Sample records for utilized rna interference

  1. Respiratory viral diseases: access to RNA interference therapy

    PubMed Central

    Bitko, Vira; Barik, Sailen

    2008-01-01

    This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824

  2. Gene Silencing in Adult Aedes aegypti Mosquitoes Through Oral Delivery of Double-Stranded RNA

    DTIC Science & Technology

    2012-01-01

    utilization of dsRNA as a bio-insecticide against mosquitoes has only recently begun to be evaluated. Double-stranded RNA targeting chitin syn- thase...double- stranded RNA nanoparticle-mediated RNA interference to silence chitin synthase genes through larval feeding in the African malaria mosquito

  3. Advance of RNA interference technique in Hemipteran insects.

    PubMed

    Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia

    2012-07-24

    RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

  4. Enhancing the cellular uptake of siRNA duplexes following noncovalent packaging with protein transduction domain peptides.

    PubMed

    Meade, Bryan R; Dowdy, Steven F

    2008-03-01

    The major limitation in utilizing information rich macromolecules for basic science and therapeutic applications is the inability of these large molecules to readily diffuse across the cellular membrane. While this restriction represents an efficient defense system against cellular penetration of unwanted foreign molecules and thus a crucial component of cell survival, overcoming this cellular characteristic for the intracellular delivery of macromolecules has been the focus of a large number of research groups worldwide. Recently, with the discovery of RNA interference, many of these groups have redirected their attention and have applied previously characterized cell delivery methodologies to synthetic short interfering RNA duplexes (siRNA). Protein transduction domain and cell penetrating peptides have been shown to enhance the delivery of multiple types of macromolecular cargo including peptides, proteins and antisense oligonucleotides and are now being utilized to enhance the cellular uptake of siRNA molecules. The dense cationic charge of these peptides that is critical for interaction with cell membrane components prior to internalization has also been shown to readily package siRNA molecules into stable nanoparticles that are capable of traversing the cell membrane. This review discusses the recent advances in noncovalent packaging of siRNA molecules with cationic peptides and the potential for the resulting complexes to successfully induce RNA interference within both in vitro and in vivo settings.

  5. Oral Delivery of Double-Stranded RNA in Larvae of the Yellow Fever Mosquito, Aedes aegypti: Implications for Pest Mosquito Control

    PubMed Central

    Singh, Aditi D.; Wong, Sylvia; Ryan, Calen P.; Whyard, Steven

    2013-01-01

    RNA interference has already proven itself to be a highly versatile molecular biology tool for understanding gene function in a limited number of insect species, but its widespread use in other species will be dependent on the development of easier methods of double-stranded RNA (dsRNA) delivery. This study demonstrates that RNA interference can be induced in the mosquito Aedes aegypti L. (Diptera: Culicidae) simply by soaking larvae in a solution of dsRNA for two hours. The mRNA transcripts for β-tubulin, chitin synthase-1 and -2, and heat shock protein 83 were reduced between 30 and 50% three days post-dsRNA treatment. The dsRNA was mixed with a visible dye to identify those individuals that fed on the dsRNA, and based on an absence of RNA interference in those individuals that contained no dye within their guts, the primary route of entry of dsRNA is likely through the gut epithelium. RNA interference was systemic in the insects, inducing measurable knock down of gene expression in tissues beyond the gut. Silencing of the β-tubulin and chitin synthase-1 genes resulted in reduced growth and/or mortality of the larvae, demonstrating the utility of dsRNA as a potential mosquito larvicide. Silencing of chitin synthase-2 did not induce mortality in the larvae, and silencing of heat shock protein 83 only induced mortality in the insects if they were subsequently subjected to a heat stress. Drosophila melanogaster Meigen (Diptera: Drosophilidae) larvae were also soaked in dsRNA designed to specifically target either their own β-tubulin gene, or that of A. aegypti, and significant mortality was only seen in larvae treated with dsRNA targeting their own gene, which suggests that dsRNA pesticides could be designed to be species-limited. PMID:24224468

  6. RNA Interference in Infectious Tropical Diseases

    PubMed Central

    Hong, Young S.

    2008-01-01

    Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671

  7. RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.

    PubMed

    Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil

    2017-01-01

    Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.

  8. Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro

    PubMed Central

    Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.

    2013-01-01

    Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792

  9. RNAi-induced silencing of embryonic tryptophan oxygenase in the Pyralid moth, Plodia interpunctella

    PubMed Central

    Fabrick, Jeffrey A.; Kanost, Michael R.; Baker, James E.

    2004-01-01

    Gene silencing through the introduction of double-stranded RNA (RNA interference, RNAi) provides a powerful tool for the elucidation of gene function in many systems, including those where genomics and proteomics are incomplete. The use of RNAi technology for gene silencing in Lepidoptera has lacked significant attention compared to other systems. To demonstrate that RNAi can be utilized in the lepidopteran, Plodia interpunctella, we cloned a cDNA for tryptophan oxygenase, and showed that silencing of tryptophan oxygenase through RNAi during embryonic development resulted in loss of eye-color pigmentation. The complete amino acid sequence of Plodia tryptophan oxygenase can be accessed through NCBI Protein Database under NCBI Accession # AY427951. Abbreviation RNAi RNA interference PCR polymerase chain reaction RT-PCR reverse transcription-PCR PMID:15861231

  10. Molecular mechanisms influencing efficiency of RNA interference in insects.

    PubMed

    Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan

    2018-06-21

    RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  11. Host-Pathogen interactions modulated by small RNAs.

    PubMed

    Islam, Waqar; Islam, Saif Ul; Qasim, Muhammad; Wang, Liande

    2017-07-03

    Biological processes such as defense mechanisms and microbial offense strategies are regulated through RNA induced interference in eukaryotes. Genetic mutations are modulated through biogenesis of small RNAs which directly impacts upon host development. Plant defense mechanisms are regulated and supported by a diversified group of small RNAs which are involved in streamlining several RNA interference pathways leading toward the initiation of pathogen gene silencing mechanisms. In the similar context, pathogens also utilize the support of small RNAs to launch their offensive attacks. Also there are strong evidences about the active involvement of these RNAs in symbiotic associations. Interestingly, small RNAs are not limited to the individuals in whom they are produced; they also show cross kingdom influences through variable interactions with other species thus leading toward the inter-organismic gene silencing. The phenomenon is understandable in the microbes which utilize these mechanisms to overcome host defense line. Understanding the mechanism of triggering host defense strategies can be a valuable step toward the generation of disease resistant host plants. We think that the cross kingdom trafficking of small RNA is an interesting insight that is needed to be explored for its vitality.

  12. Host-Pathogen interactions modulated by small RNAs

    PubMed Central

    Islam, Waqar; Islam, Saif ul; Qasim, Muhammad; Wang, Liande

    2017-01-01

    ABSTRACT Biological processes such as defense mechanisms and microbial offense strategies are regulated through RNA induced interference in eukaryotes. Genetic mutations are modulated through biogenesis of small RNAs which directly impacts upon host development. Plant defense mechanisms are regulated and supported by a diversified group of small RNAs which are involved in streamlining several RNA interference pathways leading toward the initiation of pathogen gene silencing mechanisms. In the similar context, pathogens also utilize the support of small RNAs to launch their offensive attacks. Also there are strong evidences about the active involvement of these RNAs in symbiotic associations. Interestingly, small RNAs are not limited to the individuals in whom they are produced; they also show cross kingdom influences through variable interactions with other species thus leading toward the inter-organismic gene silencing. The phenomenon is understandable in the microbes which utilize these mechanisms to overcome host defense line. Understanding the mechanism of triggering host defense strategies can be a valuable step toward the generation of disease resistant host plants. We think that the cross kingdom trafficking of small RNA is an interesting insight that is needed to be explored for its vitality. PMID:28430077

  13. Silencing the roadblocks to effective triple-negative breast cancer treatments by siRNA nanoparticles.

    PubMed

    Parvani, Jenny G; Jackson, Mark W

    2017-04-01

    Over the past decade, RNA interference (RNAi) has been ubiquitously utilized to study biological function in vitro ; however, limitations were associated with its utility in vivo More recently, small interfering RNA (siRNA) nanoparticles with improved biocompatibility have gained prevalence as a potential therapeutic option for the treatment of various diseases. The adaptability of siRNA nanoparticles enables the delivery of virtually any siRNA, which is especially advantageous for therapeutic applications in heterogeneous diseases that lack unifying molecular features, such as triple-negative breast cancer (TNBC). TNBC is an aggressive subtype of breast cancer that is stratified by the lack of estrogen receptor/progesterone receptor expression and HER2 amplification. There are currently no FDA-approved targeted therapies for the treatment of TNBCs, making cytotoxic chemotherapy the only treatment option available to these patients. In this review, we outline the current status of siRNA nanoparticles in clinical trials for cancer treatment and discuss the promising preclinical approaches that have utilized siRNA nanoparticles for TNBC treatment. Next, we address TNBC subtype-specific therapeutic interventions and highlight where and how siRNA nanoparticles fit into these strategies. Lastly, we point out ongoing challenges in the field of siRNA nanoparticle research that, if addressed, would significantly improve the efficacy of siRNA nanoparticles as a therapeutic option for cancer treatment. © 2017 Society for Endocrinology.

  14. A simple and robust vector-based shRNA expression system used for RNA interference.

    PubMed

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  15. Genetic Manipulation of Schistosoma haematobium, the Neglected Schistosome

    PubMed Central

    Rinaldi, Gabriel; Okatcha, Tunika I.; Popratiloff, Anastas; Ayuk, Mary A.; Suttiprapa, Sutas; Mann, Victoria H.; Liang, Yung-san; Lewis, Fred A.; Loukas, Alex; Brindley, Paul J.

    2011-01-01

    Background Minimal information on the genome and proteome of Schistosoma haematobium is available, in marked contrast to the situation with the other major species of human schistosomes for which draft genome sequences have been reported. Accordingly, little is known about functional genomics in S. haematobium, including the utility or not of RNA interference techniques that, if available, promise to guide development of new interventions for schistosomiasis haematobia. Methods/Findings Here we isolated and cultured developmental stages of S. haematobium, derived from experimentally infected hamsters. Targeting different developmental stages, we investigated the utility of soaking and/or square wave electroporation in order to transfect S. haematobium with nucleic acid reporters including Cy3-labeled small RNAs, messenger RNA encoding firefly luciferase, and short interfering RNAs (siRNAs). Three hours after incubation of S. haematobium eggs in 50 ng/µl Cy3-labeled siRNA, fluorescent foci were evident indicating that labeled siRNA had penetrated into miracidia developing within the egg shell. Firefly luciferase activity was detected three hours after square wave electroporation of the schistosome eggs and adult worms in 150 ng/µl of mRNA. RNA interference knockdown (silencing) of reporter luciferase activity was seen following the introduction of dsRNA specific for luciferase mRNA in eggs, schistosomules and mixed sex adults. Moreover, introduction of an endogenous gene-specific siRNA into adult schistosomes silenced transcription of tetraspanin 2 (Sh-tsp-2), the apparent orthologue of the Schistosoma mansoni gene Sm-tsp-2 which encodes the surface localized structural and signaling protein Sm-TSP-2. Together, knockdown of reporter luciferase and Sh-tsp-2 indicated the presence of an intact RNAi pathway in S. haematobium. Also, we employed laser scanning confocal microscopy to view the adult stages of S. haematobium. Conclusions These findings and approaches should facilitate analysis of gene function in S. haematobium, which in turn could facilitate the characterization of prospective intervention targets for this neglected tropical disease pathogen. PMID:22022628

  16. PEGylated poly(ethylene imine) copolymer-delivered siRNA inhibits HIV replication in vitro.

    PubMed

    Weber, Nick D; Merkel, Olivia M; Kissel, Thomas; Muñoz-Fernández, María Ángeles

    2012-01-10

    RNA interference is increasingly being utilized for the specific targeting and down-regulation of disease-causing genes, including targeting viral infections such as HIV. T lymphocytes, the primary target for HIV, are very difficult to treat with gene therapy applications such as RNA interference because of issues with drug delivery. To circumvent these problems, we investigated poly(ethylene imine) (PEI) as a method of improving transfection efficiency of siRNA to T lymphocytes. Additionally, polyethylene glycol (PEG) moieties were engrafted to the PEI polymers with the goals of improving stability and reducing cytotoxicity. Initial studies on PEG-PEI/siRNA polyplex formation, size and their interaction with cell membranes demonstrated their feasibility as drug delivery agents. Assays with lymphocytes revealed low cytotoxicity profiles of the polyplexes at pharmacologically relevant concentrations with PEGylated copolymers obtaining the best results. Successful transfection of a T cell line or primary T cells with siRNA was observed via flow cytometry and confocal microscopy. Finally, the biological effect of copolymer-delivered siRNA was measured. Of particular significance, siRNA targeted to the HIV gene nef and delivered by one of the PEG-PEI copolymers in repetitive treatments every 2-3 days was observed to inhibit HIV replication to the same extent as azidothymidine over the course of 15 days. Copyright © 2011 Elsevier B.V. All rights reserved.

  17. Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference

    PubMed Central

    Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant

    2015-01-01

    The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748

  18. RNA virus interference via CRISPR/Cas13a system in plants.

    PubMed

    Aman, Rashid; Ali, Zahir; Butt, Haroon; Mahas, Ahmed; Aljedaani, Fatimah; Khan, Muhammad Zuhaib; Ding, Shouwei; Mahfouz, Magdy

    2018-01-04

    CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.

  19. Current siRNA Targets in Atherosclerosis and Aortic Aneurysm

    PubMed Central

    Pradhan-Nabzdyk, Leena; Huang, Chenyu; Logerfo, Frank W.; Nabzdyk, Christoph S.

    2014-01-01

    Atherosclerosis (ATH) and aortic aneurysms (AA) remain challenging chronic diseases that confer high morbidity and mortality despite advances in medical, interventional, and surgical care. RNA interference represents a promising technology that may be utilized to silence genes contributing to ATH and AA. Despite positive results in preclinical and some clinical feasibility studies, challenges such as target/sequence validation, tissue specificity, transfection efficiency, and mitigation of unwanted off-target effects remain to be addressed. In this review the most current targets and some novel approaches in siRNA delivery are being discussed. Due to the plethora of investigated targets, only studies published between 2010 and 2014 were included. PMID:24882715

  20. Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS

    USDA-ARS?s Scientific Manuscript database

    Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...

  1. RNA therapeutics targeting osteoclast-mediated excessive bone resorption

    PubMed Central

    Wang, Yuwei; Grainger, David W

    2011-01-01

    RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing technique developed with dramatically increasing utility for both scientific and therapeutic purposes. Short interfering RNA (siRNA) is currently exploited to regulate protein expression relevant to many therapeutic applications, and commonly used as a tool for elucidating disease-associated genes. Osteoporosis and their associated osteoporotic fragility fractures in both men and women are rapidly becoming a global healthcare crisis as average life expectancy increases worldwide. New therapeutics are needed for this increasing patient population. This review describes the diversity of molecular targets suitable for RNAi-based gene knock-down in osteoclasts to control osteoclast-mediated excessive bone resorption. We identify strategies for developing targeted siRNA delivery and efficient gene silencing, and describe opportunities and challenges of introducing siRNA as a therapeutic approach to hard and connective tissue disorders. PMID:21945356

  2. The cytomegalovirus promoter-driven short hairpin RNA constructs mediate effective RNA interference in zebrafish in vivo.

    PubMed

    Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun

    2008-01-01

    The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.

  3. Ethical Perspectives on RNA Interference Therapeutics

    PubMed Central

    Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou

    2008-01-01

    RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370

  4. Probing Nucleobase Interactions and Predicting Mechanisms of Synthetic Interest Using Computational Chemistry, and Furthering the Development of BVI Education in Chemistry

    ERIC Educational Resources Information Center

    Harrison, Jason Gordon

    2013-01-01

    Quantum mechanical (QM) and molecular docking methods are used to probe systems of biological and synthetic interest. Probing interactions of nucleobases within proteins, and properly modeling said interactions toward novel nucleobase development, is extremely difficult, and of great utility in RNA interference (RNAi) therapeutics. The issues in…

  5. MicroRNA-mediated gene regulation: potential applications for plant genetic engineering.

    PubMed

    Zhou, Man; Luo, Hong

    2013-09-01

    Food security is one of the most important issues challenging the world today. Any strategies to solve this problem must include increasing crop yields and quality. MicroRNA-based genetic modification technology (miRNA-based GM tech) can be one of the most promising solutions that contribute to agricultural productivity directly by developing superior crop cultivars with enhanced biotic and abiotic stress tolerance and increased biomass yields. Indirectly, the technology may increase usage of marginal soils and decrease pesticide use, among other benefits. This review highlights the most recent progress of transgenic studies utilizing various miRNAs and their targets for plant trait modifications, and analyzes the potential of miRNA-mediated gene regulation for use in crop improvement. Strategies for manipulating miRNAs and their targets in transgenic plants including constitutive, stress-induced, or tissue-specific expression of miRNAs or their targets, RNA interference, expressing miRNA-resistant target genes, artificial target mimic and artificial miRNAs were discussed. We also discussed potential risks of utilizing miRNA-based GM tech. In general, miRNAs and their targets not only provide an invaluable source of novel transgenes, but also inspire the development of several new GM strategies, allowing advances in breeding novel crop cultivars with agronomically useful characteristics.

  6. Exploiting CRISPR/Cas: Interference Mechanisms and Applications

    PubMed Central

    Richter, Hagen; Randau, Lennart; Plagens, André

    2013-01-01

    The discovery of biological concepts can often provide a framework for the development of novel molecular tools, which can help us to further understand and manipulate life. One recent example is the elucidation of the prokaryotic adaptive immune system, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) that protects bacteria and archaea against viruses or conjugative plasmids. The immunity is based on small RNA molecules that are incorporated into versatile multi-domain proteins or protein complexes and specifically target viral nucleic acids via base complementarity. CRISPR/Cas interference machines are utilized to develop novel genome editing tools for different organisms. Here, we will review the latest progress in the elucidation and application of prokaryotic CRISPR/Cas systems and discuss possible future approaches to exploit the potential of these interference machineries. PMID:23857052

  7. Exploiting CRISPR/Cas: interference mechanisms and applications.

    PubMed

    Richter, Hagen; Randau, Lennart; Plagens, André

    2013-07-12

    The discovery of biological concepts can often provide a framework for the development of novel molecular tools, which can help us to further understand and manipulate life. One recent example is the elucidation of the prokaryotic adaptive immune system, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) that protects bacteria and archaea against viruses or conjugative plasmids. The immunity is based on small RNA molecules that are incorporated into versatile multi-domain proteins or protein complexes and specifically target viral nucleic acids via base complementarity. CRISPR/Cas interference machines are utilized to develop novel genome editing tools for different organisms. Here, we will review the latest progress in the elucidation and application of prokaryotic CRISPR/Cas systems and discuss possible future approaches to exploit the potential of these interference machineries.

  8. Renewing the Assault on mRNA

    PubMed Central

    McCAIN, JACK

    2004-01-01

    Mammalian cells dislike double-stranded RNA. They interpret it as a sign of an intruder, and they can unleash a recently discovered defensive mechanism to deal with the problem – they chop the invader into little pieces and use the remnants, called small interfering RNA, to identify and destroy the invader and its progeny. This process, known as RNA interference, may lend itself to new treatments for a wide range of diseases. RNA interference, however, resembles two therapies studied during the 1990s, antisense and ribozymes, in that the gene-silencing target is messenger RNA (mRNA). Is RNA interference really the Next Big Thing – or just a variation on an older but still intriguing theme? PMID:23372488

  9. [Expression of Jagged1 mRNA in human epithelial ovarian carcinoma tissues and effect of RNA interference of Jagged1 on growth of xenograft in nude mice].

    PubMed

    Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G

    2016-06-25

    To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were statistically significant (P<0.05). The relative mRNA and protein expression of Jagged1, Hes1 and Hey1 in xenograft tissues of nude micein Jagged1 interference group were lower than that in the other two groups, the differences were statistically significant (P<0.05). There were no differences of relative mRNA and protein expression of Notch1 in xenograft tissues of nude mice among the three groups (P>0.05). Jagged1 is highly expressed in epithelial ovarian carcinoma. Jagged1 gene interference in xenograft tumor can inhibit ovarian cancer cell growth and improve tumor suppressor rate, which probably play roles by inhibiting Notch1 signaling pathway.

  10. Gene silencing in non-model insects: Overcoming hurdles using symbiotic bacteria for trauma-free sustainable delivery of RNA interference: Sustained RNA interference in insects mediated by symbiotic bacteria: Applications as a genetic tool and as a biocide.

    PubMed

    Whitten, Miranda; Dyson, Paul

    2017-03-01

    Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.

  11. Transcriptional and phenotypic comparisons of Ppara knockout and siRNA knockdown mice

    PubMed Central

    De Souza, Angus T.; Dai, Xudong; Spencer, Andrew G.; Reppen, Tom; Menzie, Ann; Roesch, Paula L.; He, Yudong; Caguyong, Michelle J.; Bloomer, Sherri; Herweijer, Hans; Wolff, Jon A.; Hagstrom, James E.; Lewis, David L.; Linsley, Peter S.; Ulrich, Roger G.

    2006-01-01

    RNA interference (RNAi) has great potential as a tool for studying gene function in mammals. However, the specificity and magnitude of the in vivo response to RNAi remains to be fully characterized. A molecular and phenotypic comparison of a genetic knockout mouse and the corresponding knockdown version would help clarify the utility of the RNAi approach. Here, we used hydrodynamic delivery of small interfering RNA (siRNA) to knockdown peroxisome proliferator activated receptor alpha (Ppara), a gene that is central to the regulation of fatty acid metabolism. We found that Ppara knockdown in the liver results in a transcript profile and metabolic phenotype that is comparable to those of Ppara−/− mice. Combining the profiles from mice treated with the PPARα agonist fenofibrate, we confirmed the specificity of the RNAi response and identified candidate genes proximal to PPARα regulation. Ppara knockdown animals developed hypoglycemia and hypertriglyceridemia, phenotypes observed in Ppara−/− mice. In contrast to Ppara−/− mice, fasting was not required to uncover these phenotypes. Together, these data validate the utility of the RNAi approach and suggest that siRNA can be used as a complement to classical knockout technology in gene function studies. PMID:16945951

  12. Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins

    PubMed Central

    Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel

    2010-01-01

    The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585

  13. Decreased low back pain intensity and differential gene expression following Calmare®: results from a double-blinded randomized sham-controlled study.

    PubMed

    Starkweather, Angela R; Coyne, Patrick; Lyon, Debra E; Elswick, R K; An, Kyungeh; Sturgill, Jamie

    2015-02-01

    In this double-blinded, randomized controlled trial we evaluated the effects of Calmare®, a non-invasive neurocutaneous electrical pain intervention, on lower back pain intensity as measured by the "worst" pain score and on pain interference using the Brief Pain Inventory-Short Form, on measures of pain sensitivity assessed by quantitative sensory testing, and on mRNA expression of pain sensitivity genes. Thirty participants were randomized to receive up to 10 sessions of Calmare® treatment (n = 15) or a sham treatment (n = 15) using the same device at a non-therapeutic threshold. At 3 weeks after conclusion of treatment, compared with the sham group, the Calmare® group reported a significant decrease in the "worst" pain and interference scores. There were also significant differences in pain sensitivity and differential mRNA expression of 17 pain genes, suggesting that Calmare® can be effective in reducing pain intensity and interference in individuals with persistent low back pain by altering the mechanisms of enhanced pain sensitivity. Further study of long-term pain outcomes, particularly functional status, analgesic use and health care utilization, is warranted. © 2015 Wiley Periodicals, Inc.

  14. Interference in plant defense and development by non-structural protein NSs of Groundnut bud necrosis virus.

    PubMed

    Goswami, Suneha; Sahana, Nandita; Pandey, Vanita; Doblas, Paula; Jain, R K; Palukaitis, Peter; Canto, Tomas; Praveen, Shelly

    2012-01-01

    Groundnut bud necrosis virus (GBNV) infects a large number of leguminous and solanaceous plants. To elucidate the biological function of the non-structural protein encoded by the S RNA of GBNV (NSs), we studied its role in RNA silencing suppression and in viral pathogenesis. Our results demonstrated that GBNV NSs functions as a suppressor of RNA silencing using the agroinfiltration patch assay. An in silico analysis suggested the presence of pro-apoptotic protein Reaper-like sequences in the GBNV NSs, which were known to be present in animal infecting bunyaviruses. Utilizing NSs mutants, we demonstrated that a Leu-rich domain was required for RNA silencing suppression activity, but not the non-overlapping Trp/GH3 motif of the Reaper-like sequence. To investigate the role of NSs in symptom development we generated transgenic tomato expressing the GBNV NSs and showed that the expression of NSs in tomato mimics symptoms induced by infection with GBNV, such as leaf senescence and necrosis. As leaf senescence is controlled by miR319 regulation of the transcription factor TCP1, we assessed the accumulation of both RNAs in transgenic NSs-expressing and GBNV-infected tomato plants. In both types of plants the levels of miR319 decreased, while the levels of TCP1 transcripts increased. We propose that GBNV-NSs affects miRNA biogenesis through its RNA silencing suppressor activity and interferes with TCP1-regulated leaf developmental pathways. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon.

    PubMed Central

    Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M

    1999-01-01

    In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456

  16. RNA interference of argininosuccinate synthetase restores sensitivity to recombinant arginine deiminase (rADI) in resistant cancer cells

    PubMed Central

    2011-01-01

    Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546

  17. Influence of mycotoxins on protein and amino acid utilization.

    PubMed

    Smith, T K

    1982-09-01

    The interrelationships between mycotoxins and the utilization of dietary protein are reviewed. Acute aflatoxicosis is characterized by reduced growth and fatty infiltration of the liver. Studies with poultry, swine, and monkeys have shown that supplements of dietary protein beyond normal requirements can overcome these conditions. High-protein diets, however, have been shown to promote hepatoma characteristic of chronic aflatoxicosis in rats. Aflatoxin interferes with utilization of dietary protein by inhibiting synthesis of DNA, RNA, and protein. High-protein diets promote the metabolism of aflatoxin by the hepatic microsomal drug-metabolizing enzyme system. The Fusarium mycotoxin zearalenone increases membrane permeability and promotes uterine synthesis of DNA, RNA, and protein. Supplements of dietary protein overcome growth reduction due to zearalenone and reduce the metabolic half-life of the toxin by promoting urinary excretion of free, unmetabolized zearalenone in the rat. The trichothecene mycotoxins disrupt normal protein metabolism by inactivating the ribosomal cycle. Protein supplements appear to have little effect on trichothecene mycotoxicoses. Most mycotoxins impair utilization of dietary protein. The effectiveness of protein supplements in overcoming mycotoxicoses will depend on the mycotoxin in question.

  18. Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

    PubMed

    Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

    2015-01-01

    In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior to that of single RNA interference, and this could be a contribution for prevention of precancerous condition.

  19. [Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

    PubMed

    Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

    2010-10-01

    This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

  20. Generation of Constructs for DNA-Directed RNA Interference of Venezuelan Equine Encephalitis Virus Genes

    DTIC Science & Technology

    2006-12-01

    Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential

  1. Double strand RNA-mediated RNA interference through feeding in larval gypsy moth, Lymantria dispar (Lepidoptera: Erebidae)

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...

  2. Chemical Approaches to Control Gene Expression

    PubMed Central

    Gottesfeld, Joel M.; Turner, James M.; Dervan, Peter B.

    2000-01-01

    A current goal in molecular medicine is the development of new strategies to interfere with gene expression in living cells in the hope that novel therapies for human disease will result from these efforts. This review focuses on small-molecule or chemical approaches to manipulate gene expression by modulating either transcription of messenger RNA-coding genes or protein translation. The molecules under study include natural products, designed ligands, and compounds identified through functional screens of combinatorial libraries. The cellular targets for these molecules include DNA, messenger RNA, and the protein components of the transcription, RNA processing, and translational machinery. Studies with model systems have shown promise in the inhibition of both cellular and viral gene transcription and mRNA utilization. Moreover, strategies for both repression and activation of gene transcription have been described. These studies offer promise for treatment of diseases of pathogenic (viral, bacterial, etc.) and cellular origin (cancer, genetic diseases, etc.). PMID:11097426

  3. Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.

    PubMed

    Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S

    2016-01-01

    RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.

  4. The promises and pitfalls of RNA-interference-based therapeutics

    PubMed Central

    Castanotto, Daniela; Rossi, John J.

    2009-01-01

    The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789

  5. Effect of North Bicyclo[3.1.0]hexane 2'-Deoxypseudosugars on RNA Interference: A Novel Class of siRNA Modification | Center for Cancer Research

    Cancer.gov

    The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.

  6. Bringing RNA Interference (RNAi) into the High School Classroom

    ERIC Educational Resources Information Center

    Sengupta, Sibani

    2013-01-01

    RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…

  7. Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing

    PubMed Central

    Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom

    2015-01-01

    Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842

  8. Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.

    PubMed

    Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom

    2015-05-14

    Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.

  9. Antibody targeting facilitates effective intratumoral siRNA nanoparticle delivery to HER2-overexpressing cancer cells

    PubMed Central

    Palanca-Wessels, Maria C.; Booth, Garrett C.; Convertine, Anthony J.; Lundy, Brittany B.; Berguig, Geoffrey Y.; Press, Michael F.; Stayton, Patrick S.; Press, Oliver W.

    2016-01-01

    The therapeutic potential of RNA interference (RNAi) has been limited by inefficient delivery of short interfering RNA (siRNA). Tumor-specific recognition can be effectively achieved by antibodies directed against highly expressed cancer cell surface receptors. We investigated the utility of linking an internalizing streptavidin-conjugated HER2 antibody to an endosome-disruptive biotinylated polymeric nanocarrier to improve the functional cytoplasmic delivery of siRNA in breast and ovarian cancer cells in vitro and in an intraperitoneal ovarian cancer xenograft model in vivo, yielding an 80% reduction of target mRNA and protein levels with sustained repression for at least 96 hours. RNAi-mediated site specific cleavage of target mRNA was demonstrated using the 5′ RLM-RACE (RNA ligase mediated-rapid amplification of cDNA ends) assay. Mice bearing intraperitoneal human ovarian tumor xenografts demonstrated increased tumor accumulation of Cy5.5 fluorescently labeled siRNA and 70% target gene suppression after treatment with HER2 antibody-directed siRNA nanocarriers. Detection of the expected mRNA cleavage product by 5′ RLM-RACE assay confirmed that suppression occurs via the expected RNAi pathway. Delivery of siRNA via antibody-directed endosomolytic nanoparticles may be a promising strategy for cancer therapy. PMID:26840082

  10. Antibody targeting facilitates effective intratumoral siRNA nanoparticle delivery to HER2-overexpressing cancer cells.

    PubMed

    Palanca-Wessels, Maria C; Booth, Garrett C; Convertine, Anthony J; Lundy, Brittany B; Berguig, Geoffrey Y; Press, Michael F; Stayton, Patrick S; Press, Oliver W

    2016-02-23

    The therapeutic potential of RNA interference (RNAi) has been limited by inefficient delivery of short interfering RNA (siRNA). Tumor-specific recognition can be effectively achieved by antibodies directed against highly expressed cancer cell surface receptors. We investigated the utility of linking an internalizing streptavidin-conjugated HER2 antibody to an endosome-disruptive biotinylated polymeric nanocarrier to improve the functional cytoplasmic delivery of siRNA in breast and ovarian cancer cells in vitro and in an intraperitoneal ovarian cancer xenograft model in vivo, yielding an 80% reduction of target mRNA and protein levels with sustained repression for at least 96 hours. RNAi-mediated site specific cleavage of target mRNA was demonstrated using the 5' RLM-RACE (RNA ligase mediated-rapid amplification of cDNA ends) assay. Mice bearing intraperitoneal human ovarian tumor xenografts demonstrated increased tumor accumulation of Cy5.5 fluorescently labeled siRNA and 70% target gene suppression after treatment with HER2 antibody-directed siRNA nanocarriers. Detection of the expected mRNA cleavage product by 5' RLM-RACE assay confirmed that suppression occurs via the expected RNAi pathway. Delivery of siRNA via antibody-directed endosomolytic nanoparticles may be a promising strategy for cancer therapy.

  11. RNA Interference Therapies for an HIV-1 Functional Cure.

    PubMed

    Scarborough, Robert J; Gatignol, Anne

    2017-12-27

    HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.

  12. Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.

    PubMed

    Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M

    2018-05-01

    Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.

  13. Generation of siRNA Nanosheets for Efficient RNA Interference

    NASA Astrophysics Data System (ADS)

    Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum

    2016-04-01

    After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.

  14. High-Throughput Characterization of Cascade type I-E CRISPR Guide Efficacy Reveals Unexpected PAM Diversity and Target Sequence Preferences.

    PubMed

    Fu, Becky Xu Hua; Wainberg, Michael; Kundaje, Anshul; Fire, Andrew Z

    2017-08-01

    Interactions between Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) RNAs and CRISPR-associated (Cas) proteins form an RNA-guided adaptive immune system in prokaryotes. The adaptive immune system utilizes segments of the genetic material of invasive foreign elements in the CRISPR locus. The loci are transcribed and processed to produce small CRISPR RNAs (crRNAs), with degradation of invading genetic material directed by a combination of complementarity between RNA and DNA and in some cases recognition of adjacent motifs called PAMs (Protospacer Adjacent Motifs). Here we describe a general, high-throughput procedure to test the efficacy of thousands of targets, applying this to the Escherichia coli type I-E Cascade (CRISPR-associated complex for antiviral defense) system. These studies were followed with reciprocal experiments in which the consequence of CRISPR activity was survival in the presence of a lytic phage. From the combined analysis of the Cascade system, we found that (i) type I-E Cascade PAM recognition is more expansive than previously reported, with at least 22 distinct PAMs, with many of the noncanonical PAMs having CRISPR-interference abilities similar to the canonical PAMs; (ii) PAM positioning appears precise, with no evidence for tolerance to PAM slippage in interference; and (iii) while increased guanine-cytosine (GC) content in the spacer is associated with higher CRISPR-interference efficiency, high GC content (>62.5%) decreases CRISPR-interference efficiency. Our findings provide a comprehensive functional profile of Cascade type I-E interference requirements and a method to assay spacer efficacy that can be applied to other CRISPR-Cas systems. Copyright © 2017 by the Genetics Society of America.

  15. Human health and ecological risk assessments for SmartStax PRO (MON 89034 x TC1507 x MON 87411 x DAS-59122-7), a plant-incorporated protectant intended to control corn rootworm through ribonucleic acid (RNA) interference

    EPA Science Inventory

    The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...

  16. Validation of isoleucine utilization targets in Plasmodium falciparum

    PubMed Central

    Istvan, Eva S.; Dharia, Neekesh V.; Bopp, Selina E.; Gluzman, Ilya; Winzeler, Elizabeth A.; Goldberg, Daniel E.

    2011-01-01

    Intraerythrocytic malaria parasites can obtain nearly their entire amino acid requirement by degrading host cell hemoglobin. The sole exception is isoleucine, which is not present in adult human hemoglobin and must be obtained exogenously. We evaluated two compounds for their potential to interfere with isoleucine utilization. Mupirocin, a clinically used antibacterial, kills Plasmodium falciparum parasites at nanomolar concentrations. Thiaisoleucine, an isoleucine analog, also has antimalarial activity. To identify targets of the two compounds, we selected parasites resistant to either mupirocin or thiaisoleucine. Mutants were analyzed by genome-wide high-density tiling microarrays, DNA sequencing, and copy number variation analysis. The genomes of three independent mupirocin-resistant parasite clones had all acquired either amplifications encompassing or SNPs within the chromosomally encoded organellar (apicoplast) isoleucyl-tRNA synthetase. Thiaisoleucine-resistant parasites had a mutation in the cytoplasmic isoleucyl-tRNA synthetase. The role of this mutation in thiaisoleucine resistance was confirmed by allelic replacement. This approach is generally useful for elucidation of new targets in P. falciparum. Our study shows that isoleucine utilization is an essential pathway that can be targeted for antimalarial drug development. PMID:21205898

  17. Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound

    PubMed Central

    McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.

    2016-01-01

    RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848

  18. An Active Immune Defense with a Minimal CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA and without the Cas6 Protein*

    PubMed Central

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita

    2015-01-01

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

  19. Molecular Mechanisms of RNA-Targeting by Cas13-containing Type VI CRISPR-Cas Systems.

    PubMed

    O'Connell, Mitchell

    2018-06-22

    Prokaryotic adaptive immune systems use CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR associated (Cas) proteins for RNA-guided cleavage of foreign genetic elements. The focus of this review, Type VI CRISPR-Cas systems, include a single protein known as Cas13 (formerly C2c2), that when assembled with a crRNA forms a crRNA-guided RNA-targeting effector complex. Type VI CRISPR-Cas systems can be divided into four subtypes (A-D) based on Cas13 phylogeny. All Cas13 proteins studied to date possess two enzymatically distinct ribonuclease activities that are required for optimal interference. One RNase is responsible for pre-crRNA processing to form mature Type VI interference complexes, while the other RNase activity provided by the two HEPN (Higher Eukaryotes and Prokaryotes Nucleotide-binding) domains, is required for degradation of target RNA during viral interference. In this review, I will compare and contrast what is known about the molecular architecture and behavior of Type VI (A-D) CRISPR-Cas13 interference complexes, how this allows them to carry out their RNA-targeting function, how Type VI accessory proteins are able to modulate Cas13 activity, and how together all of these features have led to the rapid development of a range of RNA-targeting applications. Throughout I will also discuss some of the outstanding questions regarding Cas13's molecular behavior, and its role in bacterial adaptive immunity and RNA-targeting applications. Copyright © 2018. Published by Elsevier Ltd.

  20. RNA targeting with CRISPR-Cas13.

    PubMed

    Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng

    2017-10-12

    RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.

  1. CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea

    PubMed Central

    Marraffini, Luciano A.; Sontheimer, Erik J.

    2010-01-01

    Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085

  2. Next-generation libraries for robust RNA interference-based genome-wide screens

    PubMed Central

    Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.

    2015-01-01

    Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438

  3. RNA interference-mediated intrinsic antiviral immunity in invertebrates.

    PubMed

    Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul

    2013-01-01

    In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.

  4. Identification and role of regulatory non-coding RNAs in Listeria monocytogenes.

    PubMed

    Izar, Benjamin; Mraheil, Mobarak Abu; Hain, Torsten

    2011-01-01

    Bacterial regulatory non-coding RNAs control numerous mRNA targets that direct a plethora of biological processes, such as the adaption to environmental changes, growth and virulence. Recently developed high-throughput techniques, such as genomic tiling arrays and RNA-Seq have allowed investigating prokaryotic cis- and trans-acting regulatory RNAs, including sRNAs, asRNAs, untranslated regions (UTR) and riboswitches. As a result, we obtained a more comprehensive view on the complexity and plasticity of the prokaryotic genome biology. Listeria monocytogenes was utilized as a model system for intracellular pathogenic bacteria in several studies, which revealed the presence of about 180 regulatory RNAs in the listerial genome. A regulatory role of non-coding RNAs in survival, virulence and adaptation mechanisms of L. monocytogenes was confirmed in subsequent experiments, thus, providing insight into a multifaceted modulatory function of RNA/mRNA interference. In this review, we discuss the identification of regulatory RNAs by high-throughput techniques and in their functional role in L. monocytogenes.

  5. Effects of Water on the Single-Chain Elasticity of Poly(U) RNA.

    PubMed

    Luo, Zhonglong; Cheng, Bo; Cui, Shuxun

    2015-06-09

    Water, the dominant component under the physiological condition, is a complicated solvent which greatly affects the properties of solute molecules. Here, we utilize atomic force microscope-based single-molecule force spectroscopy to study the influence of water on the single-molecule elasticity of an unstructured single-stranded RNA (poly(U)). In nonpolar solvents, RNA presents its inherent elasticity, which is consistent with the theoretical single-chain elasticity calculated by quantum mechanics calculations. In aqueous buffers, however, an additional energy of 1.88 kJ/mol·base is needed for the stretching of the ssRNA chain. This energy is consumed by the bound water rearrangement (Ew) during chain elongation. Further experimental results indicate that the Ew value is uncorrelated to the salt concentrations and stretching velocity. The results obtained in an 8 M guanidine·HCl solution provide more evidence that the bound water molecules around RNA give rise to the observed deviation between aqueous and nonaqueous environments. Compared to synthetic water-soluble polymers, the value of Ew of RNA is much lower. The weak interference of water is supposed to be the precondition for the RNA secondary structure to exist in aqueous solution.

  6. An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

    PubMed

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

    2015-02-13

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Mutations of RNA splicing factors in hematological malignancies.

    PubMed

    Shukla, Girish C; Singh, Jagjit

    2017-11-28

    Systematic large-scale cancer genomic studies have produced numerous significant findings. These studies have not only revealed new cancer-promoting genes, but they also have identified cancer-promoting functions of previously known "housekeeping" genes. These studies have identified numerous mutations in genes which play a fundamental role in nuclear precursor mRNA splicing. Somatic mutations and copy number variation in many of the splicing factors which participate in the formation of multiple spliceosomal complexes appear to play a role in many cancers and in particular in myelodysplastic syndromes (MDS). Mutated proteins seem to interfere with the recognition of the authentic splice sites (SS) leading to utilization of suboptimal alternative splicing sites generating aberrantly spliced mRNA isoforms. This short review is focusing on the function of the splice factors involved in the formation of splicing complexes and potential mechanisms which affect usage of the authentic splice site recognition. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Type III CRISPR-Cas systems can provide redundancy to counteract viral escape from type I systems.

    PubMed

    Silas, Sukrit; Lucas-Elio, Patricia; Jackson, Simon A; Aroca-Crevillén, Alejandra; Hansen, Loren L; Fineran, Peter C; Fire, Andrew Z; Sánchez-Amat, Antonio

    2017-08-17

    CRISPR-Cas-mediated defense utilizes information stored as spacers in CRISPR arrays to defend against genetic invaders. We define the mode of target interference and role in antiviral defense for two CRISPR-Cas systems in Marinomonas mediterranea . One system (type I-F) targets DNA. A second system (type III-B) is broadly capable of acquiring spacers in either orientation from RNA and DNA, and exhibits transcription-dependent DNA interference. Examining resistance to phages isolated from Mediterranean seagrass meadows, we found that the type III-B machinery co-opts type I-F CRISPR-RNAs. Sequencing and infectivity assessments of related bacterial and phage strains suggests an 'arms race' in which phage escape from the type I-F system can be overcome through use of type I-F spacers by a horizontally-acquired type III-B system. We propose that the phage-host arms race can drive selection for horizontal uptake and maintenance of promiscuous type III interference modules that supplement existing host type I CRISPR-Cas systems.

  9. RNA interference technology to control pest sea lampreys--a proof-of-concept.

    PubMed

    Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven

    2014-01-01

    The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.

  10. RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept

    PubMed Central

    Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven

    2014-01-01

    The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485

  11. Mitochondrial Effects of PGC-1alpha Silencing in MPP+ Treated Human SH-SY5Y Neuroblastoma Cells

    PubMed Central

    Ye, Qinyong; Chen, Chun; Si, Erwang; Cai, Yousheng; Wang, Juhua; Huang, Wanling; Li, Dongzhu; Wang, Yingqing; Chen, Xiaochun

    2017-01-01

    The dopaminergic neuron degeneration and loss that occurs in Parkinson’s disease (PD) has been tightly linked to mitochondrial dysfunction. Although the aged-related cause of the mitochondrial defect observed in PD patients remains unclear, nuclear genes are of potential importance to mitochondrial function. Human peroxisome proliferator-activated receptor γ coactivator-1alpha (PGC-1α) is a multi-functional transcription factor that tightly regulates mitochondrial biogenesis and oxidative capacity. The goal of the present study was to explore the potential pathogenic effects of interference by the PGC-1α gene on N-methyl-4-phenylpyridinium ion (MPP+)-induced SH-SY5Y cells. We utilized RNA interference (RNAi) technology to probe the pathogenic consequences of inhibiting PGC-1α in the SH-SY5Y cell line. Remarkably, a reduction in PGC-1α resulted in the reduction of mitochondrial membrane potential, intracellular ATP content and intracellular H2O2 generation, leading to the translocation of cytochrome c (cyt c) to the cytoplasm in the MPP+-induced PD cell model. The expression of related proteins in the signaling pathway (e.g., estrogen-related receptor α (ERRα), nuclear respiratory factor 1 (NRF-1), NRF-2 and Peroxisome proliferator-activated receptor γ (PPARγ)) also decreased. Our finding indicates that small interfering RNA (siRNA) interference targeting the PGC-1α gene could inhibit the function of mitochondria in several capacities and that the PGC-1α gene may modulate mitochondrial function by regulating the expression of ERRα, NRF-1, NRF-2 and PPARγ. Thus, PGC-1α can be considered a potential therapeutic target for PD. PMID:28611589

  12. Vitamin B6 Generated by Obligate Symbionts Is Critical for Maintaining Proline Homeostasis and Fecundity in Tsetse Flies

    PubMed Central

    Michalkova, Veronika; Weiss, Brian L.; Attardo, Geoffrey M.; Aksoy, Serap

    2014-01-01

    The viviparous tsetse fly utilizes proline as a hemolymph-borne energy source. In tsetse, biosynthesis of proline from alanine involves the enzyme alanine-glyoxylate aminotransferase (AGAT), which requires pyridoxal phosphate (vitamin B6) as a cofactor. This vitamin can be synthesized by tsetse's obligate symbiont, Wigglesworthia glossinidia. In this study, we examined the role of Wigglesworthia-produced vitamin B6 for maintenance of proline homeostasis, specifically during the energetically expensive lactation period of the tsetse's reproductive cycle. We found that expression of agat, as well as genes involved in vitamin B6 metabolism in both host and symbiont, increases in lactating flies. Removal of symbionts via antibiotic treatment of flies (aposymbiotic) led to hypoprolinemia, reduced levels of vitamin B6 in lactating females, and decreased fecundity. Proline homeostasis and fecundity recovered partially when aposymbiotic tsetse were fed a diet supplemented with either yeast or Wigglesworthia extracts. RNA interference-mediated knockdown of agat in wild-type flies reduced hemolymph proline levels to that of aposymbiotic females. Aposymbiotic flies treated with agat short interfering RNA (siRNA) remained hypoprolinemic even upon dietary supplementation with microbial extracts or B vitamins. Flies infected with parasitic African trypanosomes display lower hemolymph proline levels, suggesting that the reduced fecundity observed in parasitized flies could result from parasite interference with proline homeostasis. This interference could be manifested by competition between tsetse and trypanosomes for vitamins, proline, or other factors involved in their synthesis. Collectively, these results indicate that the presence of Wigglesworthia in tsetse is critical for the maintenance of proline homeostasis through vitamin B6 production. PMID:25038091

  13. Vitamin B6 generated by obligate symbionts is critical for maintaining proline homeostasis and fecundity in tsetse flies.

    PubMed

    Michalkova, Veronika; Benoit, Joshua B; Weiss, Brian L; Attardo, Geoffrey M; Aksoy, Serap

    2014-09-01

    The viviparous tsetse fly utilizes proline as a hemolymph-borne energy source. In tsetse, biosynthesis of proline from alanine involves the enzyme alanine-glyoxylate aminotransferase (AGAT), which requires pyridoxal phosphate (vitamin B6) as a cofactor. This vitamin can be synthesized by tsetse's obligate symbiont, Wigglesworthia glossinidia. In this study, we examined the role of Wigglesworthia-produced vitamin B6 for maintenance of proline homeostasis, specifically during the energetically expensive lactation period of the tsetse's reproductive cycle. We found that expression of agat, as well as genes involved in vitamin B6 metabolism in both host and symbiont, increases in lactating flies. Removal of symbionts via antibiotic treatment of flies (aposymbiotic) led to hypoprolinemia, reduced levels of vitamin B6 in lactating females, and decreased fecundity. Proline homeostasis and fecundity recovered partially when aposymbiotic tsetse were fed a diet supplemented with either yeast or Wigglesworthia extracts. RNA interference-mediated knockdown of agat in wild-type flies reduced hemolymph proline levels to that of aposymbiotic females. Aposymbiotic flies treated with agat short interfering RNA (siRNA) remained hypoprolinemic even upon dietary supplementation with microbial extracts or B vitamins. Flies infected with parasitic African trypanosomes display lower hemolymph proline levels, suggesting that the reduced fecundity observed in parasitized flies could result from parasite interference with proline homeostasis. This interference could be manifested by competition between tsetse and trypanosomes for vitamins, proline, or other factors involved in their synthesis. Collectively, these results indicate that the presence of Wigglesworthia in tsetse is critical for the maintenance of proline homeostasis through vitamin B6 production. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. [RNA interference library research progress and its application in cancer research].

    PubMed

    Zhao, Ning; Cai, Li

    2013-02-01

    RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.

  15. Exploring Fusarium head blight disease control by RNA interference

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...

  16. Compositions and Methods for Inhibiting Gene Expressions

    NASA Technical Reports Server (NTRS)

    Williams, Loren D. (Inventor); Hsiao, Chiaolong (Inventor); Fang, Po-Yu (Inventor); Williams, Justin (Inventor)

    2018-01-01

    A combined packing and assembly method that efficiently packs ribonucleic acid (RNA) into virus like particles (VLPs) has been developed. The VLPs can spontaneously assemble and load RNA in vivo, efficiently packaging specifically designed RNAs at high densities and with high purity. In some embodiments the RNA is capable of interference activity, or is a precursor of a RNA capable of causing interference activity. Compositions and methods for the efficient expression, production and purification of VLP-RNAs are provided. VLP-RNAs can be used for the storage of RNA for long periods, and provide the ability to deliver RNA in stable form that is readily taken up by cells.

  17. Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

    DOE PAGES

    Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...

    2016-10-13

    The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

  18. Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia

    The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

  19. Bacterial delivery of RNAi effectors: transkingdom RNAi.

    PubMed

    Lage, Hermann; Krühn, Andrea

    2010-08-18

    RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.

  20. RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

    PubMed Central

    Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

    2016-01-01

    Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

  1. Modeling RNA interference in mammalian cells

    PubMed Central

    2011-01-01

    Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of parameters with an intuitive physical meaning, that makes it a unique and reliable mathematical tool. The findings here presented will be a useful instrument for better understanding RNAi biology and as modelling tool in Systems and Synthetic Biology. PMID:21272352

  2. Reduction of CD147 surface expression on primary T cells leads to enhanced cell proliferation.

    PubMed

    Biegler, Brian; Kasinrerk, Watchara

    2012-12-01

    CD147 is a ubiquitously expressed membrane glycoprotein that has numerous functional associations in health and disease. However, the molecular mechanisms by which CD147 participates in these processes are unclear. Establishing physiologically relevant silencing of CD147 in primary T cells could provide clues essential for elucidating some aspects of CD147 biology. To date, achieving the knockdown of CD147 in primary T cells has remained elusive. Utilizing RNA interference and the Nucleofector transfection system, we were able to reduce the expression of CD147 in primary T cells. Comparison of basic functions, such as proliferation and CD25 expression, were then made between control populations and populations with reduced expression. Up-regulation of CD147 was found upon T-cell activation, indicating a role in T-cell responses. To better understand the possible importance of this up-regulation, we knocked down the expression of CD147 using RNA interference. When compared to control populations the CD147 knockdown populations exhibited increased proliferation. This alteration of cell proliferation, however, was not linked to a change in CD25 expression. We achieved reduction of CD147 surface expression in primary T cells by siRNA-mediated gene silencing. Our results point to CD147 having a possible negative regulatory role in T cell-mediated immune responses.

  3. RNA interference: from biology to drugs and therapeutics.

    PubMed

    Appasani, Krishnarao

    2004-07-01

    RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.

  4. Chemical modification: the key to clinical application of RNA interference?

    PubMed Central

    Corey, David R.

    2007-01-01

    RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019

  5. The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

    PubMed

    Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

    1999-10-15

    Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

  6. Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.

    PubMed Central

    Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K

    1995-01-01

    We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978

  7. RNA interference for functional genomics and improvement of cotton (Gossypium species)

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...

  8. Silence of the transcripts: RNA interference in medicine.

    PubMed

    Barik, Sailen

    2005-10-01

    Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.

  9. Understanding the core of RNA interference: The dynamic aspects of Argonaute-mediated processes.

    PubMed

    Zhu, Lizhe; Jiang, Hanlun; Sheong, Fu Kit; Cui, Xuefeng; Wang, Yanli; Gao, Xin; Huang, Xuhui

    2017-09-01

    At the core of RNA interference, the Argonaute proteins (Ago) load and utilize small guide nucleic acids to silence mRNAs or cleave foreign nucleic acids in a sequence specific manner. In recent years, based on extensive structural studies of Ago and its interaction with the nucleic acids, considerable progress has been made to reveal the dynamic aspects of various Ago-mediated processes. Here we review these novel insights into the guide-strand loading, duplex unwinding, and effects of seed mismatch, with a focus on two representative Agos, the human Ago 2 (hAgo2) and the bacterial Thermus thermophilus Ago (TtAgo). In particular, comprehensive molecular simulation studies revealed that although sharing similar overall structures, the two Agos have vastly different conformational landscapes and guide-strand loading mechanisms because of the distinct rigidity of their L1-PAZ hinge. Given the central role of the PAZ motions in regulating the exposure of the nucleic acid binding channel, these findings exemplify the importance of protein motions in distinguishing the overlapping, yet distinct, mechanisms of Ago-mediated processes in different organisms. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Gene silencing efficiency and INF-β induction effects of splicing miRNA 155-based artificial miRNA with pre-miRNA stem-loop structures.

    PubMed

    Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin

    2012-02-01

    Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.

  11. CRISPR/Cas9: From Genome Engineering to Cancer Drug Discovery

    PubMed Central

    Luo, Ji

    2016-01-01

    Advances in translational research are often driven by new technologies. The advent of microarrays, next-generation sequencing, proteomics and RNA interference (RNAi) have led to breakthroughs in our understanding of the mechanisms of cancer and the discovery of new cancer drug targets. The discovery of the bacterial clustered regularly interspaced palindromic repeat (CRISPR) system and its subsequent adaptation as a tool for mammalian genome engineering has opened up new avenues for functional genomics studies. This review will focus on the utility of CRISPR in the context of cancer drug target discovery. PMID:28603775

  12. RNAi or overexpression: Alternative therapies for Spinocerebellar Ataxia Type 1

    PubMed Central

    Keiser, Megan S.; Geoghegan, James C.; Boudreau, Ryan L.; Lennox, Kim A.; Davidson, Beverly L.

    2014-01-01

    Spinocerebellar Ataxia Type 1 (SCA1) is an autosomal dominant late onset neurodegenerative disease caused by an expanded polyglutamine tract in ataxin-1. Here, we compared the protective effects of overexpressing ataxin-1-like using recombinant AAVs, or reducing expression of mutant ataxin-1 using virally delivered RNA interference (RNAi), in a transgenic mouse model of SCA1. For the latter, we used an artificial microRNA (miR) design that optimizes potency, efficacy and safety to suppress ataxin-1 expression (miS1). Delivery of either ataxin-1-like or miS1 viral vectors to SCA1 mice cerebella resulted in widespread cerebellar Purkinje cell transduction and improved behavioral and histological phenotypes. Our data indicate the utility of either approach as a possible therapy for SCA1 patients. PMID:23583610

  13. A Cellular High-Throughput Screening Approach for Therapeutic trans-Cleaving Ribozymes and RNAi against Arbitrary mRNA Disease Targets

    PubMed Central

    Yau, Edwin H.; Butler, Mark C.; Sullivan, Jack M.

    2016-01-01

    Major bottlenecks in development of therapeutic post transcriptional gene silencing (PTGS) agents (e.g. ribozymes, RNA interference, antisense) include the challenge of mapping rare accessible regions of the mRNA target that are open for annealing and cleavage, testing and optimization of agents in human cells to identify lead agents, testing for cellular toxicity, and preclinical evaluation in appropriate animal models of disease. Methods for rapid and reliable cellular testing of PTGS agents are needed to identify potent lead candidates for optimization. Our goal was to develop a means of rapid assessment of many RNA agents to identify a lead candidate for a given mRNA associated with a disease state. We developed a rapid human cell-based screening platform to test efficacy of hammerhead ribozyme (hhRz) or RNA interference (RNAi) constructs, using a model retinal degeneration target, human rod opsin (RHO) mRNA. The focus is on RNA Drug Discovery for diverse retinal degeneration targets. To validate the approach, candidate hhRzs were tested against NUH↓ cleavage sites (N=G,C,A,U; H=C,A,U) within the target mRNA of secreted alkaline phosphatase (SEAP), a model gene expression reporter, based upon in silico predictions of mRNA accessibility. HhRzs were embedded in a larger stable adenoviral VAI RNA scaffold for high cellular expression, cytoplasmic trafficking, and stability. Most hhRz expression plasmids exerted statistically significant knockdown of extracellular SEAP enzyme activity when readily assayed by a fluorescence enzyme assay intended for high throughput screening (HTS). Kinetics of PTGS knockdown of cellular targets is measureable in live cells with the SEAP reporter. The validated SEAP HTS platform was transposed to identify lead PTGS agents against a model hereditary retinal degeneration target, RHO mRNA. Two approaches were used to physically fuse the model retinal gene target mRNA to the SEAP reporter mRNA. The most expedient way to evaluate a large set of potential VAI-hhRz expression plasmids against diverse NUH↓ cleavage sites uses cultured human HEK293S cells stably expressing a dicistronic Target-IRES-SEAP target fusion mRNA. Broad utility of this rational RNA drug discovery approach is feasible for any ophthalmological disease-relevant mRNA targets and any disease mRNA targets in general. The approach will permit rank ordering of PTGS agents based on potency to identify a lead therapeutic compound for further optimization. PMID:27233447

  14. shRNA target prediction informed by comprehensive enquiry (SPICE): a supporting system for high-throughput screening of shRNA library.

    PubMed

    Kamatuka, Kenta; Hattori, Masahiro; Sugiyama, Tomoyasu

    2016-12-01

    RNA interference (RNAi) screening is extensively used in the field of reverse genetics. RNAi libraries constructed using random oligonucleotides have made this technology affordable. However, the new methodology requires exploration of the RNAi target gene information after screening because the RNAi library includes non-natural sequences that are not found in genes. Here, we developed a web-based tool to support RNAi screening. The system performs short hairpin RNA (shRNA) target prediction that is informed by comprehensive enquiry (SPICE). SPICE automates several tasks that are laborious but indispensable to evaluate the shRNAs obtained by RNAi screening. SPICE has four main functions: (i) sequence identification of shRNA in the input sequence (the sequence might be obtained by sequencing clones in the RNAi library), (ii) searching the target genes in the database, (iii) demonstrating biological information obtained from the database, and (iv) preparation of search result files that can be utilized in a local personal computer (PC). Using this system, we demonstrated that genes targeted by random oligonucleotide-derived shRNAs were not different from those targeted by organism-specific shRNA. The system facilitates RNAi screening, which requires sequence analysis after screening. The SPICE web application is available at http://www.spice.sugysun.org/.

  15. Logic integration of mRNA signals by an RNAi-based molecular computer.

    PubMed

    Xie, Zhen; Liu, Siyuan John; Bleris, Leonidas; Benenson, Yaakov

    2010-05-01

    Synthetic in vivo molecular 'computers' could rewire biological processes by establishing programmable, non-native pathways between molecular signals and biological responses. Multiple molecular computer prototypes have been shown to work in simple buffered solutions. Many of those prototypes were made of DNA strands and performed computations using cycles of annealing-digestion or strand displacement. We have previously introduced RNA interference (RNAi)-based computing as a way of implementing complex molecular logic in vivo. Because it also relies on nucleic acids for its operation, RNAi computing could benefit from the tools developed for DNA systems. However, these tools must be harnessed to produce bioactive components and be adapted for harsh operating environments that reflect in vivo conditions. In a step toward this goal, we report the construction and implementation of biosensors that 'transduce' mRNA levels into bioactive, small interfering RNA molecules via RNA strand exchange in a cell-free Drosophila embryo lysate, a step beyond simple buffered environments. We further integrate the sensors with our RNAi 'computational' module to evaluate two-input logic functions on mRNA concentrations. Our results show how RNA strand exchange can expand the utility of RNAi computing and point toward the possibility of using strand exchange in a native biological setting.

  16. Logic integration of mRNA signals by an RNAi-based molecular computer

    PubMed Central

    Xie, Zhen; Liu, Siyuan John; Bleris, Leonidas; Benenson, Yaakov

    2010-01-01

    Synthetic in vivo molecular ‘computers’ could rewire biological processes by establishing programmable, non-native pathways between molecular signals and biological responses. Multiple molecular computer prototypes have been shown to work in simple buffered solutions. Many of those prototypes were made of DNA strands and performed computations using cycles of annealing-digestion or strand displacement. We have previously introduced RNA interference (RNAi)-based computing as a way of implementing complex molecular logic in vivo. Because it also relies on nucleic acids for its operation, RNAi computing could benefit from the tools developed for DNA systems. However, these tools must be harnessed to produce bioactive components and be adapted for harsh operating environments that reflect in vivo conditions. In a step toward this goal, we report the construction and implementation of biosensors that ‘transduce’ mRNA levels into bioactive, small interfering RNA molecules via RNA strand exchange in a cell-free Drosophila embryo lysate, a step beyond simple buffered environments. We further integrate the sensors with our RNAi ‘computational’ module to evaluate two-input logic functions on mRNA concentrations. Our results show how RNA strand exchange can expand the utility of RNAi computing and point toward the possibility of using strand exchange in a native biological setting. PMID:20194121

  17. RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design

    USDA-ARS?s Scientific Manuscript database

    Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...

  18. Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.

    PubMed

    Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien

    2017-08-01

    RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.

  19. Domain motions of Argonaute, the catalytic engine of RNA interference

    PubMed Central

    Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

    2007-01-01

    Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142

  20. Domain motions of Argonaute, the catalytic engine of RNA interference.

    PubMed

    Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

    2007-11-30

    The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.

  1. Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences.

    PubMed

    Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

    2018-01-01

    RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.

  2. Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

    PubMed Central

    Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

    2018-01-01

    RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

  3. Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

    PubMed

    Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

    2018-02-01

    Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  4. Vector-based RNA interference against vascular endothelial growth factor-A significantly limits vascularization and growth of prostate cancer in vivo.

    PubMed

    Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia

    2005-12-01

    RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.

  5. Lipopolysaccharide promotes pulmonary fibrosis in acute respiratory distress syndrome (ARDS) via lincRNA-p21 induced inhibition of Thy-1 expression.

    PubMed

    Zhou, Wen-Qin; Wang, Peng; Shao, Qiu-Ping; Wang, Jian

    2016-08-01

    Acute respiratory distress syndrome (ARDS) is a common clinical disorder characterized by pulmonary edema leading to acute lung damage and arterial hypoxemia. Pulmonary fibrosis is a progressive, fibrotic lung disorder, whose pathogenesis in ARDS remains speculative. LincRNA-p21 was a novel regulator of cell proliferation, apoptosis and DNA damage response. This study aims to investigate the effects and mechanism of lincRNA-p21 on pulmonary fibrosis in ARDS. Purified 10 mg/kg LPS was dropped into airways of C57BL/6 mice. Expression levels of lincRNA-p21 and Thy-1 were measured by real-time PCR or western blotting. Proliferation of lung fibroblasts was analyzed by BrdU incorporation assay. Lung and BAL collagen contents were estimated using colorimetric Sircol assay. LincRNA-p21 expression was time-dependently increased and Thy-1 expression was time-dependently reduced in a mouse model of ARDS and in LPS-treated lung fibroblasts. Meanwhile, lung fibroblast proliferation was also time-dependently elevated in LPS-treated lung fibroblasts. In addition, lung fibroblast proliferation could be promoted by lincRNA-p21 overexpression and LPS treatment, however, the elevated lung fibroblast proliferation was further abrogated by Thy-1 overexpression or lincRNA-p21 interference. And Thy-1 interference could elevate cell viability of lung fibroblasts and rescue the reduction of lung fibroblast proliferation induced by lincRNA-p21 interference. Moreover, lincRNA-p21 overexpression dramatically inhibited acetylation of H3 and H4 at the Thy-1 promoter and Thy-1 expression levels in HLF1 cells. Finally, lincRNA-p21 interference rescued LPS-induced increase of lung and BAL collagen contents. LincRNA-p21 could lead to pulmonary fibrosis in ARDS by inhibition of the expression of Thy-1.

  6. Intergenic Transcriptional Interference Is Blocked by RNA Polymerase III Transcription Factor TFIIIB in Saccharomyces cerevisiae

    PubMed Central

    Korde, Asawari; Rosselot, Jessica M.; Donze, David

    2014-01-01

    The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746

  7. Prokaryotic Argonautes - variations on the RNA interference theme.

    PubMed

    van der Oost, John; Swarts, Daan C; Jore, Matthijs M

    2014-04-15

    The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.

  8. Prokaryotic Argonautes - variations on the RNA interference theme

    PubMed Central

    van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.

    2014-01-01

    The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239

  9. Achieving large dynamic range control of gene expression with a compact RNA transcription–translation regulator

    PubMed Central

    2017-01-01

    Abstract RNA transcriptional regulators are emerging as versatile components for genetic network construction. However, these regulators suffer from incomplete repression in their OFF state, making their dynamic range less than that of their protein counterparts. This incomplete repression causes expression leak, which impedes the construction of larger synthetic regulatory networks as leak propagation can interfere with desired network function. To address this, we demonstrate how naturally derived antisense RNA-mediated transcriptional regulators can be configured to regulate both transcription and translation in a single compact RNA mechanism that functions in Escherichia coli. Using in vivo gene expression assays, we show that a combination of transcriptional termination and ribosome binding site sequestration increases repression from 85% to 98%, or activation from 10-fold to over 900-fold, in response to cognate antisense RNAs. We also show that orthogonal repressive versions of this mechanism can be created through engineering minimal antisense RNAs. Finally, to demonstrate the utility of this mechanism, we use it to reduce network leak in an RNA-only cascade. We anticipate these regulators will find broad use as synthetic biology moves beyond parts engineering to the design and construction of more sophisticated regulatory networks. PMID:28387839

  10. Interplay between the catabolite repression control protein Crc, Hfq and RNA in Hfq-dependent translational regulation in Pseudomonas aeruginosa

    PubMed Central

    Wulf, Alexander; Campagne, Sébastien; Pei, Xue-Yuan; Forlani, Giada; Prindl, Konstantin; Abdou, Laetitia; Resch, Armin; Allain, Frederic H -T; Luisi, Ben F; Urlaub, Henning

    2018-01-01

    Abstract In Pseudomonas aeruginosa the RNA chaperone Hfq and the catabolite repression control protein (Crc) act as post-transcriptional regulators during carbon catabolite repression (CCR). In this regard Crc is required for full-fledged Hfq-mediated translational repression of catabolic genes. RNAseq based transcriptome analyses revealed a significant overlap between the Crc and Hfq regulons, which in conjunction with genetic data supported a concerted action of both proteins. Biochemical and biophysical approaches further suggest that Crc and Hfq form an assembly in the presence of RNAs containing A-rich motifs, and that Crc interacts with both, Hfq and RNA. Through these interactions, Crc enhances the stability of Hfq/Crc/RNA complexes, which can explain its facilitating role in Hfq-mediated translational repression. Hence, these studies revealed for the first time insights into how an interacting protein can modulate Hfq function. Moreover, Crc is shown to interfere with binding of a regulatory RNA to Hfq, which bears implications for riboregulation. These results are discussed in terms of a working model, wherein Crc prioritizes the function of Hfq toward utilization of favored carbon sources. PMID:29244160

  11. Interplay between the catabolite repression control protein Crc, Hfq and RNA in Hfq-dependent translational regulation in Pseudomonas aeruginosa.

    PubMed

    Sonnleitner, Elisabeth; Wulf, Alexander; Campagne, Sébastien; Pei, Xue-Yuan; Wolfinger, Michael T; Forlani, Giada; Prindl, Konstantin; Abdou, Laetitia; Resch, Armin; Allain, Frederic H-T; Luisi, Ben F; Urlaub, Henning; Bläsi, Udo

    2018-02-16

    In Pseudomonas aeruginosa the RNA chaperone Hfq and the catabolite repression control protein (Crc) act as post-transcriptional regulators during carbon catabolite repression (CCR). In this regard Crc is required for full-fledged Hfq-mediated translational repression of catabolic genes. RNAseq based transcriptome analyses revealed a significant overlap between the Crc and Hfq regulons, which in conjunction with genetic data supported a concerted action of both proteins. Biochemical and biophysical approaches further suggest that Crc and Hfq form an assembly in the presence of RNAs containing A-rich motifs, and that Crc interacts with both, Hfq and RNA. Through these interactions, Crc enhances the stability of Hfq/Crc/RNA complexes, which can explain its facilitating role in Hfq-mediated translational repression. Hence, these studies revealed for the first time insights into how an interacting protein can modulate Hfq function. Moreover, Crc is shown to interfere with binding of a regulatory RNA to Hfq, which bears implications for riboregulation. These results are discussed in terms of a working model, wherein Crc prioritizes the function of Hfq toward utilization of favored carbon sources.

  12. Type III CRISPR-Cas systems can provide redundancy to counteract viral escape from type I systems

    PubMed Central

    Silas, Sukrit; Lucas-Elio, Patricia; Jackson, Simon A; Aroca-Crevillén, Alejandra; Hansen, Loren L; Fineran, Peter C

    2017-01-01

    CRISPR-Cas-mediated defense utilizes information stored as spacers in CRISPR arrays to defend against genetic invaders. We define the mode of target interference and role in antiviral defense for two CRISPR-Cas systems in Marinomonas mediterranea. One system (type I-F) targets DNA. A second system (type III-B) is broadly capable of acquiring spacers in either orientation from RNA and DNA, and exhibits transcription-dependent DNA interference. Examining resistance to phages isolated from Mediterranean seagrass meadows, we found that the type III-B machinery co-opts type I-F CRISPR-RNAs. Sequencing and infectivity assessments of related bacterial and phage strains suggests an ‘arms race’ in which phage escape from the type I-F system can be overcome through use of type I-F spacers by a horizontally-acquired type III-B system. We propose that the phage-host arms race can drive selection for horizontal uptake and maintenance of promiscuous type III interference modules that supplement existing host type I CRISPR-Cas systems. PMID:28826484

  13. RNA Interference Based Approach to Down Regulate Osmoregulators of Whitefly (Bemisia tabaci): Potential Technology for the Control of Whitefly

    USDA-ARS?s Scientific Manuscript database

    Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...

  14. RNA interference as a method for target-site screening in the Western Corn Rootworm, Diabrotica virgifera virgifera

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...

  15. A Simple Laboratory Practical to Illustrate RNA Mediated Gene Interference Using Drosophila Cell Culture

    ERIC Educational Resources Information Center

    Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak

    2010-01-01

    RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…

  16. How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference

    ERIC Educational Resources Information Center

    Kuldell, Natalie H.

    2006-01-01

    It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…

  17. RNA interference in the Asian Longhorned Beetle:Identification of Key RNAi Genes and Reference Genes for RT-qPCR

    USDA-ARS?s Scientific Manuscript database

    Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...

  18. Inhibition of HBV replication in vivo using helper-dependent adenovirus vectors to deliver antiviral RNA interference expression cassettes.

    PubMed

    Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B

    2014-01-01

    HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.

  19. Next-generation RNA-based fluorescent biosensors enable anaerobic detection of cyclic di-GMP

    PubMed Central

    Wang, Xin C.; Wilson, Stephen C.; Hammond, Ming C.

    2016-01-01

    Bacteria occupy a diverse set of environmental niches with differing oxygen availability. Anaerobic environments such as mammalian digestive tracts and industrial reactors harbor an abundance of both obligate and facultative anaerobes, many of which play significant roles in human health and biomanufacturing. Studying bacterial function under partial or fully anaerobic conditions, however, is challenging given the paucity of suitable live-cell imaging tools. Here, we introduce a series of RNA-based fluorescent biosensors that respond selectively to cyclic di-GMP, an intracellular bacterial second messenger that controls cellular motility and biofilm formation. We demonstrate the utility of these biosensors in vivo under both aerobic and anaerobic conditions, and we show that biosensor expression does not interfere with the native motility phenotype. Together, our results attest to the effectiveness and versatility of RNA-based fluorescent biosensors, priming further development and application of these and other analogous sensors to study host–microbial and microbial–microbial interactions through small molecule signals. PMID:27382070

  20. [RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].

    PubMed

    Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente

    2010-01-01

    RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.

  1. Improved silencing properties using small internally segmented interfering RNAs

    PubMed Central

    Bramsen, Jesper B.; Laursen, Maria B.; Damgaard, Christian K.; Lena, Suzy W.; Ravindra Babu, B.; Wengel, Jesper; Kjems, Jørgen

    2007-01-01

    RNA interference is mediated by small interfering RNAs (siRNAs) that upon incorporation into the RNA-induced silencing complex (RISC) can target complementary mRNA for degradation. Standard siRNA design usually feature a 19–27 base pair contiguous double-stranded region that is believed to be important for RISC incorporation. Here, we describe a novel siRNA design composed of an intact antisense strand complemented with two shorter 10–12 nt sense strands. This three-stranded construct, termed small internally segmented interfering RNA (sisiRNA), is highly functional demonstrating that an intact sense strand is not a prerequisite for RNA interference. Moreover, when using the sisiRNA design only the antisense strand is functional in activated RISC thereby completely eliminating unintended mRNA targeting by the sense strand. Interestingly, the sisiRNA design supports the function of chemically modified antisense strands, which are non-functional within the context of standard siRNA designs. This suggests that the sisiRNA design has a clear potential of improving the pharmacokinetic properties of siRNA in vivo. PMID:17726057

  2. Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

    USDA-ARS?s Scientific Manuscript database

    Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

  3. An enzyme free electrochemical biosensor for sensitive detection of miRNA with a high discrimination factor by coupling the strand displacement reaction and catalytic hairpin assembly recycling.

    PubMed

    Yao, Juan; Zhang, Zhang; Deng, Zhenghua; Wang, Youqiang; Guo, Yongcan

    2017-10-23

    An isothermal, enzyme free, ultra-specific and ultra-sensitive protocol for electrochemical detection of miRNAs is proposed based on the toehold-mediated strand displacement reaction (SDR) and non-enzymatic catalytic hairpin reaction (CHA) recycling. The SDR was first triggered only in the presence of target miRNA and this process also affects other miRNA interferences having similar target sequences, thus guaranteeing a high discrimination factor and could be used in rare content miRNA detection with various amounts of interferences having similar target sequences. The output protector strand then triggered enzyme free CHA amplification and generates plenty of hairpin self-assembly products. This process in turn influences SDR equilibrium to move to the right and generates large amounts of protector output to ensure analysis sensitivity. Compared with traditional CHA, our proposed method greatly improved the signal to noise ratio and shows excellent performance in rare miRNA detection with miRNA analogue interference. Under the optimal experimental conditions and using square wave voltammetry, the established biosensor could detect target miRNA-21 down to 30 fM (S/N = 3) with a dynamic range from 100 fM to 2 nM, and discriminate rare target miRNA-21 from mismatched miRNA with high selectivity. This method holds great promise in miRNA detection from human cancer cell lines and would be a versatile and powerful tool for clinical molecular diagnostics.

  4. Using RNA interference to knock down the adhesion protein TES.

    PubMed

    Griffith, Elen

    2007-01-01

    RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.

  5. The RNA-induced silencing complex: a versatile gene-silencing machine.

    PubMed

    Pratt, Ashley J; MacRae, Ian J

    2009-07-03

    RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNA interference is mediated by a family of ribonucleoprotein complexes called RNA-induced silencing complexes (RISCs), which can be programmed to target virtually any nucleic acid sequence for silencing. The ability of RISC to locate target RNAs has been co-opted by evolution many times to generate a broad spectrum of gene-silencing pathways. Here, we review the fundamental biochemical and biophysical properties of RISC that facilitate gene targeting and describe the various mechanisms of gene silencing known to exploit RISC activity.

  6. TPP-dendrimer nanocarriers for siRNA delivery to the pulmonary epithelium and their dry powder and metered-dose inhaler formulations.

    PubMed

    Bielski, Elizabeth; Zhong, Qian; Mirza, Hamad; Brown, Matthew; Molla, Ashura; Carvajal, Teresa; da Rocha, Sandro R P

    2017-07-15

    The regulation of genes utilizing the RNA interference (RNAi) mechanism via the delivery of synthetic siRNA has great potential in the treatment of a variety of lung diseases. However, the delivery of siRNA to the lungs is challenging due to the poor bioavailability of siRNA when delivered intraveneously, and difficulty in formulating and maintaining the activity of free siRNA when delivered directly to the lungs using inhalation devices. The use of non-viral vectors such as cationic dendrimers can help enhance the stability of siRNA and its delivery to the cell cytosol. Therefore, in this work, we investigate the ability of a triphenylphosphonium (TPP) modified generation 4 poly(amidoamine) (PAMAM) dendrimer (G4NH 2 -TPP) to enhance the in vitro transfection efficiency of siRNA in a model of the pulmonary epithelium and their aerosol formulations in pressurized metered dose inhalers (pMDIs) and dry powder inhalers (DPIs). Complexes of siRNA and G4NH 2 -TPP were prepared with varying TPP densities and increasing N/P ratios. The complexation efficiency was modulated by the presence of the TPP on the dendrimer surface, allowing for a looser complexation compared to unmodified dendrimer as determined by gel electrophoresis and polyanion competition assay. An increase in TPP density and N/P ratio led to an increase in the in vitro gene knockdown of stably green fluorescent protein (eGFP) expressing lung alveolar epithelial (A549) cells. G4NH 2 -12TPP dendriplexes (G4NH 2 PAMAM dendrimers containing 12 TPP molecules on the surface complexed with siRNA) at N/P ratio 30 showed the highest in vitro gene knockdown efficiency. To assess the potential of TPP-dendriplexes for pulmonary use, we also developed micron particle technologies for both pMDIs and DPIs and determined their aerosol characteristics utilizing an Andersen Cascade Impactor (ACI). Mannitol microparticles encapsulating 12TPP-dendriplexes were shown to be effective in producing aerosols suitable for deep lung deposition for both pMDI formulations (fine particle fraction of 50-53%) and DPI formulations (fine particle fraction of 39%) with no impact on the in vitro gene knockdown efficiency of the siRNA. This work demonstrates the potential benefits of utilizing TPP-conjugated dendrimers in the formation of dendriplexes for siRNA delivery to the pulmonary epithelium and their aerosol formulation for local delivery to the lungs using portable inhalers. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

    PubMed

    Parrish, S; Fire, A

    2001-10-01

    RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.

  8. Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

    PubMed Central

    Parrish, S; Fire, A

    2001-01-01

    RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844

  9. Guanosine 2-NH2 groups of Escherichia coli RNase P RNA involved in intramolecular tertiary contacts and direct interactions with tRNA.

    PubMed Central

    Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K

    1999-01-01

    We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070

  10. EGFP-EGF1-Conjugated PLGA Nanoparticles for Targeted Delivery of siRNA into Injured Brain Microvascular Endothelial Cells for Efficient RNA Interference

    PubMed Central

    Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu

    2013-01-01

    Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330

  11. Double-stranded RNA interferes in a sequence-specific manner with the infection of representative members of the two viroid families

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo

    2008-02-05

    Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less

  12. Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

    PubMed

    Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

    2014-05-16

    Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

  13. Designing highly active siRNAs for therapeutic applications.

    PubMed

    Walton, S Patrick; Wu, Ming; Gredell, Joseph A; Chan, Christina

    2010-12-01

    The discovery of RNA interference (RNAi) generated considerable interest in developing short interfering RNAs (siRNAs) for understanding basic biology and as the active agents in a new variety of therapeutics. Early studies showed that selecting an active siRNA was not as straightforward as simply picking a sequence on the target mRNA and synthesizing the siRNA complementary to that sequence. As interest in applying RNAi has increased, the methods for identifying active siRNA sequences have evolved from focusing on the simplicity of synthesis and purification, to identifying preferred target sequences and secondary structures, to predicting the thermodynamic stability of the siRNA. As more specific details of the RNAi mechanism have been defined, these have been incorporated into more complex siRNA selection algorithms, increasing the reliability of selecting active siRNAs against a single target. Ultimately, design of the best siRNA therapeutics will require design of the siRNA itself, in addition to design of the vehicle and other components necessary for it to function in vivo. In this minireview, we summarize the evolution of siRNA selection techniques with a particular focus on one issue of current importance to the field, how best to identify those siRNA sequences likely to have high activity. Approaches to designing active siRNAs through chemical and structural modifications will also be highlighted. As the understanding of how to control the activity and specificity of siRNAs improves, the potential utility of siRNAs as human therapeutics will concomitantly grow. © 2010 The Authors Journal compilation © 2010 FEBS.

  14. A potential role for RNA interference in controlling the activity of the human LINE-1 retrotransposon.

    PubMed

    Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J

    2005-01-01

    Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.

  15. Cardiovascular RNA interference therapy: the broadening tool and target spectrum.

    PubMed

    Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina

    2013-08-16

    Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.

  16. Small Interfering RNA-Mediated Suppression of Fas Modulate Apoptosis and Proliferation in Rat Intervertebral Disc Cells.

    PubMed

    Park, Jong-Beom; Park, Chanjoo

    2017-10-01

    In vitro cell culture model. To investigate the effect of small interfering RNA (siRNA) on Fas expression, apoptosis, and proliferation in serum-deprived rat disc cells. Synthetic siRNA can trigger an RNA interference (RNAi) response in mammalian cells and precipitate the inhibition of specific gene expression. However, the potential utility of siRNA technology in downregulation of specific genes associated with disc cell apoptosis remains unclear. Rat disc cells were isolated and cultured in the presence of either 10% fetal bovine serum (FBS) (normal control) or 0% FBS (serum deprivation to induce apoptosis) for 48 hours. Fas expression, apoptosis, and proliferation were determined. Additionally, siRNA oligonucleotides against Fas (Fas siRNA) were transfected into rat disc cells to suppress Fas expression. Changes in Fas expression were assessed by reverse transcription-polymerase chain reaction and semiquantitatively analyzed using densitometry. The effect of Fas siRNA on apoptosis and proliferation of rat disc cells were also determined. Negative siRNA and transfection agent alone (Mock) were used as controls. Serum deprivation increased apoptosis by 40.3% ( p <0.001), decreased proliferation by 45.3% ( p <0.001), and upregulated Fas expression. Additionally, Fas siRNA suppressed Fas expression in serum-deprived cultures, with 68.5% reduction at the mRNA level compared to the control cultures ( p <0.001). Finally, Fas siRNA-mediated suppression of Fas expression significantly inhibited apoptosis by 9.3% and increased proliferation by 21% in serum-deprived cultures ( p <0.05 for both). The observed dual positive effect of Fas siRNA might be a powerful therapeutic approach for disc degeneration by suppression of harmful gene expression.

  17. SiLEncing SLE: the power and promise of small noncoding RNAs.

    PubMed

    Rigby, Robert J; Vinuesa, Carola G

    2008-09-01

    In this study, we outline the evidence suggesting that defects in the RNA silencing machinery can lead to the prototypic systemic autoimmune disease, systemic lupus erythematosus, and describe the potential for RNA interference to provide novel therapeutic agents. Over the last year, a class of small noncoding RNAs--microRNAs--have been shown to play key roles in immune regulation including T-cell selection in the thymus, B cell affinity maturation and selection in germinal centres, and development of regulatory T cells, suggesting that the microRNA machinery may be crucial in the maintenance of immunological tolerance. Two RNA silencing mechanisms have been shown to be involved in lupus pathogenesis: failed Roquin-mediated repression of inducible costimulatory receptors messenger RNA through miR-101 in roquin(san/san) mice and decreased expression of pro-apoptotic molecule and phosphatase and tensin homologue on chromosome 10 in mice transgenic for the miR-17-92 cluster, leading to lymphoproliferation and other lupus manisfestations. MicroRNA array experiments performed on peripheral blood mononuclear cells have revealed different expression profiles in systemic lupus erythematosus patients. RNA interference has also been used ex vivo to silence dysregulated T-cell molecules in cells from systemic lupus erythematosus patients. Dysregulation of the RNA silencing machinery has been implicated in systemic lupus erythematosus pathogenesis. Although microRNA profiling may prove to be a useful diagnostic and prognostic tool for a notoriously heterogeneous disease, manipulation of RNA interference emerges as a powerful and potentially specific means to correct dysregulated gene expression in systemic lupus erythematosus patients.

  18. Therapeutic potentials of gene silencing by RNA interference: principles, challenges, and new strategies.

    PubMed

    Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao

    2014-04-01

    During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Gene interference regulates aquaporin-4 expression in swollen tissue of rats with cerebral ischemic edema

    PubMed Central

    Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong

    2012-01-01

    To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25–6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5–4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = −0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema. PMID:25657707

  20. Gene interference regulates aquaporin-4 expression in swollen tissue of rats with cerebral ischemic edema: Correlation with variation in apparent diffusion coefficient.

    PubMed

    Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong

    2012-07-25

    To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25-6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5-4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = -0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema.

  1. Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease

    PubMed Central

    Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John

    2012-01-01

    Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703

  2. Symbiont-mediated RNA interference in insects

    PubMed Central

    Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.

    2016-01-01

    RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963

  3. Homo sapiens Systemic RNA Interference-defective-1 Transmembrane Family Member 1 (SIDT1) Protein Mediates Contact-dependent Small RNA Transfer and MicroRNA-21-driven Chemoresistance*

    PubMed Central

    Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.

    2012-01-01

    Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421

  4. Versatile RNA Interference Nanoplatform for Systemic Delivery of RNAs

    PubMed Central

    2015-01-01

    Development of nontoxic, tumor-targetable, and potent in vivo RNA delivery systems remains an arduous challenge for clinical application of RNAi therapeutics. Herein, we report a versatile RNAi nanoplatform based on tumor-targeted and pH-responsive nanoformulas (NFs). The NF was engineered by combination of an artificial RNA receptor, Zn(II)-DPA, with a tumor-targetable and drug-loadable hyaluronic acid nanoparticle, which was further modified with a calcium phosphate (CaP) coating by in situ mineralization. The NF can encapsulate small-molecule drugs within its hydrophobic inner core and strongly secure various RNA molecules (siRNAs, miRNAs, and oligonucleotides) by utilizing Zn(II)-DPA and a robust CaP coating. We substantiated the versatility of the RNAi nanoplatform by demonstrating effective delivery of siRNA and miRNA for gene silencing or miRNA replacement into different human types of cancer cells in vitro and into tumor-bearing mice in vivo by intravenous administration. The therapeutic potential of NFs coloaded with an anticancer drug doxorubicin (Dox) and multidrug resistance 1 gene target siRNA (siMDR) was also demonstrated in this study. NFs loaded with Dox and siMDR could successfully sensitize drug-resistant OVCAR8/ADR cells to Dox and suppress OVCAR8/ADR tumor cell proliferation in vitro and tumor growth in vivo. This gene/drug delivery system appears to be a highly effective nonviral method to deliver chemo- and RNAi therapeutics into host cells. PMID:24779637

  5. Delivery of RNAi reagents in murine models of obesity and diabetes.

    PubMed

    Wilcox, Denise M; Yang, Ruojing; Morgan, Sherry J; Nguyen, Phong T; Voorbach, Martin J; Jung, Paul M; Haasch, Deanna L; Lin, Emily; Bush, Eugene N; Opgenorth, Terry J; Jacobson, Peer B; Collins, Christine A; Rondinone, Cristina M; Surowy, Terry; Landschulz, Katherine T

    2006-11-29

    RNA interference (RNAi) is an exciting new tool to effect acute in vivo knockdown of genes for pharmacological target validation. Testing the application of this technology to metabolic disease targets, three RNAi delivery methods were compared in two frequently utilized preclinical models of obesity and diabetes, the diet-induced obese (DIO) and B6.V-Lep/J (ob/ob) mouse. Intraperitoneal (i.p.) and high pressure hydrodynamic intravenous (i.v.) administration of naked siRNA, and low pressure i.v. administration of shRNA-expressing adenovirus were assessed for both safety and gene knockdown efficacy using constructs targeting cJun N-terminal kinase 1 (JNK1). Hydrodynamic delivery of siRNA lowered liver JNK1 protein levels 40% in DIO mice, but was accompanied by iatrogenic liver damage. The ob/ob model proved even more intolerant of this technique, with hydrodynamic delivery resulting in severe liver damage and death of most animals. While well-tolerated, i.p. injections of siRNA in DIO mice did not result in any knockdown or phenotypic changes in the mice. On the other hand, i.v. injected adenovirus expressing shRNA potently reduced expression of JNK1 in vivo by 95% without liver toxicity. In conclusion, i.p. and hydrodynamic injections of siRNA were ineffective and/or inappropriate for in vivo gene targeting in DIO and ob/ob mice, while adenovirus-mediated delivery of shRNA provided a relatively benign and effective method for exploring liver target silencing.

  6. Mitochondrial Reactive Oxygen Species Trigger Hypoxia-Inducible Factor-Dependent Extension of the Replicative Life Span during Hypoxia▿

    PubMed Central

    Bell, Eric L.; Klimova, Tatyana A.; Eisenbart, James; Schumacker, Paul T.; Chandel, Navdeep S.

    2007-01-01

    Physiological hypoxia extends the replicative life span of human cells in culture. Here, we report that hypoxic extension of replicative life span is associated with an increase in mitochondrial reactive oxygen species (ROS) in primary human lung fibroblasts. The generation of mitochondrial ROS is necessary for hypoxic activation of the transcription factor hypoxia-inducible factor (HIF). The hypoxic extension of replicative life span is ablated by a dominant negative HIF. HIF is sufficient to induce telomerase reverse transcriptase mRNA and telomerase activity and to extend replicative life span. Furthermore, the down-regulation of the von Hippel-Lindau tumor suppressor protein by RNA interference increases HIF activity and extends replicative life span under normoxia. These findings provide genetic evidence that hypoxia utilizes mitochondrial ROS as signaling molecules to activate HIF-dependent extension of replicative life span. PMID:17562866

  7. Clinical potential of oligonucleotide-based therapeutics in the respiratory system.

    PubMed

    Moschos, Sterghios A; Usher, Louise; Lindsay, Mark A

    2017-01-01

    The discovery of an ever-expanding plethora of coding and non-coding RNAs with nodal and causal roles in the regulation of lung physiology and disease is reinvigorating interest in the clinical utility of the oligonucleotide therapeutic class. This is strongly supported through recent advances in nucleic acids chemistry, synthetic oligonucleotide delivery and viral gene therapy that have succeeded in bringing to market at least three nucleic acid-based drugs. As a consequence, multiple new candidates such as RNA interference modulators, antisense, and splice switching compounds are now progressing through clinical evaluation. Here, manipulation of RNA for the treatment of lung disease is explored, with emphasis on robust pharmacological evidence aligned to the five pillars of drug development: exposure to the appropriate tissue, binding to the desired molecular target, evidence of the expected mode of action, activity in the relevant patient population and commercially viable value proposition. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Transformation of cell-derived microparticles into quantum-dot-labeled nanovectors for antitumor siRNA delivery.

    PubMed

    Chen, Gang; Zhu, Jun-Yi; Zhang, Zhi-Ling; Zhang, Wei; Ren, Jian-Gang; Wu, Min; Hong, Zheng-Yuan; Lv, Cheng; Pang, Dai-Wen; Zhao, Yi-Fang

    2015-01-12

    Cell-derived microparticles (MPs) have been recently recognized as critical intercellular information conveyors. However, further understanding of their biological behavior and potential application has been hampered by the limitations of current labeling techniques. Herein, a universal donor-cell-assisted membrane biotinylation strategy was proposed for labeling MPs by skillfully utilizing the natural membrane phospholipid exchange of their donor cells. This innovative strategy conveniently led to specific, efficient, reproducible, and biocompatible quantum dot (QD) labeling of MPs, thereby reliably conferring valuable traceability on MPs. By further loading with small interference RNA, QD-labeled MPs that had inherent cell-targeting and biomolecule-conveying ability were successfully employed for combined bioimaging and tumor-targeted therapy. This study provides the first reliable and biofriendly strategy for transforming biogenic MPs into functionalized nanovectors. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Soaking RNAi in Bombyx mori BmN4-SID1 Cells Arrests Cell Cycle Progression

    PubMed Central

    Mon, Hiroaki; Li, Zhiqing; Kobayashi, Isao; Tomita, Shuichiro; Lee, JaeMan; Sezutsu, Hideki; Tamura, Toshiki; Kusakabe, Takahiro

    2013-01-01

    RNA interference (RNAi) is an evolutionarily conserved mechanism for sequence-specific gene silencing. Previously, the BmN4-SID1 cell expressing Caenorhabditis ele gans SID-1 was established, in which soaking RNAi could induce effective gene silencing. To establish its utility, 6 cell cycle progression related cDNAs, CDK1, MYC, MYB, RNRS, CDT1, and GEMININ, were isolated from the silkworm, Bombyx mori L. (Lepidoptera: Bombycidae), and their expressions were further silenced by soaking RNAi in the BmN4-SID1 cells. The cell cycle progression analysis using flow cytometer demonstrated that the small amount of double stranded RNA was enough to arrest cell cycle progression at the specific cell phases. These data suggest that RNAi in the BmN4-SID1 cells can be used as a powerful tool for loss-of-function analysis of B. mori genes. PMID:24773378

  10. The small non-coding RNA response to virus infection in the Leishmania vector Lutzomyia longipalpis.

    PubMed

    Ferreira, Flávia Viana; Aguiar, Eric Roberto Guimarães Rocha; Olmo, Roenick Proveti; de Oliveira, Karla Pollyanna Vieira; Silva, Emanuele Guimarães; Sant'Anna, Maurício Roberto Viana; Gontijo, Nelder de Figueiredo; Kroon, Erna Geessien; Imler, Jean Luc; Marques, João Trindade

    2018-06-01

    Sandflies are well known vectors for Leishmania but also transmit a number of arthropod-borne viruses (arboviruses). Few studies have addressed the interaction between sandflies and arboviruses. RNA interference (RNAi) mechanisms utilize small non-coding RNAs to regulate different aspects of host-pathogen interactions. The small interfering RNA (siRNA) pathway is a broad antiviral mechanism in insects. In addition, at least in mosquitoes, another RNAi mechanism mediated by PIWI interacting RNAs (piRNAs) is activated by viral infection. Finally, endogenous microRNAs (miRNA) may also regulate host immune responses. Here, we analyzed the small non-coding RNA response to Vesicular stomatitis virus (VSV) infection in the sandfly Lutzoymia longipalpis. We detected abundant production of virus-derived siRNAs after VSV infection in adult sandflies. However, there was no production of virus-derived piRNAs and only mild changes in the expression of vector miRNAs in response to infection. We also observed abundant production of virus-derived siRNAs against two other viruses in Lutzomyia Lulo cells. Together, our results suggest that the siRNA but not the piRNA pathway mediates an antiviral response in sandflies. In agreement with this hypothesis, pre-treatment of cells with dsRNA against VSV was able to inhibit viral replication while knock-down of the central siRNA component, Argonaute-2, led to increased virus levels. Our work begins to elucidate the role of RNAi mechanisms in the interaction between L. longipalpis and viruses and should also open the way for studies with other sandfly-borne pathogens.

  11. Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

    PubMed

    Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy

    2017-11-01

    RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes.

    PubMed

    Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P

    2016-11-15

    Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes

    PubMed Central

    Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.

    2016-01-01

    ABSTRACT Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5′-3′ exoribonuclease XRN1/Pacman on conserved RNA structures in the 3′ untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo. Two reproducible small-RNA hot spots within the 3′ UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3′ SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. IMPORTANCE Understanding the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. PMID:27581979

  14. The protective effect of Hif3a RNA interference and HIF-prolyl hydroxylase inhibition on cardiomyocytes under anoxia-reoxygenation.

    PubMed

    Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V

    2018-06-01

    The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.

    PubMed

    Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G

    2018-05-18

    Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.

  16. In cell mutational interference mapping experiment (in cell MIME) identifies the 5' polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging.

    PubMed

    Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland

    2018-05-18

    Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.

  17. In cell mutational interference mapping experiment (in cell MIME) identifies the 5′ polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging

    PubMed Central

    Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe

    2018-01-01

    Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260

  18. Fluorescent carbon dots as an efficient siRNA nanocarrier for its interference therapy in gastric cancer cells.

    PubMed

    Wang, Qing; Zhang, Chunlei; Shen, Guangxia; Liu, Huiyang; Fu, Hualin; Cui, Daxiang

    2014-12-30

    Fluorescent carbon dots (Cdots) have attracted increasing attention due to their potential applications in sensing, catalysis, and biomedicine. Currently, intensive research has been concentrated on the synthesis and imaging-guided therapy of these benign photoluminescent materials. Meanwhile, Cdots have been explored as nonviral vector for nucleic acid or drug delivery by chemical modification on purpose. We have developed a microwave assisted one-step synthesis of Cdots with citric acid as carbon source and tryptophan (Trp) as both nitrogen source and passivation agent. The Cdots with uniform size show superior water solubility, excellent biocompatibility, and high quantum yield. Afterwards, the PEI (polyethylenimine)-adsorbed Cdots nanoparticles (Cdots@PEI) were applied to deliver Survivin siRNA into human gastric cancer cell line MGC-803. The results have confirmed the nanocarrier exhibited excellent biocompatibility and a significant increase in cellular delivery of siRNA, inducing efficient knockdown for Survivin protein to 6.1%. In addition, PEI@Cdots complexes mediated Survivin silencing, the arrested cell cycle progression in G1 phase as well as cell apoptosis was observed. The Cdots-based and PEI-adsorbed complexes both as imaging agents and siRNA nanocarriers have been developed for Survivin siRNA delivery. And the results indicate that Cdots-based nanocarriers could be utilized in a broad range of siRNA delivery systems for cancer therapy.

  19. Messenger RNA transcripts

    Treesearch

    Dan Cullen

    2004-01-01

    In contrast to DNA, messenger RNA (mRNA) in complex substrata is rarely analyzed, in large part because labile RNA molecules are difficult to purify. Nucleic acid extractions from fungi that colonize soil are particularly difficult and plagued by humic substances that interfere with Taq polymerase (Tebbe and Vahjen 1993 and references therein). Magnetic capture...

  20. RNA interference-based nanosystems for inflammatory bowel disease therapy

    PubMed Central

    Guo, Jian; Jiang, Xiaojing; Gui, Shuangying

    2016-01-01

    Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943

  1. Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells

    DTIC Science & Technology

    2005-07-01

    pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23󈧜. My initial studies

  2. Homologous interference mediated by defective interfering influenza virus derived from a temperature-sensitive mutant of influenza virus.

    PubMed Central

    Nayak, D P; Tobita, K; Janda, J M; Davis, A R; De, B K

    1978-01-01

    A temperature-sensitive group II mutant of influenza virus, ts-52, with a presumed defect in viral RNA synthesis, readily produced von Magnus-type defective interfering virus (DI virus) when passed serially (four times) at high multiplicity in MDBK cells. The defective virus (ts-52 DI virus) had a high hemagglutinin and a low infectivity titer, and strongly interfered with the replication of standard infectious viruses (both ts-52 and wild-type ts+) in co-infected cells. Progeny virus particles produced by co-infection of DI virus and infectious virus were also defective and also had low infectivity, high hemagglutinating activity, and a strong interfering property. Infectious viruses ts+ and ts-52 were indistinguishable from ts-52 DI viruses by sucrose velocity or density gradient analysis. Additionally, these viruses all possessed similar morphology. However, when the RNA of DI viruses was analyzed by use of polyacrylamide gels containing 6 M urea, there was a reduction in the amount of large RNA species (V1 to V4), and a number of new smaller RNA species (D1 to D6) with molecular weights ranging from 2.9 X 10(5) to 1.05 X 10(5) appeared. Since these smaller RNA species (D1 to D6) were absent in some clones of infectious viruses, but were consistently associated with DI viruses and increased during undiluted passages and during co-infection of ts-52 with DI virus, they appeared to be a characteristic of DI viruses. Additionally, the UV target size of interfering activity and infectivity of DI virus indicated that interfering activity was 40 times more resistant to UV irradiation than was infectivity, further implicating small RNA molecules in interference. Our data suggest that the loss of infectivity observed among DI viruses may be due to nonspecific loss of a viral RNA segment(s), and the interfering property of DI viruses may be due to interfering RNA segments (DIRNA, D1 to D6). ts-52 DI virus interfered with the replication of standard virus (ts+) at both permissive (34 degrees C) and nonpermissive temperatures. The infectivity of the progeny virus was reduced to 0.2% for ts+ and 0.05% for ts-52 virus without a reduction in hemagglutinin titer. Interference was dependent on the concentration of DI virus. A particle ratio of 1 between DI virus (0.001 PFU/cell) and infectious virus (1.0 PFU/cell) produced a maximal amount of interference. Infectious virus yield was reduced 99.9% without any reduction of the yield of DI viruses Interference was also dependent on the time of addition of DI virus. Interference was most effective within the first 3 h of infection by infectious virus, indicating interference with an early function during viral replication. Images PMID:702654

  3. Ingestion of genetically modified yeast symbiont reduces fitness of an insect pest via RNA interference

    PubMed Central

    Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.

    2016-01-01

    RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800

  4. ABCE1 Is a Highly Conserved RNA Silencing Suppressor

    PubMed Central

    Kärblane, Kairi; Gerassimenko, Jelena; Nigul, Lenne; Piirsoo, Alla; Smialowska, Agata; Vinkel, Kadri; Kylsten, Per; Ekwall, Karl; Swoboda, Peter; Truve, Erkki; Sarmiento, Cecilia

    2015-01-01

    ATP-binding cassette sub-family E member 1 (ABCE1) is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference. PMID:25659154

  5. RNAimmuno: A database of the nonspecific immunological effects of RNA interference and microRNA reagents

    PubMed Central

    Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.

    2012-01-01

    The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954

  6. RNAimmuno: a database of the nonspecific immunological effects of RNA interference and microRNA reagents.

    PubMed

    Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J

    2012-05-01

    The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.

  7. Dicer functions as an antiviral system against human adenoviruses via cleavage of adenovirus-encoded noncoding RNA

    PubMed Central

    Machitani, Mitsuhiro; Sakurai, Fuminori; Wakabayashi, Keisaku; Tomita, Kyoko; Tachibana, Masashi; Mizuguchi, Hiroyuki

    2016-01-01

    In various organisms, including nematodes and plants, RNA interference (RNAi) is a defense system against virus infection; however, it is unclear whether RNAi functions as an antivirus system in mammalian cells. Rather, a number of DNA viruses, including herpesviruses, utilize post-transcriptional silencing systems for their survival. Here we show that Dicer efficiently suppresses the replication of adenovirus (Ad) via cleavage of Ad-encoding small RNAs (VA-RNAs), which efficiently promote Ad replication via the inhibition of eIF2α phosphorylation, to viral microRNAs (mivaRNAs). The Dicer knockdown significantly increases the copy numbers of VA-RNAs, leading to the efficient inhibition of eIF2α phosphorylation and the subsequent promotion of Ad replication. Conversely, overexpression of Dicer significantly inhibits Ad replication. Transfection with mivaRNA does not affect eIF2α phosphorylation or Ad replication. These results indicate that Dicer-mediated processing of VA-RNAs leads to loss of activity of VA-RNAs for enhancement of Ad replication and that Dicer functions as a defence system against Ad in mammalian cells. PMID:27273616

  8. RNAi therapeutics and applications of microRNAs in cancer treatment.

    PubMed

    Uchino, Keita; Ochiya, Takahiro; Takeshita, Fumitaka

    2013-06-01

    RNA interference-based therapies are proving to be powerful tools for combating various diseases, including cancer. Scientists are researching the development of safe and efficient systems for the delivery of small RNA molecules, which are extremely fragile in serum, to target organs and cells in the human body. A dozen pre-clinical and clinical trials have been under way over the past few years involving biodegradable nanoparticles, lipids, chemical modification and conjugation. On the other hand, microRNAs, which control the balance of cellular biological processes, have been studied as attractive therapeutic targets in cancer treatment. In this review, we provide an overview of RNA interference-based therapeutics in clinical trials and discuss the latest technology for the systemic delivery of nucleic acid drugs. Furthermore, we focus on dysregulated microRNAs in human cancer, which have progressed in pre-clinical trials as therapeutic targets, and describe a wide range of strategies to control the expression levels of endogenous microRNAs. Further development of RNA interference technologies and progression of clinical trials will contribute to the achievement of practical applications of nucleic acid drugs.

  9. Genetic Validation of Aminoacyl-tRNA Synthetases as Drug Targets in Trypanosoma brucei

    PubMed Central

    Kalidas, Savitha; Cestari, Igor; Monnerat, Severine; Li, Qiong; Regmi, Sandesh; Hasle, Nicholas; Labaied, Mehdi; Parsons, Marilyn; Stuart, Kenneth

    2014-01-01

    Human African trypanosomiasis (HAT) is an important public health threat in sub-Saharan Africa. Current drugs are unsatisfactory, and new drugs are being sought. Few validated enzyme targets are available to support drug discovery efforts, so our goal was to obtain essentiality data on genes with proven utility as drug targets. Aminoacyl-tRNA synthetases (aaRSs) are known drug targets for bacterial and fungal pathogens and are required for protein synthesis. Here we survey the essentiality of eight Trypanosoma brucei aaRSs by RNA interference (RNAi) gene expression knockdown, covering an enzyme from each major aaRS class: valyl-tRNA synthetase (ValRS) (class Ia), tryptophanyl-tRNA synthetase (TrpRS-1) (class Ib), arginyl-tRNA synthetase (ArgRS) (class Ic), glutamyl-tRNA synthetase (GluRS) (class 1c), threonyl-tRNA synthetase (ThrRS) (class IIa), asparaginyl-tRNA synthetase (AsnRS) (class IIb), and phenylalanyl-tRNA synthetase (α and β) (PheRS) (class IIc). Knockdown of mRNA encoding these enzymes in T. brucei mammalian stage parasites showed that all were essential for parasite growth and survival in vitro. The reduced expression resulted in growth, morphological, cell cycle, and DNA content abnormalities. ThrRS was characterized in greater detail, showing that the purified recombinant enzyme displayed ThrRS activity and that the protein localized to both the cytosol and mitochondrion. Borrelidin, a known inhibitor of ThrRS, was an inhibitor of T. brucei ThrRS and showed antitrypanosomal activity. The data show that aaRSs are essential for T. brucei survival and are likely to be excellent targets for drug discovery efforts. PMID:24562907

  10. Harnessing RNA interference to develop neonatal therapies: from Nobel Prize winning discovery to proof of concept clinical trials.

    PubMed

    DeVincenzo, John P

    2009-10-01

    A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral effects. The first proof of concept test of efficacy of an RNAi-based therapeutic in man has been initiated. A discussion of the science behind RNA interference is followed by a presentation of the potential practical issues in applying this technology to neonatal respiratory viral diseases. RNAi may offer new strategies for the treatment of a variety of orphan diseases including neonatal diseases, RSV infections, and other respiratory viruses.

  11. Structure of the CRISPR Interference Complex CSM Reveals Key Similarities with Cascade

    PubMed Central

    Rouillon, Christophe; Zhou, Min; Zhang, Jing; Politis, Argyris; Beilsten-Edmands, Victoria; Cannone, Giuseppe; Graham, Shirley; Robinson, Carol V.; Spagnolo, Laura; White, Malcolm F.

    2013-01-01

    Summary The Clustered Regularly Interspaced Palindromic Repeats (CRISPR) system is an adaptive immune system in prokaryotes. Interference complexes encoded by CRISPR-associated (cas) genes utilize small RNAs for homology-directed detection and subsequent degradation of invading genetic elements, and they have been classified into three main types (I–III). Type III complexes share the Cas10 subunit but are subclassifed as type IIIA (CSM) and type IIIB (CMR), depending on their specificity for DNA or RNA targets, respectively. The role of CSM in limiting the spread of conjugative plasmids in Staphylococcus epidermidis was first described in 2008. Here, we report a detailed investigation of the composition and structure of the CSM complex from the archaeon Sulfolobus solfataricus, using a combination of electron microscopy, mass spectrometry, and deep sequencing. This reveals a three-dimensional model for the CSM complex that includes a helical component strikingly reminiscent of the backbone structure of the type I (Cascade) family. PMID:24119402

  12. Biochemical and Structural Studies of RNA Modification and Repair

    ERIC Educational Resources Information Center

    Chan, Chio Mui

    2009-01-01

    RNA modification, RNA interference, and RNA repair are important events in the cell. This thesis presents three projects related to these three fields. By using both biochemical and structural methods, we characterized enzymatic activities of pseudouridine synthase TruD, solved the structure of "A. aeolicus" GidA, and reconstituted a novel…

  13. Defective RNA particles derived from Tomato black ring virus genome interfere with the replication of parental virus.

    PubMed

    Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F

    2018-05-02

    Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. RNA Interference for improving the Outcome of Islet Transplantation

    PubMed Central

    Li, Feng; Mahato, Ram I

    2010-01-01

    Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190

  15. Differentiating RNA from DNA by a molecular fluorescent probe based on the "door-bolt" mechanism biomaterials.

    PubMed

    Yao, Qichao; Li, Haidong; Xian, Liman; Xu, Feng; Xia, Jing; Fan, Jiangli; Du, Jianjun; Wang, Jingyun; Peng, Xiaojun

    2018-09-01

    Although excellent florescent probes have been developed for DNA, good probes for RNA remain lacking. The shortage of reported and commercial RNA probes is attributable to their severe interference from DNA. As DNA and RNA have similar structures but different functions, it has been an imperative challenge to develop RNA probes that differentiate from DNA. In this study, an NIR fluorescent probe, NBE, is described, which contains a bulky julolidine group that can fit in a spacious RNA pocket and emit intense fluorescence. However, NBE has no response to DNA, as it cannot intercalate into the double strands or even in the DNA minor groove. The sensing mechanism is similar to the effect of a door-bolt. NBE shows excellent performance in RNA sensing (outstanding photostability, high selectivity and fast response), whether in aqueous buffers, fixed cells or living cells. These findings might provide not only a potential imaging tool but also a new design strategy for the recognition of RNA while avoiding interference from DNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. An RNA isolation system for plant tissues rich in secondary metabolites

    PubMed Central

    2011-01-01

    Background Secondary metabolites are reported to interfere with the isolation of RNA particularly with the recipes that use guanidinium-based salt. Such interference was observed in isolation of RNA with medicinal plants rheum (Rheum australe) and arnebia (Arnebia euchroma). A rapid and less cumbersome system for isolation of RNA was essential to facilitate any study related to gene expression. Findings An RNA isolation system free of guanidinium salt was developed that successfully isolated RNA from rheum and arnebia. The method took about 45 min and was successfully evaluated on twenty one tissues with varied secondary metabolites. The A260/280 ratio ranged between 1.8 - 2.0 with distinct 28 S and 18 S rRNA bands visible on a formaldehyde-agarose gel. Conclusions The present manuscript describes a rapid protocol for isolation of RNA, which works well with all the tissues examined so far. The remarkable feature was the success in isolation of RNA with those tissues, wherein the most commonly used methods failed. Isolated RNA was amenable to downstream applications such as reverse transcription-polymerase chain reaction (RT-PCR), differential display (DD), suppression subtractive hybridization (SSH) library construction, and northern hybridization. PMID:21443767

  17. Dose-dependent Toxicity of Humanized Renilla reniformis GFP (hrGFP) Limits Its Utility as a Reporter Gene in Mouse Muscle

    PubMed Central

    Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q

    2013-01-01

    Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×1010 –1 × 1011 particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 109 AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hrGFP as a reporter gene in mouse muscle. These results may impact the design of future preclinical gene therapy studies targeting muscles and non-muscle tissues alike. PMID:23591809

  18. Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.

    PubMed

    Crosswhite, Patrick; Sun, Zhongjie

    2010-06-01

    The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.

  19. Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.

    PubMed

    Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla

    2014-04-01

    Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.

  20. Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens

    PubMed Central

    Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun

    2011-01-01

    Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219

  1. New Genetics

    MedlinePlus

    ... Century-Old Evolutionary Puzzle Computing Genetics Model Organisms RNA Interference The New Genetics is a science education ... the basics of DNA and its molecular cousin RNA, and new directions in genetic research. The New ...

  2. Fluorescence-based high-throughput screening of dicer cleavage activity.

    PubMed

    Podolska, Katerina; Sedlak, David; Bartunek, Petr; Svoboda, Petr

    2014-03-01

    Production of small RNAs by ribonuclease III Dicer is a key step in microRNA and RNA interference pathways, which employ Dicer-produced small RNAs as sequence-specific silencing guides. Further studies and manipulations of microRNA and RNA interference pathways would benefit from identification of small-molecule modulators. Here, we report a study of a fluorescence-based in vitro Dicer cleavage assay, which was adapted for high-throughput screening. The kinetic assay can be performed under single-turnover conditions (35 nM substrate and 70 nM Dicer) in a small volume (5 µL), which makes it suitable for high-throughput screening in a 1536-well format. As a proof of principle, a small library of bioactive compounds was analyzed, demonstrating potential of the assay.

  3. Chemical Ligation Reactions of Oligonucleotides for Biological and Medicinal Applications.

    PubMed

    Abe, Hiroshi; Kimura, Yasuaki

    2018-01-01

    Chemical ligation of oligonucleotides (ONs) is the key reaction for various ON-based technologies. We have tried to solve the problems of RNA interference (RNAi) technology by applying ON chemical ligation to RNAi. We designed a new RNAi system, called intracellular buildup RNAi (IBR-RNAi), where the RNA fragments are built up into active small-interference RNA (siRNA) in cells through a chemical ligation reaction. Using the phosphorothioate and iodoacetyl groups as reactive functional groups for the ligation, we achieved RNAi effects without inducing immune responses. Additionally, we developed a new chemical ligation for IBR-RNAi, which affords a more native-like structure in the ligated product. The new ligation method should be useful not only for IBR-RNAi but also for the chemical synthesis of biofunctional ONs.

  4. RNA interference by feeding in vitro synthesized double-stranded RNA to planarians: methodology and dynamics

    PubMed Central

    Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.

    2013-01-01

    Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014

  5. Secondary RNA structure and its role in RNA interference to silence the respiratory syncytial virus fusion protein gene.

    PubMed

    Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R

    2009-11-01

    RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.

  6. Spectrum/Orbit-Utilization Program

    NASA Technical Reports Server (NTRS)

    Miller, Edward F.; Sawitz, Paul; Zusman, Fred

    1988-01-01

    Interferences among geostationary satellites determine allocations. Spectrum/Orbit Utilization Program (SOUP) is analytical computer program for determining mutual interferences among geostationary-satellite communication systems operating in given scenario. Major computed outputs are carrier-to-interference ratios at receivers at specified stations on Earth. Information enables determination of acceptability of planned communication systems. Written in FORTRAN.

  7. MISSION LentiPlex pooled shRNA library screening in mammalian cells.

    PubMed

    Coussens, Matthew J; Corman, Courtney; Fischer, Ashley L; Sago, Jack; Swarthout, John

    2011-12-21

    RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies. There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library. The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 10(8) TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification. Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we also detail a cost-effective polyclonal approach utilizing traditional sequencing.

  8. Functional analysis of two polygalacturonase genes in Apolygus lucorum associated with eliciting plant injury using RNA interference.

    PubMed

    Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei

    2017-04-01

    Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.

  9. Crystal structure of the Csm3-Csm4 subcomplex in the type III-A CRISPR-Cas interference complex.

    PubMed

    Numata, Tomoyuki; Inanaga, Hideko; Sato, Chikara; Osawa, Takuo

    2015-01-30

    Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci play a pivotal role in the prokaryotic host defense system against invading genetic materials. The CRISPR loci are transcribed to produce CRISPR RNAs (crRNAs), which form interference complexes with CRISPR-associated (Cas) proteins to target the invading nucleic acid for degradation. The interference complex of the type III-A CRISPR-Cas system is composed of five Cas proteins (Csm1-Csm5) and a crRNA, and targets invading DNA. Here, we show that the Csm1, Csm3, and Csm4 proteins from Methanocaldococcus jannaschii form a stable subcomplex. We also report the crystal structure of the M. jannaschii Csm3-Csm4 subcomplex at 3.1Å resolution. The complex structure revealed the presence of a basic concave surface around their interface, suggesting the RNA and/or DNA binding ability of the complex. A gel retardation analysis showed that the Csm3-Csm4 complex binds single-stranded RNA in a non-sequence-specific manner. Csm4 structurally resembles Cmr3, a component of the type III-B CRISPR-Cas interference complex. Based on bioinformatics, we constructed a model structure of the Csm1-Csm4-Csm3 ternary complex, which provides insights into its role in the Csm interference complex. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. RNA interference in the clinic: challenges and future directions

    PubMed Central

    Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.

    2011-01-01

    Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526

  11. Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference

    PubMed Central

    Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

    2015-01-01

    RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667

  12. Evaluation and control of miRNA-like off-target repression for RNA interference.

    PubMed

    Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook

    2018-03-01

    RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.

  13. Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.

    PubMed

    Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

    2015-03-03

    RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.

  14. Development and biophysical characterization of HK polymer for siRNA delivery to tumor in a mouse model

    NASA Astrophysics Data System (ADS)

    Chou, Szu-Ting

    Delivery has been the major obstacle for nucleic acid therapeutics, including the RNA interference (RNAi) approach. Mixson's lab has been focused on the development of a non-viral peptide-based delivery system, HK (histidine-lysine) polymers, which have shown promise as carriers of plasmids and small interference RNA (siRNA) in several cell lines and in tumor-bearing models. In a previous study, a four-branched peptide, denoted H3K(+H)4b, with the predominant repeating -HHHK- sequence in the branch, has been shown to be the most effective and least toxic carrier in vitro and in vivo.. Building on these results, I utilized different approaches including several structure and stability molecular characterization methods to study polyplex and to develop more effective carriers for improved therapy with siRNAs targeting malignancies. To understand the role of histidine in the stability of the H3K(+H)4b/siRNA polyplex, the physicochemical properties were investigated. With the use of isothermal titration calorimetry and heteronuclear single quantum coherence NMR, histidines were shown to form hydrogen bonds with siRNA, which enhanced the stability and biological activity of the polyplexes. In addition, to enhance resistance to nucleases and to target the tumors selectively, H3K(+H)4b was chemically modified with different patterns of polyethylene glycol (PEG) and cyclic RGD (Arg-Gly-Asp, cRGD) peptide conjugates. The luciferase marker gene expressed stably by tumor xenografts in mouse models was targeted in order to evaluate the efficacy of HK carriers of siRNA that differed in location and number of cRGD-PEG attachments. The most effective carrier was (RGD-PEG)4H3K(+H) (RP-HK), which has a cRGD-PEG on each of its four terminal branches. Consistent with its prolonged stability, as observed by pharmacokinetic studies, the RP-HK polyplex down-regulated luciferase activity in tumor xenografts by nearly 70% compared with the untreated group. Subsequently, the RP-HK polyplex was used to target the Raf-1 oncogene, an important mediator of tumor cell growth and angiogenesis. As in the luciferase studies, the polyplex reduced Raf-1 mRNA by more than 75%, and more importantly, the treatment inhibited the tumor growth by 60% in a mouse model. We anticipate that further design and engineering of HK carriers will improve the predictability and therapeutic activity of siRNA polyplexes in cancer treatment.

  15. Identification of germline transcriptional regulatory elements in Aedes aegypti.

    PubMed

    Akbari, Omar S; Papathanos, Philippos A; Sandler, Jeremy E; Kennedy, Katie; Hay, Bruce A

    2014-02-04

    The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UD(MEL), and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

  16. Identification of germline transcriptional regulatory elements in Aedes aegypti

    NASA Astrophysics Data System (ADS)

    Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

    2014-02-01

    The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

  17. Multimodality Imaging of RNA Interference

    PubMed Central

    Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo

    2013-01-01

    The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567

  18. Engineering functional inorganic-organic hybrid systems: advances in siRNA therapeutics.

    PubMed

    Shen, Jianliang; Zhang, Wei; Qi, Ruogu; Mao, Zong-Wan; Shen, Haifa

    2018-03-21

    Cancer treatment still faces a lot of obstacles such as tumor heterogeneity, drug resistance and systemic toxicities. Beyond the traditional treatment modalities, exploitation of RNA interference (RNAi) as an emerging approach has immense potential for the treatment of various gene-caused diseases including cancer. The last decade has witnessed enormous research and achievements focused on RNAi biotechnology. However, delivery of small interference RNA (siRNA) remains a key challenge in the development of clinical RNAi therapeutics. Indeed, functional nanomaterials play an important role in siRNA delivery, which could overcome a wide range of sequential physiological and biological obstacles. Nanomaterial-formulated siRNA systems have potential applications in protection of siRNA from degradation, improving the accumulation in the target tissues, enhancing the siRNA therapy and reducing the side effects. In this review, we explore and summarize the role of functional inorganic-organic hybrid systems involved in the siRNA therapeutic advancements. Additionally, we gather the surface engineering strategies of hybrid systems to optimize for siRNA delivery. Major progress in the field of inorganic-organic hybrid platforms including metallic/non-metallic cores modified with organic shells or further fabrication as the vectors for siRNA delivery is discussed to give credit to the interdisciplinary cooperation between chemistry, pharmacy, biology and medicine.

  19. More complete gene silencing by fewer siRNAs: transparent optimized design and biophysical signature

    PubMed Central

    Ladunga, Istvan

    2007-01-01

    Highly accurate knockdown functional analyses based on RNA interference (RNAi) require the possible most complete hydrolysis of the targeted mRNA while avoiding the degradation of untargeted genes (off-target effects). This in turn requires significant improvements to target selection for two reasons. First, the average silencing activity of randomly selected siRNAs is as low as 62%. Second, applying more than five different siRNAs may lead to saturation of the RNA-induced silencing complex (RISC) and to the degradation of untargeted genes. Therefore, selecting a small number of highly active siRNAs is critical for maximizing knockdown and minimizing off-target effects. To satisfy these needs, a publicly available and transparent machine learning tool is presented that ranks all possible siRNAs for each targeted gene. Support vector machines (SVMs) with polynomial kernels and constrained optimization models select and utilize the most predictive effective combinations from 572 sequence, thermodynamic, accessibility and self-hairpin features over 2200 published siRNAs. This tool reaches an accuracy of 92.3% in cross-validation experiments. We fully present the underlying biophysical signature that involves free energy, accessibility and dinucleotide characteristics. We show that while complete silencing is possible at certain structured target sites, accessibility information improves the prediction of the 90% active siRNA target sites. Fast siRNA activity predictions can be performed on our web server at . PMID:17169992

  20. Parameters on plant absortion of double-stranded Ribonucleic acid, dsRNA

    USDA-ARS?s Scientific Manuscript database

    Efficient absorption of double-stranded Ribonucleic acid, dsRNA, into citrus is critical for effective psyllid management by RNA interference, RNAi. Parameters which might affect absorption into citrus trees and subsequent ingestion by Asian citrus psyllid were evaluated. Age of leaves, variety of c...

  1. Identification of phosphates involved in catalysis by the ribozyme RNase P RNA.

    PubMed Central

    Harris, M E; Pace, N R

    1995-01-01

    The RNA subunit of ribonuclease P (RNase P RNA) is a catalytic RNA that cleaves precursor tRNAs to generate mature tRNA 5' ends. Little is known concerning the identity and arrangement of functional groups that constitute the active site of this ribozyme. We have used an RNase P RNA-substrate conjugate that undergoes rapid, accurate, and efficient self-cleavage in vitro to probe, by phosphorothioate modification-interference, functional groups required for catalysis. We identify four phosphate oxygens where substitution by sulfur significantly reduces the catalytic rate (50-200-fold). Interference at one site was partially rescued in the presence of manganese, suggesting a direct involvement in binding divalent metal ion cofactors required for catalysis. All sites are located in conserved sequence and secondary structure, and positioned adjacent to the substrate phosphate in a tertiary structure model of the ribozyme-substrate complex. The spatial arrangement of phosphorothioate-sensitive sites in RNase P RNA was found to resemble the distribution of analogous positions in the secondary and potential tertiary structures of other large catalytic RNAs. PMID:7585250

  2. [Impact of Pax-8 gene interference on mitochondrial function and cardiomyocyte apoptosis].

    PubMed

    Dai, Xiao-chun; Zhou, Xi; Huang, Xiao-yan; Wang, Liang-guo; Lin, Su; Yang, De-ye

    2013-01-01

    To observe the effects of paired box gene 8 (Pax-8) silencing by RNA interference on mitochondrial function and cardiomyocytes apoptosis. The cultured H9C2 (2-1) myocytes were divided into 3 groups: short interference RNA targeting Pax-8 (Pax-8 siRNA) group, non-specific siRNA group as the negative control (NC siRNA), and blank control group (BC siRNA). Fluorescence spectrophotometry was used to detect the activity of caspase-3. RT-PCR was performed to detect mRNA expression of Bcl2 and Bax. The protein expression of Bcl2, Bax and cytoplasm of Cytochrome was examined by Western blot. Changes of ΔΨm were detected by flow cytometry.ΔΨm with JC-1 monomer/polymer ratio was calculated for measuring mitochondrial depolarization proportion. Compared to NC siRNA and BC siRNA group (0.075 ± 0.021, 0.072 ± 0.019), the activity of caspase-3 in Pax-8 siRNA group (0.167 ± 0.012) was significantly increased (P < 0.05); Bcl2 mRNA and protein expression in Pax-8 siRNA group (0.61 ± 0.06, 0.94 ± 0.11) were significantly downregulated compared with NC siRNA group (0.90 ± 0.070, 1.39 ± 0.15) and BC siRNA group (0.94 ± 0.087, 1.49 ± 0.20) (P < 0.05); Bax mRNA and protein expression in Pax-8 siRNA group (1.05 ± 0.10, 1.25 ± 0.12) were markedly upregulated compared with NC siRNA group (0.72 ± 0.03, 0.99 ± 0.12) and BC siRNA group (0.64 ± 0.03, 0.92 ± 0.06), P < 0.05; cytosolic cytochrome expression in Pax-8 siRNA group (0.75 ± 0.14) was significantly upregulated compared with NC siRNA group (0.51 ± 0.06) and BC siRNA group (0.48 ± 0.07) (P < 0.05); JC-1 monomer/polymer ratio in Pax-8 siRNA group (0.163 ± 0.011) was significantly increased compared with NC siRNA group (0.092 ± 0.015) and BC siRNA group (0.072 ± 0.025) (P < 0.05) indicating mitochondrial membrane potential was significantly reduced in Pax-8 siRNA group. Above parameters were similar between NC siRNA group and BC siRNA group (P > 0.05). Inhibiting Pax-8 results in enhanced cardiomyocytes apoptosis through the mitochondrial pathway.

  3. Silencing of Endogenous IL-10 in Human Dendritic Cells Leads to the Generation of an Improved CTL Response Against Human Melanoma Associated Antigenic Epitope, MART-127−35

    PubMed Central

    Chhabra, Arvind; Chakraborty, Nityo G.; Mukherji, Bijay

    2008-01-01

    Dendritic cells (DC) present antigenic epitopes to and activate T cells. They also polarize the ensuing T cell response to Th1 or Th2 type response, depending on their cytokine production profile. For example, IL-12 producing DC generate Th1 type T cell response whereas IL-10 producing DC is usually tolerogenic. Different strategies -- such as the use of cytokines and anti-cytokine antibodies, dominant negative forms of protein, anti-sense RNA etc. -- have been employed to influence the cytokine synthetic profile of DC as well as to make DC more immunogenic. Utilizing GFP expressing recombinant adenoviruses in association with lipid-mediated transfection of siRNA, we have silenced the endogenous IL-10 gene in DC. We show that IL-10 gene silenced DC produce more IL-12 and also generates a better cytolytic T cell response against the human melanoma associated epitope, MART-127−35, in-vitro. We also show that the GFP expressing adenoviral vector can be used to optimize the parameters for siRNA delivery in primary cells and show that RNA interference methodology can efficiently knock-down virus encoded genes transcribed at very high multiplicity of infection in DC. PMID:18249038

  4. Therapeutic siRNAs for dominant genetic skin diseases including pachyonychia congenita

    PubMed Central

    Leachman, Sancy A.; Hickerson, Robyn P.; Hull, Peter R.; Smith, Frances J. D.; Milstone, Leonard M.; Lane, E. Birgitte; Bale, Sherri J.; Roop, Dennis R.; McLean, W. H. Irwin; Kaspar, Roger L.

    2008-01-01

    The field of science and medicine has experienced a flood of data and technology associated with the human genome project. Over 10,000 human diseases have been genetically defined, but little progress has been made with respect to the clinical application of this knowledge. A notable exception to this exists for pachyonychia congenita (PC), a rare, dominant negative keratin disorder. The establishment of a non-profit organization, PC Project, has led to an unprecedented coalescence of patients, scientists, and physicians with a unified vision of developing novel therapeutics for PC. Utilizing the technological by-products of the human genome project, such as RNA interference (RNAi) and quantitative RT-PCR (qRT-PCR), physicians and scientists have collaborated to create a candidate siRNA therapeutic that selectively inhibits a mutant allele of KRT6A, the most commonly affected PC keratin. In vitro investigation of this siRNA demonstrates potent inhibition of the mutant allele and reversal of the cellular aggregation phenotype. In parallel, an allele-specific quantitative real time RT-PCR assay has been developed and validated on patient callus samples in preparation for clinical trials. If clinical efficacy is ultimately demonstrated, this “first-in-skin” siRNA may herald a paradigm shift in the treatment of dominant negative genetic disorders. PMID:18495438

  5. On-Chip Synthesis of Protein Microarrays from DNA Microarrays Via Coupled In Vitro Transcription and Translation for Surface Plasmon Resonance Imaging Biosensor Applications

    PubMed Central

    Seefeld, Ting H.; Halpern, Aaron R.; Corn, Robert M.

    2012-01-01

    Protein microarrays are fabricated from double-stranded DNA (dsDNA) microarrays by a one-step, multiplexed enzymatic synthesis in an on-chip microfluidic format and then employed for antibody biosensing measurements with surface plasmon resonance imaging (SPRI). A microarray of dsDNA elements (denoted as generator elements) that encode either a His-tagged green fluorescent protein (GFP) or a His-tagged luciferase protein is utilized to create multiple copies of messenger RNA (mRNA) in a surface RNA polymerase reaction; the mRNA transcripts are then translated into proteins by cell-free protein synthesis in a microfluidic format. The His-tagged proteins diffuse to adjacent Cu(II)-NTA microarray elements (denoted as detector elements) and are specifically adsorbed. The net result is the on-chip, cell-free synthesis of a protein microarray that can be used immediately for SPRI protein biosensing. The dual element format greatly reduces any interference from the nonspecific adsorption of enzyme or proteins. SPRI measurements for the detection of the antibodies anti-GFP and anti-luciferase were used to verify the formation of the protein microarray. This convenient on-chip protein microarray fabrication method can be implemented for multiplexed SPRI biosensing measurements in both clinical and research applications. PMID:22793370

  6. Therapeutic siRNAs for dominant genetic skin disorders including pachyonychia congenita.

    PubMed

    Leachman, Sancy A; Hickerson, Robyn P; Hull, Peter R; Smith, Frances J D; Milstone, Leonard M; Lane, E Birgitte; Bale, Sherri J; Roop, Dennis R; McLean, W H Irwin; Kaspar, Roger L

    2008-09-01

    The field of science and medicine has experienced a flood of data and technology associated with the human genome project. Over 10,000 human diseases have been genetically defined, but little progress has been made with respect to the clinical application of this knowledge. A notable exception to this exists for pachyonychia congenita (PC), a rare, dominant-negative keratin disorder. The establishment of a non-profit organization, PC Project, has led to an unprecedented coalescence of patients, scientists, and physicians with a unified vision of developing novel therapeutics for PC. Utilizing the technological by-products of the human genome project, such as RNA interference (RNAi) and quantitative RT-PCR (qRT-PCR), physicians and scientists have collaborated to create a candidate siRNA therapeutic that selectively inhibits a mutant allele of KRT6A, the most commonly affected PC keratin. In vitro investigation of this siRNA demonstrates potent inhibition of the mutant allele and reversal of the cellular aggregation phenotype. In parallel, an allele-specific quantitative real-time RT-PCR assay has been developed and validated on patient callus samples in preparation for clinical trials. If clinical efficacy is ultimately demonstrated, this "first-in-skin" siRNA may herald a paradigm shift in the treatment of dominant-negative genetic disorders.

  7. Genetics Home Reference: myotonic dystrophy

    MedlinePlus

    ... mutated gene produces an expanded version of messenger RNA , which is a molecular blueprint of the gene ... the production of proteins. The abnormally long messenger RNA forms clumps inside the cell that interfere with ...

  8. Self-Delivering RNAi Targeting PD-1 Improves Tumor-Specific T Cell Functionality for Adoptive Cell Therapy of Malignant Melanoma.

    PubMed

    Ligtenberg, Maarten A; Pico de Coaña, Yago; Shmushkovich, Taisia; Yoshimoto, Yuya; Truxova, Iva; Yang, Yuan; Betancur-Boissel, Monica; Eliseev, Alexey V; Wolfson, Alexey D; Kiessling, Rolf

    2018-06-06

    Adoptive cell therapy (ACT) is becoming a prominent alternative therapeutic treatment for cancer patients relapsing on traditional therapies. In parallel, antibodies targeting immune checkpoint molecules, such as cytotoxic-T-lymphocyte-associated antigen 4 (CTLA-4) and cell death protein 1 pathway (PD-1), are rapidly being approved for multiple cancer types, including as first line therapy for PD-L1-expressing non-small-cell lung cancer. The combination of ACT and checkpoint blockade could substantially boost the efficacy of ACT. In this study, we generated a novel self-delivering small interfering RNA (siRNA) (sdRNA) that knocked down PD-1 expression on healthy donor T cells as well as patient-derived tumor-infiltrating lymphocytes (TIL). We have developed an alternative chemical modification of RNA backbone for improved stability and increased efficacy. Our results show that T cells treated with sdRNA specific for PD-1 had increased interferon γ (IFN-γ) secreting capacity and that this modality of gene expression interference could be utilized in our rapid expansion protocol for production of TIL for therapy. TIL expanded in the presence of PD-1-specific sdRNA performed with increased functionality against autologous tumor as compared to control TIL. This method of introducing RNAi into T cells to modify the expression of proteins could easily be adopted into any ACT protocol and will lead to the exploration of new combination therapies. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Different effects of enhanced and reduced expression of pub gene on the formation of embryoid bodies by cultured embryonic mouse stem cell.

    PubMed

    Novosadova, E V; Manuilova, E S; Arsen'eva, E L; Khaidarova, N V; Dolotov, O V; Inozemtseva, L S; Kozachenkov, K Yu; Tarantul, V Z; Grivennikov, I A

    2005-07-01

    The effects of pub gene on proliferation and initial stages of differentiation of embryonic mouse stem cells were studied in vitro. To this end we used enhanced expression of human pub gene (hpub) and suppression of expression of mouse endogenous pub gene with RNA-interference in embryonic stem cells. Proliferative activity of genetically modified polyclonal lines of the embryonic stem cells transfected with plasmids carrying expressing hpub gene or plasmids generating small interference RNA to this gene did not differ from that of the control cells. Inhibition of expression of endogenous pub gene in embryonic stem cells using small interference RNA 2-fold decreased the formation of embryoid bodies, at the same time additional expression of exogenous hpub gene almost 2-fold increased their number in comparison with the control. It was hypothesized that pub gene participates in early stages of differentiation of embryonic stem cells leading to the formation of embryoid bodies.

  10. Enhanced susceptibility of cancer cells to oncolytic rhabdo-virotherapy by expression of Nodamura virus protein B2 as a suppressor of RNA interference.

    PubMed

    Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S

    2018-06-19

    Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.

  11. Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

    PubMed

    Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

    2006-05-01

    The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

  12. Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

    PubMed Central

    Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

    2006-01-01

    The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

  13. Convergent transcription in the butyrolactone regulon in Streptomyces coelicolor confers a bistable genetic switch for antibiotic biosynthesis.

    PubMed

    Chatterjee, Anushree; Drews, Laurie; Mehra, Sarika; Takano, Eriko; Kaznessis, Yiannis N; Hu, Wei-Shou

    2011-01-01

    cis-encoded antisense RNAs (cis asRNA) have been reported to participate in gene expression regulation in both eukaryotic and prokaryotic organisms. Its presence in Streptomyces coelicolor has also been reported recently; however, its role has yet to be fully investigated. Using mathematical modeling we explore the role of cis asRNA produced as a result of convergent transcription in scbA-scbR genetic switch. scbA and scbR gene pair, encoding repressor-amplifier proteins respectively, mediates the synthesis of a signaling molecule, the γ-butyrolactone SCB1 and controls the onset of antibiotic production. Our model considers that transcriptional interference caused by convergent transcription of two opposing RNA polymerases results in fatal collision and transcriptional termination, which suppresses transcription efficiency. Additionally, convergent transcription causes sense and antisense interactions between complementary sequences from opposing strands, rendering the full length transcript inaccessible for translation. We evaluated the role of transcriptional interference and the antisense effect conferred by convergent transcription on the behavior of scbA-scbR system. Stability analysis showed that while transcriptional interference affects the system, it is asRNA that confers scbA-scbR system the characteristics of a bistable switch in response to the signaling molecule SCB1. With its critical role of regulating the onset of antibiotic synthesis the bistable behavior offers this two gene system the needed robustness to be a genetic switch. The convergent two gene system with potential of transcriptional interference is a frequent feature in various genomes. The possibility of asRNA regulation in other such gene-pairs is yet to be examined.

  14. Interference of hepatitis C virus RNA replication by short interfering RNAs

    NASA Astrophysics Data System (ADS)

    Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.

    2003-02-01

    Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.

  15. PAMP-induced defense responses in potato require both salicylic acid and jasmonic acid.

    PubMed

    Halim, Vincentius A; Altmann, Simone; Ellinger, Dorothea; Eschen-Lippold, Lennart; Miersch, Otto; Scheel, Dierk; Rosahl, Sabine

    2009-01-01

    To elucidate the molecular mechanisms underlying pathogen-associated molecular pattern (PAMP)-induced defense responses in potato (Solanum tuberosum), the role of the signaling compounds salicylic acid (SA) and jasmonic acid (JA) was analyzed. Pep-13, a PAMP from Phytophthora, induces the accumulation of SA, JA and hydrogen peroxide, as well as the activation of defense genes and hypersensitive-like cell death. We have previously shown that SA is required for Pep-13-induced defense responses. To assess the importance of JA, RNA interference constructs targeted at the JA biosynthetic genes, allene oxide cyclase and 12-oxophytodienoic acid reductase, were expressed in transgenic potato plants. In addition, expression of the F-box protein COI1 was reduced by RNA interference. Plants expressing the RNA interference constructs failed to accumulate the respective transcripts in response to wounding or Pep-13 treatment, neither did they contain significant amounts of JA after elicitation. In response to infiltration of Pep-13, the transgenic plants exhibited a highly reduced accumulation of reactive oxygen species as well as reduced hypersensitive cell death. The ability of the JA-deficient plants to accumulate SA suggests that SA accumulation is independent or upstream of JA accumulation. These data show that PAMP responses in potato require both SA and JA and that, in contrast to Arabidopsis, these compounds act in the same signal transduction pathway. Despite their inability to fully respond to PAMP treatment, the transgenic RNA interference plants are not altered in their basal defense against Phytophthora infestans.

  16. Ebolavirus proteins suppress the effects of small interfering RNA by direct interaction with the mammalian RNA interference pathway.

    PubMed

    Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J

    2011-03-01

    Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.

  17. Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

    PubMed Central

    Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

    2016-01-01

    Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

  18. RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.

    PubMed

    Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C

    2017-01-01

    The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster . We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies.

  19. RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems

    PubMed Central

    Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther

    2017-01-01

    ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster. We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies. PMID:28497117

  20. Small RNAs in plants: recent development and application for crop improvement

    PubMed Central

    Kamthan, Ayushi; Chaudhuri, Abira; Kamthan, Mohan; Datta, Asis

    2015-01-01

    The phenomenon of RNA interference (RNAi) which involves sequence-specific gene regulation by small non-coding RNAs, i.e., small interfering RNA (siRNA) and microRNA (miRNA) has emerged as one of most powerful approaches for crop improvement. RNAi based on siRNA is one of the widely used tools of reverse genetics which aid in revealing gene functions in many species. This technology has been extensively applied to alter the gene expression in plants with an aim to achieve desirable traits. RNAi has been used for enhancing the crop yield and productivity by manipulating the gene involved in biomass, grain yield and enhanced shelf life of fruits and vegetables. It has also been applied for developing resistance against various biotic (bacteria, fungi, viruses, nematodes, insects) and abiotic stresses (drought, salinity, cold, etc.). Nutritional improvements of crops have also been achieved by enriching the crops with essential amino acids, fatty acids, antioxidants and other nutrients beneficial for human health or by reducing allergens or anti-nutrients. microRNAs are key regulators of important plant processes like growth, development, and response to various stresses. In spite of similarity in size (20–24 nt), miRNA differ from siRNA in precursor structures, pathway of biogenesis, and modes of action. This review also highlights the miRNA based genetic modification technology where various miRNAs/artificial miRNAs and their targets can be utilized for improving several desirable plant traits. microRNA based strategies are much efficient than siRNA-based RNAi strategies due to its specificity and less undesirable off target effects. As per the FDA guidelines, small RNA (sRNA) based transgenics are much safer for consumption than those over-expressing proteins. This review thereby summarizes the emerging advances and achievement in the field of sRNAs and its application for crop improvement. PMID:25883599

  1. [Wnt/β-catenin pathway involved in the regulation of rat mesangial cell proliferation by adipose-derived mesenchymal stem cells].

    PubMed

    Li, Zhi; Zhang, Mengying; Li, Xueqin; Lu, Jinming; Xu, Liang

    2016-11-01

    Objective To investigate the effect of adipose-derived mesenchymal stem cells (ADSCs) on glomerular mesangial cell proliferation via Wnt/β-catenin pathway. Methods The rat glomerular mesangial cells (HBZY-1) were incubated in conditioned ADSC medium. Cell cycle was analyzed with flow cytometry; the proliferation rate of HBZY-1 and the expression levels of relative genes and proteins of Wnt signaling pathway were measured using RNA interference, quantitative real-time PCR and Western blotting, respectively. Results HBZY-1 proliferation was significantly inhibited under the action of conditioned ADSC medium, whereas dickkopf WNT signaling pathway inhibitor 1 (DKK1) mRNA level was up-regulated. Fibronectin and TGF-β1 mRNA expression as well as β-catenin and Bcl-2 protein levels of HBZY-1 were significantly down-regulated. DKK1 gene expression level in ADSCs was significantly higher than that of HBZY-1. After RNA interference, DKK1 expression level in ADSCs was markedly inhibited, yet the β-catenin protein level was notably elevated. The β-catenin and Bcl-2 protein levels of HBZY-1 were also significantly raised in HBZY-1 after cultured with conditioned medium containing ADSCs treated with RNA interference. Conclusion Wnt/β-catenin may be a potential signaling pathway involved in the regulative effect of ADSCs on glomerular mesangial cell proliferation.

  2. Macromolecular structures probed by combining single-shot free-electron laser diffraction with synchrotron coherent X-ray imaging.

    PubMed

    Gallagher-Jones, Marcus; Bessho, Yoshitaka; Kim, Sunam; Park, Jaehyun; Kim, Sangsoo; Nam, Daewoong; Kim, Chan; Kim, Yoonhee; Noh, Do Young; Miyashita, Osamu; Tama, Florence; Joti, Yasumasa; Kameshima, Takashi; Hatsui, Takaki; Tono, Kensuke; Kohmura, Yoshiki; Yabashi, Makina; Hasnain, S Samar; Ishikawa, Tetsuya; Song, Changyong

    2014-05-02

    Nanostructures formed from biological macromolecular complexes utilizing the self-assembly properties of smaller building blocks such as DNA and RNA hold promise for many applications, including sensing and drug delivery. New tools are required for their structural characterization. Intense, femtosecond X-ray pulses from X-ray free-electron lasers enable single-shot imaging allowing for instantaneous views of nanostructures at ambient temperatures. When combined judiciously with synchrotron X-rays of a complimentary nature, suitable for observing steady-state features, it is possible to perform ab initio structural investigation. Here we demonstrate a successful combination of femtosecond X-ray single-shot diffraction with an X-ray free-electron laser and coherent diffraction imaging with synchrotron X-rays to provide an insight into the nanostructure formation of a biological macromolecular complex: RNA interference microsponges. This newly introduced multimodal analysis with coherent X-rays can be applied to unveil nano-scale structural motifs from functional nanomaterials or biological nanocomplexes, without requiring a priori knowledge.

  3. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

    PubMed

    Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

    2010-11-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

  4. Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System

    PubMed Central

    Cooper, Lauren A.; Stringer, Anne M.

    2018-01-01

    ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291

  5. Special Issue: Gene Therapy with Emphasis on RNA Interference

    PubMed Central

    Lundstrom, Kenneth

    2015-01-01

    Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255

  6. The RNA-mediated, asymmetric ring regulatory mechanism of the transcription termination Rho helicase decrypted by time-resolved nucleotide analog interference probing (trNAIP).

    PubMed

    Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc

    2014-08-01

    Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. RNA Interference of the Muscle Actin Gene in Bed Bugs: Exploring Injection Versus Topical Application for dsRNA Delivery.

    PubMed

    Basnet, Sanjay; Kamble, Shripat T

    2018-05-01

    Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.

  8. Potential applications of RNA interference-based therapeutics in the treatment of cardiovascular disease.

    PubMed

    Hassan, Ali

    2006-06-01

    RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.

  9. Deletion of Cytoplasmic Double-Stranded RNA Sensors Does Not Uncover Viral Small Interfering RNA Production in Human Cells.

    PubMed

    Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M; van Rij, Ronald P

    2017-01-01

    Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in mammals is the subject of debate. In vertebrates, recognition of viral RNA induces a sophisticated type I interferon (IFN)-based immune response, and it has been proposed that this response masks or inhibits antiviral RNAi. To test this hypothesis, we analyzed viral small RNA production in differentiated cells deficient in the cytoplasmic RNA sensors RIG-I and MDA5. We did not detect 22-nucleotide (nt) viral siRNAs upon infection with three different positive-sense RNA viruses. Our data suggest that the depletion of cytoplasmic RIG-I-like sensors is not sufficient to uncover viral siRNAs in differentiated cells. IMPORTANCE The contribution of the RNA interference (RNAi) pathway in antiviral immunity in vertebrates has been widely debated. It has been proposed that RNAi possesses antiviral activity in mammalian systems but that its antiviral effect is masked by the potent antiviral interferon response in differentiated mammalian cells. In this study, we show that inactivation of the interferon response is not sufficient to uncover antiviral activity of RNAi in human epithelial cells infected with three wild-type positive-sense RNA viruses.

  10. Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

    PubMed

    Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

    2009-01-01

    RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

  11. Abasic pivot substitution harnesses target specificity of RNA interference

    PubMed Central

    Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook

    2015-01-01

    Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372

  12. In silico molecular docking analysis of the human Argonaute 2 PAZ domain reveals insights into RNA interference.

    PubMed

    Kandeel, Mahmoud; Kitade, Yukio

    2013-07-01

    RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.

  13. Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma

    PubMed Central

    Xie, Yuran; Merkel, Olivia M

    2015-01-01

    Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues has limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases and costimulatory factors that have been reported as targets of siRNA mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages and dendritic cells, which could potentially be applied in asthma therapy. PMID:26148454

  14. Antiviral Effects of Small Interfering RNA Simultaneously Inducing RNA Interference and Type 1 Interferon in Coxsackievirus Myocarditis

    PubMed Central

    Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon

    2012-01-01

    Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300

  15. Gene Silencing in Insect Cells Using RNAi.

    PubMed

    Wu, Hsuan-Chen; March, John C; Bentley, William E

    2016-01-01

    A technique is described for synthesizing and transfecting double stranded RNA (dsRNA) for RNA interference (RNAi) in Sf-21 cell culture. Transfection with dsRNA only requires an hour and the cells usually recover within 12 h. Suggestions for designing dsRNA are included in the methods. Furthermore, websites are provided for rapid and effective dsRNA design. Three kits are essential for using the described methods: RNAqueous®-4PCR, Megascript™ T7 kit, and the Superscript™ III kit from Life Technologies, Inc.

  16. RNA interference for performance enhancement and detection in doping control.

    PubMed

    Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

    2011-10-01

    RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.

  17. RNA interference-mediated silencing of mutant superoxide dismutase rescues cyclosporin A-induced death in cultured neuroblastoma cells

    PubMed Central

    Maxwell, Michele M.; Pasinelli, Piera; Kazantsev, Aleksey G.; Brown, Robert H.

    2004-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive and fatal neurodegenerative disorder resulting from selective death of motor neurons in the brain and spinal cord. In ≈25% of familial ALS cases, the disease is caused by dominantly acting point mutations in the gene encoding cytosolic Cu,Zn superoxide dismutase (SOD1). In cell culture and in rodent models of ALS, mutant SOD1 proteins exhibit dose-dependent toxicity; thus, agents that reduce mutant protein expression would be powerful therapeutic tools. A wealth of recent evidence has demonstrated that the mechanism of RNA-mediated interference (RNAi) can be exploited to achieve potent and specific gene silencing in vitro and in vivo. We have evaluated the utility of RNAi for selective silencing of mutant SOD1 expression in cultured cells and have identified small interfering RNAs capable of specifically inhibiting expression of ALS-linked mutant, but not wild-type, SOD1. We have investigated the functional effects of RNAi-mediated silencing of mutant SOD1 in cultured murine neuroblastoma cells. In this model, stable expression of mutant, but not wild-type, human SOD1 sensitizes cells to cytotoxic stimuli. We find that silencing of mutant SOD1 protects these cells against cyclosporin A-induced cell death. These results demonstrate a positive physiological effect caused by RNAi-mediated silencing of a dominant disease allele. The present study further supports the therapeutic potential of RNAi-based methods for the treatment of inherited human diseases, including ALS. PMID:14981234

  18. Postexposure protection of guinea pigs against a lethal ebola virus challenge is conferred by RNA interference.

    PubMed

    Geisbert, Thomas W; Hensley, Lisa E; Kagan, Elliott; Yu, Erik Zhaoying; Geisbert, Joan B; Daddario-DiCaprio, Kathleen; Fritz, Elizabeth A; Jahrling, Peter B; McClintock, Kevin; Phelps, Janet R; Lee, Amy C H; Judge, Adam; Jeffs, Lloyd B; MacLachlan, Ian

    2006-06-15

    Ebola virus (EBOV) infection causes a frequently fatal hemorrhagic fever (HF) that is refractory to treatment with currently available antiviral therapeutics. RNA interference represents a powerful, naturally occurring biological strategy for the inhibition of gene expression and has demonstrated utility in the inhibition of viral replication. Here, we describe the development of a potential therapy for EBOV infection that is based on small interfering RNAs (siRNAs). Four siRNAs targeting the polymerase (L) gene of the Zaire species of EBOV (ZEBOV) were either complexed with polyethylenimine (PEI) or formulated in stable nucleic acid-lipid particles (SNALPs). Guinea pigs were treated with these siRNAs either before or after lethal ZEBOV challenge. Treatment of guinea pigs with a pool of the L gene-specific siRNAs delivered by PEI polyplexes reduced plasma viremia levels and partially protected the animals from death when administered shortly before the ZEBOV challenge. Evaluation of the same pool of siRNAs delivered using SNALPs proved that this system was more efficacious, as it completely protected guinea pigs against viremia and death when administered shortly after the ZEBOV challenge. Additional experiments showed that 1 of the 4 siRNAs alone could completely protect guinea pigs from a lethal ZEBOV challenge. Further development of this technology has the potential to yield effective treatments for EBOV HF as well as for diseases caused by other agents that are considered to be biological threats.

  19. A member of the polymerase beta nucleotidyltransferase superfamily is required for RNA interference in C. elegans.

    PubMed

    Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C

    2005-02-22

    RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.

  20. Suppression of RNA Interference by Adenovirus Virus-Associated RNA†

    PubMed Central

    Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran

    2005-01-01

    We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917

  1. RNA interference of tubulin genes has lethal effects in Mythimna separate.

    PubMed

    Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

    2018-05-23

    RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

  2. Structural analyses of the CRISPR protein Csc2 reveal the RNA-binding interface of the type I-D Cas7 family.

    PubMed

    Hrle, Ajla; Maier, Lisa-Katharina; Sharma, Kundan; Ebert, Judith; Basquin, Claire; Urlaub, Henning; Marchfelder, Anita; Conti, Elena

    2014-01-01

    Upon pathogen invasion, bacteria and archaea activate an RNA-interference-like mechanism termed CRISPR (clustered regularly interspaced short palindromic repeats). A large family of Cas (CRISPR-associated) proteins mediates the different stages of this sophisticated immune response. Bioinformatic studies have classified the Cas proteins into families, according to their sequences and respective functions. These range from the insertion of the foreign genetic elements into the host genome to the activation of the interference machinery as well as target degradation upon attack. Cas7 family proteins are central to the type I and type III interference machineries as they constitute the backbone of the large interference complexes. Here we report the crystal structure of Thermofilum pendens Csc2, a Cas7 family protein of type I-D. We found that Csc2 forms a core RRM-like domain, flanked by three peripheral insertion domains: a lid domain, a Zinc-binding domain and a helical domain. Comparison with other Cas7 family proteins reveals a set of similar structural features both in the core and in the peripheral domains, despite the absence of significant sequence similarity. T. pendens Csc2 binds single-stranded RNA in vitro in a sequence-independent manner. Using a crosslinking - mass-spectrometry approach, we mapped the RNA-binding surface to a positively charged surface patch on T. pendens Csc2. Thus our analysis of the key structural and functional features of T. pendens Csc2 highlights recurring themes and evolutionary relationships in type I and type III Cas proteins.

  3. RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.

    PubMed

    Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F

    2005-01-01

    In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.

  4. Photoinduced RNA interference.

    PubMed

    Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi

    2012-07-17

    Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of the target gene was detected even without PCI. Recently, a polymer capable of trapping the siRNA in endocytic vesicles controlled RNAi almost entirely by light. CLIP-RNAi uses photosensitizing carrier proteins that can be activated over a wide range of visible light wavelengths. With this method RNA carrier/siRNA complexes are completely trapped within endosomes, and RNAi is controlled strictly by light. Such precise, light-dependent control will open up new possibilities for cellular and molecular biology and therapy. Most recently, gold nanoparticles (AuNPs) conjugated to siRNA have provided temporal and spatial control of RNAi. The light-dependent melting of AuNPs accompanied by a shape transformation induces the release of thiolated siRNAs from AuNPs. In this method, the unique optical properties of the AuNP enable deep penetration of the excitation light into tissues at nearinfrared wavelengths. The development of photoinduced RNAi technology will lead to novel insights into gene functions and selective drug delivery, and many other scientific fields will continue to influence its progress.

  5. Structural basis of RNA recognition and activation by innate immune receptor RIG-I

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, Fuguo; Ramanathan, Anand; Miller, Matthew T.

    Retinoic-acid-inducible gene-I (RIG-I; also known as DDX58) is a cytoplasmic pathogen recognition receptor that recognizes pathogen-associated molecular pattern (PAMP) motifs to differentiate between viral and cellular RNAs. RIG-I is activated by blunt-ended double-stranded (ds)RNA with or without a 5'-triphosphate (ppp), by single-stranded RNA marked by a 5'-ppp and by polyuridine sequences. Upon binding to such PAMP motifs, RIG-I initiates a signalling cascade that induces innate immune defences and inflammatory cytokines to establish an antiviral state. The RIG-I pathway is highly regulated and aberrant signalling leads to apoptosis, altered cell differentiation, inflammation, autoimmune diseases and cancer. The helicase and repressor domainsmore » (RD) of RIG-I recognize dsRNA and 5'-ppp RNA to activate the two amino-terminal caspase recruitment domains (CARDs) for signalling. Here, to understand the synergy between the helicase and the RD for RNA binding, and the contribution of ATP hydrolysis to RIG-I activation, we determined the structure of human RIG-I helicase-RD in complex with dsRNA and an ATP analogue. The helicase-RD organizes into a ring around dsRNA, capping one end, while contacting both strands using previously uncharacterized motifs to recognize dsRNA. Small-angle X-ray scattering, limited proteolysis and differential scanning fluorimetry indicate that RIG-I is in an extended and flexible conformation that compacts upon binding RNA. These results provide a detailed view of the role of helicase in dsRNA recognition, the synergy between the RD and the helicase for RNA binding and the organization of full-length RIG-I bound to dsRNA, and provide evidence of a conformational change upon RNA binding. The RIG-I helicase-RD structure is consistent with dsRNA translocation without unwinding and cooperative binding to RNA. The structure yields unprecedented insight into innate immunity and has a broader impact on other areas of biology, including RNA interference and DNA repair, which utilize homologous helicase domains within DICER and FANCM.« less

  6. The role of Cas8 in type I CRISPR interference.

    PubMed

    Cass, Simon D B; Haas, Karina A; Stoll, Britta; Alkhnbashi, Omer S; Sharma, Kundan; Urlaub, Henning; Backofen, Rolf; Marchfelder, Anita; Bolt, Edward L

    2015-05-05

    CRISPR (clustered regularly interspaced short palindromic repeat) systems provide bacteria and archaea with adaptive immunity to repel invasive genetic elements. Type I systems use 'cascade' [CRISPR-associated (Cas) complex for antiviral defence] ribonucleoprotein complexes to target invader DNA, by base pairing CRISPR RNA (crRNA) to protospacers. Cascade identifies PAMs (protospacer adjacent motifs) on invader DNA, triggering R-loop formation and subsequent DNA degradation by Cas3. Cas8 is a candidate PAM recognition factor in some cascades. We analysed Cas8 homologues from type IB CRISPR systems in archaea Haloferax volcanii (Hvo) and Methanothermobacter thermautotrophicus (Mth). Cas8 was essential for CRISPR interference in Hvo and purified Mth Cas8 protein responded to PAM sequence when binding to nucleic acids. Cas8 interacted physically with Cas5-Cas7-crRNA complex, stimulating binding to PAM containing substrates. Mutation of conserved Cas8 amino acid residues abolished interference in vivo and altered catalytic activity of Cas8 protein in vitro. This is experimental evidence that Cas8 is important for targeting Cascade to invader DNA. © 2015 Authors.

  7. RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.

    PubMed

    Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

    2014-01-01

    RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.

  8. RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding

    PubMed Central

    Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

    2014-01-01

    RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689

  9. Silencing the hsp25 Gene Eliminates Migration Capability of the Highly Metastatic Murine 4T1 Breast Adenocarcinoma Cell

    PubMed Central

    Bausero, Maria A.; Bharti, Ajit; Page, Diana T.; Perez, Kristen D.; Eng, Jason W.-L.; Ordonez, Susana L.; Jantschitsch, Christian; Kindas-Muegge, Ingela; Ciocca, Daniel; Asea, Alexzander

    2006-01-01

    The 25-kDa heat shock protein (Hsp25) is associated with various malignancies and is expressed at high levels in biopsies as well as circulating in the serum of breast cancer patients. In this study, we used RNA interference technology to silence the hsp25 gene in 4T1 breast adenocarcinoma cells, known as a poorly immunogenic, highly metastatic cell line. We demonstrate that transfection of 4T1 cells with short interference RNA-Hsp25 dramatically inhibits proliferation as compared with control transfected cells. In addition, we show that 4T1 cells transfected with short interference RNA-Hsp25 abrogates tumor migration potential by a mechanism that is in part due to the repression of matrix metalloproteinase 9 expression and a concomitant upregulation of its antagonist, tissue inhibitor metalloproteinase 1. Taken together, these findings provide a model system for the study of metastatic potential of tumors and are suggestive of an earlier unrecognized role for Hsp25 in tumor migration. PMID:16340246

  10. Silencing the hsp25 gene eliminates migration capability of the highly metastatic murine 4T1 breast adenocarcinoma cell.

    PubMed

    Bausero, Maria A; Bharti, Ajit; Page, Diana T; Perez, Kristen D; Eng, Jason W-L; Ordonez, Susana L; Asea, Edwina E; Jantschitsch, Christian; Kindas-Muegge, Ingela; Ciocca, Daniel; Asea, Alexzander

    2006-01-01

    The 25-kDa heat shock protein (Hsp25) is associated with various malignancies and is expressed at high levels in biopsies as well as circulating in the serum of breast cancer patients. In this study, we used RNA interference technology to silence the hsp25 gene in 4T1 breast adenocarcinoma cells, known as a poorly immunogenic, highly metastatic cell line. We demonstrate that transfection of 4T1 cells with short interference RNA-Hsp25 dramatically inhibits proliferation as compared with control transfected cells. In addition, we show that 4T1 cells transfected with short interference RNA-Hsp25 abrogates tumor migration potential by a mechanism that is in part due to the repression of matrix metalloproteinase 9 expression and a concomitant upregulation of its antagonist, tissue inhibitor metalloproteinase 1. Taken together, these findings provide a model system for the study of metastatic potential of tumors and are suggestive of an earlier unrecognized role for Hsp25 in tumor migration. Copyright 2006 S. Karger AG, Basel.

  11. Multifunctional RNA Nanoparticles

    PubMed Central

    2015-01-01

    Our recent advancements in RNA nanotechnology introduced novel nanoscaffolds (nanorings); however, the potential of their use for biomedical applications was never fully revealed. As presented here, besides functionalization with multiple different short interfering RNAs for combinatorial RNA interference (e.g., against multiple HIV-1 genes), nanorings also allow simultaneous embedment of assorted RNA aptamers, fluorescent dyes, proteins, as well as recently developed RNA–DNA hybrids aimed to conditionally activate multiple split functionalities inside cells. PMID:25267559

  12. Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.

    PubMed

    Hernández, Armando R; Peterson, Larryn W; Kool, Eric T

    2012-08-17

    Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.

  13. Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases

    PubMed Central

    Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.

    2012-01-01

    Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660

  14. Expression and RNA interference of salivary polygalacturonase genes in the tarnished plant bug, Lygus lineolaris.

    PubMed

    Walker, William B; Allen, Margaret L

    2010-01-01

    Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.

  15. Evolution at increased error rate leads to the coexistence of multiple adaptive pathways in an RNA virus.

    PubMed

    Cabanillas, Laura; Arribas, María; Lázaro, Ester

    2013-01-16

    When beneficial mutations present in different genomes spread simultaneously in an asexual population, their fixation can be delayed due to competition among them. This interference among mutations is mainly determined by the rate of beneficial mutations, which in turn depends on the population size, the total error rate, and the degree of adaptation of the population. RNA viruses, with their large population sizes and high error rates, are good candidates to present a great extent of interference. To test this hypothesis, in the current study we have investigated whether competition among beneficial mutations was responsible for the prolonged presence of polymorphisms in the mutant spectrum of an RNA virus, the bacteriophage Qβ, evolved during a large number of generations in the presence of the mutagenic nucleoside analogue 5-azacytidine. The analysis of the mutant spectra of bacteriophage Qβ populations evolved at artificially increased error rate shows a large number of polymorphic mutations, some of them with demonstrated selective value. Polymorphisms distributed into several evolutionary lines that can compete among them, making it difficult the emergence of a defined consensus sequence. The presence of accompanying deleterious mutations, the high degree of recurrence of the polymorphic mutations, and the occurrence of epistatic interactions generate a highly complex interference dynamics. Interference among beneficial mutations in bacteriophage Qβ evolved at increased error rate permits the coexistence of multiple adaptive pathways that can provide selective advantages by different molecular mechanisms. In this way, interference can be seen as a positive factor that allows the exploration of the different local maxima that exist in rugged fitness landscapes.

  16. Dose-dependent Toxicity of Humanized Renilla reniformis GFP (hrGFP) Limits Its Utility as a Reporter Gene in Mouse Muscle.

    PubMed

    Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q

    2013-04-16

    Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×10(10) -1 × 10(11) particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 10(9) AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hrGFP as a reporter gene in mouse muscle. These results may impact the design of future preclinical gene therapy studies targeting muscles and non-muscle tissues alike.Molecular Therapy - Nucleic Acids (2013) 2, e86; doi:10.1038/mtna.2013.16; published online 16 April 2013.

  17. Transfer and functional consequences of dietary microRNAs in vertebrates: Concepts in search of corroboration Negative results challenge the hypothesis that dietary xenomiRs cross the gut and regulate genes ...

    USDA-ARS?s Scientific Manuscript database

    If validated, diet-derived foreign microRNA absorption and function in consuming vertebrates would drastically alter our understanding of nutrition and ecology. RNA interference (RNAi) mechanisms of Caenorhabditis elegans are enhanced by uptake of environmental RNA and amplification and systemic dis...

  18. Cas5d Protein Processes Pre-crRNA and Assembles into a Cascade-like Interference Complex in Subtype I-C/Dvulg CRISPR-Cas System

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nam, Ki Hyun; Haitjema, Charles; Liu, Xueqi

    Clustered regularly interspaced short palindromic repeats (CRISPRs), together with an operon of CRISPR-associated (Cas) proteins, form an RNA-based prokaryotic immune system against exogenous genetic elements. Cas5 family proteins are found in several type I CRISPR-Cas systems. Here, we report the molecular function of subtype I-C/Dvulg Cas5d from Bacillus halodurans. We show that Cas5d cleaves pre-crRNA into unit length by recognizing both the hairpin structure and the 3 single stranded sequence in the CRISPR repeat region. Cas5d structure reveals a ferredoxin domain-based architecture and a catalytic triad formed by Y46, K116, and H117 residues. We further show that after pre-crRNA processing,more » Cas5d assembles with crRNA, Csd1, and Csd2 proteins to form a multi-sub-unit interference complex similar to Escherichia coli Cascade (CRISPR-associated complex for antiviral defense) in architecture. Our results suggest that formation of a crRNA-presenting Cascade-like complex is likely a common theme among type I CRISPR subtypes.« less

  19. Knockdown of the Chromatin Remodeling Gene Brahma by RNA Interference Reduces Reproductive Fitness and Lifespan in Common Bed Bug (Hemiptera: Cimicidae).

    PubMed

    Basnet, Sanjay; Kamble, Shripat T

    2018-05-04

    The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.

  20. Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma.

    PubMed

    Xie, Yuran; Merkel, Olivia M

    2015-10-01

    Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues have limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases, and costimulatory factors that have been reported as targets of siRNA-mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages, and dendritic cells, which could potentially be applied in asthma therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Efficacy of a Novel Class of RNA Interference Therapeutic Agents

    PubMed Central

    Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki

    2012-01-01

    RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145

  2. RNA interference-mediated NOTCH3 knockdown induces phenotype switching of vascular smooth muscle cells in vitro

    PubMed Central

    Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming

    2015-01-01

    Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway. PMID:26550181

  3. RNA interference-mediated NOTCH3 knockdown induces phenotype switching of vascular smooth muscle cells in vitro.

    PubMed

    Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming

    2015-01-01

    Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway.

  4. RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans

    PubMed Central

    Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.

    2005-01-01

    In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635

  5. Molecular requirements for RNA-induced silencing complex assembly in the Drosophila RNA interference pathway.

    PubMed

    Pham, John W; Sontheimer, Erik J

    2005-11-25

    Complexes in the Drosophila RNA-induced silencing complex (RISC) assembly pathway can be resolved using native gel electrophoresis, revealing an initiator called R1, an intermediate called R2, and an effector called R3 (now referred to as holo-RISC). Here we show that R1 forms when the Dicer-2/R2D2 heterodimer binds short interfering RNA (siRNA) duplexes. The heterodimer alone can initiate RISC assembly, indicating that other factors are dispensable for initiation. During assembly, R2 requires Argonaute 2 to convert into holo-RISC. This requirement is reminiscent of the RISC-loading complex, which also requires Argonaute 2 for assembly into RISC. We have compared R2 to the RISC-loading complex and show that the two complexes are similar in their sensitivities to ATP and to chemical modifications on siRNA duplexes, indicating that they are likely to be identical. We have examined the requirements for RISC formation and show that the siRNA 5'-termini are repeatedly monitored during RISC assembly, first by the Dcr-2/R2D2 heterodimer and again after R2 formation, before siRNA unwinding. The 2'-position of the 5'-terminal nucleotide also affects RISC assembly, because an siRNA strand bearing a 2'-deoxyribose at this position can inhibit the cognate strand from entering holo-RISC; in contrast, the 2'-deoxyribose-modified strand has enhanced activity in the RNA interference pathway.

  6. Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.

    PubMed

    Huang, Mei; Wu, Joseph C

    2011-01-01

    Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.

  7. Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia

    PubMed Central

    Huang, Mei; Wu, Joseph C.

    2011-01-01

    Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030

  8. RNA interference inhibits yellow fever virus replication in vitro and in vivo.

    PubMed

    Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L

    2009-04-01

    RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.

  9. Interference activity of a minimal Type I CRISPR–Cas system from Shewanella putrefaciens

    PubMed Central

    Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

    2015-01-01

    Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. PMID:26350210

  10. A Small GTP-Binding Host Protein Is Required for Entry of Powdery Mildew Fungus into Epidermal Cells of Barley1

    PubMed Central

    Schultheiss, Holger; Dechert, Cornelia; Kogel, Karl-Heinz; Hückelhoven, Ralph

    2002-01-01

    Small GTP-binding proteins such as those from the RAC family are cytosolic signal transduction proteins that often are involved in processing of extracellular stimuli. Plant RAC proteins are implicated in regulation of plant cell architecture, secondary wall formation, meristem signaling, and defense against pathogens. We isolated a RacB homolog from barley (Hordeum vulgare) to study its role in resistance to the barley powdery mildew fungus (Blumeria graminis f.sp. hordei). RacB was constitutively expressed in the barley epidermis and its expression level was not strongly influenced by inoculation with B. graminis. However, after biolistic bombardment of barley leaf segments with RacB-double-stranded RNA, sequence-specific RNA interference with RacB function inhibited fungal haustorium establishment in a cell-autonomous and genotype-specific manner. Mutants compromised in function of the Mlo wild-type gene and the Ror1 gene (genotype mlo5 ror1) that are moderately susceptible to B. graminis showed no alteration in powdery mildew resistance upon RacB-specific RNA interference. Thus, the phenotype, induced by RacB-specific RNA interference, was apparently dependent on the same processes as mlo5-mediated broad resistance, which is suppressed by ror1. We conclude that an RAC small GTP-binding protein is required for successful fungal haustorium establishment and that this function may be linked to MLO-associated functions. PMID:11950993

  11. 40 CFR 1065.372 - NDUV analyzer HC and H2O interference verification.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... compensation algorithms that utilize measurements of other gases to meet this interference verification, simultaneously conduct such measurements to test the algorithms during the analyzer interference verification. (c...

  12. Non-target Effects of Green Fluorescent Protein (GFP)-derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays

    PubMed Central

    Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.

    2013-01-01

    RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797

  13. Non-Target Effects of Green Fluorescent Protein (GFP)-Derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays.

    PubMed

    Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P

    2013-01-04

    RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

  14. Expression and RNA Interference of Salivary Polygalacturonase Genes in the Tarnished Plant Bug, Lygus lineolaris

    PubMed Central

    Walker, William B.; Allen, Margaret L.

    2010-01-01

    Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205

  15. Neutral Polymeric Micelles for RNA Delivery

    PubMed Central

    Lundy, Brittany B.; Convertine, Anthony; Miteva, Martina; Stayton, Patrick S.

    2013-01-01

    RNA interference (RNAi) drugs have significant therapeutic potential but delivery systems with appropriate efficacy and toxicity profiles are still needed. Here, we describe a neutral, ampholytic polymeric delivery system based on conjugatable diblock polymer micelles. The diblock copolymer contains a hydrophilic poly[N-(2-hydroxypropyl) methacrylamide-co-N-(2-(pyridin-2- yldisulfanyl)ethyl)methacrylamide) (poly[HPMA-co-PDSMA]) segment to promote aqueous stability and facilitate thiol-disulfide exchange reactions, and a second ampholytic block composed of propyl acrylic acid (PAA), dimethylaminoethyl methacrylate (DMAEMA), and butyl methacrylate (BMA). The poly[(HPMA-co-PDSMA)-b-(PAA-co-DMAEMA-co-BMA)] was synthesized using Reversible Addition-Fragmentation chain Transfer (RAFT) polymerization with an overall molecular weight of 22,000 g/mol and a PDI of 1.88. Dynamic light scattering and fluorescence measurements indicated that the diblock copolymers self-assemble under aqueous conditions to form polymeric micelles with a hydrodynamic radius and critical micelle concentration of 25 nm and 25 μg/mL respectively. Red blood cell hemolysis experiments show that the neutral hydrophilic micelles have potent membrane destabilizing activity at endosomal pH values. Thiolated siRNA targeting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was directly conjugated to the polymeric micelles via thiol exchange reactions with the pyridal disulfide groups present in the micelle corona. Maximum silencing activity in HeLa cells was observed at a 1:10 molar ratio of siRNA to polymer following a 48 h incubation period. Under these conditions 90 % mRNA knockdown and 65 % and protein knockdown of at 48 h was achieved with negligible toxicity. In contrast the polymeric micelles lacking a pH-responsive endosomalytic segment demonstrated negligible mRNA and protein knockdown under these conditions. The potent mRNA knockdown and excellent biocompatibility of the neutral siRNA conjugates demonstrate the potential utility if this carrier design for delivering therapeutic siRNA drugs. PMID:23360541

  16. Fusogenic-Oligoarginine Peptide-Mediated Delivery of siRNAs Targeting the CIP2A Oncogene into Oral Cancer Cells

    PubMed Central

    Cantini, Liliana; Attaway, Christopher C.; Butler, Betsy; Andino, Lourdes M.; Sokolosky, Melissa L.; Jakymiw, Andrew

    2013-01-01

    Despite a better understanding of the pathogenesis of oral cancer, its treatment outcome remains poor. Thus, there is a need for new therapeutic strategies to improve the prognosis of this disease. RNA interference (RNAi) appears to be a promising therapeutic tool for the treatment of many diseases, including oral cancer. However, an obstacle for RNAi-mediated therapies has been delivery, in particular, the retention of small interfering RNAs (siRNAs) in endosomes and their subsequent degradation in lysosomes, resulting in inefficient gene silencing. Thus, the current study examined the feasibility of designing and utilizing a peptide, termed 599, consisting of a synthetic influenza virus-derived endosome-disruptive fusogenic peptide sequence and a stretch of cationic cell-penetrating nona(D-arginine) residues, to deliver siRNAs into oral cancer cells and induce silencing of the therapeutic target, CIP2A, an oncoprotein overexpressed in various human malignancies including oral cancer. Increasing the 599 peptide-to-siRNA molar ratio demonstrated a higher binding capacity for siRNA molecules and enhanced siRNA delivery into the cytoplasm of oral cancer cells. In fact, quantitative measurements of siRNA delivery into cells demonstrated that a 50∶1 peptide-to-siRNA molar ratio could deliver 18-fold higher amounts of siRNAs compared to cells treated with siRNA alone with no significant long-term cytotoxic effects. Most importantly, the 599 peptide-mediated siRNA delivery promoted significant CIP2A mRNA and protein silencing which resulted in decreased oral cancer cell invasiveness and anchorage-independent growth. Together, these data demonstrate that a chimeric peptide consisting of a fusogenic sequence, in combination with cell-penetrating residues, can be used to effectively deliver siRNAs into oral cancer cells and induce the silencing of its target gene, potentially offering a new therapeutic strategy in combating oral cancer. PMID:24019920

  17. Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells.

    PubMed

    Khandelia, Piyush; Yap, Karen; Makeyev, Eugene V

    2011-08-02

    Sequence-specific gene silencing by short hairpin (sh) RNAs has recently emerged as an indispensable tool for understanding gene function and a promising avenue for drug discovery. However, a wider biomedical use of this approach is hindered by the lack of straightforward methods for achieving uniform expression of shRNAs in mammalian cell cultures. Here we report a high-efficiency and low-background (HILO) recombination-mediated cassette exchange (RMCE) technology that yields virtually homogeneous cell pools containing doxycycline-inducible shRNA elements in a matter of days and with minimal efforts. To ensure immediate utility of this approach for a wider research community, we modified 11 commonly used human (A549, HT1080, HEK293T, HeLa, HeLa-S3, and U2OS) and mouse (CAD, L929, N2a, NIH 3T3, and P19) cell lines to be compatible with the HILO-RMCE process. Because of its technical simplicity and cost efficiency, the technology will be advantageous for both low- and high-throughput shRNA experiments. We also provide evidence that HILO-RMCE will facilitate a wider range of molecular and cell biology applications by allowing one to rapidly engineer cell populations expressing essentially any transgene of interest.

  18. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie

    2009-11-20

    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR)more » shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.« less

  19. Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells

    PubMed Central

    Khandelia, Piyush; Yap, Karen; Makeyev, Eugene V.

    2011-01-01

    Sequence-specific gene silencing by short hairpin (sh) RNAs has recently emerged as an indispensable tool for understanding gene function and a promising avenue for drug discovery. However, a wider biomedical use of this approach is hindered by the lack of straightforward methods for achieving uniform expression of shRNAs in mammalian cell cultures. Here we report a high-efficiency and low-background (HILO) recombination-mediated cassette exchange (RMCE) technology that yields virtually homogeneous cell pools containing doxycycline-inducible shRNA elements in a matter of days and with minimal efforts. To ensure immediate utility of this approach for a wider research community, we modified 11 commonly used human (A549, HT1080, HEK293T, HeLa, HeLa-S3, and U2OS) and mouse (CAD, L929, N2a, NIH 3T3, and P19) cell lines to be compatible with the HILO-RMCE process. Because of its technical simplicity and cost efficiency, the technology will be advantageous for both low- and high-throughput shRNA experiments. We also provide evidence that HILO-RMCE will facilitate a wider range of molecular and cell biology applications by allowing one to rapidly engineer cell populations expressing essentially any transgene of interest. PMID:21768390

  20. Hypoxia-inducible factor 1–mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions

    PubMed Central

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-01-01

    Abstract Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type–specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34+ haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl2 induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. PMID:22050843

  1. RNA interference: learning gene knock-down from cell physiology

    PubMed Central

    Mocellin, Simone; Provenzano, Maurizio

    2004-01-01

    Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

  2. Silencing the lettuce homologs of small rubber particle protein does not influence natural rubber biosynthesis in lettuce (Lactuca sativa).

    PubMed

    Chakrabarty, Romit; Qu, Yang; Ro, Dae-Kyun

    2015-05-01

    Natural rubber, cis-1,4-polyisoprene, is an important raw material in chemical industries, but its biosynthetic mechanism remains elusive. Natural rubber is known to be synthesized in rubber particles suspended in laticifer cells in the Brazilian rubber tree (Hevea brasiliensis). In the rubber tree, rubber elongation factor (REF) and its homolog, small rubber particle protein (SRPP), were found to be the most abundant proteins in rubber particles, and they have been implicated in natural rubber biosynthesis. As lettuce (Lactuca sativa) can synthesize natural rubber, we utilized this annual, transformable plant to examine in planta roles of the lettuce REF/SRPP homologs by RNA interference. Among eight lettuce REF/SRPP homologs identified, transcripts of two genes (LsSRPP4 and LsSRPP8) accounted for more than 90% of total transcripts of REF/SRPP homologs in lettuce latex. LsSRPP4 displays a typical primary protein sequence as other REF/SRPP, while LsSRPP8 is twice as long as LsSRPP4. These two major LsSRPP transcripts were individually and simultaneously silenced by RNA interference, and relative abundance, polymer molecular weight, and polydispersity of natural rubber were analyzed from the LsSRPP4- and LsSRPP8-silenced transgenic lettuce. Despite previous data suggesting the implications of REF/SRPP in natural rubber biosynthesis, qualitative and quantitative alterations of natural rubber could not be observed in transgenic lettuce lines. It is concluded that lettuce REF/SRPP homologs are not critically important proteins in natural rubber biosynthesis in lettuce. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. A mex3 homolog is required for differentiation during planarian stem cell lineage development

    PubMed Central

    Zhu, Shu Jun; Hallows, Stephanie E; Currie, Ko W; Xu, ChangJiang; Pearson, Bret J

    2015-01-01

    Neoblasts are adult stem cells (ASCs) in planarians that sustain cell replacement during homeostasis and regeneration of any missing tissue. While numerous studies have examined genes underlying neoblast pluripotency, molecular pathways driving postmitotic fates remain poorly defined. In this study, we used transcriptional profiling of irradiation-sensitive and irradiation-insensitive cell populations and RNA interference (RNAi) functional screening to uncover markers and regulators of postmitotic progeny. We identified 32 new markers distinguishing two main epithelial progenitor populations and a planarian homolog to the MEX3 RNA-binding protein (Smed-mex3-1) as a key regulator of lineage progression. mex3-1 was required for generating differentiated cells of multiple lineages, while restricting the size of the stem cell compartment. We also demonstrated the utility of using mex3-1(RNAi) animals to identify additional progenitor markers. These results identified mex3-1 as a cell fate regulator, broadly required for differentiation, and suggest that mex3-1 helps to mediate the balance between ASC self-renewal and commitment. DOI: http://dx.doi.org/10.7554/eLife.07025.001 PMID:26114597

  4. RNAi and Antiviral Defense in the Honey Bee.

    PubMed

    Brutscher, Laura M; Flenniken, Michelle L

    2015-01-01

    Honey bees play an important agricultural and ecological role as pollinators of numerous agricultural crops and other plant species. Therefore, investigating the factors associated with high annual losses of honey bee colonies in the US is an important and active area of research. Pathogen incidence and abundance correlate with Colony Collapse Disorder- (CCD-) affected colonies in the US and colony losses in the US and in some European countries. Honey bees are readily infected by single-stranded positive sense RNA viruses. Largely dependent on the host immune response, virus infections can either remain asymptomatic or result in deformities, paralysis, or death of adults or larvae. RNA interference (RNAi) is an important antiviral defense mechanism in insects, including honey bees. Herein, we review the role of RNAi in honey bee antiviral defense and highlight some parallels between insect and mammalian immune systems. A more thorough understanding of the role of pathogens on honey bee health and the immune mechanisms bees utilize to combat infectious agents may lead to the development of strategies that enhance honey bee health and result in the discovery of additional mechanisms of immunity in metazoans.

  5. RNAi and Antiviral Defense in the Honey Bee

    PubMed Central

    Brutscher, Laura M.; Flenniken, Michelle L.

    2015-01-01

    Honey bees play an important agricultural and ecological role as pollinators of numerous agricultural crops and other plant species. Therefore, investigating the factors associated with high annual losses of honey bee colonies in the US is an important and active area of research. Pathogen incidence and abundance correlate with Colony Collapse Disorder- (CCD-) affected colonies in the US and colony losses in the US and in some European countries. Honey bees are readily infected by single-stranded positive sense RNA viruses. Largely dependent on the host immune response, virus infections can either remain asymptomatic or result in deformities, paralysis, or death of adults or larvae. RNA interference (RNAi) is an important antiviral defense mechanism in insects, including honey bees. Herein, we review the role of RNAi in honey bee antiviral defense and highlight some parallels between insect and mammalian immune systems. A more thorough understanding of the role of pathogens on honey bee health and the immune mechanisms bees utilize to combat infectious agents may lead to the development of strategies that enhance honey bee health and result in the discovery of additional mechanisms of immunity in metazoans. PMID:26798663

  6. Exposure to West Nile Virus Increases Bacterial Diversity and Immune Gene Expression in Culex pipiens.

    PubMed

    Zink, Steven D; Van Slyke, Greta A; Palumbo, Michael J; Kramer, Laura D; Ciota, Alexander T

    2015-10-27

    Complex interactions between microbial residents of mosquitoes and arboviruses are likely to influence many aspects of vectorial capacity and could potentially have profound effects on patterns of arbovirus transmission. Such interactions have not been well studied for West Nile virus (WNV; Flaviviridae, Flavivirus) and Culex spp. mosquitoes. We utilized next-generation sequencing of 16S ribosomal RNA bacterial genes derived from Culex pipiens Linnaeus following WNV exposure and/or infection and compared bacterial populations and broad immune responses to unexposed mosquitoes. Our results demonstrate that WNV infection increases the diversity of bacterial populations and is associated with up-regulation of classical invertebrate immune pathways including RNA interference (RNAi), Toll, and Jak-STAT (Janus kinase-Signal Transducer and Activator of Transcription). In addition, WNV exposure alone, without the establishment of infection, results in similar alterations to microbial and immune signatures, although to a lesser extent. Multiple bacterial genera were found in greater abundance inWNV-exposed and/or infected mosquitoes, yet the most consistent and notable was the genus Serratia.

  7. Translation Repression in Human Cells by MicroRNA-Induced Gene Silencing Requires RCK/p54

    PubMed Central

    Chu, Chia-ying

    2006-01-01

    RNA interference is triggered by double-stranded RNA that is processed into small interfering RNAs (siRNAs) by Dicer enzyme. Endogenously, RNA interference triggers are created from small noncoding RNAs called microRNAs (miRNAs). RNA-induced silencing complexes (RISC) in human cells can be programmed by exogenously introduced siRNA or endogenously expressed miRNA. siRNA-programmed RISC (siRISC) silences expression by cleaving a perfectly complementary target mRNA, whereas miRNA-induced silencing complexes (miRISC) inhibits translation by binding imperfectly matched sequences in the 3′ UTR of target mRNA. Both RISCs contain Argonaute2 (Ago2), which catalyzes target mRNA cleavage by siRISC and localizes to cytoplasmic mRNA processing bodies (P-bodies). Here, we show that RCK/p54, a DEAD box helicase, interacts with argonaute proteins, Ago1 and Ago2, in affinity-purified active siRISC or miRISC from human cells; directly interacts with Ago1 and Ago2 in vivo, facilitates formation of P-bodies, and is a general repressor of translation. Disrupting P-bodies by depleting Lsm1 did not affect RCK/p54 interactions with argonaute proteins and its function in miRNA-mediated translation repression. Depletion of RCK/p54 disrupted P-bodies and dispersed Ago2 throughout the cytoplasm but did not significantly affect siRNA-mediated RNA functions of RISC. Depleting RCK/p54 released general, miRNA-induced, and let-7-mediated translational repression. Therefore, we propose that translation repression is mediated by miRISC via RCK/p54 and its specificity is dictated by the miRNA sequence binding multiple copies of miRISC to complementary 3′ UTR sites in the target mRNA. These studies also suggest that translation suppression by miRISC does not require P-body structures, and location of miRISC to P-bodies is the consequence of translation repression. PMID:16756390

  8. In-silico analysis for RNA-interference mechanism of α-synuclein to treat Parkinson's disease.

    PubMed

    Seema, S; Seenivasagam, R; Hemavathi, K

    2013-01-01

    Parkinson's Disease (PD) causing mutations in α-synuclein gene are ALA30PRO, GLU46LYS and ALA53THR. The conformational changes in proteins with respect to all the three mutations were analysed. These were used to predict the structures of Short Interfering RNA (siRNA) antisense strand and siRNA region. The siRNA binds with the argonaute protein forming RNA Induced Silencing Complex (RISC). Then, siRNA antisense-strand was attached to RISC. The structure of dicer (RNase-III-enzyme) cleaves double-stranded RNA (dsRNA) into two siRNA-strands. Incorporation of single siRNA-strand into RISC guides to pair with the complementary α-synuclein target-messenger RNA (mRNA) thereby enabling it to cleave the target.

  9. Analytical performance of a bronchial genomic classifier.

    PubMed

    Hu, Zhanzhi; Whitney, Duncan; Anderson, Jessica R; Cao, Manqiu; Ho, Christine; Choi, Yoonha; Huang, Jing; Frink, Robert; Smith, Kate Porta; Monroe, Robert; Kennedy, Giulia C; Walsh, P Sean

    2016-02-26

    The current standard practice of lung lesion diagnosis often leads to inconclusive results, requiring additional diagnostic follow up procedures that are invasive and often unnecessary due to the high benign rate in such lesions (Chest 143:e78S-e92, 2013). The Percepta bronchial genomic classifier was developed and clinically validated to provide more accurate classification of lung nodules and lesions that are inconclusive by bronchoscopy, using bronchial brushing specimens (N Engl J Med 373:243-51, 2015, BMC Med Genomics 8:18, 2015). The analytical performance of the Percepta test is reported here. Analytical performance studies were designed to characterize the stability of RNA in bronchial brushing specimens during collection and shipment; analytical sensitivity defined as input RNA mass; analytical specificity (i.e. potentially interfering substances) as tested on blood and genomic DNA; and assay performance studies including intra-run, inter-run, and inter-laboratory reproducibility. RNA content within bronchial brushing specimens preserved in RNAprotect is stable for up to 20 days at 4 °C with no changes in RNA yield or integrity. Analytical sensitivity studies demonstrated tolerance to variation in RNA input (157 ng to 243 ng). Analytical specificity studies utilizing cancer positive and cancer negative samples mixed with either blood (up to 10 % input mass) or genomic DNA (up to 10 % input mass) demonstrated no assay interference. The test is reproducible from RNA extraction through to Percepta test result, including variation across operators, runs, reagent lots, and laboratories (standard deviation of 0.26 for scores on > 6 unit scale). Analytical sensitivity, analytical specificity and robustness of the Percepta test were successfully verified, supporting its suitability for clinical use.

  10. Neural mechanisms of interference control in working memory: effects of interference expectancy and fluid intelligence.

    PubMed

    Burgess, Gregory C; Braver, Todd S

    2010-09-20

    A critical aspect of executive control is the ability to limit the adverse effects of interference. Previous studies have shown activation of left ventrolateral prefrontal cortex after the onset of interference, suggesting that interference may be resolved in a reactive manner. However, we suggest that interference control may also operate in a proactive manner to prevent effects of interference. The current study investigated the temporal dynamics of interference control by varying two factors - interference expectancy and fluid intelligence (gF) - that could influence whether interference control operates proactively versus reactively. A modified version of the recent negatives task was utilized. Interference expectancy was manipulated across task blocks by changing the proportion of recent negative (interference) trials versus recent positive (facilitation) trials. Furthermore, we explored whether gF affected the tendency to utilize specific interference control mechanisms. When interference expectancy was low, activity in lateral prefrontal cortex replicated prior results showing a reactive control pattern (i.e., interference-sensitivity during probe period). In contrast, when interference expectancy was high, bilateral prefrontal cortex activation was more indicative of proactive control mechanisms (interference-related effects prior to the probe period). Additional results suggested that the proactive control pattern was more evident in high gF individuals, whereas the reactive control pattern was more evident in low gF individuals. The results suggest the presence of two neural mechanisms of interference control, with the differential expression of these mechanisms modulated by both experimental (e.g., expectancy effects) and individual difference (e.g., gF) factors.

  11. On the Benefits of Creeping Wave Antennas in Reducing Interference Between Neighboring Wireless Body Area Networks.

    PubMed

    Tsouri, Gill R; Zambito, Stephanie R; Venkataraman, Jayanti

    2017-02-01

    We consider the on-body, off-body, and body-to-body channels in wireless body area networks utilizing creeping wave antennas. Experimental setups are used to gather measurements in the 2.4 GHz band with body area networks operating in an office environment. Data packets providing received signal strength indicators are used to assess the performance of the creeping wave antenna in reducing interference at a neighboring on-body access point while supporting reliable on-body communications. Results demonstrate that creeping wave antennas provide reliable on-body communications while significantly reducing inter-network interference; the inter-network interference is shown to be 10 dB weaker than the on-body signal. In addition, the inter-network interference when both networks utilize creeping wave antennas is shown to be 3 dB weaker than the interference when monopole antennas are used.

  12. Dietary risk assessment of v-ATPase A dsRNAs on monarch butterfly larvae

    USDA-ARS?s Scientific Manuscript database

    The goal of this study is to assess the risks of RNA interference (RNAi)-based genetically engineered crops on a non-target arthropod, monarch butterfly, Danaus plexippus. We hypothesize that an insecticidal double-stranded (ds) RNA targeting western corn rootworm, Diabrotica virgifera virgifera, ha...

  13. Dana-Farber Cancer Institute: Genome-wide shRNA Screens with DEMETER Inferred Gene Effects | Office of Cancer Genomics

    Cancer.gov

    In this study RNA interference (RNAi) screens were performed on 285 cell lines and combined with 216 lines previously screened, which were then analyzed together with DEMETER to discover genetic dependencies across the entire pool of cell lines. Read the abstract

  14. Characterizing small RNA populations in non-transgenic and aflatoxin-reducing-transgenic peanut lines

    USDA-ARS?s Scientific Manuscript database

    Aflatoxin contamination is a major constraint in the food production worlwide. In peanut these aflatoxins are mainly produced by Aspergillus flavus (Link) and A. parasiticus (Speare). The use of RNA interference (RNAi) is a promising method to reduce or prevent the accumulation of aflatoxin in pean...

  15. Proteomics for understanding miRNA biology

    PubMed Central

    Huang, Tai-Chung; Pinto, Sneha M.; Pandey, Akhilesh

    2013-01-01

    MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. PMID:23125164

  16. Lack of WDR36 leads to preimplantation embryonic lethality in mice and delays the formation of small subunit ribosomal RNA in human cells in vitro.

    PubMed

    Gallenberger, Martin; Meinel, Dominik M; Kroeber, Markus; Wegner, Michael; Milkereit, Philipp; Bösl, Michael R; Tamm, Ernst R

    2011-02-01

    Mutations in WD repeat domain 36 gene (WDR36) play a causative role in some forms of primary open-angle glaucoma, a leading cause of blindness worldwide. WDR36 is characterized by the presence of multiple WD40 repeats and shows homology to Utp21, an essential protein component of the yeast small subunit (SSU) processome required for maturation of 18S rRNA. To clarify the functional role of WDR36 in the mammalian organism, we generated and investigated mutant mice with a targeted deletion of Wdr36. In parallel experiments, we used RNA interference to deplete WDR36 mRNA in mouse embryos and cultured human trabecular meshwork (HTM-N) cells. Deletion of Wdr36 in the mouse caused preimplantation embryonic lethality, and essentially similar effects were observed when WDR36 mRNA was depleted in mouse embryos by RNA interference. Depletion of WDR36 mRNA in HTM-N cells caused apoptotic cell death and upregulation of mRNA for BAX, TP53 and CDKN1A. By immunocytochemistry, staining for WDR36 was observed in the nucleolus of cells, which co-localized with that of nucleolar proteins such as nucleophosmin and PWP2. In addition, recombinant and epitope-tagged WDR36 localized to the nucleolus of HTM-N cells. By northern blot analysis, a substantial decrease in 21S rRNA, the precursor of 18S rRNA, was observed following knockdown of WDR36. In addition, metabolic-labeling experiments consistently showed a delay of 18S rRNA maturation in WDR36-depleted cells. Our results provide evidence that WDR36 is an essential protein in mammalian cells which is involved in the nucleolar processing of SSU 18S rRNA.

  17. Knockdown of RNA interference pathway genes in western corn rootworm, Diabrotica virgifera virgifera, identifies no fitness costs associated with Argonaute 2 or Dicer-2.

    PubMed

    Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D

    2018-06-01

    The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.

    PubMed

    Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana

    2018-01-01

    Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.

  19. Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

    PubMed Central

    Tomoyasu, Yoshinori

    2014-01-01

    The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485

  20. The cytoskeletal scaffold Shank3 is recruited to pathogen-induced actin rearrangements

    PubMed Central

    Huett, Alan; Leong, John M; Podolsky, Daniel K.; Xavier, Ramnik J.

    2009-01-01

    Summary The common gastrointestinal pathogens enteropathogenic Escherichia coli (EPEC) and Salmonella Typhimurium both reorganize the gut epithelial cell actin cytoskeleton to mediate pathogenesis, utilizing mimicry of the host signaling apparatus. The PDZ domain-containing protein Shank3, is a large cytoskeletal scaffold protein with known functions in neuronal morphology and synaptic signaling, and is also capable of acting as a scaffolding adaptor during Ret tyrosine kinase signaling in epithelial cells. Using immunofluorescent and functional RNA-interference approaches we show that Shank3 is present in both EPEC- and S. Typhimurium-induced actin rearrangements and is required for optimal EPEC pedestal formation. We propose that Shank3 is one of a number of host synaptic proteins likely to play key roles in bacteria-host interactions. PMID:19371741

  1. Immunity to Rice black streaked dwarf virus, a plant reovirus, can be achieved in rice plants by RNA silencing against the gene for the viroplasm component protein.

    PubMed

    Shimizu, Takumi; Nakazono-Nagaoka, Eiko; Akita, Fusamichi; Uehara-Ichiki, Tamaki; Omura, Toshihiro; Sasaya, Takahide

    2011-09-01

    The nonstructural protein P9-1 of Rice black streaked dwarf virus has been confirmed to accumulate in viroplasms, the putative sites of viral replication, in infected plants and insects. We transformed rice plants by introducing an RNA interference construct against the P9-1-encoding gene. The resultant transgenic plants accumulated short interfering RNAs specific to the construct. All progenies produced by self-fertilization of these transgenic plants with induced RNA interference against the gene for P9-1 were resistant to infection by the virus. Our results demonstrated that interfering with the expression of a viroplasm component protein of plant reoviruses, which plays an important role in viral proliferation, might be a practical and effective way to control plant reovirus infection in crop plants. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. On future's doorstep: RNA interference and the pharmacopeia of tomorrow.

    PubMed

    Gewirtz, Alan M

    2007-12-01

    Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.

  3. Delivery of dsRNA through topical feeding for RNA interference in the citrus sap piercing-sucking hemipteran, Diaphorina citri.

    PubMed

    Killiny, Nabil; Kishk, Abdelaziz

    2017-06-01

    RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.

  4. 27nt-RNAs guide histone variant deposition via 'RNA-induced DNA replication interference' and thus transmit parental genome partitioning in Stylonychia.

    PubMed

    Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim

    2018-06-12

    During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.

  5. RNA sensor LGP2 inhibits TRAF ubiquitin ligase to negatively regulate innate immune signaling.

    PubMed

    Parisien, Jean-Patrick; Lenoir, Jessica J; Mandhana, Roli; Rodriguez, Kenny R; Qian, Kenin; Bruns, Annie M; Horvath, Curt M

    2018-06-01

    The production of type I interferon (IFN) is essential for cellular barrier functions and innate and adaptive antiviral immunity. In response to virus infections, RNA receptors RIG-I and MDA5 stimulate a mitochondria-localized signaling apparatus that uses TRAF family ubiquitin ligase proteins to activate master transcription regulators IRF3 and NFκB, driving IFN and antiviral target gene expression. Data indicate that a third RNA receptor, LGP2, acts as a negative regulator of antiviral signaling by interfering with TRAF family proteins. Disruption of LGP2 expression in cells results in earlier and overactive transcriptional responses to virus or dsRNA LGP2 associates with the C-terminus of TRAF2, TRAF3, TRAF5, and TRAF6 and interferes with TRAF ubiquitin ligase activity. TRAF interference is independent of LGP2 ATP hydrolysis, RNA binding, or its C-terminal domain, and LGP2 can regulate TRAF-mediated signaling pathways in trans , including IL-1β, TNFα, and cGAMP These findings provide a unique mechanism for LGP2 negative regulation through TRAF suppression and extend the potential impact of LGP2 negative regulation beyond the IFN antiviral response. © 2018 The Authors.

  6. Trypanosoma brucei RNA Editing Complex

    PubMed Central

    O'Hearn, Sean F.; Huang, Catherine E.; Hemann, Mike; Zhelonkina, Alevtina; Sollner-Webb, Barbara

    2003-01-01

    Maturation of Trypanosoma brucei mitochondrial mRNA involves massive posttranscriptional insertion and deletion of uridine residues. This RNA editing utilizes an enzymatic complex with seven major proteins, band I through band VII. We here use RNA interference (RNAi) to examine the band II and band V proteins. Band II is found essential for viability; it is needed to maintain the normal structure of the editing complex and to retain the band V ligase protein. Previously, band III was found essential for certain activities, including maintenance of the editing complex and retention of the band IV ligase protein. Thus, band II and band V form a protein pair with features analogous to the band III/band IV ligase pair. Since band V is specific for U insertion and since band IV is needed for U deletion, their parallel organization suggests that the editing complex has a pseudosymmetry. However, unlike the essential band IV ligase, RNAi to band V has only a morphological but no growth rate effect, suggesting that it is stimulatory but nonessential. Indeed, in vitro analysis of band V RNAi cell extract demonstrates that band IV can seal U insertion when band V is lacking. Thus, band IV ligase is the first activity of the basic editing complex shown able to serve in both forms of editing. Our studies also indicate that the U insertional portion may be less central in the editing complex than the corresponding U deletional portion. PMID:14560033

  7. Nanoparticle-based delivery of small interfering RNA: challenges for cancer therapy

    PubMed Central

    Miele, Evelina; Spinelli, Gian Paolo; Miele, Ermanno; Di Fabrizio, Enzo; Ferretti, Elisabetta; Tomao, Silverio; Gulino, Alberto

    2012-01-01

    During recent decades there have been remarkable advances and profound changes in cancer therapy. Many therapeutic strategies learned at the bench, including monoclonal antibodies and small molecule inhibitors, have been used at the bedside, leading to important successes. One of the most important advances in biology has been the discovery that small interfering RNA (siRNA) is able to regulate the expression of genes, by a phenomenon known as RNA interference (RNAi). RNAi is one of the most rapidly growing fields of research in biology and therapeutics. Much research effort has gone into the application of this new discovery in the treatment of various diseases, including cancer. However, even though these molecules may have potential and strong utility, some limitations make their clinical application difficult, including delivery problems, side effects due to off-target actions, disturbance of physiological functions of the cellular machinery involved in gene silencing, and induction of the innate immune response. Many researchers have attempted to overcome these limitations and to improve the safety of potential RNAi-based therapeutics. Nanoparticles, which are nanostructured entities with tunable size, shape, and surface, as well as biological behavior, provide an ideal opportunity to modify current treatment regimens in a substantial way. These nanoparticles could be designed to surmount one or more of the barriers encountered by siRNA. Nanoparticle drug formulations afford the chance to improve drug bioavailability, exploiting superior tissue permeability, payload protection, and the “stealth” features of these entities. The main aims of this review are: to explain the siRNA mechanism with regard to potential applications in siRNA-based cancer therapy; to discuss the possible usefulness of nanoparticle-based delivery of certain molecules for overcoming present therapeutic limitations; to review the ongoing relevant clinical research with its pitfalls and promises; and to evaluate critically future perspectives and challenges in siRNA-based cancer therapy. PMID:22915840

  8. Enzymatic Synthesis of Self-assembled Dicer Substrate RNA Nanostructures for Programmable Gene Silencing.

    PubMed

    Jang, Bora; Kim, Boyoung; Kim, Hyunsook; Kwon, Hyokyoung; Kim, Minjeong; Seo, Yunmi; Colas, Marion; Jeong, Hansaem; Jeong, Eun Hye; Lee, Kyuri; Lee, Hyukjin

    2018-06-08

    Enzymatic synthesis of RNA nanostructures is achieved by isothermal rolling circle transcription (RCT). Each arm of RNA nanostructures provides a functional role of Dicer substrate RNA inducing sequence specific RNA interference (RNAi). Three different RNAi sequences (GFP, RFP, and BFP) are incorporated within the three-arm junction RNA nanostructures (Y-RNA). The template and helper DNA strands are designed for the large-scale in vitro synthesis of RNA strands to prepare self-assembled Y-RNA. Interestingly, Dicer processing of Y-RNA is highly influenced by its physical structure and different gene silencing activity is achieved depending on its arm length and overhang. In addition, enzymatic synthesis allows the preparation of various Y-RNA structures using a single DNA template offering on demand regulation of multiple target genes.

  9. Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

    PubMed

    Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

    2017-02-01

    RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

  10. A yeast model for the mechanism of the Epstein-Barr virus immune evasion identifies a new therapeutic target to interfere with the virus stealthiness.

    PubMed

    Lista, María José; Martins, Rodrigo Prado; Angrand, Gaelle; Quillévéré, Alicia; Daskalogianni, Chrysoula; Voisset, Cécile; Teulade-Fichou, Marie-Paule; Fåhraeus, Robin; Blondel, Marc

    2017-08-31

    The oncogenic Epstein-Barr virus (EBV) evades the immune system but has an Achilles heel: its genome maintenance protein EBNA1. Indeed, EBNA1 is essential for viral genome replication and maintenance but also highly antigenic. Hence, EBV evolved a system in which the glycine-alanine repeat (GAr) of EBNA1 limits the translation of its own mRNA at a minimal level to ensure its essential function thereby, at the same time, minimizing immune recognition. Defining intervention points where to interfere with EBNA1 immune evasion is an important step to trigger an immune response against EBV-carrying cancers. Thanks to a yeast-based assay that recapitulates all the aspects of EBNA1 self-limitation of expression, a recent study by Lista et al. [Nature Communications (2017) 7, 435-444] has uncovered the role of the host cell nucleolin (NCL) in this process via a direct interaction of this protein with G-quadruplexes (G4) formed in GAr-encoding sequence of EBNA1 mRNA. In addition, the G4 ligand PhenDC3 prevents NCL binding on EBNA1 mRNA and reverses GAr-mediated repression of translation and antigen presentation. This shows that the NCL-EBNA1 mRNA interaction is a relevant therapeutic target to unveil EBV-carrying cancers to the immune system and that the yeast model can be successfully used for uncovering drugs and host factors that interfere with EBV stealthiness.

  11. Interference activity of a minimal Type I CRISPR-Cas system from Shewanella putrefaciens.

    PubMed

    Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

    2015-10-15

    Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

    PubMed

    Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

    2011-04-29

    RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. RNA interference: ready to silence cancer?

    PubMed

    Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

    2006-01-01

    RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

  14. Induction of RNA interference in dendritic cells.

    PubMed

    Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping

    2004-01-01

    Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.

  15. NAIM and site-specific functional group modification analysis of RNase P RNA: magnesium dependent structure within the conserved P1-P4 multihelix junction contributes to catalysis.

    PubMed

    Kaye, Nicholas M; Christian, Eric L; Harris, Michael E

    2002-04-09

    The tRNA processing endonuclease ribonuclease P contains an essential and highly conserved RNA molecule (RNase P RNA) that is the catalytic subunit of the enzyme. To identify and characterize functional groups involved in RNase P RNA catalysis, we applied self-cleaving ribozyme-substrate conjugates, on the basis of the RNase P RNA from Escherichia coli, in nucleotide analogue interference mapping (NAIM) and site-specific modification experiments. At high monovalent ion concentrations (3 M) that facilitate protein-independent substrate binding, we find that the ribozyme is largely insensitive to analogue substitution and that concentrations of Mg2+ (1.25 mM) well below that necessary for optimal catalytic rate (>100 mM) are required to produce interference effects because of modification of nucleotide bases. An examination of the pH dependence of the reaction rate at 1.25 mM Mg2+ indicates that the increased sensitivity to analogue interference is not due to a change in the rate-limiting step. The nucleotide positions detected by NAIM under these conditions are located exclusively in the catalytic domain, consistent with the proposed global structure of the ribozyme, and predominantly occur within the highly conserved P1-P4 multihelix junction. Several sensitive positions in J3/4 and J2/4 are proximal to a previously identified site of divalent metal ion binding in the P1-P4 element. Kinetic analysis of ribozymes with site-specific N7-deazaadenosine and deazaguanosine modifications in J3/4 was, in general, consistent with the interference results and also permitted the analysis of sites not accessible by NAIM. These results show that, in this region only, modification of the N7 positions of A62, A65, and A66 resulted in measurable effects on reaction rate and modification at each position displayed distinct sensitivities to Mg2+ concentration. These results reveal a restricted subset of individual functional groups within the catalytic domain that are particularly important for substrate cleavage and demonstrate a close association between catalytic function and metal ion-dependent structure in the highly conserved P1-P4 multihelix junction.

  16. Specificity Protein (Sp) Transcription Factors and Metformin Regulate Expression of the Long Non-coding RNA HULC

    EPA Science Inventory

    There is evidence that specificity protein 1 (Sp1) transcription factor (TF) regulates expression of long non-coding RNAs (lncRNAs) in hepatocellular carcinoma (HCC) cells. RNA interference (RNAi) studies showed that among several lncRNAs expressed in HepG2, SNU-449 and SK-Hep-1...

  17. Knockdown of Zinc Transporter ZIP5 by RNA Interference Inhibits Esophageal Cancer Growth In Vivo.

    PubMed

    Li, Qian; Jin, Jing; Liu, Jianghui; Wang, Liqun; He, Yutong

    2016-01-01

    We recently found that SLC39A5 (ZIP5), a zinc transporter, is overexpressed in esophageal cancer. Downregulation of ZIP5 inhibited the proliferation, migration, and invasion of the esophageal cancer cell line KYSE170 in vitro. In this study, we found that downregulation of SLC39A5 (ZIP5) by interference resulted in a significant reduction in esophageal cancer tumor volume and weight in vivo. COX2 (cyclooxygenase 2) expression was decreased and E-cadherin expression was increased in the KYSE170K xenografts, which was caused by the downregulation of ZIP5. However, we did not find that the downregulation of ZIP5 caused a change in the relative expressions of cyclin D1, VEGF (vascular endothelial growth factor), MMP9 (matrix metalloprotein 9), and Bcl-2 (B-cell lymphoma/leukmia-2) mRNA or an alteration in the average level of zinc in the peripheral blood and xenografts in vivo. Collectively, these findings indicate that knocking down ZIP5 by small interfering RNA (siRNA) might be a novel treatment strategy for esophageal cancer with ZIP5 overexpression.

  18. Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects.

    PubMed

    Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E

    2018-05-04

    Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for delivery of dsRNA to use in crop protection and overcome environmental challenges for pest management.

  19. HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

    PubMed Central

    Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

    2015-01-01

    Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

  20. HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

    PubMed

    Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

    2015-01-01

    Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

  1. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

    PubMed

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

    2018-02-12

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

  2. Backbone and sidechain methyl Ile (δ1), Leu and Val chemical shift assignments of RDE-4 (1-243), an RNA interference initiation protein in C. elegans.

    PubMed

    Chiliveri, Sai Chaitanya; Kumar, Sonu; Marelli, Udaya Kiran; Deshmukh, Mandar V

    2012-10-01

    The RNAi pathway of several organisms requires presence of double stranded RNA binding proteins for functioning of Dicer in gene regulation. In C. elegans, a double stranded RNA binding protein, RDE-4 (385 aa, 44 kDa) recognizes long exogenous dsRNA and initiates the RNAi pathway. We have achieved complete backbone and stereospecific methyl sidechain Ile (δ1), Leu and Val chemical shifts of first 243 amino acids of RDE-4, namely RDE-4ΔC.

  3. Iron(II) supramolecular helicates interfere with the HIV-1 Tat-TAR RNA interaction critical for viral replication.

    PubMed

    Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor

    2016-07-12

    The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat-TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates.

  4. Two classes of silencing RNAs move between C. elegans tissues

    PubMed Central

    Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

    2011-01-01

    Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

  5. Role of caspase-9 in the effector caspases and genome expressions, and growth of bovine skeletal myoblasts.

    PubMed

    Van Ba, Hoa; Hwang, Inho

    2014-02-01

    Caspase-9 has been reported as the key regulator of apoptosis, however, its role in skeletal myoblast development and molecular involvements during cell growth still remains unknown. The current study aimed to present the key role of caspase-9 in the expressions of apoptotic caspases and genome, and cell viability during myoblast growth using RNA interference mediated silencing. Three small interference RNA sequences (siRNAs) targeting caspase-9 gene was designed and ligated into pSilencer plasmid vector to construct shRNA expression constructs. Cells were transfected with the constructs for 48 h. Results indicated that all three siRNAs could silence the caspase-9 mRNA expression significantly. Particularly, the mRNA expression level of caspase-9 in the cells transfected by shRNA1, shRNA2 and shRNA3 constructs were reduced by 37.85%, 68.20% and 58.14%, respectively. Suppression of caspase-9 led to the significant increases in the mRNA and protein expressions of effector caspase-3, whereas the reduction in mRNA and protein expressions of caspase-7. The microarray results showed that the suppression of caspase-9 resulted in significant upregulations of cell proliferation-, adhesion-, growth-, development- and division-regulating genes, whereas the reduction in the expressions of cell death program- and stress response-regulating genes. Furthermore, cell viability was significantly increased following the transfection. These data suggest that caspase-9 could play an important role in the control of cell growth, and knockdown of caspase-9 may have genuine potential in the treatment of skeletal muscle atrophy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  6. Promoter of lncRNA Gene PVT1 Is a Tumor-Suppressor DNA Boundary Element. | Office of Cancer Genomics

    Cancer.gov

    Noncoding mutations in cancer genomes are frequent but challenging to interpret. PVT1 encodes an oncogenic lncRNA, but recurrent translocations and deletions in human cancers suggest alternative mechanisms. Here, we show that the PVT1 promoter has a tumor-suppressor function that is independent of PVT1 lncRNA. CRISPR interference of PVT1 promoter enhances breast cancer cell competition and growth in vivo.

  7. Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.

    PubMed

    Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E

    2013-04-01

    Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.

  8. Efficient HIV-1 inhibition by a 16 nt-long RNA aptamer designed by combining in vitro selection and in silico optimisation strategies

    PubMed Central

    Sánchez-Luque, Francisco J.; Stich, Michael; Manrubia, Susanna; Briones, Carlos; Berzal-Herranz, Alfredo

    2014-01-01

    The human immunodeficiency virus type-1 (HIV-1) genome contains multiple, highly conserved structural RNA domains that play key roles in essential viral processes. Interference with the function of these RNA domains either by disrupting their structures or by blocking their interaction with viral or cellular factors may seriously compromise HIV-1 viability. RNA aptamers are amongst the most promising synthetic molecules able to interact with structural domains of viral genomes. However, aptamer shortening up to their minimal active domain is usually necessary for scaling up production, what requires very time-consuming, trial-and-error approaches. Here we report on the in vitro selection of 64 nt-long specific aptamers against the complete 5′-untranslated region of HIV-1 genome, which inhibit more than 75% of HIV-1 production in a human cell line. The analysis of the selected sequences and structures allowed for the identification of a highly conserved 16 nt-long stem-loop motif containing a common 8 nt-long apical loop. Based on this result, an in silico designed 16 nt-long RNA aptamer, termed RNApt16, was synthesized, with sequence 5′-CCCCGGCAAGGAGGGG-3′. The HIV-1 inhibition efficiency of such an aptamer was close to 85%, thus constituting the shortest RNA molecule so far described that efficiently interferes with HIV-1 replication. PMID:25175101

  9. Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

    PubMed

    Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

    2015-10-01

    The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

  10. RNA interference targets arbovirus replication in Culicoides cells.

    PubMed

    Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain

    2013-03-01

    Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.

  11. Prediction of effective RNA interference targets and pathway-related genes in lepidopteran insects by RNA sequencing analysis.

    PubMed

    Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia

    2018-06-01

    When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  12. Reversal of multidrug resistance in MCF-7/Adr cells by codelivery of doxorubicin and BCL2 siRNA using a folic acid-conjugated polyethylenimine hydroxypropyl-β-cyclodextrin nanocarrier

    PubMed Central

    Li, Jin-Ming; Zhang, Wei; Su, Hua; Wang, Yuan-Yuan; Tan, Cai-Ping; Ji, Liang-Nian; Mao, Zong-Wan

    2015-01-01

    Systemic administration of chemotherapy for cancer often faces drug resistance, limiting its applications in cancer therapy. In this study, we developed a simple multifunctional nanocarrier based on polyethylenimine (PEI) to codeliver doxorubicin (DOX) and BCL2 small interfering RNA (siRNA) for overcoming multidrug resistance (MDR) and enhancing apoptosis in MCF-7/Adr cancer cells by combining chemotherapy and RNA interference (RNAi) therapy. The low-molecular-weight branch PEI was used to conjugate hydroxypropyl-β-cyclodextrin (HP-β-CD) and folic acid (FA), forming the codelivery nanocarrier (FA-HP-β-CD-PEI) to encapsulate DOX with the cavity HP-β-CD and bind siRNA with the positive charge of PEI for tumor-targeting codelivering drugs. The drug-loaded nanocomplexes (FA-HP-β-CD-PEI/DOX/siRNA) showed uniform size distribution, high cellular uptake, and significant gene suppression of BCL2, displaying the potential of overcoming MDR for enhancing the effect of anticancer drugs. Furthermore, the nanocomplexes achieved significant cell apoptosis through a mechanism of downregulating the antiapoptotic protein BCL2, resulted in improving therapeutic efficacy of the coadministered DOX by tumor targeting and RNA interference. Our study indicated that combined RNAi therapy and chemotherapy using our functional codelivery nanocarrier could overcome MDR and enhance apoptosis in MDR cancer cells for a potential application in treating MDR cancers. PMID:25960653

  13. Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors

    PubMed Central

    Lakatos, Lóránt; Csorba, Tibor; Pantaleo, Vitantonio; Chapman, Elisabeth J; Carrington, James C; Liu, Yu-Ping; Dolja, Valerian V; Calvino, Lourdes Fernández; López-Moya, Juan José; Burgyán, József

    2006-01-01

    RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in higher plants and insects. To counteract RNA silencing, viruses express silencing suppressors that interfere with both siRNA- and microRNA-guided silencing pathways. We used comparative in vitro and in vivo approaches to analyse the molecular mechanism of suppression by three well-studied silencing suppressors. We found that silencing suppressors p19, p21 and HC-Pro each inhibit the intermediate step of RNA silencing via binding to siRNAs, although the molecular features required for duplex siRNA binding differ among the three proteins. None of the suppressors affected the activity of preassembled RISC complexes. In contrast, each suppressor uniformly inhibited the siRNA-initiated RISC assembly pathway by preventing RNA silencing initiator complex formation. PMID:16724105

  14. RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

    USDA-ARS?s Scientific Manuscript database

    The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

  15. Double strand RNA oral delivery methods to induce RNA interference in phloem and plant-sap-feeding insects

    USDA-ARS?s Scientific Manuscript database

    Phloem and plant sap feeding insect pests invade the integrity of crops and fruits to retrieve nutrients in the process damaging food productivity. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. Halyomorpha hal...

  16. Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

    PubMed Central

    2010-01-01

    Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854

  17. Downregulation of the CCK-B receptor in pancreatic cancer cells blocks proliferation and promotes apoptosis

    PubMed Central

    Fino, Kristin K.; Matters, Gail L.; McGovern, Christopher O.; Gilius, Evan L.

    2012-01-01

    Gastrin stimulates the growth of pancreatic cancer cells through the activation of the cholecystokinin-B receptor (CCK-BR), which has been found to be overexpressed in pancreatic cancer. In this study, we proposed that the CCK-BR drives growth of pancreatic cancer; hence, interruption of CCK-BR activity could potentially be an ideal target for cancer therapeutics. The effect of CCK-BR downregulation in the human pancreatic adenocarcinoma cells was examined by utilizing specific CCK-BR-targeted RNA interference reagents. The CCK-BR receptor expression was both transiently and stably downregulated by transfection with selective CCK-BR small-interfering RNA or short-hairpin RNA, respectively, and the effects on cell growth and apoptosis were assessed. CCK-BR downregulation resulted in reduced cancer cell proliferation, decreased DNA synthesis, and cell cycle arrest as demonstrated by an inhibition of G1 to S phase progression. Furthermore, CCK-BR downregulation increased caspase-3 activity, TUNEL-positive cells, and decreased X-linked inhibitor of apoptosis protein expression, suggesting apoptotic activity. Pancreatic cancer cell mobility was decreased when the CCK-BR was downregulated, as assessed by a migration assay. These results show the importance of the CCK-BR in regulation of growth and apoptosis in pancreatic cancer. Strategies to decrease the CCK-BR expression and activity may be beneficial for the development of new methods to improve the treatment for patients with pancreatic cancer. PMID:22442157

  18. Short-interfering RNAs Induce Retinal Degeneration via TLR3 and IRF3

    PubMed Central

    Kleinman, Mark E; Kaneko, Hiroki; Cho, Won Gil; Dridi, Sami; Fowler, Benjamin J; Blandford, Alexander D; Albuquerque, Romulo JC; Hirano, Yoshio; Terasaki, Hiroko; Kondo, Mineo; Fujita, Takashi; Ambati, Balamurali K; Tarallo, Valeria; Gelfand, Bradley D; Bogdanovich, Sasha; Baffi, Judit Z; Ambati, Jayakrishna

    2012-01-01

    The discovery of sequence-specific gene silencing by endogenous double-stranded RNAs (dsRNA) has propelled synthetic short-interfering RNAs (siRNAs) to the forefront of targeted pharmaceutical engineering. The first clinical trials utilized 21-nucleotide (nt) siRNAs for the treatment of neovascular age-related macular degeneration (AMD). Surprisingly, these compounds were not formulated for cell permeation, which is required for bona fide RNA interference (RNAi). We showed that these “naked” siRNAs suppress neovascularization in mice not via RNAi but via sequence-independent activation of cell surface Toll-like receptor-3 (TLR3). Here, we demonstrate that noninternalized siRNAs induce retinal degeneration in mice by activating surface TLR3 on retinal pigmented epithelial cells. Cholesterol conjugated siRNAs capable of cell permeation and triggering RNAi also induce the same phenotype. Retinal degeneration was not observed after treatment with siRNAs shorter than 21-nts. Other cytosolic dsRNA sensors are not critical to this response. TLR3 activation triggers caspase-3-mediated apoptotic death of the retinal pigment epithelium (RPE) via nuclear translocation of interferon regulatory factor-3. While this unexpected adverse effect of siRNAs has implications for future clinical trials, these findings also introduce a new preclinical model of geographic atrophy (GA), a late stage of dry AMD that causes blindness in millions worldwide. PMID:21988875

  19. Structures of the orthosomycin antibiotics avilamycin and evernimicin in complex with the bacterial 70S ribosome

    PubMed Central

    Arenz, Stefan; Graf, Michael; Nguyen, Fabian; Huter, Paul; Polikanov, Yury S.; Blanchard, Scott C.; Wilson, Daniel N.

    2016-01-01

    The ribosome is one of the major targets for therapeutic antibiotics; however, the rise in multidrug resistance is a growing threat to the utility of our current arsenal. The orthosomycin antibiotics evernimicin (EVN) and avilamycin (AVI) target the ribosome and do not display cross-resistance with any other classes of antibiotics, suggesting that they bind to a unique site on the ribosome and may therefore represent an avenue for development of new antimicrobial agents. Here we present cryo-EM structures of EVN and AVI in complex with the Escherichia coli ribosome at 3.6- to 3.9-Å resolution. The structures reveal that EVN and AVI bind to a single site on the large subunit that is distinct from other known antibiotic binding sites on the ribosome. Both antibiotics adopt an extended conformation spanning the minor grooves of helices 89 and 91 of the 23S rRNA and interacting with arginine residues of ribosomal protein L16. This binding site overlaps with the elbow region of A-site bound tRNA. Consistent with this finding, single-molecule FRET (smFRET) experiments show that both antibiotics interfere with late steps in the accommodation process, wherein aminoacyl-tRNA enters the peptidyltransferase center of the large ribosomal subunit. These data provide a structural and mechanistic rationale for how these antibiotics inhibit the elongation phase of protein synthesis. PMID:27330110

  20. [Inhibitory effect of RNA interference targeting GFI-1 on the proliferation of atypical chronic myelogenous leukemia NT1 cells].

    PubMed

    Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R

    2016-08-01

    To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (P<0.05)]. Western blot results showed that the GFI-1 protein expression level in the GFI-1 siRNA group was also significantly reduced, compared with those of the NC group and vehicle group (P<0.05 for both). From MTT assay data, the absorbance value of NT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (P<0.05); G0/G1: (66.7±3.8)% vs. (53.3±4.5)% and (48.6±3.2)%, respectively, (P<0.05)]. Furthermore, the tumor weight in the GFI-1 siRNA group [(0.37±0.02) g] was significantly lower than those in the NC group [(0.83±0.06) g] and vehicle group [(0.92±0.04) g] (P<0.05). RNA interference targeting GFI-1 inhibits the growth and proliferation of NT1 cells, which may provide a new therapeutic target for atypical chronic myelogenous leukemia.

  1. The effect of Pokemon on bladder cancer epithelial-mesenchymal transition.

    PubMed

    Guo, Changcheng; Zhu, Kai; Sun, Wei; Yang, Bin; Gu, Wenyu; Luo, Jun; Peng, Bo; Zheng, Junhua

    2014-01-24

    This study aimed at detecting Pokemon expression in bladder cancer cell and investigating the relationship between Pokemon and epithelial-mesenchymal transition. Furthermore, we investigated the functions of Pokemon in the carcinogenesis and development of bladder cancer. This study was also designed to observe the inhibitory effects of siRNA expression vector on Pokemon in bladder cancer cell. The siRNA expression vectors which were constructed to express a short hairpin RNA against Pokemon were transfected to the bladder cancer cells T24 with a liposome. Levels of Pokemon, E-cadherin and β-catenin mRNA and protein were examined by real-time quantitative-fluorescent PCR and Western blot analysis, respectively. The effects of Pokemon silencing on epithelial-mesenchymal transition of T24 cells were evaluated with wound-healing assay. Pokemon was strongly inhibited by siRNA treatment, especially siRNA3 treatment group, as it was reflected by Western blot and real-time PCR. The gene and protein of E-cadherin expression level showed increased markedly after Pokemon was inhibited by RNA interference. While there were no differences in the levels of gene and protein of β-catenin among five groups. The bladder cancer cell after Pokemon siRNA interference showed a significantly reduced wound-closing efficiency at 6, 12 and 24h. Our findings suggest Pokemon may inhibit the expression of E-cadherin. The low expression of E-cadherin lead to increasing the phenotype and apical-base polarity of epithelial cells. These changes of cells may result in the recurrence and progression of bladder cancer at last. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Usefulness of multiple chalk-based food colorings for inducing better gene silencing by feeding RNA interference in planarians.

    PubMed

    Hattori, Miki; Miyamoto, Mai; Hosoda, Kazutaka; Umesono, Yoshihiko

    2018-01-01

    Planarians have become widely recognized as one of the major animal models for regeneration studies in invertebrates. To induce RNA interference (RNAi) by feeding in planarians, the widely accepted protocol is one in which animals undergo two or three feedings of food containing double-stranded RNA (dsRNA) plus visible food coloring (e.g., blood) for confirmation of feeding by individual animals. However, one possible problem is that incorporated food coloring is often retained within the gut for several days, which makes it difficult to confirm the success of each round of dsRNA feeding based on the difference of the color density within the gut before and after feeding. As a consequence, the difference of appetite levels among individuals undergoing dsRNA feeding leads to phenotypic variability among them due to insufficient knockdown. In our attempts to overcome this problem, we have developed a novel method for achieving robust confirmation of the success of dsRNA feeding in individuals fed multiple times by means of including a combination of three different colored chalks (pink, yellow and blue) as food coloring. Notably, we found that this method is superior to the conventional method for positively marking individuals that actively consumed the dsRNA-containing food during four times of once-daily feeding. Using these selected animals, we obtained stable and sufficiently strong RNAi-induced phenotypes. We termed this improved multi-colored chalk-spiked method of feeding RNAi "Candi" and propose its benefits for gene function analysis in planarians. © 2017 Japanese Society of Developmental Biologists.

  3. RNA interference targeting cytosolic NADP(+)-dependent isocitrate dehydrogenase exerts anti-obesity effect in vitro and in vivo.

    PubMed

    Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo

    2012-08-01

    A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.

  4. Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

    PubMed

    Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

    2013-02-01

    To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells

    PubMed Central

    Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan

    2008-01-01

    P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720

  6. DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.

    PubMed

    Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan

    2008-03-01

    P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).

  7. RNA interference mediated in human primary cells via recombinant baculoviral vectors.

    PubMed

    Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

    2005-04-01

    The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

  8. siRNA Delivery to the Lung: What’s New?

    PubMed Central

    Merkel, Olivia M.; Rubinstein, Israel; Kissel, Thomas

    2014-01-01

    RNA interference (RNAi) has been thought of as the general answer to many unmet medical needs. After the first success stories, it soon became obvious that short interfering RNA (siRNA) is not suitable for systemic administration due to its poor pharmacokinetics. Therefore local administration routes have been adopted for more successful in vivo RNAi. This paper reviews nucleic acid modifications, nanocarrier chemistry, animal models used in successful pulmonary siRNA delivery, as well as clinical translation approaches. We summarize what has been published recently and conclude with the potential problems that may still hamper the efficient clinical application of RNAi in the lung. PMID:24907426

  9. Improving Small Interfering RNA Delivery In Vivo Through Lipid Conjugation.

    PubMed

    Osborn, Maire F; Khvorova, Anastasia

    2018-05-10

    RNA interference (RNAi)-based therapeutics are approaching clinical approval for genetically defined diseases. Current clinical success is a result of significant innovations in the development of chemical architectures that support sustained, multi-month efficacy in vivo following a single administration. Conjugate-mediated delivery has established itself as the most promising platform for safe and targeted small interfering RNA (siRNA) delivery. Lipophilic conjugates represent a major class of modifications that improve siRNA pharmacokinetics and enable efficacy in a broad range of tissues. Here, we review current literature and define key features and limitations of this approach for in vivo modulation of gene expression.

  10. Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

    PubMed

    Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

    2012-07-01

    A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

  11. Gene interactions in the DNA damage-response pathway identified by genome-wide RNA-interference analysis of synthetic lethality

    PubMed Central

    van Haaften, Gijs; Vastenhouw, Nadine L.; Nollen, Ellen A. A.; Plasterk, Ronald H. A.; Tijsterman, Marcel

    2004-01-01

    Here, we describe a systematic search for synthetic gene interactions in a multicellular organism, the nematode Caenorhabditis elegans. We established a high-throughput method to determine synthetic gene interactions by genome-wide RNA interference and identified genes that are required to protect the germ line against DNA double-strand breaks. Besides known DNA-repair proteins such as the C. elegans orthologs of TopBP1, RPA2, and RAD51, eight genes previously unassociated with a double-strand-break response were identified. Knockdown of these genes increased sensitivity to ionizing radiation and camptothecin and resulted in increased chromosomal nondisjunction. All genes have human orthologs that may play a role in human carcinogenesis. PMID:15326288

  12. Differential utilization of decapping enzymes in mammalian mRNA decay pathways

    PubMed Central

    Li, You; Song, Mangen; Kiledjian, Megerditch

    2011-01-01

    mRNA decapping is a crucial step in the regulation of mRNA stability and gene expression. Dcp2 is an mRNA decapping enzyme that has been widely studied. We recently reported the presence of a second mammalian cytoplasmic decapping enzyme, Nudt16. Here we address the differential utilization of the two decapping enzymes in specified mRNA decay processes. Using mouse embryonic fibroblast (MEF) cell lines derived from a hypomorphic knockout of the Dcp2 gene with undetectable levels of Dcp2 or MEF cell lines harboring a Nudt16-directed shRNA to generate reduced levels of Nudt16, we demonstrate the distinct roles for Dcp2 and Nudt16 in nonsense-mediated mRNA decay (NMD), decay of ARE-containing mRNA and miRNA-mediated silencing. Our results indicated that NMD preferentially utilizes Dcp2 rather than Nudt16; Dcp2 and Nudt16 are redundant in miRNA-mediated silencing; and Dcp2 and Nudt16 are differentially utilized for ARE-mRNA decay. These data demonstrate that the two distinct decapping enzymes can uniquely function in specific mRNA decay processes in mammalian cells. PMID:21224379

  13. Endosymbiont interference and microbial diversity of the Pacific coast tick, Dermacentor occidentalis, in San Diego County, California.

    PubMed

    Gurfield, Nikos; Grewal, Saran; Cua, Lynnie S; Torres, Pedro J; Kelley, Scott T

    2017-01-01

    The Pacific coast tick, Dermacentor occidentalis Marx, is found throughout California and can harbor agents that cause human diseases such as anaplasmosis, ehrlichiosis, tularemia, Rocky Mountain spotted fever and rickettsiosis 364D. Previous studies have demonstrated that nonpathogenic endosymbiotic bacteria can interfere with Rickettsia co-infections in other tick species. We hypothesized that within D. occidentalis ticks, interference may exist between different nonpathogenic endosymbiotic or nonendosymbiotic bacteria and Spotted Fever group Rickettsia (SFGR). Using PCR amplification and sequencing of the romp A gene and intergenic region we identified a cohort of SFGR-infected and non-infected D. occidentalis ticks collected from San Diego County. We then amplified a partial segment of the 16S rRNA gene and used next-generation sequencing to elucidate the microbiomes and levels of co-infection in the ticks. The SFGR R. philipii str. 364D and R. rhipicephali were detected in 2.3% and 8.2% of the ticks, respectively, via romp A sequencing. Interestingly, next generation sequencing revealed an inverse relationship between the number of Francisella- like endosymbiont (FLE) 16S rRNA sequences and Rickettsia 16S rRNA sequences within individual ticks that is consistent with partial interference between FLE and SFGR infecting ticks. After excluding the Rickettsia and FLE endosymbionts from the analysis, there was a small but significant difference in microbial community diversity and a pattern of geographic isolation by distance between collection locales. In addition, male ticks had a greater diversity of bacteria than female ticks and ticks that weren't infected with SFGR had similar microbiomes to canine skin microbiomes. Although experimental studies are required for confirmation, our findings are consistent with the hypothesis that FLEs and, to a lesser extent, other bacteria, interfere with the ability of D. occidentalis to be infected with certain SFGR. The results also raise interesting possibilities about the effects of putative vertebrate hosts on the tick microbiome.

  14. Proteomics for understanding miRNA biology.

    PubMed

    Huang, Tai-Chung; Pinto, Sneha M; Pandey, Akhilesh

    2013-02-01

    MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Implanting Glioblastoma Spheroids into Rat Brains and Monitoring Tumor Growth by MRI Volumetry.

    PubMed

    Löhr, Mario; Linsenmann, Thomas; Jawork, Anna; Kessler, Almuth F; Timmermann, Nils; Homola, György A; Ernestus, Ralf-Ingo; Hagemann, Carsten

    2017-01-01

    The outcome of patients suffering from glioblastoma multiforme (GBM) remains poor with a median survival of less than 15 months. To establish innovative therapeutical approaches or to analyze the effect of protein overexpression or protein knockdown by RNA interference in vivo, animal models are mandatory. Here, we describe the implantation of C6 glioma spheroids into the rats' brain and how to follow tumor growth by MRI scans. We show that C6 cells grown in Sprague-Dawley rats share several morphologic features of human glioblastoma like pleomorphic cells, areas of necrosis, vascular proliferation, and tumor cell invasion into the surrounding brain tissue. In addition, we describe a method for tumor volumetry utilizing the CISS 3D- or contrast-enhanced T1-weighted 3D sequence and freely available post-processing software.

  16. siRNA-mediated silencing of MDR1 reverses the resistance to oxaliplatin in SW480/OxR colon cancer cells.

    PubMed

    Montazami, N; Kheir Andish, M; Majidi, J; Yousefi, M; Yousefi, B; Mohamadnejad, L; Shanebandi, D; Estiar, M A; Khaze, V; Mansoori, B; Baghbani, E; Baradaran, B

    2015-05-28

    One of the most challenging aspects of colon cancer therapy is rapid acquisition of multidrug resistant phenotype. The multidrug resistance gene 1 (MDR1) product, p—glycoprotein (P—gp), pump out a variety of anticancer agents from the cell, giving rise to a general drug resistance against chemotherapeutic agents. The aim of this study was to investigate the effect of a specific MDR1 small interference RNA (siRNA) on sensitivity of oxaliplatin—resistant SW480 human colon cancer cell line (SW480/OxR) to the chemotherapeutic drug oxaliplatin. SW480 cells were made resistant by continuous incubation with stepwise serially increased concentrations of oxaliplatin over a 6—months period. Resistance cell were subsequently transfected with specific MDR1 siRNA. Relative MDR1 mRNA expression was measured by Quantitative real—time PCR. Western blot analysis was performed to determine the protein levels of P—gp. The cytotoxic effects of oxaliplatin and MDR1 siRNA, alone and in combination were assessed using MTT and the number of apoptotic cells was determined with the TUNEL assay. MDR1 siRNA effectively reduced MDR1 expression in both mRNA and protein levels. MDR1 down—regulation synergistically increased the cytotoxic effects of oxaliplatin and spontaneous apoptosis SW480/OxR. Our data demonstrates that RNA interference could down regulate MDR1 gene expression and reduce the P—gp level, and partially reverse the drug resistance in SW480/OxR cells in vitro. Therefore, the results could suggest that MDR1 silencing may be a potent adjuvant in human colon chemotherapy.

  17. RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.

    PubMed

    Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy

    2018-06-01

    Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  18. Small Molecule Modulators of Pre-mRNA Splicing in Cancer Therapy.

    PubMed

    Salton, Maayan; Misteli, Tom

    2016-01-01

    Pre-mRNA splicing is a fundamental process in mammalian gene expression and alternative RNA splicing plays a considerable role in generating protein diversity. RNA splicing events are also key to the pathology of numerous diseases, particularly cancers. Some tumors are molecularly addicted to specific RNA splicing isoforms making interference with pre-mRNA processing a viable therapeutic strategy. Several RNA splicing modulators have recently been characterized, some showing promise in preclinical studies. While the targets of most splicing modulators are constitutive RNA processing components, possibly leading to undesirable side effects, selectivity for individual splicing events has been observed. Given the high prevalence of splicing defects in cancer, small molecule modulators of RNA processing represent a potentially promising novel therapeutic strategy in cancer treatment. Here, we review their reported effects, mechanisms, and limitations. Published by Elsevier Ltd.

  19. Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

    PubMed Central

    Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara

    2011-01-01

    RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198

  20. Virus-Derived Gene Expression and RNA Interference Vector for Grapevine

    PubMed Central

    Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.

    2012-01-01

    The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553

  1. Enhanced Whitefly Resistance in Transgenic Tobacco Plants Expressing Double Stranded RNA of v-ATPase A Gene

    PubMed Central

    Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C.; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K.

    2014-01-01

    Background Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Methodology/Principal Findings Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Conclusions/Significance Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops. PMID:24595215

  2. Communication: Finding destructive interference features in molecular transport junctions.

    PubMed

    Reuter, Matthew G; Hansen, Thorsten

    2014-11-14

    Associating molecular structure with quantum interference features in electrode-molecule-electrode transport junctions has been difficult because existing guidelines for understanding interferences only apply to conjugated hydrocarbons. Herein we use linear algebra and the Landauer-Büttiker theory for electron transport to derive a general rule for predicting the existence and locations of interference features. Our analysis illustrates that interferences can be directly determined from the molecular Hamiltonian and the molecule-electrode couplings, and we demonstrate its utility with several examples.

  3. Oligonucleotide Antiviral Therapeutics: Antisense and RNA Interference for Highly Pathogenic RNA Viruses

    DTIC Science & Technology

    2008-01-01

    siRNA delivery method in his animal model, it remains to be studied whether this general pproach is safe in humans. Often cited as an advantage of siRNAs...way studying the intravenous delivery f ASO drug candidates targeting Bcl-2 (Genasense®, Genta) nd c-myc (Resten-NG®, AVI BioPharma), while completed... studies have been published investigating MOs as a treatment for EBOV infection, with both showing fficacy in animal models. PMOs were designed to

  4. Using an interference spectrum as a short-range absolute rangefinder with fiber and wideband source

    NASA Astrophysics Data System (ADS)

    Hsieh, Tsung-Han; Han, Pin

    2018-06-01

    Recently, a new type of displacement instrument using spectral-interference has been found, which utilizes fiber and a wideband light source to produce an interference spectrum. In this work, we develop a method that measures the absolute air-gap distance by taking wavelengths at two interference spectra minima. The experimental results agree with the theoretical calculations. It is also utilized to produce and control the spectral switch, which is much easier than other previous methods using other control mechanisms. A scanning mode of this scheme for stepped surface measurement is suggested, which is verified by a standard thickness gauge test. Our scheme is different to one available on the market that may use a curve-fitting method, and some comparisons are made between our scheme and that one.

  5. Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System.

    PubMed

    Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T

    2018-04-17

    In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.

  6. Effects of RNA interference-mediated silencing of toll-like receptor 4 gene on proliferation and apoptosis of human breast cancer MCF-7 and MDA-MB-231 cells: An in vitro study.

    PubMed

    Gao, Xiao-Ling; Yang, Jiao-Jiao; Wang, Shu-Juan; Chen, Yan; Wang, Bei; Cheng, Er-Jing; Gong, Jian-Nan; Dong, Yan-Ting; Liu, Dai; Wang, Xiang-Li; Huang, Ya-Qiong; An, Dong-Dong

    2018-06-22

    Breast cancer is known as the most prevalent cancer in women worldwide, and has an undeniable negative impact on public health, both physically, and mentally. This study aims to investigate the effects of toll-like receptor 4 (TLR4) gene silencing on proliferation and apoptosis of human breast cancer cells to explore for a new theoretical basis for its treatment. TLR4 small interference RNA (siRNA) fragment recombinant plasmids were constructed, including TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3. Human breast cancer MCF-7 and MDA-MB-231 cells were assigned into blank, negative control (NC), TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups. MCF-7 and MDA-MB-231 cell growth was detected by MTT assay. Apoptosis and cell cycle were determined by flow cytometry. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blot analysis were conducted to determine the expression of TLR4, CDK4, cyclin D1, Livin, Bcl-2, p53, c-FLIP, and caspase-3. In comparison with the NC and blank groups, the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups showed decreased the expression of TLR4, inhibited proliferation of MCF-7 and MDA-MB-231 cells and promoted MCF-7 and MDA-MB-231 cell apoptosis, and the cells were blocked in G1 phase. In comparison with the NC and blank groups, in the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups, siRNA-TLR4 significantly increased expression of p53 and caspase-3 in MCF-7 and MDA-MB-231 cells, while it decreased the expressions of CDK4, cyclinD1, Livin, Bal-2, and c-FLIP. The study demonstrates that TLR4 gene silencing inhibits proliferation and induces apoptosis of MCF-7 and MDA-MB-231 cells. © 2018 Wiley Periodicals, Inc.

  7. Iron(II) supramolecular helicates interfere with the HIV-1 Tat–TAR RNA interaction critical for viral replication

    PubMed Central

    Malina, Jaroslav; Hannon, Michael J.; Brabec, Viktor

    2016-01-01

    The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat–TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates. PMID:27405089

  8. Microprocessor mediates transcriptional termination in long noncoding microRNA genes

    PubMed Central

    Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J.; Jopling, Catherine L.

    2015-01-01

    MicroRNA (miRNA) play a major role in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with co-transcriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. While most miRNA are located within introns of protein coding genes, a substantial minority of miRNA originate from long non coding (lnc) RNA where transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lnc-pri-miRNA do not use the canonical cleavage and polyadenylation (CPA) pathway, but instead use Microprocessor cleavage to terminate transcription. This Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a novel RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells. PMID:25730776

  9. Intelligent Therapeutics and Metabolic Programming Through Tailormade, Ligand-Controlled RNA Switches

    DTIC Science & Technology

    2007-02-05

    lines. Three regulatory mechanisms have been examined in our laboratory: antisense inhibition, ribozyme cleavage, and RNA interference (RNAi...cell lines. However, the latter two regulatory mechanisms, ribozyme -based inactivation and RNAi-mediated silencing, demonstrated significant activity...in these cell lines as is briefly described below. Microswitches responsive to the small molecule theophylline and targeting GFP based on a ribozyme

  10. ß-catenin, a transcription factor activated by canonical Wnt signaling, is expressed in sensory neurons of calves latently infected with bovine herpesvirus 1

    USDA-ARS?s Scientific Manuscript database

    Like many a-herpesvirinae subfamily members, bovine herpes virus 1 (BoHV-1) expresses an abundant transcript in latently infected sensory neurons: the latency-related (LR) RNA. LR-RNA encodes a protein (ORF2) that inhibits apoptosis, interacts with Notch family members, interferes with Notch mediate...

  11. Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes.

    PubMed

    Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris

    2014-04-01

    Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.

  12. Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes

    PubMed Central

    Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris

    2014-01-01

    Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493

  13. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens

    PubMed Central

    Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.

    2012-01-01

    Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330

  14. [Expression of cation-chloride cotransporters KCC2 and NKCC1 in brainstem of para- chlorophenylalanine-induced acute insomnia rats].

    PubMed

    Lin, Fang-ju; Yang, Xiao-su; Yang, De; Zou, Yan-qun

    2013-05-21

    To explore the possible roles of KCC2 and NKCC1 in the pathological mechanism of acute insomnia in rats. A total of 18 Sprague-Dawley rats were randomly selected into model, interference and normal control groups.The expressions of KCC2 and NKCC1 in brainstem were detected by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot.The concentration of intracellular Cl(-) ([Cl(-)]i) in brainstem was detected by fluorescence probe MQAE with laser confocal microscopy. (1) Comparing with the control group, both KCC2 mRNA and protein expression were down-regulated in the model and interference groups (mRNA:0.196 ± 0.021 vs 0.939 ± 0.109, P < 0.05; 0.485 ± 0.026 vs 0.939 ± 0.109, P < 0.05; protein expression:0.363 ± 0.058 vs 0.967 ± 0.155, P < 0.05; 0.663 ± 0.106 vs 0.967 ± 0.155, P < 0.05).However they became up-regulated in the interference group versus the model group (mRNA: 0.485 ± 0.026 vs 0.196 ± 0.021, P < 0.05; protein expression:0.663 ± 0.106 vs 0.363 ± 0.058, P < 0.05). (2) Comparing with the control group, both NKCC1 mRNA and protein expression in the model group were slightly up-regulated.But statistical difference was insignificant (mRNA: 0.344 ± 0.026 vs 0.320 ± 0.019, P > 0.05; protein expression:0.244 ± 0.010 vs 0.230 ± 0.021, P > 0.05).There was down-regulation in the interference group versus the model and control groups (mRNA: 0.066 ± 0.031 vs 0.320 ± 0.019, P < 0.05; 0.066 ± 0.031 vs 0.344 ± 0.026, P < 0.05; protein expression:0.131 ± 0.012 vs 0.230 ± 0.021, P < 0.05; 0.131 ± 0.012 vs 0.244 ± 0.010, P < 0.05). (3) Comparing with the control group, [Cl(-)]i became up-regulated in the model group (0.0315 ± 0.0039 vs 0.0164 ± 0.0019, P < 0.05).It was down-regulated in the interference group versus the model group (0.0182 ± 0.0013 vs 0.0315 ± 0.0039, P < 0.05), but higher than control group without statistical difference (0.0182 ± 0.0013 vs 0.0164 ± 0.0019, P > 0.05). The down-regulation of KCC2 and rise of [Cl(-)]i in brainstem may participate in the pathological mechanism of acute insomnia in rats. And the mechanism of sedative-hypnotic diazepam may be operate through an up-regulation of KCC2, a down-regulation of NKCC1 and decreased [Cl(-)]i.

  15. Small Molecules Targeting the miRNA-Binding Domain of Argonaute 2: From Computer-Aided Molecular Design to RNA Immunoprecipitation.

    PubMed

    Bellissimo, Teresa; Masciarelli, Silvia; Poser, Elena; Genovese, Ilaria; Del Rio, Alberto; Colotti, Gianni; Fazi, Francesco

    2017-01-01

    The development of small-molecule-based target therapy design for human disease and cancer is object of growing attention. Recently, specific microRNA (miRNA) mimicking compounds able to bind the miRNA-binding domain of Argonaute 2 protein (AGO2) to inhibit miRNA loading and its functional activity were described. Computer-aided molecular design techniques and RNA immunoprecipitation represent suitable approaches to identify and experimentally determine if a compound is able to impair the loading of miRNAs on AGO2 protein. Here, we describe these two methodologies that we recently used to select a specific compound able to interfere with the AGO2 functional activity and able to improve the retinoic acid-dependent myeloid differentiation of leukemic cells.

  16. A-to-I editing of coding and non-coding RNAs by ADARs

    PubMed Central

    Nishikura, Kazuko

    2016-01-01

    Adenosine deaminases acting on RNA (ADARs) convert adenosine to inosine in double-stranded RNA. This A-to-I editing occurs not only in protein-coding regions of mRNAs, but also frequently in non-coding regions that contain inverted Alu repeats. Editing of coding sequences can result in the expression of functionally altered proteins that are not encoded in the genome, whereas the significance of Alu editing remains largely unknown. Certain microRNA (miRNA) precursors are also edited, leading to reduced expression or altered function of mature miRNAs. Conversely, recent studies indicate that ADAR1 forms a complex with Dicer to promote miRNA processing, revealing a new function of ADAR1 in the regulation of RNA interference. PMID:26648264

  17. Delivery of RNA interference therapeutics using polycation-based nanoparticles.

    PubMed

    Howard, Kenneth Alan

    2009-07-25

    RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.

  18. RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

    PubMed

    Musiyenko, Alla; Bitko, Vira; Barik, Sailen

    2007-07-01

    Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

  19. C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation.

    PubMed

    Liu, Ying; Ye, Xuecheng; Jiang, Feng; Liang, Chunyang; Chen, Dongmei; Peng, Junmin; Kinch, Lisa N; Grishin, Nick V; Liu, Qinghua

    2009-08-07

    The catalytic engine of RNA interference (RNAi) is the RNA-induced silencing complex (RISC), wherein the endoribonuclease Argonaute and single-stranded small interfering RNA (siRNA) direct target mRNA cleavage. We reconstituted long double-stranded RNA- and duplex siRNA-initiated RISC activities with the use of recombinant Drosophila Dicer-2, R2D2, and Ago2 proteins. We used this core reconstitution system to purify an RNAi regulator that we term C3PO (component 3 promoter of RISC), a complex of Translin and Trax. C3PO is a Mg2+-dependent endoribonuclease that promotes RISC activation by removing siRNA passenger strand cleavage products. These studies establish an in vitro RNAi reconstitution system and identify C3PO as a key activator of the core RNAi machinery.

  20. Acoustic interference suppression of quartz crystal microbalance sensor arrays utilizing phononic crystals

    NASA Astrophysics Data System (ADS)

    Chen, Yung-Yu; Huang, Li-Chung; Wang, Wei-Shan; Lin, Yu-Ching; Wu, Tsung-Tsong; Sun, Jia-Hong; Esashi, Masayoshi

    2013-04-01

    Acoustic interference suppression of quartz crystal microbalance (QCM) sensor arrays utilizing phononic crystals is investigated in this paper. A square-lattice phononic crystal structure is designed to have a complete band gap covering the QCM's resonance frequency. The monolithic sensor array consisting of two QCMs separated by phononic crystals is fabricated by micromachining processes. As a result, 12 rows of phononic crystals with band gap boost insertion loss between the two QCMs by 20 dB and also reduce spurious modes. Accordingly, the phononic crystal is verified to be capable of suppressing the acoustic interference between adjacent QCMs in a sensor array.

  1. Regulatory functions of trehalose-6-phosphate synthase in the chitin biosynthesis pathway in Tribolium castaneum (Coleoptera: Tenebrionidae) revealed by RNA interference.

    PubMed

    Chen, Q W; Jin, S; Zhang, L; Shen, Q D; Wei, P; Wei, Z M; Wang, S G; Tang, B

    2018-06-01

    RNA interference (RNAi) is a very effective technique for studying gene function and may be an efficient method for controlling pests. Trehalose-6-phosphate synthase (TPS), which plays a key role in the synthesis of trehalose and insect development, was cloned in Tribolium castaneum (Herbst) (TcTPS) and the putative functions were studied using RNAi via the injection of double-stranded RNA (dsRNA) corresponding to conserved TPS and trehalose-6-phosphate phosphatase domains. Expression analyses show that TcTPS is expressed higher in the fat body, while quantitative real-time polymerase chain reaction results show that the expression of four trehalase isoforms was significantly suppressed by dsTPS injection. Additionally, the expression of six chitin synthesis-related genes, such as hexokinase 2 and glutamine-fructose-6-phosphate aminotransferase, was suppressed at 48 and 72 h post-dsTPS-1 and dsTPS-2 RNA injection, which were two dsTPS fragments that had been designed for two different locations in TcTPS open reading frame, and that trehalose content and trehalase 1 activity decreased significantly at 72 h post-dsRNA injection. Furthermore, T. castaneum injected with dsTPS-1 and dsTPS-2 RNA displayed significantly lower levels of chitin and could not complete the molting process from larvae to pupae, revealing abnormal molting phenotypes. These results demonstrate that silencing TPS gene leads to molting deformities and high mortality rates via regulation of gene expression in the chitin biosynthetic pathway, and may be a promising approach for pest control in the future.

  2. Small interfering RNA against the 2C genomic region of coxsackievirus B3 exerts potential antiviral effects in permissive HeLa cells.

    PubMed

    Luan, Ying; Dai, Hai-Li; Yang, Dan; Zhu, Lin; Gao, Tie-Lei; Shao, Hong-Jiang; Peng, Xue; Jin, Zhan-Feng

    2012-01-01

    Coxsackievirus B3 (CVB3) is the most important causal agent of viral heart muscle disease, but no specific antiviral drug is currently available. Small interfering RNA (siRNA) has been used as an antiviral therapeutic strategy via posttranscriptional gene silencing. In this study, eleven siRNAs were designed to target seven distinct regions of the CVB3 genome including VP1, VP2, VP3, 2A, 2C, 3C, and 3D. All of the siRNAs were individually transfected into HeLa cells, which were subsequently infected with CVB3. The impacts of RNA interference (RNAi) on viral replication were evaluated using five measures: cytopathic effect (CPE), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, 50% tissue culture infectious dose (TCID(50)), real-time RT-PCR, and Western blot. Five of the eleven siRNAs were highly efficient at inhibiting viral replication. This was especially true for siRNA-5, which targeted the ATPase 2C. However, antiviral activity varied significantly among siRNA-9, -10, and -11 even though that they all targeted the 3D region. Our results revealed several effective targets for CVB3 silencing, and provided evidence that sequences except CRE within the 2C region may also be potential targets for CVB3-specific siRNAs design. These data supported a potential role of RNA interference in future antiviral intervention therapies. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.

    PubMed

    Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L

    2016-12-05

    Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.

  4. Molecular interactions and immune responses between Maize fine streak virus and the leafhopper vector Graminella nigrifrons through differential expression and RNA interference.

    PubMed

    Chen, Y; Redinbaugh, M G; Michel, A P

    2015-06-01

    Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.

  5. Species specific inhibition of viral replication using dicer substrate siRNAs (DsiRNAs) targeting the viral nucleoprotein of the fish pathogenic rhabdovirus viral hemorrhagic septicemia virus (VHSV).

    PubMed

    Bohle, Harry; Lorenzen, Niels; Schyth, Brian Dall

    2011-06-01

    Gene knock down by the use of small interfering RNAs (siRNAs) is widely used as a method for reducing the expression of specific genes in eukaryotic cells via the RNA interference pathway. But, the effectivity of siRNA induced gene knock down in cells from fish has in several studies been questioned and the specificity seems to be a general problem in cells originating from both lower and higher vertebrates. Here we show that we are able to reduce the level of viral gene expression and replication specifically in fish cells in vitro. We do so by using 27/25-mer DsiRNAs acting as substrates for dicer for the generation of siRNAs targeting the nucleoprotein N gene of viral hemorrhagic septicemia virus (VHSV). This rhabdovirus infects salmonid fish and is responsible for large yearly losses in aquaculture production. Specificity of the DsiRNA is assured in two ways: first, by using the conventional method of testing a control DsiRNA which should not target the gene of interest. Second, by assuring that replication of a heterologous virus of the same genus as the target virus was not inhibited by the DsiRNA. Target controls are, as we have previously highlighted, essential for verification of the specificity of siRNA-induced interference with virus multiplication, but they are still not in general use. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. RNA Interference in Moths: Mechanisms, Applications, and Progress

    PubMed Central

    Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He

    2016-01-01

    The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569

  7. siRNA targeting decoy receptor 3 enhances the sensitivity of gastric carcinoma cells to 5-fluorouracil.

    PubMed

    Xu, Xiao-Tao; Tao, Ze-Zhang; Song, Qi-Bin; Yao, Yi; Ruan, Peng

    2012-09-01

    In order to investigate the effects of RNA interference of decoy receptor 3 (DcR3) on the sensitivity of gastric cancer cells to 5-fluorouracil (5-FU) and the relevant mechanisms, siRNA against DcR3 was transfected into the gastric cancer cell line AGS. AGS cells were treated with different doses of 5-FU or for different time periods. The sensitivity of AGS cells to 5-FU was determined. The cell survival rate was detected by MTT assay. The apoptotic rate was determined by DAPI staining, and the expression of related proteins were detected by western blot analysis. The results showed that the cell survival rate was significanlty decreased in the knockdown group compared to the control group at different doses of 5-FU (P<0.01). After different time periods of treatment with 5-FU, the cell survival rate in the knockdown group was significantly decreased compared to the control group, respectively (P<0.01). The apoptotic rate of AGS cells in the knockdown group was increased along with the increasing dose of siRNA. The siRNA against DcR3 enhanced the expression of Fas, FasL, caspase-3 and caspase-8. In conclusion, knockdown of DcR3 by RNA interference enhances apoptosis and inhibits the growth of gastric cancer cells. Downregulation of DcR3 enhances the sensitivity of gastric cancer cells to 5-FU and increased the expression of Fas, FasL and caspase-3/8.

  8. Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome

    NASA Astrophysics Data System (ADS)

    Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei

    2004-11-01

    Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity

  9. Decreased expression of RNA interference machinery, Dicer and Drosha, is associated with poor outcome in ovarian cancer patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.

    2008-05-06

    The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens,more » respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.« less

  10. HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.

    PubMed

    Vongrad, Valentina; Imig, Jochen; Mohammadi, Pejman; Kishore, Shivendra; Jaskiewicz, Lukasz; Hall, Jonathan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J

    2015-01-01

    MiRNAs and other small noncoding RNAs (sncRNAs) are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs) have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi) pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM). The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM) were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs. PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.

  11. RNA interference of carboxyesterases causes nymph mortality in the Asian citrus psyllid, Diaphorina citri.

    PubMed

    Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil

    2017-03-01

    Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.

  12. The effects of RNA interference mediated VEGF gene silencing on biological behavior of renal cell carcinoma and transplanted renal tumor in nude mice.

    PubMed

    Wang, Qi; Wang, Shuai; Sun, Si-Qiao; Cheng, Zhi-Hua; Zhang, Yang; Chen, Guang; Gu, Meng; Yao, Hai-Jun; Wang, Zhong; Zhou, Juan; Peng, Yu-Bing; Xu, Ming-Xi; Zhang, Ke; Sun, Xi-Wei

    2016-01-01

    This study was to explore the effects of RNA interference mediated vascular endothelial growth factor (VEGF) gene silencing on biological behavior of renal cell carcinoma (RCC), transplanted renal tumor and angiogenesis in nude mice. The specific siRNA sequence targeting VEGF were designed and synthesized to construct hVEGF-siRNA plasmid which was transfected into RCC 786-O cells. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of VEGF gene expression and western blot was adopted for the examination of VEGF protein expression. The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to detect cell growth as well as cell migration and invasion. The transplanted renal tumor models in nude mice were established, and the growth condition of nude mice, and VEGF protein expression in transplanted tumor slices and the microvessel density (MVD) were detected. The expression level of VEGF mRNA in VEGF-siRNA group was significant lower than that in the control group and negative group, suggesting that establishment of plasmid specifically inhibited the expression of VEGF gene The expression level of VEGF protein in VEGF-siRNA group was significant lower than that in the control group and negative group. VEGF gene silencing has the significant inhibition effects on proliferation, migration and invasion of RCC 786-O cells. The tumor weight, VEGF protein positive rate and MVD in VEGF-siRNA group were significant lower than those in negative group and blank group. The VEGF gene silencing could inhibit the cell proliferation, migration and invasion of RCC 786-O cells; inhibition of VEGF protein expression could prevent transplanted RCC growth and tumor angiogenesis.

  13. Interference of transcription across H-NS binding sites and repression by H-NS.

    PubMed

    Rangarajan, Aathmaja Anandhi; Schnetz, Karin

    2018-05-01

    Nucleoid-associated protein H-NS represses transcription by forming extended DNA-H-NS complexes. Repression by H-NS operates mostly at the level of transcription initiation. Less is known about how DNA-H-NS complexes interfere with transcription elongation. In vitro H-NS has been shown to enhance RNA polymerase pausing and to promote Rho-dependent termination, while in vivo inhibition of Rho resulted in a decrease of the genome occupancy by H-NS. Here we show that transcription directed across H-NS binding regions relieves H-NS (and H-NS/StpA) mediated repression of promoters in these regions. Further, we observed a correlation of transcription across the H-NS-bound region and de-repression. The data suggest that the transcribing RNA polymerase is able to remodel the H-NS complex and/or dislodge H-NS from the DNA and thus relieve repression. Such an interference of transcription and H-NS mediated repression may imply that poorly transcribed AT-rich loci are prone to be repressed by H-NS, while efficiently transcribed loci escape repression. © 2018 John Wiley & Sons Ltd.

  14. An in vivo and in silico approach to study cis-antisense: a short cut to higher order response

    NASA Astrophysics Data System (ADS)

    Courtney, Colleen; Varanasi, Usha; Chatterjee, Anushree

    2014-03-01

    Antisense interactions are present in all domains of life. Typically sense, antisense RNA pairs originate from overlapping genes with convergent face to face promoters, and are speculated to be involved in gene regulation. Recent studies indicate the role of transcriptional interference (TI) in regulating expression of genes in convergent orientation. Modeling antisense, TI gene regulation mechanisms allows us to understand how organisms control gene expression. We present a modeling and experimental framework to understand convergent transcription that combines the effects of transcriptional interference and cis-antisense regulation. Our model shows that combining transcriptional interference and antisense RNA interaction adds multiple-levels of regulation which affords a highly tunable biological output, ranging from first order response to complex higher-order response. To study this system we created a library of experimental constructs with engineered TI and antisense interaction by using face-to-face inducible promoters separated by carefully tailored overlapping DNA sequences to control expression of a set of fluorescent reporter proteins. Studying this gene expression mechanism allows for an understanding of higher order behavior of gene expression networks.

  15. RNA Interference in Insect Vectors for Plant Viruses.

    PubMed

    Kanakala, Surapathrudu; Ghanim, Murad

    2016-12-12

    Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.

  16. RNA Interference in Insect Vectors for Plant Viruses

    PubMed Central

    Kanakala, Surapathrudu; Ghanim, Murad

    2016-01-01

    Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446

  17. An optofluidic approach for gold nanoprobes based-cancer theranostics

    NASA Astrophysics Data System (ADS)

    Panwar, Nishtha; Song, Peiyi; Yang, Chengbin; Yong, Ken-Tye; Tjin, Swee Chuan

    2017-02-01

    Suppression of overexpressed gene mutations in cancer cells through RNA interference (RNAi) technique is a therapeutically effective modality for oncogene silencing. In general, transfection agent is needed for siRNA delivery. Also, it is a tedious and time consuming process to analyze the gene transfection using current conventional flow cytometry systems and commercially available transfection kits. Therefore, there are two urgent challenges that we need to address for understanding and real time monitoring the delivery of siRNA to cancer cells more effectively. One, nontoxic, biocompatible and stable non-viral transfection agents need to be developed and investigated for gene delivery in cancer cells. Two, new, portable optofluidic methods need to be engineered for determining the transfection efficiency of the nanoformulation in real time. First, we demonstrate the feasibility of using gold nanorods (AuNRs) as nanoprobes for the delivery of Interleukin-8 (IL-8) siRNA in a pancreatic cancer cell line- MiaPaCa-2. An optimum ratio of 10:1 for the AuNRs-siRNA nanoformulation required for efficient loading has been experimentally determined. Promising transfection rates (≈88%) of the nanoprobe-assisted gene delivery are quantified by flow cytometry and fluorescence imaging, which are higher than the commercial control, Oligofectamine. The excellent gene knockdown performance (over 81%) of the proposed model support in vivo trials for RNAi-based cancer theranostics. In addition to cancer theranostics, our nanoprobe combination can be also applied for disease outbreak monitoring like MERS. Second, we present an optical fiber-integrated microfluidic chip that utilizes simple hydrodynamic and optical setups for miniaturized on-chip flow cytometry. The chip provides a powerful and convenient tool to quantitatively determine the siRNA transfection into cancer cells without using bulky flow cytometer. These studies outline the role of AuNRs as potential non-viral gene delivery vehicles, and their suitability for microfluidics-based lab-on-chip flow cytometry applications.

  18. RNA Interference towards the Potato Psyllid, Bactericera cockerelli, Is Induced in Plants Infected with Recombinant Tobacco mosaic virus (TMV)

    PubMed Central

    Wuriyanghan, Hada; Falk, Bryce W.

    2013-01-01

    The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will provide a faster and more convenient method for screening of suitable RNAi target sequences in planta. PMID:23824081

  19. RNA interference of GGTA1 physiological and immune functions in immortalized porcine aortic endothelial cells.

    PubMed

    Han, Wei; Zhou, Jingshi; Li, Xiao; Wang, Jianfeng; Li, Junjie; Zhang, Zhuochao; Yang, Zhaoxu; Wang, Desheng; Tao, Kaishan; Dou, Kefeng

    2013-11-01

    Pig organs are commonly used in xenotransplantation, and α-1,3-galactose has been shown to be the main cause of hyperacute rejection. The development of transgenic pigs that lack α-1,3-galactosyltransferase (GGTA1) has overcome this problem to a certain extent, but transgenic pigs are difficult to maintain, making their usefulness in basic research limited. For this reason, we propose to establish a cell model to study hyperacute rejection. Immortalized primary porcine aortic endothelial cells were transfected with a short hairpin RNA targeted to GGTA1. Cell proliferation, apoptosis, complement C3 activation, and the binding of human immunoglobulins and components of the complement system, including IgM, IgG, C3, and C5b-9, were examined. After RNA interference, GGTA1 was found to be reduced at both the transcript and protein level as assessed by quantitative polymerase chain reaction and flow cytometry, respectively. When cultured in the presence of human serum, the proliferation rate of the transfected cells was higher than that of untransfected cells, and the apoptosis rate was lower. Additionally, activation of C3 and the binding of human immunoglobulins IgM and IgG and complement component C3 and C5b-9 to the transfected cells were lower than in the immortalized group but higher than in untransfected cells. RNA interference of GGTA1 in cultured porcine endothelial cells reduces the reaction of immunoglobulin and complement system with the cells. Therefore, this in vitro cell model could be useful for further study of xenotransplantation. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. RNA interference-based functional knockdown of the voltage-gated potassium channel Kv7.2 in dorsal root ganglion neurons after in vitro and in vivo gene transfer by adeno-associated virus vectors.

    PubMed

    Valdor, Markus; Wagner, Anke; Röhrs, Viola; Berg, Johanna; Fechner, Henry; Schröder, Wolfgang; Tzschentke, Thomas M; Bahrenberg, Gregor; Christoph, Thomas; Kurreck, Jens

    2018-01-01

    Activation of the neuronal potassium channel Kv7.2 encoded by the KCNQ2 gene has recently been shown to be an attractive mechanism to inhibit nociceptive transmission. However, potent, selective, and clinically proven activators of Kv7.2/Kv7.3 currents with analgesic properties are still lacking. An important prerequisite for the development of new drugs is a model to test the selectivity of novel agonists by abrogating Kv7.2/Kv7.3 function. Since constitutive knockout mice are not viable, we developed a model based on RNA interference-mediated silencing of KCNQ2. By delivery of a KCNQ2-specific short hairpin RNA with adeno-associated virus vectors, we completely abolished the activity of the specific Kv7.2/Kv7.3-opener ICA-27243 in rat sensory neurons. Results obtained in the silencing experiments were consistent between freshly prepared and cryopreserved dorsal root ganglion neurons, as well as in dorsal root ganglion neurons dissociated and cultured after in vivo administration of the silencing vector by intrathecal injections into rats. Interestingly, the tested associated virus serotypes substantially differed with respect to their transduction capability in cultured neuronal cell lines and primary dorsal root ganglion neurons and the in vivo transfer of transgenes by intrathecal injection of associated virus vectors. However, our study provides the proof-of-concept that RNA interference-mediated silencing of KCNQ2 is a suitable approach to create an ex vivo model for testing the specificity of novel Kv7.2/Kv7.3 agonists.

  1. NAVAIR Avionics Master Plan.

    DTIC Science & Technology

    1981-02-26

    data rates, sufficient to handle radio frequency infor- mation. It also diminishes the vulnerability of the data paths to extraneous interferences from...The 1990 system will be unusable if Electromagnetic Interference (EMI)/Electromagnetic Pulse (EMP)/temperature/shock environments are not successfully...direct result of technological advancements driven by over utilization of the lower frequency spectrum (resulting in signal interference ) as well as

  2. Dual role for argonautes in microRNA processing and posttranscriptional regulation of microRNA expression.

    PubMed

    Diederichs, Sven; Haber, Daniel A

    2007-12-14

    MicroRNAs are small endogenous noncoding RNAs involved in posttranscriptional gene regulation. During microRNA biogenesis, Drosha and Dicer process the primary transcript (pri-miRNA) through a precursor hairpin (pre-miRNA) to the mature miRNA. The miRNA is incorporated into the RNA-Induced Silencing Complex (RISC) with Argonaute proteins, the effector molecules in RNA interference (RNAi). Here, we show that all Argonautes elevate mature miRNA expression posttranscriptionally, independent of RNase activity. Also, we identify a role for the RISC slicer Argonaute2 (Ago2) in cleaving the pre-miRNA to an additional processing intermediate, termed Ago2-cleaved precursor miRNA or ac-pre-miRNA. This endogenous, on-pathway intermediate results from cleavage of the pre-miRNA hairpin 12 nucleotides from its 3'-end. By analogy to siRNA processing, Ago2 cleavage may facilitate removal of the nicked passenger strand from RISC after maturation. The multiple roles of Argonautes in the RNAi effector phase and miRNA biogenesis and maturation suggest coordinate regulation of microRNA expression and function.

  3. dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi.

    PubMed

    Parker, Greg S; Maity, Tuhin Subhra; Bass, Brenda L

    2008-12-26

    Double-stranded RNA (dsRNA)-binding proteins facilitate Dicer functions in RNA interference. Caenorhabditis elegans RDE-4 facilitates cleavage of long dsRNA to small interfering RNA (siRNA), while human trans-activation response RNA-binding protein (TRBP) functions downstream to pass siRNA to the RNA-induced silencing complex. We show that these distinct in vivo roles are reflected in in vitro binding properties. RDE-4 preferentially binds long dsRNA, while TRBP binds siRNA with an affinity that is independent of dsRNA length. These properties are mechanistically based on the fact that RDE-4 binds cooperatively, via contributions from multiple domains, while TRBP binds noncooperatively. Our studies offer a paradigm for how dsRNA-binding proteins, which are not sequence specific, discern dsRNA length. Additionally, analyses of the ability of RDE-4 deletion constructs and RDE-4/TRBP chimeras to reconstitute Dicer activity suggest RDE-4 promotes activity using its dsRNA-binding motif 2 to bind dsRNA, its linker region to interact with Dicer, and its C-terminus for Dicer activation.

  4. Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.

    PubMed

    Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha

    2009-08-01

    Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.

  5. [Herpes simplex virus-mediated RNA interference targeting vesicular glutamate transporter 3 attenuates tactile allodynia in mice].

    PubMed

    Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang

    2016-11-20

    To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.

  6. RNA interference can be used to disrupt gene function in tardigrades

    PubMed Central

    Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob

    2012-01-01

    How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800

  7. Combinatorial RNA Interference Therapy Prevents Selection of Pre-existing HBV Variants in Human Liver Chimeric Mice

    PubMed Central

    Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua

    2015-01-01

    Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836

  8. RNA interference can be used to disrupt gene function in tardigrades.

    PubMed

    Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob

    2013-05-01

    How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.

  9. RNA Interference: A New Mechanism by Which FMRP Acts in the Normal Brain? What Can Drosophila Teach Us?

    ERIC Educational Resources Information Center

    Siomi, Haruhiko; Ishizuka, Akira; Siomi, Mikiko C.

    2004-01-01

    Fragile X syndrome is the most common heritable form of mental retardation caused by loss-of-function mutations in the "FMR1" gene. The "FMR1" gene encodes an RNA-binding protein that associates with translating ribosomes and acts as a negative translational regulator. Recent work in "Drosophila melanogaster" has shown that the fly homolog of…

  10. Near-Field Noise Source Localization in the Presence of Interference

    NASA Astrophysics Data System (ADS)

    Liang, Guolong; Han, Bo

    In order to suppress the influence of interference sources on the noise source localization in the near field, the near-field broadband source localization in the presence of interference is studied. Oblique projection is constructed with the array measurements and the steering manifold of interference sources, which is used to filter the interference signals out. 2D-MUSIC algorithm is utilized to deal with the data in each frequency, and then the results of each frequency are averaged to achieve the positioning of the broadband noise sources. The simulations show that this method suppresses the interference sources effectively and is capable of locating the source which is in the same direction with the interference source.

  11. Cigarette smoking substantially alters plasma microRNA profiles in healthy subjects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takahashi, Kei; Yokota, Shin-ichi; Tatsumi, Naoyuki

    Circulating microRNAs (miRNAs) are receiving attention as potential biomarkers of various diseases, including cancers, chronic obstructive pulmonary disease, and cardiovascular disease. However, it is unknown whether the levels of circulating miRNAs in a healthy subject might vary with external factors in daily life. In this study, we investigated whether cigarette smoking, a habit that has spread throughout the world and is a risk factor for various diseases, affects plasma miRNA profiles. We determined the profiles of 11 smokers and 7 non-smokers by TaqMan MicroRNA array analysis. A larger number of miRNAs were detected in smokers than in non-smokers, and themore » plasma levels of two-thirds of the detected miRNAs (43 miRNAs) were significantly higher in smokers than in non-smokers. A principal component analysis of the plasma miRNA profiles clearly separated smokers and non-smokers. Twenty-four of the miRNAs were previously reported to be potential biomarkers of disease, suggesting the possibility that smoking status might interfere with the diagnosis of disease. Interestingly, we found that quitting smoking altered the plasma miRNA profiles to resemble those of non-smokers. These results suggested that the differences in the plasma miRNA profiles between smokers and non-smokers could be attributed to cigarette smoking. In addition, we found that an acute exposure of ex-smokers to cigarette smoke (smoking one cigarette) did not cause a dramatic change in the plasma miRNA profile. In conclusion, we found that repeated cigarette smoking substantially alters the plasma miRNA profile, interfering with the diagnosis of disease or signaling potential smoking-related diseases. - Highlights: • Plasma miRNA profiles were unambiguously different between smokers and non-smokers. • Smoking status might interfere with the diagnosis of disease using plasma miRNAs. • Changes of plasma miRNA profiles may be a signal of smoking-related diseases.« less

  12. RNA Interference: Biology, Mechanism, and Applications

    PubMed Central

    Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.

    2003-01-01

    Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679

  13. Silencing of P2X7R by RNA interference in the hippocampus can attenuate morphological and behavioral impact of pilocarpine-induced epilepsy.

    PubMed

    Amorim, Rebeca Padrão; Araújo, Michelle Gasparetti Leão; Valero, Jorge; Lopes-Cendes, Iscia; Pascoal, Vinicius Davila Bitencourt; Malva, João Oliveira; da Silva Fernandes, Maria José

    2017-12-01

    Cell signaling mediated by P2X7 receptors (P2X7R) has been suggested to be involved in epileptogenesis, via modulation of intracellular calcium levels, excitotoxicity, activation of inflammatory cascades, and cell death, among other mechanisms. These processes have been described to be involved in pilocarpine-induced status epilepticus (SE) and contribute to hyperexcitability, resulting in spontaneous and recurrent seizures. Here, we aimed to investigate the role of P2X7R in epileptogenesis in vivo using RNA interference (RNAi) to inhibit the expression of this receptor. Small interfering RNA (siRNA) targeting P2X7R mRNA was injected into the lateral ventricles (icv) 6 h after SE. Four groups were studied: Saline-Vehicle, Saline-siRNA, Pilo-Vehicle, and Pilo-siRNA. P2X7R was quantified by western blotting and neuronal death assessed by Fluoro-Jade B histochemistry. The hippocampal volume (edema) was determined 48 h following RNAi. Behavioral parameters as latency to the appearance of spontaneous seizures and the number of seizures were determined until 60 days after the SE onset. The Saline-siRNA and Pilo-siRNA groups showed a 43 and 37% reduction, respectively, in P2X7R protein levels compared to respective vehicle groups. Neuroprotection was observed in CA1 and CA3 of the Pilo-siRNA group compared to Pilo-Vehicle. P2X7R silencing in pilocarpine group reversed the increase in the edema detected in the hilus, suprapyramidal dentate gyrus, CA1, and CA3; reduced mortality rate following SE; increased the time to onset of spontaneous seizure; and reduced the number of seizures, when compared to the Pilo-Vehicle group. Therefore, our data highlights the potential of P2X7R as a therapeutic target for the adjunct treatment of epilepsy.

  14. Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

    PubMed Central

    Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

    2012-01-01

    Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

  15. 40 CFR 1065.369 - H2O, CO, and CO2 interference verification for photoacoustic alcohol analyzers.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... compensation algorithms that utilize measurements of other gases to meet this interference verification, simultaneously conduct these other measurements to test the compensation algorithms during the analyzer...

  16. Designing and Testing Functional RNA Nanoparticles | Center for Cancer Research

    Cancer.gov

    Recent advances in nanotechnology have generated excitement that nanomaterials may provide novel approaches for the diagnosis and treatment of deadly diseases, such as cancer. However, the use of synthetic materials to generate nanoparticles can present challenges with endotoxin content, sterility, or biocompatibility. Employing biological materials may overcome these issues with RNA being particularly attractive given the clinical applications of RNA interference and the abundance of functional RNAs, including aptamers and ribozymes. RNA can form stable three-dimensional nanoparticle structures that can be decorated with other nucleic acids, small molecules, or proteins, potentially increasing local concentrations of therapeutic agents and acting synergistically when combined.

  17. Eukaryotic gene regulation by targeted chromatin re-modeling at dispersed, middle-repetitive sequence elements.

    PubMed

    Hodgetts, Ross

    2004-12-01

    RNA interference might have evolved to minimize the deleterious impact of transposable elements and viruses on eukaryotic genomes, because mutations in genes within the RNAi pathway cause mobilization of transposons in nematodes and flies. Although the first examples of RNAi involved post-transcriptional gene silencing, recently the pathway has been shown to act at the transcriptional level. It does so by establishing a chromatin configuration on the target DNA that has many of the hallmarks of heterochromatin, thus preventing its transcription. Members of dispersed, repeated sequence families appear to have been utilized by the RNAi machinery to regulate nearby genes in yeast. The unusual genomic distribution of three repeated element families in the chicken, fruit-fly and nematode genomes prompts speculation that some of these repeats have been co-opted to control gene expression, either locally or over extended chromosomal domains.

  18. Why is epigenetics important in understanding the pathogenesis of inflammatory musculoskeletal diseases?

    PubMed

    Oppermann, Udo

    2013-04-03

    In its widest sense, the term epigenetics describes a range of mechanisms in genome function that do not solely result from the DNA sequence itself. These mechanisms comprise DNA and chromatin modifications and their associated systems, as well as the noncoding RNA machinery. The epigenetic apparatus is essential for controlling normal development and homeostasis, and also provides a means for the organism to integrate and react upon environmental cues. A multitude of functional studies as well as systematic genome-wide mapping of epigenetic marks and chromatin modifiers reveal the importance of epigenomic mechanisms in human pathologies, including inflammatory conditions and musculoskeletal disease such as rheumatoid arthritis. Collectively, these studies pave the way to identify possible novel therapeutic intervention points and to investigate the utility of drugs that interfere with epigenetic signalling not only in cancer, but possibly also in inflammatory and autoimmune diseases.

  19. Why is epigenetics important in understanding the pathogenesis of inflammatory musculoskeletal diseases?

    PubMed Central

    2013-01-01

    In its widest sense, the term epigenetics describes a range of mechanisms in genome function that do not solely result from the DNA sequence itself. These mechanisms comprise DNA and chromatin modifications and their associated systems, as well as the noncoding RNA machinery. The epigenetic apparatus is essential for controlling normal development and homeostasis, and also provides a means for the organism to integrate and react upon environmental cues. A multitude of functional studies as well as systematic genome-wide mapping of epigenetic marks and chromatin modifiers reveal the importance of epigenomic mechanisms in human pathologies, including inflammatory conditions and musculoskeletal disease such as rheumatoid arthritis. Collectively, these studies pave the way to identify possible novel therapeutic intervention points and to investigate the utility of drugs that interfere with epigenetic signalling not only in cancer, but possibly also in inflammatory and autoimmune diseases. PMID:23566317

  20. Cyclophilin A Associates with Enterovirus-71 Virus Capsid and Plays an Essential Role in Viral Infection as an Uncoating Regulator

    PubMed Central

    Huang, Jiaoyan; Yan, Wenzhong; Wang, Jinglan; Su, Dan; Ni, Cheng; Li, Jian; Rao, Zihe; Liu, Lei; Lou, Zhiyong

    2014-01-01

    Viruses utilize host factors for their efficient proliferation. By evaluating the inhibitory effects of compounds in our library, we identified inhibitors of cyclophilin A (CypA), a known immunosuppressor with peptidyl-prolyl cis-trans isomerase activity, can significantly attenuate EV71 proliferation. We demonstrated that CypA played an essential role in EV71 entry and that the RNA interference-mediated reduction of endogenous CypA expression led to decreased EV71 multiplication. We further revealed that CypA directly interacted with and modified the conformation of H-I loop of the VP1 protein in EV71 capsid, and thus regulated the uncoating process of EV71 entry step in a pH-dependent manner. Our results aid in the understanding of how host factors influence EV71 life cycle and provide new potential targets for developing antiviral agents against EV71 infection. PMID:25275585

  1. Microscale Symmetrical Electroporator Array as a Versatile Molecular Delivery System

    NASA Astrophysics Data System (ADS)

    Ouyang, Mengxing; Hill, Winfield; Lee, Jung Hyun; Hur, Soojung Claire

    2017-03-01

    Successful developments of new therapeutic strategies often rely on the ability to deliver exogenous molecules into cytosol. We have developed a versatile on-chip vortex-assisted electroporation system, engineered to conduct sequential intracellular delivery of multiple molecules into various cell types at low voltage in a dosage-controlled manner. Micro-patterned planar electrodes permit substantial reduction in operational voltages and seamless integration with an existing microfluidic technology. Equipped with real-time process visualization functionality, the system enables on-chip optimization of electroporation parameters for cells with varying properties. Moreover, the system’s dosage control and multi-molecular delivery capabilities facilitate intracellular delivery of various molecules as a single agent or in combination and its utility in biological research has been demonstrated by conducting RNA interference assays. We envision the system to be a powerful tool, aiding a wide range of applications, requiring single-cell level co-administrations of multiple molecules with controlled dosages.

  2. Precision medicine--delivering the goods?

    PubMed

    Peer, Dan

    2014-09-28

    Personalized (or precision) medicine aims to individualize therapeutic interventions, based on OMICS data such as genomics, proteomics, metabolomics etc', profiling together with histopathological insights to the type, stage, and the grade of the disease, as well as on the potential response of a particular patient to a particular treatment regimen. With next generation sequencing technologies, it is now possible to identify all germline variants of an individual in an affordable cost and thus paving the way for clinicians to provide healthcare from an individual perspective. In this special issue of Cancer Letters termed "Trends in Personalized Cancer Research" we bring together physicians and scientists summarizing the state-of-the-art in precision medicine from hematological malignancies and solid tumors with the current gold standard diagnostic and therapy to basic and translational research utilizing nanotechnology and RNA interference strategies for future personalized theranostics in oncology. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. New RNAi strategy for selective suppression of a mutant allele in polyglutamine disease.

    PubMed

    Kubodera, Takayuki; Yokota, Takanori; Ishikawa, Kinya; Mizusawa, Hidehiro

    2005-12-01

    In gene therapy of dominantly inherited diseases with small interfering RNA (siRNA), mutant allele specific suppression may be necessary for diseases in which the defective gene normally has an important role. It is difficult, however, to design a mutant allele-specific siRNA for trinucleotide repeat diseases in which the difference of sequences is only repeat length. To overcome this problem, we use a new RNA interference (RNAi) strategy for selective suppression of mutant alleles. Both mutant and wild-type alleles are inhibited by the most effective siRNA, and wild-type protein is restored using the wild-type mRNA modified to be resistant to the siRNA. Here, we applied this method to spinocerebellar ataxia type 6 (SCA6). We discuss its feasibility and problems for future gene therapy.

  4. Structural insights into RNA processing by the human RISC-loading complex.

    PubMed

    Wang, Hong-Wei; Noland, Cameron; Siridechadilok, Bunpote; Taylor, David W; Ma, Enbo; Felderer, Karin; Doudna, Jennifer A; Nogales, Eva

    2009-11-01

    Targeted gene silencing by RNA interference (RNAi) requires loading of a short guide RNA (small interfering RNA (siRNA) or microRNA (miRNA)) onto an Argonaute protein to form the functional center of an RNA-induced silencing complex (RISC). In humans, Argonaute2 (AGO2) assembles with the guide RNA-generating enzyme Dicer and the RNA-binding protein TRBP to form a RISC-loading complex (RLC), which is necessary for efficient transfer of nascent siRNAs and miRNAs from Dicer to AGO2. Here, using single-particle EM analysis, we show that human Dicer has an L-shaped structure. The RLC Dicer's N-terminal DExH/D domain, located in a short 'base branch', interacts with TRBP, whereas its C-terminal catalytic domains in the main body are proximal to AGO2. A model generated by docking the available atomic structures of Dicer and Argonaute homologs into the RLC reconstruction suggests a mechanism for siRNA transfer from Dicer to AGO2.

  5. Targeted nanobubbles in low-frequency ultrasound-mediated gene transfection and growth inhibition of hepatocellular carcinoma cells.

    PubMed

    Wu, Bolin; Qiao, Qiang; Han, Xue; Jing, Hui; Zhang, Hao; Liang, Hongjian; Cheng, Wen

    2016-09-01

    The use of SonoVue combined with ultrasound exposure increases the transfection efficiency of short interfering RNA (siRNA). The objective of this study was to prepare targeted nanobubbles (TNB) conjugated with NET-1 siRNA and an antibody GPC3 to direct nanobubbles to hepatocellular carcinoma cells. SMMC-7721 human hepatocellular carcinoma cells were treated with six different groups. The transfection efficiency and cellular apoptosis were measured by flow cytometry. The protein and messenger RNA (mRNA) expression were measured by Western blot and quantitative real-time PCR, respectively. The migration and invasion potential of the cells were determined by Transwell analysis. The results show that US-guided siRNA-TNB transfection effectively enhanced gene silencing. In summary, siRNA-TNB may be an effective delivery vector to mediate highly effective RNA interference in tumor treatment.

  6. RDE-1 slicer activity is required only for passenger-strand cleavage during RNAi in Caenorhabditis elegans.

    PubMed

    Steiner, Florian A; Okihara, Kristy L; Hoogstrate, Suzanne W; Sijen, Titia; Ketting, René F

    2009-02-01

    RNA interference (RNAi) is a process in which double-stranded RNA is cleaved into small interfering RNAs (siRNAs) that induce the destruction of homologous single-stranded mRNAs. Argonaute proteins are essential components of this silencing process; they bind siRNAs directly and can cleave RNA targets using a conserved RNase H motif. In Caenorhabditis elegans, the Argonaute protein RDE-1 has a central role in RNAi. In animals lacking RDE-1, the introduction of double-stranded RNA does not trigger any detectable level of RNAi. Here we show that RNase H activity of RDE-1 is required only for efficient removal of the passenger strand of the siRNA duplex and not for triggering the silencing response at the target-mRNA level. These results uncouple the role of the RDE-1 RNase H activity in small RNA maturation from its role in target-mRNA silencing in vivo.

  7. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  8. Small interfering ribonucleic acid induces liquid-to-ripple phase transformation in a phospholipid membrane

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choubey, Amit; Nomura, Ken-ichi; Kalia, Rajiv K.

    Small interfering ribonucleic acid (siRNA) molecules play a pivotal role in silencing gene expression via the RNA interference mechanism. A key limitation to the widespread implementation of siRNA therapeutics is the difficulty of delivering siRNA-based drugs to cells. Here, we examine changes in the structure and dynamics of a dipalmitoylphosphatidylcholine bilayer in the presence of a siRNA molecule and mechanical barriers to siRNA transfection in the bilayer. Our all-atom molecular dynamics simulation shows that siRNA induces a liquid crystalline-to-ripple phase transformation in the bilayer. The ripple phase consists of a major region of non-interdigitated and a minor region of interdigitatedmore » lipid molecules with an intervening kink. In the ripple phase, hydrocarbon chains of lipid molecules have large compressive stresses, which present a considerable barrier to siRNA transfection.« less

  9. Wastewater treatment plant effluent alters pituitary gland gonadotropin mRNA levels in juvenile coho salmon (Oncorhynchus kisutch).

    PubMed

    Harding, Louisa B; Schultz, Irvin R; da Silva, Denis A M; Ylitalo, Gina M; Ragsdale, Dave; Harris, Stephanie I; Bailey, Stephanie; Pepich, Barry V; Swanson, Penny

    2016-09-01

    It is well known that endocrine disrupting compounds (EDCs) present in wastewater treatment plant (WWTP) effluents interfere with reproduction in fish, including altered gonad development and induction of vitellogenin (Vtg), a female-specific egg yolk protein precursor produced in the liver. As a result, studies have focused on the effects of EDC exposure on the gonad and liver. However, impacts of environmental EDC exposure at higher levels of the hypothalamic-pituitary-gonad axis are less well understood. The pituitary gonadotropins, follicle-stimulating hormone (Fsh) and luteinizing hormone (Lh) are involved in all aspects of gonad development and are subject to feedback from gonadal steroids making them a likely target of endocrine disruption. In this study, the effects of WWTP effluent exposure on pituitary gonadotropin mRNA expression were investigated to assess the utility of Lh beta-subunit (lhb) as a biomarker of estrogen exposure in juvenile coho salmon (Oncorhynchus kisutch). First, a controlled 72-h exposure to 17α-ethynylestradiol (EE2) and 17β-trenbolone (TREN) was performed to evaluate the response of juvenile coho salmon to EDC exposure. Second, juvenile coho salmon were exposed to 0, 20 or 100% effluent from eight WWTPs from the Puget Sound, WA region for 72h. Juvenile coho salmon exposed to 2 and 10ng EE2L(-1) had 17-fold and 215-fold higher lhb mRNA levels relative to control fish. Hepatic vtg mRNA levels were dramatically increased 6670-fold, but only in response to 10ng EE2L(-1) and Fsh beta-subunit (fshb) mRNA levels were not altered by any of the treatments. In the WWTP effluent exposures, lhb mRNA levels were significantly elevated in fish exposed to five of the WWTP effluents. In contrast, transcript levels of vtg were not affected by any of the WWTP effluent exposures. Mean levels of natural and synthetic estrogens in fish bile were consistent with pituitary lhb expression, suggesting that the observed lhb induction may be due to estrogenic activity of the WWTP effluents. These results suggest that lhb gene expression may be a sensitive index of acute exposure to estrogenic chemicals in juvenile coho salmon. Further work is needed to determine the kinetics and specificity of lhb induction to evaluate its utility as a potential indicator of estrogen exposure in immature fish. Published by Elsevier B.V.

  10. Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.

    PubMed

    Wang, Leo L; Burdick, Jason A

    2017-01-01

    It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Fluorescence Reporter-Based Genome-Wide RNA Interference Screening to Identify Alternative Splicing Regulators.

    PubMed

    Misra, Ashish; Green, Michael R

    2017-01-01

    Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.

  12. High-throughput screens in mammalian cells using the CRISPR-Cas9 system.

    PubMed

    Peng, Jingyu; Zhou, Yuexin; Zhu, Shiyou; Wei, Wensheng

    2015-06-01

    As a powerful genome-editing tool, the clustered regularly interspaced short palindromic repeats (CRISPR)-clustered regularly interspaced short palindromic repeats-associated protein 9 (Cas9) system has been quickly developed into a large-scale function-based screening strategy in mammalian cells. This new type of genetic library is constructed through the lentiviral delivery of single-guide RNA collections that direct Cas9 or inactive dead Cas9 fused with effectors to interrogate gene function or regulate gene transcription in targeted cells. Compared with RNA interference screening, the CRISPR-Cas9 system demonstrates much higher levels of effectiveness and reliability with respect to both loss-of-function and gain-of-function screening. Unlike the RNA interference strategy, a CRISPR-Cas9 library can target both protein-coding sequences and regulatory elements, including promoters, enhancers and elements transcribing microRNAs and long noncoding RNAs. This powerful genetic tool will undoubtedly accelerate the mechanistic discovery of various biological processes. In this mini review, we summarize the general procedure of CRISPR-Cas9 library mediated functional screening, system optimization strategies and applications of this new genetic toolkit. © 2015 FEBS.

  13. Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation

    PubMed Central

    Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.

    2004-01-01

    Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. PMID:15084750

  14. Analysis of Variability in HIV-1 Subtype A Strains in Russia Suggests a Combination of Deep Sequencing and Multitarget RNA Interference for Silencing of the Virus.

    PubMed

    Kretova, Olga V; Chechetkin, Vladimir R; Fedoseeva, Daria M; Kravatsky, Yuri V; Sosin, Dmitri V; Alembekov, Ildar R; Gorbacheva, Maria A; Gashnikova, Natalya M; Tchurikov, Nickolai A

    2017-02-01

    Any method for silencing the activity of the HIV-1 retrovirus should tackle the extremely high variability of HIV-1 sequences and mutational escape. We studied sequence variability in the vicinity of selected RNA interference (RNAi) targets from isolates of HIV-1 subtype A in Russia, and we propose that using artificial RNAi is a potential alternative to traditional antiretroviral therapy. We prove that using multiple RNAi targets overcomes the variability in HIV-1 isolates. The optimal number of targets critically depends on the conservation of the target sequences. The total number of targets that are conserved with a probability of 0.7-0.8 should exceed at least 2. Combining deep sequencing and multitarget RNAi may provide an efficient approach to cure HIV/AIDS.

  15. New insights into siRNA amplification and RNAi.

    PubMed

    Zhang, Chi; Ruvkun, Gary

    2012-08-01

    In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes.

  16. [Components and assembly of RNA-induced silencing complex].

    PubMed

    Song, Xue-Mei; Yan, Fei; Du, Li-Xin

    2006-06-01

    Degradation of homologous RNA in RNA interference is carried out by functional RNA-induced silencing complex (RISC). RISC contains Dicer, Argonaute proein, siRNA and other components. Researching structures and functions of these components is primary important for understanding assembly and functional mechanism of RISC, as well as the whole RNAi pathway. Recent research works showed that Dicer, containing RNaseIII domain, is responsible for production of siRNA at the beginning of RNAi, and guarantees the stability of RISC intermediate in assembly process. As the core component of RISC, Argonaute protein functions as slicer to cleave target RNA and offers the binding site of siRNA in RISC assembly, which are depended on PIWI domain and PAZ domain separately. Although there is only one strand of siRNA that is the guider of RISC, the double stranded structural character of siRNA is determinant of RNAi. Except those, there are still other components with unknown functions in RISC. The knowledge about RISC components and assembly now, is basis of a presumed RISC assembly model.

  17. RNA major groove modifications improve siRNA stability and biological activity

    PubMed Central

    Terrazas, Montserrat; Kool, Eric T.

    2009-01-01

    RNA 5-methyl and 5-propynyl pyrimidine analogs were substituted into short interfering RNAs (siRNAs) to probe major groove steric effects in the active RNA-induced silencing complex (RISC). Synthetic RNA guide strands containing varied combinations of propynyl and methyl substitution revealed that all C-5 substitutions increased the thermal stability of siRNA duplexes containing them. Cellular gene suppression experiments using luciferase targets in HeLa cells showed that the bulky 5-propynyl modification was detrimental to RNA interference activity, despite its stabilization of the helix. Detrimental effects of this substitution were greatest at the 5′-half of the guide strand, suggesting close steric approach of proteins in the RISC complex with that end of the siRNA/mRNA duplex. However, substitutions with the smaller 5-methyl group resulted in gene silencing activities comparable to or better than that of wild-type siRNA. The major groove modifications also increased the serum stability of siRNAs. PMID:19042976

  18. The HIV Nef protein modulates cellular and exosomal miRNA profiles in human monocytic cells.

    PubMed

    Aqil, Madeeha; Naqvi, Afsar Raza; Mallik, Saurav; Bandyopadhyay, Sanghamitra; Maulik, Ujjwal; Jameel, Shahid

    2014-01-01

    The HIV Nef protein is a multifunctional virulence factor that perturbs intracellular membranes and signalling and is secreted into exosomes. While Nef-containing exosomes have a distinct proteomic profile, no comprehensive analysis of their miRNA cargo has been carried out. Since Nef functions as a viral suppressor of RNA interference and disturbs the distribution of RNA-induced silencing complex proteins between cells and exosomes, we hypothesized that it might also affect the export of miRNAs into exosomes. Exosomes were purified from human monocytic U937 cells that stably expressed HIV-1 Nef. The RNA from cells and exosomes was profiled for 667 miRNAs using a Taqman Low Density Array. Selected miRNAs and their mRNA targets were validated by quantitative RT-PCR. Bioinformatics analyses were used to identify targets and predict pathways. Nef expression affected a significant fraction of miRNAs in U937 cells. Our analysis showed 47 miRNAs to be selectively secreted into Nef exosomes and 2 miRNAs to be selectively retained in Nef-expressing cells. The exosomal miRNAs were predicted to target several cellular genes in inflammatory cytokine and other pathways important for HIV pathogenesis, and an overwhelming majority had targets within the HIV genome. This is the first study to report miRnome analysis of HIV Nef expressing monocytes and exosomes. Our results demonstrate that Nef causes large-scale dysregulation of cellular miRNAs, including their secretion through exosomes. We suggest this to be a novel viral strategy to affect pathogenesis and to limit the effects of RNA interference on viral replication and persistence.

  19. Lentiviral vectors encoding shRNAs efficiently transduce and knockdown LINGO-1 but induce an interferon response and cytotoxicity in CNS neurons

    PubMed Central

    Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.

    2017-01-01

    Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506

  20. [Lentivirus-mediated RNA interference of CD133 inhibits the proliferation of CD133(+) liver cancer stem cells and increases their cisplatin chemosensitivity].

    PubMed

    Lan, Xi; Wang, Yong; Cao, Shu; Zou, Dongling; Li, Fang; Li, Shaolin

    2012-12-01

    To study the effects of CD133 suppression by lentivirus-mediated RNA interference (RNAi) on the proliferation and chemosensitivity of CD133(+) cancer stem cells (CSCs) sorted from HepG2 cell line. CD133(+) and CD133- cells were sorted from HepG2 cell line by flow cytometry, and the expression of CD133 before and after cell sorting were detected. The stem cell property of sorted CD133(+) cells were validated by sphere-forming assay in vitro and xenograft experiments in vivo. Lentivirus-mediated short hairpin RNA (shRNA) targeting CD133 were transfected into CD133(+) cells, and CD133 mRNA and protein expressions of the transfected cells were detected by RT-PCR and Western blotting, respectively. Before and after the transfection, the proliferative ability of CD133(+) cells was evaluated by colony formation assay, and the cell growth inhibition rate and apoptosis following cisplatin exposure were detected using CCK-8 assay and flow cytometry. The sorted CD133(+) cells showed a high purity of (88.74∓3.19)%, as compared with the purity of (3.36∓1.80)% before cell sorting. CD133(+) cells showed a high tumor sphere formation ability and tumorigenesis capacity compared with CD133- cells. CD133 shRNA transfection significantly inhibited CD133 mRNA and protein expressions in CD133(+) cells (P<0.01), resulting also in a significantly lowered cell proliferative ability (P<0.01) and an increased growth inhibition rate (P<0.01) and obviously increased cell apoptosis (P<0.05) after cisplatin exposure. Lentivirus-mediated RNAi for CD133 suppression inhibits the proliferation of CD133(+) liver cancer stem cells and increases their chemosensitivity to cisplatin.

  1. Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

    PubMed Central

    Krishnamurthy, Sateesh; Behlke, Mark A; Ramachandran, Shyam; Salem, Aliasger K; McCray Jr, Paul B; Davidson, Beverly L

    2012-01-01

    The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA) delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE) or human airway epithelia (HAE) grown at the air–liquid interface (ALI), the delivery of a Dicer-substrate small-interfering RNA (DsiRNA) duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT) with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding) exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF), a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap) database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi) responses. PMID:23344182

  2. Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

    PubMed

    Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

    2016-07-08

    Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

  3. RNA interference inhibits herpes simplex virus type 1 isolated from saliva samples and mucocutaneous lesions.

    PubMed

    Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de

    2014-01-01

    The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.

  4. SUMOylation of TARBP2 regulates miRNA/siRNA efficiency

    PubMed Central

    Chen, Cheng; Zhu, Changhong; Huang, Jian; Zhao, Xian; Deng, Rong; Zhang, Hailong; Dou, Jinzhuo; Chen, Qin; Xu, Ming; Yuan, Haihua; Wang, Yanli; Yu, Jianxiu

    2015-01-01

    Small RNA-induced gene silencing is essential for post-transcriptional regulation of gene expression; however, it remains unclear how miRNA/siRNA efficiency is regulated. Here we show that TARBP2 is SUMOylated at K52, which can be enhanced by its phosphorylation. This modification can stabilize TARBP2 via repressing its K48-linked ubiquitination. We find that TARBP2 SUMOylation does not influence the overall production of mature miRNAs, but it regulates miRNA/siRNA efficiency. SUMOylated TARBP2 recruits Ago2 to constitute the RNA-induced silencing complex (RISC)-loading complex (RLC), and simultaneously promotes more pre-miRNAs to load into the RLC. Consequently, Ago2 is stabilized and miRNAs/siRNAs bound by TARBP2/Dicer is effectively transferred to Ago2. Thus, these processes lead to the formation of the effective RISC for RNA interference (RNAi). Collectively, our data suggest that SUMOylation of TARBP2 is required for regulating miRNA/siRNA efficiency, which is a general mechanism of miRNA/siRNA regulation. PMID:26582366

  5. A review on current status of antiviral siRNA.

    PubMed

    Qureshi, Abid; Tantray, Vaqar Gani; Kirmani, Altaf Rehman; Ahangar, Abdul Ghani

    2018-04-15

    Viral diseases like influenza, AIDS, hepatitis, and Ebola cause severe epidemics worldwide. Along with their resistant strains, new pathogenic viruses continue to be discovered so creating an ongoing need for new antiviral treatments. RNA interference is a cellular gene-silencing phenomenon in which sequence-specific degradation of target mRNA is achieved by means of complementary short interfering RNA (siRNA) molecules. Short interfering RNA technology affords a potential tractable strategy to combat viral pathogenesis because siRNAs are specific, easy to design, and can be directed against multiple strains of a virus by targeting their conserved gene regions. In this review, we briefly summarize the current status of siRNA therapy for representative examples from different virus families. In addition, other aspects like their design, delivery, medical significance, bioinformatics resources, and limitations are also discussed. Copyright © 2018 John Wiley & Sons, Ltd.

  6. Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome

    PubMed Central

    Polikanov, Yury S.; Osterman, Ilya A.; Szal, Teresa; Tashlitsky, Vadim N.; Serebryakova, Marina V.; Kusochek, Pavel; Bulkley, David; Malanicheva, Irina A.; Efimenko, Tatyana A.; Efremenkova, Olga V.; Konevega, Andrey L.; Shaw, Karen J.; Bogdanov, Alexey A.; Rodnina, Marina V.; Dontsova, Olga A.; Mankin, Alexander S.; Steitz, Thomas A.; Sergiev, Petr V.

    2014-01-01

    SUMMARY We demonstrate that the antibiotic amicoumacin A (AMI) whose cellular target was unknown, is a potent inhibitor of protein synthesis. Resistance mutations in helix 24 of the 16S rRNA mapped the AMI binding site to the small ribosomal subunit. The crystal structure of bacterial ribosome in complex with AMI solved at 2.4 Å resolution revealed that the antibiotic makes contacts with universally conserved nucleotides of 16S rRNA in the E site and the mRNA backbone. Simultaneous interactions of AMI with 16S rRNA and mRNA and the in vivo experimental evidence suggest that it may inhibit the progression of the ribosome along mRNA. Consistent with this proposal, binding of AMI interferes with translocation in vitro. The inhibitory action of AMI can be partly compensated by mutations in the translation elongation factor G. PMID:25306919

  7. Acute Knockdown of Kv4.1 Regulates Repetitive Firing Rates and Clock Gene Expression in the Suprachiasmatic Nucleus and Daily Rhythms in Locomotor Behavior

    PubMed Central

    Hermanstyne, Tracey O.; Mellor, Rebecca L.

    2017-01-01

    Abstract Rapidly activating and inactivating A-type K+ currents (IA) encoded by Kv4.2 and Kv4.3 pore-forming (α) subunits of the Kv4 subfamily are key regulators of neuronal excitability. Previous studies have suggested a role for Kv4.1 α-subunits in regulating the firing properties of mouse suprachiasmatic nucleus (SCN) neurons. To test this, we utilized an RNA-interference strategy to knockdown Kv4.1, acutely and selectively, in the SCN. Current-clamp recordings revealed that the in vivo knockdown of Kv4.1 significantly (p < 0.0001) increased mean ± SEM repetitive firing rates in SCN neurons during the day (6.4 ± 0.5 Hz) and at night (4.3 ± 0.6 Hz), compared with nontargeted shRNA-expressing SCN neurons (day: 3.1 ± 0.5 Hz; night: 1.6 ± 0.3 Hz). IA was also significantly (p < 0.05) reduced in Kv4.1-targeted shRNA-expressing SCN neurons (day: 80.3 ± 11.8 pA/pF; night: 55.3 ± 7.7 pA/pF), compared with nontargeted shRNA-expressing (day: 121.7 ± 10.2 pA/pF; night: 120.6 ± 16.5 pA/pF) SCN neurons. The magnitude of the effect of Kv4.1-targeted shRNA expression on firing rates and IA was larger at night. In addition, Kv4.1-targeted shRNA expression significantly (p < 0.001) increased mean ± SEM nighttime input resistance (Rin; 2256 ± 166 MΩ), compared to nontargeted shRNA-expressing SCN neurons (1143 ± 93 MΩ). Additional experiments revealed that acute knockdown of Kv4.1 significantly (p < 0.01) shortened, by ∼0.5 h, the circadian period of spontaneous electrical activity, clock gene expression and locomotor activity demonstrating a physiological role for Kv4.1-encoded IA channels in regulating circadian rhythms in neuronal excitability and behavior. PMID:28560311

  8. Acute Knockdown of Kv4.1 Regulates Repetitive Firing Rates and Clock Gene Expression in the Suprachiasmatic Nucleus and Daily Rhythms in Locomotor Behavior.

    PubMed

    Hermanstyne, Tracey O; Granados-Fuentes, Daniel; Mellor, Rebecca L; Herzog, Erik D; Nerbonne, Jeanne M

    2017-01-01

    Rapidly activating and inactivating A-type K + currents (I A ) encoded by Kv4.2 and Kv4.3 pore-forming (α) subunits of the Kv4 subfamily are key regulators of neuronal excitability. Previous studies have suggested a role for Kv4.1 α-subunits in regulating the firing properties of mouse suprachiasmatic nucleus (SCN) neurons. To test this, we utilized an RNA-interference strategy to knockdown Kv4.1, acutely and selectively, in the SCN. Current-clamp recordings revealed that the in vivo knockdown of Kv4.1 significantly ( p < 0.0001) increased mean ± SEM repetitive firing rates in SCN neurons during the day (6.4 ± 0.5 Hz) and at night (4.3 ± 0.6 Hz), compared with nontargeted shRNA-expressing SCN neurons (day: 3.1 ± 0.5 Hz; night: 1.6 ± 0.3 Hz). I A was also significantly ( p < 0.05) reduced in Kv4.1-targeted shRNA-expressing SCN neurons (day: 80.3 ± 11.8 pA/pF; night: 55.3 ± 7.7 pA/pF), compared with nontargeted shRNA-expressing (day: 121.7 ± 10.2 pA/pF; night: 120.6 ± 16.5 pA/pF) SCN neurons. The magnitude of the effect of Kv4.1-targeted shRNA expression on firing rates and I A was larger at night. In addition, Kv4.1-targeted shRNA expression significantly ( p < 0.001) increased mean ± SEM nighttime input resistance (R in ; 2256 ± 166 MΩ), compared to nontargeted shRNA-expressing SCN neurons (1143 ± 93 MΩ). Additional experiments revealed that acute knockdown of Kv4.1 significantly ( p < 0.01) shortened, by ∼0.5 h, the circadian period of spontaneous electrical activity, clock gene expression and locomotor activity demonstrating a physiological role for Kv4.1-encoded I A channels in regulating circadian rhythms in neuronal excitability and behavior.

  9. A quantitative framework for the forward design of synthetic miRNA circuits.

    PubMed

    Bloom, Ryan J; Winkler, Sally M; Smolke, Christina D

    2014-11-01

    Synthetic genetic circuits incorporating regulatory components based on RNA interference (RNAi) have been used in a variety of systems. A comprehensive understanding of the parameters that determine the relationship between microRNA (miRNA) and target expression levels is lacking. We describe a quantitative framework supporting the forward engineering of gene circuits that incorporate RNAi-based regulatory components in mammalian cells. We developed a model that captures the quantitative relationship between miRNA and target gene expression levels as a function of parameters, including mRNA half-life and miRNA target-site number. We extended the model to synthetic circuits that incorporate protein-responsive miRNA switches and designed an optimized miRNA-based protein concentration detector circuit that noninvasively measures small changes in the nuclear concentration of β-catenin owing to induction of the Wnt signaling pathway. Our results highlight the importance of methods for guiding the quantitative design of genetic circuits to achieve robust, reliable and predictable behaviors in mammalian cells.

  10. The dsRNA binding protein RDE-4 interacts with RDE-1, DCR-1, and a DExH-box helicase to direct RNAi in C. elegans.

    PubMed

    Tabara, Hiroaki; Yigit, Erbay; Siomi, Haruhiko; Mello, Craig C

    2002-06-28

    Double-stranded (ds) RNA induces potent gene silencing, termed RNA interference (RNAi). At an early step in RNAi, an RNaseIII-related enzyme, Dicer (DCR-1), processes long-trigger dsRNA into small interfering RNAs (siRNAs). DCR-1 is also required for processing endogenous regulatory RNAs called miRNAs, but how DCR-1 recognizes its endogenous and foreign substrates is not yet understood. Here we show that the C. elegans RNAi pathway gene, rde-4, encodes a dsRNA binding protein that interacts during RNAi with RNA identical to the trigger dsRNA. RDE-4 protein also interacts in vivo with DCR-1, RDE-1, and a conserved DExH-box helicase. Our findings suggest a model in which RDE-4 and RDE-1 function together to detect and retain foreign dsRNA and to present this dsRNA to DCR-1 for processing.

  11. Live cell imaging of Argonaute proteins in mammalian cells.

    PubMed

    Pare, Justin M; Lopez-Orozco, Joaquin; Hobman, Tom C

    2011-01-01

    The central effector of mammalian RNA interference (RNAi) is the RNA-induced silencing complex (RISC). Proteins of the Argonaute family are the core components of RISC. Recent work from multiple laboratories has shown that Argonaute family members are associated with at least two types of cytoplasmic RNA granules: GW/Processing bodies and stress granules. These Argonaute-containing granules harbor proteins that function in mRNA degradation and translational repression in response to stress. The known role of Argonaute proteins in miRNA-mediated translational repression and siRNA-directed mRNA cleavage (i.e., Argonaute 2) has prompted speculation that the association of Argonautes with these granules may reflect the activity of RNAi in vivo. Accordingly, studying the dynamic association between Argonautes and RNA granules in living cells will undoubtedly provide insight into the regulatory mechanisms of RNA-based silencing. This chapter describes a method for imaging fluorescently tagged Argonaute proteins in living mammalian cells using spinning disk confocal microscopy.

  12. Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection.

    PubMed

    East-Seletsky, Alexandra; O'Connell, Mitchell R; Knight, Spencer C; Burstein, David; Cate, Jamie H D; Tjian, Robert; Doudna, Jennifer A

    2016-10-13

    Bacterial adaptive immune systems use CRISPRs (clustered regularly interspaced short palindromic repeats) and CRISPR-associated (Cas) proteins for RNA-guided nucleic acid cleavage. Although most prokaryotic adaptive immune systems generally target DNA substrates, type III and VI CRISPR systems direct interference complexes against single-stranded RNA substrates. In type VI systems, the single-subunit C2c2 protein functions as an RNA-guided RNA endonuclease (RNase). How this enzyme acquires mature CRISPR RNAs (crRNAs) that are essential for immune surveillance and how it carries out crRNA-mediated RNA cleavage remain unclear. Here we show that bacterial C2c2 possesses a unique RNase activity responsible for CRISPR RNA maturation that is distinct from its RNA-activated single-stranded RNA degradation activity. These dual RNase functions are chemically and mechanistically different from each other and from the crRNA-processing behaviour of the evolutionarily unrelated CRISPR enzyme Cpf1 (ref. 11). The two RNase activities of C2c2 enable multiplexed processing and loading of guide RNAs that in turn allow sensitive detection of cellular transcripts.

  13. Lysosomal membrane protein SIDT2 mediates the direct uptake of DNA by lysosomes

    PubMed Central

    Aizawa, Shu; Contu, Viorica Raluca; Fujiwara, Yuuki; Hase, Katsunori; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji

    2017-01-01

    ABSTRACT Lysosomes degrade macromolecules such as proteins and nucleic acids. We previously identified 2 novel types of autophagy, RNautophagy and DNautophagy, where lysosomes directly take up RNA and DNA, in an ATP-dependent manner, for degradation. We have also reported that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference defective-1), mediates RNA translocation during RNautophagy. In this addendum, we report that SIDT2 also mediates DNA translocation in the process of DNautophagy. These findings help elucidate the mechanisms underlying the direct uptake of nucleic acids by lysosomes and the physiological functions of DNautophagy. PMID:27846365

  14. Lysosomal membrane protein SIDT2 mediates the direct uptake of DNA by lysosomes.

    PubMed

    Aizawa, Shu; Contu, Viorica Raluca; Fujiwara, Yuuki; Hase, Katsunori; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji; Kabuta, Tomohiro

    2017-01-02

    Lysosomes degrade macromolecules such as proteins and nucleic acids. We previously identified 2 novel types of autophagy, RNautophagy and DNautophagy, where lysosomes directly take up RNA and DNA, in an ATP-dependent manner, for degradation. We have also reported that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference defective-1), mediates RNA translocation during RNautophagy. In this addendum, we report that SIDT2 also mediates DNA translocation in the process of DNautophagy. These findings help elucidate the mechanisms underlying the direct uptake of nucleic acids by lysosomes and the physiological functions of DNautophagy.

  15. Nanoparticle-mediated RNA interference of angiotensinogen decreases blood pressure and improves myocardial remodeling in spontaneously hypertensive rats.

    PubMed

    Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin

    2015-09-01

    Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.

  16. Appraising the roles of CBLL1 and the ubiquitin/proteasome system for flavivirus entry and replication.

    PubMed

    Fernandez-Garcia, Maria-Dolores; Meertens, Laurent; Bonazzi, Matteo; Cossart, Pascale; Arenzana-Seisdedos, Fernando; Amara, Ali

    2011-03-01

    The ubiquitin ligase CBLL1 (also known as HAKAI) has been proposed to be a critical cellular factor exploited by West Nile virus (WNV) for productive infection. CBLL1 has emerged as a major hit in a recent RNA interference screen designed to identify cellular factors required for the early stages of the WNV life cycle. Follow-up experiments showed that HeLa cells knocked down for CBLL1 by a small interfering RNA (siRNA) failed to internalize WNV particles and resisted infection. Furthermore, depletion of a free-ubiquitin pool by the proteasome inhibitor MG132 abolished WNV endocytosis, suggesting that CBLL1 acts in concert with the ubiquitin proteasome system to mediate virus internalization. Here, we examined the effect of CBLL1 knockdown and proteasome inhibitors on infection by WNV and other flaviviruses. We identified new siRNAs that repress the CBLL1 protein and strongly inhibit the endocytosis of Listeria monocytogenes, a bacterial pathogen known to require CBLL1 to invade host cells. Strikingly, however, we detected efficient WNV, dengue virus, and yellow fever virus infection of human cells, despite potent downregulation of CBLL1 by RNA interference. In addition, we found that the proteasome inhibitors MG132 and lactacystin did not affect WNV internalization but strongly repressed flavivirus RNA translation and replication. Together, these data do not support a requirement for CBLL1 during flavivirus entry and rather suggest an essential role of the ubiquitin/proteasome pathway for flavivirus genome amplification.

  17. Role of RNA interference (RNAi) in the Moss Physcomitrella patens.

    PubMed

    Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel

    2013-01-14

    RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.

  18. RNA interference targeting E637K mutation rescues hERG channel currents and restores its kinetic properties.

    PubMed

    Lu, Xiaoli; Yang, Xi; Huang, Xiaoyan; Huang, Chen; Sun, Huan Huan; Jin, Lihua; Xu, Weifeng; Mao, Haiyan; Guo, Junming; Zhou, Jianqing; Lian, Jiangfang

    2013-01-01

    Long QT syndrome (LQTS) is a monogenic proarrhythmic disorder that predisposes affected individuals to sudden death from tachyarrhythmia. As an inherited disease, LQTS cannot be completely cured by conventional treatment modalities. Individualized gene therapy is a promising therapeutic approach. The purpose of this study was to investigate the role of small interference RNA (siRNA) on expression of E637K-hERG (human ether-a-go-go-related gene) mutant and whether it can be used to rescue the mutant's dominant-negative suppressive effects on hERG protein channel function. Western blot was performed to select the most sensitive siRNAs to target E637K-hERG mutant knockdown. Confocal laser scanning microscope was performed to monitor cellular localization of wild-type (WT)-hERG and E637K-hERG with or without siRNA. Patch-clamp technique was used to assess the effect of siRNA on the electrophysiologic characteristics of the rapidly activating delayed rectifier K(+) current I(Kr) of the hERG protein channel. siRNA led to a significant decrease in the level of E637K-hERG protein but did not affect the level of WT-hERG protein. WT-hERG localization in cells coexpressing E637K-hERG mutant was restored to the membrane by siRNA. The siRNA-mediated inhibition of E637K-hERG mutant restored the maximum current and tail current amplitudes. Furthermore, siRNA treatment rescued the kinetic properties of WT/E637K-hERG protein channel to a level comparable to that of WT-hERG protein channel. Our findings illustrated that siRNA can effectively inhibit E637K-hERG protein expression and rescue the dominant-negative effect of this mutation by restoring the kinetic properties of hERG protein channel. It has potential clinical implications with regard to the possibility of using siRNA in the treatment of LQTS. Copyright © 2013 Heart Rhythm Society. All rights reserved.

  19. Studying human disease genes in Caenorhabditis elegans: a molecular genetics laboratory project.

    PubMed

    Cox-Paulson, Elisabeth A; Grana, Theresa M; Harris, Michelle A; Batzli, Janet M

    2012-01-01

    Scientists routinely integrate information from various channels to explore topics under study. We designed a 4-wk undergraduate laboratory module that used a multifaceted approach to study a question in molecular genetics. Specifically, students investigated whether Caenorhabditis elegans can be a useful model system for studying genes associated with human disease. In a large-enrollment, sophomore-level laboratory course, groups of three to four students were assigned a gene associated with either breast cancer (brc-1), Wilson disease (cua-1), ovarian dysgenesis (fshr-1), or colon cancer (mlh-1). Students compared observable phenotypes of wild-type C. elegans and C. elegans with a homozygous deletion in the assigned gene. They confirmed the genetic deletion with nested polymerase chain reaction and performed a bioinformatics analysis to predict how the deletion would affect the encoded mRNA and protein. Students also performed RNA interference (RNAi) against their assigned gene and evaluated whether RNAi caused a phenotype similar to that of the genetic deletion. As a capstone activity, students prepared scientific posters in which they presented their data, evaluated whether C. elegans was a useful model system for studying their assigned genes, and proposed future directions. Assessment showed gains in understanding genotype versus phenotype, RNAi, common bioinformatics tools, and the utility of model organisms.

  20. Studying Human Disease Genes in Caenorhabditis elegans: A Molecular Genetics Laboratory Project

    PubMed Central

    Cox-Paulson, Elisabeth A.; Grana, Theresa M.; Harris, Michelle A.; Batzli, Janet M.

    2012-01-01

    Scientists routinely integrate information from various channels to explore topics under study. We designed a 4-wk undergraduate laboratory module that used a multifaceted approach to study a question in molecular genetics. Specifically, students investigated whether Caenorhabditis elegans can be a useful model system for studying genes associated with human disease. In a large-enrollment, sophomore-level laboratory course, groups of three to four students were assigned a gene associated with either breast cancer (brc-1), Wilson disease (cua-1), ovarian dysgenesis (fshr-1), or colon cancer (mlh-1). Students compared observable phenotypes of wild-type C. elegans and C. elegans with a homozygous deletion in the assigned gene. They confirmed the genetic deletion with nested polymerase chain reaction and performed a bioinformatics analysis to predict how the deletion would affect the encoded mRNA and protein. Students also performed RNA interference (RNAi) against their assigned gene and evaluated whether RNAi caused a phenotype similar to that of the genetic deletion. As a capstone activity, students prepared scientific posters in which they presented their data, evaluated whether C. elegans was a useful model system for studying their assigned genes, and proposed future directions. Assessment showed gains in understanding genotype versus phenotype, RNAi, common bioinformatics tools, and the utility of model organisms. PMID:22665589

  1. RNAi Screening in Spodoptera frugiperda.

    PubMed

    Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K

    2016-01-01

    RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.

  2. Biochemical identification of Argonaute 2 as the sole protein required for RNA-induced silencing complex activity

    PubMed Central

    Rand, Tim A.; Ginalski, Krzysztof; Grishin, Nick V.; Wang, Xiaodong

    2004-01-01

    RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2. PMID:15452342

  3. Biochemical identification of Argonaute 2 as the sole protein required for RNA-induced silencing complex activity.

    PubMed

    Rand, Tim A; Ginalski, Krzysztof; Grishin, Nick V; Wang, Xiaodong

    2004-10-05

    RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2.

  4. Nucleic Acid Templated Reactions for Chemical Biology.

    PubMed

    Di Pisa, Margherita; Seitz, Oliver

    2017-06-21

    Nucleic acid directed bioorthogonal reactions offer the fascinating opportunity to unveil and redirect a plethora of intracellular mechanisms. Nano- to picomolar amounts of specific RNA molecules serve as templates and catalyze the selective formation of molecules that 1) exert biological effects, or 2) provide measurable signals for RNA detection. Turnover of reactants on the template is a valuable asset when concentrations of RNA templates are low. The idea is to use RNA-templated reactions to fully control the biodistribution of drugs and to push the detection limits of DNA or RNA analytes to extraordinary sensitivities. Herein we review recent and instructive examples of conditional synthesis or release of compounds for in cellulo protein interference and intracellular nucleic acid imaging. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  5. Establishment of conditional vectors for hairpin siRNA knockdowns

    PubMed Central

    Matsukura, Shiro; Jones, Peter A.; Takai, Daiya

    2003-01-01

    Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529

  6. [The role of miRNA in endometrial cancer in the context of miRNA 205].

    PubMed

    Wilczyński, Miłosz; Danielska, Justyna; Dzieniecka, Monika; Malinowski, Andrzej

    2015-11-01

    MiRNAs are small, non-coding molecules of ribonucleic acids of approximately 22 bp length, which serve as regulators of gene expression and protein translation due to interference with messenger RNA (mRNA). MiRNAs, which take part in the regulation of cell cycle and apoptosis, may be associated with carcinogenesis. Aberrant expression of miRNAs in endometrial cancer might contribute to the endometrial cancer initiation or progression, as well as metastasis formation, and may influence cancer invasiveness. Specific-miRNAs expressed in endometrial cancer tissues may serve as diagnostic markers of the disease, prognostic biomarkers, or play an important part in oncological therapy We aimed to describe the role of miRNAs in endometrial cancer with special consideration of miRNA 205.

  7. Flavivirus RNAi suppression: decoding non-coding RNA.

    PubMed

    Pijlman, Gorben P

    2014-08-01

    Flaviviruses are important human pathogens that are transmitted by invertebrate vectors, mostly mosquitoes and ticks. During replication in their vector, flaviviruses are subject to a potent innate immune response known as antiviral RNA interference (RNAi). This defense mechanism is associated with the production of small interfering (si)RNA that lead to degradation of viral RNA. To what extent flaviviruses would benefit from counteracting antiviral RNAi is subject of debate. Here, the experimental evidence to suggest the existence of flavivirus RNAi suppressors is discussed. I will highlight the putative role of non-coding, subgenomic flavivirus RNA in suppression of RNAi in insect and mammalian cells. Novel insights from ongoing research will reveal how arthropod-borne viruses modulate innate immunity including antiviral RNAi. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Hairpin-Hairpin Molecular Beacon Interactions for Detection of Survivin mRNA in Malignant SW480 Cells.

    PubMed

    Ratajczak, Katarzyna; Krazinski, Bartlomiej E; Kowalczyk, Anna E; Dworakowska, Beata; Jakiela, Slawomir; Stobiecka, Magdalena

    2018-05-07

    Cancer biomarkers offer unique prospects for the development of cancer diagnostics and therapy. One of such biomarkers, protein survivin (Sur), exhibits strong antiapoptotic and proliferation-enhancing properties and is heavily expressed in multiple cancers. Thus, it can be utilized to provide new modalities for modulating the cell-growth rate, essential for effective cancer treatment. Herein, we have focused on the development of a new survivin-based cancer detection platform for colorectal cancer cells SW480 using a turn-on fluorescence oligonucleotide molecular beacon (MB) probe, encoded to recognize Sur messenger RNA (mRNA). Contrary to the expectations, we have found that both the complementary target oligonucleotide strands as well as the single- and double-mismatch targets, instead of exhibiting the anticipated simple random conformations, preferentially formed secondary structure motifs by folding into small-loop hairpin structures. Such a conformation may interfere with, or even undermine, the biorecognition process. To gain better understanding of the interactions involved, we have replaced the classical Tyagi-Kramer model of interactions between a straight target oligonucleotide strand and a hairpin MB with a new model to account for the hairpin-hairpin interactions as the biorecognition principle. A detailed mechanism of these interactions has been proposed. Furthermore, in experimental work, we have demonstrated an efficient transfection of malignant SW480 cells with SurMB probes containing a fluorophore Joe (SurMB-Joe) using liposomal nanocarriers. The green emission from SurMB-Joe in transfected cancer cells, due to the hybridization of the SurMB-Joe loop with Sur mRNA hairpin target, corroborates Sur overexpression. On the other hand, healthy human-colon epithelial cells CCD 841 CoN show only negligible expression of survivin mRNA. These experiments provide the proof-of-concept for distinguishing between the cancer and normal cells by the proposed hairpin-hairpin interaction method. The single nucleotide polymorphism sensitivity and a low detection limit of 26 nM (S/N = 3σ) for complementary targets have been achieved.

  9. Functional Nanostructures for Effective Delivery of Small Interfering RNA Therapeutics

    PubMed Central

    Hong, Cheol Am; Nam, Yoon Sung

    2014-01-01

    Small interfering RNA (siRNA) has proved to be a powerful tool for target-specific gene silencing via RNA interference (RNAi). Its ability to control targeted gene expression gives new hope to gene therapy as a treatment for cancers and genetic diseases. However, siRNA shows poor pharmacological properties, such as low serum stability, off-targeting, and innate immune responses, which present a significant challenge for clinical applications. In addition, siRNA cannot cross the cell membrane for RNAi activity because of its anionic property and stiff structure. Therefore, the development of a safe, stable, and efficient system for the delivery of siRNA therapeutics into the cytoplasm of targeted cells is crucial. Several nanoparticle platforms for siRNA delivery have been developed to overcome the major hurdles facing the therapeutic uses of siRNA. This review covers a broad spectrum of non-viral siRNA delivery systems developed for enhanced cellular uptake and targeted gene silencing in vitro and in vivo and discusses their characteristics and opportunities for clinical applications of therapeutic siRNA. PMID:25285170

  10. [Mechanism of protective effects of tumor necrosis factor receptor associated protein 1 on hypoxic cardiomyocytes of rats].

    PubMed

    Xiang, F; Zhang, D X; Ma, S Y; Huang, Y S

    2016-12-20

    Objective: To investigate the mechanism of protective effects of tumor necrosis factor receptor associated protein 1 (TRAP1) on hypoxic cardiomyocytes of rats. Methods: Primary cultured cardiomyocytes were obtained from neonatal Sprague-Dawley rats (aged 1 to 3 days) and then used in the following experiments. (1) Cells were divided into group TRAP1 and control group according to the random number table (the same grouping method below), and then the total protein of cells was extracted. Total protein of cells in group TRAP1 was added with mouse anti-rat TRAP1 monoclonal antibody, while that in control group was added with the same type of IgG from mouse. Co-immunoprecipitation and protein mass spectrography analysis were used to determine the possible proteins interacted with TRAP1. (2) Cells were divided into normoxia blank control group (NBC), normoxia+ TRAP1 interference control group (NTIC), normoxia+ TRAP1 interference group (NTI), normoxia+ TRAP1 over-expression control group (NTOC), and normoxia+ TRAP1 over-expression group (NTO), with 1 well in each group. Cells in group NBC were routinely cultured, while cells in the latter four groups were respectively added with TRAP1 RNA interference empty virus vector, TRAP1 RNA interference adenovirus vector, TRAP1 over-expression empty virus vector, and TRAP1 over-expression adenovirus vector. Another batch of cells were divided into group NBC, hypoxic blank control group (HBC), hypoxic+ TRAP1 interference control group (HTIC), hypoxic+ TRAP1 interference group (HTI), hypoxic+ TRAP1 over-expression control group (HTOC), and hypoxic+ TRAP1 over-expression group (HTO), with 1 well in each group. Cells in hypoxic groups were under hypoxic condition for 6 hours after being treated as those in the corresponding normoxia groups, respectively. The mRNA expression of cytochrome c oxidase subunit Ⅱ (COXⅡ) of cells in each group was detected by real time fluorescent quantitive reverse transcription polymerase chain reaction. Experiments were repeated for three times. (3) Cells were divided into group NBC, group HBC, group HTOC, group HTO, hypoxic+ TRAP1 over-expression+ COXⅡinterference control group (HTOCIC), and hypoxic+ TRAP1 over-expression+ COXⅡinterference group (HTOCI), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTOCIC and HTOCI were respectively transfected with COXⅡ RNA interference empty virus vector and COXⅡ RNA interference adenovirus vector, and then both added with TRAP1 over-expression adenovirus vector. The proliferation activity of cells was determined by cell counting kit 8 and microplate reader, and the ratio of death cells was measured by propidium lodide and Hoechst 33342 staining. Another batch of cells were divided into group NBC, group HBC, group HTIC, group HTI, hypoxic+ TRAP1 interference+ COXⅡover-expression control group (HTICOC), and hypoxic+ TRAP1 interference+ COXⅡ over-expression group (HTICO), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTICOC and HTICO were both transfected with TRAP1 RNA interference adenovirus vector, and then respectively added with COXⅡ over-expression empty virus vector and COXⅡ over-expression adenovirus vector. The proliferation activity of cells and the ratio of death cells were detected as before. Experiments were repeated for three times. Data were processed with one-way analysis of variance and LSD test. Results: (1) The expression of TRAP1 was found in cells of group TRAP1, while that was not found in cells of control group. The possible proteins interacted with TRAP1 were keratin, COXⅡ, and an unknown protein with predicted molecular weight 13×10 3 . (2) Compared with that in group NBC, the mRNA expression of COXⅡof cells had no significant change in group NTIC and group NTOC (with P values above 0.05), but significantly decreased in group NTI ( P <0.01), and significantly increased in group NTO ( P <0.01). Compared with that in group NBC, the mRNA expression of COXⅡof cells in group HBC was significantly decreased ( P <0.01). Compared with that in group HBC, the mRNA expression of COXⅡof cells had no significant change in group HTIC and group HTOC (with P values above 0.05), but significantly decreased in group HTI ( P <0.01), and significantly increased in group HTO ( P <0.01). (3) The proliferation activity of cells in group NBC, group HBC, group HTOC, group HTO, group HTOCIC, and group HTOCI was respectively 0.498±0.022, 0.303±0.018, 0.313±0.032, 0.456±0.031, 0.448±0.034, and 0.335±0.026, and the ratios of death cells in above groups were respectively (4.7±1.5)%, (24.7±3.1)%, (26.0±2.7)%, (13.3±2.5)%, (12.7±2.1)%, and (21.0±1.7)%. Compared with those in group NBC, the proliferation activity of cells in HBC was decreased, while the ratio of death cells was increased (with P values below 0.01). Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was decreased in group HTO (with P values below 0.01). Compared with those in group HTO, the proliferation activity of cells and the ratio of death cells in group HTOCIC had no significant change (with P values above 0.05), while the proliferation activity of cells was decreased and the ratio of death cells was increased in group HTOCI (with P values below 0.01). (4) The proliferation activity of cells in group NBC, group HBC, group HTIC, group HTI, group HTICOC, and group HTICO was respectively 0.444±0.025, 0.275±0.016, 0.283±0.021, 0.150±0.009, 0.135±0.011, and 0.237±0.017, and the ratios of death cells in above groups were respectively (3.7±0.6)%, (21.0±2.7)%, (20.3±3.1)%, (31.7±2.5)%, (33.3±3.2)%, and (19.3±1.5)%. Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTIC had no significant change (with P values above 0.05). Compared with those in group HBC and group HTIC, the proliferation activity of cells was decreased and the ratio of death cells was significantly increased in group HTI (with P values below 0.01). Compared with those in group HTI, the proliferation activity of cells and the ratio of death cells in group HTICOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was significantly decreased in group HTICO (with P values below 0.01). Conclusions: TRAP1 can up-regulate the expression of COXⅡ mRNA, and COXⅡ is one of the downstream effector molecules that TRAP1 mediates its protective effects on hypoxic cardiomyocytes.

  11. Emerging strategies for RNA interference (RNAi) applications in insects.

    PubMed

    Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W

    2015-01-01

    RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.

  12. Improvement of heterologous protein production in Aspergillus oryzae by RNA interference with alpha-amylase genes.

    PubMed

    Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko

    2009-11-01

    Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae.

  13. RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)

    PubMed Central

    Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.

    2016-01-01

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765

  14. RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).

    PubMed

    Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E

    2016-01-01

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.

  15. Utilization of coincidence criteria in absolute length measurements by optical interferometry in vacuum and air

    NASA Astrophysics Data System (ADS)

    Schödel, R.

    2015-08-01

    Traceability of length measurements to the international system of units (SI) can be realized by using optical interferometry making use of well-known frequencies of monochromatic light sources mentioned in the Mise en Pratique for the realization of the metre. At some national metrology institutes, such as Physikalisch-Technische Bundesanstalt (PTB) in Germany, the absolute length of prismatic bodies (e.g. gauge blocks) is realized by so-called gauge-block interference comparators. At PTB, a number of such imaging phase-stepping interference comparators exist, including specialized vacuum interference comparators, each equipped with three highly stabilized laser light sources. The length of a material measure is expressed as a multiple of each wavelength. The large number of integer interference orders can be extracted by the method of exact fractions in which the coincidence of the lengths resulting from the different wavelengths is utilized as a criterion. The unambiguous extraction of the integer interference orders is an essential prerequisite for correct length measurements. This paper critically discusses coincidence criteria and their validity for three modes of absolute length measurements: 1) measurements under vacuum in which the wavelengths can be identified with the vacuum wavelengths, 2) measurements under air in which the air refractive index is obtained from environmental parameters using an empirical equation, and 3) measurements under air in which the air refractive index is obtained interferometrically by utilizing a vacuum cell placed along the measurement pathway. For case 3), which corresponds to PTB’s Kösters-Comparator for long gauge blocks, the unambiguous determination of integer interference orders related to the air refractive index could be improved by about a factor of ten when an ‘overall dispersion value,’ suggested in this paper, is used as coincidence criterion.

  16. Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.

    PubMed

    Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian

    2017-10-01

    Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.

  17. RNA viruses and microRNAs: challenging discoveries for the 21st century

    PubMed Central

    Swaminathan, Gokul; Martin-Garcia, Julio

    2013-01-01

    RNA viruses represent the predominant cause of many clinically relevant viral diseases in humans. Among several evolutionary advantages acquired by RNA viruses, the ability to usurp host cellular machinery and evade antiviral immune responses is imperative. During the past decade, RNA interference mechanisms, especially microRNA (miRNA)-mediated regulation of cellular protein expression, have revolutionized our understanding of host-viral interactions. Although it is well established that several DNA viruses express miRNAs that play crucial roles in their pathogenesis, expression of miRNAs by RNA viruses remains controversial. However, modulation of the miRNA machinery by RNA viruses may confer multiple benefits for enhanced viral replication and survival in host cells. In this review, we discuss the current literature on RNA viruses that may encode miRNAs and the varied advantages of engineering RNA viruses to express miRNAs as potential vectors for gene therapy. In addition, we review how different families of RNA viruses can alter miRNA machinery for productive replication, evasion of antiviral immune responses, and prolonged survival. We underscore the need to further explore the complex interactions of RNA viruses with host miRNAs to augment our understanding of host-virus interplay. PMID:24046280

  18. RNA extraction from self-assembling peptide hydrogels to allow qPCR analysis of encapsulated cells.

    PubMed

    Burgess, Kyle A; Workman, Victoria L; Elsawy, Mohamed A; Miller, Aline F; Oceandy, Delvac; Saiani, Alberto

    2018-01-01

    Self-assembling peptide hydrogels offer a novel 3-dimensional platform for many applications in cell culture and tissue engineering but are not compatible with current methods of RNA isolation; owing to interactions between RNA and the biomaterial. This study investigates the use of two techniques based on two different basic extraction principles: solution-based extraction and direct solid-state binding of RNA respectively, to extract RNA from cells encapsulated in four β-sheet forming self-assembling peptide hydrogels with varying net positive charge. RNA-peptide fibril interactions, rather than RNA-peptide molecular complexing, were found to interfere with the extraction process resulting in low yields. A column-based approach relying on RNA-specific binding was shown to be more suited to extracting RNA with higher purity from these peptide hydrogels owing to its reliance on strong specific RNA binding interactions which compete directly with RNA-peptide fibril interactions. In order to reduce the amount of fibrils present and improve RNA yields a broad spectrum enzyme solution-pronase-was used to partially digest the hydrogels before RNA extraction. This pre-treatment was shown to significantly increase the yield of RNA extracted, allowing downstream RT-qPCR to be performed.

  19. Design of siRNA Therapeutics from the Molecular Scale

    PubMed Central

    Angart, Phillip; Vocelle, Daniel; Chan, Christina; Walton, S. Patrick

    2013-01-01

    While protein-based therapeutics is well-established in the market, development of nucleic acid therapeutics has lagged. Short interfering RNAs (siRNAs) represent an exciting new direction for the pharmaceutical industry. These small, chemically synthesized RNAs can knock down the expression of target genes through the use of a native eukaryotic pathway called RNA interference (RNAi). Though siRNAs are routinely used in research studies of eukaryotic biological processes, transitioning the technology to the clinic has proven challenging. Early efforts to design an siRNA therapeutic have demonstrated the difficulties in generating a highly-active siRNA with good specificity and a delivery vehicle that can protect the siRNA as it is transported to a specific tissue. In this review article, we discuss design considerations for siRNA therapeutics, identifying criteria for choosing therapeutic targets, producing highly-active siRNA sequences, and designing an optimized delivery vehicle. Taken together, these design considerations provide logical guidelines for generating novel siRNA therapeutics. PMID:23976875

  20. Structure of yeast Argonaute with guide RNA

    PubMed Central

    Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.

    2012-01-01

    The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195

  1. Protection from feed-forward amplification in an amplified RNAi mechanism

    PubMed Central

    Pak, Julia; Maniar, Jay Mahesh; Mello, Cecilia Cabral; Fire, Andrew

    2012-01-01

    SUMMARY The effectiveness of RNA interference (RNAi) in many organisms is potentiated through the signal-amplifying activity of a targeted RNA directed RNA polymerase (RdRP) system that can convert a small population of exogenously-encountered dsRNA fragments into an abundant internal pool of small interfering RNA (siRNA). As for any biological amplification system, we expect an underlying architecture that will limit the ability of a randomly encountered trigger to produce an uncontrolled and self-escalating response. Investigating such limits in C. elegans, we find that feed-forward amplification is limited by a critical biosynthetic and structural distinction at the RNA level between (i) triggers that can produce amplification and (ii) siRNA products of the amplification reaction. By assuring that initial (primary) siRNAs can act as triggers but not templates for activation, and that the resulting (secondary) siRNAs can enforce gene silencing on additional targets without unbridled trigger amplification, the system achieves substantial but fundamentally limited signal amplification. PMID:23141544

  2. Antiviral effect of PmRab7 knock-down on inhibition of Laem-Singh virus replication in black tiger shrimp.

    PubMed

    Ongvarrasopone, Chalermporn; Chomchay, Ekapol; Panyim, Sakol

    2010-10-01

    PmRab7 is a Penaeus monodon small GTPase protein possibly involved in replication of several shrimp viruses. In this study RNA interference (RNAi) using double-stranded RNA (dsRNA) targeting PmRab7 gene (dsRNA-PmRab7) was employed to silence the expression of PmRab7 to investigate the inhibitory effect on Laem-Singh virus (LSNV) replication. Injection of dsRNA-PmRab7 24h before challenge with the virus resulted in a drastic decrease of PmRab7 mRNA and complete inhibition of LSNV replication at 3 days post-challenge. In a therapeutic mode, shrimp injected with dsRNA-PmRab7 1 day but not at 3 or 5 days post-LSNV challenge resulted in inhibition of LSNV replication. These results pave the way to use dsRNA-PmRab7 to prevent or cure LSNV infection in shrimp. Copyright © 2010 Elsevier B.V. All rights reserved.

  3. Exaptive origins of regulated mRNA decay in eukaryotes.

    PubMed

    Hamid, Fursham M; Makeyev, Eugene V

    2016-09-01

    Eukaryotic gene expression is extensively controlled at the level of mRNA stability and the mechanisms underlying this regulation are markedly different from their archaeal and bacterial counterparts. We propose that two such mechanisms, nonsense-mediated decay (NMD) and motif-specific transcript destabilization by CCCH-type zinc finger RNA-binding proteins, originated as a part of cellular defense against RNA pathogens. These branches of the mRNA turnover pathway might have been used by primeval eukaryotes alongside RNA interference to distinguish their own messages from those of RNA viruses and retrotransposable elements. We further hypothesize that the subsequent advent of "professional" innate and adaptive immunity systems allowed NMD and the motif-triggered mechanisms to be efficiently repurposed for regulation of endogenous cellular transcripts. This scenario explains the rapid emergence of archetypical mRNA destabilization pathways in eukaryotes and argues that other aspects of post-transcriptional gene regulation in this lineage might have been derived through a similar exaptation route. © 2016 The Authors BioEssays Published by WILEY Periodicals, Inc.

  4. Bioengineered Nanoparticles for siRNA delivery

    PubMed Central

    Kozielski, Kristen L.; Tzeng, Stephany Y.; Green, Jordan J.

    2014-01-01

    Short interfering RNA (siRNA) has been an important laboratory tool in the last two decades and has allowed researchers to better understand the functions of non-protein-coding genes through RNA interference (RNAi). Although RNAi holds great promise for this purpose as well as for treatment of many diseases, efforts at using siRNA have been hampered by the difficulty of safely and effectively introducing it into cells of interest, both in vitro and in vivo. To overcome this challenge, many biomaterials and nanoparticles (NPs) have been developed and optimized for siRNA delivery, often taking cues from the DNA delivery field, although different barriers exist for these two types of molecules. In this review, we discuss general properties of biomaterials and nanoparticles that are necessary for effective nucleic acid delivery. We also discuss specific examples of bioengineered materials, including lipid-based NPs, polymeric NPs, inorganic NPs, and RNA-based NPs, which clearly illustrate the problems and successes in siRNA delivery. PMID:23821336

  5. Complexities in Isolation and Purification of Multiple Viruses from Mixed Viral Infections: Viral Interference, Persistence and Exclusion.

    PubMed

    Kumar, Naveen; Barua, Sanjay; Riyesh, Thachamvally; Chaubey, Kundan K; Rawat, Krishan Dutt; Khandelwal, Nitin; Mishra, Anil K; Sharma, Nitika; Chandel, Surender S; Sharma, Shalini; Singh, Manoj K; Sharma, Dinesh K; Singh, Shoor V; Tripathi, Bhupendra N

    2016-01-01

    Successful purification of multiple viruses from mixed infections remains a challenge. In this study, we investigated peste des petits ruminants virus (PPRV) and foot-and-mouth disease virus (FMDV) mixed infection in goats. Rather than in a single cell type, cytopathic effect (CPE) of the virus was observed in cocultured Vero/BHK-21 cells at 6th blind passage (BP). PPRV, but not FMDV could be purified from the virus mixture by plaque assay. Viral RNA (mixture) transfection in BHK-21 cells produced FMDV but not PPRV virions, a strategy which we have successfully employed for the first time to eliminate the negative-stranded RNA virus from the virus mixture. FMDV phenotypes, such as replication competent but noncytolytic, cytolytic but defective in plaque formation and, cytolytic but defective in both plaque formation and standard FMDV genome were observed respectively, at passage level BP8, BP15 and BP19 and hence complicated virus isolation in the cell culture system. Mixed infection was not found to induce any significant antigenic and genetic diversity in both PPRV and FMDV. Further, we for the first time demonstrated the viral interference between PPRV and FMDV. Prior transfection of PPRV RNA, but not Newcastle disease virus (NDV) and rotavirus RNA resulted in reduced FMDV replication in BHK-21 cells suggesting that the PPRV RNA-induced interference was specifically directed against FMDV. On long-term coinfection of some acute pathogenic viruses (all possible combinations of PPRV, FMDV, NDV and buffalopox virus) in Vero cells, in most cases, one of the coinfecting viruses was excluded at passage level 5 suggesting that the long-term coinfection may modify viral persistence. To the best of our knowledge, this is the first documented evidence describing a natural mixed infection of FMDV and PPRV. The study not only provides simple and reliable methodologies for isolation and purification of two epidemiologically and economically important groups of viruses, but could also help in establishing better guidelines for trading animals that could transmit further infections and epidemics in disease free nations.

  6. The involvement of osteopontin and matrix metalloproteinase- 9 in the migration of endometrial epithelial cells in patients with endometriosis.

    PubMed

    Yang, Mei; Jiang, Chunfan; Chen, Hua; Nian, Yan; Bai, Zhimiao; Ha, Chunfang

    2015-08-20

    Endometriosis, which shares certain characteristics with cancers, may cause abnormal expression of proteins involved in cell migration. Endometrial epithelial cells (EECs) are believed to play an important role in endometriotic migration. The aim of this study was to investigate the relationship between the expression of osteopontin (OPN) and matrix metalloproteinase-9 (MMP-9) in endometriotic migration. We performed primary culture of EECs and investigated the expression of OPN and MMP-9 in EECs regulated by 17beta-estradiol (E2). OPN-specific siRNA interference was used to down-regulate OPN and to explore the corresponding change in MMP-9 expression. Real-time RT-PCR, western blot analysis and flow cytometry were used to determine the expression levels of OPN and MMP-9. Gelatin zymography was performed to observe the enzymatic activity of MMP-9 in conditioned media. Transwell and wound scratch assays were performed to investigate the migration ability of EECs. The expression levels of OPN and MMP-9 in normal EECs (NEECs) were inferior to those in EECs from patients with endometriosis (EEECs). The expression levels of OPN and MMP-9 from stage III/IV EEECs and secretory-phase EECs were higher than those of stage I/II EEECs or proliferative-phase EECs. The expression levels of OPN and MMP-9 in EEECs were increased by E2 treatment and remarkably decreased by siRNA interference. Active MMP-9 expression increased with E2 treatment and decreased with siRNA treatment in EEECs compared with the same treatments in NEECs. The migratory abilities of EEECs were enhanced after cells were treated with E2; in contrast, these abilities were reduced by siRNA interference. In NEECs, active MMP-9 and cellular migration abilities were only minimally influenced by E2 and siRNA treatment. The present study suggests that the up-regulation of MMP-9 via activation of OPN induced by estrogen may correlate with the migration of endometrial epithelial cells in patients with endometriosis.

  7. Complexities in Isolation and Purification of Multiple Viruses from Mixed Viral Infections: Viral Interference, Persistence and Exclusion

    PubMed Central

    Kumar, Naveen; Barua, Sanjay; Riyesh, Thachamvally; Chaubey, Kundan K.; Rawat, Krishan Dutt; Khandelwal, Nitin; Mishra, Anil K.; Sharma, Nitika; Chandel, Surender S.; Sharma, Shalini; Singh, Manoj K.; Sharma, Dinesh K.; Singh, Shoor V.; Tripathi, Bhupendra N.

    2016-01-01

    Successful purification of multiple viruses from mixed infections remains a challenge. In this study, we investigated peste des petits ruminants virus (PPRV) and foot-and-mouth disease virus (FMDV) mixed infection in goats. Rather than in a single cell type, cytopathic effect (CPE) of the virus was observed in cocultured Vero/BHK-21 cells at 6th blind passage (BP). PPRV, but not FMDV could be purified from the virus mixture by plaque assay. Viral RNA (mixture) transfection in BHK-21 cells produced FMDV but not PPRV virions, a strategy which we have successfully employed for the first time to eliminate the negative-stranded RNA virus from the virus mixture. FMDV phenotypes, such as replication competent but noncytolytic, cytolytic but defective in plaque formation and, cytolytic but defective in both plaque formation and standard FMDV genome were observed respectively, at passage level BP8, BP15 and BP19 and hence complicated virus isolation in the cell culture system. Mixed infection was not found to induce any significant antigenic and genetic diversity in both PPRV and FMDV. Further, we for the first time demonstrated the viral interference between PPRV and FMDV. Prior transfection of PPRV RNA, but not Newcastle disease virus (NDV) and rotavirus RNA resulted in reduced FMDV replication in BHK-21 cells suggesting that the PPRV RNA-induced interference was specifically directed against FMDV. On long-term coinfection of some acute pathogenic viruses (all possible combinations of PPRV, FMDV, NDV and buffalopox virus) in Vero cells, in most cases, one of the coinfecting viruses was excluded at passage level 5 suggesting that the long-term coinfection may modify viral persistence. To the best of our knowledge, this is the first documented evidence describing a natural mixed infection of FMDV and PPRV. The study not only provides simple and reliable methodologies for isolation and purification of two epidemiologically and economically important groups of viruses, but could also help in establishing better guidelines for trading animals that could transmit further infections and epidemics in disease free nations. PMID:27227480

  8. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

    PubMed

    Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

    2007-07-26

    Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

  9. Utilizing laser interference lithography to fabricate hierarchical optical active nanostructures inspired by the blue Morpho butterfly

    NASA Astrophysics Data System (ADS)

    Siddique, Radwanul H.; Faisal, Abrar; Hünig, Ruben; Bartels, Carolin; Wacker, Irene; Lemmer, Uli; Hoelscher, Hendrik

    2014-09-01

    The famous non-iridescent blue of the Morpho butter by is caused by a `Christmas tree' like nanostructure which is a challenge for common fabrication techniques. Here, we introduce a method to fabricate this complex morphology utilizing dual beam interference lithography. We add a reflective coating below the photoresist to create a second interference pattern in vertical direction by exploiting the back reflection from the substrate. This vertical pattern exposes the lamella structure into the photosensitive polymer while the horizontal interference pattern determines the distance of the ridges. The photosensitive polymer is chosen accordingly to create the Christmas tree' like tapered shape. The resulting artificial Morpho replica shows brilliant non-iridescent blue up to an incident angle of 40. Its optical properties are close to the original Morpho structure because the refractive index of the polymer is close to chitin. Moreover, the biomimetic surface is water repellent with a contact angle of 110.

  10. The interference of flexible working times with the utility of time: a predictor of social impairment?

    PubMed

    Wirtz, Anna; Giebel, Ole; Schomann, Carsten; Nachreiner, Friedhelm

    2008-04-01

    Periodic components inherent in actual schedules of flexible working hours and their interference with social rhythms were measured using spectrum analysis. The resulting indicators of periodicity and interference were then related to the reported social impairments of workers. The results show that a suppression of the 24 and the 168 h (seven-day) components (absence of periodicity) in the work schedules predicts reported social impairment. However, even if there are relatively strong 24 and 168 h components left in the work schedules, their interference with the social rhythm (using the phase difference between working hours and the utility of time) further predicts impairment. The results thus indicate that the periodicity of working hours and the amount of (social) desynchronization induced by flexible work schedules can be used both for predicting the impairing effects of the specific work schedules on social well-being as well as for the design of socially acceptable flexible work hours.

  11. A 3’UTR polymorphism marks differential KLRG1 mRNA levels through disruption of a miR-584-5p binding site and associates with pemphigus foliaceus susceptibility

    PubMed Central

    Cipolla, Gabriel A.; Park, Jong K.; de Oliveira, Liana A.; Lobo-Alves, Sara Cristina; de Almeida, Rodrigo C.; Farias, Ticiana D. J.; Lemos, Débora de S.; Malheiros, Danielle; Lavker, Robert M.; Petzl-Erler, Maria Luiza

    2016-01-01

    Genetic variations mapping to 3’ untranslated regions (3’UTRs) may overlap with microRNA (miRNA) binding sites, therefore potentially interfering with translation inhibition or messenger RNA (mRNA) degradation. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) located within the 3’UTRs of six candidate genes and predicted to interfere with miRNA ligation could account for disease-relevant differential mRNA levels. Focusing on pemphigus foliaceus (PF) – an autoimmune blistering skin condition with unique endemic patterns – we investigated if nine 3’UTR SNPs from the CD1D, CTLA4, KLRD1, KLRG1, NKG7, and TNFSF13B genes differentially expressed in PF were disease-associated. The heterozygous genotype of the KLRG1 rs1805672 polymorphism was associated with increased predisposition to PF (A/G vs. A/A: P=0.038; OR=1.60), and a trend for augmented susceptibility was observed for carriers of the G allele (P=0.094; OR=1.44). In silico analyses suggested that rs1805672 G allele could disrupt binding of miR-584-5p, and indicated rs1805672 as an expression Quantitative Trait Locus (eQTL), with an effect on KLRG1 gene expression. Dual-luciferase assay showed that miR-584-5p mediated approximately 50% downregulation of the reporter gene’s activity through the 3’UTR of KLRG1 harboring rs1805672 A allele (vs. miRNA-negative condition, P=0.006). This silencing relationship was lost after site-directed mutation to G allele (vs. miRNA-negative condition, P=0.391; vs. rs1805672 A allele, P=0.005). Collectively, these results suggest that a disease-associated SNP located within the 3’UTR of KLRG1 directly interferes with miR-584-5p binding, allowing for KLRG1 mRNA differential accumulation, which in turn may contribute to pathogenesis of autoimmune diseases, such as pemphigus. PMID:27424220

  12. A 3'UTR polymorphism marks differential KLRG1 mRNA levels through disruption of a miR-584-5p binding site and associates with pemphigus foliaceus susceptibility.

    PubMed

    Cipolla, Gabriel A; Park, Jong Kook; de Oliveira, Liana A; Lobo-Alves, Sara Cristina; de Almeida, Rodrigo C; Farias, Ticiana D J; Lemos, Débora de S; Malheiros, Danielle; Lavker, Robert M; Petzl-Erler, Maria Luiza

    2016-10-01

    Genetic variations mapping to 3' untranslated regions (3'UTRs) may overlap with microRNA (miRNA) binding sites, therefore potentially interfering with translation inhibition or messenger RNA (mRNA) degradation. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) located within the 3'UTRs of six candidate genes and predicted to interfere with miRNA ligation could account for disease-relevant differential mRNA levels. Focusing on pemphigus foliaceus (PF) - an autoimmune blistering skin condition with unique endemic patterns - we investigated whether nine 3'UTR SNPs from the CD1D, CTLA4, KLRD1, KLRG1, NKG7, and TNFSF13B genes differentially expressed in PF were disease-associated. The heterozygous genotype of the KLRG1 rs1805672 polymorphism was associated with increased predisposition to PF (A/G vs. A/A: P=0.038; OR=1.60), and a trend for augmented susceptibility was observed for carriers of the G allele (P=0.094; OR=1.44). In silico analyses suggested that rs1805672 G allele could disrupt binding of miR-584-5p, and indicated rs1805672 as an expression Quantitative Trait Locus (eQTL), with an effect on KLRG1 gene expression. Dual-luciferase assay showed that miR-584-5p mediated approximately 50% downregulation of the reporter gene's activity through the 3'UTR of KLRG1 harboring rs1805672 A allele (vs. miRNA-negative condition, P=0.006). This silencing relationship was lost after site-directed mutation to G allele (vs. miRNA-negative condition, P=0.391; vs. rs1805672 A allele, P=0.005). Collectively, these results suggest that a disease-associated SNP located within the 3'UTR of KLRG1 directly interferes with miR-584-5p binding, allowing for KLRG1 mRNA differential accumulation, which in turn may contribute to pathogenesis of autoimmune diseases, such as pemphigus. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Local gene silencing in plants via synthetic dsRNA and carrier peptide.

    PubMed

    Numata, Keiji; Ohtani, Misato; Yoshizumi, Takeshi; Demura, Taku; Kodama, Yutaka

    2014-10-01

    Quick and facile transient RNA interference (RNAi) is one of the most valuable plant biotechnologies for analysing plant gene functions. To establish a novel double-strand RNA (dsRNA) delivery system for plants, we developed an ionic complex of synthetic dsRNA with a carrier peptide in which a cell-penetrating peptide is fused with a polycation sequence as a gene carrier. The dsRNA-peptide complex is 100-300 nm in diameter and positively charged. Infiltration of the complex into intact leaf cells of Arabidopsis thaliana successfully induced rapid and efficient down-regulation of exogenous and endogenous genes such as yellow fluorescent protein and chalcone synthase. The present method realizes quick and local gene silencing in specific tissues and/or organs in plants. © 2014 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  14. Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

    PubMed

    Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

    2016-06-17

    In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

  15. Different effects of the TAR structure on HIV-1 and HIV-2 genomic RNA translation

    PubMed Central

    Soto-Rifo, Ricardo; Limousin, Taran; Rubilar, Paulina S.; Ricci, Emiliano P.; Décimo, Didier; Moncorgé, Olivier; Trabaud, Mary-Anne; André, Patrice; Cimarelli, Andrea; Ohlmann, Théophile

    2012-01-01

    The 5′-untranslated region (5′-UTR) of the genomic RNA of human immunodeficiency viruses type-1 (HIV-1) and type-2 (HIV-2) is composed of highly structured RNA motifs essential for viral replication that are expected to interfere with Gag and Gag-Pol translation. Here, we have analyzed and compared the properties by which the viral 5′-UTR drives translation from the genomic RNA of both human immunodeficiency viruses. Our results showed that translation from the HIV-2 gRNA was very poor compared to that of HIV-1. This was rather due to the intrinsic structural motifs in their respective 5′-UTR without involvement of any viral protein. Further investigation pointed to a different role of TAR RNA, which was much inhibitory for HIV-2 translation. Altogether, these data highlight important structural and functional differences between these two human pathogens. PMID:22121214

  16. Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

    PubMed

    Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

    2017-07-01

    The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

  17. Defining the molecular profile of planarian pluripotent stem cells using a combinatorial RNA-seq, RNA interference and irradiation approach

    PubMed Central

    2012-01-01

    Background Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. Results We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Conclusions Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology. PMID:22439894

  18. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

    PubMed

    Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

    2014-05-06

    In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

  19. Comparison of Dengue Virus Type 2-Specific Small RNAs from RNA Interference-Competent and –Incompetent Mosquito Cells

    PubMed Central

    Scott, Jaclyn C.; Brackney, Doug E.; Campbell, Corey L.; Bondu-Hawkins, Virginie; Hjelle, Brian; Ebel, Greg D.; Olson, Ken E.; Blair, Carol D.

    2010-01-01

    The exogenous RNA interference (RNAi) pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (si)RNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2)-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2) cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV) corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts. PMID:21049014

  20. Differential utilization of TATA box-binding protein (TBP) and TBP-related factor 1 (TRF1) at different classes of RNA polymerase III promoters.

    PubMed

    Verma, Neha; Hung, Ko-Hsuan; Kang, Jin Joo; Barakat, Nermeen H; Stumph, William E

    2013-09-20

    In the fruit fly Drosophila melanogaster, RNA polymerase III transcription was found to be dependent not upon the canonical TATA box-binding protein (TBP) but instead upon the TBP-related factor 1 (TRF1) (Takada, S., Lis, J. T., Zhou, S., and Tjian, R. (2000) Cell 101, 459-469). Here we confirm that transcription of fly tRNA genes requires TRF1. However, we unexpectedly find that U6 snRNA gene promoters are occupied primarily by TBP in cells and that knockdown of TBP, but not TRF1, inhibits U6 transcription in cells. Moreover, U6 transcription in vitro effectively utilizes TBP, whereas TBP cannot substitute for TRF1 to promote tRNA transcription in vitro. Thus, in fruit flies, different classes of RNA polymerase III promoters differentially utilize TBP and TRF1 for the initiation of transcription.

Top