friendly and resource-recycling. Moreover, the fabricated single- or few-layered nanoplatelets possessed good solubility in aqueous solution due to their edge functionalization, and could be well dispersed in water at concentrations (10 mg ml-1 for graphene, 6.3 mg ml-1 for MoS2, and 6.0 mg ml-1 for BN) which were much higher than that of other methods. The dispersions of graphene, MoS2, and BN nanosheets were highly stable over several months, which allowed us to easily prepare graphene, MoS2, and BN films through simple vacuum filtration or spraying. These results indicated that pulping black liquor can be used as a material or reagent, and the mass production of 2D material is possible in a simple and fast method.

Incorporation of Monolignol Conjugates into Lignin for Improved Processing

USDA-ARS?s Scientific Manuscript database

Lignin remains one of the most significant barriers to the efficient utilization of cellulosic substrates, either for pulping or for biofuels production. Now that monomer substitution in the lignification process is now well authenticated in various transgenic plants, it is opportune to begin explor...

High-Throughput HPLC-MS/MS Method for Quantification of Ibuprofen Enantiomers in Human Plasma: Focus on Investigation of Metabolite Interference.

PubMed

Nakov, Natalija; Bogdanovska, Liljana; Acevska, Jelena; Tonic-Ribarska, Jasmina; Petkovska, Rumenka; Dimitrovska, Aneta; Kasabova, Lilia; Svinarov, Dobrin

2016-11-01

In this research, as a part of the development of fast and reliable HPLC-MS/MS method for quantification of ibuprofen (IBP) enantiomers in human plasma, the possibility of IBP acylglucoronide (IBP-Glu) back-conversion was assessed. This involved investigation of in source and in vitro back-conversion. The separation of IBP enantiomers, its metabolite and rac-IBP-d3 (internal standard), was achieved within 6 min using Chiracel OJ-RH chromatographic column (150 × 2.1 mm, 5 μm). The followed selected reaction monitoring transitions for IBP-Glu (m/z 381.4 → 205.4, m/z 381.4 → 161.4 and m/z 205.4 → 161.4) implied that under the optimized electrospray ionization parameters, in source back-conversion of IBP-Glu was insignificant. The results obtained after liquid-liquid extraction of plasma samples spiked with IBP-Glu revealed that the amount of IBP enantiomers generated by IBP-Glu back-conversion was far <20% of lower limit of quantification sample. These results indicate that the presence of IBP-Glu in real samples will not affect the quantification of the IBP enantiomers; thereby reliability of the method was improved. Additional advantage of the method is the short analysis time making it suitable for the large number of samples. The method was fully validated according to the EMA guideline and was shown to meet all requirements to be applied in a pharmacokinetic study. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Pharmacophore, QSAR, and binding mode studies of substrates of human cytochrome P450 2D6 (CYP2D6) using molecular docking and virtual mutations and an application to chinese herbal medicine screening.

PubMed

Mo, Sui-Lin; Liu, Wei-Feng; Li, Chun-Guang; Zhou, Zhi-Wei; Luo, Hai-Bin; Chew, Helen; Liang, Jun; Zhou, Shu-Feng

2012-07-01

The highly polymorphic human cytochrome P450 2D6 (CYP2D6) metabolizes about 25% of currently used drugs. In this study, we have explored the interaction of a large number of substrates (n = 120) with wild-type and mutated CYP2D6 by molecular docking using the CDOCKER module. Before we conducted the molecular docking and virtual mutations, the pharmacophore and QSAR models of CYP2D6 substrates were developed and validated. Finally, we explored the interaction of a traditional Chinese herbal formula, Fangjifuling decoction, with CYP2D6 by virtual screening. The optimized pharmacophore model derived from 20 substrates of CYP2D6 contained two hydrophobic features and one hydrogen bond acceptor feature, giving a relevance ratio of 76% when a validation set of substrates were tested. However, our QSAR models gave poor prediction of the binding affinity of substrates. Our docking study demonstrated that 117 out of 120 substrates could be docked into the active site of CYP2D6. Forty one out of 117 substrates (35.04%) formed hydrogen bonds with various active site residues of CYP2D6 and 53 (45.30%) substrates formed a strong π-π interaction with Phe120 (53/54), with only carvedilol showing π-π interaction with Phe483. The active site residues involving hydrogen bond formation with substrates included Leu213, Lys214, Glu216, Ser217, Gln244, Asp301, Ser304, Ala305, Phe483, and Phe484. Furthermore, the CDOCKER algorithm was further applied to study the impact of mutations of 28 active site residues (mostly non-conserved) of CYP2D6 on substrate binding modes using five probe substrates including bufuralol, debrisoquine, dextromethorphan, sparteine, and tramadol. All mutations of the residues examined altered the hydrogen bond formation and/or aromatic interactions, depending on the probe used in molecular docking. Apparent changes of the binding modes have been observed with the Glu216Asp and Asp301Glu mutants. Overall, 60 compounds out of 130 from Fangjifuling decoction matched our pharmacophore model for CYP2D6 substrates. Fifty four out of these 60 compounds could be docked into the active site of CYP2D6 and 24 of 54 compounds formed hydrogen bonds with Glu216, Asp301, Ser304, and Ala305 in CYP2D6. These results have provided further insights into the factors that determining the binding modes of substrates to CYP2D6. Screening of high-affinity ligands for CYP2D6 from herbal formula using computational models is a useful approach to identify potential herb-drug interactions.

Membrane Technology for the Recovery of Lignin: A Review

PubMed Central

Humpert, Daniel; Ebrahimi, Mehrdad; Czermak, Peter

2016-01-01

Utilization of renewable resources is becoming increasingly important, and only sustainable processes that convert such resources into useful products can achieve environmentally beneficial economic growth. Wastewater from the pulp and paper industry is an unutilized resource offering the potential to recover valuable products such as lignin, pigments, and water [1]. The recovery of lignin is particularly important because it has many applications, and membrane technology has been investigated as the basis of innovative recovery solutions. The concentration of lignin can be increased from 62 to 285 g∙L−1 using membranes and the recovered lignin is extremely pure. Membrane technology is also scalable and adaptable to different waste liquors from the pulp and paper industry. PMID:27608047

A comparative study of mucilage and pulp polysaccharides from tamarillo fruit (Solanum betaceum Cav.).

PubMed

do Nascimento, Georgia Erdmann; Iacomini, Marcello; Cordeiro, Lucimara M C

2016-07-01

A comparative study of mucilage (locular tissue) and pulp polysaccharides from ripe tamarillo fruits (Solanum betaceum Cav.) was carried out. After aqueous and alkaline extractions and various purification steps (freeze-thaw and α-amylase - EC 3.2.1.1 treatments, Fehling precipitation and ultrafiltration through 50 kDa cut-off membrane), the obtained fractions from mucilage were analyzed by sugar composition, HPSEC, and NMR spectroscopy analyses. The results showed that the mucilage of tamarillo contains a highly methoxylated homogalacturonans mixed with type I arabinogalactans, a linear (1 → 5)-linked α-L-arabinan, and a linear (1 → 4)-β-D-xylan. A comparison with polysaccharides extracted from the pulp revealed that differences were observed in the yield and in the ratio of extracted polysaccharides. Moreover, structural differences between pulp and mucilage polysaccharides were also observed, such as in the length of side chains of the pectins, and in the degree of branching of the xylans. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Proton transfer events in GFP.

PubMed

Di Donato, Mariangela; van Wilderen, Luuk J G W; Van Stokkum, Ivo H M; Stuart, Thomas Cohen; Kennis, John T M; Hellingwerf, Klaas J; van Grondelle, Rienk; Groot, Marie Louise

2011-09-28

Proton transfer is one of the most important elementary processes in biology. Green fluorescent protein (GFP) serves as an important model system to elucidate the mechanistic details of this reaction, because in GFP proton transfer can be induced by light absorption. Illumination initiates proton transfer through a 'proton-wire', formed by the chromophore (the proton donor), water molecule W22, Ser205 and Glu222 (the acceptor), on a picosecond time scale. To obtain a more refined view of this process, we have used a combined approach of time resolved mid-infrared spectroscopy and visible pump-dump-probe spectroscopy to resolve with atomic resolution how and how fast protons move through this wire. Our results indicate that absorption of light by GFP induces in 3 ps (10 ps in D(2)O) a shift of the equilibrium positions of all protons in the H-bonded network, leading to a partial protonation of Glu222 and to a so-called low barrier hydrogen bond (LBHB) for the chromophore's proton, giving rise to dual emission at 475 and 508 nm. This state is followed by a repositioning of the protons on the wire in 10 ps (80 ps in D(2)O), ultimately forming the fully deprotonated chromophore and protonated Glu222.

Pharmacological rescue of Ras signaling, GluA1-dependent synaptic plasticity, and learning deficits in a fragile X model.

PubMed

Lim, Chae-Seok; Hoang, Elizabeth T; Viar, Kenneth E; Stornetta, Ruth L; Scott, Michael M; Zhu, J Julius

2014-02-01

Fragile X syndrome, caused by the loss of Fmr1 gene function, is the most common form of inherited mental retardation, with no effective treatment. Using a tractable animal model, we investigated mechanisms of action of a few FDA-approved psychoactive drugs that modestly benefit the cognitive performance in fragile X patients. Here we report that compounds activating serotonin (5HT) subtype 2B receptors (5HT2B-Rs) or dopamine (DA) subtype 1-like receptors (D1-Rs) and/or those inhibiting 5HT2A-Rs or D2-Rs moderately enhance Ras-PI3K/PKB signaling input, GluA1-dependent synaptic plasticity, and learning in Fmr1 knockout mice. Unexpectedly, combinations of these 5HT and DA compounds at low doses synergistically stimulate Ras-PI3K/PKB signal transduction and GluA1-dependent synaptic plasticity and remarkably restore normal learning in Fmr1 knockout mice without causing anxiety-related side effects. These findings suggest that properly dosed and combined FDA-approved psychoactive drugs may effectively treat the cognitive impairment associated with fragile X syndrome.

A web-based study of the relationship of duration of insulin pump infusion set use and fasting blood glucose level in adults with type 1 diabetes.

PubMed

Sampson Perrin, Alysa J; Guzzetta, Russell C; Miller, Kellee M; Foster, Nicole C; Lee, Anna; Lee, Joyce M; Block, Jennifer M; Beck, Roy W

2015-05-01

To evaluate the impact of infusion set use duration on glycemic control, we conducted an Internet-based study using the T1D Exchange's online patient community, Glu ( myGlu.org ). For 14 days, 243 electronically consented adults with type 1 diabetes (T1D) entered online that day's fasting blood glucose (FBG) level, the prior day's total daily insulin (TDI) dose, and whether the infusion set was changed. Mean duration of infusion set use was 3.0 days. Mean FBG level was higher with each successive day of infusion set use, increasing from 126 mg/dL on Day 1 to 133 mg/dL on Day 3 to 147 mg/dL on Day 5 (P<0.001). TDI dose did not vary with increased duration of infusion set use. Internet-based data collection was used to rapidly conduct the study at low cost. The results indicate that FBG levels increase with each additional day of insulin pump infusion set use.

Nonlinear Multiobjective MPC-Based Optimal Operation of a High Consistency Refining System in Papermaking

DOE PAGES

Li, Mingjie; Zhou, Ping; Wang, Hong; ...

2017-09-19

As one of the most important unit in the papermaking industry, the high consistency (HC) refining system is confronted with challenges such as improving pulp quality, energy saving, and emissions reduction in its operation processes. Here in this correspondence, an optimal operation of HC refining system is presented using nonlinear multiobjective model predictive control strategies that aim at set-point tracking objective of pulp quality, economic objective, and specific energy (SE) consumption objective, respectively. First, a set of input and output data at different times are employed to construct the subprocess model of the state process model for the HC refiningmore » system, and then the Wiener-type model can be obtained through combining the mechanism model of Canadian Standard Freeness and the state process model that determines their structures based on Akaike information criterion. Second, the multiobjective optimization strategy that optimizes both the set-point tracking objective of pulp quality and SE consumption is proposed simultaneously, which uses NSGA-II approach to obtain the Pareto optimal set. Furthermore, targeting at the set-point tracking objective of pulp quality, economic objective, and SE consumption objective, the sequential quadratic programming method is utilized to produce the optimal predictive controllers. In conclusion, the simulation results demonstrate that the proposed methods can make the HC refining system provide a better performance of set-point tracking of pulp quality when these predictive controllers are employed. In addition, while the optimal predictive controllers orienting with comprehensive economic objective and SE consumption objective, it has been shown that they have significantly reduced the energy consumption.« less

Substance P influenced gelatinolytic activity via reactive oxygen species in human pulp cells.

PubMed

Wang, F-M; Hu, T; Cheng, R; Tan, H; Zhou, X-D

2008-10-01

To investigate the effects of substance P (SP) on gelatinolytic activity of matrix metalloproteinases (MMPs) in human pulp cells. Human dental pulp cells were isolated and cultured. Subconfluent cells, between the third and sixth passages, were maintained under serum deprivation for 18 h followed by the treatment of varying doses of SP (1 pmol L(-1), 100 pmol L(-1), 10 nmol L(-1), 1 micromol L(-1) and 100 micromol L(-1)). Conditioned media were then subjected to gelatin zymography using 8% sodium dodecyl sulphate polyacrylamide gel electrophoresis minigels containing 1.5 g L(-1) gelatin. The effect of SP on intracellular reactive oxygen species (ROS) was also examined by confocal microscopy. ROS scavenger N-Acetyl-L-cysteine (NAC, 5 mmol L(-1)) was utilized to evaluate the roles of ROS pathway in mediating the impact of SP on cellular gelatinolytic activity. Data were analysed using analysis of variance with Bonferroni correction for multiple comparisons or an unpaired Student's t-test. Substance P, at levels above 1 micromol L(-1), remarkably enhanced MMP-2 activity reflected by the band migrating at 66 kDa (P < 0.05). A gelatinolytic band at approximately 44 kDa appeared to be intensified in a SP dose-dependent manner. In addition, it was demonstrated that SP could induce ROS production in pulp cells and ROS scavenger NAC was further found to significantly reduce MMP-2 activity (P < 0.05), as well as other bands of gelatinolytic proteinases. Substance P can influence gelatinolytic activity in human pulp cells via ROS pathway.

Nonlinear Multiobjective MPC-Based Optimal Operation of a High Consistency Refining System in Papermaking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Mingjie; Zhou, Ping; Wang, Hong

As one of the most important unit in the papermaking industry, the high consistency (HC) refining system is confronted with challenges such as improving pulp quality, energy saving, and emissions reduction in its operation processes. Here in this correspondence, an optimal operation of HC refining system is presented using nonlinear multiobjective model predictive control strategies that aim at set-point tracking objective of pulp quality, economic objective, and specific energy (SE) consumption objective, respectively. First, a set of input and output data at different times are employed to construct the subprocess model of the state process model for the HC refiningmore » system, and then the Wiener-type model can be obtained through combining the mechanism model of Canadian Standard Freeness and the state process model that determines their structures based on Akaike information criterion. Second, the multiobjective optimization strategy that optimizes both the set-point tracking objective of pulp quality and SE consumption is proposed simultaneously, which uses NSGA-II approach to obtain the Pareto optimal set. Furthermore, targeting at the set-point tracking objective of pulp quality, economic objective, and SE consumption objective, the sequential quadratic programming method is utilized to produce the optimal predictive controllers. In conclusion, the simulation results demonstrate that the proposed methods can make the HC refining system provide a better performance of set-point tracking of pulp quality when these predictive controllers are employed. In addition, while the optimal predictive controllers orienting with comprehensive economic objective and SE consumption objective, it has been shown that they have significantly reduced the energy consumption.« less

Test-retest reliability of a continuous glucose monitoring system in individuals with type 2 diabetes.

PubMed

Terada, Tasuku; Loehr, Sarah; Guigard, Emmanuel; McCargar, Linda J; Bell, Gordon J; Senior, Peter; Boulé, Normand G

2014-08-01

This study determined the test-retest reliability of a continuous glucose monitoring system (CGMS) (iPro™2; Medtronic, Northridge, CA) under standardized conditions in individuals with type 2 diabetes (T2D). Fourteen individuals with T2D spent two nonconsecutive days in a calorimetry unit. On both days, meals, medication, and exercise were standardized. Glucose concentrations were measured continuously by CGMS, from which daily mean glucose concentration (GLU(mean)), time spent in hyperglycemia (t(>10.0 mmol/L)), and meal, exercise, and nocturnal mean glucose concentrations, as well as glycemic variability (SD(w), percentage coefficient of variation [%cv(w)], mean amplitude of glycemic excursions [MAGEc, MAGE(ave), and MAGE(abs.gos)], and continuous overlapping net glycemic action [CONGA(n)]) were estimated. Absolute and relative reliabilities were investigated using coefficient of variation (CV) and intraclass correlation, respectively. Relative reliability ranged from 0.77 to 0.95 (P<0.05) for GLU(mean) and meal, exercise, and nocturnal glycemia with CV ranging from 3.9% to 11.7%. Despite significant relative reliability (R=0.93; P<0.01), t(>10.0 mmol/L) showed larger CV (54.7%). Among the different glycemic variability measures, a significant between-day difference was observed in MAGEc, MAGE(ave), CONGA6, and CONGA12. The remaining measures (i.e., SD(w), %cv(w), MAGE(abs.gos), and CONGA1-4) indicated no between-day differences and significant relative reliability. In individuals with T2D, CGMS-estimated glycemic profiles were characterized by high relative and absolute reliability for both daily and shorter-term measurements as represented by GLUmean and meal, exercise, and nocturnal glycemia. Among the different methods to calculate glycemic variability, our results showed SD(w), %cv(w), MAGE(abs.gos), and CONGAn with n ≤ 4 were reliable measures. These results suggest the usefulness of CGMS in clinical trials utilizing repeated measured.

The Metabotropic Glutamate Receptor 4-Positive Allosteric Modulator VU0364770 Produces Efficacy Alone and in Combination with l-DOPA or an Adenosine 2A Antagonist in Preclinical Rodent Models of Parkinson's Disease

PubMed Central

Jones, Carrie K.; Bubser, Michael; Thompson, Analisa D.; Dickerson, Jonathan W.; Turle-Lorenzo, Nathalie; Amalric, Marianne; Blobaum, Anna L.; Bridges, Thomas M.; Morrison, Ryan D.; Jadhav, Satyawan; Engers, Darren W.; Italiano, Kimberly; Bode, Jacob; Daniels, J. Scott; Lindsley, Craig W.; Hopkins, Corey R.; Conn, P. Jeffrey

2012-01-01

Parkinson's disease (PD) is a debilitating neurodegenerative disorder associated with severe motor impairments caused by the loss of dopaminergic innervation of the striatum. Previous studies have demonstrated that positive allosteric modulators (PAMs) of metabotropic glutamate receptor 4 (mGlu4), including N-phenyl-7-(hydroxyimino)cyclopropa[b]chromen-1a-carboxamide, can produce antiparkinsonian-like effects in preclinical models of PD. However, these early mGlu4 PAMs exhibited unsuitable physiochemical properties for systemic dosing, requiring intracerebroventricular administration and limiting their broader utility as in vivo tools to further understand the role of mGlu4 in the modulation of basal ganglia function relevant to PD. In the present study, we describe the pharmacologic characterization of a systemically active mGlu4 PAM, N-(3-chlorophenyl)picolinamide (VU0364770), in several rodent PD models. VU0364770 showed efficacy alone or when administered in combination with l-DOPA or an adenosine 2A (A2A) receptor antagonist currently in clinical development (preladenant). When administered alone, VU0364770 exhibited efficacy in reversing haloperidol-induced catalepsy, forelimb asymmetry-induced by unilateral 6-hydroxydopamine (6-OHDA) lesions of the median forebrain bundle, and attentional deficits induced by bilateral 6-OHDA nigrostriatal lesions in rats. In addition, VU0364770 enhanced the efficacy of preladenant to reverse haloperidol-induced catalepsy when given in combination. The effects of VU0364770 to reverse forelimb asymmetry were also potentiated when the compound was coadministered with an inactive dose of l-DOPA, suggesting that mGlu4 PAMs may provide l-DOPA-sparing activity. The present findings provide exciting support for the potential role of selective mGlu4 PAMs as a novel approach for the symptomatic treatment of PD and a possible augmentation strategy with either l-DOPA or A2A antagonists. PMID:22088953

Ionotropic glutamate receptor expression in human white matter.

PubMed

Christensen, Pia Crone; Samadi-Bahrami, Zahra; Pavlov, Vlady; Stys, Peter K; Moore, G R Wayne

2016-09-06

Glutamate is the key excitatory neurotransmitter of the central nervous system (CNS). Its role in human grey matter transmission is well understood, but this is less clear in white matter (WM). Ionotropic glutamate receptors (iGluR) are found on both neuronal cell bodies and glia as well as on myelinated axons in rodents, and rodent WM tissue is capable of glutamate release. Thus, rodent WM expresses many of the components of the traditional grey matter neuron-to-neuron synapse, but to date this has not been shown for human WM. We demonstrate the presence of iGluRs in human WM by immunofluorescence employing high-resolution spectral confocal imaging. We found that the obligatory N-methyl-d-aspartic acid (NMDA) receptor subunit GluN1 and the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit GluA4 co-localized with myelin, oligodendroglial cell bodies and processes. Additionally, GluA4 colocalized with axons, often in distinct clusters. These findings may explain why human WM is vulnerable to excitotoxic events following acute insults such as stroke and traumatic brain injury and in more chronic inflammatory conditions such as multiple sclerosis (MS). Further exploration of human WM glutamate signalling could pave the way for developing future therapies modulating the glutamate-mediated damage in these and other CNS disorders. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Juvenile treatment with mGluR2/3 agonist prevents schizophrenia-like phenotypes in adult by acting through GSK3β.

PubMed

Xing, Bo; Han, Genie; Wang, Min-Juan; Snyder, Melissa A; Gao, Wen-Jun

2018-05-14

Prodromal memory deficits represent an important marker for the development of schizophrenia (SZ), in which glutamatergic hypofunction occurs in the prefrontal cortex (PFC). The mGluR2/3 agonist LY379268 (LY37) attenuates excitatory N-methyl-D-aspartate receptor (NMDAR)-induced neurotoxicity, a central pathological characteristic of glutamatergic hypofunction. We therefore hypothesized that early treatment with LY37 would rescue cognitive deficits and confer benefits for SZ-like behaviors in adults. To test this, we assessed whether early intervention with LY37 would improve learning outcomes in the Morris Water Maze for rats prenatally exposed to methylazoxymethanol acetate (MAM), a neurodevelopmental SZ model. We found that a medium dose of LY37 prevents learning deficits in MAM rats. These effects were mediated through postsynaptic mGluR2/3 via improving GluN2B-NMDAR function by inhibiting glycogen synthase kinase-3β (GSK3β). Furthermore, dendritic spine loss and learning and memory deficits observed in adult MAM rats were restored by juvenile LY37 treatment, which did not change prefrontal neuronal excitability and glutamatergic synaptic transmission in adult normal rats. Our results provide a mechanism for mGluR2/3 agonists against NMDAR hypofunction, which may prove to be beneficial in the prophylactic treatment of SZ. Copyright © 2018 Elsevier Ltd. All rights reserved.

Impact of paper mill wastewater on soil properties and crop yield through lysimeter studies.

PubMed

Singh, P K; Ladwani, K; Ladwani, K; Deshbhratar, P B; Ramteke, D S

2013-01-01

Paper and pulp industries produce large quantities of wastewater which can have adverse effects on the receiving water systems. In the present study lysimeters were used and filled with different soils replicating natural soil horizons and provided with a leachate collection system. The physico-chemical characteristics of the soil in each lysimeter and the quality of wastewater before leaching were assessed. Treated wastewater was evaluated for crop irrigation, and was categorized according to the irrigation water class 'Increasing Problem to Severe Problem' with respect to salinity and specific ion toxicity. Sandy loam soils showed 96% chemical oxygen demand (COD) removal while clay loam soils removed 99% of COD, and the colour removal in both the cases was found to be 100%. Application of wastewater resulted in an increase of pH value, ranging from 6.2-7.6; the electrical conductivity (ECe) of saturated extracts was found to be 0.6-1.7 dS m(-1), and exchangeable sodium percentage (ESP) ranged from 7.8-11.1% in soils. Similarly, an increase in the organic carbon, available nitrogen, phosphorus and potash content of soils was observed when irrigated with wastewater. Wastewater irrigation showed increased grain and straw yield of jowar, wheat and moong. These results permit successful utilization of pulp and paper mill wastewater for crop production without damaging the soils.

Expression of ionotropic glutamate receptors, AMPA, kainite and NMDA, in the pigeon retina.

PubMed

Atoji, Yasuro

2015-07-01

Glutamate is an excitatory neurotransmitter in the vertebrate retina. A previous study found vesicular glutamate transporter 2 (vGluT2) mRNA in the pigeon retina, suggesting that bipolar and ganglion cells are glutamatergic. The present study examined the localization of ionotropic glutamate receptors to identify receptor cells in the pigeon retina using in situ hybridization histochemistry. Nine subunits of AMPA receptor (GluA1, GluA2, GluA3, and GluA4), kainate receptor (GluK1, GluK2, and GluK4), and NMDA receptor (GluN1 and GluN2A) were found to be expressed in the inner nuclear layer (INL) and ganglion cell layers. GluA1, GluA2, GluA3, and GluA4 were primarily expressed in the inner half of INL, and the signal intensity was strong for GluA2, GluA3, and GluA4. GluK1 was intensely expressed in the outer half of INL, whereas GluK2 and GluK4 were mainly localized in the inner half of INL. GluN1 and GluN2A were moderately expressed in the inner half of INL. Horizontal cells expressed GluA3 and GluA4, and ganglion cells expressed all subunits examined. These results suggest that the glutamatergic neurotransmission in the pigeon retina is similar to that in mammals. Copyright © 2015 Elsevier Ltd. All rights reserved.

[Air stripping-UASB process for the treatment of evaporator condensate from a Kraft pulp mill].

PubMed

Zhou, Wei-li; Qin, Xiao-peng; Yu, Jun; Imai, Tsuyoshi; Ukita, Masao

2006-04-01

Evaporator condensate from a kraft pulp mill is characterized by high temperature, high strength, poor nutrition, and some odor and inhibitive materials. In this study, air stripping-UASB process was developed to treat the wastewater from a kraft pulp mill. The lab scale study demonstrated that air stripping process removed 70%-80% of the volatile organic sulfur compounds. After that, the UASB reactor showed high efficiency, at the organic loading rate (COD) of 30 kg x (m3 x d)(-1), COD removal was retained about 95%. On the other hand, the inoculated granules were broken in the new surroundings and were replaced with the newly formed granules The scanning electronic microscope (SEM) observation showed wide difference of the predominant anaerobic microorganisms in the seed and newly formed granules.

Utilization of bagasse and coconut fibers waste as fillers of sandwich composite for bridge railway sleepers

NASA Astrophysics Data System (ADS)

Soehardjo, K. A.; Basuki, A.

2017-07-01

The bridge railway sleepers is an essential component in the construction of railways, as the foundation of the rail support in order to withstand the load a train that runs above it. Sleepers used in bridge construction are expected to have a longer service life, lighter weight and durable so that can be used more efficient. This research was carried out to create a model of bridges railway sleepers made of sandwich structured composite from fiber glass, epoxy resin with fillers waste of bagasse (sugar cane pulp mill) or coconut fiberboard (copra industry) that using polyurethane as an adhesive. The process of making was conditioned for small and medium industrial applications. Railway sleepers’ specifications adapted to meet the requirements of end user. The process steps in this research include; lay-up fiberglass combined with bagasse/coconut fiberboard (as fillers), gluing with epoxy resin, molded it with pressure to be solid, curing after solidification process. The specimens of composite, bagasse and coconut fiber board were tested for tensile and compressive strength. The prototype were tested of mechanical test: flexural moment test to the stand rail, flexural moment test to the middle of the sleepers and tensile strength test on one side of the sleepers, in accordance to SNI 11-3388-1994 Method testing of single block concrete sleepers and bearing single rail fastening systems. The results of mechanical testing all variations meet the technical specifications of end user such as test results for flexural moment on all prototypes, after load test, there is no visible crack. While in the tensile strength test, it seem the prototype with coconut fiberboard filler, shows better performance than bagasse fiberboard filler, the decisions is just depended on techno economic and lifetime.

Edge-glued panels from Alaska hardwoods: retail manager perspectives

Treesearch

David Nicholls; Matthew Bumgardner; Valerie Barber

2010-01-01

In Alaska, red alder (Alnus rubra Bong.) and paper birch (Betula papyrifera Marsh.) are both lesser-known hardwoods grown, harvested, and manufactured into appearance products, with potential for increased utilization. The production of edgeglued panels from red alder and paper birch offers one expansion opportunity for wood...

Concord and Niagara Grape Juice and Their Phenolics Modify Intestinal Glucose Transport in a Coupled in Vitro Digestion/Caco-2 Human Intestinal Model

PubMed Central

Moser, Sydney; Lim, Jongbin; Chegeni, Mohammad; Wightman, JoLynne D.; Hamaker, Bruce R.; Ferruzzi, Mario G.

2016-01-01

While the potential of dietary phenolics to mitigate glycemic response has been proposed, the translation of these effects to phenolic rich foods such as 100% grape juice (GJ) remains unclear. Initial in vitro screening of GJ phenolic extracts from American grape varieties (V. labrusca; Niagara and Concord) suggested limited inhibitory capacity for amylase and α-glucosidase (6.2%–11.5% inhibition; p < 0.05). Separately, all GJ extracts (10–100 µM total phenolics) did reduce intestinal trans-epithelial transport of deuterated glucose (d7-glu) and fructose (d7-fru) by Caco-2 monolayers in a dose-dependent fashion, with 60 min d7-glu/d7-fru transport reduced 10%–38% by GJ extracts compared to control. To expand on these findings by assessing the ability of 100% GJ to modify starch digestion and glucose transport from a model starch-rich meal, 100% Niagara and Concord GJ samples were combined with a starch rich model meal (1:1 and 1:2 wt:wt) and glucose release and transport were assessed in a coupled in vitro digestion/Caco-2 cell model. Digestive release of glucose from the starch model meal was decreased when digested in the presence of GJs (5.9%–15% relative to sugar matched control). Furthermore, transport of d7-glu was reduced 10%–38% by digesta containing bioaccessible phenolics from Concord and Niagara GJ compared to control. These data suggest that phenolics present in 100% GJ may alter absorption of monosaccharides naturally present in 100% GJ and may potentially alter glycemic response if consumed with a starch rich meal. PMID:27399765

3D porous chitosan scaffolds suit survival and neural differentiation of dental pulp stem cells.

PubMed

Feng, Xingmei; Lu, Xiaohui; Huang, Dan; Xing, Jing; Feng, Guijuan; Jin, Guohua; Yi, Xin; Li, Liren; Lu, Yuanzhou; Nie, Dekang; Chen, Xiang; Zhang, Lei; Gu, Zhifeng; Zhang, Xinhua

2014-08-01

A key aspect of cell replacement therapy in brain injury treatment is construction of a suitable biomaterial scaffold that can effectively carry and transport the therapeutic cells to the target area. In the present study, we created small 3D porous chitosan scaffolds through freeze-drying, and showed that these can support and enhance the differentiation of dental pulp stem cells (DPSCs) to nerve cells in vitro. The DPSCs were collected from the dental pulp of adult human third molars. At a swelling rate of ~84.33 ± 10.92 %, the scaffold displayed high porosity and interconnectivity of pores, as revealed by SEM. Cell counting kit-8 assay established the biocompatibility of the chitosan scaffold, supporting the growth and survival of DPSCs. The successful neural differentiation of DPSCs was assayed by RT-PCR, western blotting, and immunofluorescence. We found that the scaffold-attached DPSCs showed high expression of Nestin that decreased sharply following induction of differentiation. Exposure to the differentiation media also increased the expression of neural molecular markers Microtubule-associated protein 2, glial fibrillary acidic protein, and 2',3'-cyclic nucleotide phosphodiesterase. This study demonstrates that the granular 3D chitosan scaffolds are non-cytotoxic, biocompatible, and provide a conducive and favorable micro-environment for attachment, survival, and neural differentiation of DPSCs. These scaffolds have enormous potential to facilitate future advances in treatment of brain injury.

Long-term effects of local pretreatment with alendronate on healing of replanted rat teeth.

PubMed

Komatsu, K; Shimada, A; Shibata, T; Shimoda, S; Oida, S; Kawasaki, K; Nifuji, A

2008-04-01

Our previous study showed that topical alendronate, an inhibitor of bone resorption, reduces root resorption and ankylosis for 21 d after replantation of rat teeth. The aim of the present study was to evaluate the long-term inhibitory effects of topical alendronate in the replanted teeth. The rat maxillary first molars were extracted, placed in saline containing 1 mm alendronate (alendronate group) or saline (saline group) for 5 min and then replanted. The maxillae were dissected at 60 and 120 d. Microcomputed tomography horizontal sections at three root levels were analyzed for root and bone resorption, ankylosis and pulp mineralization. In the alendronate group at 60 and 120 d, the frequencies of resorption of roots and bone were lower than those in the saline group. The p values show statistical significances of lower frequencies in the alendronate group than in the saline group by chi-square test (see Table 1). Ankylosis and pulp mineralization occurred in the alendronate and saline groups. Bone marrow spaces were narrowed in conjunction with bone tissue expansion around the replanted teeth in the alendronate group. The inhibitory effects of topical alendronate were retained on root and bone resorption, but not on ankylosis and pulp mineralization, in the replanted teeth for 4 mo. Alendronate might also stimulate bone formation around the rat replanted teeth.

Interfacial Shear Strength and Adhesive Behavior of Silk Ionomer Surfaces.

PubMed

Kim, Sunghan; Geryak, Ren D; Zhang, Shuaidi; Ma, Ruilong; Calabrese, Rossella; Kaplan, David L; Tsukruk, Vladimir V

2017-09-11

The interfacial shear strength between different layers in multilayered structures of layer-by-layer (LbL) microcapsules is a crucial mechanical property to ensure their robustness. In this work, we investigated the interfacial shear strength of modified silk fibroin ionomers utilized in LbL shells, an ionic-cationic pair with complementary ionic pairing, (SF)-poly-l-glutamic acid (Glu) and SF-poly-l-lysine (Lys), and a complementary pair with partially screened Coulombic interactions due to the presence of poly(ethylene glycol) (PEG) segments and SF-Glu/SF-Lys[PEG] pair. Shearing and adhesive behavior between these silk ionomer surfaces in the swollen state were probed at different spatial scales and pressure ranges by using functionalized atomic force microscopy (AFM) tips as well as functionalized colloidal probes. The results show that both approaches were consistent in analyzing the interfacial shear strength of LbL silk ionomers at different spatial scales from a nanoscale to a fraction of a micron. Surprisingly, the interfacial shear strength between SF-Glu and SF-Lys[PEG] pair with partially screened ionic pairing was greater than the interfacial shear strength of the SF-Glu and SF-Lys pair with a high density of complementary ionic groups. The difference in interfacial shear strength and adhesive strength is suggested to be predominantly facilitated by the interlayer hydrogen bonding of complementary amino acids and overlap of highly swollen PEG segments.

Protein and quality characterization of triticale translocation lines in breadmaking

USDA-ARS?s Scientific Manuscript database

Introduction of high molecular weight glutenin subunits (HMW-GS) from the Glu-D1d locus of wheat into triticale restores the genetic constitution of high molecular weight glutenin loci to that of wheat and subsequently improves the breadmaking quality of triticale. One means of achieving such restor...

Prediction of N-Methyl-D-Aspartate Receptor GluN1-Ligand Binding Affinity by a Novel SVM-Pose/SVM-Score Combinatorial Ensemble Docking Scheme

PubMed Central

Leong, Max K.; Syu, Ren-Guei; Ding, Yi-Lung; Weng, Ching-Feng

2017-01-01

The glycine-binding site of the N-methyl-D-aspartate receptor (NMDAR) subunit GluN1 is a potential pharmacological target for neurodegenerative disorders. A novel combinatorial ensemble docking scheme using ligand and protein conformation ensembles and customized support vector machine (SVM)-based models to select the docked pose and to predict the docking score was generated for predicting the NMDAR GluN1-ligand binding affinity. The predicted root mean square deviation (RMSD) values in pose by SVM-Pose models were found to be in good agreement with the observed values (n = 30, r2 = 0.928–0.988,  = 0.894–0.954, RMSE = 0.002–0.412, s = 0.001–0.214), and the predicted pKi values by SVM-Score were found to be in good agreement with the observed values for the training samples (n = 24, r2 = 0.967,  = 0.899, RMSE = 0.295, s = 0.170) and test samples (n = 13, q2 = 0.894, RMSE = 0.437, s = 0.202). When subjected to various statistical validations, the developed SVM-Pose and SVM-Score models consistently met the most stringent criteria. A mock test asserted the predictivity of this novel docking scheme. Collectively, this accurate novel combinatorial ensemble docking scheme can be used to predict the NMDAR GluN1-ligand binding affinity for facilitating drug discovery. PMID:28059133

Prediction of N-Methyl-D-Aspartate Receptor GluN1-Ligand Binding Affinity by a Novel SVM-Pose/SVM-Score Combinatorial Ensemble Docking Scheme.

PubMed

Leong, Max K; Syu, Ren-Guei; Ding, Yi-Lung; Weng, Ching-Feng

2017-01-06

The glycine-binding site of the N-methyl-D-aspartate receptor (NMDAR) subunit GluN1 is a potential pharmacological target for neurodegenerative disorders. A novel combinatorial ensemble docking scheme using ligand and protein conformation ensembles and customized support vector machine (SVM)-based models to select the docked pose and to predict the docking score was generated for predicting the NMDAR GluN1-ligand binding affinity. The predicted root mean square deviation (RMSD) values in pose by SVM-Pose models were found to be in good agreement with the observed values (n = 30, r 2  = 0.928-0.988,  = 0.894-0.954, RMSE = 0.002-0.412, s = 0.001-0.214), and the predicted pK i values by SVM-Score were found to be in good agreement with the observed values for the training samples (n = 24, r 2  = 0.967,  = 0.899, RMSE = 0.295, s = 0.170) and test samples (n = 13, q 2  = 0.894, RMSE = 0.437, s = 0.202). When subjected to various statistical validations, the developed SVM-Pose and SVM-Score models consistently met the most stringent criteria. A mock test asserted the predictivity of this novel docking scheme. Collectively, this accurate novel combinatorial ensemble docking scheme can be used to predict the NMDAR GluN1-ligand binding affinity for facilitating drug discovery.

Prediction of N-Methyl-D-Aspartate Receptor GluN1-Ligand Binding Affinity by a Novel SVM-Pose/SVM-Score Combinatorial Ensemble Docking Scheme

NASA Astrophysics Data System (ADS)

Leong, Max K.; Syu, Ren-Guei; Ding, Yi-Lung; Weng, Ching-Feng

2017-01-01

The glycine-binding site of the N-methyl-D-aspartate receptor (NMDAR) subunit GluN1 is a potential pharmacological target for neurodegenerative disorders. A novel combinatorial ensemble docking scheme using ligand and protein conformation ensembles and customized support vector machine (SVM)-based models to select the docked pose and to predict the docking score was generated for predicting the NMDAR GluN1-ligand binding affinity. The predicted root mean square deviation (RMSD) values in pose by SVM-Pose models were found to be in good agreement with the observed values (n = 30, r2 = 0.928-0.988,  = 0.894-0.954, RMSE = 0.002-0.412, s = 0.001-0.214), and the predicted pKi values by SVM-Score were found to be in good agreement with the observed values for the training samples (n = 24, r2 = 0.967,  = 0.899, RMSE = 0.295, s = 0.170) and test samples (n = 13, q2 = 0.894, RMSE = 0.437, s = 0.202). When subjected to various statistical validations, the developed SVM-Pose and SVM-Score models consistently met the most stringent criteria. A mock test asserted the predictivity of this novel docking scheme. Collectively, this accurate novel combinatorial ensemble docking scheme can be used to predict the NMDAR GluN1-ligand binding affinity for facilitating drug discovery.

GluA2 trafficking is involved in apoptosis of retinal ganglion cells induced by activation of EphB/EphrinB reverse signaling in a rat chronic ocular hypertension model.

PubMed

Dong, Ling-Dan; Gao, Feng; Wang, Xiao-Han; Miao, Yanying; Wang, Shu-Yue; Wu, Yi; Li, Fang; Wu, Jihong; Cheng, Xiang-Lin; Sun, Xing-Huai; Yang, Xiong-Li; Wang, Zhongfeng

2015-04-01

EphB1, expressed in Müller cells, and ephrinB2, expressed in both Müller cells and retinal ganglion cells (RGCs), constitute an EphB/ephrinB reverse signaling in RGCs. Whether and how this reverse signaling is involved in RGC apoptosis in a rat chronic ocular hypertension (COH) model was investigated. In the COH model, both EphB1 and ephrinB2 were significantly increased and the reverse signaling was activated, which was accompanied by increased protein levels of phosphorylated (p) src, GluA2, and p-GluA2. Intravitreal injection of EphB2-Fc, an activator of ephrinB2, induced an increase in TUNEL-positive signals in normal retinae. A coimmunoprecipitation assay demonstrated direct interactions among ephrinB2, p-src, and GluA2. Moreover, in COH rats the expression of GluA2 proteins on the surface of retinal cells was decreased. Such GluA2 endocytosis could be prevented by preoperational intravitreal injection of 4-amino-3-(4-chlorophenyl)-1-(t-butyl)-1H-pyrazolo [3,4-d] pyrimidine (PP2), an inhibitor of src family tyrosine kinases, and possibly involved the protein interacting with C kinase 1 and phosphorylation of GluA2. In normal rats, intravitreal injection of EphB2-Fc caused changes in these protein levels similar to those observed in COH rats, which all could be avoided by preinjection of PP2. Patch-clamp experiments further showed that the current-voltage relationship of AMPA receptor-mediated EPSCs of RGCs exhibited stronger inward rectification in EphB2-Fc-injected rats. Furthermore, preinjection of PP2 or N-[3-[[4-[(3-aminopropyl)amino]butyl]amino]propyl]-1-naphthaleneacetamide trihydrochloride) (Naspm), a Ca(2+)-permeable GluA2-lacking AMPA receptor inhibitor, remarkably inhibited RGC apoptosis in either EphB2-Fc-injected or COH rats. Together, elevated GluA2 trafficking induced by activated EphB2/ephrinB2 reverse signaling likely contributes to RGC apoptosis in COH rats. Copyright © 2015 the authors 0270-6474/15/355409-13$15.00/0.

Infrared Spectroscopic Evidence of Surface Speciation of Amino Acids on Titanium Dioxide

NASA Astrophysics Data System (ADS)

Jonsson, C. M.; Jonsson, C. L.; Parikh, S. J.; Sverjensky, D. A.; Cleaves, H. J.; Hazen, R. M.

2008-12-01

Interactions that occur at the interface between molecules and mineral surfaces in the presence of water are integral to many chemical and physical processes, including the behavior of pollutants in the environment, metal implants in the human body, and perhaps the origin of life. During the emergence of life, mineral surfaces may have played a role in the selection of amino acids, leading to the formation of proteins that are essential building blocks of life. To investigate this hypothesis, we are studying two amino acids, glutamic (Glu) and aspartic (Asp) acid, and their adsorption to the rutile form of titanium dioxide as a function of pH and surface coverage in electrolyte solutions. The objective is to get a fundamental understanding of the speciation and coordination chemistry of these amino acids at the rutile surface. We used attenuated total reflectance (ATR) Fourier transform infrared (FTIR) spectroscopy to investigate the adsorption of Glu on rutile, and a previously published ATR-FTIR study [1] of Asp and Glu adsorption on an amorphous titanium dioxide film was used as a guide to peak assignment and interpretation of our FTIR spectra. Binding of Glu to both surfaces occurs primarily through one or both of the carboxyl groups, implying that at least two types of surface complexes are formed in a proportion presumably dependent on surface coverage and pH. The interpretation of our results suggests that Glu binds to rutile in a mixed chelating-monodentate fashion involving both carboxyl groups (Glu lying down at the surface), and in a chelating fashion involving only the gamma carboxyl group (Glu standing up at the surface). FTIR results also show that the intensity of the amine peak increases with sorption, which is possibly a consequence of the amine group being brought closer to the surface but not binding directly to it. Glu adsorption on rutile is favored at low pH, based on results from batch adsorption experiments. We have commenced a systematic investigation of Glu and Asp interactions with the rutile surface using potentiometric titrations, adsorption experiments and FTIR spectroscopy. The spectroscopic evidence integrated with quantitative adsorption data and potentiometric titration data are used to describe the adsorption with surface complexation models. [1] Roddick-Lanzilotta A.D. and McQuillan A.J. (2000) J. Colloid & Interface Sci. 227, 48-54.