Detection of ESR1 mutations in plasma and tumors from metastatic breast cancer patients using next-generation sequencing.

PubMed

Yanagawa, Takehiro; Kagara, Naofumi; Miyake, Tomohiro; Tanei, Tomonori; Naoi, Yasuto; Shimoda, Masafumi; Shimazu, Kenzo; Kim, Seung Jin; Noguchi, Shinzaburo

2017-06-01

Liquid biopsy using digital PCR (dPCR) has been widely used for the screening of ESR1 mutations, since they are frequently identified in the hotspot. However, dPCR is limited to the known mutations. Therefore, we aimed to analyze the utility of next-generation sequencing (NGS) to discover novel ESR1 mutations. Whole exon sequencing of the ESR1 gene using NGS was performed in 16 primary and 47 recurrent tumor samples and 38 plasma samples from hormone receptor-positive metastatic breast cancer patients. Functional analyses were then performed for the novel mutations we detected. We identified no mutations in primary tumors and six mutations in five recurrent tumors, including three types of known mutations (Y537C, Y537N, and D538G) and two novel mutations (E279V and G557R). We also identified seven mutations in five plasma samples, including three types of known mutations (S463P, Y537S, and D538G) and one mutation not reported in COSMIC database (L536H). All nine patients with ESR1 mutations were treated with aromatase inhibitors (AIs) prior to sampling, and the mutations were frequently detected in patients who received AI treatments in the metastatic setting. Among the three novel mutations (E279V, L536H, and G557R), L536H, but not E279V and G557R, showed ligand-independent activity. All three mutant proteins showed nuclear localization and had no relation with non-genomic ER pathways. Although the molecular mechanisms of the E279V and G557R mutations remain unclear, our data suggest the utility of NGS as a liquid biopsy for metastatic breast cancer patients and the potential to identify novel ESR1 mutations.

Nonsquamous, Non-Small-Cell Lung Cancer Patients Who Carry a Double Mutation of EGFR, EML4-ALK or KRAS: Frequency, Clinical-Pathological Characteristics, and Response to Therapy.

PubMed

Ulivi, Paola; Chiadini, Elisa; Dazzi, Claudio; Dubini, Alessandra; Costantini, Matteo; Medri, Laura; Puccetti, Maurizio; Capelli, Laura; Calistri, Daniele; Verlicchi, Alberto; Gamboni, Alessandro; Papi, Maximilian; Mariotti, Marita; De Luigi, Nicoletta; Scarpi, Emanuela; Bravaccini, Sara; Turolla, Gian Michele; Amadori, Dino; Crinò, Lucio; Delmonte, Angelo

2016-09-01

Epidermal growth factor receptor (EGFR) and v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) mutations, and echinoderm microtubule-associated protein-like 4 (EML4) anaplastic lymphoma kinase (ALK) translocation are generally considered to be mutually exclusive. However, concomitant mutations are found in a small number of patients and the effect of these on response to targeted therapy is still unknown. We considered 380 non-small-cell lung cancer (NSCLC) patients who underwent nonsequential testing for EGFR and EML4-ALK translocation. KRAS mutation analysis was also performed on 282 patients. We found 1.6%, 1.1%, and 2.5% of patients who showed a double mutation comprising EGFR and EML4-ALK, EGFR and KRAS, and EML4-ALK and KRAS, respectively. Twenty-eight patients with EGFR mutation underwent first-line therapy with a tyrosine kinase receptor; a clinical benefit was observed in 81.8% of patients with EGFR mutations only and in 67% of those who also showed an EML4-ALK translocation. Twelve patients with an EML4-ALK translocation received crizotinib and 7 of these had disease progression within 3 months (2 had a concomitant KRAS mutation and 1 had a concomitant EGFR mutation). Two patients showed stable disease, 1 of whom also had a KRAS mutation. Two patients obtained a partial response and 1 had a complete response; all harbored an EML4-ALK translocation only. The median overall survival of patients who carried an EML4-ALK translocation alone or concomitant with a KRAS mutation was 57.1 (range, 10.7-not reached) and 10.7 (range, 4.6-not reached) months, respectively. Concomitant EGFR, EML4-ALK, or KRAS mutations can occur in NSCLC. Concomitant KRAS mutation and EML4-ALK translocation represents the most common double alteration and confers a poor prognosis. Copyright © 2015 Elsevier Inc. All rights reserved.

Targeted mutation analysis of endometrial clear cell carcinoma.

PubMed

Hoang, Lien N; McConechy, Melissa K; Meng, Bo; McIntyre, John B; Ewanowich, Carol; Gilks, Cyril Blake; Huntsman, David G; Köbel, Martin; Lee, Cheng-Han

2015-04-01

Endometrial clear cell carcinomas (CCC) constitute fewer than 5% of all carcinomas of the endometrium. Currently, little is known regarding the genetic basis of endometrial CCC. We performed genomic and immunohistochemical analyses on 14 rigorously reviewed pure endometrial CCC. The genomic analysis consisted of sequencing the coding regions of 26 genes implicated previously in endometrial carcinoma. Twelve of 14 tumours displayed a prototypical CCC immunophenotype [napsin A+, hepatocyte nuclear factor-1β (HNF1β(+) ) and oestrogen receptor(-) ] and all showed intact mismatch repair protein expression. We detected mutations in 11 of 14 tumours, and there was a predominance of mutations involving genes that are mutated more frequently in endometrial serous carcinomas than in endometrioid carcinomas. Two tumours displayed a prototypical serous carcinoma mutation profile (concurrent TP53 and PPP2R1A mutations, without PTEN, CTNNB1 or ARID1A mutation). No mutations in PTEN, CTNNB1 or POLE were identified. The overall mutation profile of this cohort of endometrial CCC appears to be more serous-like than endometrioid-like, with a minor subset in the TP53-mutated CCC showing serous carcinoma profile. These findings provide new insights into the molecular features of morphologically prototypical endometrial CCC, and underscore the need for further investigations into the oncogenesis of endometrial CCC. © 2014 John Wiley & Sons Ltd.

GATA2 mutations in patients with acute myeloid leukemia-paired samples analyses show that the mutation is unstable during disease evolution.

PubMed

Hou, Hsin-An; Lin, Yun-Chu; Kuo, Yuan-Yeh; Chou, Wen-Chien; Lin, Chien-Chin; Liu, Chieh-Yu; Chen, Chien-Yuan; Lin, Liang-In; Tseng, Mei-Hsuan; Huang, Chi-Fei; Chiang, Ying-Chieh; Liu, Ming-Chih; Liu, Chia-Wen; Tang, Jih-Luh; Yao, Ming; Huang, Shang-Yi; Ko, Bor-Sheng; Hsu, Szu-Chun; Wu, Shang-Ju; Tsay, Woei; Chen, Yao-Chang; Tien, Hwei-Fang

2015-02-01

Recently, mutations of the GATA binding protein 2 (GATA2) gene were identified in acute myeloid leukemia (AML) patients with CEBPA double mutations (CEBPA (double-mut)), but the interaction of this mutation with other genetic alterations and its dynamic changes during disease progression remain to be determined. In this study, 14 different missense GATA2 mutations, which were all clustered in the highly conserved N-terminal zinc finger 1 domain, were identified in 27.4, 6.7, and 1 % of patients with CEBPA (double-mut), CEBPA (single-mut), and CEBPA wild type, respectively. All but one patient with GATA2 mutation had concurrent CEBPA mutation. GATA2 mutations were closely associated with younger age, FAB M1 subtype, intermediate-risk cytogenetics, expression of HLA-DR, CD7, CD15, or CD34 on leukemic cells, and CEBPA mutation, but negatively associated with FAB M4 subtype, favorable-risk cytogenetics, and NPM1 mutation. Patients with GATA2 mutation had significantly better overall survival and relapse-free survival than those without GATA2 mutation. Sequential analysis showed that the original GATA2 mutations might be lost during disease progression in GATA2-mutated patients, while novel GATA2 mutations might be acquired at relapse in GATA2-wild patients. In conclusion, AML patients with GATA2 mutations had distinct clinic-biological features and a favorable prognosis. GATA2 mutations might be lost or acquired at disease progression, implying that it was a second hit in the leukemogenesis of AML, especially those with CEBPA mutation.

High Mutation Levels are Compatible with Normal Embryonic Development in Mlh1-Deficient Mice.

PubMed

Fan, Xiaoyan; Li, Yan; Zhang, Yulong; Sang, Meixiang; Cai, Jianhui; Li, Qiaoxia; Ozaki, Toshinori; Ono, Tetsuya; He, Dongwei

2016-10-01

To elucidate the role of the mismatch repair gene Mlh1 in genome instability during the fetal stage, spontaneous mutations were studied in Mlh1-deficient lacZ-transgenic mouse fetuses. Mutation levels were high at 9.5 days post coitum (dpc) and gradually increased during the embryonic stage, after which they remained unchanged. In addition, mutations that were found in brain, liver, spleen, small intestine and thymus showed similar levels and no statistically significant difference was found. The molecular nature of mutations at 12.5 dpc in fetuses of Mlh1 +/+ and Mlh1 -/- mice showed their own unique spectra, suggesting that deletion mutations were the main causes in the deficiency of the Mlh1 gene. Of note, fetuses of irradiated mice exhibited marked differences such as post-implantation loss and Mendelian distribution. Collectively, these results strongly suggest that high mutation ofMlh1 -/- -deficient fetuses has little effect on the fetuses during their early developmental stages, whereas Mlh1 -/- -deficient fetuses from X-ray irradiated mothers are clearly effected.

Predicted Mutation Strength of Nontruncating PKD1 Mutations Aids Genotype-Phenotype Correlations in Autosomal Dominant Polycystic Kidney Disease.

PubMed

Heyer, Christina M; Sundsbak, Jamie L; Abebe, Kaleab Z; Chapman, Arlene B; Torres, Vicente E; Grantham, Jared J; Bae, Kyongtae T; Schrier, Robert W; Perrone, Ronald D; Braun, William E; Steinman, Theodore I; Mrug, Michal; Yu, Alan S L; Brosnahan, Godela; Hopp, Katharina; Irazabal, Maria V; Bennett, William M; Flessner, Michael F; Moore, Charity G; Landsittel, Douglas; Harris, Peter C

2016-09-01

Autosomal dominant polycystic kidney disease (ADPKD) often results in ESRD but with a highly variable course. Mutations to PKD1 or PKD2 cause ADPKD; both loci have high levels of allelic heterogeneity. We evaluated genotype-phenotype correlations in 1119 patients (945 families) from the HALT Progression of PKD Study and the Consortium of Radiologic Imaging Study of PKD Study. The population was defined as: 77.7% PKD1, 14.7% PKD2, and 7.6% with no mutation detected (NMD). Phenotypic end points were sex, eGFR, height-adjusted total kidney volume (htTKV), and liver cyst volume. Analysis of the eGFR and htTKV measures showed that the PKD1 group had more severe disease than the PKD2 group, whereas the NMD group had a PKD2-like phenotype. In both the PKD1 and PKD2 populations, men had more severe renal disease, but women had larger liver cyst volumes. Compared with nontruncating PKD1 mutations, truncating PKD1 mutations associated with lower eGFR, but the mutation groups were not differentiated by htTKV. PKD1 nontruncating mutations were evaluated for conservation and chemical change and subdivided into strong (mutation strength group 2 [MSG2]) and weak (MSG3) mutation groups. Analysis of eGFR and htTKV measures showed that patients with MSG3 but not MSG2 mutations had significantly milder disease than patients with truncating cases (MSG1), an association especially evident in extreme decile populations. Overall, we have quantified the contribution of genic and PKD1 allelic effects and sex to the ADPKD phenotype. Intrafamilial correlation analysis showed that other factors shared by families influence htTKV, with these additional genetic/environmental factors significantly affecting the ADPKD phenotype. Copyright © 2016 by the American Society of Nephrology.

Loss of GATA-1 Full Length as a Cause of Diamond–Blackfan Anemia Phenotype

PubMed Central

Parrella, Sara; Aspesi, Anna; Quarello, Paola; Garelli, Emanuela; Pavesi, Elisa; Carando, Adriana; Nardi, Margherita; Ellis, Steven R.; Ramenghi, Ugo; Dianzani, Irma

2015-01-01

Mutations in the hematopoietic transcription factor GATA-1 alter the proliferation/differentiation of hemopoietic progenitors. Mutations in exon 2 interfere with the synthesis of the full-length isoform of GATA-1 and lead to the production of a shortened isoform, GATA-1s. These mutations have been found in patients with Diamond–Blackfan anemia (DBA), a congenital erythroid aplasia typically caused by mutations in genes encoding ribosomal proteins. We sequenced GATA-1 in 23 patients that were negative for mutations in the most frequently mutated DBA genes. One patient showed a c.2T > C mutation in the initiation codon leading to the loss of the full-length GATA-1 isoform. PMID:24453067

Autosomal dominant optic neuropathy and sensorineual hearing loss associated with a novel mutation of WFS1

PubMed Central

Pennings, Ronald J.E.; Hol, Frans A.; Kunst, Henricus P.M.; Hoefsloot, Elisabeth H.; Cruysberg, Johannes R.M.; Cremers, Cor W.R.J.

2010-01-01

Purpose To describe the phenotype of a novel Wolframin (WFS1) mutation in a family with autosomal dominant optic neuropathy and deafness. The study is designed as a retrospective observational case series. Methods Seven members of a Dutch family underwent ophthalmological, otological, and genetical examinations in one institution. Fasting serum glucose was assessed in the affected family members. Results All affected individuals showed loss of neuroretinal rim of the optic nerve at fundoscopy with enlarged blind spots at perimetry. They showed a red-green color vision defect at color vision tests and deviations at visually evoked response tests. The audiograms of the affected individuals showed hearing loss and were relatively flat. The unaffected individuals showed no visual deviations or hearing impairment. The affected family members had no glucose intolerance. Leber hereditary optic neuropathy (LHON) mitochondrial mutations and mutations in the Optic atrophy-1 gene (OPA1) were excluded. In the affected individuals, a novel missense mutation c.2508G>C (p.Lys836Asn) in exon 8 of WFS1 was identified. Conclusions This study describes the phenotype of a family with autosomal dominant optic neuropathy and hearing impairment associated with a novel missense mutation in WFS1. PMID:20069065

Detection of Activating Estrogen Receptor Gene (ESR1) Mutations in Single Circulating Tumor Cells.

PubMed

Paolillo, Carmela; Mu, Zhaomei; Rossi, Giovanna; Schiewer, Matthew J; Nguyen, Thomas; Austin, Laura; Capoluongo, Ettore; Knudsen, Karen; Cristofanilli, Massimo; Fortina, Paolo

2017-10-15

Purpose: Early detection is essential for treatment plans before onset of metastatic disease. Our purpose was to demonstrate feasibility to detect and monitor estrogen receptor 1 ( ESR1 ) gene mutations at the single circulating tumor cell (CTC) level in metastatic breast cancer (MBC). Experimental Design: We used a CTC molecular characterization approach to investigate heterogeneity of 14 hotspot mutations in ESR1 and their correlation with endocrine resistance. Combining the CellSearch and DEPArray technologies allowed recovery of 71 single CTCs and 12 WBC from 3 ER-positive MBC patients. Forty CTCs and 12 WBC were subjected to whole genome amplification by MALBAC and Sanger sequencing. Results: Among 3 selected patients, 2 had an ESR1 mutation (Y537). One showed two different ESR1 variants in a single CTC and another showed loss of heterozygosity. All mutations were detected in matched cell-free DNA (cfDNA). Furthermore, one had 2 serial blood samples analyzed and showed changes in both cfDNA and CTCs with emergence of mutations in ESR1 (Y537S and T570I), which has not been reported previously. Conclusions: CTCs are easily accessible biomarkers to monitor and better personalize management of patients with previously demonstrated ER-MBC who are progressing on endocrine therapy. We showed that single CTC analysis can yield important information on clonal heterogeneity and can be a source of discovery of novel and potential driver mutations. Finally, we also validate a workflow for liquid biopsy that will facilitate early detection of ESR1 mutations, the emergence of endocrine resistance and the choice of further target therapy. Clin Cancer Res; 23(20); 6086-93. ©2017 AACR . ©2017 American Association for Cancer Research.

Mutation analysis of the APC gene in Taiwanese FAP families: low incidence of APC germline mutation in a distinct subgroup of FAP families.

PubMed

Chiang, J M; Chen, H W; Tang, R P; Chen, J S; Changchien, C R; Hsieh, P S; Wang, J Y

2010-06-01

Familial adenomatous polyposis (FAP) is an autosomal-dominant disease caused by germline mutations in the adenomatous polyposis coli (APC) gene. The affected individuals develop colorectal polyposis and show various extra-colonic manifestations. In this study, we aimed to investigate the genetic and clinical characteristics of FAP in Taiwanese families and analyze the genotype-phenotype correlations. Blood samples were obtained from 66 FAP patients registered in the hereditary colorectal cancer database. Then, germline mutations in the APC genes of these 66 polyposis patients from 47 unrelated FAP families were analyzed. The germline-mutation-negative cases were analyzed by performing multiplex ligation-dependent probe amplification (MLPA) and single-strand conformation polymorphism (SSCP) analysis of the MUTYH gene. Among the analyzed families, 79% (37/47) of the families showed 28 APC mutations, including 19 frameshift mutations, 4 nonsense mutations, 3 genomic deletion mutations, 1 missense mutation, and 1 splice-site mutation. In addition, we identified 15 novel mutations in 32% (15/47) of the families. The cases in which APC mutations were not identified showed significantly lower incidence of profuse polyposis (P = 0.034) and gastroduodenal polyps (P = 0.027). Furthermore, FAP families in which some affected individuals had less than 100 polyps showed significant association with low incidence of APC germline mutations (P = 0.002). We have added the APC germline-mutation data for Taiwanese FAP patients and indicated the presence of an FAP subgroup comprising affected individuals with nonadenomatous polyps or less than 100 adenomatous polyps; this form of FAP is less frequently caused by germline mutations of the APC gene.

Search for Novel Candidate Mutations for Metronidazole Resistance in Helicobacter pylori Using Next-Generation Sequencing

PubMed Central

Binh, Tran Thanh; Suzuki, Rumiko; Trang, Tran Thi Huyen; Kwon, Dong Hyeon

2015-01-01

Metronidazole resistance is a key factor associated with Helicobacter pylori treatment failure. Although this resistance is mainly associated with mutations in the rdxA and frxA genes, the question of whether metronidazole resistance is caused by the inactivation of frxA alone is still debated. Furthermore, it is unclear whether there are other mutations involved in addition to the two genes that are associated with resistance. A metronidazole-resistant strain was cultured from the metronidazole-susceptible H. pylori strain 26695-1 by exposure to low concentrations of metronidazole. The genome sequences of both susceptible and resistant H. pylori strains were determined by Illumina next-generation sequencing, from which putative candidate resistance mutations were identified. Natural transformation was used to introduce PCR products containing candidate mutations into the susceptible parent strain 26695-1, and the metronidazole MIC was determined for each strain. Mutations in frxA (hp0642), rdxA (hp0954), and rpsU (hp0562) were confirmed by the Sanger method. The mutated sequence in rdxA was successfully transformed into strain 26695-1, and the transformants showed resistance to metronidazole. The transformants containing a single mutation in rdxA showed a low MIC (16 mg/liter), while those containing mutations in both rdxA and frxA showed a higher MIC (48 mg/liter). No transformants containing a single mutation in frxA or rpsU were obtained. Next-generation sequencing was used to identify mutations related to drug resistance. We confirmed that the mutations in rdxA are mainly associated with metronidazole resistance, and mutations in frxA are able to enhance H. pylori resistance only in the presence of rdxA mutations. Moreover, mutations in rpsU may play a role in metronidazole resistance. PMID:25645832

Ovarian Tumors related to Intronic Mutations in DICER1: A Report from the International Ovarian and Testicular Stromal Tumor Registry

PubMed Central

Schultz, Kris Ann; Harris, Anne; Messinger, Yoav; Sencer, Susan; Baldinger, Shari; Dehner, Louis P.; Hill, D. Ashley

2015-01-01

Germline DICER1 mutations have been described in individuals with pleuropulmonary blastoma (PPB), ovarian Sertoli-Leydig cell tumor (SLCT), sarcomas, multinodular goiter, thyroid carcinoma, cystic nephroma and other neoplastic conditions. Early results from the International Ovarian and Testicular Stromal Tumor Registry show germline DICER1 mutations in 48% of girls and women with SLCT. In this report, a young woman presented with ovarian undifferentiated sarcoma. Four years later, she presented with SLCT. She was successfully treated for both malignancies. Sequence results showed a germline intronic mutation in DICER1. This mutation results in an exact duplication of the six bases at the splice site at the intron 23 and exon 24 junction. Predicted improper splicing leads to inclusion of 10 bases of intronic sequence, frameshift and premature truncation of the protein disrupting the RNase IIIb domain. A second individual with SLCT was found to have an identical germline mutation. In each of the ovarian tumors, an additional somatic mutation in the RNase IIIb domain of DICER1 was found. In rare patients, germline intronic mutations in DICER1 that are predicted to cause incorrect splicing can also contribute to the pathogenesis of SLCT. PMID:26289771

X-linked Charcot-Marie-Tooth (CMT) neuropathies (CMTX1, CMTX2, CMTX3) show different clinical phenotype and molecular genetics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ionasescu, V.V.; Searby, C.C.; Ionasescu, R.

1994-09-01

The purpose of this study was to compare the X-linked dominant type CMTX1 (20 families) with X-linked recessive types CMTX2 and CMTX3 (2 families). The clinical phenotype was consistent with CMT peripheral neuropathy in all cases including distal weakness, atrophy and sensory loss, pes cavus and areflexia. Additional clinicial involvement of the central nervous system was present in one family with CMTX2 (mental retardation) and one family with CMTX3 (spastic paraparesis). Tight genetic linkage to Xq13.1 was present in 20 families with CMTX1 (Z=34.07 at {theta}=0) for the marker DXS453. Fifteen of the CMTX1 families showed point mutations of themore » connexin 32 coding region (5 nonsense mutations, 8 missense mutations, 2 deletions). Five CMTX1 neuropathy families showed no evidence of point mutations of the CX32 coding sequence. These findings suggest that the CMTX1 neuropathy genotype in these families may be the result of promoter mutations, 3{prime}-untranslated region mutations or exon/intron splice site mutations or a mutation with a different type of connexin but which has close structural similarities to CX32. No mutations of the CX32 coding region were found in the CMTX2 or CMTX3 families. Linkage to Xq13.1 was excluded in both families. Genetic linkage to Xp22.2 was present in the CMTX2 family (Z=3.54 at {theta}=0) for the markers DXS987 and DXS999. Suggestion of linkage to Xq26 (Z=1.81 at {theta}=0) for the marker DXS86 was present in the CMTX3 family.« less

New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.

PubMed

Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C

2001-05-04

The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.

Comparison of next-generation sequencing mutation profiling with BRAF and IDH1 mutation-specific immunohistochemistry.

PubMed

Jabbar, Kausar J; Luthra, Rajalakshmi; Patel, Keyur P; Singh, Rajesh R; Goswami, Rashmi; Aldape, Ken D; Medeiros, L Jeffrey; Routbort, Mark J

2015-04-01

Mutation-specific antibodies for BRAF V600E and IDH1 R132H offer convenient immunohistochemical (IHC) assays to detect these mutations in tumors. Previous studies using these antibodies have shown high sensitivity and specificity, but use in routine diagnosis with qualitative assessment has not been well studied. In this retrospective study, we reviewed BRAF and IDH1 mutation-specific IHC results compared with separately obtained clinical next-generation sequencing results. For 67 tumors with combined IDH1 IHC and mutation data, IHC was unequivocally reported as positive or negative in all cases. Sensitivity of IHC for IDH1 R132H was 98% and specificity was 100% compared with mutation status. Four IHC-negative samples showed non-R132H IDH1 mutations including R132C, R132G, and P127T. For 128 tumors with combined BRAF IHC and mutation data, IHC was positive in 33, negative in 82, and equivocal in 13 tumors. The sensitivity of IHC was 97% and specificity was 99% when including only unequivocally positive or negative results. If equivocal IHC cases were included in the analysis as negative, sensitivity fell to 81%. If equivocal cases were classified as positive, specificity dropped to 91%. Eight IHC-negative samples showed non-V600E BRAF mutations including V600K, N581I, V600M, and K601E. We conclude that IHC for BRAF V600E and IDH1 R132H is relatively sensitive and specific, but there is a discordance rate that is not trivial. In addition, a significant proportion of patients harbor BRAF non-V600E or IDH1 non-R132H mutations not detectable by IHC, potentially limiting utility of IHC screening for BRAF and IDH1 mutations.

Naturally Occurring Mutations in the MPS1 Gene Predispose Cells to Kinase Inhibitor Drug Resistance.

PubMed

Gurden, Mark D; Westwood, Isaac M; Faisal, Amir; Naud, Sébastien; Cheung, Kwai-Ming J; McAndrew, Craig; Wood, Amy; Schmitt, Jessica; Boxall, Kathy; Mak, Grace; Workman, Paul; Burke, Rosemary; Hoelder, Swen; Blagg, Julian; Van Montfort, Rob L M; Linardopoulos, Spiros

2015-08-15

Acquired resistance to therapy is perhaps the greatest challenge to effective clinical management of cancer. With several inhibitors of the mitotic checkpoint kinase MPS1 in preclinical development, we sought to investigate how resistance against these inhibitors may arise so that mitigation or bypass strategies could be addressed as early as possible. Toward this end, we modeled acquired resistance to the MPS1 inhibitors AZ3146, NMS-P715, and CCT251455, identifying five point mutations in the kinase domain of MPS1 that confer resistance against multiple inhibitors. Structural studies showed how the MPS1 mutants conferred resistance by causing steric hindrance to inhibitor binding. Notably, we show that these mutations occur in nontreated cancer cell lines and primary tumor specimens, and that they also preexist in normal lymphoblast and breast tissues. In a parallel piece of work, we also show that the EGFR p.T790M mutation, the most common mutation conferring resistance to the EGFR inhibitor gefitinib, also preexists in cancer cells and normal tissue. Our results therefore suggest that mutations conferring resistance to targeted therapy occur naturally in normal and malignant cells and these mutations do not arise as a result of the increased mutagenic plasticity of cancer cells. ©2015 American Association for Cancer Research.

PRSS1 and SPINK1 mutations in idiopathic chronic and recurrent acute pancreatitis.

PubMed

Pelaez-Luna, Mario; Robles-Diaz, Guillermo; Canizales-Quinteros, Samuel; Tusié-Luna, Maria T

2014-09-07

To identify gene mutations in PRSS1 and SPINK1 in individuals with early onset idiopathic chronic or recurrent acute pancreatitis. The cationic trypsinogen gene (PRSS1; exons 2 and 3) and the serine protease inhibitor Kazal 1 gene (SPINK1; exon 3) were selectively amplified and sequenced from blood samples of 19 patients admitted to the Pancreas Clinic at our institution with chronic pancreatitis and/or idiopathic recurrent acute pancreatitis that were diagnosed or with onset before age 35. Fifty healthy volunteers served as controls. Whole blood samples were collected and gene specific sequences were amplified by polymerase chain reaction (PCR). All PCR products were subsequently sequenced in order to identify the presence of any mutations. Nineteen patients with pancreatitis (14 males; median age 24 years, range 15-48 years) were included in this study, of which five showed the presence of gene mutations. Direct sequencing results indicated the presence of two previously unidentified mutations in exon 2 of PRSS1 (V39E and N42S) in two patients with recurrent acute pancreatitis. Two cases had the N34S SPINK1 mutation. Analysis of the relatives of one patient homozygous for this mutation showed that five of the six family members carried the N34S SPINK1 mutation. Of these members, three were healthy heterozygous carriers and two were homozygotes (one sibling had diabetes, the other was healthy). Another patient was heterozygous for a novel SPINK1 mutation located on exon 3 (V46D). All members from this patient's family had normal genotypes, indicating that it was a de novo mutation. No mutations in either gene were present in the control subjects. Two novel PRSS1 mutations and one novel SPINK1 mutation were identified in Mexican patients with early onset idiopathic recurrent acute pancreatitis.

Chemosensitivity of BRCA1-Mutated Ovarian Cancer Cells and Established Cytotoxic Agents.

PubMed

van Haaften, Caroline; van Eendenburg, Jaap; Boot, Arnoud; Corver, Willem E; Haans, Lucien; van Wezel, Tom; Trimbos, J Baptist

2017-10-01

Serous adenocarcinomas that arise in patients with inherited mutations in the tumor suppressor genes BRCA1 and BRCA2 are initially well treatable with platinum/paclitaxel. For recurrent disease in patients with BRCA1 or BRCA2 mutations, olaparib treatment is available. To study additional therapeutic regimens, a better understanding of the cellular and molecular mechanisms of the tumors in in vitro models is important. From a high-grade serous ovarian tumor of a BRCA1 mutation carrier, we established 3 distinct cell line subclones, OVCA-TR3.1, -2, and -3. Immunohistochemical characterization, flow cytometric analyses, chemosensitivity, and somatic mutation profiling were performed. The cell lines expressed AE1/AE3, Pax8, WT-1, OC125, estrogen receptor (ER), and p53, comparable to the primary tumor. Synergism could be shown in the combination treatment eremophila-1-(10)-11(13)-dien-12,8β-olide (EPD), with cisplatin, whereas combination with olaparib did not show synergism. Eremophila-1-(10)-11(13)-dien-12,8β-olide, a sesquiterpene lactone, is a novel chemotherapeutic agent. The inherited BRCA1 c.2989_2990dupAA mutation was confirmed in the cell lines. Loss of heterozygosity of BRCA1 was detected in each cell line, as well as a homozygous TP53 c.722C>A mutation. Flow cytometry showed that all cell lines had a distinct DNA index. Three new isogenic ovarian cancer cell lines were developed from a patient with a germ line BRCA1 mutation. Chemosensitivity profiling of the cell lines showed high tolerance for olaparib. Treatment with EPD proved synergistic with cisplatin. The effects of EPD will be further investigated for future clinical efficacy.

Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

PubMed Central

Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

1999-01-01

We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

ASXL1 mutation correction by CRISPR/Cas9 restores gene function in leukemia cells and increases survival in mouse xenografts

PubMed Central

Valletta, Simona; Dolatshad, Hamid; Bartenstein, Matthias; Yip, Bon Ham; Bello, Erica; Gordon, Shanisha; Yu, Yiting; Shaw, Jacqueline; Roy, Swagata; Scifo, Laura; Schuh, Anna; Pellagatti, Andrea; Fulga, Tudor A.; Verma, Amit; Boultwood, Jacqueline

2015-01-01

Recurrent somatic mutations of the epigenetic modifier and tumor suppressor ASXL1 are common in myeloid malignancies, including chronic myeloid leukemia (CML), and are associated with poor clinical outcome. CRISPR/Cas9 has recently emerged as a powerful and versatile genome editing tool for genome engineering in various species. We have used the CRISPR/Cas9 system to correct the ASXL1 homozygous nonsense mutation present in the CML cell line KBM5, which lacks ASXL1 protein expression. CRISPR/Cas9-mediated ASXL1 homozygous correction resulted in protein re-expression with restored normal function, including down-regulation of Polycomb repressive complex 2 target genes. Significantly reduced cell growth and increased myeloid differentiation were observed in ASXL1 mutation-corrected cells, providing new insights into the role of ASXL1 in human myeloid cell differentiation. Mice xenografted with mutation-corrected KBM5 cells showed significantly longer survival than uncorrected xenografts. These results show that the sole correction of a driver mutation in leukemia cells increases survival in vivo in mice. This study provides proof-of-concept for driver gene mutation correction via CRISPR/Cas9 technology in human leukemia cells and presents a strategy to illuminate the impact of oncogenic mutations on cellular function and survival. PMID:26623729

ASXL1 mutation correction by CRISPR/Cas9 restores gene function in leukemia cells and increases survival in mouse xenografts.

PubMed

Valletta, Simona; Dolatshad, Hamid; Bartenstein, Matthias; Yip, Bon Ham; Bello, Erica; Gordon, Shanisha; Yu, Yiting; Shaw, Jacqueline; Roy, Swagata; Scifo, Laura; Schuh, Anna; Pellagatti, Andrea; Fulga, Tudor A; Verma, Amit; Boultwood, Jacqueline

2015-12-29

Recurrent somatic mutations of the epigenetic modifier and tumor suppressor ASXL1 are common in myeloid malignancies, including chronic myeloid leukemia (CML), and are associated with poor clinical outcome. CRISPR/Cas9 has recently emerged as a powerful and versatile genome editing tool for genome engineering in various species. We have used the CRISPR/Cas9 system to correct the ASXL1 homozygous nonsense mutation present in the CML cell line KBM5, which lacks ASXL1 protein expression. CRISPR/Cas9-mediated ASXL1 homozygous correction resulted in protein re-expression with restored normal function, including down-regulation of Polycomb repressive complex 2 target genes. Significantly reduced cell growth and increased myeloid differentiation were observed in ASXL1 mutation-corrected cells, providing new insights into the role of ASXL1 in human myeloid cell differentiation. Mice xenografted with mutation-corrected KBM5 cells showed significantly longer survival than uncorrected xenografts. These results show that the sole correction of a driver mutation in leukemia cells increases survival in vivo in mice. This study provides proof-of-concept for driver gene mutation correction via CRISPR/Cas9 technology in human leukemia cells and presents a strategy to illuminate the impact of oncogenic mutations on cellular function and survival.

A Novel Mutation in OTX2 Causes Combined Pituitary Hormone Deficiency, Bilateral Microphthalmia, and Agenesis of the Left Internal Carotid Artery.

PubMed

Shimada, Aya; Takagi, Masaki; Nagashima, Yuka; Miyai, Kentaro; Hasegawa, Yukihiro

2016-01-01

Mutations in OTX2 cause hypopituitarism, ranging from isolated growth hormone deficiency to combined pituitary hormone deficiency (CPHD), which are commonly detected in association with severe eye abnormalities, including anophthalmia or microphthalmia. Pituitary phenotypes of OTX2 mutation carriers are highly variable; however, ACTH deficiency during the neonatal period is not common in previous reports. We report a novel missense OTX2 (R89P) mutation in a CPHD patient with severe hypoglycemia in the neonatal period due to ACTH deficiency, bilateral microphthalmia, and agenesis of the left internal carotid artery (ICA). We identified a novel heterozygous mutation in OTX2 (c.266G>C, p.R89P). R89P OTX2 showed markedly reduced transcriptional activity of HESX1 and POU1F1 reporters compared with wild-type OTX2. A dominant negative effect was noted only in the transcription analysis with POU1F1 promoter. Electrophoretic mobility shift assay experiments showed that R89P OTX2 abrogated DNA-binding ability. OTX2 mutations can cause ACTH deficiency in the neonatal period. Our study also shows that OTX2 mutations are associated with agenesis of the ICA. To the best of our knowledge, this is the first report of a transcription factor gene mutation, which was identified due to agenesis of the ICA of a patient with CPHD. This study extends our understanding of the phenotypic features, molecular mechanism, and developmental course associated with mutations in OTX2. © 2016 S. Karger AG, Basel.

Viremia and HIV-1 Drug Resistance Mutations Among Patients Receiving Second-Line Highly Active Antiretroviral Therapy in Chennai, Southern India

PubMed Central

Vidya, Madhavan; Balakrishnan, Pachamuthu; Kantor, Rami; Solomon, Sunil S.; Katzenstein, David; Kumarasamy, Nagalingeswaran; Yeptomi, Tokugha; Sivamalar, Sathasivam; Rifkin, Samara; Mayer, Kenneth H.; Solomon, Suniti

2012-01-01

Background. A cross-sectional study among individuals receiving second-line antiretroviral treatment was conducted to report on the level of detectable viremia and the types of drug resistance mutations among those with detectable human immunodeficiency virus (HIV) type 1 plasma viral loads (PVLs). Methods. PVLs were measured using Abbott m2000rt real-time polymerase chain reaction, and genotyping was performed with the ViroSeq genotyping system, version 2.0, and ViroSeq analysis software, version 2.8. Results. Of 107 patient plasma specimens consecutively analyzed, 30 (28%) had undetectable PVLs (<150 copies/mL), and 77 (72%) were viremic with a median PVL of 5450 copies/mL (interquartile range, 169–1 997 967). Sequencing was done for 107 samples with PVLs >2000 copies/mL: 33 patients (73%) had 1 of the protease (PR) inhibitor mutations; 41 (91%) had nucleoside reverse-transcriptase inhibitor (NRTI) mutations; 33 (73%) had non-NRTI (NNRTI) mutations; and 30 (66.7%) had both NRTI and NNRTI mutations. Triple-class resistance to NRTIs, NNRTIs, and PR inhibitors was observed in 24 (53%) patients. Based on the mutational profiles observed, all 45 sequences were susceptible to darunavir and tipranavir, whereas 47% showed resistance to lopinavir, 58% showed resistance to atazanavir, and >60% showed resistance to saquinavir, indinavir, nelfinavir, and fosamprenavir. Conclusions. The results of the study showed that the majority of patients receiving second-line antiretroviral therapy started to accumulate PR resistance mutations, and the mutation profiles suggest that darunavir might be the drug of choice for third-line regimens in India. PMID:22323567

Therapeutic benefits of ACTH and levetiracetam in STXBP1 encephalopathy with a de novo mutation: A case report and literature review.

PubMed

Liu, Shunli; Wang, Liyuan; Cai, Xiao Tang; Zhou, Hui; Yu, Dan; Wang, Zhiling

2018-05-01

The case report aims to discuss the clinical symptoms and treatment of encephalopathy caused by a novel syntaxin- binding protein 1 (STXBP1) genetic mutation. The patient, a girl, was born at 38+4 weeks of gestation. She had frequent spasm attacks accompanied by obvious psychomotor development retardation since the neonatal period. Genetic screening identified a novel STXBP1 genetic mutation. Early-onset epileptic encephalopathy with STXBP1 mutation. We adjusted the antiepileptic strategy to oral levetiracetam and topiramate, and intravenous administration of adrenocorticotropic hormone(ACTH) for 2 weeks. Subsequently, prednisone was continued, and gradually reduced and withdrawn over 3 months. The treatment was effective with complete control of the epileptic seizures and improvements in the electroencephalogram readings. However, the effects on psychomotor ability were slow and limited. A literature review of STXBP1 mutation cases in which ACTH was administered showed that complete seizure control is observed in 60% of cases, 20% are partially affected, and the remaining 20% show no effect. ACTH and levetiracetam had good therapeutic effects in epilepsy control in this case of de novo STXBP1 mutation. ACTH is an effective drug for early-onset epileptic encephalopathy caused by STXBP1 mutation. However, controlling epilepsy using this therapy does not alter the psychomotor development retardation caused by the STXBP1 mutation.

Extensive Variation in the Mutation Rate Between and Within Human Genes Associated with Mendelian Disease.

PubMed

Smith, Thomas; Ho, Gladys; Christodoulou, John; Price, Elizabeth Ann; Onadim, Zerrin; Gauthier-Villars, Marion; Dehainault, Catherine; Houdayer, Claude; Parfait, Beatrice; van Minkelen, Rick; Lohman, Dietmar; Eyre-Walker, Adam

2016-05-01

We have investigated whether the mutation rate varies between genes and sites using de novo mutations (DNMs) from three genes associated with Mendelian diseases (RB1, NF1, and MECP2). We show that the relative frequency of mutations at CpG dinucleotides relative to non-CpG sites varies between genes and relative to the genomic average. In particular we show that the rate of transition mutation at CpG sites relative to the rate of non-CpG transversion is substantially higher in our disease genes than amongst DNMs in general; the rate of CpG transition can be several hundred-fold greater than the rate of non-CpG transversion. We also show that the mutation rate varies significantly between sites of a particular mutational type, such as non-CpG transversion, within a gene. We estimate that for all categories of sites, except CpG transitions, there is at least a 30-fold difference in the mutation rate between the 10% of sites with the highest and lowest mutation rates. However, our best estimate is that the mutation rate varies by several hundred-fold variation. We suggest that the presence of hypermutable sites may be one reason certain genes are associated with disease. © 2016 WILEY PERIODICALS, INC.

Dominant Mutations in S. cerevisiae PMS1 Identify the Mlh1-Pms1 Endonuclease Active Site and an Exonuclease 1-Independent Mismatch Repair Pathway

PubMed Central

Smith, Catherine E.; Mendillo, Marc L.; Bowen, Nikki; Hombauer, Hans; Campbell, Christopher S.; Desai, Arshad; Putnam, Christopher D.; Kolodner, Richard D.

2013-01-01

Lynch syndrome (hereditary nonpolypsis colorectal cancer or HNPCC) is a common cancer predisposition syndrome. Predisposition to cancer in this syndrome results from increased accumulation of mutations due to defective mismatch repair (MMR) caused by a mutation in one of the mismatch repair genes MLH1, MSH2, MSH6 or PMS2/scPMS1. To better understand the function of Mlh1-Pms1 in MMR, we used Saccharomyces cerevisiae to identify six pms1 mutations (pms1-G683E, pms1-C817R, pms1-C848S, pms1-H850R, pms1-H703A and pms1-E707A) that were weakly dominant in wild-type cells, which surprisingly caused a strong MMR defect when present on low copy plasmids in an exo1Δ mutant. Molecular modeling showed these mutations caused amino acid substitutions in the metal coordination pocket of the Pms1 endonuclease active site and biochemical studies showed that they inactivated the endonuclease activity. This model of Mlh1-Pms1 suggested that the Mlh1-FERC motif contributes to the endonuclease active site. Consistent with this, the mlh1-E767stp mutation caused both MMR and endonuclease defects similar to those caused by the dominant pms1 mutations whereas mutations affecting the predicted metal coordinating residue Mlh1-C769 had no effect. These studies establish that the Mlh1-Pms1 endonuclease is required for MMR in a previously uncharacterized Exo1-independent MMR pathway. PMID:24204293

Dominant mutations in S. cerevisiae PMS1 identify the Mlh1-Pms1 endonuclease active site and an exonuclease 1-independent mismatch repair pathway.

PubMed

Smith, Catherine E; Mendillo, Marc L; Bowen, Nikki; Hombauer, Hans; Campbell, Christopher S; Desai, Arshad; Putnam, Christopher D; Kolodner, Richard D

2013-10-01

Lynch syndrome (hereditary nonpolypsis colorectal cancer or HNPCC) is a common cancer predisposition syndrome. Predisposition to cancer in this syndrome results from increased accumulation of mutations due to defective mismatch repair (MMR) caused by a mutation in one of the mismatch repair genes MLH1, MSH2, MSH6 or PMS2/scPMS1. To better understand the function of Mlh1-Pms1 in MMR, we used Saccharomyces cerevisiae to identify six pms1 mutations (pms1-G683E, pms1-C817R, pms1-C848S, pms1-H850R, pms1-H703A and pms1-E707A) that were weakly dominant in wild-type cells, which surprisingly caused a strong MMR defect when present on low copy plasmids in an exo1Δ mutant. Molecular modeling showed these mutations caused amino acid substitutions in the metal coordination pocket of the Pms1 endonuclease active site and biochemical studies showed that they inactivated the endonuclease activity. This model of Mlh1-Pms1 suggested that the Mlh1-FERC motif contributes to the endonuclease active site. Consistent with this, the mlh1-E767stp mutation caused both MMR and endonuclease defects similar to those caused by the dominant pms1 mutations whereas mutations affecting the predicted metal coordinating residue Mlh1-C769 had no effect. These studies establish that the Mlh1-Pms1 endonuclease is required for MMR in a previously uncharacterized Exo1-independent MMR pathway.

A systematic comparison of all mutations in hereditary sensory neuropathy type I (HSAN I) reveals that the G387A mutation is not disease associated.

PubMed

Hornemann, Thorsten; Penno, Anke; Richard, Stephane; Nicholson, Garth; van Dijk, Fleur S; Rotthier, Annelies; Timmerman, Vincent; von Eckardstein, Arnold

2009-04-01

Hereditary sensory neuropathy type 1 (HSAN I) is an autosomal dominant inherited neurodegenerative disorder of the peripheral nervous system associated with mutations in the SPTLC1 subunit of the serine palmitoyltransferase (SPT). Four missense mutations (C133W, C133Y, V144D and G387A) in SPTLC1 were reported to cause HSAN I. SPT catalyses the condensation of Serine and Palmitoyl-CoA, which is the first and rate-limiting step in the de novo synthesis of ceramides. Earlier studies showed that C133W and C133Y mutants have a reduced activity, whereas the impact of the V144D and G387A mutations on the human enzyme was not tested yet. In this paper, we show that none of the HSAN I mutations interferes with SPT complex formation. We demonstrate that also V144D has a reduced SPT activity, however to a lower extent than C133W and C133Y. In contrast, the G387A mutation showed no influence on SPT activity. Furthermore, the growth phenotype of LY-B cells--a SPTLC1 deficient CHO cell line--could be reversed by expressing either the wild-type SPTLC1 or the G387A mutant, but not the C133W mutant. This indicates that the G387A mutation is most likely not directly associated with HSAN I. These findings were genetically confirmed by the identification of a nuclear HSAN family which showed segregation of the G387A variant as a non-synonymous SNP.

Human NR5A1/SF-1 Mutations Show Decreased Activity on BDNF (Brain-Derived Neurotrophic Factor), an Important Regulator of Energy Balance: Testing Impact of Novel SF-1 Mutations Beyond Steroidogenesis

PubMed Central

Malikova, Jana; Camats, Núria; Fernández-Cancio, Mónica; Heath, Karen; González, Isabel; Caimarí, María; del Campo, Miguel; Albisu, Marian; Kolouskova, Stanislava; Audí, Laura; Flück, Christa E.

2014-01-01

Context Human NR5A1/SF-1 mutations cause 46,XY disorder of sex development (DSD) with broad phenotypic variability, and rarely cause adrenal insufficiency although SF-1 is an important transcription factor for many genes involved in steroidogenesis. In addition, the Sf-1 knockout mouse develops obesity with age. Obesity might be mediated through Sf-1 regulating activity of brain-derived neurotrophic factor (BDNF), an important regulator of energy balance in the ventromedial hypothalamus. Objective To characterize novel SF-1 gene variants in 4 families, clinical, genetic and functional studies were performed with respect to steroidogenesis and energy balance. Patients 5 patients with 46,XY DSD were found to harbor NR5A1/SF-1 mutations including 2 novel variations. One patient harboring a novel mutation also suffered from adrenal insufficiency. Methods SF-1 mutations were studied in cell systems (HEK293, JEG3) for impact on transcription of genes involved in steroidogenesis (CYP11A1, CYP17A1, HSD3B2) and in energy balance (BDNF). BDNF regulation by SF-1 was studied by promoter assays (JEG3). Results Two novel NR5A1/SF-1 mutations (Glu7Stop, His408Profs*159) were confirmed. Glu7Stop is the 4th reported SF-1 mutation causing DSD and adrenal insufficiency. In vitro studies revealed that transcription of the BDNF gene is regulated by SF-1, and that mutant SF-1 decreased BDNF promoter activation (similar to steroid enzyme promoters). However, clinical data from 16 subjects carrying SF-1 mutations showed normal birth weight and BMI. Conclusions Glu7Stop and His408Profs*159 are novel SF-1 mutations identified in patients with 46,XY DSD and adrenal insufficiency (Glu7Stop). In vitro, SF-1 mutations affect not only steroidogenesis but also transcription of BDNF which is involved in energy balance. However, in contrast to mice, consequences on weight were not found in humans with SF-1 mutations. PMID:25122490

Human NR5A1/SF-1 mutations show decreased activity on BDNF (brain-derived neurotrophic factor), an important regulator of energy balance: testing impact of novel SF-1 mutations beyond steroidogenesis.

PubMed

Malikova, Jana; Camats, Núria; Fernández-Cancio, Mónica; Heath, Karen; González, Isabel; Caimarí, María; del Campo, Miguel; Albisu, Marian; Kolouskova, Stanislava; Audí, Laura; Flück, Christa E

2014-01-01

Human NR5A1/SF-1 mutations cause 46,XY disorder of sex development (DSD) with broad phenotypic variability, and rarely cause adrenal insufficiency although SF-1 is an important transcription factor for many genes involved in steroidogenesis. In addition, the Sf-1 knockout mouse develops obesity with age. Obesity might be mediated through Sf-1 regulating activity of brain-derived neurotrophic factor (BDNF), an important regulator of energy balance in the ventromedial hypothalamus. To characterize novel SF-1 gene variants in 4 families, clinical, genetic and functional studies were performed with respect to steroidogenesis and energy balance. 5 patients with 46,XY DSD were found to harbor NR5A1/SF-1 mutations including 2 novel variations. One patient harboring a novel mutation also suffered from adrenal insufficiency. SF-1 mutations were studied in cell systems (HEK293, JEG3) for impact on transcription of genes involved in steroidogenesis (CYP11A1, CYP17A1, HSD3B2) and in energy balance (BDNF). BDNF regulation by SF-1 was studied by promoter assays (JEG3). Two novel NR5A1/SF-1 mutations (Glu7Stop, His408Profs*159) were confirmed. Glu7Stop is the 4th reported SF-1 mutation causing DSD and adrenal insufficiency. In vitro studies revealed that transcription of the BDNF gene is regulated by SF-1, and that mutant SF-1 decreased BDNF promoter activation (similar to steroid enzyme promoters). However, clinical data from 16 subjects carrying SF-1 mutations showed normal birth weight and BMI. Glu7Stop and His408Profs*159 are novel SF-1 mutations identified in patients with 46,XY DSD and adrenal insufficiency (Glu7Stop). In vitro, SF-1 mutations affect not only steroidogenesis but also transcription of BDNF which is involved in energy balance. However, in contrast to mice, consequences on weight were not found in humans with SF-1 mutations.

BRF1 mutations alter RNA polymerase III–dependent transcription and cause neurodevelopmental anomalies

PubMed Central

Hög, Friederike; Dentici, Maria Lisa; Tan, Perciliz L.; Sowada, Nadine; Medeira, Ana; Gueneau, Lucie; Thiele, Holger; Kousi, Maria; Lepri, Francesca; Wenzeck, Larissa; Blumenthal, Ian; Radicioni, Antonio; Schwarzenberg, Tito Livio; Mandriani, Barbara; Fischetto, Rita; Morris-Rosendahl, Deborah J.; Altmüller, Janine; Reymond, Alexandre; Nürnberg, Peter; Merla, Giuseppe; Dallapiccola, Bruno; Katsanis, Nicholas; Cramer, Patrick; Kubisch, Christian

2015-01-01

RNA polymerase III (Pol III) synthesizes tRNAs and other small noncoding RNAs to regulate protein synthesis. Dysregulation of Pol III transcription has been linked to cancer, and germline mutations in genes encoding Pol III subunits or tRNA processing factors cause neurogenetic disorders in humans, such as hypomyelinating leukodystrophies and pontocerebellar hypoplasia. Here we describe an autosomal recessive disorder characterized by cerebellar hypoplasia and intellectual disability, as well as facial dysmorphic features, short stature, microcephaly, and dental anomalies. Whole-exome sequencing revealed biallelic missense alterations of BRF1 in three families. In support of the pathogenic potential of the discovered alleles, suppression or CRISPR-mediated deletion of brf1 in zebrafish embryos recapitulated key neurodevelopmental phenotypes; in vivo complementation showed all four candidate mutations to be pathogenic in an apparent isoform-specific context. BRF1 associates with BDP1 and TBP to form the transcription factor IIIB (TFIIIB), which recruits Pol III to target genes. We show that disease-causing mutations reduce Brf1 occupancy at tRNA target genes in Saccharomyces cerevisiae and impair cell growth. Moreover, BRF1 mutations reduce Pol III–related transcription activity in vitro. Taken together, our data show that BRF1 mutations that reduce protein activity cause neurodevelopmental anomalies, suggesting that BRF1-mediated Pol III transcription is required for normal cerebellar and cognitive development. PMID:25561519

Tandem duplication within a Neurofibromatosis type I (NFI) gene exon in a family with features of Watson syndrome and Noonan syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tassabehji, M.; Strachan, T.; Colley, A.

Type 1 neurofibromatosis (NF1), Watson syndrome (WS), and Noonan syndrome (NS) show some overlap in clinical manifestations. In addition, WS has been shown to be linked to markers flanking the NF1 locus and a deletion at the NF1 locus demonstrated in a WS patient. This suggests either that WS and NF1 are allelic or the phenotypes arise from mutations in very closely linked genes. Here the authors provide evidence for the former by demonstrating a mutation in the NF1 gene in a family with features of both WS and NS. The mutation is an almost perfect in-frame tandem duplication ofmore » 42 bases in exon 28 of the NF1 gene. Unlike the mutations previously described in classical NF1, which show a preponderance of null alleles, the mutation in this family would be expected to result in a mutant neurofibromin product. 31 refs., 2 figs.« less

BCOR and BCORL1 mutations in myelodysplastic syndromes and related disorders.

PubMed

Damm, Frederik; Chesnais, Virginie; Nagata, Yasunobu; Yoshida, Kenichi; Scourzic, Laurianne; Okuno, Yusuke; Itzykson, Raphael; Sanada, Masashi; Shiraishi, Yuichi; Gelsi-Boyer, Véronique; Renneville, Aline; Miyano, Satoru; Mori, Hiraku; Shih, Lee-Yung; Park, Sophie; Dreyfus, François; Guerci-Bresler, Agnes; Solary, Eric; Rose, Christian; Cheze, Stéphane; Prébet, Thomas; Vey, Norbert; Legentil, Marion; Duffourd, Yannis; de Botton, Stéphane; Preudhomme, Claude; Birnbaum, Daniel; Bernard, Olivier A; Ogawa, Seishi; Fontenay, Michaela; Kosmider, Olivier

2013-10-31

Patients with low-risk myelodysplastic syndromes (MDS) that rapidly progress to acute myeloid leukemia (AML) remain a challenge in disease management. Using whole-exome sequencing of an MDS patient, we identified a somatic mutation in the BCOR gene also mutated in AML. Sequencing of BCOR and related BCORL1 genes in a cohort of 354 MDS patients identified 4.2% and 0.8% of mutations respectively. BCOR mutations were associated with RUNX1 (P = .002) and DNMT3A mutations (P = .015). BCOR is also mutated in chronic myelomonocytic leukemia patients (7.4%) and BCORL1 in AML patients with myelodysplasia-related changes (9.1%). Using deep sequencing, we show that BCOR mutations arise after mutations affecting genes involved in splicing machinery or epigenetic regulation. In univariate analysis, BCOR mutations were associated with poor prognosis in MDS (overall survival [OS]: P = .013; cumulative incidence of AML transformation: P = .005). Multivariate analysis including age, International Prognostic Scoring System, transfusion dependency, and mutational status confirmed a significant inferior OS to patients with a BCOR mutation (hazard ratio, 3.3; 95% confidence interval, 1.4-8.1; P = .008). These data suggest that BCOR mutations define the clinical course rather than disease initiation. Despite infrequent mutations, BCOR analyses should be considered in risk stratification.

Novel mutations in the RB1 gene from Chinese families with a history of retinoblastoma.

PubMed

Zhang, Leilei; Jia, Renbing; Zhao, Junyang; Fan, Jiayan; Zhou, YiXiong; Han, Bing; Song, Xin; Wu, Li; Zhang, He; Song, Huaidong; Ge, Shengfang; Fan, Xianqun

2015-04-01

Retinoblastoma is an aggressive eye cancer that develops during infancy and is divided into two clinical types, sporadic and heritable. RB1 has been identified as the only pathological gene responsible for heritable retinoblastoma. Here, we identified 11 RB1 germline mutations in the Han pedigrees of 17 bilateral retinoblastoma patients from China. Four mutations were nonsense mutations, five were splice site mutations, and two resulted in a frame shift due to an insertion or a deletion. Three of the mutations had not been previously reported, and the p.Q344L mutation occurred in two generations of retinoblastoma patients. We investigated phenotypic-genotypic relationships for the novel mutations and showed that these mutations affected the expression, location, and function of the retinoblastoma protein. Abnormal protein localization was observed after transfection of the mutant genes. In addition, changes in the cell cycle distribution and apoptosis rates were observed when the Saos-2 cell line was transfected with plasmids encoding the mutant RB1 genes. Our findings expand the spectrum of known RB1 mutations and will benefit the investigation of RB1 mutation hotspots. Genetic counseling can be offered to families with heritable RB1 mutations.

Prognostic Implications of Multiplex Detection of KRAS Mutations in Cell-Free DNA from Patients with Pancreatic Ductal Adenocarcinoma.

PubMed

Kim, Min Kyeong; Woo, Sang Myung; Park, Boram; Yoon, Kyong-Ah; Kim, Yun-Hee; Joo, Jungnam; Lee, Woo Jin; Han, Sung-Sik; Park, Sang-Jae; Kong, Sun-Young

2018-04-01

Cell-free DNA (cfDNA) is known to provide potential biomarkers for predicting clinical outcome, but its value in pancreatic ductal adenocarcinoma (PDAC) has not been fully evaluated. The aim of this study was to evaluate the clinical applicability of quantitative analysis of multiplex KRAS mutations in cell-free DNA from patients with PDAC. A total of 106 patients with PDAC were enrolled in this prospective study. The concentration and fraction of KRAS mutations were determined through multiplex detection of KRAS mutations in plasma samples by use of a droplet digital PCR kit (Bio-Rad). KRAS mutations were detected in 96.1% of tissue samples. Eighty patients (80.5%) harbored KRAS mutations in cfDNA, with a median KRAS mutation concentration of 0.165 copies/μL and a median fractional abundance of 0.415%. Multivariable analyses demonstrated that the KRAS mutation concentration [hazard ratio (HR), 2.08; 95% CI, 1.20-3.63] and KRAS fraction (HR, 1.73; 95% CI, 1.02-2.95) were significant factors for progression-free survival. KRAS mutation concentration (HR, 1.97; 95% CI, 1.05-3.67) also had prognostic implications for overall survival. Subgroup analyses showed that KRAS mutation concentration and fractional abundance significantly affected progression-free survival in resectable PDAC ( P = 0.016). Moreover, when combined with the cancer biomarker CA19-9, the KRAS mutation concentration in cfDNA showed additive benefits for the prediction of overall survival. This study demonstrates that multiplex detection of KRAS mutations in plasma cfDNA is clinically relevant, providing a potential candidate biomarker for prognosis of PDAC. © 2018 American Association for Clinical Chemistry.

A KCNQ1 mutation causes age-dependant bradycardia and persistent atrial fibrillation.

PubMed

Ki, Chang-Seok; Jung, Chae Lim; Kim, Hyun-ji; Baek, Kwan-Hyuck; Park, Seung Jung; On, Young Keun; Kim, Ki-Suk; Noh, Su Jin; Youm, Jae Boum; Kim, June Soo; Cho, Hana

2014-03-01

Atrial fibrillation (AF) is the most common arrhythmia. Gain-of-function mutations in KCNQ1, the pore-forming α-subunit of the slow delayed rectifier K current (IKs) channel, have been associated with AF. The purpose of this study was functional assessment of a mutation in KCNQ1 identified in a family with persistent AF and sinus bradycardia. We investigated whether this KCNQ1 missense mutation could form the genetic basis for AF and bradycardia simultaneously in this family. Sanger sequencing in a family with hereditary persistent AF identified a novel KCNQ1 variant (V241F) in a highly conserved region of S4 domain. The proband and her son developed bradycardia and persistent AF in an age-dependent fashion. The other son was a mutation carrier but he showed sinus bradycardia and not AF. Whole-cell patch clamp electrophysiology showed that V241F mutation in KCNQ1 shifted the activation curve to the left and dramatically slowed deactivation, leading to a constitutively open-like phenotype. Computer modeling showed that V241F would slow pacemaker activity. Also, simulations of atrial excitation predicted that V241F results in extreme shortening of action potential duration, possibly resulting in AF. Our study indicates that V241F might cause sinus bradycardia by increasing IKs. Additionally, V241F likely shortens atrial refractoriness to promote a substrate for reentry. KCNQ1 mutations have previously been described in AF, yet this is the first time a mutation in KCNQ1 is associated with age-dependent bradycardia and persistent AF. This finding further supports the hypothesis that sinus node dysfunction contributes to the development of AF.

C1q deficiency: identification of a novel missense mutation and treatment with fresh frozen plasma.

PubMed

Topaloglu, Rezan; Taskiran, Ekim Z; Tan, Cagman; Erman, Baran; Ozaltin, Fatih; Sanal, Ozden

2012-07-01

A Turkish patient with C1q deficiency presented with a lupus-like disease, and a new missense mutation at A chain is presented. To characterize the genetic defect, all exons of the genes for the A, B, and C chains of C1q were sequenced in the patient. This revealed a missense mutation in the collagen-like domain of the A chain, p.Gly31 Arg. No other sequence variants, including the common silent mutations, were found in the three chains. Exon 1 of the C1q A chain was sequenced in 105 samples from healthy controls for this particular mutation. None of these carried the mutation. The C1q-deficient patient was treated with fresh frozen plasma infusions. Our findings showed that Turkish patients may have different mutations than the previously described common mutation, and once again, not only nonsense mutations but also missense mutations cause hereditary C1q deficiency. Regular fresh frozen plasma infusions to the patient have been clinically and therapeutically successful.

Mutation profiling of 16 candidate genes in de novo acute myeloid leukemia patients.

PubMed

Zhang, Yang; Wang, Fang; Chen, Xue; Liu, Wenjing; Fang, Jiancheng; Wang, Mingyu; Teng, Wen; Cao, Panxiang; Liu, Hongxing

2018-05-26

This retrospective analysis aimed to investigate the mutation profile of 16 common mutated genes in de novo acute myeloid leukemia (AML) patients. A total of 259 patients who were diagnosed of de novo AML were enrolled in this study. Mutation profiling of 16 candidate genes were performed in bone marrow samples by using Sanger sequencing.We identified at least 1 mutation in 199 of the 259 samples (76.8%), and 2 or more mutations in 31.7% of samples. FLT3-ITD was the most common mutated gene (16.2%, 42/259), followed by CEBPA (15.1%, 39/259), NRAS (14.7%, 38/259), and NPM1 (13.5%, 35/259). Concurrence was observed in 97.1% of the NPM1 mutated cases and in 29.6% of the double mutated CEBPA cases. Distinct patterns of co-occurrence were observed for different hotspot mutations within the IDH2 gene: R140 mutations were associated with NPM1 and/or FLT3-ITD mutations, whereas R172 mutations co-occurred with DNMT3A mutations only. Concurrence was also observed in 86.6% of epigenetic regulation genes, most of which co-occurred with NPM1 mutations. The results showed certain rules in the mutation profiling and concurrence of AML patients, which was related to the function classification of genes. Defining the mutation spectrum and mutation pattern of AML will contribute to the comprehensive assessment of patients and identification of new therapeutic targets.

Are We Ready to Use ESR1 Mutations in Clinical Practice?

PubMed

Jeselsohn, Rinath

2017-10-01

The recurrent ligand-binding domain ESR1 mutations are an important mechanism of endocrine resistance in estrogen receptor-positive (ER+) metastatic breast cancer. These mutations evolve under the selective pressure of endocrine treatments and are rarely found in treatment-naïve ER+ breast cancers. Preclinical studies showed that these mutations lead to ligand-independent activity facilitating resistance to aromatase inhibitors and relative resistance to tamoxifen and fulvestrant. Retrospective analyses of ESR1 mutations in baseline plasma circulating tumor DNA from clinical trials suggest that these mutations are prognostic of poor overall survival and predictive of resistance to aromatase inhibitors in metastatic disease. Larger datasets and prospective studies to confirm these results are lacking. In addition, response to other standard treatments for metastatic breast cancer in the presence of the ESR1 mutations is unknown, and studies to determine the optimal treatment combinations for patients with ESR1 mutations are also needed.

Ultrasonographic characteristics and BI-RADS-US classification of BRCA1 mutation-associated breast cancer in Guangxi, China.

PubMed

Li, Cheng; Liu, Junjie; Wang, Sida; Chen, Yuanyuan; Yuan, Zhigang; Zeng, Jian; Li, Zhixian

2015-01-01

To retrospectively analyze and compare the ultrasonographic characteristics and BI-RADS-US classification between patients with BRCA1 mutation-associated breast cancer and those without BRCA1 gene mutation in Guangxi, China. The study was performed in 36 lesions from 34 BRCA1 mutation-associated breast cancer patients. A total of 422 lesions from 422 breast cancer patients without BRCA1 mutations served as control group. The comparison of the ultrasonographic features and BI-RADS-US classification between two the groups were reviewed. More complex inner echo was disclosed in BRCA1 mutation-associated breast cancer patients (x(2) = 4.741, P = 0.029). The BI-RADS classification of BRCA1 mutation-associated breast cancer was lower (U = 6094.0, P = 0.022). BRCA1 mutation-associated breast cancer frequently displays as microlobulated margin and complex echo. It also shows more benign characteristics in morphology, and the BI-RADS classification is prone to be underestimated.

Mistranslation can enhance fitness through purging of deleterious mutations

PubMed Central

Bratulic, Sinisa; Toll-Riera, Macarena; Wagner, Andreas

2017-01-01

Phenotypic mutations are amino acid changes caused by mistranslation. How phenotypic mutations affect the adaptive evolution of new protein functions is unknown. Here we evolve the antibiotic resistance protein TEM-1 towards resistance on the antibiotic cefotaxime in an Escherichia coli strain with a high mistranslation rate. TEM-1 populations evolved in such strains endow host cells with a general growth advantage, not only on cefotaxime but also on several other antibiotics that ancestral TEM-1 had been unable to deactivate. High-throughput sequencing of TEM-1 populations shows that this advantage is associated with a lower incidence of weakly deleterious genotypic mutations. Our observations show that mistranslation is not just a source of noise that delays adaptive evolution. It could even facilitate adaptive evolution by exacerbating the effects of deleterious mutations and leading to their more efficient purging. The ubiquity of mistranslation and its effects render mistranslation an important factor in adaptive protein evolution. PMID:28524864

Germline mutations of BRCA1 gene exon 11 are not associated with platinum response neither with survival advantage in patients with primary ovarian cancer: understanding the clinical importance of one of the biggest human exons. A study of the Tumor Bank Ovarian Cancer (TOC) Consortium.

PubMed

Dimitrova, Desislava; Ruscito, Ilary; Olek, Sven; Richter, Rolf; Hellwag, Alexander; Türbachova, Ivana; Woopen, Hannah; Baron, Udo; Braicu, Elena Ioana; Sehouli, Jalid

2016-09-01

Germline mutations in BRCA1 gene have been reported in up to 20 % of epithelial ovarian cancer (EOC) patients. Distinct clinical characteristics have been attributed to this special EOC population. We hypothesized that mutations in different BRCA1 gene exons may differently affect the clinical course of the disease. The aim of this study was to analyze, in a large cohort of primary EOCs, the clinical impact of mutations in BRCA1 gene exon 11, the largest exon of the gene sequence encoding the 60 % of BRCA1 protein. Two hundred sixty-three primary EOC patients, treated between 2000 and 2008 at Charité University Hospital of Berlin, were included. Patients' blood samples were obtained from the Tumor Ovarian Cancer (TOC) Network ( www.toc-network.de ). Direct sequencing of BRCA1 gene exon 11 was performed for each patient to detect mutations. Based on their BRCA1 exon 11 mutational status, patients were compared regarding clinico-pathological variables and survival. Mutations in BRCA1 exon 11 were found in 18 out of 263 patients (6.8 %). Further 10/263 (3.8 %) cases showed variants of uncertain significance (VUS). All exon 11 BRCA1-positive tumors (100 %) were Type 2 ovarian carcinomas (p = 0.05). Age at diagnosis was significantly younger in Type 2 exon 11 mutated patients (p = 0.01). On multivariate analysis, BRCA1 exon 11 mutational status was not found to be an independent predictive factor for optimal cytoreduction, platinum response, or survival. Mutations in BRCA1 gene exon 11 seem to predispose women to exclusively develop a Type 2 ovarian cancer at younger age. Exon 11 BRCA1-mutated EOC patients showed distinct clinico-pathological features but similar clinical outcome with respect to sporadic EOC patients.

A synonymous mutation in TCOF1 causes Treacher Collins syndrome due to mis-splicing of a constitutive exon.

PubMed

Macaya, D; Katsanis, S H; Hefferon, T W; Audlin, S; Mendelsohn, N J; Roggenbuck, J; Cutting, G R

2009-08-01

Interpretation of the pathogenicity of sequence alterations in disease-associated genes is challenging. This is especially true for novel alterations that lack obvious functional consequences. We report here on a patient with Treacher Collins syndrome (TCS) found to carry a previously reported mutation, c.122C > T, which predicts p.A41V, and a novel synonymous mutation, c.3612A > C. Pedigree analysis showed that the c.122C > T mutation segregated with normal phenotypes in multiple family members while the c.3612A > C was de novo in the patient. Analysis of TCOF1 RNA in lymphocytes showed a transcript missing exon 22. These results show that TCS in the patient is due to haploinsufficiency of TCOF1 caused by the synonymous de novo c.3612A > C mutation. This study highlights the importance of clinical and pedigree evaluation in the interpretation of known and novel sequence alterations. 2009 Wiley-Liss, Inc.

Favorable outcome of patients with acute myeloid leukemia harboring a low-allelic burden FLT3-ITD mutation and concomitant NPM1 mutation: relevance to post-remission therapy.

PubMed

Pratcorona, Marta; Brunet, Salut; Nomdedéu, Josep; Ribera, Josep Maria; Tormo, Mar; Duarte, Rafael; Escoda, Lourdes; Guàrdia, Ramon; Queipo de Llano, M Paz; Salamero, Olga; Bargay, Joan; Pedro, Carmen; Martí, Josep Maria; Torrebadell, Montserrat; Díaz-Beyá, Marina; Camós, Mireia; Colomer, Dolors; Hoyos, Montserrat; Sierra, Jorge; Esteve, Jordi

2013-04-04

Risk associated to FLT3 internal tandem duplication (FLT3-ITD) in patients with acute myeloid leukemia (AML) may depend on mutational burden and its interaction with other mutations. We analyzed the effect of FLT3-ITD/FLT3 wild-type (FLT3wt) ratio depending on NPM1 mutation (NPM1mut) in 303 patients with intermediate-risk cytogenetics AML treated with intensive chemotherapy. Among NPM1mut patients, FLT3wt and low ratio (<0.5) subgroups showed similar overall survival, relapse risk, and leukemia-free survival, whereas high ratio (≥0.5) patients had a worse outcome. In NPM1wt AML, FLT3-ITD subgroups showed a comparable outcome, with higher risk of relapse and shortened overall survival than FLT3wt patients. Allogeneic stem cell transplantation in CR1 was associated with a reduced relapse risk in all molecular subgroups with the exception of NPM1mut AML with absent or low ratio FLT3-ITD. In conclusion, effect of FLT3 burden is modulated by NPM1 mutation, especially in patients with a low ratio.

A missense mutation in Fgfr1 causes ear and skull defects in hush puppy mice.

PubMed

Calvert, Jennifer A; Dedos, Skarlatos G; Hawker, Kelvin; Fleming, Michelle; Lewis, Morag A; Steel, Karen P

2011-06-01

The hush puppy mouse mutant has been shown previously to have skull and outer, middle, and inner ear defects, and an increase in hearing threshold. The fibroblast growth factor receptor 1 (Fgfr1) gene is located in the region of chromosome 8 containing the mutation. Sequencing of the gene in hush puppy heterozygotes revealed a missense mutation in the kinase domain of the protein (W691R). Homozygotes were found to die during development, at approximately embryonic day 8.5, and displayed a phenotype similar to null mutants. Reverse transcription PCR indicated a decrease in Fgfr1 transcript in heterozygotes and homozygotes. Generation of a construct containing the mutation allowed the function of the mutated receptor to be studied. Immunocytochemistry showed that the mutant receptor protein was present at the cell membrane, suggesting normal expression and trafficking. Measurements of changes in intracellular calcium concentration showed that the mutated receptor could not activate the IP(3) pathway, in contrast to the wild-type receptor, nor could it initiate activation of the Ras/MAP kinase pathway. Thus, the hush puppy mutation in fibroblast growth factor receptor 1 appears to cause a loss of receptor function. The mutant protein appears to have a dominant negative effect, which could be due to it dimerising with the wild-type protein and inhibiting its activity, thus further reducing the levels of functional protein. A dominant modifier, Mhspy, which reduces the effect of the hush puppy mutation on pinna and stapes development, has been mapped to the distal end of chromosome 7 and may show imprinting.

The Impact of ESR1 Mutations on the Treatment of Metastatic Breast Cancer.

PubMed

Pejerrey, Sasha M; Dustin, Derek; Kim, Jin-Ah; Gu, Guowei; Rechoum, Yassine; Fuqua, Suzanne A W

2018-05-07

After nearly 20 years of research, it is now established that mutations within the estrogen receptor (ER) gene, ESR1, frequently occur in metastatic breast cancer and influence response to hormone therapy. Though early studies presented differing results, sensitive sequencing techniques now show that ESR1 mutations occur at a frequency between 20 and 40% depending on the assay method. Recent studies have focused on several "hot spot mutations," a cluster of mutations found in the hormone-binding domain of the ESR1 gene. Throughout the course of treatment, tumor evolution can occur, and ESR1 mutations emerge and become enriched in the metastatic setting. Sensitive techniques to continually monitor mutant burden in vivo are needed to effectively treat patients with mutant ESR1. The full impact of these mutations on tumor response to different therapies remains to be determined. However, recent studies indicate that mutant-bearing tumors may be less responsive to specific hormonal therapies, and suggest that aromatase inhibitor (AI) therapy may select for the emergence of ESR1 mutations. Additionally, different mutations may respond discretely to targeted therapies. The need for more preclinical mechanistic studies on ESR1 mutations and the development of better agents to target these mutations are urgently needed. In the future, sequential monitoring of ESR1 mutational status will likely direct personalized therapeutic regimens appropriate to each tumor's unique mutational landscape.

Fragment analysis represents a suitable approach for the detection of hotspot c.7541_7542delCT NOTCH1 mutation in chronic lymphocytic leukemia.

PubMed

Vavrova, Eva; Kantorova, Barbara; Vonkova, Barbara; Kabathova, Jitka; Skuhrova-Francova, Hana; Diviskova, Eva; Letocha, Ondrej; Kotaskova, Jana; Brychtova, Yvona; Doubek, Michael; Mayer, Jiri; Pospisilova, Sarka

2017-09-01

The hotspot c.7541_7542delCT NOTCH1 mutation has been proven to have a negative clinical impact in chronic lymphocytic leukemia (CLL). However, an optimal method for its detection has not yet been specified. The aim of our study was to examine the presence of the NOTCH1 mutation in CLL using three commonly used molecular methods. Sanger sequencing, fragment analysis and allele-specific PCR were compared in the detection of the c.7541_7542delCT NOTCH1 mutation in 201 CLL patients. In 7 patients with inconclusive mutational analysis results, the presence of the NOTCH1 mutation was also confirmed using ultra-deep next generation sequencing. The NOTCH1 mutation was detected in 15% (30/201) of examined patients. Only fragment analysis was able to identify all 30 NOTCH1-mutated patients. Sanger sequencing and allele-specific PCR showed a lower detection efficiency, determining 93% (28/30) and 80% (24/30) of the present NOTCH1 mutations, respectively. Considering these three most commonly used methodologies for c.7541_7542delCT NOTCH1 mutation screening in CLL, we defined fragment analysis as the most suitable approach for detecting the hotspot NOTCH1 mutation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification of novel mutations in CD2BP1 gene in clinically proven rheumatoid arthritis patients of south India.

PubMed

Kumar, Bhattaram Siddhartha; Kumar, Pasupuleti Santhosh; Sowgandhi, Nannepaga; Prajwal, Bhattaram Manoj; Mohan, Alladi; Sarma, Kadainti Venkata Subbaraya; Sarma, Potukuchi Venkata Gurunadha Krishna

2016-08-01

Pyogenic Arthritis, Pyoderma gangrenosum, and Acne (PAPA syndrome) is a rare autosomal dominant, auto-inflammatory disease that affects joints and skin. The disease results due to mutations in the cluster of differentiation 2 binding protein 1 (CD2BP1) gene on chromosome 15q24.3. Rheumatoid arthritis (RA) is a common, genetically complex disease that affects the joints with occasional skin manifestations. Studies related to the pathophysiology of inflammation in these two disorders show a certain degree of overlap at genetic level. The present study was done to confirm the existence of such a genetic overlap between PAPA syndrome and RA in south Indian population. In the present study 100 patients who were clinically diagnosed rheumatoid arthritis and 100 apparently healthy controls were chosen and the 15 exons of CD2BP1 gene were PCR-amplified and sequenced. The sequence analysis showed that in exon 3 thirty eight patients revealed presence of novel heterozygous missense mutations p.Glu51Asp, p.Leu57Arg and p.Ala64Thr. In exons 6, 10 and 14 eight patients showed 44 novel missense mutations and two patients showed novel frame shift mutations p.(Met123_Leu416delinsThr) and p.(Thr337Profs*52) leading to truncated protein formation. Such mutations were not seen in controls. Further, the in silico analysis revealed the mutant CD2BP1 structure showed deletion of Cdc15 and SH3 domains when superimposed with the wild type CD2BP1 structure with variable RMSD values. Therefore, these structural variations in CD2BP1 gene due to the mutations could be one of the strongest reasons to demonstrate the involvement of these gene variations in the patients with rheumatoid arthritis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Diagnostic algorithm for detection of targetable driver mutations in lung adenocarcinomas: Comprehensive analyses of 205 cases with immunohistochemistry, real-time PCR and fluorescence in situ hybridization methods.

PubMed

Kao, Hua-Lin; Yeh, Yi-Chen; Lin, Chin-Hsuan; Hsu, Wei-Fang; Hsieh, Wen-Yu; Ho, Hsiang-Ling; Chou, Teh-Ying

2016-11-01

Analysis of the targetable driver mutations is now recommended in all patients with advanced lung adenocarcinoma. Molecular-based methods are usually adopted, however, along with the implementation of highly sensitive and/or mutation-specific antibodies, immunohistochemistry (IHC) has been considered an alternative method for identifying driver mutations in lung adenocarcinomas. A total of 205 lung adenocarcinomas were examined for EGFR mutations and ALK and ROS1 rearrangements using real-time PCR, fluorescence in situ hybridization (FISH) and IHC in parallel. The performance of different commercially available IHC antibody clones toward targetable driver mutations was evaluated. The association between these driver mutations and clinicopathological characteristics was also analyzed. In 205 cases we studied, 58.5% were found to harbor EGFR mutations, 6.3% ALK rearrangements and 1.0% ROS1 rearrangements. Compared to molecular-based methods, IHC of EGFR mutations showed an excellent specificity but the sensitivity is suboptimal, while IHC of ALK and ROS1 rearrangements demonstrated high sensitivity and specificity. No significant difference regarding the performance of different antibody clones toward these driver mutations was observed, except that clone SP125 showed a higher sensitivity than 43B2 in the detection of p.L858R of EGFR. In circumstances such as poor quality of nucleic acids or low content of tumor cells, IHC of EGFR mutation-specific antibodies could be used as an alternative method. Patients negative for EGFR mutations are subjected to further analysis on ALK and ROS1 rearrangements using IHC methods. Herein, we proposed a lung adenocarcinoma testing algorithm for the application of IHC in therapeutic diagnosis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Gain-of-Function Mutations in RIT1 Cause Noonan Syndrome, a RAS/MAPK Pathway Syndrome

PubMed Central

Aoki, Yoko; Niihori, Tetsuya; Banjo, Toshihiro; Okamoto, Nobuhiko; Mizuno, Seiji; Kurosawa, Kenji; Ogata, Tsutomu; Takada, Fumio; Yano, Michihiro; Ando, Toru; Hoshika, Tadataka; Barnett, Christopher; Ohashi, Hirofumi; Kawame, Hiroshi; Hasegawa, Tomonobu; Okutani, Takahiro; Nagashima, Tatsuo; Hasegawa, Satoshi; Funayama, Ryo; Nagashima, Takeshi; Nakayama, Keiko; Inoue, Shin-ichi; Watanabe, Yusuke; Ogura, Toshihiko; Matsubara, Yoichi

2013-01-01

RAS GTPases mediate a wide variety of cellular functions, including cell proliferation, survival, and differentiation. Recent studies have revealed that germline mutations and mosaicism for classical RAS mutations, including those in HRAS, KRAS, and NRAS, cause a wide spectrum of genetic disorders. These include Noonan syndrome and related disorders (RAS/mitogen-activated protein kinase [RAS/MAPK] pathway syndromes, or RASopathies), nevus sebaceous, and Schimmelpenning syndrome. In the present study, we identified a total of nine missense, nonsynonymous mutations in RIT1, encoding a member of the RAS subfamily, in 17 of 180 individuals (9%) with Noonan syndrome or a related condition but with no detectable mutations in known Noonan-related genes. Clinical manifestations in the RIT1-mutation-positive individuals are consistent with those of Noonan syndrome, which is characterized by distinctive facial features, short stature, and congenital heart defects. Seventy percent of mutation-positive individuals presented with hypertrophic cardiomyopathy; this frequency is high relative to the overall 20% incidence in individuals with Noonan syndrome. Luciferase assays in NIH 3T3 cells showed that five RIT1 alterations identified in children with Noonan syndrome enhanced ELK1 transactivation. The introduction of mRNAs of mutant RIT1 into 1-cell-stage zebrafish embryos was found to result in a significant increase of embryos with craniofacial abnormalities, incomplete looping, a hypoplastic chamber in the heart, and an elongated yolk sac. These results demonstrate that gain-of-function mutations in RIT1 cause Noonan syndrome and show a similar biological effect to mutations in other RASopathy-related genes. PMID:23791108

Spinal Neurofibromatosis without Café-au-Lait Macules in Two Families with Null Mutations of the NF1 Gene

PubMed Central

Kaufmann, Dieter; Müller, Ralf; Bartelt, Britta; Wolf, Michael; Kunzi-Rapp, Karin; Hanemann, Clemens Oliver; Fahsold, Raimund; Hein, Christian; Vogel, Walther; Assum, Günter

2001-01-01

Spinal neurofibromatosis (SNF) is considered to be an alternative form of neurofibromatosis, showing multiple spinal tumors and café-au-lait macules. Involvement of the neurofibromatosis type 1 (NF1) locus has been demonstrated, by linkage analysis, for three families with SNF. In one of them, a cosegregating frameshift mutation in exon 46 of the NF1 gene was identified. In the present study, we report four individuals from two families who carry NF1 null mutations that would be expected to cause NF1. Three patients have multiple spinal tumors and no café-au-lait macules, and the fourth has no clinical signs of NF1. In the first family, a missense mutation (Leu2067Pro) in NF1 exon 33 was found, and, in the second, a splice-site mutation (IVS31-5A→G) enlarging exon 32 by 4 bp at the 5′ end was found. The latter mutation has also been observed in an unrelated patient with classical NF1. Both NF1 mutations cause a reduction in neurofibromin of ∼50%, with no truncated protein present in the cells. This demonstrates that typical NF1 null mutations can result in a phenotype that is distinct from classical NF1, showing only a small spectrum of the NF1 symptoms, such as multiple spinal tumors, but not completely fitting the current clinical criteria for SNF. We speculate that this phenotype is caused by an unknown modifying gene that compensates for some, but not all, of the effects caused by neurofibromin deficiency. PMID:11704931

[Clinical and genetic analysis for two children with congenital disturbance of glycosylation with PMM2 gene mutations].

PubMed

Ren, Changhong; Fang, Fang; Huang, Yu; Cheng, Hua; Dai, Lifang

2015-12-01

To analyze the clinical and PMM2 gene mutation features of congenital disturbance of glycosylation caused by PMM2 gene mutation (PMM2-CDG, previously known as CDG 1a). The clinical data of two Chinese patients who were clinically diagnosed as PMM2-CDG at neurology department of Beijing Children's Hospital in 2012 were retrospectively collected. The gene mutations were identified by Sanger sequencing. Both patients were female, aged 1 year and 1 month and 8 months respectively. The main clinical features of the two cases were developmental delay after birth, chronic diarrhea and metabolic acidosis, associated with elevated serum transaminases, and decreased antithrombin III activity. Physical examination showed esotropia, inverted nipples, and abnormal subcutaneous fat pads. The cranial MRI showed cerebellar atrophy. Both cases were treated with occupational therapy, physical therapy and speech therapy. The development was gradually improved but also delayed as compared with normal peers during follow-up for more than 3 years. Genetic analysis showed that patient 1 was compound heterozygous for c. 422G>A(p.Arg141His), which was reported for known pathogenic mutation, and c. 669C>A(p.Asp223Glu), was a new mutation. The patient 2 showed compound heterozygous mutation for c. 634A>G (p.Met212Val)and c. 713G>C(p.Arg238Pro), which were both new mutations. PMM2-CDG is a rare metabolic disease, and the diagnosis should be considered in a child with developmental delay, elevated serum transaminases, decreased antithrombin III activity, inverted nipples, abnormal subcutaneous fat pads, esotropia, and cerebellar atrophy on MRI. It can be confirmed by PMM2 gene analysis.

Elevated mutation rate during meiosis in Saccharomyces cerevisiae.

PubMed

Rattray, Alison; Santoyo, Gustavo; Shafer, Brenda; Strathern, Jeffrey N

2015-01-01

Mutations accumulate during all stages of growth, but only germ line mutations contribute to evolution. While meiosis contributes to evolution by reassortment of parental alleles, we show here that the process itself is inherently mutagenic. We have previously shown that the DNA synthesis associated with repair of a double-strand break is about 1000-fold less accurate than S-phase synthesis. Since the process of meiosis involves many programmed DSBs, we reasoned that this repair might also be mutagenic. Indeed, in the early 1960's Magni and Von Borstel observed elevated reversion of recessive alleles during meiosis, and found that the revertants were more likely to be associated with a crossover than non-revertants, a process that they called "the meiotic effect." Here we use a forward mutation reporter (CAN1 HIS3) placed at either a meiotic recombination coldspot or hotspot near the MAT locus on Chromosome III. We find that the increased mutation rate at CAN1 (6 to 21 -fold) correlates with the underlying recombination rate at the locus. Importantly, we show that the elevated mutation rate is fully dependent upon Spo11, the protein that introduces the meiosis specific DSBs. To examine associated recombination we selected for random spores with or without a mutation in CAN1. We find that the mutations isolated this way show an increased association with recombination (crossovers, loss of crossover interference and/or increased gene conversion tracts). Polζ appears to contribute about half of the mutations induced during meiosis, but is not the only source of mutations for the meiotic effect. We see no difference in either the spectrum or distribution of mutations between mitosis and meiosis. The correlation of hotspots with elevated mutagenesis provides a mechanism for organisms to control evolution rates in a gene specific manner.

BRCA1 mutations in South African breast and/or ovarian cancer families: evidence of a novel founder mutation in Afrikaner families.

PubMed

Reeves, Michelle D; Yawitch, Tali M; van der Merwe, Nerina C; van den Berg, Hester J; Dreyer, Greta; van Rensburg, Elizabeth J

2004-07-10

Germ-line mutations within BRCA1 are responsible for different proportions of inherited susceptibility to breast/ovarian cancer, and the spectrum of mutations within this gene is often unique to certain populations. At this time, there have been no reports regarding the role of BRCA1 in South African breast and/or ovarian cancer families. We therefore screened 90 South African breast/ovarian cancer families for BRCA1 mutations by means of PCR-based mutation detection assays. Eighteen families (20%) were identified with BRCA1 disease-causing mutations. Four Ashkenazi Jewish families were identified with the 185delAG mutation, whereas 2 Afrikaner and 1 Ashkenazi Jewish family were found to harbor the 5382insC mutation. Five of the families (5.56%), all of whom are Afrikaners, were found to carry the novel E881X mutation. Genotype analyses show that these patients share a common ancestor. Genealogic studies have identified 3 possible founding couples for this mutation, all of whom arrived in the Cape from France in the late 1600s. Of the remaining mutations detected, 3 have not been reported previously and include the S451X, 1493delC (detected twice) and 4957insC mutations. Copyright 2004 Wiley-Liss, Inc.

Deep sequencing of natural and experimental populations of Drosophila melanogaster reveals biases in the spectrum of new mutations.

PubMed

Assaf, Zoe June; Tilk, Susanne; Park, Jane; Siegal, Mark L; Petrov, Dmitri A

2017-12-01

Mutations provide the raw material of evolution, and thus our ability to study evolution depends fundamentally on having precise measurements of mutational rates and patterns. We generate a data set for this purpose using (1) de novo mutations from mutation accumulation experiments and (2) extremely rare polymorphisms from natural populations. The first, mutation accumulation (MA) lines are the product of maintaining flies in tiny populations for many generations, therefore rendering natural selection ineffective and allowing new mutations to accrue in the genome. The second, rare genetic variation from natural populations allows the study of mutation because extremely rare polymorphisms are relatively unaffected by the filter of natural selection. We use both methods in Drosophila melanogaster , first generating our own novel data set of sequenced MA lines and performing a meta-analysis of all published MA mutations (∼2000 events) and then identifying a high quality set of ∼70,000 extremely rare (≤0.1%) polymorphisms that are fully validated with resequencing. We use these data sets to precisely measure mutational rates and patterns. Highlights of our results include: a high rate of multinucleotide mutation events at both short (∼5 bp) and long (∼1 kb) genomic distances, showing that mutation drives GC content lower in already GC-poor regions, and using our precise context-dependent mutation rates to predict long-term evolutionary patterns at synonymous sites. We also show that de novo mutations from independent MA experiments display similar patterns of single nucleotide mutation and well match the patterns of mutation found in natural populations. © 2017 Assaf et al.; Published by Cold Spring Harbor Laboratory Press.

Heterozygous Mutations Causing Partial Prohormone Convertase 1 Deficiency Contribute to Human Obesity

PubMed Central

Creemers, John W.M.; Choquet, Hélène; Stijnen, Pieter; Vatin, Vincent; Pigeyre, Marie; Beckers, Sigri; Meulemans, Sandra; Than, Manuel E.; Yengo, Loïc; Tauber, Maithé; Balkau, Beverley; Elliott, Paul; Jarvelin, Marjo-Riitta; Van Hul, Wim; Van Gaal, Luc; Horber, Fritz; Pattou, François; Froguel, Philippe; Meyre, David

2012-01-01

Null mutations in the PCSK1 gene, encoding the proprotein convertase 1/3 (PC1/3), cause recessive monogenic early onset obesity. Frequent coding variants that modestly impair PC1/3 function mildly increase the risk for common obesity. The aim of this study was to determine the contribution of rare functional PCSK1 mutations to obesity. PCSK1 exons were sequenced in 845 nonconsanguineous extremely obese Europeans. Eight novel nonsynonymous PCSK1 mutations were identified, all heterozygous. Seven mutations had a deleterious effect on either the maturation or the enzymatic activity of PC1/3 in cell lines. Of interest, five of these novel mutations, one of the previously described frequent variants (N221D), and the mutation found in an obese mouse model (N222D), affect residues at or near the structural calcium binding site Ca-1. The prevalence of the newly identified mutations was assessed in 6,233 obese and 6,274 lean European adults and children, which showed that carriers of any of these mutations causing partial PCSK1 deficiency had an 8.7-fold higher risk to be obese than wild-type carriers. These results provide the first evidence of an increased risk of obesity in heterozygous carriers of mutations in the PCSK1 gene. Furthermore, mutations causing partial PCSK1 deficiency are present in 0.83% of extreme obesity phenotypes. PMID:22210313

Heterozygous mutations causing partial prohormone convertase 1 deficiency contribute to human obesity.

PubMed

Creemers, John W M; Choquet, Hélène; Stijnen, Pieter; Vatin, Vincent; Pigeyre, Marie; Beckers, Sigri; Meulemans, Sandra; Than, Manuel E; Yengo, Loïc; Tauber, Maithé; Balkau, Beverley; Elliott, Paul; Jarvelin, Marjo-Riitta; Van Hul, Wim; Van Gaal, Luc; Horber, Fritz; Pattou, François; Froguel, Philippe; Meyre, David

2012-02-01

Null mutations in the PCSK1 gene, encoding the proprotein convertase 1/3 (PC1/3), cause recessive monogenic early onset obesity. Frequent coding variants that modestly impair PC1/3 function mildly increase the risk for common obesity. The aim of this study was to determine the contribution of rare functional PCSK1 mutations to obesity. PCSK1 exons were sequenced in 845 nonconsanguineous extremely obese Europeans. Eight novel nonsynonymous PCSK1 mutations were identified, all heterozygous. Seven mutations had a deleterious effect on either the maturation or the enzymatic activity of PC1/3 in cell lines. Of interest, five of these novel mutations, one of the previously described frequent variants (N221D), and the mutation found in an obese mouse model (N222D), affect residues at or near the structural calcium binding site Ca-1. The prevalence of the newly identified mutations was assessed in 6,233 obese and 6,274 lean European adults and children, which showed that carriers of any of these mutations causing partial PCSK1 deficiency had an 8.7-fold higher risk to be obese than wild-type carriers. These results provide the first evidence of an increased risk of obesity in heterozygous carriers of mutations in the PCSK1 gene. Furthermore, mutations causing partial PCSK1 deficiency are present in 0.83% of extreme obesity phenotypes.

Pediatric acute myeloid leukemia with NPM1 mutations is characterized by a gene expression profile with dysregulated HOX gene expression distinct from MLL-rearranged leukemias.

PubMed

Mullighan, C G; Kennedy, A; Zhou, X; Radtke, I; Phillips, L A; Shurtleff, S A; Downing, J R

2007-09-01

Somatic mutations in nucleophosmin (NPM1) occur in approximately 35% of adult acute myeloid leukemia (AML). To assess the frequency of NPM1 mutations in pediatric AML, we sequenced NPM1 in the diagnostic blasts from 93 pediatric AML patients. Six cases harbored NPM1 mutations, with each case lacking common cytogenetic abnormalities. To explore the phenotype of the AMLs with NPM1 mutations, gene expression profiles were obtained using Affymetrix U133A microarrays. NPM1 mutations were associated with increased expression of multiple homeobox genes including HOXA9, A10, B2, B6 and MEIS1. As dysregulated homeobox gene expression is also a feature of MLL-rearranged leukemia, the gene expression signatures of NPM1-mutated and MLL-rearranged leukemias were compared. Significant differences were identified between these leukemia subtypes including the expression of different HOX genes, with NPM1-mutated AML showing higher levels of expression of HOXB2, B3, B6 and D4. These results confirm recent reports of perturbed HOX expression in NPM1-mutated adult AML, and provide the first evidence that the NPM1-mutated signature is distinct from MLL-rearranged AML. These findings suggest that mutated NPM1 leads to dysregulated HOX expression via a different mechanism than MLL rearrangement.

[The significance of pedigree genetic screening and rapid immunological parameters in the diagnosis of primary hemophagocytic lymphohistiocytosis].

PubMed

Zhang, J; Wang, Y N; Wang, J S; Wu, L; Wei, N; Fu, L; Gao, Z; Chen, J H; Pei, R J; Wang, Z

2016-07-01

To investigate the significance of pedigree genetic screening and rapid immunological parameters in the diagnosis of primary hemophagocytic lymphohistiocytosis (HLH). Four cases of primary HLH patients with PRF1, UNC13D and SH2D1A gene mutations were conducted pedigree investigation, including family genetic screening and detections of immunological parameters (NK cell activity, CD107a degranulation and expression of HLH related defective protein), to evaluate the significance of these different indicators in the diagnosis of primary HLH and explore their correlations. The DNA mutations of the four families included missense mutation c.T172C (p.S58P) and non- frameshift deletions c.1083_1094del (p.361_365del), missense mutation c.C1349T (p.T450M) and frameshift mutation c.1090_1091delCT (p.T364fsX93) in PRF1 gene, missense mutation c.G2588A (p.G863D) in UNC13D gene and hemizygous mutation c.32T>G (p.I11S) in SH2D1A gene. The patients and their family members presented decreased NK cell activities. Individuals who carried mutations of PRF1 gene and SH2D1A gene showed low expression of perforin (PRF1) and signaling lymphocytic activation molecule associated protein (SAP). And the patient with UNC13D gene mutation and his family member with identical mutation showed significant reducing cytotoxic degranulation function (expression of CD107a). Pedigree genetic screening and rapid detection of immunological parameters might play an important role in the diagnosis of primary HLH, and both of them had good consistency. As an efficient detection means, the rapid immunological detection indicators would provide reliable basis for the early diagnosis of the primary HLH.

Pyrosequencing analysis for detection of a BRAFV600E mutation in an FNAB specimen of thyroid nodules.

PubMed

Kim, Suk Kyeong; Kim, Dong-Lim; Han, Hye Seung; Kim, Wan Seop; Kim, Seung Ja; Moon, Won Jin; Oh, Seo Young; Hwang, Tae Sook

2008-06-01

Fine-needle aspiration biopsy (FNAB) is the primary means of distinguishing benign from malignant and of guiding therapeutic intervention in thyroid nodules. However, 10% to 30% of cases with indeterminate cytology in FNAB need other diagnostic tools to refine diagnosis. We compared the pyrosequencing method with the conventional direct DNA sequencing analysis and investigated the usefulness of preoperative BRAF mutation analysis as an adjunct diagnostic tool with routine FNAB. A total of 103 surgically confirmed patients' FNA slides were recruited and DNA was extracted after atypical cells were scraped from the slides. BRAF mutation was analyzed by pyrosequencing and direct DNA sequencing. Sixty-three (77.8%) of 81 histopathologically diagnosed malignant nodules revealed positive BRAF mutation on pyrosequencing analysis. In detail, 63 (84.0%) of 75 papillary thyroid carcinoma (PTC) samples showed positive BRAF mutation, whereas 3 follicular thyroid carcinomas, 1 anaplastic carcinoma, 1 medullary thyroid carcinoma, and 1 metastatic lung carcinoma did not show BRAF mutation. None of 22 benign nodules had BRAF mutation in both pyrosequencing and direct DNA sequencing. Out of 27 thyroid nodules classified as 'indeterminate' on cytologic examination preoperatively, 21 (77.8%) cases turned out to be malignant: 18 PTCs (including 2 follicular variant types) and 3 follicular thyroid carcinomas. Among these, 13 (61.9%) classic PTCs had BRAF mutation. None of 6 benign nodules, including 3 follicular adenomas and 3 nodular hyperplasias, had BRAF mutation. Among 63 PTCs with positive BRAF mutation detected by pyrosequencing analysis, 3 cases did not show BRAF mutation by direct DNA sequencing. Although it was not statistically significant, pyrosequencing was superior to direct DNA sequencing in detecting the BRAF mutation of thyroid nodules (P=0.25). Detecting BRAF mutation by pyrosequencing is more sensitive, faster, and less expensive than direct DNA sequencing and is proposed as an adjunct diagnostic tool in evaluating thyroid nodules of indeterminate cytology.

Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

PubMed

Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

2015-03-15

Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein molecule that alter the biosynthesis of thyroid hormones. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Preexisting MEK1 Exon 3 Mutations in V600E/KBRAF Melanomas Do Not Confer Resistance to BRAF Inhibitors

PubMed Central

Shi, Hubing; Moriceau, Gatien; Kong, Xiangju; Koya, Richard C.; Nazarian, Ramin; Pupo, Gulietta M.; Bacchiocchi, Antonella; Dahlman, Kimberly B.; Chmielowski, Bartosz; Sosman, Jeffrey A.; Halaban, Ruth; Kefford, Richard F.; Long, Georgina V.; Ribas, Antoni; Lo, Roger S.

2012-01-01

BRAF inhibitors (BRAFi) induce antitumor responses in nearly 60% of patients with advanced V600E/KBRAF melanomas. Somatic activating MEK1 mutations are thought to be rare in melanomas, but their potential concurrence with V600E/KBRAF may be selected for by BRAFi. We sequenced MEK1/2 exon 3 in melanomas at baseline and upon disease progression. Of 31 baseline V600E/KBRAF melanomas, 5 (16%) carried concurrent somatic BRAF/MEK1 activating mutations. Three of 5 patients with BRAF/MEK1 double-mutant baseline melanomas showed objective tumor responses, consistent with the overall 60% frequency. No MEK1 mutation was found in disease progression melanomas, except when it was already identified at baseline. MEK1-mutant expression in V600E/KBRAF melanoma cell lines resulted in no significant alterations in p-ERK1/2 levels or growth-inhibitory sensitivities to BRAFi, MEK1/2 inhibitor (MEKi), or their combination. Thus, activating MEK1 exon 3 mutations identified herein and concurrent with V600E/KBRAF do not cause BRAFi resistance in melanoma. SIGNIFICANCE As BRAF inhibitors gain widespread use for treatment of advanced melanoma, bio-markers for drug sensitivity or resistance are urgently needed. We identify here concurrent activating mutations in BRAF and MEK1 in melanomas and show that the presence of a downstream mutation in MEK1 does not necessarily make BRAF–mutant melanomas resistant to BRAF inhibitors. PMID:22588879

Whole-exome sequencing and targeted gene sequencing provide insights into the role of PALB2 as a male breast cancer susceptibility gene.

PubMed

Silvestri, Valentina; Zelli, Veronica; Valentini, Virginia; Rizzolo, Piera; Navazio, Anna Sara; Coppa, Anna; Agata, Simona; Oliani, Cristina; Barana, Daniela; Castrignanò, Tiziana; Viel, Alessandra; Russo, Antonio; Tibiletti, Maria Grazia; Zanna, Ines; Masala, Giovanna; Cortesi, Laura; Manoukian, Siranoush; Azzollini, Jacopo; Peissel, Bernard; Bonanni, Bernardo; Peterlongo, Paolo; Radice, Paolo; Palli, Domenico; Giannini, Giuseppe; Chillemi, Giovanni; Montagna, Marco; Ottini, Laura

2017-01-01

Male breast cancer (MBC) is a rare disease whose etiology appears to be largely associated with genetic factors. BRCA1 and BRCA2 mutations account for about 10% of all MBC cases. Thus, a fraction of MBC cases are expected to be due to genetic factors not yet identified. To further explain the genetic susceptibility for MBC, whole-exome sequencing (WES) and targeted gene sequencing were applied to high-risk, BRCA1/2 mutation-negative MBC cases. Germ-line DNA of 1 male and 2 female BRCA1/2 mutation-negative breast cancer (BC) cases from a pedigree showing a first-degree family history of MBC was analyzed with WES. Targeted gene sequencing for the validation of WES results was performed for 48 high-risk, BRCA1/2 mutation-negative MBC cases from an Italian multicenter study of MBC. A case-control series of 433 BRCA1/2 mutation-negative MBC and female breast cancer (FBC) cases and 849 male and female controls was included in the study. WES in the family identified the partner and localizer of BRCA2 (PALB2) c.419delA truncating mutation carried by the proband, her father, and her paternal uncle (all affected with BC) and the N-acetyltransferase 1 (NAT1) c.97C>T nonsense mutation carried by the proband's maternal aunt. Targeted PALB2 sequencing detected the c.1984A>T nonsense mutation in 1 of the 48 BRCA1/2 mutation-negative MBC cases. NAT1 c.97C>T was not found in the case-control series. These results add strength to the evidence showing that PALB2 is involved in BC risk for both sexes and indicate that consideration should be given to clinical testing of PALB2 for BRCA1/2 mutation-negative families with multiple MBC and FBC cases. Cancer 2017;123:210-218. © 2016 American Cancer Society. © 2016 American Cancer Society.

Mutational analysis of COL1A1 and COL1A2 genes among Estonian osteogenesis imperfecta patients.

PubMed

Zhytnik, Lidiia; Maasalu, Katre; Reimann, Ene; Prans, Ele; Kõks, Sulev; Märtson, Aare

2017-08-15

Osteogenesis imperfecta (OI) is a rare bone disorder. In 90% of cases, OI is caused by mutations in the COL1A1/2 genes, which code procollagen α1 and α2 chains. The main aim of the current research was to identify the mutational spectrum of COL1A1/2 genes in Estonian patients. The small population size of Estonia provides a unique chance to explore the collagen I mutational profile of 100% of OI families in the country. We performed mutational analysis of peripheral blood gDNA of 30 unrelated Estonian OI patients using Sanger sequencing of COL1A1 and COL1A2 genes, including all intron-exon junctions and 5'UTR and 3'UTR regions, to identify causative OI mutations. We identified COL1A1/2 mutations in 86.67% of patients (26/30). 76.92% of discovered mutations were located in the COL1A1 (n = 20) and 23.08% in the COL1A2 (n = 6) gene. Half of the COL1A1/2 mutations appeared to be novel. The percentage of quantitative COL1A1/2 mutations was 69.23%. Glycine substitution with serine was the most prevalent among missense mutations. All qualitative mutations were situated in the chain domain of pro-α1/2 chains. Our study shows that among the Estonian OI population, the range of collagen I mutations is quite high, which agrees with other described OI cohorts of Northern Europe. The Estonian OI cohort differs due to the high number of quantitative variants and simple missense variants, which are mostly Gly to Ser substitutions and do not extend the chain domain of COL1A1/2 products.

Coexistence of JAK2 and CALR mutations and their clinical implications in patients with essential thrombocythemia.

PubMed

Kang, Min-Gu; Choi, Hyun-Woo; Lee, Jun Hyung; Choi, Yong Jun; Choi, Hyun-Jung; Shin, Jong-Hee; Suh, Soon-Pal; Szardenings, Michael; Kim, Hye-Ran; Shin, Myung-Geun

2016-08-30

Janus kinase 2 (JAK2) and calreticulin (CALR) constitute the two most frequent mutations in essential thrombocythemia (ET), and both are reported to be mutually exclusive. Hence, we examined a cohort of 123 myeloproliferative neoplasm (MPN) patients without BCR-ABL1 rearrangement and additional ET patients (n=96) for coexistence of JAK2 and CALR mutations. The frequency of CALR mutations was 20.3% in 123 MPN patients; 31.1% in ET (n=74), 25% in primary myelofibrosis (n=4) and 2.2% in polycythemia vera (n=45). JAK2 and CALR mutations coexisted in 7 (4.2%) of 167 ET patients. Clinical characteristics, progression-free survival (PFS), and elapsed time to achieve partial remission across 4 groups (JAK2+/CALR+, JAK2+/CALR-, JAK2-/CALR+, JAK2-/CALR-) were reviewed. The JAK2+/CALR- group had higher leukocyte counts and hemoglobin levels and more frequent thrombotic events than JAK2-/CALR- group. JAK2 mutations have a greater effect on the disease phenotype and the clinical features of MPN patients rather than do CALR mutation. JAK2+ groups showed a tendency of poor PFS than JAK2- groups regardless of CALR mutation. CALR+ was a predictor of late response to the treatment. Our study also showed that thrombosis was more frequent in ET patients with type 2 CALR mutations than in those with type 1 CALR mutations.

Identification and functional analysis of CBLB mutations in type 1 diabetes.

PubMed

Yokoi, Norihide; Fujiwara, Yuuka; Wang, He-Yao; Kitao, Mai; Hayashi, Chihiro; Someya, Tomohiro; Kanamori, Masao; Oiso, Yutaka; Tajima, Naoko; Yamada, Yuichiro; Seino, Yutaka; Ikegami, Hiroshi; Seino, Susumu

2008-03-28

Casitas B-lineage lymphoma b (Cblb) is a negative regulator of T-cell activation and dysfunction of Cblb in rats and mice results in autoimmunity. In particular, a nonsense mutation in Cblb has been identified in a rat model of autoimmune type 1 diabetes. To clarify the possible involvement of CBLB mutation in type 1 diabetes in humans, we performed mutation screening of CBLB and characterized functional properties of the mutations in Japanese subjects. Six missense mutations (A155V, F328L, N466D, K837R, T882A, and R968L) were identified in one diabetic subject each, excepting N466D. Of these mutations, F328L showed impaired suppression of T-cell activation and was a loss-of-function mutation. These data suggest that the F328L mutation is involved in the development of autoimmune diseases including type 1 diabetes, and also provide insight into the structure-function relationship of CBLB protein.

Nonlethal sec71-1 and sec72-1 mutations eliminate proteins associated with the Sec63p-BiP complex from S. cerevisiae.

PubMed Central

Fang, H; Green, N

1994-01-01

The sec71-1 and sec72-1 mutations were identified by a genetic assay that monitored membrane protein integration into the endoplasmic reticulum (ER) membrane of the yeast Saccharomyces cerevisiae. The mutations inhibited integration of various chimeric membrane proteins and translocation of a subset of water soluble proteins. In this paper we show that SEC71 encodes the 31.5-kDa transmembrane glycoprotein (p31.5) and SEC72 encodes the 23-kDa protein (p23) of the Sec63p-BiP complex. SEC71 is therefore identical to SEC66 (HSS1), which was previously shown to encode p31.5. DNA sequence analyses reveal that sec71-1 cells contain a nonsense mutation that removes approximately two-thirds of the cytoplasmic C-terminal domain of p31.5. The sec72-1 mutation shifts the reading frame of the gene encoding p23. Unexpectedly, the sec71-1 mutant lacks p31.5 and p23. Neither mutation is lethal, although sec71-1 cells exhibit a growth defect at 37 degrees C. These results show that p31.5 and p23 are important for the trafficking of a subset of proteins to the ER membrane. Images PMID:7841522

ssaD1, a suppressor of secA51(Ts) that renders growth of Escherichia coli cold sensitive, is an early amber mutation in the transcription factor gene nusB.

PubMed Central

Rajapandi, T.; Oliver, D.

1994-01-01

Complementation analysis of the ssaD1 mutation, isolated as a suppressor of the secA51(Ts) mutation that renders growth of Escherichia coli cold sensitive, was used to show that ssaD corresponds to nusB, a gene known to be important in transcription antitermination. DNA sequence analysis of the ssaD1 allele showed that it creates an amber mutation in the 15th codon of nusB. Analysis of the effect of different levels of NusB protein on secA transcription and translation suggested that NusB plays little or no role in the control of secA expression. Accordingly, mechanisms by which nusB inactivation can lead to suppression of secA51(Ts) and secY24(Ts) mutations without affecting secA expression need to be considered. PMID:8021230

Mutations in WNT1 Cause Different Forms of Bone Fragility

PubMed Central

Keupp, Katharina; Beleggia, Filippo; Kayserili, Hülya; Barnes, Aileen M.; Steiner, Magdalena; Semler, Oliver; Fischer, Björn; Yigit, Gökhan; Janda, Claudia Y.; Becker, Jutta; Breer, Stefan; Altunoglu, Umut; Grünhagen, Johannes; Krawitz, Peter; Hecht, Jochen; Schinke, Thorsten; Makareeva, Elena; Lausch, Ekkehart; Cankaya, Tufan; Caparrós-Martín, José A.; Lapunzina, Pablo; Temtamy, Samia; Aglan, Mona; Zabel, Bernhard; Eysel, Peer; Koerber, Friederike; Leikin, Sergey; Garcia, K. Christopher; Netzer, Christian; Schönau, Eckhard; Ruiz-Perez, Victor L.; Mundlos, Stefan; Amling, Michael; Kornak, Uwe; Marini, Joan; Wollnik, Bernd

2013-01-01

We report that hypofunctional alleles of WNT1 cause autosomal-recessive osteogenesis imperfecta, a congenital disorder characterized by reduced bone mass and recurrent fractures. In consanguineous families, we identified five homozygous mutations in WNT1: one frameshift mutation, two missense mutations, one splice-site mutation, and one nonsense mutation. In addition, in a family affected by dominantly inherited early-onset osteoporosis, a heterozygous WNT1 missense mutation was identified in affected individuals. Initial functional analysis revealed that altered WNT1 proteins fail to activate canonical LRP5-mediated WNT-regulated β-catenin signaling. Furthermore, osteoblasts cultured in vitro showed enhanced Wnt1 expression with advancing differentiation, indicating a role of WNT1 in osteoblast function and bone development. Our finding that homozygous and heterozygous variants in WNT1 predispose to low-bone-mass phenotypes might advance the development of more effective therapeutic strategies for congenital forms of bone fragility, as well as for common forms of age-related osteoporosis. PMID:23499309

Mutational subtypes of JAK2 and CALR correlate with different clinical features in Japanese patients with myeloproliferative neoplasms.

PubMed

Misawa, Kyohei; Yasuda, Hajime; Araki, Marito; Ochiai, Tomonori; Morishita, Soji; Shirane, Shuichi; Edahiro, Yoko; Gotoh, Akihiko; Ohsaka, Akimichi; Komatsu, Norio

2018-06-01

The majority of patients with Philadelphia chromosome-negative myeloproliferative neoplasms (MPNs) harbor JAK2, CALR, or MPL mutations. We compared clinical manifestations of different subtypes of JAK2 and CALR mutations in Japanese patients with MPNs. Within our cohort, we diagnosed 166 patients as polycythemia vera (PV), 212 patients as essential thrombocythemia (ET), 23 patients as pre-primary myelofibrosis (PMF), 65 patients as overt PMF, and 27 patients as secondary myelofibrosis following the 2016 WHO criteria. Compared to patients with JAK2V617F-mutated PV, JAK2 exon 12-mutated PV patients were younger, showed lower white blood cell (WBC) counts, lower platelet counts, higher red blood cell counts, and higher frequency of thrombotic events. Compared to JAK2-mutated ET patients, CALR-mutated ET patients were younger, showed lower WBC counts, lower hemoglobin levels, higher platelet counts, and fewer thrombotic events. CALR type 1-like mutation was the dominant subtype in CALR-mutated overt PMF patients. Compared with JAK2V617F-mutated ET patients, JAK2V617F-mutated pre-PMF patients showed higher LDH levels, lower hemoglobin levels, higher JAK2V617F allele burden, and higher frequency of splenomegaly. In conclusion, Japanese patients with MPNs grouped by different mutation subtypes exhibit characteristics similar to those of their Western counterparts. In addition, ET and pre-PMF patients show different characteristics, even when restricted to JAK2V617F-mutated patients.

Discovery of naturally occurring ESR1 mutations in breast cancer cell lines modelling endocrine resistance.

PubMed

Martin, Lesley-Ann; Ribas, Ricardo; Simigdala, Nikiana; Schuster, Eugene; Pancholi, Sunil; Tenev, Tencho; Gellert, Pascal; Buluwela, Laki; Harrod, Alison; Thornhill, Allan; Nikitorowicz-Buniak, Joanna; Bhamra, Amandeep; Turgeon, Marc-Olivier; Poulogiannis, George; Gao, Qiong; Martins, Vera; Hills, Margaret; Garcia-Murillas, Isaac; Fribbens, Charlotte; Patani, Neill; Li, Zheqi; Sikora, Matthew J; Turner, Nicholas; Zwart, Wilbert; Oesterreich, Steffi; Carroll, Jason; Ali, Simak; Dowsett, Mitch

2017-11-30

Resistance to endocrine therapy remains a major clinical problem in breast cancer. Genetic studies highlight the potential role of estrogen receptor-α (ESR1) mutations, which show increased prevalence in the metastatic, endocrine-resistant setting. No naturally occurring ESR1 mutations have been reported in in vitro models of BC either before or after the acquisition of endocrine resistance making functional consequences difficult to study. We report the first discovery of naturally occurring ESR1 Y537C and ESR1 Y537S mutations in MCF7 and SUM44 ESR1-positive cell lines after acquisition of resistance to long-term-estrogen-deprivation (LTED) and subsequent resistance to fulvestrant (ICIR). Mutations were enriched with time, impacted on ESR1 binding to the genome and altered the ESR1 interactome. The results highlight the importance and functional consequence of these mutations and provide an important resource for studying endocrine resistance.

AIP mutations impair AhR signaling in pituitary adenoma patients fibroblasts and in GH3 cells.

PubMed

Lecoq, Anne-Lise; Viengchareun, Say; Hage, Mirella; Bouligand, Jérôme; Young, Jacques; Boutron, Audrey; Zizzari, Philippe; Lombès, Marc; Chanson, Philippe; Kamenický, Peter

2016-05-01

Germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene predispose humans to pituitary adenomas through unknown molecular mechanisms. The best-known interacting partner of AIP is the aryl hydrocarbon receptor (AhR), a transcription factor that mediates the effects of xenobiotics implicated in carcinogenesis. As 75% of AIP mutations disrupt the physical and/or functional interaction with AhR, we postulated that the tumorigenic potential of AIP mutations might result from altered AhR signaling. We evaluated the impact of AIP mutations on the AhR signaling pathway, first in fibroblasts from AIP-mutated patients with pituitary adenomas, by comparison with fibroblasts from healthy subjects, then in transfected pituitary GH3 cells. The AIP protein level in mutated fibroblasts was about half of that in cells from healthy subjects, but AhR expression was unaffected. Gene expression analyses showed significant modifications in the expression of the AhR target genes CYP1B1 and AHRR in AIP-mutated fibroblasts, both before and after stimulation with the endogenous AhR ligand kynurenine. Kynurenine increased Cyp1b1 expression to a greater extent in GH3 cells overexpressing wild type compared with cells expressing mutant AIP Knockdown of endogenous Aip in these cells attenuated Cyp1b1 induction by the AhR ligand. Both mutant AIP expression and knockdown of endogenous Aip affected the kynurenine-dependent GH secretion of GH3 cells. This study of human fibroblasts bearing endogenous heterozygous AIP mutations and transfected pituitary GH3 cells shows that AIP mutations affect the AIP protein level and alter AhR transcriptional activity in a gene- and tissue-dependent manner. © 2016 Society for Endocrinology.

Diversity of the Genes Implicated in Algerian Patients Affected by Usher Syndrome

PubMed Central

Abdi, Samia; Bahloul, Amel; Behlouli, Asma; Hardelin, Jean-Pierre; Makrelouf, Mohamed; Boudjelida, Kamel; Louha, Malek; Cheknene, Ahmed; Belouni, Rachid; Rous, Yahia; Merad, Zahida; Selmane, Djamel; Hasbelaoui, Mokhtar; Bonnet, Crystel; Zenati, Akila; Petit, Christine

2016-01-01

Usher syndrome (USH) is an autosomal recessive disorder characterized by a dual sensory impairment affecting hearing and vision. USH is clinically and genetically heterogeneous. Ten different causal genes have been reported. We studied the molecular bases of the disease in 18 unrelated Algerian patients by targeted-exome sequencing, and identified the causal biallelic mutations in all of them: 16 patients carried the mutations at the homozygous state and 2 at the compound heterozygous state. Nine of the 17 different mutations detected in MYO7A (1 of 5 mutations), CDH23 (4 of 7 mutations), PCDH15 (1 mutation), USH1C (1 mutation), USH1G (1 mutation), and USH2A (1 of 2 mutations), had not been previously reported. The deleterious consequences of a missense mutation of CDH23 (p.Asp1501Asn) and the in-frame single codon deletion in USH1G (p.Ala397del) on the corresponding proteins were predicted from the solved 3D-structures of extracellular cadherin (EC) domains of cadherin-23 and the sterile alpha motif (SAM) domain of USH1G/sans, respectively. In addition, we were able to show that the USH1G mutation is likely to affect the binding interface between the SAM domain and USH1C/harmonin. This should spur the use of 3D-structures, not only of isolated protein domains, but also of protein-protein interaction interfaces, to predict the functional impact of mutations detected in the USH genes. PMID:27583663

Diversity of the Genes Implicated in Algerian Patients Affected by Usher Syndrome.

PubMed

Abdi, Samia; Bahloul, Amel; Behlouli, Asma; Hardelin, Jean-Pierre; Makrelouf, Mohamed; Boudjelida, Kamel; Louha, Malek; Cheknene, Ahmed; Belouni, Rachid; Rous, Yahia; Merad, Zahida; Selmane, Djamel; Hasbelaoui, Mokhtar; Bonnet, Crystel; Zenati, Akila; Petit, Christine

2016-01-01

Usher syndrome (USH) is an autosomal recessive disorder characterized by a dual sensory impairment affecting hearing and vision. USH is clinically and genetically heterogeneous. Ten different causal genes have been reported. We studied the molecular bases of the disease in 18 unrelated Algerian patients by targeted-exome sequencing, and identified the causal biallelic mutations in all of them: 16 patients carried the mutations at the homozygous state and 2 at the compound heterozygous state. Nine of the 17 different mutations detected in MYO7A (1 of 5 mutations), CDH23 (4 of 7 mutations), PCDH15 (1 mutation), USH1C (1 mutation), USH1G (1 mutation), and USH2A (1 of 2 mutations), had not been previously reported. The deleterious consequences of a missense mutation of CDH23 (p.Asp1501Asn) and the in-frame single codon deletion in USH1G (p.Ala397del) on the corresponding proteins were predicted from the solved 3D-structures of extracellular cadherin (EC) domains of cadherin-23 and the sterile alpha motif (SAM) domain of USH1G/sans, respectively. In addition, we were able to show that the USH1G mutation is likely to affect the binding interface between the SAM domain and USH1C/harmonin. This should spur the use of 3D-structures, not only of isolated protein domains, but also of protein-protein interaction interfaces, to predict the functional impact of mutations detected in the USH genes.

Homozygous EDNRB mutation in a patient with Waardenburg syndrome type 1.

PubMed

Morimoto, Noriko; Mutai, Hideki; Namba, Kazunori; Kaneko, Hiroki; Kosaki, Rika; Matsunaga, Tatsuo

2018-04-01

To examine and expand the genetic spectrum of Waardenburg syndrome type 1 (WS1). Clinical features related to Waardenburg syndrome (WS) were examined in a five-year old patient. Mutation analysis of genes related to WS was performed in the proband and her parents. Molecular modeling of EDNRB and the p.R319W mutant was conducted to predict the pathogenicity of the mutation. The proband showed sensorineural hearing loss, heterochromia iridis, and dystopia canthorum, fulfilling the clinical criteria of WS1. Genetic analyses revealed that the proband had no mutation in PAX3 which has been known as the cause of WS1, but had a homozygous missense mutation (p.R319W) in endothelin receptor type B (EDNRB) gene. The asymptomatic parents had the mutation in a heterozygote state. This mutation has been previously reported in a heterozygous state in a patient with Hirschsprung's disease unaccompanied by WS, but the patient and her parents did not show any symptoms in gastrointestinal tract. Molecular modeling of EDNRB with the p.R319W mutation demonstrated reduction of the positively charged surface area in this region, which might reduce binding ability of EDNRB to G protein and lead to abnormal signal transduction underlying the WS phenotype. Our findings suggested that autosomal recessive mutation in EDNRB may underlie a part of WS1 with the current diagnostic criteria, and supported that Hirschsprung's disease is a multifactorial genetic disease which requires additional factors. Further molecular analysis is necessary to elucidate the gene interaction and to reappraise the current WS classification. Copyright © 2017 Elsevier B.V. All rights reserved.

Homozygous Mutation G539R in the Gene for P450 Oxidoreductase in a Family Previously Diagnosed as Having 17,20-Lyase Deficiency

PubMed Central

Hershkovitz, Eli; Parvari, Ruthi; Wudy, Stefan A.; Hartmann, Michaela F.; Gomes, Larissa G.; Loewental, Neta; Miller, Walter L.

2008-01-01

Context: Very few patients have been described with isolated 17,20-lyase deficiency who have had their mutations in P450c17 (17α-hydroxylase/17,20-lyase) proven by DNA sequencing and in vitro characterization of the mutations. Most patients with 17,20-lyase deficiency have mutations in the domain of P450c17 that interact with the electron-donating redox partner, P450 oxidoreductase (POR). Objective: Our objective was to clarify the genetic and functional basis of isolated 17,20-lyase deficiency in familial cases who were previously reported as having 17,20-lyase deficiency. Patients: Four undervirilized males of an extended Bedouin family were investigated. One of these has previously been reported to carry mutations in the CYP17A1 gene encoding P450c17 causing isolated 17,20-lyase deficiency. Methods: Serum hormones were evaluated before and after stimulation with ACTH. Urinary steroid metabolites were profiled by gas chromatography-mass spectrometry. Exons 1 and 8 of CYP17A1 previously reported to harbor mutations in one of these patients and all 15 coding exons of POR were sequenced. Results: Gas chromatography-mass spectrometry (GC-MS) urinary steroid profiling and serum steroid measurements showed combined deficiencies of 17,20-lyase and 21-hydroxylase. Sequencing of exons 1 and 8 of CYP17A1 in two different laboratories showed no mutations. Sequencing of POR showed that all four patients were homozygous for G539R, a previously studied mutation that retains 46% of normal capacity to support the 17α-hydroxylase activity but only 8% of the 17,20-lyase activity of P450c17. Conclusion: POR deficiency can masquerade clinically as isolated 17,20-lyase deficiency. PMID:18559916

Homozygous mutation G539R in the gene for P450 oxidoreductase in a family previously diagnosed as having 17,20-lyase deficiency.

PubMed

Hershkovitz, Eli; Parvari, Ruthi; Wudy, Stefan A; Hartmann, Michaela F; Gomes, Larissa G; Loewental, Neta; Miller, Walter L

2008-09-01

Very few patients have been described with isolated 17,20-lyase deficiency who have had their mutations in P450c17 (17alpha-hydroxylase/17,20-lyase) proven by DNA sequencing and in vitro characterization of the mutations. Most patients with 17,20-lyase deficiency have mutations in the domain of P450c17 that interact with the electron-donating redox partner, P450 oxidoreductase (POR). Our objective was to clarify the genetic and functional basis of isolated 17,20-lyase deficiency in familial cases who were previously reported as having 17,20-lyase deficiency. Four undervirilized males of an extended Bedouin family were investigated. One of these has previously been reported to carry mutations in the CYP17A1 gene encoding P450c17 causing isolated 17,20-lyase deficiency. Serum hormones were evaluated before and after stimulation with ACTH. Urinary steroid metabolites were profiled by gas chromatography-mass spectrometry. Exons 1 and 8 of CYP17A1 previously reported to harbor mutations in one of these patients and all 15 coding exons of POR were sequenced. Gas chromatography-mass spectrometry (GC-MS) urinary steroid profiling and serum steroid measurements showed combined deficiencies of 17,20-lyase and 21-hydroxylase. Sequencing of exons 1 and 8 of CYP17A1 in two different laboratories showed no mutations. Sequencing of POR showed that all four patients were homozygous for G539R, a previously studied mutation that retains 46% of normal capacity to support the 17alpha-hydroxylase activity but only 8% of the 17,20-lyase activity of P450c17. POR deficiency can masquerade clinically as isolated 17,20-lyase deficiency.

Gain-of-function mutations in RIT1 cause Noonan syndrome, a RAS/MAPK pathway syndrome.

PubMed

Aoki, Yoko; Niihori, Tetsuya; Banjo, Toshihiro; Okamoto, Nobuhiko; Mizuno, Seiji; Kurosawa, Kenji; Ogata, Tsutomu; Takada, Fumio; Yano, Michihiro; Ando, Toru; Hoshika, Tadataka; Barnett, Christopher; Ohashi, Hirofumi; Kawame, Hiroshi; Hasegawa, Tomonobu; Okutani, Takahiro; Nagashima, Tatsuo; Hasegawa, Satoshi; Funayama, Ryo; Nagashima, Takeshi; Nakayama, Keiko; Inoue, Shin-Ichi; Watanabe, Yusuke; Ogura, Toshihiko; Matsubara, Yoichi

2013-07-11

RAS GTPases mediate a wide variety of cellular functions, including cell proliferation, survival, and differentiation. Recent studies have revealed that germline mutations and mosaicism for classical RAS mutations, including those in HRAS, KRAS, and NRAS, cause a wide spectrum of genetic disorders. These include Noonan syndrome and related disorders (RAS/mitogen-activated protein kinase [RAS/MAPK] pathway syndromes, or RASopathies), nevus sebaceous, and Schimmelpenning syndrome. In the present study, we identified a total of nine missense, nonsynonymous mutations in RIT1, encoding a member of the RAS subfamily, in 17 of 180 individuals (9%) with Noonan syndrome or a related condition but with no detectable mutations in known Noonan-related genes. Clinical manifestations in the RIT1-mutation-positive individuals are consistent with those of Noonan syndrome, which is characterized by distinctive facial features, short stature, and congenital heart defects. Seventy percent of mutation-positive individuals presented with hypertrophic cardiomyopathy; this frequency is high relative to the overall 20% incidence in individuals with Noonan syndrome. Luciferase assays in NIH 3T3 cells showed that five RIT1 alterations identified in children with Noonan syndrome enhanced ELK1 transactivation. The introduction of mRNAs of mutant RIT1 into 1-cell-stage zebrafish embryos was found to result in a significant increase of embryos with craniofacial abnormalities, incomplete looping, a hypoplastic chamber in the heart, and an elongated yolk sac. These results demonstrate that gain-of-function mutations in RIT1 cause Noonan syndrome and show a similar biological effect to mutations in other RASopathy-related genes. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Congenital nephrogenic diabetes insipidus with a novel mutation in the aquaporin 2 gene.

PubMed

Park, Youn Jong; Baik, Haing Woon; Cheong, Hae Il; Kang, Ju Hyung

2014-07-01

Congenital nephrogenic diabetes insipidus (CNDI) is a rare disorder caused by mutations of the arginine vasopressin (AVP) V2 receptor or aquaporin 2 ( AQP2 ) genes. The current study presented the case of CNDI in a 1-month-old male with a novel mutation in the AQP2 gene. The patient was referred due to the occurrence of hypernatremia and mild-intermittent fever since birth. An AVP stimulation test was compatible with CNDI as there was no significant response to desmopressin. Molecular genetic analysis demonstrated two mutations in exon 1 of the AQP2 gene: C to T transition, which resulted in a missense mutation of 108 Thr (ACG) to Met (ATG); and a 127, 128 delCA, which resulted in a deletion mutation of glutamine in position 43 at codon CAG as the first affected amino acid, with the new reading frame endign in a termination codon at position 62. The molecular genetic analysis of the parents showed that the missense mutation was inherited maternally and the deletion mutation was inherited paternally. The parents showed no signs or symptoms of CNDI, indicating autosomal recessive inheritance. The 108 Thr (ACG) to Met (ATG) mutation was confirmed as a novel mutation. Therefore, the molecular identification of the AQP2 gene has clinical significance, as early recognition of CNDI in infants that show only non-specific symptoms, can be facilitated. Thus, repeated episodes of dehydration, which may cause physical and mental retardation can be avoided.

Congenital nephrogenic diabetes insipidus with a novel mutation in the aquaporin 2 gene

PubMed Central

PARK, YOUN JONG; BAIK, HAING WOON; CHEONG, HAE IL; KANG, JU HYUNG

2014-01-01

Congenital nephrogenic diabetes insipidus (CNDI) is a rare disorder caused by mutations of the arginine vasopressin (AVP) V2 receptor or aquaporin 2 (AQP2) genes. The current study presented the case of CNDI in a 1-month-old male with a novel mutation in the AQP2 gene. The patient was referred due to the occurrence of hypernatremia and mild-intermittent fever since birth. An AVP stimulation test was compatible with CNDI as there was no significant response to desmopressin. Molecular genetic analysis demonstrated two mutations in exon 1 of the AQP2 gene: C to T transition, which resulted in a missense mutation of 108Thr (ACG) to Met (ATG); and a 127, 128 delCA, which resulted in a deletion mutation of glutamine in position 43 at codon CAG as the first affected amino acid, with the new reading frame endign in a termination codon at position 62. The molecular genetic analysis of the parents showed that the missense mutation was inherited maternally and the deletion mutation was inherited paternally. The parents showed no signs or symptoms of CNDI, indicating autosomal recessive inheritance. The 108Thr (ACG) to Met (ATG) mutation was confirmed as a novel mutation. Therefore, the molecular identification of the AQP2 gene has clinical significance, as early recognition of CNDI in infants that show only non-specific symptoms, can be facilitated. Thus, repeated episodes of dehydration, which may cause physical and mental retardation can be avoided. PMID:24944815

The prevalence of CTNNB1 mutations in primary aldosteronism and consequences for clinical outcomes.

PubMed

Wu, Vin-Cent; Wang, Shuo-Meng; Chueh, Shih-Chieh Jeff; Yang, Shao-Yu; Huang, Kuo-How; Lin, Yen-Hung; Wang, Jian-Jhong; Connolly, Rory; Hu, Ya-Hui; Gomez-Sanchez, Celso E; Peng, Kang-Yung; Wu, Kwan-Dun

2017-01-19

Constitutive activation of the Wnt pathway/β-catenin signaling may be important in aldosterone-producing adenoma (APA). However, significant gaps remain in our understanding of the prevalence and clinical outcomes after adrenalectomy in APA patients harboring CTNNB1 mutations. The molecular expression of CYP11B2 and gonadal receptors in adenomas were also explored. Adenomas from 219 APA patients (95 men; 44.2%; aged 50.5 ± 11.9 years) showed a high rate of somatic mutations (n = 128, 58.4%). The majority of them harbored KCNJ5 mutations (n = 116, 52.9%); 8 patients (3.7%, 6 women) had CTNNB1 mutations. Patients with APAs harboring CTNNB1 mutations were older and had shorter duration of hypertension. After adrenalectomy, CTNNB1 mutation carriers had a higher possibility (87.5%) of residual hypertension than other APA patients. APAs harboring CTNNB1 mutations have heterogeneous staining of β-catenin and variable expression of gonadal receptors and both CYP11B1 and CYP11B2. This suggests that CTNNB1 mutations may be more related to tumorigenesis rather than excessive aldosterone production.

Compound heterozygous mutations in the SRD5A2 gene exon 4 in a male pseudohermaphrodite patient of Chinese origin.

PubMed

Fernández-Cancio, Mónica; Nistal, Manuel; Gracia, Ricardo; Molina, M Antonia; Tovar, Juan Antonio; Esteban, Cristina; Carrascosa, Antonio; Audí, Laura

2004-01-01

The goal of this study was to perform 5-alpha-reductase type 2 gene (SRD5A2) analysis in a male pseudohermaphrodite (MPH) patient with normal testosterone (T) production and normal androgen receptor (AR) gene coding sequences. A patient of Chinese origin with ambiguous genitalia at 14 months, a 46,XY karyotype, and normal T secretion under human chorionic gonadotropin (hCG) stimulation underwent a gonadectomy at 20 months. Exons 1-8 of the AR gene and exons 1-5 of the SRD5A2 gene were sequenced from peripheral blood DNA. AR gene coding sequences were normal. SRD5A2 gene analysis revealed 2 consecutive mutations in exon 4, each located in a different allele: 1) a T nucleotide deletion, which predicts a frameshift mutation from codon 219, and 2) a missense mutation at codon 227, where the substitution of guanine (CGA) by adenine (CAA) predicts a glutamine replacement of arginine (R227Q). Testes located in the inguinal canal showed a normal morphology for age. The patient was a compound heterozygote for SRD5A2 mutations, carrying 2 mutations in exon 4. The patient showed an R227Q mutation that has been described in an Asian population and MPH patients, along with a novel frameshift mutation, Tdel219. Testis morphology showed that, during early infancy, the 5-alpha-reductase enzyme deficiency may not have affected interstitial or tubular development.

Mutation rates at 42 Y chromosomal short tandem repeats in Chinese Han population in Eastern China.

PubMed

Wu, Weiwei; Ren, Wenyan; Hao, Honglei; Nan, Hailun; He, Xin; Liu, Qiuling; Lu, Dejian

2018-01-31

Mutation analysis of 42 Y chromosomal short tandem repeats (Y-STRs) loci was performed using a sample of 1160 father-son pairs from the Chinese Han population in Eastern China. The results showed that the average mutation rate across the 42 Y-STR loci was 0.0041 (95% CI 0.0036-0.0047) per locus per generation. The locus-specific mutation rates varied from 0.000 to 0.0190. No mutation was found at DYS388, DYS437, DYS448, DYS531, and GATA_H4. DYS627, DYS570, DYS576, and DYS449 could be classified as rapidly mutating Y-STRs, with mutation rates higher than 1.0 × 10 -2 . DYS458, DYS630, and DYS518 were moderately mutating Y-STRs, with mutation rates ranging from 8 × 10 -3 to 1 × 10 -2 . Although the characteristics of the Y-STR mutations were consistent with those in previous studies, mutation rate differences between our data and previous published data were found at some rapidly mutating Y-STRs. The single-copy loci located on the short arm of the Y chromosome (Yp) showed relatively higher mutation rates more frequently than the multi-copy loci. These results will not only extend the data for Y-STR mutations but also be important for kinship analysis, paternal lineage identification, and family relationship reconstruction in forensic Y-STR analysis.

EYA1 mutations associated with the branchio-oto-renal syndrome result in defective otic development in Xenopus laevis

PubMed Central

Li, Youe; Manaligod, Jose M.; Weeks, Daniel L.

2009-01-01

Background information. The BOR (branchio-oto-renal) syndrome is a dominant disorder most commonly caused by mutations in the EYA1 (Eyes Absent 1) gene. Symptoms commonly include deafness and renal anomalies. Results. We have used the embryos of the frog Xenopus laevis as an animal model for early ear development to examine the effects of different EYA1 mutations. Four eya1 mRNAs encoding proteins correlated with congenital anomalies in human were injected into early stage embryos. We show that the expression of mutations associated with BOR, even in the presence of normal levels of endogenous eya1 mRNA, leads to morphologically abnormal ear development as measured by overall otic vesicle size, establishment of sensory tissue and otic innervation. The molecular consequences of mutant eya1 expression were assessed by QPCR (quantitative PCR) analysis and in situ hybridization. Embryos expressing mutant eya1 showed altered levels of multiple genes (six1, dach, neuroD, ngnr-1 and nt3) important for normal ear development. Conclusions. These studies lend support to the hypothesis that dominant-negative effects of EYA1 mutations may have a role in the pathogenesis of BOR. PMID:19951260

Structural Impact of Three Parkinsonism-Associated Missense Mutations on Human DJ-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lakshminarasimhan, M.; Maldonado, M.T.; Zhou, W.

2009-05-20

A number of missense mutations in the oxidative stress response protein DJ-1 are implicated in rare forms of familial Parkinsonism. The best-characterized Parkinsonian DJ-1 missense mutation, L166P, disrupts homodimerization and results in a poorly folded protein. The molecular basis by which the other Parkinsonism-associated mutations disrupt the function of DJ-1, however, is incompletely understood. In this study we show that three different Parkinsonism-associated DJ-1 missense mutations (A104T, E163K, and M26I) reduce the thermal stability of DJ-1 in solution by subtly perturbing the structure of DJ-1 without causing major folding defects or loss of dimerization. Atomic resolution X-ray crystallography shows thatmore » the A104T substitution introduces water and a discretely disordered residue into the core of the protein, E163K disrupts a key salt bridge with R145, and M26I causes packing defects in the core of the dimer. The deleterious effect of each Parkinsonism-associated mutation on DJ-1 is dissected by analysis of engineered substitutions (M26L, A104V, and E163K/R145E) that partially alleviate each of the defects introduced by the A104T, E163K and M26I mutations. In total, our results suggest that the protective function of DJ-1 can be compromised by diverse perturbations in its structural integrity, particularly near the junctions of secondary structural elements.« less

Variation of p53 mutational spectra between carcinoma of the upper and lower respiratory tract.

PubMed

Law, J C; Whiteside, T L; Gollin, S M; Weissfeld, J; El-Ashmawy, L; Srivastava, S; Landreneau, R J; Johnson, J T; Ferrell, R E

1995-07-01

Mutations of the p53 tumor suppressor gene are the most common genetic alterations associated with human cancer. Tumor-associated p53 mutations often show characteristic tissue-specific profiles which may infer environmentally induced mutational mechanisms. The p53 mutational frequency and spectrum were determined for 95 carcinomas of the upper and lower respiratory tract (32 lung and 63 upper respiratory tract). Mutations were identified at a frequency of 30% in upper respiratory tract (URT) tumors and 31% in lung tumors. All 29 identified mutations were single-base substitutions. Comparison of the frequency of specific base substitutions between lung and URT showed a striking difference. Transitions occurred at a frequency of 68% in URT, but only 30% in lung. Mutations involving G:C-->A:T transitions, which are commonly reported in gastric and esophageal tumors, were the most frequently identified alteration in URT (11/19). Mutations involving G:C-->T:A transversions, which were relatively common in lung tumors (3/10) and are representative of tobacco smoke-induced mutations were rare in URT tumors (1/19). Interestingly, G:C-->A:T mutations at CpG sites, which are characteristic of endogenous processes, were observed frequently in URT tumors (9/19) but only rarely in lung tumors (1/10), suggesting that both endogenous and exogenous factors are responsible for the observed differences in mutational spectra between the upper and lower respiratory systems.

Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento.

PubMed

Ma, Li; Sheng, Xun-Lun; Li, Hui-Ping; Zhang, Fang-Xia; Liu, Ya-Ni; Rong, Wei-Ning; Zhang, Jian-Ling

2013-01-01

To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.

Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento

PubMed Central

Ma, Li; Sheng, Xun-Lun; Li, Hui-Ping; Zhang, Fang-Xia; Liu, Ya-Ni; Rong, Wei-Ning; Zhang, Jian-Ling

2013-01-01

AIM To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. METHODS Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. RESULTS Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. CONCLUSION The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP. PMID:23991373

Novel Phenotypic and Genotypic Findings in X-Linked Retinoschisis

PubMed Central

Tsang, Stephen H.; Vaclavik, Veronika; Bird, Alan C.; Robson, Anthony G.; Holder, Graham E.

2009-01-01

Objective To describe atypical phenotypes associated with the retinoschisis (X-linked, juvenile) 1 mutation (RS1). Methods Seven patients with multiple fine white dots at the macula and reduced visual acuity were evaluated. Six patients underwent pattern and full-field electroretinography (ERG). On-off ERG, optical coherence tomography, and fundus autofluorescence imaging were performed in some patients. Mutational screening of RS1 was prompted by the ERG findings. Results Fine white dots resembling drusenlike deposits and sometimes associated with retinal pigment epithelial abnormalities were present in the maculae. An electronegative bright-flash ERG configuration was present in all patients tested, and abnormal pattern ERG findings confirmed macular dysfunction. A parafoveal ring of high-density autofluorescence was present in 3 eyes; 1 patient showed high-density foci concordant with the white dots. Optical coherence tomography did not show foveal schisis in 3 of 4 eyes. All patients carried mutations in RS1, including 1 with a novel 206T→C mutation in exon 4. Conclusions Multiple fine white dots at the macula may be the initial fundus feature in RS1 mutation. Electrophysiologic findings suggest dysfunction after phototransduction and enable focused mutational screening. Autofluorescence imaging results suggest early retinal pigment epithelium involvement; a parafoveal ring of high-density autofluorescence has not previously been described in this disorder. PMID:17296904

Germline Mutations of BRCA1 and BRCA2 in Korean Ovarian Cancer Patients: Finding Founder Mutations.

PubMed

Choi, Min Chul; Heo, Jin-Hyung; Jang, Ja-Hyun; Jung, Sang Geun; Park, Hyun; Joo, Won Duk; Lee, Chan; Lee, Je Ho; Lee, Jun Mo; Hwang, Yoon Young; Kim, Seung Jo

2015-10-01

To investigate and analyze the BRCA mutations in Korean ovarian cancer patients with or without family history and to find founder mutations in this group. One hundred two patients who underwent a staging operation for pathologically proven epithelial cancer between January 2013 and December 2014 were enrolled. Thirty-two patients declined to analyze BRCA1/2 gene alterations after genetic counseling and pedigree analysis. Lymphocyte specimens from peripheral blood were assessed for BRCA1/2 by direct sequencing. BRCA genetic test results of 70 patients were available. Eighteen BRCA1/2 mutations and 17 unclassified variations (UVs) were found. Five of the BRCA1/2 mutations and 4 of the UVs were not reported in the Breast Cancer Information Core database. One BRCA2 UV (8665_8667delGGA) was strongly suspicious to be a deleterious mutation. BRCA1/2 mutations were identified in 11 (61.1%) of 18 patients with a family history and in 7 (13.5%) of 52 patients without a family history.Candidates for founder mutations in Korean ovarian cancer patients were assessed among 39 BRCA1/2 mutations from the present study and from literature reviews. The analysis showed that 1041_1043delAGCinsT (n = 4; 10.2%) and 3746insA (n = 4; 10.2%) were possible BRCA1 founder mutations. Only one of the BRCA2 mutations (5804_5807delTTAA) was repeated twice (n = 2; 5.1%). The prevalence of BRCA1/2 mutations in Korean ovarian cancer patients irrespective of the family history was significantly higher than previously reported. Possible founder mutations in Korean ovarian cancer patients were identified.

Isocitrate dehydrogenase 1 and 2 mutations in cholangiocarcinoma.

PubMed

Kipp, Benjamin R; Voss, Jesse S; Kerr, Sarah E; Barr Fritcher, Emily G; Graham, Rondell P; Zhang, Lizhi; Highsmith, W Edward; Zhang, Jun; Roberts, Lewis R; Gores, Gregory J; Halling, Kevin C

2012-10-01

Somatic mutations in isocitrate dehydrogenase 1 and 2 genes are common in gliomas and help stratify patients with brain cancer into histologic and molecular subtypes. However, these mutations are considered rare in other solid tumors. The aims of this study were to determine the frequency of isocitrate dehydrogenase 1 and 2 mutations in cholangiocarcinoma and to assess histopathologic differences between specimens with and without an isocitrate dehydrogenase mutation. We sequenced 94 formalin-fixed, paraffin-embedded cholangiocarcinoma (67 intrahepatic and 27 extrahepatic) assessing for isocitrate dehydrogenase 1 (codon 132) and isocitrate dehydrogenase 2 (codons 140 and 172) mutations. Multiple histopathologic characteristics were also evaluated and compared with isocitrate dehydrogenase 1/2 mutation status. Of the 94 evaluated specimens, 21 (22%) had a mutation including 14 isocitrate dehydrogenase 1 and 7 isocitrate dehydrogenase 2 mutations. Isocitrate dehydrogenase mutations were more frequently observed in intrahepatic cholangiocarcinoma than in extrahepatic cholangiocarcinoma (28% versus 7%, respectively; P = .030). The 14 isocitrate dehydrogenase 1 mutations were R132C (n = 9), R132S (n = 2), R132G (n = 2), and R132L (n = 1). The 7 isocitrate dehydrogenase 2 mutations were R172K (n = 5), R172M (n = 1), and R172G (n = 1). Isocitrate dehydrogenase mutations were more frequently observed in tumors with clear cell change (P < .001) and poorly differentiated histology (P = .012). The results of this study show for the first time that isocitrate dehydrogenase 1 and 2 genes are mutated in cholangiocarcinoma. The results of this study are encouraging because it identifies a new potential target for genotype-directed therapeutic trials and may represent a potential biomarker for earlier detection of cholangiocarcinoma in a subset of cases. Copyright © 2012 Elsevier Inc. All rights reserved.

Ferroportin (Q248H) mutations in African families with dietary iron overload.

PubMed

McNamara, Lynne; Gordeuk, Victor R; MacPhail, A Patrick

2005-12-01

Dietary iron overload found in sub-Saharan Africa might be caused by an interaction between dietary iron and an iron-loading gene. Caucasian people with ferroportin gene mutations have iron overload histologically similar to that found in African patients with iron overload. Ferroportin is also implicated in the hypoferremic response to inflammation. The prevalence of the ferroportin Q248H mutation, unique to African people, and its association with dietary iron overload, mean cell volume (MCV) and C-reactive protein (CRP) were examined in 19 southern African families. Polymerase chain reaction (PCR) and restriction enzyme digestion were used to identify the Q248H mutation. Statistical analysis was carried out to correlate the presence of the mutation with markers of iron overload and inflammation. We identified three (1.4%) Q248H homozygotes and 53 (24.1%) heterozygotes in the families examined in the present study. There was no increased prevalence of the mutation in index subjects or their families. Logistic regression showed significantly higher serum ferritin concentrations with the mutation. The mean cell volume (MCV) was significantly lower, and the serum CRP significantly higher in subjects who carried the mutation. The present study of 19 families with African iron overload failed to show evidence that the ferroportin (Q248H) mutation is responsible for the condition. Logistic regression, correcting for factors influencing iron status, did show increased ferritin levels in individuals with the mutation. The strong association with low MCV suggests the possibility that the ferroportin (Q248H) mutation might interfere with iron supply, whereas the elevated serum CRP might indicate that the ferroportin mutation influences the inflammatory response in African populations. Copyright 2005 Blackwell Publishing Asia Pty Ltd.

Reduced BRCA1 transcript levels in freshly isolated blood leukocytes from BRCA1 mutation carriers is mutation specific.

PubMed

Chehade, Rania; Pettapiece-Phillips, Rachael; Salmena, Leonardo; Kotlyar, Max; Jurisica, Igor; Narod, Steven A; Akbari, Mohammad R; Kotsopoulos, Joanne

2016-08-17

BRCA1 mutation carriers face a high lifetime risk of developing both breast and ovarian cancer. Haploinsufficiency is thought to predispose these women to cancer by reducing the pool of available BRCA1 transcript and protein, thereby compromising BRCA1 function. Whether or not cancer-free BRCA1 mutation carriers have lower messenger (m)RNA transcript levels in peripheral blood leukocytes has not been evaluated. The primary aim of this study was to characterize an association between BRCA1 mutation status and BRCA1 mRNA leukocyte expression levels among healthy women with a BRCA1 mutation. RNA was extracted from freshly isolated peripheral blood leukocytes of 58 cancer-free, female participants (22 BRCA1 mutation carriers and 36 non-carriers). The expression levels of 236 cancer-associated genes, including BRCA1, were quantified using the Human Cancer Reference gene panel from the Nanostring Technologies nCounter Analysis System. Multivariate modeling demonstrated that carrying a BRCA1 mutation was the most significant predictor of BRCA1 mRNA levels. BRCA1 mRNA levels were significantly lower in BRCA1 mutation carriers compared to non-carriers (146.7 counts vs. 175.1 counts; P = 0.002). Samples with BRCA1 mutations within exon 11 had lower BRCA1 mRNA levels than samples with mutations within the 5' and 3' regions of the BRCA1 gene (122.1 counts vs. 138.9 and 168.6 counts, respectively; P = 0.003). Unsupervised hierarchical clustering of gene expression profiles from freshly isolated blood leukocytes revealed that BRCA1 mutation carriers cluster more closely with other BRCA1 mutation carriers than with BRCA1 wild-type samples. Moreover, a set of 17 genes (including BRCA1) previously shown to be involved in carcinogenesis, were differentially expressed between BRCA1 mutation carriers and non-carriers. Overall, these findings support the concept of BRCA1 haploinsufficiency wherein a specific mutation results in dosage-dependent alteration of BRCA1 at the transcriptional level. This study is the first to show a decrease in BRCA1 mRNA expression in freshly isolated blood leukocytes from healthy, unaffected BRCA1 mutation carriers.

Prognostic significance of IDH 1 mutation in patients with glioblastoma multiforme.

PubMed

Khan, Inamullah; Waqas, Muhammad; Shamim, Muhammad Shahzad

2017-05-01

Focus of brain tumour research is shifting towards tumour genesis and genetics, and possible development of individualized treatment plans. Genetic analysis shows recurrent mutation in isocitrate dehydrogenase (IDH1) gene in most Glioblastoma multiforme (GBM) cells. In this review we evaluated the prognostic significance of IDH 1 mutation on the basis of published evidence. Multiple retrospective clinical analyses correlate the presence of IDH1 mutation in GBM with good prognostic outcomes compared to wild-type IDH1. A systematic review reported similar results. Based on the review of current literature IDH1 mutation is an independent factor for longer overall survival (OS) and progression free survival (PFS) in GBM patients when compared to wild-type IDH1. The prognostic significance opens up new avenues for treatment.

Oncogenic mutations in KEAP1 disturbing inhibitory Nrf2-Keap1 interaction: Activation of antioxidative pathway in papillary thyroid carcinoma.

PubMed

Danilovic, Debora Lucia Seguro; de Mello, Evandro Sobroza; Frazzato, Eliana Salgado Turri; Wakamatsu, Alda; de Lima Jorge, Alexander Augusto; Hoff, Ana Oliveira; Marui, Suemi

2018-06-01

Nuclear factor erythroid 2-like 2 (NFE2L2) encodes Nrf2, transcription factor of antioxidative genes. In the presence of reactive oxygen species, Keap1 (Kelch-ECH-associating protein-1) inhibitor complex undergoes conformational changes disrupting Keap1-Nrf2 binding and Nrf2 translocates into nucleus. We evaluated the presence of mutations in NFE2L2 and KEAP1 in papillary thyroid carcinomas (PTCs) and correlated them with clinical presentation. Coding regions of NFE2L2 and KEAP1 were sequenced in 131 patients with PTC. Clinical and histopathological features were analyzed. Immunohistochemical analysis of Nrf2 expression was performed in mutated carcinomas. Although no mutations were found in NFE2L2, missense mutations in KEAP1 were observed in 6 patients with PTC (4.6%). Immunohistochemistry showed increased Nrf2 expression in nuclei of all mutated carcinomas, which presented poor prognostic features in histopathology. We identified mutations in KEAP1 associated with Nrf2 overexpression in PTC. Mutations favored disruption of inhibitory interaction Nrf2-Keap1 to enable increased antioxidant Nrf2 activity, possibly with prognostic consequences. © 2018 Wiley Periodicals, Inc.

Molecular and Clinical Characterization of Albinism in a Large Cohort of Italian Patients

PubMed Central

Gargiulo, Annagiusi; Testa, Francesco; Rossi, Settimio; Di Iorio, Valentina; Fecarotta, Simona; de Berardinis, Teresa; Iovine, Antonello; Magli, Adriano; Signorini, Sabrina; Fazzi, Elisa; Galantuomo, Maria Silvana; Fossarello, Maurizio; Montefusco, Sandro; Ciccodicola, Alfredo; Neri, Alberto; Macaluso, Claudio; Simonelli, Francesca; Surace, Enrico Maria

2011-01-01

Purpose. The purpose of this study was to identify the molecular basis of albinism in a large cohort of Italian patients showing typical ocular landmarks of the disease and to provide a full characterization of the clinical ophthalmic manifestations. Methods. DNA samples from 45 patients with ocular manifestations of albinism were analyzed by direct sequencing analysis of five genes responsible for albinism: TYR, P, TYRP1, SLC45A2 (MATP), and OA1. All patients studied showed a variable degree of skin and hair hypopigmentation. Eighteen patients with distinct mutations in each gene associated with OCA were evaluated by detailed ophthalmic analysis, optical coherence tomography (OCT), and fundus autofluorescence. Results. Disease-causing mutations were identified in more than 95% of analyzed patients with OCA (28/45 [62.2%] cases with two or more mutations; 15/45 [33.3%] cases with one mutation). Thirty-five different mutant alleles were identified of which 15 were novel. Mutations in TYR were the most frequent (73.3%), whereas mutations in P occurred more rarely (13.3%) than previously reported. Novel mutations were also identified in rare loci such as TYRP1 and MATP. Mutations in the OA1 gene were not detected. Clinical assessment revealed that patients with iris and macular pigmentation had significantly higher visual acuity than did severe hypopigmented phenotypes. Conclusions. TYR gene mutations represent a relevant cause of oculocutaneous albinism in Italy, whereas mutations in P present a lower frequency than that found in other populations. Clinical analysis revealed that the severity of the ocular manifestations depends on the degree of retinal pigmentation. PMID:20861488

TERT promoter mutations in bladder cancer affect patient survival and disease recurrence through modification by a common polymorphism.

PubMed

Rachakonda, P Sivaramakrishna; Hosen, Ismail; de Verdier, Petra J; Fallah, Mahdi; Heidenreich, Barbara; Ryk, Charlotta; Wiklund, N Peter; Steineck, Gunnar; Schadendorf, Dirk; Hemminki, Kari; Kumar, Rajiv

2013-10-22

The telomerase reverse transcriptase (TERT) promoter, an important element of telomerase expression, has emerged as a target of cancer-specific mutations. Originally described in melanoma, the mutations in TERT promoter have been shown to be common in certain other tumor types that include glioblastoma, hepatocellular carcinoma, and bladder cancer. To fully define the occurrence and effect of the TERT promoter mutations, we investigated tumors from a well-characterized series of 327 patients with urothelial cell carcinoma of bladder. The somatic mutations, mainly at positions -124 and -146 bp from ATG start site that create binding motifs for E-twenty six/ternary complex factors (Ets/TCF), affected 65.4% of the tumors, with even distribution across different stages and grades. Our data showed that a common polymorphism rs2853669, within a preexisting Ets2 binding site in the TERT promoter, acts as a modifier of the effect of the mutations on survival and tumor recurrence. The patients with the mutations showed poor survival in the absence [hazard ratio (HR) 2.19, 95% confidence interval (CI) 1.02-4.70] but not in the presence (HR 0.42, 95% CI 0.18-1.01) of the variant allele of the polymorphism. The mutations in the absence of the variant allele were highly associated with the disease recurrence in patients with Tis, Ta, and T1 tumors (HR 1.85, 95% CI 1.11-3.08). The TERT promoter mutations are the most common somatic lesions in bladder cancer with clinical implications. The association of the mutations with patient survival and disease recurrence, subject to modification by a common polymorphism, can be a unique putative marker with individualized prognostic potential.

Cone structure in patients with usher syndrome type III and mutations in the Clarin 1 gene.

PubMed

Ratnam, Kavitha; Västinsalo, Hanna; Roorda, Austin; Sankila, Eeva-Marja K; Duncan, Jacque L

2013-01-01

To study macular structure and function in patients with Usher syndrome type III (USH3) caused by mutations in the Clarin 1 gene (CLRN1). High-resolution macular images were obtained by adaptive optics scanning laser ophthalmoscopy and spectral domain optical coherence tomography in 3 patients with USH3 and were compared with those of age-similar control subjects. Vision function measures included best-corrected visual acuity, kinetic and static perimetry, and full-field electroretinography. Coding regions of the CLRN1 gene were sequenced. CLRN1 mutations were present in all the patients; a 20-year-old man showed compound heterozygous mutations (p.N48K and p.S188X), and 2 unrelated women aged 25 and 32 years had homozygous mutations (p.N48K). Best-corrected visual acuity ranged from 20/16 to 20/40, with scotomas beginning at 3° eccentricity. The inner segment-outer segment junction or the inner segment ellipsoid band was disrupted within 1° to 4° of the fovea, and the foveal inner and outer segment layers were significantly thinner than normal. Cones near the fovea in patients 1 and 2 showed normal spacing, and the preserved region ended abruptly. Retinal pigment epithelial cells were visible in patient 3 where cones were lost. Cones were observed centrally but not in regions with scotomas, and retinal pigment epithelial cells were visible in regions without cones in patients with CLRN1 mutations. High-resolution measures of retinal structure demonstrate patterns of cone loss associated with CLRN1 mutations. These findings provide insight into the effect of CLRN1 mutations on macular cone structure, which has implications for the development of treatments for USH3. clinicaltrials.gov Identifier: NCT00254605.

In vivo and in vitro functional characterization of Andersen's syndrome mutations.

PubMed

Bendahhou, Saïd; Fournier, Emmanuel; Sternberg, Damien; Bassez, Guillaume; Furby, Alain; Sereni, Carole; Donaldson, Matthew R; Larroque, Marie-Madeleine; Fontaine, Bertrand; Barhanin, Jacques

2005-06-15

The inward rectifier K(+) channel Kir2.1 carries all Andersen's syndrome mutations identified to date. Patients exhibit symptoms of periodic paralysis, cardiac dysrhythmia and multiple dysmorphic features. Here, we report the clinical manifestations found in three families with Andersen's syndrome. Molecular genetics analysis identified two novel missense mutations in the KCNJ2 gene leading to amino acid changes C154F and T309I of the Kir2.1 open reading frame. Patch clamp experiments showed that the two mutations produced a loss of channel function. When co-expressed with Kir2.1 wild-type (WT) channels, both mutations exerted a dominant-negative effect leading to a loss of the inward rectifying K(+) current. Confocal microscopy imaging in HEK293 cells is consistent with a co-assembly of the EGFP-fused mutant proteins with WT channels and proper traffick to the plasma membrane to produce silent channels alone or as hetero-tetramers with WT. Functional expression in C2C12 muscle cell line of newly as well as previously reported Andersen's syndrome mutations confirmed that these mutations act through a dominant-negative effect by altering channel gating or trafficking. Finally, in vivo electromyographic evaluation showed a decrease in muscle excitability in Andersen's syndrome patients. We hypothesize that Andersen's syndrome-associated mutations and hypokalaemic periodic paralysis-associated calcium channel mutations may lead to muscle membrane hypoexcitability via a common mechanism.

In vivo and in vitro functional characterization of Andersen's syndrome mutations

PubMed Central

Bendahhou, Saïd; Fournier, Emmanuel; Sternberg, Damien; Bassez, Guillaume; Furby, Alain; Sereni, Carole; Donaldson, Matthew R; Larroque, Marie-Madeleine; Fontaine, Bertrand; Barhanin, Jacques

2005-01-01

The inward rectifier K+ channel Kir2.1 carries all Andersen's syndrome mutations identified to date. Patients exhibit symptoms of periodic paralysis, cardiac dysrhythmia and multiple dysmorphic features. Here, we report the clinical manifestations found in three families with Andersen's syndrome. Molecular genetics analysis identified two novel missense mutations in the KCNJ2 gene leading to amino acid changes C154F and T309I of the Kir2.1 open reading frame. Patch clamp experiments showed that the two mutations produced a loss of channel function. When co-expressed with Kir2.1 wild-type (WT) channels, both mutations exerted a dominant-negative effect leading to a loss of the inward rectifying K+ current. Confocal microscopy imaging in HEK293 cells is consistent with a co-assembly of the EGFP-fused mutant proteins with WT channels and proper traffick to the plasma membrane to produce silent channels alone or as hetero-tetramers with WT. Functional expression in C2C12 muscle cell line of newly as well as previously reported Andersen's syndrome mutations confirmed that these mutations act through a dominant-negative effect by altering channel gating or trafficking. Finally, in vivo electromyographic evaluation showed a decrease in muscle excitability in Andersen's syndrome patients. We hypothesize that Andersen's syndrome-associated mutations and hypokalaemic periodic paralysis-associated calcium channel mutations may lead to muscle membrane hypoexcitability via a common mechanism. PMID:15831539

Novel POC1A mutation in primordial dwarfism reveals new insights for centriole biogenesis.

PubMed

Koparir, Asuman; Karatas, Omer F; Yuceturk, Betul; Yuksel, Bayram; Bayrak, Ali O; Gerdan, Omer F; Sagiroglu, Mahmut S; Gezdirici, Alper; Kirimtay, Koray; Selcuk, Ece; Karabay, Arzu; Creighton, Chad J; Yuksel, Adnan; Ozen, Mustafa

2015-10-01

POC1A encodes a WD repeat protein localizing to centrioles and spindle poles and is associated with short stature, onychodysplasia, facial dysmorphism and hypotrichosis (SOFT) syndrome. These main features are related to the defect in cell proliferation of chondrocytes in growth plate. In the current study, we aimed at identifying the molecular basis of two patients with primordial dwarfism (PD) in a single family through utilization of whole-exome sequencing. A novel homozygous p.T120A missense mutation was detected in POC1A in both patients, a known causative gene of SOFT syndrome, and confirmed using Sanger sequencing. To test the pathogenicity of the detected mutation, primary fibroblast cultures obtained from the patients and a control individual were used. For evaluating the global gene expression profile of cells carrying p.T120A mutation in POC1A, we performed the gene expression array and compared their expression profiles to those of control fibroblast cells. The gene expression array analysis showed that 4800 transcript probes were significantly deregulated in cells with p.T120A mutation in comparison to the control. GO term association results showed that deregulated genes are mostly involved in the extracellular matrix and cytoskeleton. Furthermore, the p.T120A missense mutation in POC1A caused the formation of abnormal mitotic spindle structure, including supernumerary centrosomes, and changes in POC1A were accompanied by alterations in another centrosome-associated WD repeat protein p80-katanin. As a result, we identified a novel mutation in POC1A of patients with PD and showed that this mutation causes the formation of multiple numbers of centrioles and multipolar spindles with abnormal chromosome arrangement. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Ultra-deep sequencing confirms immunohistochemistry as a highly sensitive and specific method for detecting BRAF V600E mutations in colorectal carcinoma.

PubMed

Rössle, Matthias; Sigg, Michèle; Rüschoff, Jan H; Wild, Peter J; Moch, Holger; Weber, Achim; Rechsteiner, Markus P

2013-11-01

The activating BRAF (V600) mutation is a well-established negative prognostic biomarker in metastatic colorectal carcinoma (CRC). A recently developed monoclonal mouse antibody (clone VE1) has been shown to detect reliably BRAF (V600E) mutated protein by immunohistochemistry (IHC). In this study, we aimed to compare the detection of BRAF (V600E) mutations by IHC, Sanger sequencing (SaS), and ultra-deep sequencing (UDS) in CRC. VE1-IHC was established in a cohort of 68 KRAS wild-type CRCs. The VE1-IHC was only positive in the three patients with a known BRAF (V600E) mutation as assessed by SaS and UDS. The test cohort consisted of 265 non-selected, consecutive CRC samples. Thirty-nine out of 265 cases (14.7%) were positive by VE1-IHC. SaS of 20 randomly selected IHC negative tumors showed BRAF wild-type (20/20). Twenty-four IHC-positive cases were confirmed by SaS (24/39; 61.5%) and 15 IHC-positive cases (15/39; 38.5%) showed a BRAF wild-type by SaS. UDS detected a BRAF (V600E) mutation in 13 of these 15 discordant cases. In one tumor, the mutation frequency was below our threshold for UDS positivity, while in another case, UDS could not be performed due to low DNA amount. Statistical analysis showed sensitivities of 100% and 63% and specificities of 95 and 100% for VE1-IHC and SaS, respectively, compared to combined results of SaS and UDS. Our data suggests that there is high concordance between UDS and IHC using the anti-BRAF(V600E) (VE1) antibody. Thus, VE1 immunohistochemistry is a highly sensitive and specific method in detecting BRAF (V600E) mutations in colorectal carcinoma.

Value and limitations of immunohistochemistry and gene sequencing for detection of the IDH1-R132H mutation in diffuse glioma biopsy specimens.

PubMed

Preusser, Matthias; Wöhrer, Adelheid; Stary, Susanne; Höftberger, Romana; Streubel, Berthold; Hainfellner, Johannes A

2011-08-01

To assess the value of anti-isocitrate dehydrogenase 1 (IDH1) immunohistochemistry for evaluating diffuse gliomas, we analyzed anti-IDH1-R132H immunohistochemistry using monoclonal antibodies DIA-H09 and IMab-1 and IDH1 gene sequencing in formalin-fixed and paraffin-embedded biopsy samples of 95 diffuse gliomas. We found concordant immunostaining results using the 2 antibodies in 94 (98.9%) of the 95 cases, but DIA-H09 generally showed a higher signal-to-background ratio than IMab-1 did. Fifty-five percent of cases showed anti-IDH1-R132H immunostaining of virtually all tumor cells and 15% of only a fraction of tumor cells. All cases with complete or partial immunostaining of the tumor tissue carried the IDH1-R132H mutation. In all cases with negative immunostaining results (approximately 30%), genetic analysis showed IDH1 wild-type or non-R132H-IDH1 mutations. In a single tiny biopsy, both anti-IDH1-R132H antibodies showed immunoreactivity, but genetic testing was inconclusive. Our data confirm anti-IDH1-R132H immunostaining as a reliable method for evaluation of IDH1 gene mutation status. They also suggest the following: (i) in some cases, nonspecific background staining or regional heterogeneity of IDH1-R132H protein expression may necessitate confirmatory genetic analysis; (ii) for individual cases, anti-IDH1-R132H immunostaining may not reliably identify infiltrating tumor cells admixed with preexisting or reactive glial cells; and (iii) in tiny biopsies, immunohistochemistry may be more sensitive for detection of IDH1-R132H mutation than genetic analysis.

Dosage Mutator Genes in Saccharomyces cerevisiae: A Novel Mutator Mode-of-Action of the Mph1 DNA Helicase.

PubMed

Ang, J Sidney; Duffy, Supipi; Segovia, Romulo; Stirling, Peter C; Hieter, Philip

2016-11-01

Mutations that cause genome instability are considered important predisposing events that contribute to initiation and progression of cancer. Genome instability arises either due to defects in genes that cause an increased mutation rate (mutator phenotype), or defects in genes that cause chromosome instability (CIN). To extend the catalog of genome instability genes, we systematically explored the effects of gene overexpression on mutation rate, using a forward-mutation screen in budding yeast. We screened ∼5100 plasmids, each overexpressing a unique single gene, and characterized the five strongest mutators, MPH1 (mutator phenotype 1), RRM3, UBP12, PIF1, and DNA2 We show that, for MPH1, the yeast homolog of Fanconi Anemia complementation group M (FANCM), the overexpression mutator phenotype is distinct from that of mph1Δ. Moreover, while four of our top hits encode DNA helicases, the overexpression of 48 other DNA helicases did not cause a mutator phenotype, suggesting this is not a general property of helicases. For Mph1 overexpression, helicase activity was not required for the mutator phenotype; in contrast Mph1 DEAH-box function was required for hypermutation. Mutagenesis by MPH1 overexpression was independent of translesion synthesis (TLS), but was suppressed by overexpression of RAD27, a conserved flap endonuclease. We propose that binding of DNA flap structures by excess Mph1 may block Rad27 action, creating a mutator phenotype that phenocopies rad27Δ. We believe this represents a novel mutator mode-of-action and opens up new prospects to understand how upregulation of DNA repair proteins may contribute to mutagenesis. Copyright © 2016 by the Genetics Society of America.

Detection of ESR1 mutations in circulating cell-free DNA from patients with metastatic breast cancer treated with palbociclib and letrozole.

PubMed

Gyanchandani, Rekha; Kota, Karthik J; Jonnalagadda, Amruth R; Minteer, Tanya; Knapick, Beth A; Oesterreich, Steffi; Brufsky, Adam M; Lee, Adrian V; Puhalla, Shannon L

2017-09-15

ESR1 mutations are frequently acquired in hormone-resistant metastatic breast cancer (MBC). CDK4/6 inhibition along with endocrine therapy is a promising strategy in hormone receptor-positive MBC. However, the incidence and impact of ESR1 mutations on clinical outcome in patients treated with CDK4/6 inhibitors have not been defined. In this study, we evaluated the frequency of ESR1 mutations in cfDNA from 16 patients with MBC undergoing palbociclib and letrozole therapy. Four common ESR1 mutations (D538G, Y537C, Y537N, and Y537S) were analyzed in serial blood draws using ddPCR. Mutation rate was 31.3% (5/16) (n=3; de novo , n=2; acquired). D538G was the most frequent mutation (n=3), followed by Y537N and Y537S (n=2). One patient showed multiple ESR1 mutations. Mutations were enriched during therapy. Progression-free survival (PFS) and overall survival (OS) were similar in patients with and without mutation detected at any given time during treatment. However, PFS was significantly shorter in patients with ESR1 mutation at initial blood draw (3.3 versus 9.0 months, P-value=0.038). In conclusion, ESR1 mutation prevalence is consistent with recent studies in hormone-refractory breast cancer. Further, treatment with palbociclib and letrozole does not prevent selection of ESR1 mutations in later lines of therapy. Larger studies are warranted to validate these findings.

Detection of ESR1 mutations in circulating cell-free DNA from patients with metastatic breast cancer treated with palbociclib and letrozole

PubMed Central

Gyanchandani, Rekha; Kota, Karthik J.; Jonnalagadda, Amruth R.; Minteer, Tanya; Knapick, Beth A.; Oesterreich, Steffi; Brufsky, Adam M.; Lee, Adrian V.; Puhalla, Shannon L.

2017-01-01

ESR1 mutations are frequently acquired in hormone-resistant metastatic breast cancer (MBC). CDK4/6 inhibition along with endocrine therapy is a promising strategy in hormone receptor-positive MBC. However, the incidence and impact of ESR1 mutations on clinical outcome in patients treated with CDK4/6 inhibitors have not been defined. In this study, we evaluated the frequency of ESR1 mutations in cfDNA from 16 patients with MBC undergoing palbociclib and letrozole therapy. Four common ESR1 mutations (D538G, Y537C, Y537N, and Y537S) were analyzed in serial blood draws using ddPCR. Mutation rate was 31.3% (5/16) (n=3; de novo, n=2; acquired). D538G was the most frequent mutation (n=3), followed by Y537N and Y537S (n=2). One patient showed multiple ESR1 mutations. Mutations were enriched during therapy. Progression-free survival (PFS) and overall survival (OS) were similar in patients with and without mutation detected at any given time during treatment. However, PFS was significantly shorter in patients with ESR1 mutation at initial blood draw (3.3 versus 9.0 months, P-value=0.038). In conclusion, ESR1 mutation prevalence is consistent with recent studies in hormone-refractory breast cancer. Further, treatment with palbociclib and letrozole does not prevent selection of ESR1 mutations in later lines of therapy. Larger studies are warranted to validate these findings. PMID:28978004

Age-related cancer mutations associated with clonal hematopoietic expansion

PubMed Central

Xie, Mingchao; Lu, Charles; Wang, Jiayin; McLellan, Michael D.; Johnson, Kimberly J.; Wendl, Michael C.; McMichael, Joshua F.; Schmidt, Heather K.; Yellapantula, Venkata; Miller, Christopher A.; Ozenberger, Bradley A.; Welch, John S.; Link, Daniel C.; Walter, Matthew J.; Mardis, Elaine R.; Dipersio, John F.; Chen, Feng; Wilson, Richard K.; Ley, Timothy J.; Ding, Li

2015-01-01

Several genetic alterations characteristic of leukemia and lymphoma have been detected in the blood of individuals without apparent hematological malignancies. We analyzed blood-derived sequence data from 2,728 individuals within The Cancer Genome Atlas, and discovered 77 blood-specific mutations in cancer-associated genes, the majority being associated with advanced age. Remarkably, 83% of these mutations were from 19 leukemia/lymphoma-associated genes, and nine were recurrently mutated (DNMT3A, TET2, JAK2, ASXL1, TP53, GNAS, PPM1D, BCORL1 and SF3B1). We identified 14 additional mutations in a very small fraction of blood cells, possibly representing the earliest stages of clonal expansion in hematopoietic stem cells. Comparison of these findings to mutations in hematological malignancies identified several recurrently mutated genes that may be disease initiators. Our analyses show that the blood cells of more than 2% of individuals (5–6% of people older than 70 years) contain mutations that may represent premalignant, initiating events that cause clonal hematopoietic expansion. PMID:25326804

Inhibition of mutant IDH1 decreases D-2-HG levels without affecting tumorigenic properties of chondrosarcoma cell lines.

PubMed

Suijker, Johnny; Oosting, Jan; Koornneef, Annemarie; Struys, Eduard A; Salomons, Gajja S; Schaap, Frank G; Waaijer, Cathelijn J F; Wijers-Koster, Pauline M; Briaire-de Bruijn, Inge H; Haazen, Lizette; Riester, Scott M; Dudakovic, Amel; Danen, Erik; Cleton-Jansen, Anne-Marie; van Wijnen, Andre J; Bovée, Judith V M G

2015-05-20

Mutations in isocitrate dehydrogenase 1 (IDH1) and IDH2 are found in a subset of benign and malignant cartilage tumors, gliomas and leukaemias. The mutant enzyme causes the production of D-2-hydroxyglutarate (D-2-HG), affecting CpG island and histone methylation. While mutations in IDH1/2 are early events in benign cartilage tumors, we evaluated whether these mutations play a role in malignant chondrosarcomas. Compared to IDH1/2 wildtype cell lines, chondrosarcoma cell lines harboring an endogenous IDH1 (n=3) or IDH2 mutation (n=2) showed up to a 100-fold increase in intracellular and extracellular D-2-HG levels. Specific inhibition of mutant IDH1 using AGI-5198 decreased levels of D-2-HG in a dose dependent manner. After 72 hours of treatment one out of three mutant IDH1 cell lines showed a moderate decrease in viability , while D-2-HG levels decreased >90%. Likewise, prolonged treatment (up to 20 passages) did not affect proliferation and migration. Furthermore, global gene expression, CpG island methylation as well as histone H3K4, -9, and -27 trimethylation levels remained unchanged. Thus, while IDH1/2 mutations cause enchondroma, malignant progression towards central chondrosarcoma renders chondrosarcoma growth independent of these mutations. Thus, monotherapy based on inhibition of mutant IDH1 appears insufficient for treatment of inoperable or metastasized chondrosarcoma patients.

Co-inheritance of HNF1a and GCK mutations in a family with maturity-onset diabetes of the young (MODY): implications for genetic testing.

PubMed

López-Garrido, M P; Herranz-Antolín, S; Alija-Merillas, M J; Giralt, P; Escribano, J

2013-09-01

To determine the genetic basis of dominant early-onset diabetes mellitus in two families. Molecular analysis by PCR sequencing of the promoter, the 5' untranslated region (UTR) and exons of both GCK and HNF1A genes was carried out in two families with clinically diagnosed dominant diabetes mellitus. The novel HNF1A c.-154_-160TGGGGGT mutation, located in the 5' UTR, was present in several members of the two families in the heterozygous state. Interestingly, the GCK p.Y61X mutation was also identified in three members of one of the families, and two of them carried both mutations in heterozygosis. To the best of our knowledge, this is the first report of the co-inheritance of GCK and HNF1A mutations and the coexistence of maturity-onset diabetes of the young (MODY) 2, MODY 3 and unusual MODY 2-3 genotypes in the same family. Carriers of both GCK and HNF1A mutations manifested a typical MODY 3 phenotype and showed that the presence of a second mutation in the GCK gene apparently did not modify the clinical outcome, at least at the time of this study. Our data show that co-inheritance of MODY 2 and MODY 3 mutations should be considered, at least in some cases, for accurate genetic testing. © 2012 John Wiley & Sons Ltd.

N-ras Mutation Detection by Pyrosequencing in Adult Patients with Acute Myeloid Leukemia at a Single Institution

PubMed Central

Jeong, Ji Hun; Park, Soon Ho; Park, Mi Jung; Kim, Moon Jin; Kim, Kyung Hee; Park, Pil Whan; Seo, Yiel Hea; Lee, Jae Hoon; Park, Jinny; Hong, Junshik

2013-01-01

Background N-ras mutations are one of the most commonly detected abnormalities of myeloid origin. N-ras mutations result in a constitutively active N-ras protein that induces uncontrolled cell proliferation and inhibits apoptosis. We analyzed N-ras mutations in adult patients with AML at a particular institution and compared pyrosequencing analysis with a direct sequencing method for the detection of N-ras mutations. Methods We analyzed 90 bone marrow samples from 83 AML patients. We detected N-ras mutations in codons 12, 13, and 61 using the pyrosequencing method and subsequently confirmed all data by direct sequencing. Using these methods, we screened the N-ras mutation quantitatively and determined the incidence and characteristic of N-ras mutation. Results The incidence of N-ras mutation was 7.2% in adult AML patients. The patients with N-ras mutations showed significant higher hemoglobin levels (P=0.022) and an increased incidence of FLT3 mutations (P=0.003). We observed 3 cases with N-ras mutations in codon 12 (3.6%), 2 cases in codon 13 (2.4%), and 1 case in codon 61 (1.2%). All the mutations disappeared during chemotherapy. Conclusions There is a low incidence (7.2%) of N-ras mutations in AML patients compared with other populations. Similar data is obtained by both pyrosequencing and direct sequencing. This study showed the correlation between the N-ras mutation and the therapeutic response. However, pyrosequencing provides quantitative data and is useful for monitoring therapeutic responses. PMID:23667841

Mutations involved in Aicardi-Goutières syndrome implicate SAMHD1 as regulator of the innate immune response.

PubMed

Rice, Gillian I; Bond, Jacquelyn; Asipu, Aruna; Brunette, Rebecca L; Manfield, Iain W; Carr, Ian M; Fuller, Jonathan C; Jackson, Richard M; Lamb, Teresa; Briggs, Tracy A; Ali, Manir; Gornall, Hannah; Couthard, Lydia R; Aeby, Alec; Attard-Montalto, Simon P; Bertini, Enrico; Bodemer, Christine; Brockmann, Knut; Brueton, Louise A; Corry, Peter C; Desguerre, Isabelle; Fazzi, Elisa; Cazorla, Angels Garcia; Gener, Blanca; Hamel, Ben C J; Heiberg, Arvid; Hunter, Matthew; van der Knaap, Marjo S; Kumar, Ram; Lagae, Lieven; Landrieu, Pierre G; Lourenco, Charles M; Marom, Daphna; McDermott, Michael F; van der Merwe, William; Orcesi, Simona; Prendiville, Julie S; Rasmussen, Magnhild; Shalev, Stavit A; Soler, Doriette M; Shinawi, Marwan; Spiegel, Ronen; Tan, Tiong Y; Vanderver, Adeline; Wakeling, Emma L; Wassmer, Evangeline; Whittaker, Elizabeth; Lebon, Pierre; Stetson, Daniel B; Bonthron, David T; Crow, Yanick J

2009-07-01

Aicardi-Goutières syndrome is a mendelian mimic of congenital infection and also shows overlap with systemic lupus erythematosus at both a clinical and biochemical level. The recent identification of mutations in TREX1 and genes encoding the RNASEH2 complex and studies of the function of TREX1 in DNA metabolism have defined a previously unknown mechanism for the initiation of autoimmunity by interferon-stimulatory nucleic acid. Here we describe mutations in SAMHD1 as the cause of AGS at the AGS5 locus and present data to show that SAMHD1 may act as a negative regulator of the cell-intrinsic antiviral response.

Mutations involved in Aicardi-Goutières syndrome implicate SAMHD1 as regulator of the innate immune response

PubMed Central

Rice, Gillian I; Bond, Jacquelyn; Asipu, Aruna; Brunette, Rebecca L; Manfield, Iain W; Carr, Ian M; Fuller, Jonathan C; Jackson, Richard M; Lamb, Teresa; Briggs, Tracy A; Ali, Manir; Gornall, Hannah; Couthard, Lydia R; Aeby, Alec; Attard-Montalto, Simon P; Bertini, Enrico; Bodemer, Christine; Brockmann, Knut; Brueton, Louise A; Corry, Peter C; Desguerre, Isabelle; Fazzi, Elisa; Cazorla, Angels Garcia; Gener, Blanca; Hamel, Ben C J; Heiberg, Arvid; Hunter, Matthew; van der Knaap, Marjo S; Kumar, Ram; Lagae, Lieven; Landrieu, Pierre G; Lourenco, Charles M; Marom, Daphna; McDermott, Michael F; van der Merwe, William; Orcesi, Simona; Prendiville, Julie S; Rasmussen, Magnhild; Shalev, Stavit A; Soler, Doriette M; Shinawi, Marwan; Spiegel, Ronen; Tan, Tiong Y; Vanderver, Adeline; Wakeling, Emma L; Wassmer, Evangeline; Whittaker, Elizabeth; Lebon, Pierre; Stetson, Daniel B; Bonthron, David T; Crow, Yanick J

2014-01-01

Aicardi-Goutières syndrome is a mendelian mimic of congenital infection and also shows overlap with systemic lupus erythematosus at both a clinical and biochemical level. The recent identification of mutations in TREX1 and genes encoding the RNASEH2 complex and studies of the function of TREX1 in DNA metabolism have defined a previously unknown mechanism for the initiation of autoimmunity by interferon-stimulatory nucleic acid. Here we describe mutations in SAMHD1 as the cause of AGS at the AGS5 locus and present data to show that SAMHD1 may act as a negative regulator of the cell-intrinsic antiviral response. PMID:19525956

A de novo KCNA1 Mutation in a Patient with Tetany and Hypomagnesemia.

PubMed

van der Wijst, Jenny; Konrad, Martin; Verkaart, Sjoerd A J; Tkaczyk, Marcin; Latta, Femke; Altmüller, Janine; Thiele, Holger; Beck, Bodo; Schlingmann, Karl Peter; de Baaij, Jeroen H F

2018-05-23

Mutations in the KCNA1 gene encoding the voltage-gated potassium (K+) channel Kv1.1 have been linked to rare neurological syndromes, episodic ataxia type 1 (EA1) and myokymia. In 2009, a KCNA1 mutation was identified in a large family with autosomal dominant hypomagnesemia. Despite efforts in establishing a genotype-phenotype correlation for the wide variety of symptoms in EA1, little is known on the serum magnesium (Mg2+) levels in these patients. In the present study, we describe a new de novo KCNA1 mutation in a Polish patient with tetany and hypomagnesemia. Electrophysiological and biochemical analyses were performed to determine the pathogenicity of the mutation. A female patient presented with low serum Mg2+ levels, renal Mg2+ wasting, muscle cramps, and tetanic episodes. Whole exome sequencing identified a p.Leu328Val mutation in KCNA1 encoding the Kv1.1 K+ channel. Electrophysiological examinations demonstrated that the p.Leu328Val mutation caused a dominant-negative loss of function of the encoded Kv1.1 channel. Cell surface biotinylation showed normal plasma membrane expression. Taken together, this is the second report linking KCNA1 with hypomagnesemia, thereby emphasizing the need for further evaluation of the clinical phenotypes observed in patients carrying KCNA1 mutations. © 2018 S. Karger AG, Basel.

Prevalence and Characterization of Somatic Mutations in Chinese Aldosterone-Producing Adenoma Patients

PubMed Central

Wang, Baojun; Li, Xintao; Zhang, Xu; Ma, Xin; Chen, Luyao; Zhang, Yu; Lyu, Xiangjun; Tang, Yuzhe; Huang, Qingbo; Gao, Yu; Fan, Yang; Ouyang, Jinzhi

2015-01-01

Abstract Recently somatic mutations of KCNJ5, ATP1A1, ATP2B3, and CACNA1D have been identified in patients with aldosterone-producing adenoma (APA). The present study sequenced the DNA in the tissues and blood samples from Chinese patients with APA for KCNJ5, ATP1A1, ATP2B3, and CACNA1D gene mutations. Among the 114 patients, 86 (75.4%) were identified with KCNJ5 somatic mutations, including 3 previously reported (G151R, L168R, T158A) and 2 other unreported mutations. One patient presented with both a point mutation (E147) and an insertion mutation, whereas another had a 36-base duplication, G153_G164dup. No mutation of ATP1A1 and ATP2B3 in the known hotspots was identified and only 1 male patient was detected with a novel CACNA1D mutation, V748I. Unlike other studies, male and female patients had similar KCNJ5 mutation rates (76.9% vs 74.2%). Mutation carriers were younger and had lower preoperative potassium level, whereas male (but not female) mutation carriers had higher preoperative plasma aldosterone concentration and preoperative blood pressures. Mutation carriers also had higher LV mass index (LVMI) than nonmutation carriers. After surgery, LVMI improved significantly in the KCNJ5 mutation group but not in the nonmutation group. The mRNA expression of KCNJ5, CYP11B2, and ATP2B3 was higher in the KCNJ5-mutated APA tissues. Functional characterization of the 2 novel KCNJ5 mutations showed that they were associated with decreased proliferation, membrane depolarization, elevated secretion of aldosterone, and increased expression of CYP11B1 and CYP11B2. In conclusion, Chinese APA patients appear to have a high frequency of somatic KCNJ5 mutation. Mutation prevalence rates are similar among men and women and 2 novel mutations are identified. KCNJ5-mutated patients benefit more from surgical resection of APA than nonmutated patients. PMID:25906099

SMARCB1 mutations in schwannomatosis and genotype correlations with rhabdoid tumors.

PubMed

Smith, Miriam J; Wallace, Andrew J; Bowers, Naomi L; Eaton, Helen; Evans, D Gareth R

2014-09-01

Mutations in the SMARCB1 gene are involved in several human tumor-predisposing syndromes. They were established as an underlying cause of the tumor suppressor syndrome schwannomatosis in 2008. There is a much higher rate of mutation detection in familial disease than in sporadic disease. We have performed extensive genetic testing on a cohort of familial and sporadic patients who fulfilled clinical diagnostic criteria for schwannomatosis. In our updated cohort, we identified novel mutations within the SMARCB1 gene as well as several recurrent mutations. Of the schwannomatosis screens reported to date, including those in our updated cohort, SMARCB1 mutations have been found in 45% of familial probands and 9% of sporadic patients. The exon 1 mutation, c.41C>A p.Pro14His (10% in our series), and the 3' untranslated region mutation, c.*82C>T (27%), are the most common changes reported in patients with schwannomatosis to date, indicating the presence of mutation hot spots at both 5' and 3' portions of the gene. Comparison with germline SMARCB1 mutations in patients with rhabdoid tumors showed that the schwannomatosis mutations were significantly more likely to occur at either end of the gene and be nontruncating mutations (P < 0.0001). SMARCB1 mutations are found in a significant proportion of schwannomatosis patients, and an even higher proportion of rhabdoid patients. Whereas SMARCB1 alone seems to account for rhabdoid disease, there is likely to be substantial heterogeneity in schwannomatosis even for familial disease. There is a clear genotype-phenotype correlation, with germline rhabdoid mutations being significantly more likely to be centrally placed, involve multiple exon deletions, and be truncating mutations. Copyright © 2014 Elsevier Inc. All rights reserved.

Earlier onset of motor deficits in mice with double mutations in Dyt1 and Sgce.

PubMed

Yokoi, Fumiaki; Yang, Guang; Li, Jindong; DeAndrade, Mark P; Zhou, Tong; Li, Yuqing

2010-10-01

DYT1 early-onset generalized torsion dystonia is an inherited movement disorder caused by mutations in DYT1 coding for torsinA with ∼30% penetrance. Most of the DYT1 dystonia patients exhibit symptoms during childhood and adolescence. On the other hand, DYT1 mutation carriers without symptoms during these periods mostly do not exhibit symptoms later in their life. Little is known about what controls the timing of the onset, a critical issue for DYT1 mutation carriers. DYT11 myoclonus-dystonia is caused by mutations in SGCE coding for ε-sarcoglycan. Two dystonia patients from a single family with double mutations in DYT1 and SGCE exhibited more severe symptoms. A recent study suggested that torsinA contributes to the quality control of ε-sarcoglycan. Here, we derived mice carrying mutations in both Dyt1 and Sgce and found that these double mutant mice showed earlier onset of motor deficits in beam-walking test. A novel monoclonal antibody against mouse ε-sarcoglycan was developed by using Sgce knock-out mice to avoid the immune tolerance. Western blot analysis suggested that functional deficits of torsinA and ε-sarcoglycan may independently cause motor deficits. Examining additional mutations in other dystonia genes may be beneficial to predict the onset in DYT1 mutation carriers.

Recessive and dominant mutations in COL12A1 cause a novel EDS/myopathy overlap syndrome in humans and mice

PubMed Central

Zou, Yaqun; Zwolanek, Daniela; Izu, Yayoi; Gandhy, Shreya; Schreiber, Gudrun; Brockmann, Knut; Devoto, Marcella; Tian, Zuozhen; Hu, Ying; Veit, Guido; Meier, Markus; Stetefeld, Jörg; Hicks, Debbie; Straub, Volker; Voermans, Nicol C.; Birk, David E.; Barton, Elisabeth R.; Koch, Manuel; Bönnemann, Carsten G.

2014-01-01

Collagen VI-related myopathies are disorders of connective tissue presenting with an overlap phenotype combining clinical involvement from the muscle and from the connective tissue. Not all patients displaying related overlap phenotypes between muscle and connective tissue have mutations in collagen VI. Here, we report a homozygous recessive loss of function mutation and a de novo dominant mutation in collagen XII (COL12A1) as underlying a novel overlap syndrome involving muscle and connective tissue. Two siblings homozygous for a loss of function mutation showed widespread joint hyperlaxity combined with weakness precluding independent ambulation, while the patient with the de novo missense mutation was more mildly affected, showing improvement including the acquisition of walking. A mouse model with inactivation of the Col12a1 gene showed decreased grip strength, a delay in fiber-type transition and a deficiency in passive force generation while the muscle seems more resistant to eccentric contraction induced force drop, indicating a role for a matrix-based passive force-transducing elastic element in the generation of the weakness. This new muscle connective tissue overlap syndrome expands on the emerging importance of the muscle extracellular matrix in the pathogenesis of muscle disease. PMID:24334604

A Novel FOXE1 Mutation (R73S) in Bamforth–Lazarus Syndrome Causing Increased Thyroidal Gene Expression

PubMed Central

Carré, Aurore; Hamza, Rasha T.; Kariyawasam, Dulanjalee; Guillot, Loïc; Teissier, Raphaël; Tron, Elodie; Castanet, Mireille; Dupuy, Corinne; El Kholy, Mohamed; Polak, Michel

2014-01-01

Background: Homozygous loss-of-function mutations in the FOXE1 gene have been reported in several patients with partial or complete Bamforth–Lazarus syndrome: congenital hypothyroidism (CH) with thyroid dysgenesis (usually athyreosis), cleft palate, spiky hair, with or without choanal atresia, and bifid epiglottis. Here, our objective was to evaluate potential functional consequences of a FOXE1 mutation in a patient with a similar clinical phenotype. Methods: FOXE1 was sequenced in eight patients with thyroid dysgenesis and cleft palate. Transient transfection was performed in HEK293 cells using the thyroglobulin (TG) and thyroid peroxidase (TPO) promoters in luciferase reporter plasmids to assess the functional impact of the FOXE1 mutations. Primary human thyrocytes transfected with wild type and mutant FOXE1 served to assess the impact of the mutation on endogenous TG and TPO expression. Results: We identified and characterized the function of a new homozygous FOXE1 missense mutation (p.R73S) in a boy with a typical phenotype (athyreosis, cleft palate, and partial choanal atresia). This new mutation located within the forkhead domain was inherited from the heterozygous healthy consanguineous parents. In vitro functional studies in HEK293 cells showed that this mutant gene enhanced the activity of the TG and TPO gene promoters (1.5-fold and 1.7-fold respectively vs. wild type FOXE1; p<0.05), unlike the five mutations previously reported in Bamforth–Lazarus syndrome. The gain-of-function effect of the FOXE1-p.R73S mutant gene was confirmed by an increase in endogenous TG production in primary human thyrocytes. Conclusion: We identified a new homozygous FOXE1 mutation responsible for enhanced expression of the TG and TPO genes in a boy whose phenotype is similar to that reported previously in patients with loss-of-function FOXE1 mutations. This finding further delineates the role for FOXE1 in both thyroid and palate development, and shows that enhanced gene activity should be considered among the mechanisms underlying Bamforth–Lazarus syndrome. PMID:24219130

Cerebroretinal microangiopathy with calcifications and cysts associated with CTC1 and NDP mutations.

PubMed

Romaniello, Romina; Arrigoni, Filippo; Citterio, Andrea; Tonelli, Alessandra; Sforzini, Cinzia; Rizzari, Carmelo; Pessina, Marco; Triulzi, Fabio; Bassi, Maria Teresa; Borgatti, Renato

2013-12-01

Mutations in the conserved telomere maintenance component 1 (CTC1) gene were recently described in Coats plus syndrome and in cerebroretinal microangiopathy with calcifications and cysts. Norrie disease protein (NDP) gene was found mutated in Norrie disease, in Familial Exudative Vitreoretinopathy, and in Coats syndrome. Here we describe a boy affected by Norrie disease who developed typical features of cerebroretinal microangiopathy with calcifications and cysts. Direct sequencing of the CTC1 and NDP genes in this patient shows the presence of compound heterozygosity for 2 mutations in CTC1 (c.775G>A, pV259M and a novel microdeletion c.1213delG) and a missense mutation in the NDP gene (c.182T>C, p.L61P). Based on these genetic findings and on the expression of both genes in endothelial cells, we postulate that microangiopathy might be a primary underlying pathologic abnormality in cerebroretinal microangiopathy with calcifications and cysts. This hypothesis is further supported by magnetic resonance imaging (MRI) data showing multiple minute calcifications in the deep gray nuclei and in terminal arteriolar zones.

Mutations in the profilin 1 gene cause familial amyotrophic lateral sclerosis.

PubMed

Wu, Chi-Hong; Fallini, Claudia; Ticozzi, Nicola; Keagle, Pamela J; Sapp, Peter C; Piotrowska, Katarzyna; Lowe, Patrick; Koppers, Max; McKenna-Yasek, Diane; Baron, Desiree M; Kost, Jason E; Gonzalez-Perez, Paloma; Fox, Andrew D; Adams, Jenni; Taroni, Franco; Tiloca, Cinzia; Leclerc, Ashley Lyn; Chafe, Shawn C; Mangroo, Dev; Moore, Melissa J; Zitzewitz, Jill A; Xu, Zuo-Shang; van den Berg, Leonard H; Glass, Jonathan D; Siciliano, Gabriele; Cirulli, Elizabeth T; Goldstein, David B; Salachas, Francois; Meininger, Vincent; Rossoll, Wilfried; Ratti, Antonia; Gellera, Cinzia; Bosco, Daryl A; Bassell, Gary J; Silani, Vincenzo; Drory, Vivian E; Brown, Robert H; Landers, John E

2012-08-23

Amyotrophic lateral sclerosis (ALS) is a late-onset neurodegenerative disorder resulting from motor neuron death. Approximately 10% of cases are familial (FALS), typically with a dominant inheritance mode. Despite numerous advances in recent years, nearly 50% of FALS cases have unknown genetic aetiology. Here we show that mutations within the profilin 1 (PFN1) gene can cause FALS. PFN1 is crucial for the conversion of monomeric (G)-actin to filamentous (F)-actin. Exome sequencing of two large ALS families showed different mutations within the PFN1 gene. Further sequence analysis identified 4 mutations in 7 out of 274 FALS cases. Cells expressing PFN1 mutants contain ubiquitinated, insoluble aggregates that in many cases contain the ALS-associated protein TDP-43. PFN1 mutants also display decreased bound actin levels and can inhibit axon outgrowth. Furthermore, primary motor neurons expressing mutant PFN1 display smaller growth cones with a reduced F/G-actin ratio. These observations further document that cytoskeletal pathway alterations contribute to ALS pathogenesis.

Analysis of ESR1 mutation in circulating tumor DNA demonstrates evolution during therapy for metastatic breast cancer

PubMed Central

Schiavon, Gaia; Hrebien, Sarah; Garcia-Murillas, Isaac; Cutts, Rosalind J; Pearson, Alex; Tarazona, Noelia; Fenwick, Kerry; Kozarewa, Iwanka; Lopez-Knowles, Elena; Ribas, Ricardo; Nerurkar, Ashutosh; Osin, Peter; Chandarlapaty, Sarat; Martin, Lesley-Ann; Dowsett, Mitch; Smith, Ian E; Turner, Nicholas C.

2016-01-01

Acquired ESR1 mutations are a major mechanism of resistance to aromatase inhibitors (AI). We developed ultra-high sensitivity multiplexed digital PCR assays for ESR1 mutations in circulating tumor DNA (ctDNA) and used these to investigate the clinical relevance and origin of ESR1 mutations in a cohort of 171 women with advanced breast cancer. ESR1 mutation status in ctDNA showed high concordance with contemporaneous tumor biopsies, and could be assessed in samples shipped at room temperature in preservative tubes without loss of accuracy. ESR1 mutations were found exclusively in patients with estrogen receptor positive breast cancer previously exposed to AI. Patients with ESR1 mutations had a substantially shorter progression-free survival on subsequent AI-based therapy (HR 3.1, 95%CI 1.9-23.1, log rank p=0.0041). ESR1 mutation prevalence differed markedly between patients that were first exposed to AI during the adjuvant and metastatic settings (5.8% (3/52) vs 36.4% (16/44) respectively, p=0.0002). In an independent cohort, ESR1 mutations were identified in 0% (0/32, 95%CI 0-10.9%) tumor biopsies taken after progression on adjuvant AI. In a patient with serial samples taken during metastatic treatment, ESR1 mutation was selected during metastatic AI therapy, to become the dominant clone in the cancer. ESR1 mutations can be robustly identified with ctDNA analysis and predict for resistance to subsequent AI therapy. ESR1 mutations are rarely acquired during adjuvant AI therapy, but are commonly selected by therapy for metastatic disease, providing evidence that the mechanisms of resistance to targeted therapy may be substantially different between the treatment of micro-metastatic and overt metastatic cancer. PMID:26560360

Analysis of ESR1 mutation in circulating tumor DNA demonstrates evolution during therapy for metastatic breast cancer.

PubMed

Schiavon, Gaia; Hrebien, Sarah; Garcia-Murillas, Isaac; Cutts, Rosalind J; Pearson, Alex; Tarazona, Noelia; Fenwick, Kerry; Kozarewa, Iwanka; Lopez-Knowles, Elena; Ribas, Ricardo; Nerurkar, Ashutosh; Osin, Peter; Chandarlapaty, Sarat; Martin, Lesley-Ann; Dowsett, Mitch; Smith, Ian E; Turner, Nicholas C

2015-11-11

Acquired ESR1 mutations are a major mechanism of resistance to aromatase inhibitors (AIs). We developed ultra high-sensitivity multiplex digital polymerase chain reaction assays for ESR1 mutations in circulating tumor DNA (ctDNA) and investigated the clinical relevance and origin of ESR1 mutations in 171 women with advanced breast cancer. ESR1 mutation status in ctDNA showed high concordance with contemporaneous tumor biopsies and was accurately assessed in samples shipped at room temperature in preservative tubes. ESR1 mutations were found exclusively in estrogen receptor-positive breast cancer patients previously exposed to AI. Patients with ESR1 mutations had a substantially shorter progression-free survival on subsequent AI-based therapy [hazard ratio, 3.1; 95% confidence interval (CI), 1.9 to 23.1; P = 0.0041]. ESR1 mutation prevalence differed markedly between patients who were first exposed to AI during the adjuvant and metastatic settings [5.8% (3 of 52) versus 36.4% (16 of 44), respectively; P = 0.0002]. In an independent cohort, ESR1 mutations were identified in 0% (0 of 32; 95% CI, 0 to 10.9) tumor biopsies taken after progression on adjuvant AI. In a patient with serial sampling, ESR1 mutation was selected during metastatic AI therapy to become the dominant clone in the cancer. ESR1 mutations can be robustly identified with ctDNA analysis and predict for resistance to subsequent AI therapy. ESR1 mutations are rarely acquired during adjuvant AI but are commonly selected by therapy for metastatic disease, providing evidence that mechanisms of resistance to targeted therapy may be substantially different between the treatment of micrometastatic and overt metastatic cancer. Copyright © 2015, American Association for the Advancement of Science.

Ovarian metastasis from uveal melanoma with MLH1/PMS2 protein loss in a patient with germline MLH1 mutated Lynch syndrome: consequence or coincidence?

PubMed

Lobo, João; Pinto, Carla; Freitas, Micaela; Pinheiro, Manuela; Vizcaino, Rámon; Oliva, Esther; Teixeira, Manuel R; Jerónimo, Carmen; Bartosch, Carla

2017-03-01

Currently, uveal melanoma is not considered within the Lynch syndrome tumor spectrum. However, there are studies suggesting a contribution of microsatellite instability in sporadic uveal melanoma tumorigenesis. We report a 45-year-old woman who was referred for genetic counseling due to a family history of Lynch syndrome caused by a MLH1 mutation. She originally underwent enucleation of the right eye secondary to a uveal spindle cell melanoma diagnosed at age 25. The tumor recurred 22 years later presenting as an ovarian metastasis and concurrently a microscopic endometrial endometrioid carcinoma, grade 1/3 was diagnosed. Subsequent studies highlighted that the uveal melanoma showed high microsatellite instability and loss of MLH1 and PMS2 protein expression, with no MLH1 promoter methylation or BRAF mutation. Additionally, a GNAQ mutation was found. We conclude that our patient's uveal melanoma is most likely related to MLH1 germline mutation and thus Lynch syndrome related. To the best of our knowledge, this is the first report of uveal melanoma showing MLH1/PMS2 protein loss in the context of Lynch syndrome.

Rare causes of early-onset dystonia-parkinsonism with cognitive impairment: a de novo PSEN-1 mutation.

PubMed

Carecchio, Miryam; Picillo, Marina; Valletta, Lorella; Elia, Antonio E; Haack, Tobias B; Cozzolino, Autilia; Vitale, Annalisa; Garavaglia, Barbara; Iuso, Arcangela; Bagella, Caterina F; Pappatà, Sabina; Barone, Paolo; Prokisch, Holger; Romito, Luigi; Tiranti, Valeria

2017-07-01

Mutations in PSEN1 are responsible for familial Alzheimer's disease (FAD) inherited as autosomal dominant trait, but also de novo mutations have been rarely reported in sporadic early-onset dementia cases. Parkinsonism in FAD has been mainly described in advanced disease stages. We characterized a patient presenting with early-onset dystonia-parkinsonism later complicated by dementia and myoclonus. Brain MRI showed signs of iron accumulation in the basal ganglia mimicking neurodegeneration with brain iron accumulation (NBIA) as well as fronto-temporal atrophy. Whole exome sequencing revealed a novel PSEN1 mutation and segregation within the family demonstrated the mutation arose de novo.We suggest considering PSEN1 mutations in cases of dystonia-parkinsonism with positive DAT-Scan, later complicated by progressive cognitive decline and cortical myoclonus even without a dominant family history.

Gradual Loss of ACTH Due to a Novel Mutation in LHX4: Comprehensive Mutation Screening in Japanese Patients with Congenital Hypopituitarism

PubMed Central

Takagi, Masaki; Ishii, Tomohiro; Inokuchi, Mikako; Amano, Naoko; Narumi, Satoshi; Asakura, Yumi; Muroya, Koji; Hasegawa, Yukihiro; Adachi, Masanori; Hasegawa, Tomonobu

2012-01-01

Mutations in transcription factors genes, which are well regulated spatially and temporally in the pituitary gland, result in congenital hypopituitarism (CH) in humans. The prevalence of CH attributable to transcription factor mutations appears to be rare and varies among populations. This study aimed to define the prevalence of CH in terms of nine CH-associated genes among Japanese patients. We enrolled 91 Japanese CH patients for DNA sequencing of POU1F1, PROP1, HESX1, LHX3, LHX4, SOX2, SOX3, OTX2, and GLI2. Additionally, gene copy numbers for POU1F1, PROP1, HESX1, LHX3, and LHX4 were examined by multiplex ligation-dependent probe amplification. The gene regulatory properties of mutant LHX4 proteins were characterized in vitro. We identified two novel heterozygous LHX4 mutations, namely c.249-1G>A, p.V75I, and one common POU1F1 mutation, p.R271W. The patient harboring the c.249-1G>A mutation exhibited isolated growth hormone deficiency at diagnosis and a gradual loss of ACTH, whereas the patient with the p.V75I mutation exhibited multiple pituitary hormone deficiency. In vitro experiments showed that both LHX4 mutations were associated with an impairment of the transactivation capacities of POU1F1 andαGSU, without any dominant-negative effects. The total mutation prevalence in Japanese CH patients was 3.3%. This study is the first to describe, a gradual loss of ACTH in a patient carrying an LHX4 mutation. Careful monitoring of hypothalamic–pituitary -adrenal function is recommended for CH patients with LHX4 mutations. PMID:23029363

Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1.

PubMed

Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui; Liu, Mugen

2013-01-01

To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A.

Identification of novel mutations of the WFS1 gene in Brazilian patients with Wolfram syndrome.

PubMed

Gasparin, Maria Regina R; Crispim, Felipe; Paula, Sílvia L; Freire, Maria Beatriz S; Dalbosco, Ivaldir S; Manna, Thais Della; Salles, João Eduardo N; Gasparin, Fábio; Guedes, Aléxis; Marcantonio, João M; Gambini, Márcio; Salim, Camila P; Moisés, Regina S

2009-02-01

Wolfram syndrome (WS) is a rare, progressive, neurodegenerative disorder with an autosomal recessive pattern of inheritance. The gene for WS, WFS1, was identified on chromosome 4p16 and most WS patients carry mutations in this gene. However, some studies have provided evidence for genetic heterogeneity and the genotype-phenotype relationships are not clear. Our aim was to ascertain the spectrum of WFS1 mutations in Brazilian patients with WS and to examine the phenotype-genotype relationships in these patients. Clinical characterization and analyses of the WFS1 gene were performed in 27 Brazilian patients with WS from 19 families. We identified 15 different mutations in the WFS1 gene in 26 patients, among which nine are novel. All mutations occurred in exon 8, except for one missense mutation which was located in exon 5. Although we did not find any clear phenotype-genotype relationship in patients with mutations in exon 8, the homozygous missense mutation in exon 5 was associated with a mild phenotype: onset of diabetes mellitus and optic atrophy during adulthood with good metabolic control being achieved with low doses of sulfonylurea. Our data show that WFS1 is the major gene involved in WS in Brazilian patients and most mutations are concentrated in exon 8. Also, our study increases the spectrum of WFS1 mutations. Although no clear phenotype-genotype relationship was found for mutations in exon 8, a mild phenotype was associated with a homozygous missense mutation in exon 5.

Molecular profiling of appendiceal epithelial tumors using massively parallel sequencing to identify somatic mutations.

PubMed

Liu, Xiaoying; Mody, Kabir; de Abreu, Francine B; Pipas, J Marc; Peterson, Jason D; Gallagher, Torrey L; Suriawinata, Arief A; Ripple, Gregory H; Hourdequin, Kathryn C; Smith, Kerrington D; Barth, Richard J; Colacchio, Thomas A; Tsapakos, Michael J; Zaki, Bassem I; Gardner, Timothy B; Gordon, Stuart R; Amos, Christopher I; Wells, Wendy A; Tsongalis, Gregory J

2014-07-01

Some epithelial neoplasms of the appendix, including low-grade appendiceal mucinous neoplasm and adenocarcinoma, can result in pseudomyxoma peritonei (PMP). Little is known about the mutational spectra of these tumor types and whether mutations may be of clinical significance with respect to therapeutic selection. In this study, we identified somatic mutations using the Ion Torrent AmpliSeq Cancer Hotspot Panel v2. Specimens consisted of 3 nonneoplastic retention cysts/mucocele, 15 low-grade mucinous neoplasms (LAMNs), 8 low-grade/well-differentiated mucinous adenocarcinomas with pseudomyxoma peritonei, and 12 adenocarcinomas with/without goblet cell/signet ring cell features. Barcoded libraries were prepared from up to 10 ng of extracted DNA and multiplexed on single 318 chips for sequencing. Data analysis was performed using Golden Helix SVS. Variants that remained after the analysis pipeline were individually interrogated using the Integrative Genomics Viewer. A single Janus kinase 3 (JAK3) mutation was detected in the mucocele group. Eight mutations were identified in the V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) and GNAS complex locus (GNAS) genes among LAMN samples. Additional gene mutations were identified in the AKT1 (v-akt murine thymoma viral oncogene homolog 1), APC (adenomatous polyposis coli), JAK3, MET (met proto-oncogene), phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3CA), RB1 (retinoblastoma 1), STK11 (serine/threonine kinase 11), and tumor protein p53 (TP53) genes. Among the PMPs, 6 mutations were detected in the KRAS gene and also in the GNAS, TP53, and RB1 genes. Appendiceal cancers showed mutations in the APC, ATM (ataxia telangiectasia mutated), KRAS, IDH1 [isocitrate dehydrogenase 1 (NADP+)], NRAS [neuroblastoma RAS viral (v-ras) oncogene homolog], PIK3CA, SMAD4 (SMAD family member 4), and TP53 genes. Our results suggest molecular heterogeneity among epithelial tumors of the appendix. Next generation sequencing efforts have identified mutational spectra in several subtypes of these tumors that may suggest a phenotypic heterogeneity showing mutations that are relevant for targeted therapies. © 2014 The American Association for Clinical Chemistry.

Deterioration in Distortion Product Otoacoustic Emissions in Auditory Neuropathy Patients With Distinct Clinical and Genetic Backgrounds.

PubMed

Kitao, Kyoko; Mutai, Hideki; Namba, Kazunori; Morimoto, Noriko; Nakano, Atsuko; Arimoto, Yukiko; Sugiuchi, Tomoko; Masuda, Sawako; Okamoto, Yasuhide; Morita, Noriko; Sakamoto, Hirokazu; Shintani, Tomoko; Fukuda, Satoshi; Kaga, Kimitaka; Matsunaga, Tatsuo

2018-04-23

Auditory neuropathy (AN) is a clinical disorder characterized by the absence of auditory brainstem response and presence of otoacoustic emissions. A gradual loss of otoacoustic emissions has been reported for some cases of AN. Such cases could be diagnosed as cochlear hearing loss and lead to misunderstanding of the pathology when patients first visit clinics after the loss of otoacoustic emissions. The purpose of this study was to investigate the time course of changes in distortion product otoacoustic emissions (DPOAEs) in association with patients' genetic and clinical backgrounds, including the use of hearing aids. DPOAE measurements from 31 patients with AN were assessed. Genetic analyses for GJB2, OTOF, and mitochondrial m.1555A> G and m.3243A> G mutations were conducted for all cases, and the analyses for CDH23 and OPA1 were conducted for the selected cases. Patients who were younger than 10 years of age at the time of AN diagnosis were designated as the pediatric AN group (22 cases), and those who were 18 years of age or older were designated as the adult AN group (9 cases). DPOAE was measured at least twice in all patients. The response rate for DPOAEs was defined and analyzed. The pediatric AN group comprised 10 patients with OTOF mutations, 1 with GJB2 mutations, 1 with OPA1 mutation, and 10 with indefinite causes. Twelve ears (27%) showed no change in DPOAE, 20 ears (46%) showed a decrease in DPOAE, and 12 ears (27%) lost DPOAE. Loss of DPOAE occurred in one ear (2%) at 0 years of age and four ears (9%) at 1 year of age. The time courses of DPOAEs in patients with OTOF mutations were divided into those with early loss and those with no change, indicating that the mechanism for deterioration of DPOAEs includes not only the OTOF mutations but also other common modifier factors. Most, but not all, AN patients who used hearing aids showed deterioration of DPOAEs after the start of using hearing aids. A few AN patients also showed deterioration of DPOAEs before using hearing aids. The adult AN group comprised 2 patients with OPA1 mutations, 2 with OTOF mutations, and 5 with indefinite causes. Four ears (22%) showed no change in DPOAE, 13 ears (72%) showed a decrease, and one ear (6%) showed a loss of DPOAE. Although the ratio of DPOAE decrease was higher in the adult AN group than in the pediatric AN group, the ratio of DPOAE loss was lower in the adult AN group. DPOAE was not lost in all four ears with OPA1 mutations and in all four ears with OTOF mutations in the adult group. DPOAE was decreased or lost in approximately 70% of pediatric and about 80% of adult AN patients. Eleven percent of pediatric AN patients lost DPOAEs by 1 year of age. Genetic factors were thought to have influenced the time course of DPOAEs in the pediatric AN group. In most adult AN patients, DPOAE was rarely lost regardless of the genetic cause.

Whole exome sequencing reveals recurrent mutations in BRCA2 and FAT genes in acinar cell carcinomas of the pancreas.

PubMed

Furukawa, Toru; Sakamoto, Hitomi; Takeuchi, Shoko; Ameri, Mitra; Kuboki, Yuko; Yamamoto, Toshiyuki; Hatori, Takashi; Yamamoto, Masakazu; Sugiyama, Masanori; Ohike, Nobuyuki; Yamaguchi, Hiroshi; Shimizu, Michio; Shibata, Noriyuki; Shimizu, Kyoko; Shiratori, Keiko

2015-03-06

Acinar cell carcinoma of the pancreas is a rare tumor with a poor prognosis. Compared to pancreatic ductal adenocarcinoma, its molecular features are poorly known. We studied a total of 11 acinar cell carcinomas, including 3 by exome and 4 by target sequencing. Exome sequencing revealed 65 nonsynonymous mutations and 22 indels with a mutation rate of 3.4 mutations/Mb per tumor, on average. By accounting for not only somatic but also germline mutations with loss of the wild-type allele, we identified recurrent mutations of BRCA2 and FAT genes. BRCA2 showed somatic or germline premature termination mutations, with loss of the wild-type allele in 3 of 7 tumors. FAT1, FAT3, and FAT4 showed somatic or germline missense mutations in 4 of 7 tumors. The germline FAT mutations were with loss of the wild-type allele. Loss of BRCA2 expression was observed in 5 of 11 tumors. One patient with a BRCA2-mutated tumor experienced complete remission of liver metastasis following cisplatinum chemotherapy. In conclusion, acinar cell carcinomas show a distinct mutation pattern and often harbor somatic or germline mutations of BRCA2 and FAT genes. This result may warrant assessment of BRCA2 abrogation in patients with the carcinoma to determine their sensitivity to chemotherapy.

BRCA2, EGFR, and NTRK mutations in mismatch repair-deficient colorectal cancers with MSH2 or MLH1 mutations.

PubMed

Deihimi, Safoora; Lev, Avital; Slifker, Michael; Shagisultanova, Elena; Xu, Qifang; Jung, Kyungsuk; Vijayvergia, Namrata; Ross, Eric A; Xiu, Joanne; Swensen, Jeffrey; Gatalica, Zoran; Andrake, Mark; Dunbrack, Roland L; El-Deiry, Wafik S

2017-06-20

Deficient mismatch repair (MMR) and microsatellite instability (MSI) contribute to ~15% of colorectal cancer (CRCs). We hypothesized MSI leads to mutations in DNA repair proteins including BRCA2 and cancer drivers including EGFR. We analyzed mutations among a discovery cohort of 26 MSI-High (MSI-H) and 558 non-MSI-H CRCs profiled at Caris Life Sciences. Caris-profiled MSI-H CRCs had high mutation rates (50% vs 14% in non-MSI-H, P < 0.0001) in BRCA2. Of 1104 profiled CRCs from a second cohort (COSMIC), MSH2/MLH1-mutant CRCs showed higher mutation rates in BRCA2 compared to non-MSH2/MLH1-mutant tumors (38% vs 6%, P < 0.0000001). BRCA2 mutations in MSH2/MLH1-mutant CRCs included 75 unique mutations not known to occur in breast or pancreatic cancer per COSMIC v73. Only 5 deleterious BRCA2 mutations in CRC were previously reported in the BIC database as germ-line mutations in breast cancer. Some BRCA2 mutations were predicted to disrupt interactions with partner proteins DSS1 and RAD51. Some CRCs harbored multiple BRCA2 mutations. EGFR was mutated in 45.5% of MSH2/MLH1-mutant and 6.5% of non-MSH2/MLH1-mutant tumors (P < 0.0000001). Approximately 15% of EGFR mutations found may be actionable through TKI therapy, including N700D, G719D, T725M, T790M, and E884K. NTRK gene mutations were identified in MSH2/MLH1-mutant CRC including NTRK1 I699V, NTRK2 P716S, and NTRK3 R745L. Our findings have clinical relevance regarding therapeutic targeting of BRCA2 vulnerabilities, EGFR mutations or other identified oncogenic drivers such as NTRK in MSH2/MLH1-mutant CRCs or other tumors with mismatch repair deficiency.

Cancer-associated Isocitrate Dehydrogenase 1 (IDH1) R132H Mutation and d-2-Hydroxyglutarate Stimulate Glutamine Metabolism under Hypoxia*

PubMed Central

Reitman, Zachary J.; Duncan, Christopher G.; Poteet, Ethan; Winters, Ali; Yan, Liang-Jun; Gooden, David M.; Spasojevic, Ivan; Boros, Laszlo G.; Yang, Shao-Hua; Yan, Hai

2014-01-01

Mutations in the cytosolic NADP+-dependent isocitrate dehydrogenase (IDH1) occur in several types of cancer, and altered cellular metabolism associated with IDH1 mutations presents unique therapeutic opportunities. By altering IDH1, these mutations target a critical step in reductive glutamine metabolism, the metabolic pathway that converts glutamine ultimately to acetyl-CoA for biosynthetic processes. While IDH1-mutated cells are sensitive to therapies that target glutamine metabolism, the effect of IDH1 mutations on reductive glutamine metabolism remains poorly understood. To explore this issue, we investigated the effect of a knock-in, single-codon IDH1-R132H mutation on the metabolism of the HCT116 colorectal adenocarcinoma cell line. Here we report the R132H-isobolome by using targeted 13C isotopomer tracer fate analysis to trace the metabolic fate of glucose and glutamine in this system. We show that introduction of the R132H mutation into IDH1 up-regulates the contribution of glutamine to lipogenesis in hypoxia, but not in normoxia. Treatment of cells with a d-2-hydroxyglutarate (d-2HG) ester recapitulated these changes, indicating that the alterations observed in the knocked-in cells were mediated by d-2HG produced by the IDH1 mutant. These studies provide a dynamic mechanistic basis for metabolic alterations observed in IDH1-mutated tumors and uncover potential therapeutic targets in IDH1-mutated cancers. PMID:24986863

A novel PAX3 mutation in a Japanese boy with Waardenburg syndrome type 1.

PubMed

Yoshida, Yu; Doi, Rieko; Adachi, Kaori; Nanba, Eiji; Kodani, Isamu; Ryoke, Kazuo

2016-01-01

Waardenburg syndrome type 1 (WS1) is a rare autosomal dominant disorder characterized by hair hypopigmentation, abnormal iris pigmentation, and congenital hearing loss. WS1 is caused by mutations in paired box gene 3 (PAX3). We identified a novel PAX3 mutation (c.1107 C>G, p.Ser369Arg) in a Japanese WS1 patient showing abnormal right iris pigmentation, right-sided congenital hearing loss, synophrys, incomplete left cleft lip, and cryptorchidism.

A novel PAX3 mutation in a Japanese boy with Waardenburg syndrome type 1

PubMed Central

Yoshida, Yu; Doi, Rieko; Adachi, Kaori; Nanba, Eiji; Kodani, Isamu; Ryoke, Kazuo

2016-01-01

Waardenburg syndrome type 1 (WS1) is a rare autosomal dominant disorder characterized by hair hypopigmentation, abnormal iris pigmentation, and congenital hearing loss. WS1 is caused by mutations in paired box gene 3 (PAX3). We identified a novel PAX3 mutation (c.1107 C>G, p.Ser369Arg) in a Japanese WS1 patient showing abnormal right iris pigmentation, right-sided congenital hearing loss, synophrys, incomplete left cleft lip, and cryptorchidism. PMID:27081571

A Novel Germline Mutation in BRCA1 Causes Exon 20 Skipping in a Korean Family with a History of Breast Cancer.

PubMed

Yoon, Kyong-Ah; Kong, Sun-Young; Lee, Eun Ji; Cho, Jeong Nam; Chang, Suhwan; Lee, Eun Sook

2017-09-01

Germline mutations in the BRCA1 and BRCA2 genes are strong genetic factors for predispositions to breast, ovarian, and other related cancers. This report describes a family with a history of breast and ovarian cancers that harbored a novel BRCA1 germline mutation. A single nucleotide deletion in intron 20, namely c.5332+4delA, was detected in a 43-year-old patient with breast cancer. This mutation led to the skipping of exon 20, which in turn resulted in the production of a truncated BRCA1 protein that was 1773 amino acids in length. The mother of the proband had died due to ovarian cancer and had harbored the same germline mutation. Ectopically expressed mutant BRCA1 protein interacted with the BARD1 protein, but showed a reduced transcriptional function, as demonstrated by the expression of cyclin B1 . This novel germline mutation in the BRCA1 gene caused familial breast and ovarian cancers.

Comprehensive Mutation Analysis of PMS2 in a Large Cohort of Probands Suspected of Lynch Syndrome or Constitutional Mismatch Repair Deficiency Syndrome.

PubMed

van der Klift, Heleen M; Mensenkamp, Arjen R; Drost, Mark; Bik, Elsa C; Vos, Yvonne J; Gille, Hans J J P; Redeker, Bert E J W; Tiersma, Yvonne; Zonneveld, José B M; García, Encarna Gómez; Letteboer, Tom G W; Olderode-Berends, Maran J W; van Hest, Liselotte P; van Os, Theo A; Verhoef, Senno; Wagner, Anja; van Asperen, Christi J; Ten Broeke, Sanne W; Hes, Frederik J; de Wind, Niels; Nielsen, Maartje; Devilee, Peter; Ligtenberg, Marjolijn J L; Wijnen, Juul T; Tops, Carli M J

2016-11-01

Monoallelic PMS2 germline mutations cause 5%-15% of Lynch syndrome, a midlife cancer predisposition, whereas biallelic PMS2 mutations cause approximately 60% of constitutional mismatch repair deficiency (CMMRD), a rare childhood cancer syndrome. Recently improved DNA- and RNA-based strategies are applied to overcome problematic PMS2 mutation analysis due to the presence of pseudogenes and frequent gene conversion events. Here, we determined PMS2 mutation detection yield and mutation spectrum in a nationwide cohort of 396 probands. Furthermore, we studied concordance between tumor IHC/MSI (immunohistochemistry/microsatellite instability) profile and mutation carrier state. Overall, we found 52 different pathogenic PMS2 variants explaining 121 Lynch syndrome and nine CMMRD patients. In vitro mismatch repair assays suggested pathogenicity for three missense variants. Ninety-one PMS2 mutation carriers (70%) showed isolated loss of PMS2 in their tumors, for 31 (24%) no or inconclusive IHC was available, and eight carriers (6%) showed discordant IHC (presence of PMS2 or loss of both MLH1 and PMS2). Ten cases with isolated PMS2 loss (10%; 10/97) harbored MLH1 mutations. We confirmed that recently improved mutation analysis provides a high yield of PMS2 mutations in patients with isolated loss of PMS2 expression. Application of universal tumor prescreening methods will however miss some PMS2 germline mutation carriers. © 2016 WILEY PERIODICALS, INC.

Calreticulin mutation analysis in non-mutated Janus kinase 2 essential thrombocythemia patients in Chiang Mai University: analysis of three methods and clinical correlations.

PubMed

Rattarittamrong, Ekarat; Tantiworawit, Adisak; Kumpunya, Noppamas; Wongtagan, Ornkamon; Tongphung, Ratchanoo; Phusua, Arunee; Chai-Adisaksopha, Chatree; Hantrakool, Sasinee; Rattanathammethee, Thanawat; Norasetthada, Lalita; Charoenkwan, Pimlak; Lekawanvijit, Suree

2018-03-09

The primary objective was to determine the prevalence of calreticulin (CALR) mutation in patients with non-JAK2V617F mutated essential thrombocythemia (ET). The secondary objectives were to evaluate the accuracy of CALR mutation analysis by high-resolution melting (HRM) analysis and real-time polymerase chain reaction (PCR) compared with DNA sequencing and to compare clinical characteristics of CALR mutated and JAK2V617F mutated ET. This was a prospective cohort study involving ET patients registered at Chiang Mai University in the period September 2015-September 2017 who were aged more than 2 years, and did not harbor JAK2V617F mutation. The presence of CALR mutation was established by DNA sequencing, HRM, and real-time PCR for type 1 and type 2 mutation. Clinical data were compared with that from ET patients with mutated JAK2V617F. Twenty-eight patients were enrolled onto the study. CALR mutations were found in 10 patients (35.7%). Three patients had type 1 mutation, 5 patients had type 2 mutation, 1 patient had type 18 mutation, and 1 patients had novel mutations (c.1093 C-G, c.1098_1131 del, c.1135 G-A). HRM could differentiate between the types of mutation in complete agreement with DNA sequencing. Patients with a CALR mutation showed a significantly greater male predominance and had a higher platelet count when compared with 42 JAK2V617F patients. The prevalence of CALR mutation in JAK2V617F-negative ET in this study is 35.7%. HRM is an effective method of detecting CALR mutation and is a more advantageous method of screening for CALR mutation.

Noninvasive detection of activating estrogen receptor 1 (ESR1) mutations in estrogen receptor-positive metastatic breast cancer.

PubMed

Guttery, David S; Page, Karen; Hills, Allison; Woodley, Laura; Marchese, Stephanie D; Rghebi, Basma; Hastings, Robert K; Luo, Jinli; Pringle, J Howard; Stebbing, Justin; Coombes, R Charles; Ali, Simak; Shaw, Jacqueline A

2015-07-01

Activating mutations in the estrogen receptor 1 (ESR1) gene are acquired on treatment and can drive resistance to endocrine therapy. Because of the spatial and temporal limitations of needle core biopsies, our goal was to develop a highly sensitive, less invasive method of detecting activating ESR1 mutations via circulating cell-free DNA (cfDNA) and tumor cells as a "liquid biopsy." We developed a targeted 23-amplicon next-generation sequencing (NGS) panel for detection of hot-spot mutations in ESR1, phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha (PIK3CA), tumor protein p53 (TP53), fibroblast growth factor receptor 1 (FGFR1), and fibroblast growth factor receptor 2 (FGFR2) in 48 patients with estrogen receptor-α-positive metastatic breast cancer who were receiving systemic therapy. Selected mutations were validated using droplet digital PCR (ddPCR). Nine baseline cfDNA samples had an ESR1 mutation. NGS detected 3 activating mutations in ESR1, and 3 hot-spot mutations in PIK3CA, and 3 in TP53 in baseline cfDNA, and the ESR1 p.D538G mutation in 1 matched circulating tumor cell sample. ddPCR analysis was more sensitive than NGS and identified 6 additional baseline cfDNA samples with the ESR1 p.D538G mutation at a frequency of <1%. In serial blood samples from 11 patients, 4 showed changes in cfDNA, 2 with emergence of a mutation in ESR1. We also detected a low frequency ESR1 mutation (1.3%) in cfDNA of 1 primary patient who was thought to have metastatic disease but was clear by scans. Early identification of ESR1 mutations by liquid biopsy might allow for cessation of ineffective endocrine therapies and switching to other treatments, without the need for tissue biopsy and before the emergence of metastatic disease. © 2015 American Association for Clinical Chemistry.

Implications of ESR1 Mutations in Hormone Receptor-Positive Breast Cancer.

PubMed

Reinert, Tomás; Gonçalves, Rodrigo; Bines, José

2018-04-17

Endocrine treatment resistance eventually develops during adjuvant and even more often during hormonal treatment for advanced breast cancer (ABC). An ESR1 gene mutation, which encodes for the estrogen receptor (ER) protein, is one of the potential mechanisms of therapy resistance. The ESR1 mutations result in conformational changes in the ER leading to subsequent estrogen-independent transcriptional activity. These mutations are found at a lower level in early stage when compared to metastatic BC, more often through selective pressure after aromatase inhibitor (AI) treatment. Recent studies have explored the role of ESR1 mutations as potential prognostic and predictive biomarkers and showed that ESR1 mutations are likely associated with a more aggressive disease. However, definitive associations with outcome in order to make a specific treatment recommendation are yet to be found. The development of targeted therapy directed to ESR1-mutated clones is an appealing concept, and preclinical and clinical works are in progress. ESR1 mutations represent an exciting field with a rapidly increasing number of recent publications that will likely advance the knowledge of treatment resistance mechanisms and pave the way into more individualized patient endocrine treatment.

Undifferentiated and Dedifferentiated Endometrial Carcinomas With POLE Exonuclease Domain Mutations Have a Favorable Prognosis.

PubMed

Espinosa, Iñigo; Lee, Cheng-Han; D'Angelo, Emanuela; Palacios, José; Prat, Jaime

2017-08-01

POLE exonuclease domain mutations have recently been described in undifferentiated endometrial carcinoma but, because of the rarity of this aggressive type of endometrial cancer, their prognostic significance is unknown. We have analyzed the immunophenotype (ARID1A, MLH1, PMS2, MSH2, MSH6, p53, β-catenin, and SMARCB1) and mutational status (POLE, PIK3CA, and PTEN) of 21 undifferentiated carcinomas (8 undifferentiated and 13 dedifferentiated carcinomas). Loss of ARID1A expression was observed in 9 of 19 cases (47%), loss of expression of at least 1 DNA mismatch repair protein in 7 (7/21; 33%), and p53 immunoreaction was aberrant (mutated/inactivated) in 11 cases (11/21; 52%). All tumors were negative for β-catenin. Normal nuclear SMARCB1 (INI1) staining was found in all but 1 dedifferentiated case. Two undifferentiated and 7 dedifferentiated carcinomas showed POLE exonuclease domain mutations (9/21; 42%). PIK3CA mutations occurred in six tumors (6/21; 28%) (2 undifferentiated and 4 dedifferentiated carcinomas). PTEN mutations were found in 7 of 15 cases (47%) (4 undifferentiated and 3 dedifferentiated carcinomas). POLE-mutated undifferentiated and dedifferentiated endometrial carcinomas were more frequently stage I tumors than similar carcinomas lacking exonuclease domain mutations (7/9; 78% vs. 3/12; 25%; P=0.023) and patients had significantly better outcome (disease-specific survival) than those without POLE exonuclease domain mutations (P=0.02). Determination of the POLE mutation status is important for the management of these patients.

FERMT1 promoter mutations in patients with Kindler syndrome.

PubMed

Has, C; Chmel, N; Levati, L; Neri, I; Sonnenwald, T; Pigors, M; Godbole, K; Dudhbhate, A; Bruckner-Tuderman, L; Zambruno, G; Castiglia, D

2015-09-01

Mutations in the FERMT1 gene, encoding the focal adhesion protein kindlin-1 underlie the Kindler syndrome (KS), an autosomal recessive skin disorder with a phenotype comprising skin blistering, photosensitivity, progressive poikiloderma with extensive skin atrophy, and propensity to skin cancer. The FERMT1 mutational spectrum comprises gross genomic deletions, splice site, nonsense, and frameshift mutations, which are scattered over the coding region spanning exon 2-15. We now report three KS families with mutations affecting the promoter region of FERMT1. Two of these mutations are large deletions (∼38.0 and 1.9 kb in size) and one is a single nucleotide variant (c.-20A>G) within the 5' untranslated region (UTR). Each mutation resulted in loss of gene expression in patient skin or cultured keratinocytes. Reporter assays showed the functional relevance of the genomic regions deleted in our patients for FERMT1 gene transcription and proved the causal role of the c.-20A>G variant in reducing transcriptional activity. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A novel mutation of the high-temperature requirement A serine peptidase 1 (HTRA1) gene in a Chinese family with cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL).

PubMed

Chen, Yan; He, Zhiyi; Meng, Su; Li, Lei; Yang, Hua; Zhang, Xiaotang

2013-10-01

Mutations in the high-temperature requirement A serine peptidase 1 (HTRA1) gene were studied in a Chinese family with cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL). Exons 1-9 of the HTRA1 gene were amplified and bidirectionally sequenced in a Chinese family with CARASIL. Mutation effects were analysed by three-dimensional modelling of the serine protease HTRA1 protein. The proband was found to be homozygous for a novel missense mutation (c.854 C > T) identified in exon 4 of the HTRA1 gene; the parents of the proband were heterozygous for the same missense mutation. This c.854 C > T mutation resulted in a change from proline to leucine (p.P285L) in serine protease HTRA1, and was absent in 260 control chromosomes. Three-dimensional models showed that the change from proline to leucine (p.P285L) could attenuate the hydrogen bond between S284 and S287 residues, which might affect function of serine protease HTRA1. Discovery of a novel missense mutation (c.854C>T) associated with CARASIL expands the known CARASIL-related mutations in HTRA1.

Expression and Mutational Analysis of c-kit in Ovarian Surface Epithelial Tumors

PubMed Central

Lee, Myung-Hoon; Park, Tae-In; Bae, Han-Ik

2006-01-01

Coexpression of Kit ligand and c-kit has been reported in some gynecologic tumors. To determine whether imatinib mesylate is useful in ovarian epithelial tumors, we performed immunohistochemical and mutational analysis. The cases consisted of 33 cases, which included 13 serous cystadenocarcinomas, 1 borderline serous tumor, 8 mucinous cystadenocarcinomas, 6 borderline mucinous tumors and 5 clear cell carcinomas. Five cases of serous cystadenoma and 5 cases of mucinous cystadenoma were also included. In the immunohistochemical study, 3 cases (3/6, 50%) of borderline mucinous cystic tumor and two cases (2/8, 25%) of mucinous cystadenocarcinoma show positive staining for KIT protein. Only one case (1/13, 7.7%) of serous cystadenocarcinoma had positive staining. On mutational analysis, no mutation was identified at exon 11. However, two cases of borderline mucinous tumors and one case of mucinous cystadenocarcinoma had mutations at exon 17. In these cases, the immunohistochemistry also shows focal positive staining at epithelial component. Although, KIT protein expression showed higher incidence in mucinous tumors than serous tumors, they lack KIT-activating mutations in exon 11. Thus, ovarian surface epithelial tumors are unlikely to respond to imatinib mesylate. PMID:16479070

Skeletal muscle biopsy analysis in reducing body myopathy and other FHL1-related disorders.

PubMed

Malfatti, Edoardo; Olivé, Montse; Taratuto, Ana Lía; Richard, Pascale; Brochier, Guy; Bitoun, Marc; Gueneau, Lucie; Laforêt, Pascal; Stojkovic, Tanya; Maisonobe, Thierry; Monges, Soledad; Lubieniecki, Fabiana; Vasquez, Gabriel; Streichenberger, Nathalie; Lacène, Emmanuelle; Saccoliti, Maria; Prudhon, Bernard; Alexianu, Marilena; Figarella-Branger, Dominique; Schessl, Joachim; Bonnemann, Carsten; Eymard, Bruno; Fardeau, Michel; Bonne, Gisèle; Romero, Norma Beatriz

2013-09-01

FHL1 mutations have been associated with various disorders that include reducing body myopathy (RBM), Emery-Dreifuss-like muscular dystrophy, isolated hypertrophic cardiomyopathy, and some overlapping conditions. We report a detailed histochemical, immunohistochemical, electron microscopic, and immunoelectron microscopic analyses of muscle biopsies from 18 patients carrying mutations in FHL1: 14 RBM patients (Group 1), 3 Emery-Dreifuss muscular dystrophy patients (Group 2), and 1 patient with hypertrophic cardiomyopathy and muscular hypertrophy (Group 2). Group 1 muscle biopsies consistently showed RBs associated with cytoplasmic bodies. The RBs showed prominent FHL1 immunoreactivity whereas desmin, αB-crystallin, and myotilin immunoreactivity surrounded RBs. By electron microscopy, RBs were composed of electron-dense tubulofilamentous material that seemed to spread progressively between the myofibrils and around myonuclei. By immunoelectron microscopy, FHL1 protein was found exclusively inside RBs. Group 2 biopsies showed mild dystrophic abnormalities without RBs; only minor nonspecific myofibrillar abnormalities were observed under electron microscopy. Molecular analysis revealed missense mutations in the second FHL1 LIM domain in Group 1 patients and ins/del or missense mutations within the fourth FHL1 LIM domain in Group 2 patients. Our findings expand the morphologic features of RBM, clearly demonstrate the localization of FHL1 in RBs, and further illustrate major morphologic differences among different FHL1-related myopathies.

A Deletion in the N-Myc Downstream Regulated Gene 1 (NDRG1) Gene in Greyhounds with Polyneuropathy

PubMed Central

Drögemüller, Cord; Becker, Doreen; Kessler, Barbara; Kemter, Elisabeth; Tetens, Jens; Jurina, Konrad; Hultin Jäderlund, Karin; Flagstad, Annette; Perloski, Michele; Lindblad-Toh, Kerstin; Matiasek, Kaspar

2010-01-01

The polyneuropathy of juvenile Greyhound show dogs shows clinical similarities to the genetically heterogeneous Charcot-Marie-Tooth (CMT) disease in humans. The pedigrees containing affected dogs suggest monogenic autosomal recessive inheritance and all affected dogs trace back to a single male. Here, we studied the neuropathology of this disease and identified a candidate causative mutation. Peripheral nerve biopsies from affected dogs were examined using semi-thin histology, nerve fibre teasing and electron microscopy. A severe chronic progressive mixed polyneuropathy was observed. Seven affected and 17 related control dogs were genotyped on the 50k canine SNP chip. This allowed us to localize the causative mutation to a 19.5 Mb interval on chromosome 13 by homozygosity mapping. The NDRG1 gene is located within this interval and NDRG1 mutations have been shown to cause hereditary motor and sensory neuropathy-Lom in humans (CMT4D). Therefore, we considered NDRG1 a positional and functional candidate gene and performed mutation analysis in affected and control Greyhounds. A 10 bp deletion in canine NDRG1 exon 15 (c.1080_1089delTCGCCTGGAC) was perfectly associated with the polyneuropathy phenotype of Greyhound show dogs. The deletion causes a frame shift (p.Arg361SerfsX60) which alters several amino acids before a stop codon is encountered. A reduced level of NDRG1 transcript could be detected by RT-PCR. Western blot analysis demonstrated an absence of NDRG1 protein in peripheral nerve biopsy of an affected Greyhound. We thus have identified a candidate causative mutation for polyneuropathy in Greyhounds and identified the first genetically characterized canine CMT model which offers an opportunity to gain further insights into the pathobiology and therapy of human NDRG1 associated CMT disease. Selection against this mutation can now be used to eliminate polyneuropathy from Greyhound show dogs. PMID:20582309

Characterization of Ribozymes Targeting a Congenital Night Blindness Mutation in Rhodopsin Mutation.

PubMed

Conley, Shannon M; Whalen, Patrick; Lewin, Alfred S; Naash, Muna I

2016-01-01

The G90D mutation in the rhodopsin gene leads to autosomal dominant congenital stationary night blindness (CSNB) in patients. This occurs because the G90D mutant protein cannot efficiently bind chromophore and is constitutively active. To combat this mutation, we designed and characterized two different hammerhead ribozymes to cleave G90D transcript. In vitro testing showed that the G90D1 ribozyme efficiently and specifically cleaved the mutant transcript while G90D2 cleaved both WT and mutant transcript. AAV-mediated delivery of G90D1 under the control of the mouse opsin promoter (MOP500) to G90D transgenic eyes showed that the ribozyme partially retarded the functional degeneration (as measured by electroretinography [ERG]) associated with this mutation. These results suggest that with additional optimization, ribozymes may be a useful part of the gene therapy knockdown strategy for dominant retinal disease.

Repurposing Pan-HDAC Inhibitors for ARID1A-Mutated Ovarian Cancer.

PubMed

Fukumoto, Takeshi; Park, Pyoung Hwa; Wu, Shuai; Fatkhutdinov, Nail; Karakashev, Sergey; Nacarelli, Timothy; Kossenkov, Andrew V; Speicher, David W; Jean, Stephanie; Zhang, Lin; Wang, Tian-Li; Shih, Ie-Ming; Conejo-Garcia, Jose R; Bitler, Benjamin G; Zhang, Rugang

2018-03-27

ARID1A, a subunit of the SWI/SNF complex, is among the most frequently mutated genes across cancer types. ARID1A is mutated in more than 50% of ovarian clear cell carcinomas (OCCCs), diseases that have no effective therapy. Here, we show that ARID1A mutation confers sensitivity to pan-HDAC inhibitors such as SAHA in ovarian cancers. This correlated with enhanced growth suppression induced by the inhibition of HDAC2 activity in ARID1A-mutated cells. HDAC2 interacts with EZH2 in an ARID1A status-dependent manner. HDAC2 functions as a co-repressor of EZH2 to suppress the expression of EZH2/ARID1A target tumor suppressor genes such as PIK3IP1 to inhibit proliferation and promote apoptosis. SAHA reduced the growth and ascites of the ARID1A-inactivated OCCCs in both orthotopic and genetic mouse models. This correlated with a significant improvement of survival of mice bearing ARID1A-mutated OCCCs. These findings provided preclinical rationales for repurposing FDA-approved pan-HDAC inhibitors for treating ARID1A-mutated cancers. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Highly sensitive detection of ESR1 mutations in cell-free DNA from patients with metastatic breast cancer using molecular barcode sequencing.

PubMed

Masunaga, Nanae; Kagara, Naofumi; Motooka, Daisuke; Nakamura, Shota; Miyake, Tomohiro; Tanei, Tomonori; Naoi, Yasuto; Shimoda, Masafumi; Shimazu, Kenzo; Kim, Seung Jin; Noguchi, Shinzaburo

2018-01-01

We aimed to develop a highly sensitive method to detect ESR1 mutations in cell-free DNA (cfDNA) using next-generation sequencing with molecular barcode (MB-NGS) targeting the hotspot segment (c.1600-1713). The sensitivity of MB-NGS was tested using serially diluted ESR1 mutant DNA and then cfDNA samples from 34 patients with metastatic breast cancer were analyzed with MB-NGS. The results of MB-NGS were validated in comparison with conventional NGS and droplet digital PCR (ddPCR). MB-NGS showed a higher sensitivity (0.1%) than NGS without barcode (1%) by reducing background errors. Of the cfDNA samples from 34 patients with metastatic breast cancer, NGS without barcode revealed seven mutations in six patients (17.6%) and MB-NGS revealed six additional mutations including three mutations not reported in the COSMIC database of breast cancer, resulting in total 13 ESR1 mutations in ten patients (29.4%). Regarding the three hotspot mutations, all the patients with mutations detected by MB-NGS had identical mutations detected by droplet digital PCR (ddPCR), and mutant allele frequency correlated very well between both (r = 0.850, p < 0.01). Moreover, all the patients without these mutations by MB-NGS were found to have no mutations by ddPCR. In conclusion, MB-NGS could successfully detect ESR1 mutations in cfDNA with a higher sensitivity of 0.1% than conventional NGS and was considered as clinically useful as ddPCR.

Preexisting compensatory amino acids compromise fitness costs of a HIV-1 T cell escape mutation

DOE PAGES

Liu, Donglai; Zuo, Tao; Hora, Bhavna; ...

2014-01-01

Background: Fitness costs and slower disease progression are associated with a cytolytic T lymphocyte (CTL) escape mutation T242N in Gag in HIV-1-infected individuals carrying HLA-B*57/5801 alleles. However, the impact of different context in diverse HIV-1 strains on the fitness costs due to the T242N mutation has not been well characterized. To better understand the extent of fitness costs of the T242N mutation and the repair of fitness loss through compensatory amino acids, we investigated its fitness impact in different transmitted/founder (T/F) viruses. Results: The T242N mutation resulted in various levels of fitness loss in four different T/F viruses. However, themore » fitness costs were significantly compromised by preexisting compensatory amino acids in (Isoleucine at position 247) or outside (glutamine at position 219) the CTL epitope. Moreover, the transmitted T242N escape mutant in subject CH131 was as fit as the revertant N242T mutant and the elimination of the compensatory amino acid I247 in the T/F viral genome resulted in significant fitness cost, suggesting the fitness loss caused by the T242N mutation had been fully repaired in the donor at transmission. Analysis of the global circulating HIV-1 sequences in the Los Alamos HIV Sequence Database showed a high prevalence of compensatory amino acids for the T242N mutation and other T cell escape mutations. Conclusions: Our results show that the preexisting compensatory amino acids in the majority of circulating HIV-1 strains could significantly compromise the fitness loss due to CTL escape mutations and thus increase challenges for T cell based vaccines.« less

ESR1 and PIK3CA mutational status in serum and plasma from metastatic breast cancer patients: A comparative study.

PubMed

Takeshita, Takashi; Yamamoto, Yutaka; Yamamoto-Ibusuki, Mutsuko; Tomiguchi, Mai; Sueta, Aiko; Iwase, Hirotaka

2018-04-07

Plasma and serum cell-free DNA (cfDNA) are useful sources of tumor DNA, but comparative investigations of the tumor mutational status between them are rare. we performed droplet digital PCR assay for representative hotspot mutations in metastatic breast cancer (MBC) (ESR1 and PIK3CA) in serum and plasma cfDNA concurrently extracted from the blood of 33 estrogen receptor-positive MBC patients. ESR1 mutations in plasma cfDNA were found in 7 of the 33 patients; ESR1 mutations in serum cfDNA were detected in only one out of 7 patients with ESR1 mutations in plasma cfDNA. PIK3CA exon 9 and exon 20 mutations in plasma cfDNA were found in 3 and 7 out of the 33 patients, respectively; PIK3CA exon 9 mutations in serum cfDNA were detected in 2 out of 3 patients with PIK3CA exon 9 mutations in plasma cfDNA; PIK3CA exon 20 mutations in serum cfDNA were detected in 2 out of 7 patients with PIK3CA exon 20 mutations in plasma cfDNA. Here we show the higher frequency of ESR1 and PIK3CA mutations in the plasma than in the serum in 33 MBC patients; therefore, serum samples should not be considered the preferred source of cfDNA.

Spectrum of mutations in leiomyosarcomas identified by clinical targeted next-generation sequencing.

PubMed

Lee, Paul J; Yoo, Naomi S; Hagemann, Ian S; Pfeifer, John D; Cottrell, Catherine E; Abel, Haley J; Duncavage, Eric J

2017-02-01

Recurrent genomic mutations in uterine and non-uterine leiomyosarcomas have not been well established. Using a next generation sequencing (NGS) panel of common cancer-associated genes, 25 leiomyosarcomas arising from multiple sites were examined to explore genetic alterations, including single nucleotide variants (SNV), small insertions/deletions (indels), and copy number alterations (CNA). Sequencing showed 86 non-synonymous, coding region somatic variants within 151 gene targets in 21 cases, with a mean of 4.1 variants per case; 4 cases had no putative mutations in the panel of genes assayed. The most frequently altered genes were TP53 (36%), ATM and ATRX (16%), and EGFR and RB1 (12%). CNA were identified in 85% of cases, with the most frequent copy number losses observed in chromosomes 10 and 13 including PTEN and RB1; the most frequent gains were seen in chromosomes 7 and 17. Our data show that deletions in canonical cancer-related genes are common in leiomyosarcomas. Further, the spectrum of gene mutations observed shows that defects in DNA repair and chromosomal maintenance are central to the biology of leiomyosarcomas, and that activating mutations observed in other common cancer types are rare in leiomyosarcomas. Copyright © 2017 Elsevier Inc. All rights reserved.

Systematic analysis of mutation distribution in three dimensional protein structures identifies cancer driver genes.

PubMed

Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki

2016-05-26

Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes.

Systematic analysis of mutation distribution in three dimensional protein structures identifies cancer driver genes

PubMed Central

Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A.; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki

2016-01-01

Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes. PMID:27225414

A novel COL1A1 mutation in a family with osteogenesis imperfecta associated with phenotypic variabilities

PubMed Central

Seto, Toshiyuki; Yamamoto, Toshiyuki; Shimojima, Keiko; Shintaku, Haruo

2017-01-01

Osteogenesis imperfecta (OI) is a heterogeneous disorder that is characterized by bone fragility and systemic complications, and is mainly caused by gene mutations in COL1A1 or COL1A2. A novel COL1A1 splicing mutation, c.750+2T>A, was identified in a Japanese OI family. Only the proband in this family showed various complications, such as heart valve diseases and severe scoliosis. The clinical heterogeneity in the family is discussed in this study. PMID:28326186

Prognostic relevance of autophagy-related markers LC3, p62/sequestosome 1, Beclin-1 and ULK1 in colorectal cancer patients with respect to KRAS mutational status.

PubMed

Schmitz, Klaus Juergen; Ademi, Ceflije; Bertram, Stefanie; Schmid, Kurt Werner; Baba, Hideo Andreas

2016-07-22

Autophagy is a cellular pathway that regulates transportation of cytoplasmic macromolecules and organelles to lysosomes for degradation. Autophagy is involved in both tumorigenesis and tumour suppression. Here we investigated the potential prognostic value of the autophagy-related proteins Beclin-1, p62, LC3 and uncoordinated (UNC) 51-like kinase 1 (ULK1) in a cohort of colorectal cancer (CRC) specimens. In this study, we analysed the immunoexpression of the autophagy-related proteins p62, LC3, Beclin-1 and ULK1 in 127 CRC patients with known KRAS mutational status and detailed clinical follow-up. Survival analysis of p62 staining showed a significant correlation of cytoplasmic (not nuclear) p62 expression with a favourable tumour-specific overall survival (OS). The prognostic power of cytoplasmic p62 was found in the KRAS-mutated subgroup but was lost in the KRAS wildtype subgroup. Survival analysis of Beclin-1 staining did not show an association with OS in the complete cohort. LC3 overexpression demonstrated a slight, though not significant, association with decreased OS. Upon stratifying cases by KRAS mutational status, nuclear (not cytoplasmic) Beclin-1 staining was associated with a significantly decreased OS in the KRAS-mutated subgroup but not in the KRAS wildtype CRCs. In addition, LC3 overexpression was significantly associated with decreased OS in the KRAS-mutated CRC subgroup. ULK1 expression was not correlated to survival. Immunohistochemical analyses of LC3, p62 and Beclin-1 may constitute promising novel prognostic markers in CRC, especially in KRAS-mutated CRCs. This strategy might help in identifying high-risk patients who would benefit from autophagy-related anticancer drugs.

[Cardiofaciocutaneous syndrome, a Noonan syndrome related disorder: clinical and molecular findings in 11 patients].

PubMed

Carcavilla, Atilano; García-Miñaúr, Sixto; Pérez-Aytés, Antonio; Vendrell, Teresa; Pinto, Isabel; Guillén-Navarro, Encarna; González-Meneses, Antonio; Aoki, Yoko; Grinberg, Daniel; Ezquieta, Begoña

2015-01-20

To describe 11 patients with cardiofaciocutaneous syndrome (CFC) and compare them with 130 patients with other RAS-MAPK syndromes (111 Noonan syndrome patients [NS] and 19 patients with LEOPARD syndrome). Clinical data from patients submitted for genetic analysis were collected. Bidirectional sequencing analysis of PTPN11, SOS1, RAF1, BRAF, and MAP2K1 focused on exons carrying recurrent mutations, and of all KRAS exons were performed. Six different mutations in BRAF were identified in 9 patients, as well as 2 MAP2K1 mutations. Short stature, developmental delay, language difficulties and ectodermal anomalies were more frequent in CFC patients when compared with other neuro-cardio-faciocutaneous syndromes (P<.05). In at least 2 cases molecular testing helped reconsider the diagnosis. CFC patients showed a rather severe phenotype but at least one patient with BRAF mutation showed no developmental delay, which illustrates the variability of the phenotypic spectrum caused by BRAF mutations. Molecular genetic testing is a valuable tool for differential diagnosis of CFC and NS related disorders. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

Mutations affecting the cytoplasmic functions of the co-chaperone DNAJB6 cause limb-girdle muscular dystrophy

PubMed Central

Sarparanta, Jaakko; Jonson, Per Harald; Golzio, Christelle; Sandell, Satu; Luque, Helena; Screen, Mark; McDonald, Kristin; Stajich, Jeffrey M.; Mahjneh, Ibrahim; Vihola, Anna; Raheem, Olayinka; Penttilä, Sini; Lehtinen, Sara; Huovinen, Sanna; Palmio, Johanna; Tasca, Giorgio; Ricci, Enzo; Hackman, Peter; Hauser, Michael; Katsanis, Nicholas; Udd, Bjarne

2012-01-01

Limb-girdle muscular dystrophy type 1D (LGMD1D) was linked to 7q36 over a decade ago1, but its genetic cause has remained elusive. We have studied nine LGMD families from Finland, the U.S., and Italy, and identified four dominant missense mutations leading to p.Phe93Leu or p.Phe89Ile changes in the ubiquitously expressed co-chaperone DNAJB6. Functional testing in vivo showed that the mutations have a dominant toxic effect mediated specifically by the cytoplasmic isoform of DNAJB6. In vitro studies demonstrated that the mutations increase the half-life of DNAJB6, extending this effect to the wild-type protein, and reduce its protective anti-aggregation effect. Further, we show that DNAJB6 interacts with members of the CASA complex, including the myofibrillar-myopathy-causing protein BAG3. Our data provide the genetic cause of LGMD1D, suggest that the pathogenesis is mediated by defective chaperone function, and highlight how mutations expressed ubiquitously can exert their effect in a tissue-, cellular compartment-, and isoform-specific manner. PMID:22366786

A recurrent deletion mutation in OPA1 causes autosomal dominant optic atrophy in a Chinese family

NASA Astrophysics Data System (ADS)

Zhang, Liping; Shi, Wei; Song, Liming; Zhang, Xiao; Cheng, Lulu; Wang, Yanfang; Ge, Xianglian; Li, Wei; Zhang, Wei; Min, Qingjie; Jin, Zi-Bing; Qu, Jia; Gu, Feng

2014-11-01

Autosomal dominant optic atrophy (ADOA) is the most frequent form of hereditary optic neuropathy and occurs due to the degeneration of the retinal ganglion cells. To identify the genetic defect in a family with putative ADOA, we performed capture next generation sequencing (CNGS) to screen known retinal disease genes. However, six exons failed to be sequenced by CNGS in optic atrophy 1 gene (OPA1). Sequencing of those exons identified a 4 bp deletion mutation (c.2983-1_2985del) in OPA1. Furthermore, we sequenced the transcripts of OPA1 from the patient skin fibroblasts and found there is six-nucleotide deletion (c.2984-c.2989, AGAAAG). Quantitative-PCR and Western blotting showed that OPA1 mRNA and its protein expression have no obvious difference between patient skin fibroblast and control. The analysis of protein structure by molecular modeling suggests that the mutation may change the structure of OPA1 by formation of an alpha helix protruding into an existing pocket. Taken together, we identified an OPA1 mutation in a family with ADOA by filling the missing CNGS data. We also showed that this mutation affects the structural intactness of OPA1. It provides molecular insights for clinical genetic diagnosis and treatment of optic atrophy.

A recurrent deletion mutation in OPA1 causes autosomal dominant optic atrophy in a Chinese family.

PubMed

Zhang, Liping; Shi, Wei; Song, Liming; Zhang, Xiao; Cheng, Lulu; Wang, Yanfang; Ge, Xianglian; Li, Wei; Zhang, Wei; Min, Qingjie; Jin, Zi-Bing; Qu, Jia; Gu, Feng

2014-11-06

Autosomal dominant optic atrophy (ADOA) is the most frequent form of hereditary optic neuropathy and occurs due to the degeneration of the retinal ganglion cells. To identify the genetic defect in a family with putative ADOA, we performed capture next generation sequencing (CNGS) to screen known retinal disease genes. However, six exons failed to be sequenced by CNGS in optic atrophy 1 gene (OPA1). Sequencing of those exons identified a 4 bp deletion mutation (c.2983-1_2985del) in OPA1. Furthermore, we sequenced the transcripts of OPA1 from the patient skin fibroblasts and found there is six-nucleotide deletion (c.2984-c.2989, AGAAAG). Quantitative-PCR and Western blotting showed that OPA1 mRNA and its protein expression have no obvious difference between patient skin fibroblast and control. The analysis of protein structure by molecular modeling suggests that the mutation may change the structure of OPA1 by formation of an alpha helix protruding into an existing pocket. Taken together, we identified an OPA1 mutation in a family with ADOA by filling the missing CNGS data. We also showed that this mutation affects the structural intactness of OPA1. It provides molecular insights for clinical genetic diagnosis and treatment of optic atrophy.

Individualized Mutation Detection in Circulating Tumor DNA for Monitoring Colorectal Tumor Burden Using a Cancer-Associated Gene Sequencing Panel.

PubMed

Sato, Kei A; Hachiya, Tsuyoshi; Iwaya, Takeshi; Kume, Kohei; Matsuo, Teppei; Kawasaki, Keisuke; Abiko, Yukito; Akasaka, Risaburo; Matsumoto, Takayuki; Otsuka, Koki; Nishizuka, Satoshi S

2016-01-01

Circulating tumor DNA (ctDNA) carries information on tumor burden. However, the mutation spectrum is different among tumors. This study was designed to examine the utility of ctDNA for monitoring tumor burden based on an individual mutation profile. DNA was extracted from a total of 176 samples, including pre- and post-operational plasma, primary tumors, and peripheral blood mononuclear cells (PBMC), from 44 individuals with colorectal tumor who underwent curative resection of colorectal tumors, as well as nine healthy individuals. Using a panel of 50 cancer-associated genes, tumor-unique mutations were identified by comparing the single nucleotide variants (SNVs) from tumors and PBMCs with an Ion PGM sequencer. A group of the tumor-unique mutations from individual tumors were designated as individual marker mutations (MMs) to trace tumor burden by ctDNA using droplet digital PCR (ddPCR). From these experiments, three major objectives were assessed: (a) Tumor-unique mutations; (b) mutation spectrum of a tumor; and (c) changes in allele frequency of the MMs in ctDNA after curative resection of the tumor. A total of 128 gene point mutations were identified in 27 colorectal tumors. Twenty-six genes were mutated in at least 1 sample, while 14 genes were found to be mutated in only 1 sample, respectively. An average of 2.7 genes were mutated per tumor. Subsequently, 24 MMs were selected from SNVs for tumor burden monitoring. Among the MMs found by ddPCR with > 0.1% variant allele frequency in plasma DNA, 100% (8 out of 8) exhibited a decrease in post-operation ctDNA, whereas none of the 16 MMs found by ddPCR with < 0.1% variant allele frequency in plasma DNA showed a decrease. This panel of 50 cancer-associated genes appeared to be sufficient to identify individual, tumor-unique, mutated ctDNA markers in cancer patients. The MMs showed the clinical utility in monitoring curatively-treated colorectal tumor burden if the allele frequency of MMs in plasma DNA is above 0.1%.

Genetic heterogeneity of pseudoxanthoma elasticum: the Chinese signature profile of ABCC6 and ENPP1 mutations.

PubMed

Jin, Liang; Jiang, Qiujie; Wu, Zhengsheng; Shao, Changxia; Zhou, Yong; Yang, Luting; Uitto, Jouni; Wang, Gang

2015-05-01

Pseudoxanthoma elasticum (PXE), an autosomal recessive disorder characterized by ectopic mineralization, is caused by mutations in the ABCC6 gene. We examined clinically 29 Chinese PXE patients from unrelated families, so far the largest cohort of Asian PXE patients. In a subset of 22 patients, we sequenced ABCC6 and another candidate gene, ENPP1, and conducted pathogenicity analyses for each variant. We identified a total of 17 distinct mutations in ABCC6, 15 of them being, to our knowledge, previously unreported, including 5 frameshift and 10 missense variants. In addition, a missense mutation in combination with a recurrent nonsense mutation in ENPP1 was discovered in a pediatric PXE case. No cases with p.R1141X or del23-29 mutations, common in Caucasian patient populations, were identified. The 10 missense mutations in ABCC6 were expressed in the mouse liver via hydrodynamic tail-vein injections. One mutant protein showed cytoplasmic accumulation indicating abnormal subcellular trafficking, while the other nine mutants showed correct plasma membrane location. These nine mutations were further investigated for their pathogenicity using a recently developed zebrafish mRNA rescue assay. Minimal rescue of the morpholino-induced phenotype was achieved with eight of the nine mutant human ABCC6 mRNAs tested, implying pathogenicity. This study demonstrates that the Chinese PXE population harbors unique ABCC6 mutations. These genetic data have implications for allele-specific therapy currently being developed for PXE.

Four Novel p.N385K, p.V36A, c.1033–1034insT and c.1417–1418delCT Mutations in the Sphingomyelin Phosphodiesterase 1 (SMPD1) Gene in Patients with Types A and B Niemann-Pick Disease (NPD)

PubMed Central

Manshadi, Masoumeh Dehghan; Kamalidehghan, Behnam; Keshavarzi, Fatemeh; Aryani, Omid; Dadgar, Sepideh; Arastehkani, Ahoora; Tondar, Mahdi; Ahmadipour, Fatemeh; Meng, Goh Yong; Houshmand, Massoud

2015-01-01

Background: Types A and B Niemann-Pick disease (NPD) are autosomal-recessive lysosomal storage disorders caused by the deficient activity of acid sphingomyelinase due to mutations in the sphingomyelin phosphodiesterase 1 (SMPD1) gene. Methods: In order to determine the prevalence and distribution of SMPD1 gene mutations, the genomic DNA of 15 unrelated Iranian patients with types A and B NPD was examined using PCR, DNA sequencing and bioinformatics analysis. Results: Of 8 patients with the p.G508R mutation, 5 patients were homozygous, while the other 3 were heterozygous. One patient was heterozygous for both the p.N385K and p.G508R mutations. Another patient was heterozygous for both the p.A487V and p.G508R mutations. Two patients (one homozygous and one heterozygous) showed the p.V36A mutation. One patient was homozygous for the c.1033–1034insT mutation. One patient was homozygous for the c.573delT mutation, and 1 patient was homozygous for the c.1417–1418delCT mutation. Additionally, bioinformatics analysis indicated that two new p.V36A and p.N385K mutations decreased the acid sphingomyelinase (ASM) protein stability, which might be evidence to suggest the pathogenicity of these mutations. Conclusion: with detection of these new mutations, the genotypic spectrum of types A and B NPD is extended, facilitating the definition of disease-related mutations. However, more research is essential to confirm the pathogenic effect of these mutations. PMID:25811928

Temporal and Geographical Distribution of Adamantane-Resistant H1N1 Virus and The Evolution Tree of MP Gene Mutation

NASA Astrophysics Data System (ADS)

He, W.; Dong, G.

2016-12-01

The adamantanamine, a kind of M2 inhibitor, is globally used to treat the infection of Influenza A(H1N1). But for the past decade, the H1N1 influenza virus becomes significantly resistant to adamantanamine owing to the mutation on site 26, 27, 30, 31 and 34. This study collects a number of 14823 M2 protein sequences of H1N1 virus strains from NCBI range from 1918 to April 12, 2016. We statistics the mutation rate of different hosts, mutation sites, countries and years to find out the change of mutation rate. The result shows that 60.53% H1N1 influenza virus affected Human have the resistance to adamantanamine and the S31N mutation should be the main reason. We also find that the mutation rate of S31N raised from 23.33% to 88.76%. The second aspect in this study is analyzing the MP gene sequence of H1N1 influenza virus to find out the evolution of H1N1 according to MP protein. This study collecting a great number of M2 protein sequences to find out the mutation situation of H1N1 have a signification to the surveillance of drug resistance and have a bit of guidance on using the adamantanamine.

Monoclonal antibody specific for IDH1 R132H mutation.

PubMed

Capper, David; Zentgraf, Hanswalter; Balss, Jörg; Hartmann, Christian; von Deimling, Andreas

2009-11-01

IDH1 R132H mutations occur in approximately 70% of astrocytomas and oligodendroglial tumors. We developed a mouse monoclonal antibody targeting the IDH1 R132H mutation. Here, we show the high specificity and sensitivity of this antibody on Western blots and tissue sections from formalin fixed paraffin embedded tumor specimens. This antibody is highly useful for tumor classification, in detecting single infiltrating tumor cells and for the characterization of the cellular role of mutant IDH1 protein.

[Analysis of MAT1A gene mutations in a child affected with simple hypermethioninemia].

PubMed

Sun, Yun; Ma, Dingyuan; Wang, Yanyun; Yang, Bin; Jiang, Tao

2017-02-10

To detect potential mutations of MAT1A gene in a child suspected with simple hypermethioninemia by MS/MS neonatal screening. Clinical data of the child was collected. Genomic DNA was extracted by a standard method and subjected to targeted sequencing using an Ion Ampliseq TM Inherited Disease Panel. Detected mutations were verified by Sanger sequencing. The child showed no clinical features except evaluated methionine. A novel compound mutation of the MAT1A gene, i.e., c.345delA and c.529C>T, was identified in the child. His father and mother were found to be heterozygous for the c.345delA mutation and c.529C>T mutation, respectively. The compound mutation c.345delA and c.529C>T of the MAT1A gene probably underlie the disease in the child. The semi-conductor sequencing has provided an important means for the diagnosis of hereditary diseases.

Clinical features of X linked juvenile retinoschisis associated with new mutations in the XLRS1 gene in Italian families.

PubMed

Simonelli, F; Cennamo, G; Ziviello, C; Testa, F; de Crecchio, G; Nesti, A; Manitto, M P; Ciccodicola, A; Banfi, S; Brancato, R; Rinaldi, E

2003-09-01

To describe the clinical phenotype of X linked juvenile retinoschisis in eight Italian families with six different mutations in the XLRS1 gene. Complete ophthalmic examinations, electroretinography and A and B-scan standardised echography were performed in 18 affected males. The coding sequences of the XLRS1 gene were amplified by polymerase chain reaction and directly sequenced on an automated sequencer. Six different XLRS1 mutations were identified; two of these mutations Ile81Asn and the Trp122Cys, have not been previously described. The affected males showed an electronegative response to the standard white scotopic stimulus and a prolonged implicit time of the 30 Hz flicker. In the families with Trp112Cys and Trp122Cys mutations we observed a more severe retinoschisis (RS) clinical picture compared with the other genotypes. The severe RS phenotypes associated with Trp112Cys and to Trp122Cys mutations suggest that these mutations determine a notable alteration in the function of the retinoschisin protein.

Apatinib in the treatment of advanced lung adenocarcinoma with KRAS mutation.

PubMed

Zeng, Da-Xiong; Wang, Chang-Guo; Huang, Jian-An; Jiang, Jun-Hong

2017-01-01

Activating KRAS mutations in lung adenocarcinoma are characterized with treatment resistance and poor prognosis. As a small molecule inhibitor of vascular endothelial growth factor receptor-2 (VEGFR-2) tyrosine kinase, apatinib has been proven successful in advanced gastric cancer and breast cancer. In this study, we show the result of apatinib as salvage treatment in lung adenocarcinoma patients with KRAS mutation. Four advanced lung adenocarcinoma patients with KRAS mutation were orally administered apatinib (250 mg/d) after second-line treatment. One patient showed progressive disease, while 3 patients showed stable disease response to apatinib, with a median progression-free survival (PFS) of 3.8 months (1.5-5.5 months). The main toxicities were hoarseness and hemoptysis, which were manageable. Therefore, apatinib might be an optional choice for advanced lung adenocarcinoma patients with KRAS mutation in post second-line treatment.

The occurrence and the type of germline mutations in the RET gene in patients with medullary thyroid carcinoma and their unaffected kindred's from Central Poland.

PubMed

Paszko, Z; Sromek, M; Czetwertynska, M; Skasko, E; Czapczak, D; Wisniewska, A; Prokurat, A; Chrupek, M; Jagielska, A; Kozlowicz-Gudzinska, I

2007-12-01

We aimed to investigate the occurrence and types of pathogenic mutations in the RET gene in patients with MTC of the Central Poland population and in their relatives. DNA was extracted from the peripheral blood lymphocytes of a total of 330 persons, including 235 MTC patients and 95 of their unaffected kindred's. Exons 10, 11, 13, 14, 15 and 16 of the RET gene were amplified by PCR and sequenced. Sixty-seven people were found to carry pathogenic, germline mutations in the RET gene. In exon 10, C609F, C609R and C609Y (3 families), C618G, C618F (2 families), and C620G (4 families) mutations were identified. In exon 11, C634R (8 families) and C649L mutations (1 patient) were found. Five families carried Y791F mutation in exon 13. One patient with PTC revealed the presence of a Y791F mutation. In 3 families, exon 14 of the RET gene harbored the following mutations: V804L (1 patient), E819K (1 patient) and R844Q (1 patient). In 1 family, the S891A mutation was identified in exon 15, 3 families were found to carry mutations in exon16, R912P in 1 family and M918T in 2 families. In summary, of the 235 patients affected by MTC, 46 (19.6%) carried pathogenic RET gene mutations, 1 patient with RET mutation had kidney carcinoma, and 1 had PTC. The results show the occurrence of a variety of mutations prevalent in patients with MTC in the population of Central Poland. These results may contribute to a better diagnosis of medullary thyroid carcinoma.

Primary hyperoxaluria type 1: diagnostic relevance of mutations and polymorphisms in the alanine:glyoxylate aminotransferase gene (AGXT).

PubMed

Tarn, A C; von Schnakenburg, C; Rumsby, G

1997-09-01

Primary hyperoxaluria type 1 (PH1) is an autosomal recessive disorder of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). The disease shows considerable phenotypic, enzymatic and genetic heterogeneity. To date, 7 polymorphisms and 11 point mutations have been described in the gene encoding AGT. We report on the prevalence of these polymorphisms and mutations in 79 patients with PH1 with the aim of assessing their diagnostic relevance. A strong association of the C154T, intron 1 insertion and C386T polymorphisms is confirmed and this linkage extends to include the type 1 variant of a polymorphic tandem repeat in intron 4. Only 64 of 158 (40%) PH1 alleles have one of the defined mutations, with the G630A mutation accounting for 39 of these and T853C for 14. Overall only 20 (25%) of the patients studied had the genetic basis of their disease fully explained: 7 were homozygous for the G630A mutation, 5 were homozygous for the T853C mutation, 1 was homozygous for the C819T mutation, and 7 had two different mutations identified and were presumed to be compound heterozygotes. Only the two more frequent G630A and T853C mutations are of general diagnostic relevance for mutation screening. It seems likely that there are a significant number of other mutations, perhaps family-specific, still to be described. There was no apparent difference in the types of mutations in patients presenting in the first year of life (36%), suggesting that other factors, such as periods of dehydration or urinary tract infections, might contribute more to the clinical manifestation than genotype.

Gain-of-Function Mutations in SCN11A Cause Familial Episodic Pain

PubMed Central

Zhang, Xiang Yang; Wen, Jingmin; Yang, Wei; Wang, Cheng; Gao, Luna; Zheng, Liang Hong; Wang, Tao; Ran, Kaikai; Li, Yulei; Li, Xiangyang; Xu, Ming; Luo, Junyu; Feng, Shenglei; Ma, Xixiang; Ma, Hongying; Chai, Zuying; Zhou, Zhuan; Yao, Jing; Zhang, Xue; Liu, Jing Yu

2013-01-01

Many ion channel genes have been associated with human genetic pain disorders. Here we report two large Chinese families with autosomal-dominant episodic pain. We performed a genome-wide linkage scan with microsatellite markers after excluding mutations in three known genes (SCN9A, SCN10A, and TRPA1) that cause similar pain syndrome to our findings, and we mapped the genetic locus to a 7.81 Mb region on chromosome 3p22.3–p21.32. By using whole-exome sequencing followed by conventional Sanger sequencing, we identified two missense mutations in the gene encoding voltage-gated sodium channel Nav1.9 (SCN11A): c.673C>T (p.Arg225Cys) and c.2423C>G (p.Ala808Gly) (one in each family). Each mutation showed a perfect cosegregation with the pain phenotype in the corresponding family, and neither of them was detected in 1,021 normal individuals. Both missense mutations were predicted to change a highly conserved amino acid residue of the human Nav1.9 channel. We expressed the two SCN11A mutants in mouse dorsal root ganglion (DRG) neurons and showed that both mutations enhanced the channel’s electrical activities and induced hyperexcitablity of DRG neurons. Taken together, our results suggest that gain-of-function mutations in SCN11A can be causative of an autosomal-dominant episodic pain disorder. PMID:24207120

Clinical and genetic heterogeneity in patients with mosaic variegated aneuploidy: delineation of clinical subtypes.

PubMed

García-Castillo, Herbert; Vásquez-Velásquez, Ana Isabel; Rivera, Horacio; Barros-Núñez, Patricio

2008-07-01

Mosaic variegated aneuploidy (MVA) is a rare autosomal recessive syndrome related to BUB1B gene mutations and characterized by multiple mosaic aneuploidies, cancer predisposition, and a distinct phenotype. We report on two mildly affected sibs with MVA syndrome but without BUB1B mutation. Both patients exhibited growth retardation, frontal bossing, triangular face and micrognathia but not microcephaly or cancer. Aneuploidies were assessed both in G-banded metaphases from lymphocyte cultures and in interphase nuclei from buccal cells by FISH. Screening of 23 exons and intron-exon boundaries of BUB1B was also carried out. These patients were then compared with other 19 MVA patients screened for BUB1B mutations. Around one half of the cultured lymphocytes from our patients had aneuploidies ranging from nullisomies to heptasomies; the most frequent abnormalities were trisomies (42%) and monosomies (28%). FISH results demonstrated more chromosomal losses than gains. Screening of BUB1B in our two patients failed to identify any mutation. A review of the 21/35 patients screened for BUB1B demonstrated three clinical pictures. Patients with monoallelic BUB1B mutations were severely affected with Dandy-Walker complex (7/8), cataracts (6/6), and Wilms' tumor (7/8); premature chromatid separation (PCS) was observed in 8/8 propositi and 7/7 carrier parents. Patients without BUB1B mutations were mildly affected with no evidence of cancer, Dandy-Walker malformation or cataract, and rarely (1/7) showed PCS. Finally, patients with biallelic BUB1B mutations showed a moderate phenotype. The distinct MVA clinical groups delineated here point to involvement of at least another mitotic spindle checkpoint gene in addition to the BUB1B gene. (c) 2008 Wiley-Liss, Inc.

A comprehensive biophysical description of pairwise epistasis throughout an entire protein domain

PubMed Central

Olson, C. Anders; Wu, Nicholas C.; Sun, Ren

2014-01-01

SUMMARY Background Non-additivity in fitness effects from two or more mutations, termed epistasis, can result in compensation of deleterious mutations or negation of beneficial mutations. Recent evidence shows the importance of epistasis in individual evolutionary pathways. However, an unresolved question in molecular evolution is how often and how significantly fitness effects change in alternative genetic backgrounds. Results To answer this question we quantified the effects of all single mutations and double mutations between all positions in the IgG-binding domain of protein G (GB1). By observing the first two steps of all possible evolutionary pathways, this fitness profile enabled the characterization of the extent and magnitude of pairwise epistasis throughout an entire protein molecule. Furthermore, we developed a novel approach to quantitatively determine the effects of single mutations on structural stability (ΔΔGU). This enabled determination of the importance of stability effects in functional epistasis. Conclusions Our results illustrate common biophysical mechanisms for occurrences of positive and negative epistasis. Our results show pervasive positive epistasis within a conformationally dynamic network of residues. The stability analysis shows that significant negative epistasis, which is more common than positive epistasis, mostly occurs between combinations of destabilizing mutations. Furthermore, we show that although significant positive epistasis is rare, many deleterious mutations are beneficial in at least one alternative mutational background. The distribution of conditionally beneficial mutations throughout the domain demonstrates that the functional portion of sequence space can be significantly expanded by epistasis. PMID:25455030

Mutations in STX1B, encoding a presynaptic protein, cause fever-associated epilepsy syndromes.

PubMed

Schubert, Julian; Siekierska, Aleksandra; Langlois, Mélanie; May, Patrick; Huneau, Clément; Becker, Felicitas; Muhle, Hiltrud; Suls, Arvid; Lemke, Johannes R; de Kovel, Carolien G F; Thiele, Holger; Konrad, Kathryn; Kawalia, Amit; Toliat, Mohammad R; Sander, Thomas; Rüschendorf, Franz; Caliebe, Almuth; Nagel, Inga; Kohl, Bernard; Kecskés, Angela; Jacmin, Maxime; Hardies, Katia; Weckhuysen, Sarah; Riesch, Erik; Dorn, Thomas; Brilstra, Eva H; Baulac, Stephanie; Møller, Rikke S; Hjalgrim, Helle; Koeleman, Bobby P C; Jurkat-Rott, Karin; Lehman-Horn, Frank; Roach, Jared C; Glusman, Gustavo; Hood, Leroy; Galas, David J; Martin, Benoit; de Witte, Peter A M; Biskup, Saskia; De Jonghe, Peter; Helbig, Ingo; Balling, Rudi; Nürnberg, Peter; Crawford, Alexander D; Esguerra, Camila V; Weber, Yvonne G; Lerche, Holger

2014-12-01

Febrile seizures affect 2-4% of all children and have a strong genetic component. Recurrent mutations in three main genes (SCN1A, SCN1B and GABRG2) have been identified that cause febrile seizures with or without epilepsy. Here we report the identification of mutations in STX1B, encoding syntaxin-1B, that are associated with both febrile seizures and epilepsy. Whole-exome sequencing in independent large pedigrees identified cosegregating STX1B mutations predicted to cause an early truncation or an in-frame insertion or deletion. Three additional nonsense or missense mutations and a de novo microdeletion encompassing STX1B were then identified in 449 familial or sporadic cases. Video and local field potential analyses of zebrafish larvae with antisense knockdown of stx1b showed seizure-like behavior and epileptiform discharges that were highly sensitive to increased temperature. Wild-type human syntaxin-1B but not a mutated protein rescued the effects of stx1b knockdown in zebrafish. Our results thus implicate STX1B and the presynaptic release machinery in fever-associated epilepsy syndromes.

Prevalence of BRCA1/BRCA2 mutations in a Brazilian population sample at-risk for hereditary breast cancer and characterization of its genetic ancestry

PubMed Central

Paula, André E.; Pereira, Rui; Andrade, Carlos E.; Felicio, Paula S.; Souza, Cristiano P.; Mendes, Deise R.P.; Volc, Sahlua; Berardinelli, Gustavo N.; Grasel, Rebeca S.; Sabato, Cristina S.; Viana, Danilo V.; Machado, José Carlos; Costa, José Luis; Mauad, Edmundo C.; Scapulatempo-Neto, Cristovam; Arun, Banu; Reis, Rui M.; Palmero, Edenir I.

2016-01-01

Background There are very few data about the mutational profile of families at-risk for hereditary breast and ovarian cancer (HBOC) from Latin America (LA) and especially from Brazil, the largest and most populated country in LA. Results Of the 349 probands analyzed, 21.5% were BRCA1/BRCA2 mutated, 65.3% at BRCA1 and 34.7% at BRCA2 gene. The mutation c.5266dupC (former 5382insC) was the most frequent alteration, representing 36.7% of the BRCA1 mutations and 24.0% of all mutations identified. Together with the BRCA1 c.3331_3334delCAAG mutation, these mutations constitutes about 35% of the identified mutations and more than 50% of the BRCA1 pathogenic mutations. Interestingly, six new mutations were identified. Additionally, 39 out of the 44 pathogenic mutations identified were not previously reported in the Brazilian population. Besides, 36 different variants of unknown significance (VUS) were identified. Regarding ancestry, average ancestry proportions were 70.6% European, 14.5% African, 8.0% Native American and 6.8% East Asian. Materials and methods This study characterized 349 Brazilian families at-risk for HBOC regarding their germline BRCA1/BRCA2 status and genetic ancestry. Conclusions This is the largest report of BRCA1/BRCA2 assessment in an at-risk HBOC Brazilian population. We identified 21.5% of patients harboring BRCA1/BRCA2 mutations and characterized the genetic ancestry of a sample group at-risk for hereditary breast cancer showing once again how admixed is the Brazilian population. No association was found between genetic ancestry and mutational status. The knowledge of the mutational profile in a population can contribute to the definition of more cost-effective strategies for the identification of HBOC families. PMID:27741520

Mutations in POGLUT1, Encoding Protein O-Glucosyltransferase 1, Cause Autosomal-Dominant Dowling-Degos Disease

PubMed Central

Basmanav, F. Buket; Oprisoreanu, Ana-Maria; Pasternack, Sandra M.; Thiele, Holger; Fritz, Günter; Wenzel, Jörg; Größer, Leopold; Wehner, Maria; Wolf, Sabrina; Fagerberg, Christina; Bygum, Anette; Altmüller, Janine; Rütten, Arno; Parmentier, Laurent; El Shabrawi-Caelen, Laila; Hafner, Christian; Nürnberg, Peter; Kruse, Roland; Schoch, Susanne; Hanneken, Sandra; Betz, Regina C.

2014-01-01

Dowling-Degos disease (DDD) is an autosomal-dominant genodermatosis characterized by progressive and disfiguring reticulate hyperpigmentation. We previously identified loss-of-function mutations in KRT5 but were only able to detect pathogenic mutations in fewer than half of our subjects. To identify additional causes of DDD, we performed exome sequencing in five unrelated affected individuals without mutations in KRT5. Data analysis identified three heterozygous mutations from these individuals, all within the same gene. These mutations, namely c.11G>A (p.Trp4∗), c.652C>T (p.Arg218∗), and c.798-2A>C, are within POGLUT1, which encodes protein O-glucosyltransferase 1. Further screening of unexplained cases for POGLUT1 identified six additional mutations, as well as two of the above described mutations. Immunohistochemistry of skin biopsies of affected individuals with POGLUT1 mutations showed significantly weaker POGLUT1 staining in comparison to healthy controls with strong localization of POGLUT1 in the upper parts of the epidermis. Immunoblot analysis revealed that translation of either wild-type (WT) POGLUT1 or of the protein carrying the p.Arg279Trp substitution led to the expected size of about 50 kDa, whereas the c.652C>T (p.Arg218∗) mutation led to translation of a truncated protein of about 30 kDa. Immunofluorescence analysis identified a colocalization of the WT protein with the endoplasmic reticulum and a notable aggregating pattern for the truncated protein. Recently, mutations in POFUT1, which encodes protein O-fucosyltransferase 1, were also reported to be responsible for DDD. Interestingly, both POGLUT1 and POFUT1 are essential regulators of Notch activity. Our results furthermore emphasize the important role of the Notch pathway in pigmentation and keratinocyte morphology. PMID:24387993

X-linked Alport syndrome caused by splicing mutations in COL4A5.

PubMed

Nozu, Kandai; Vorechovsky, Igor; Kaito, Hiroshi; Fu, Xue Jun; Nakanishi, Koichi; Hashimura, Yuya; Hashimoto, Fusako; Kamei, Koichi; Ito, Shuichi; Kaku, Yoshitsugu; Imasawa, Toshiyuki; Ushijima, Katsumi; Shimizu, Junya; Makita, Yoshio; Konomoto, Takao; Yoshikawa, Norishige; Iijima, Kazumoto

2014-11-07

X-linked Alport syndrome is caused by mutations in the COL4A5 gene. Although many COL4A5 mutations have been detected, the mutation detection rate has been unsatisfactory. Some men with X-linked Alport syndrome show a relatively mild phenotype, but molecular basis investigations have rarely been conducted to clarify the underlying mechanism. In total, 152 patients with X-linked Alport syndrome who were suspected of having Alport syndrome through clinical and pathologic investigations and referred to the hospital for mutational analysis between January of 2006 and January of 2013 were genetically diagnosed. Among those patients, 22 patients had suspected splice site mutations. Transcripts are routinely examined when suspected splice site mutations for abnormal transcripts are detected; 11 of them showed expected exon skipping, but others showed aberrant splicing patterns. The mutation detection strategy had two steps: (1) genomic DNA analysis using PCR and direct sequencing and (2) mRNA analysis using RT-PCR to detect RNA processing abnormalities. Six splicing consensus site mutations resulting in aberrant splicing patterns, one exonic mutation leading to exon skipping, and four deep intronic mutations producing cryptic splice site activation were identified. Interestingly, one case produced a cryptic splice site with a single nucleotide substitution in the deep intron that led to intronic exonization containing a stop codon; however, the patient showed a clearly milder phenotype for X-linked Alport syndrome in men with a truncating mutation. mRNA extracted from the kidney showed both normal and abnormal transcripts, with the normal transcript resulting in the milder phenotype. This novel mechanism leads to mild clinical characteristics. This report highlights the importance of analyzing transcripts to enhance the mutation detection rate and provides insight into genotype-phenotype correlations. This approach can clarify the cause of atypically mild phenotypes in X-linked Alport syndrome. Copyright © 2014 by the American Society of Nephrology.

Validation in mesenchymal progenitor cells of a mutation-independent ex vivo approach to gene therapy for osteogenesis imperfecta.

PubMed

Millington-Ward, Sophia; Allers, Carolina; Tuohy, Gearóid; Conget, Paulette; Allen, Danny; McMahon, Helena P; Kenna, Paul F; Humphries, Peter; Farrar, G Jane

2002-09-15

Over 100 dominant-negative mutations within the COL1A1 gene have been identified in osteogenesis imperfecta (OI). In terms of human therapeutics, targeting each of these mutations independently is unlikely to be feasible. Here we show that the hammerhead ribozyme Rzpol1a1, targeting a common polymorphism within transcripts from the COL1A1 gene, downregulates COL1A1 transcript in human mesenchymal progenitor cells at a ribozyme to transcript ratio of only 1:1. Downregulation was confirmed at the protein level. Transducing stem cells with Rzpol1A1 ex vivo followed by autologous transplantation could provide a gene therapy for a large proportion of OI patients with gain-of-function mutations using a single therapeutic.

De novo mutations in HCN1 cause early infantile epileptic encephalopathy.

PubMed

Nava, Caroline; Dalle, Carine; Rastetter, Agnès; Striano, Pasquale; de Kovel, Carolien G F; Nabbout, Rima; Cancès, Claude; Ville, Dorothée; Brilstra, Eva H; Gobbi, Giuseppe; Raffo, Emmanuel; Bouteiller, Delphine; Marie, Yannick; Trouillard, Oriane; Robbiano, Angela; Keren, Boris; Agher, Dahbia; Roze, Emmanuel; Lesage, Suzanne; Nicolas, Aude; Brice, Alexis; Baulac, Michel; Vogt, Cornelia; El Hajj, Nady; Schneider, Eberhard; Suls, Arvid; Weckhuysen, Sarah; Gormley, Padhraig; Lehesjoki, Anna-Elina; De Jonghe, Peter; Helbig, Ingo; Baulac, Stéphanie; Zara, Federico; Koeleman, Bobby P C; Haaf, Thomas; LeGuern, Eric; Depienne, Christel

2014-06-01

Hyperpolarization-activated, cyclic nucleotide-gated (HCN) channels contribute to cationic Ih current in neurons and regulate the excitability of neuronal networks. Studies in rat models have shown that the Hcn1 gene has a key role in epilepsy, but clinical evidence implicating HCN1 mutations in human epilepsy is lacking. We carried out exome sequencing for parent-offspring trios with fever-sensitive, intractable epileptic encephalopathy, leading to the discovery of two de novo missense HCN1 mutations. Screening of follow-up cohorts comprising 157 cases in total identified 4 additional amino acid substitutions. Patch-clamp recordings of Ih currents in cells expressing wild-type or mutant human HCN1 channels showed that the mutations had striking but divergent effects on homomeric channels. Individuals with mutations had clinical features resembling those of Dravet syndrome with progression toward atypical absences, intellectual disability and autistic traits. These findings provide clear evidence that de novo HCN1 point mutations cause a recognizable early-onset epileptic encephalopathy in humans.

Permanent Neonatal Diabetes Caused by Dominant, Recessive, or Compound Heterozygous SUR1 Mutations with Opposite Functional Effects

PubMed Central

Ellard, Sian ; Flanagan, Sarah E. ; Girard, Christophe A. ; Patch, Ann-Marie ; Harries, Lorna W. ; Parrish, Andrew ; Edghill, Emma L. ; Mackay, Deborah J. G. ; Proks, Peter ; Shimomura, Kenju ; Haberland, Holger ; Carson, Dennis J. ; Shield, Julian P. H. ; Hattersley, Andrew T. ; Ashcroft, Frances M. 

2007-01-01

Heterozygous activating mutations in the KCNJ11 gene encoding the pore-forming Kir6.2 subunit of the pancreatic beta cell KATP channel are the most common cause of permanent neonatal diabetes (PNDM). Patients with PNDM due to a heterozygous activating mutation in the ABCC8 gene encoding the SUR1 regulatory subunit of the KATP channel have recently been reported. We studied a cohort of 59 patients with permanent diabetes who received a diagnosis before 6 mo of age and who did not have a KCNJ11 mutation. ABCC8 gene mutations were identified in 16 of 59 patients and included 8 patients with heterozygous de novo mutations. A recessive mode of inheritance was observed in eight patients with homozygous, mosaic, or compound heterozygous mutations. Functional studies of selected mutations showed a reduced response to ATP consistent with an activating mutation that results in reduced insulin secretion. A novel mutational mechanism was observed in which a heterozygous activating mutation resulted in PNDM only when a second, loss-of-function mutation was also present. PMID:17668386

Identification of six novel mutations in Iranian patients with maple syrup urine disease and their in silico analysis.

PubMed

Abiri, Maryam; Karamzadeh, Razieh; Karimipoor, Morteza; Ghadami, Shirin; Alaei, Mohammad Reza; Bagheri, Samira Dabagh; Bagherian, Hamideh; Setoodeh, Aria; Noori-Daloii, Mohammad Reza; Sirous Zeinali

2016-04-01

Maple syrup urine disease (MSUD) is a rare inborn error of branched-chain amino acid metabolism. The disease prevalence is higher in populations with elevated rate of consanguineous marriages such as Iran. Different types of disease causing mutations have been previously reported in BCKDHA, BCKDHB, DBT and DLD genes known to be responsible for MSUD phenotype. In this study, two sets of multiplex polymorphic STR (Short Tandem Repeat) markers linked to the above genes were used to aid in homozygosity mapping in order to find probable pathogenic change(s) in the studied families. The families who showed homozygote haplotype for the BCKDHA gene were subsequently sequenced. Our findings showed that exons 2, 4 and 6 contain most of the mutations which are novel. The changes include two single nucleotide deletion (i.e. c. 143delT and c.702delT), one gross deletion covering the whole exon four c.(375+1_376-1)_(8849+1_885-1), two splice site changes (c.1167+1G>T, c. 288+1G>A), and one point mutation (c.731G>A). Computational approaches were used to analyze these two novel mutations in terms of their impact on protein structure. Computational structural modeling indicated that these mutations might affect structural stability and multimeric assembly of branched-chain α-keto acid dehydrogenase complex (BCKDC). Copyright © 2016. Published by Elsevier B.V.

Hereditary diffuse gastric cancer: implications of genetic testing for screening and prophylactic surgery.

PubMed

Cisco, Robin M; Ford, James M; Norton, Jeffrey A

2008-10-01

Approximately 10% of patients with gastric cancer show familial clustering, and 3% show autosomal dominance and high penetrance. Hereditary diffuse gastric cancer (HDGC) is an autosomal-dominant, inherited cancer syndrome in which affected individuals develop diffuse-type gastric cancer at a young age. Inactivating mutations in the E-cadherin gene CDH1 have been identified in 30% to 50% of patients. CDH1 mutation carriers have an approximately 70% lifetime risk of developing DGC, and affected women carry an additional 20% to 40% risk of developing lobular breast cancer. Because endoscopic surveillance is ineffective in identifying early HDGC, gene-directed prophylactic total gastrectomy currently is offered for CDH1 mutation carriers. In series of asymptomatic individuals undergoing total gastrectomy for CDH1 mutations, the removed stomachs usually contain small foci of early DGC, making surgery not prophylactic but curative. The authors of this review recommend consideration of total gastrectomy in CDH1 mutation carriers at an age 5 years younger than the youngest family member who developed gastric cancer. Individuals who choose not to undergo prophylactic gastrectomy should be followed with biannual chromoendoscopy, and women with CDH1 mutations also should undergo regular surveillance with magnetic resonance imaging studies of the breast. Because of the emergence of gene-directed gastrectomy for HDGC, today, a previously lethal disease is detected by molecular techniques, allowing curative surgery at an early stage.

High MACC1 expression in combination with mutated KRAS G13 indicates poor survival of colorectal cancer patients.

PubMed

Ilm, Katharina; Kemmner, Wolfgang; Osterland, Marc; Burock, Susen; Koch, Gudrun; Herrmann, Pia; Schlag, Peter M; Stein, Ulrike

2015-02-14

The metastasis-associated in colon cancer 1 (MACC1) gene has been identified as prognostic biomarker for colorectal cancer (CRC). Here, we aimed at the refinement of risk assessment by separate and combined survival analyses of MACC1 expression with any of the markers KRAS mutated in codon 12 (KRAS G12) or codon 13 (KRAS G13), BRAF V600 mutation and MSI status in a retrospective study of 99 CRC patients with tumors UICC staged I, II and III. We showed that only high MACC1 expression (HR: 6.09, 95% CI: 2.50-14.85, P < 0.001) and KRAS G13 mutation (HR: 5.19, 95% CI: 1.06-25.45, P = 0.042) were independent prognostic markers for shorter metastasis-free survival (MFS). Accordingly, Cox regression analysis revealed that patients with high MACC1 expression and KRAS G13 mutation exhibited the worst prognosis (HR: 14.48, 95% CI: 3.37-62.18, P < 0.001). Patients were classified based on their molecular characteristics into four clusters with significant differences in MFS (P = 0.003) by using the SPSS 2-step cluster function and Kaplan-Meier survival analysis. According to our results, patients with high MACC1 expression and mutated KRAS G13 exhibited the highest risk for metachronous metastases formation. Moreover, we demonstrated that the "Traditional pathway" with an intermediate risk for metastasis formation can be further subdivided by assessing MACC1 expression into a low and high risk group with regard to MFS prognosis. This is the first report showing that identification of CRC patients at high risk for metastasis is possible by assessing MACC1 expression in combination with KRAS G13 mutation.

Splice site mutations in GH1 detected in previously (Genetically) undiagnosed families with congenital isolated growth hormone deficiency type II.

PubMed

Kempers, M J E; van der Crabben, S N; de Vroede, M; Alfen-van der Velden, J; Netea-Maier, R T; Duim, R A J; Otten, B J; Losekoot, M; Wit, J M

2013-01-01

Congenital isolated growth hormone deficiency (IGHD) is a rare endocrine disorder that presents with severe proportionate growth failure. Dominant (type II) IGHD is usually caused by heterozygous mutations of GH1. The presentation of newly affected family members in 3 families with dominant IGHD in whom previous genetic testing had not demonstrated a GH1 mutation or had not been performed, prompted us to identify the underlying genetic cause. GH1 was sequenced in 3 Caucasian families with a clinical autosomal dominant IGHD. All affected family members had severe growth hormone (GH) deficiency that became apparent in the first 2 years of life. GH treatment led to a marked increase in height SDS. So far, no other pituitary dysfunctions have become apparent. In the first family a novel splice site mutation in GH1 was identified (c.172-1G>C, IVS2-1G>C). In two other families a previously reported splice site mutation (c.291+1G>A, IVS3+1G>A) was found. These data show that several years after negative genetic testing it was now possible to make a genetic diagnosis in these families with a well-defined, clearly heritable, autosomal dominant IGHD. This underscores the importance of clinical and genetic follow-up in a multidisciplinary setting. It also shows that even without a positive family history, genetic testing should be considered if the phenotype is strongly suggestive for a genetic syndrome. Identification of pathogenic mutations, like these GH1 mutations, has important clinical implications for the surveillance and genetic counseling of patients and expands our knowledge on the genotype-phenotype correlation. © 2013 S. Karger AG, Basel.

Molecular characterization of the breakpoints of a 12-kb deletion in the NF1 gene in a family showing germ-line mosaicism.

PubMed Central

Lázaro, C; Gaona, A; Lynch, M; Kruyer, H; Ravella, A; Estivill, X

1995-01-01

Neurofibromatosis type 1 (NF1) is caused by deletions, insertions, translocations, and point mutations in the NF1 gene, which spans 350 kb on the long arm of human chromosome 17. Although several point mutations have been described, large molecular abnormalities have rarely been characterized in detail. We describe here the molecular breakpoints of a 12-kb deletion of the NF1 gene, which is responsible for the NF1 phenotype in a kindred with two children affected because of germline mosaicism in the unaffected father, who has the mutation in 10% of his spermatozoa. The mutation spans introns 31-39, removing 12,021 nt and inserting 30 bp, of which 19 bp are a direct repetition of a sequence located in intron 31, just 4 bp before the 5' breakpoint. The 5' and 3' breakpoints contain the sequence TATTTTA, which could be involved in the generation of the deletion. The most plausible explanation for the mechanism involved in the generation of this 12-kb deletion is homologous/nonhomologous recombination. Since sperm of the father does not contain the corresponding insertion of the 12-kb deleted sequence, this deletion could have occurred within the NF1 chromosome through loop formation. RNA from lymphocytes of one of the NF1 patients showed similar levels of the mutated and normal transcripts, suggesting that the NF1-mRNA from mutations causing frame shifts of the reading frame or stop codons in this gene is not degraded during its processing. The mutation was not detected in fresh lymphocytes from the unaffected father by PCR analysis, supporting the case for true germ-line mosaicism. Images Figure 1 Figure 3 PMID:7485153

Identification of novel point mutations in splicing sites integrating whole-exome and RNA-seq data in myeloproliferative diseases.

PubMed

Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo

2013-11-01

Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC 3 (NM_003786.3:c.1783-1G>A), KLHDC 1 (NM_172193.1:c.568-2A>G), HOOK 1 (NM_015888.4:c.1662-1G>A), SMAD 9 (NM_001127217.2:c.1004-1C>T), and DNAH 9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC 3, HOOK 1. In ABCC 3 and HOOK 1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK 1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4-6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis.

Cancer-associated isocitrate dehydrogenase 1 (IDH1) R132H mutation and d-2-hydroxyglutarate stimulate glutamine metabolism under hypoxia.

PubMed

Reitman, Zachary J; Duncan, Christopher G; Poteet, Ethan; Winters, Ali; Yan, Liang-Jun; Gooden, David M; Spasojevic, Ivan; Boros, Laszlo G; Yang, Shao-Hua; Yan, Hai

2014-08-22

Mutations in the cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDH1) occur in several types of cancer, and altered cellular metabolism associated with IDH1 mutations presents unique therapeutic opportunities. By altering IDH1, these mutations target a critical step in reductive glutamine metabolism, the metabolic pathway that converts glutamine ultimately to acetyl-CoA for biosynthetic processes. While IDH1-mutated cells are sensitive to therapies that target glutamine metabolism, the effect of IDH1 mutations on reductive glutamine metabolism remains poorly understood. To explore this issue, we investigated the effect of a knock-in, single-codon IDH1-R132H mutation on the metabolism of the HCT116 colorectal adenocarcinoma cell line. Here we report the R132H-isobolome by using targeted (13)C isotopomer tracer fate analysis to trace the metabolic fate of glucose and glutamine in this system. We show that introduction of the R132H mutation into IDH1 up-regulates the contribution of glutamine to lipogenesis in hypoxia, but not in normoxia. Treatment of cells with a d-2-hydroxyglutarate (d-2HG) ester recapitulated these changes, indicating that the alterations observed in the knocked-in cells were mediated by d-2HG produced by the IDH1 mutant. These studies provide a dynamic mechanistic basis for metabolic alterations observed in IDH1-mutated tumors and uncover potential therapeutic targets in IDH1-mutated cancers. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Sequential mutations in Notch1, Fbxw7, and Tp53 in radiation-induced mouse thymic lymphomas.

PubMed

Jen, Kuang-Yu; Song, Ihn Young; Banta, Karl Luke; Wu, Di; Mao, Jian-Hua; Balmain, Allan

2012-01-19

T-cell acute lymphoblastic lymphomas commonly demonstrate activating Notch1 mutations as well as mutations or deletions in Fbxw7. However, because Fbxw7 targets Notch1 for degradation, genetic alterations in these genes are expected to be mutually exclusive events in lymphomagenesis. Previously, by using a radiation-induced Tp53-deficient mouse model for T-cell acute lymphoblastic lymphoma, we reported that loss of heterozygosity at the Fbxw7 locus occurs frequently in a Tp53-dependent manner. In the current study, we show that these thymic lymphomas also commonly exhibit activating Notch1 mutations in the proline-glutamic acid-serine-threonine (PEST) domain. Moreover, concurrent activating Notch1 PEST domain mutations and single-copy deletions at the Fbxw7 locus occur with high frequency in the same individual tumors, indicating that these changes are not mutually exclusive events. We further demonstrate that although Notch1 PEST domain mutations are independent of Tp53 status, they are completely abolished in mice with germline Fbxw7 haploinsufficiency. Therefore, Notch1 PEST domain mutations only occur when Fbxw7 expression levels are intact. These data suggest a temporal sequence of mutational events involving these important cancer-related genes, with Notch1 PEST domain mutations occurring first, followed by Fbxw7 deletion, and eventually by complete loss of Tp53.

Gene mutations in children with chronic pancreatitis.

PubMed

Witt, H

2001-01-01

In the last few years, several genes have been identified as being associated with hereditary and idiopathic chronic pancreatitis (CP), i.e. PRSS1, CFTR and SPINK1. In this study, we investigated 164 unrelated children and adolescents with CP for mutations in disease-associated genes by direct DNA sequencing, SSCP, RFLP and melting curve analysis. In 15 patients, we detected a PRSS1 mutation (8 with A16V, 5 with R122H, 2 with N29I), and in 34 patients, a SPINK1 mutation (30 with N34S, 4 with others). SPINK1 mutations were predominantly found in patients without a family history (29/121). Ten patients were homozygous for N34S, SPINK1 mutations were most common in 'idiopathic' CP, whereas patients with 'hereditary' CP predominantly showed a PRSS1 mutation (R122H, N29I). In patients without a family history, the most common PRSS1 mutation was A16V (7/121). In conclusion, our data suggest that CP may be inherited in a dominant, recessive or multigenetic manner as a result of mutations in the above-mentioned or as yet unidentified genes. This challenges the concept of idiopathic CP as a nongenetic disorder and the differentiation between hereditary and idiopathic CP. Therefore, we propose to classify CP as either 'primary CP' (with or without a family history) or 'secondary CP' caused by toxic, metabolic or other factors.

Mutations in ALDH1A3 represent a frequent cause of microphthalmia/anophthalmia in consanguineous families.

PubMed

Abouzeid, Hana; Favez, Tatiana; Schmid, Angélique; Agosti, Céline; Youssef, Mohammed; Marzouk, Iman; El Shakankiry, Nihal; Bayoumi, Nader; Munier, Francis L; Schorderet, Daniel F

2014-08-01

Anophthalmia or microphthalmia (A/M), characterized by absent or small eye, can be unilateral or bilateral and represent developmental anomalies due to the mutations in several genes. Recently, mutations in aldehyde dehydrogenase family 1, member A3 (ALDH1A3) also known as retinaldehyde dehydrogenase 3, have been reported to cause A/M. Here, we screened a cohort of 75 patients with A/M and showed that mutations in ALDH1A3 occurred in six families. Based on this series, we estimate that mutations in ALDH1A3 represent a major cause of A/M in consanguineous families, and may be responsible for approximately 10% of the cases. Screening of this gene should be performed in a first line of investigation, together with SOX2. © 2014 WILEY PERIODICALS, INC.

MLLT1 YEATS domain mutations in clinically distinctive Favourable Histology Wilms tumours

PubMed Central

Perlman, Elizabeth J.; Gadd, Samantha; Arold, Stefan T.; Radhakrishnan, Anand; Gerhard, Daniela S.; Jennings, Lawrence; Huff, Vicki; Guidry Auvil, Jaime M.; Davidsen, Tanja M.; Dome, Jeffrey S.; Meerzaman, Daoud; Hsu, Chih Hao; Nguyen, Cu; Anderson, James; Ma, Yussanne; Mungall, Andrew J.; Moore, Richard A.; Marra, Marco A.; Mullighan, Charles G.; Ma, Jing; Wheeler, David A.; Hampton, Oliver A.; Gastier-Foster, Julie M.; Ross, Nicole; Smith, Malcolm A.

2015-01-01

Wilms tumour is an embryonal tumour of childhood that closely resembles the developing kidney. Genomic changes responsible for the development of the majority of Wilms tumours remain largely unknown. Here we identify recurrent mutations within Wilms tumours that involve the highly conserved YEATS domain of MLLT1 (ENL), a gene known to be involved in transcriptional elongation during early development. The mutant MLLT1 protein shows altered binding to acetylated histone tails. Moreover, MLLT1-mutant tumours show an increase in MYC gene expression and HOX dysregulation. Patients with MLLT1-mutant tumours present at a younger age and have a high prevalence of precursor intralobar nephrogenic rests. These data support a model whereby activating MLLT1 mutations early in renal development result in the development of Wilms tumour. PMID:26635203

Exome sequencing identifies putative drivers of progression of transient myeloproliferative disorder to AMKL in infants with Down syndrome.

PubMed

Nikolaev, Sergey I; Santoni, Federico; Vannier, Anne; Falconnet, Emilie; Giarin, Emanuela; Basso, Giuseppe; Hoischen, Alexander; Veltman, Joris A; Groet, Jurgen; Nizetic, Dean; Antonarakis, Stylianos E

2013-07-25

Some neonates with Down syndrome (DS) are diagnosed with self-regressing transient myeloproliferative disorder (TMD), and 20% to 30% of those progress to acute megakaryoblastic leukemia (AMKL). We performed exome sequencing in 7 TMD/AMKL cases and copy-number analysis in these and 10 additional cases. All TMD/AMKL samples contained GATA1 mutations. No exome-sequenced TMD/AMKL sample had other recurrently mutated genes. However, 2 of 5 TMD cases, and all AMKL cases, showed mutations/deletions other than GATA1, in genes proven as transformation drivers in non-DS leukemia (EZH2, APC, FLT3, JAK1, PARK2-PACRG, EXT1, DLEC1, and SMC3). One patient at the TMD stage revealed 2 clonal expansions with different GATA1 mutations, of which 1 clone had an additional driver mutation. Interestingly, it was the other clone that gave rise to AMKL after accumulating mutations in 7 other genes. Data suggest that GATA1 mutations alone are sufficient for clonal expansions, and additional driver mutations at the TMD stage do not necessarily predict AMKL progression. Later in infancy, leukemic progression requires "third-hit driver" mutations/somatic copy-number alterations found in non-DS leukemias. Putative driver mutations affecting WNT (wingless-related integration site), JAK-STAT (Janus kinase/signal transducer and activator of transcription), or MAPK/PI3K (mitogen-activated kinase/phosphatidylinositol-3 kinase) pathways were found in all cases, aberrant activation of which converges on overexpression of MYC.

Mutations in the Promoter Region of the Aldolase B Gene that cause Hereditary Fructose Intolerance

PubMed Central

Coffee, Erin M.; Tolan, Dean R.

2010-01-01

SUMMARY Hereditary fructose intolerance (HFI) is a potentially fatal inherited metabolic disease caused by a deficiency of aldolase B activity in the liver and kidney. Over 40 disease-causing mutations are known in the protein-coding region of ALDOB. Mutations upstream of the protein-coding portion of ALDOB are reported here for the first time. DNA sequence analysis of 61 HFI patients revealed single base mutations in the promoter, intronic enhancer, and the first exon, which is entirely untranslated. One mutation, g.–132G>A, is located within the promoter at an evolutionarily conserved nucleotide within a transcription factor-binding site. A second mutation, IVS1+1G>C, is at the donor splice site of the first exon. In vitro electrophoretic mobility shift assays show a decrease in nuclear extract-protein binding at the g.–132G>A mutant site. The promoter mutation results in decreased transcription using luciferase reporter plasmids. Analysis of cDNA from cells transfected with plasmids harboring the IVS1+1G>C mutation results in aberrant splicing leading to complete retention of the first intron (~ 5 kb). The IVS1+1G>C splicing mutation results in loss of luciferase activity from a reporter plasmid. These novel mutations in ALDOB represent 2% of alleles in American HFI patients, with IVS1+1G>C representing a significantly higher allele frequency (6%) among HFI patients of Hispanic and African-American ethnicity. PMID:20882353

Genetic counseling in Usher syndrome: linkage and mutational analysis of 10 Colombian families.

PubMed

Tamayo, M L; Lopez, G; Gelvez, N; Medina, D; Kimberling, W J; Rodríguez, V; Tamayo, G E; Bernal, J E

2008-01-01

Usher Syndrome (US), an autosomal recessive disease, is characterized by retinitis pigmentosa (RP), vestibular dysfunction, and congenital sensorineural deafness. There are three recognized clinical types of the disorder. In order to improve genetic counseling for affected families, we conducted linkage analysis and DNA sequencing in 10 Colombian families with confirmed diagnosis of US (4 type I and 6 type II). Seventy-five percent of the US1 families showed linkage to locus USH1B, while the remaining 25% showed linkage to loci USH1B and USH1C. Among families showing linkage to USH1B we found two different mutations in the MYO7A gene: IVS42-26insTTGAG in exon 43 (heterozygous state) and R634X (CGA-TGA) in exon 16 (homozygous state). All six US2 families showed linkage to locus USH2A. Of them, 4 had c.2299delG mutation (1 homozygote state and 3 heterozygous); in the remaining 2 we did not identify any pathologic DNA variant. USH2A individuals with a 2299delG mutation presented a typical and homogeneous retinal phenotype with bilateral severe hearing loss, except for one individual with a heterozygous 2299delG mutation, whose hearing loss was asymmetric, but more profound than in the other cases. The study of these families adds to the genotype-phenotype characterization of the different types and subtypes of US and facilitates genetic counseling in these families. We would like to emphasize the need to perform DNA studies as a prerequisite for genetic counseling in affected families.

Age-related mutations associated with clonal hematopoietic expansion and malignancies.

PubMed

Xie, Mingchao; Lu, Charles; Wang, Jiayin; McLellan, Michael D; Johnson, Kimberly J; Wendl, Michael C; McMichael, Joshua F; Schmidt, Heather K; Yellapantula, Venkata; Miller, Christopher A; Ozenberger, Bradley A; Welch, John S; Link, Daniel C; Walter, Matthew J; Mardis, Elaine R; Dipersio, John F; Chen, Feng; Wilson, Richard K; Ley, Timothy J; Ding, Li

2014-12-01

Several genetic alterations characteristic of leukemia and lymphoma have been detected in the blood of individuals without apparent hematological malignancies. The Cancer Genome Atlas (TCGA) provides a unique resource for comprehensive discovery of mutations and genes in blood that may contribute to the clonal expansion of hematopoietic stem/progenitor cells. Here, we analyzed blood-derived sequence data from 2,728 individuals from TCGA and discovered 77 blood-specific mutations in cancer-associated genes, the majority being associated with advanced age. Remarkably, 83% of these mutations were from 19 leukemia and/or lymphoma-associated genes, and nine were recurrently mutated (DNMT3A, TET2, JAK2, ASXL1, TP53, GNAS, PPM1D, BCORL1 and SF3B1). We identified 14 additional mutations in a very small fraction of blood cells, possibly representing the earliest stages of clonal expansion in hematopoietic stem cells. Comparison of these findings to mutations in hematological malignancies identified several recurrently mutated genes that may be disease initiators. Our analyses show that the blood cells of more than 2% of individuals (5-6% of people older than 70 years) contain mutations that may represent premalignant events that cause clonal hematopoietic expansion.

MELAS syndrome in a patient with a point mutation in MTTS1.

PubMed

Lindberg, C; Moslemi, A-R; Oldfors, A

2008-02-01

BACKGROUND, OBJECTIVE AND METHODS: We describe a female patient with a mitochondrial encephalopathy, lactic acidosis and stroke-like episodes syndrome. As a child, she developed epilepsy and stroke-like episodes giving cognitive impairment and ataxia but no hearing impairment. At the age of 44 years, she suffered a cerebral sinus thrombosis which was warfarin treated. One month later, she developed an episode of severe acidosis associated with encephalopathy and myelopathy. She was found to harbour a 7512T>C mutation in the mitochondrial encoded tRNA(Ser(UCN)) gene (MTTS1). The mutation load was 91% in muscle and 24% in blood. Enzyme histochemical analysis of the muscle tissue showed numerous cytochrome c oxidase (COX)-negative fibres. Restriction fragment length polymorphism (RFLP) analysis of single muscle fibres showed significantly higher level (median 97%, range: 94-99%) of the mutation in the COX-negative fibres compared with COX-positive fibres (median 36%, range: 12-91%), demonstrating the pathogenic effect of the mutation. Different levels of heteroplasmy (range 34-61%) were detected in hair shafts analysed by RFLP. This case adds to the spectrum of clinical presentations, i.e. sinus thrombosis, in patients having MTTS1 mutations.

Chloroplast mutations induced by 9-aminoacridine hydrochloride are independent of the plastome mutator in Oenothera.

PubMed

GuhaMajumdar, M; Baldwin, S; Sears, B B

2004-02-01

Oenothera plants homozygous for the recessive plastome mutator allele ( pm) show chloroplast DNA (cpDNA) mutation frequencies that are about 1,000-fold higher than spontaneous levels. The pm-encoded gene product has been hypothesized to have a function in cpDNA replication, repair and/or mutation avoidance. Previous chemical mutagenesis experiments with the alkylating agent nitroso-methyl urea (NMU) showed a synergistic effect of NMU on the induction of mutations in the pm line, suggesting an interaction between the pm-encoded gene product and one of the repair systems that corrects alkylation damage. The goal of the experiments described here was to examine whether the pm activity extends to the repair of damage caused by non-alkylating mutagens. To this end, the intercalating mutagen, 9-aminoacridine hydrochloride (9AA) was tested for synergism with the plastome mutator. A statistical analysis of the data reported here indicates that the pm-encoded gene product is not involved in the repair of the 9AA-induced mutations. However, the recovery of chlorotic sectors in plants derived from the mutagenized seeds shows that 9AA can act as a mutagen of the chloroplast genome.

Diagnosing XLP1 in patients with hemophagocytic lymphohistiocytosis.

PubMed

Meazza, Raffaella; Tuberosa, Claudia; Cetica, Valentina; Falco, Michela; Parolini, Silvia; Grieve, Sam; Griffiths, Gillian M; Sieni, Elena; Marcenaro, Stefania; Micalizzi, Concetta; Montin, Davide; Fagioli, Franca; Moretta, Alessandro; Mingari, Maria C; Moretta, Lorenzo; Notarangelo, Luigi D; Bottino, Cristina; Aricò, Maurizio; Pende, Daniela

2014-12-01

Hemophagocytic lymphohistiocytosis (HLH) is a life-threatening, heterogeneous, hyperinflammmatory disorder. Prompt identification of inherited forms resulting from mutation in genes involved in cellular cytotoxicity can be crucial. X-linked lymphoproliferative disease 1 (XLP1), due to mutations in SH2D1A (Xq25) encoding signaling lymphocyte activation molecule-associated protein (SAP), may present with HLH. Defective SAP induces paradoxical inhibitory function of the 2B4 coreceptor and impaired natural killer (NK) (and T) cell response against EBV-infected cells. To characterize a cohort of patients with HLH and XLP1 for SAP expression and 2B4 function in lymphocytes, proposing a rapid diagnostic screening to direct mutation analysis. We set up rapid assays for 2B4 function (degranulation or (51)Cr-release) to be combined with intracellular SAP expression in peripheral blood NK cells. We studied 12 patients with confirmed mutation in SH2D1A and some family members. The combined phenotypic/functional assays allowed efficient and complete diagnostic evaluation of all patients with XLP1, thus directing mutation analysis and treatment. Nine cases were SAP(-), 2 expressed SAP with mean relative fluorescence intensity values below the range of healthy controls (SAP(dull)), and 1, carrying the R55L mutation, was SAP(+). NK cells from all patients showed inhibitory 2B4 function and defective killing of B-EBV cells. Carriers with SH2D1A mutations abolishing SAP expression and low percentage of SAP(+) cells showed neutral 2B4 function at the polyclonal NK cell level. Three novel SH2D1A mutations have been identified. Study of SAP expression is specific but may have insufficient sensitivity for screening XLP1 as a single tool. Combination with 2B4 functional assay allows identification of all cases. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yagishita, Shigehiro; Horinouchi, Hidehito, E-mail: hhorinou@ncc.go.jp; Katsui Taniyama, Tomoko

Purpose: To determine the frequency and clinical significance of epidermal growth factor receptor (EGFR) mutations in patients with potentially curable stage III non–small-cell lung cancer (NSCLC) who are eligible for definitive chemoradiotherapy (CRT). Patients and Methods: Between January 2001 and December 2010, we analyzed the EGFR mutational status in consecutive NSCLC patients who were treated by CRT. The response rate, relapse-free survival, 2-year relapse-free rate, initial relapse sites, and overall survival of the patients were investigated. Results: A total of 528 patients received CRT at our hospital during the study period. Of these, 274 were diagnosed as having nonsquamous NSCLC. Sufficientmore » specimens for mutational analyses could be obtained from 198 of these patients. The proportion of patients with EGFR activating mutations was 17%. In addition to the well-known characteristics of patients carrying EGFR mutations (female, adenocarcinoma, and never/light smoker), the proportion of cases with smaller primary lesions (T1/2) was found to be higher in patients with EGFR mutations than in those with wild-type EGFR. Patients with EGFR mutations showed similar response rate, relapse-free survival, and 2-year relapse-free rates as compared to patients with wild-type EGFR. Local relapses as the site of initial relapse occurred significantly less frequently in patients with EGFR mutation (4% vs 21%; P=.045). Patients with EGFR mutations showed longer local control (adjusted hazard ratio 0.49; P=.043). After disease progression, a majority of the patients with EGFR mutations received EGFR tyrosine kinase inhibitors (62%), and these patients showed longer postprogression survival than those with wild-type EGFR. Conclusions: Our study is the first to show radiosensitive biology of EGFR-mutated tumors in definitive CRT with curative intent. This finding could serve as a credible baseline estimate of EGFR-mutated population in stage III nonsquamous NSCLC.« less

In Vivo-Selected Pyrazinoic Acid-Resistant Mycobacterium tuberculosis Strains Harbor Missense Mutations in the Aspartate Decarboxylase PanD and the Unfoldase ClpC1.

PubMed

Gopal, Pooja; Tasneen, Rokeya; Yee, Michelle; Lanoix, Jean-Philippe; Sarathy, Jansy; Rasic, George; Li, Liping; Dartois, Véronique; Nuermberger, Eric; Dick, Thomas

2017-07-14

Through mutant selection on agar containing pyrazinoic acid (POA), the bioactive form of the prodrug pyrazinamide (PZA), we recently showed that missense mutations in the aspartate decarboxylase PanD and the unfoldase ClpC1, and loss-of-function mutation of polyketide synthases Mas and PpsA-E involved in phthiocerol dimycocerosate synthesis, cause resistance to POA and PZA in Mycobacterium tuberculosis. Here we first asked whether these in vitro-selected POA/PZA-resistant mutants are attenuated in vivo, to potentially explain the lack of evidence of these mutations among PZA-resistant clinical isolates. Infection of mice with panD, clpC1, and mas/ppsA-E mutants showed that whereas growth of clpC1 and mas/ppsA-E mutants was attenuated, the panD mutant grew as well as the wild-type. To determine whether these resistance mechanisms can emerge within the host, mice infected with wild-type M. tuberculosis were treated with POA, and POA-resistant colonies were confirmed for PZA and POA resistance. Genome sequencing revealed that 82 and 18% of the strains contained missense mutations in panD and clpC1, respectively. Consistent with their lower fitness and POA resistance level, independent mas/ppsA-E mutants were not found. In conclusion, we show that the POA/PZA resistance mechanisms due to panD and clpC1 missense mutations are recapitulated in vivo. Whereas the representative clpC1 mutant was attenuated for growth in the mouse infection model, providing a possible explanation for their absence among clinical isolates, the growth kinetics of the representative panD mutant was unaffected. Why POA/PZA resistance-conferring panD mutations are observed in POA-treated mice but not yet among clinical strains isolated from PZA-treated patients remains to be determined.

Timing, rates and spectra of human germline mutation.

PubMed

Rahbari, Raheleh; Wuster, Arthur; Lindsay, Sarah J; Hardwick, Robert J; Alexandrov, Ludmil B; Turki, Saeed Al; Dominiczak, Anna; Morris, Andrew; Porteous, David; Smith, Blair; Stratton, Michael R; Hurles, Matthew E

2016-02-01

Germline mutations are a driving force behind genome evolution and genetic disease. We investigated genome-wide mutation rates and spectra in multi-sibling families. The mutation rate increased with paternal age in all families, but the number of additional mutations per year differed by more than twofold between families. Meta-analysis of 6,570 mutations showed that germline methylation influences mutation rates. In contrast to somatic mutations, we found remarkable consistency in germline mutation spectra between the sexes and at different paternal ages. In parental germ line, 3.8% of mutations were mosaic, resulting in 1.3% of mutations being shared by siblings. The number of these shared mutations varied significantly between families. Our data suggest that the mutation rate per cell division is higher during both early embryogenesis and differentiation of primordial germ cells but is reduced substantially during post-pubertal spermatogenesis. These findings have important consequences for the recurrence risks of disorders caused by de novo mutations.

Targeted mutations and MD simulations of a methanol-stable lipase YLIP9 from Yarrowia lipolytica MSR80 to develop a biodiesel enzyme.

PubMed

Syal, Poonam; Verma, Ved Vrat; Gupta, Rani

2017-11-01

Biodiesel, an environment friendly alternative for fuels, contains methyl esters of long-chain fatty acids. Our group has reported a methanol-stable YLIP9 from Yarrowia lipolytica MSR80 that shows poor catalysis of long-chain fatty acids. To shift its substrate specificity, residues within lid and binding pocket were identified for sequential mutations using YLIP2 as the template. Of the two point mutations (Glu116Leu and Ser119Val) introduced in the lid, the former mutation (YLIP9L1) increased the catalytic rate by ∼2-fold without any change in substrate specificity. In this mutant, six binding pocket residues (Bp2-Bp7) were further mutated to obtain six double mutants. YLIP9L1Bp3 showed significant shift in substrate specificity towards long-chain pNPesters with 11-fold increase in catalytic efficiency than YLIP9. Double mutations also led to increased thermostability and lowered activation energy of YLIP9L1Bp3 thereby shifting its optimum temperature from 60°C to 50°C. In silico molecular dynamics simulations revealed improved lid flexibility and increased catalytic triad volume in YLIP9L1Bp3. The enzyme YLIP9L1Bp3 was methanol-stable having selectivity for long-chain fatty acids with improved catalytic efficiency. Its application as a biodiesel enzyme was validated by transesterification of palm oil in presence of methanol, where it showed 8-fold increase in conversion of oil to methyl esters. Copyright © 2017 Elsevier B.V. All rights reserved.

Sick sinus syndrome with HCN4 mutations shows early onset and frequent association with atrial fibrillation and left ventricular noncompaction.

PubMed

Ishikawa, Taisuke; Ohno, Seiko; Murakami, Takashi; Yoshida, Kentaro; Mishima, Hiroyuki; Fukuoka, Tetsuya; Kimoto, Hiroki; Sakamoto, Risa; Ohkusa, Takafumi; Aiba, Takeshi; Nogami, Akihiko; Sumitomo, Naokata; Shimizu, Wataru; Yoshiura, Koh-Ichiro; Horigome, Hitoshi; Horie, Minoru; Makita, Naomasa

2017-05-01

Familial sick sinus syndrome (SSS) is often attributable to mutations in genes encoding the cardiac Na channel SCN5A and pacemaker channel HCN4. We previously found that SSS with SCN5A mutations shows early onset of manifestations and male predominance. Despite recent reports on the complications of atrial fibrillation (AF) and left ventricular noncompaction (LVNC) in patients with SSS caused by HCN4 mutations, their overall clinical spectrum remains unknown. The purpose of this study was to investigate the clinical and demographic features of SSS patients carrying HCN4 mutations. We genetically screened 38 unrelated SSS families and functionally analyzed the mutant SCN5A and HCN4 channels by patch clamping. We also evaluated the clinical features of familial SSS by a meta-analysis of 48 SSS probands with mutations in HCN4 (n = 16) and SCN5A (n = 32), including previously reported cases, and 538 sporadic SSS cases. We identified two HCN4 and three SCN5A loss-of-function mutations in our familial SSS cohort. Meta-analysis of HCN4 mutation carriers showed a significantly younger age at diagnosis (39.1 ± 21.7 years) than in sporadic SSS (74.3 ± 0.4 years; P <.001), but a significantly older age than in SCN5A mutation carriers (20.0 ± 17.6 years; P = .003). Moreover, HCN4 mutation carriers were more frequently associated with AF (43.8%) and LVNC (50%) and with older age at pacemaker implantation (43.5 ± 22.1 years) than were SCN5A mutation carriers (17.8 ± 16.5 years; P <.001). SSS with HCN4 mutations may form a distinct SSS subgroup characterized by early clinical manifestation after adolescence and frequent association with AF and LVNC. Copyright © 2017 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

Escherichia coli arabinose isomerase and Staphylococcus aureus tagatose-6-phosphate isomerase: which is a better template for directed evolution of non-natural substrate isomerization?

PubMed

Kim, Hye Jung; Uhm, Tae Guk; Kim, Seong Bo; Kim, Pil

2010-06-01

Metallic and non-metallic isomerases can be used to produce commercially important monosaccharides. To determine which category of isomerase is more suitable as a template for directed evolution to improve enzymes for galactose isomerization, L-arabinose isomerase from Escherichia coli (ECAI; E.C. 5.3.1.4) and tagatose-6-phosphate isomerase from Staphylococcus aureus (SATI; E.C. 5.3.1.26) were chosen as models of a metallic and non-metallic isomerase, respectively. Random mutations were introduced into the genes encoding ECAI and SATI at the same rate, resulting in the generation of 515 mutants of each isomerase. The isomerization activity of each of the mutants toward a non-natural substrate (galactose) was then measured. With an average mutation rate of 0.2 mutations/kb, 47.5% of the mutated ECAIs showed an increase in activity compared with wild-type ECAI, and the remaining 52.5% showed a decrease in activity. Among the mutated SATIs, 58.6% showed an increase in activity, whereas 41.4% showed a decrease in activity. Mutant clones showing a significant change in relative activity were sequenced and specific increases in activity were measured. The maximum increase in activity achieved by mutation of ECAI was 130%, and that for SATI was 190%. Based on these results, the characteristics of the different isomerases are discussed in terms of their usefulness for directed evolution of non-natural substrate isomerization.

ASXL2 mutations are frequently found in pediatric AML patients with t(8;21)/ RUNX1-RUNX1T1 and associated with a better prognosis.

PubMed

Yamato, Genki; Shiba, Norio; Yoshida, Kenichi; Shiraishi, Yuichi; Hara, Yusuke; Ohki, Kentaro; Okubo, Jun; Okuno, Haruna; Chiba, Kenichi; Tanaka, Hiroko; Kinoshita, Akitoshi; Moritake, Hiroshi; Kiyokawa, Nobutaka; Tomizawa, Daisuke; Park, Myoung-Ja; Sotomatsu, Manabu; Taga, Takashi; Adachi, Souichi; Tawa, Akio; Horibe, Keizo; Arakawa, Hirokazu; Miyano, Satoru; Ogawa, Seishi; Hayashi, Yasuhide

2017-05-01

ASXL2 is an epigenetic regulator involved in polycomb repressive complex regulation or recruitment. Clinical features of pediatric acute myeloid leukemia (AML) patients with ASXL2 mutations remain unclear. Thus, we investigated frequencies of ASXL1 and ASXL2 mutations, clinical features of patients with these mutations, correlations of these mutations with other genetic alterations including BCOR/BCORL1 and cohesin complex component genes, and prognostic impact of these mutations in 369 pediatric patients with de novo AML (0-17 years). We identified 9 (2.4%) ASXL1 and 17 (4.6%) ASXL2 mutations in 25 patients. These mutations were more common in patients with t(8;21)(q22;q22)/RUNX1-RUNX1T1 (ASXL1, 6/9, 67%, P = 0.02; ASXL2, 10/17, 59%, P = 0.01). Among these 25 patients, 4 (27%) of 15 patients with t(8;21) and 6 (60%) of 10 patients without t(8;21) relapsed. However, most patients with relapse were rescued using stem cell transplantation irrespective of t(8;21). The overall survival (OS) and event-free survival (EFS) rates showed no differences among pediatric AML patients with t(8;21) and ASXL1 or ASXL2 mutations and ASXL wild-type (5-year OS, 75% vs. 100% vs. 91% and 5-year EFS, 67% vs. 80% vs. 67%). In 106 patients with t(8;21) AML, the coexistence of mutations in tyrosine kinase pathways and chromatin modifiers and/or cohesin complex component genes had no effect on prognosis. These results suggest that ASXL1 and ASXL2 mutations play key roles as cooperating mutations that induce leukemogenesis, particularly in pediatric AML patients with t(8;21), and these mutations might be associated with a better prognosis than that reported previously. © 2017 Wiley Periodicals, Inc.

Central nervous system involvement in severe congenital neutropenia: neurological and neuropsychological abnormalities associated with specific HAX1 mutations.

PubMed

Carlsson, G; van't Hooft, I; Melin, M; Entesarian, M; Laurencikas, E; Nennesmo, I; Trebińska, A; Grzybowska, E; Palmblad, J; Dahl, N; Nordenskjöld, M; Fadeel, B; Henter, J-I

2008-10-01

Homozygous mutations in the HAX1 gene were recently identified in severe congenital neutropenia patients belonging to the original Kostmann family in northern Sweden. Our observations suggested that these patients also develop neurological and neuropsychological symptoms. Detailed clinical studies and mutation analyses were performed in the surviving patients belonging to the Kostmann kindred and in two patients not related to this family, along with studies of HAX1 splice variant expression in normal human tissues. Five of six Kostmann family patients and one other patient from northern Sweden harboured homozygous HAX1 mutations (568C-->T, Q190X) and one carried a heterozygous ELA2 gene mutation. One Swedish patient of Kurdish extraction carried alternative homozygous HAX1 mutations (131G-->A, W44X). All the three patients with Q190X mutations who were alive and available for evaluation developed neurological disease with decreased cognitive function, and three of four patients who reached 10 years developed epilepsy. In contrast, the patients with the ELA2 and W44X HAX1 mutations, respectively, showed no obvious neurological abnormalities. Moreover, two alternative HAX1 splice variants were identified in normal human tissues, including the brain. Both transcripts contained exon 5, harbouring the Q190X mutation, whereas the 5' end of exon 2 containing the W44X mutation was spliced out from the second transcript. We describe neurological and neuropsychological abnormalities for the first time in Kostmann disease patients. These central nervous system symptoms appear to be associated with specific HAX1 mutations.

Clarithromycin Resistance Mutations in Helicobacter pylori in Association with Virulence Factors and Antibiotic Susceptibility of the Strains.

PubMed

Boyanova, Lyudmila; Markovska, Rumyana; Yordanov, Daniel; Gergova, Galina; Mitov, Ivan

2016-04-01

Antibiotic resistance is the major cause for Helicobacter pylori eradication failure. H. pylori clarithromycin resistance mutations were evaluated in 84 (82 phenotypically clarithromycin resistant and 2 intermediately susceptible) strains by allele-specific PCR and 3'-mismatched PCR. Many (57.1%) of these strains were metronidazole resistant. Prevalence of cagA(+), cagE(+), vacA s1a, m1, i1, and i2 strains was 76.2%, 58.0%, 82.1%, 35.7%, 50.0%, and 50.0%, respectively. A2143G, A2142G, A2142C, and A2143G+A2142G mutation rates were 64.3%, 23.8%, 1.2%, and 10.7%, respectively. Strains harboring the A2142G mutation showed 5.3-fold higher clarithromycin MIC50 than those harboring the A2143G mutation. The A2143G mutation alone was 1.7-fold more common in vacA i2 strains compared with vacA i1 strains, while the A2142G mutation alone was 3-fold more frequent in vacA i1 strains than vacA i2 strains and 3.1-fold more common in metronidazole-susceptible compared with metronidazole-resistant strains. Briefly, clarithromycin resistance mutations were significantly linked to vacA i allele and metronidazole susceptibility. This is the first report about associations between the A2143G mutation and less virulent vacA i2 strains, and between the A2142G mutation and more virulent vacA i1 strains. As the 2143G mutation often predicts eradication failure by clarithromycin-based regimens, the results may be linked to the better eradication of more virulent strains compared with the less virulent strains.

Molecular mechanisms of isocitrate dehydrogenase 1 (IDH1) mutations identified in tumors: The role of size and hydrophobicity at residue 132 on catalytic efficiency

PubMed Central

Avellaneda Matteo, Diego; Grunseth, Adam J.; Gonzalez, Eric R.; Anselmo, Stacy L.; Kennedy, Madison A.; Moman, Precious; Scott, David A.; Hoang, An; Sohl, Christal D.

2017-01-01

Isocitrate dehydrogenase 1 (IDH1) catalyzes the reversible NADP+-dependent conversion of isocitrate (ICT) to α-ketoglutarate (αKG) in the cytosol and peroxisomes. Mutations in IDH1 have been implicated in >80% of lower grade gliomas and secondary glioblastomas and primarily affect residue 132, which helps coordinate substrate binding. However, other mutations found in the active site have also been identified in tumors. IDH1 mutations typically result in a loss of catalytic activity, but many also can catalyze a new reaction, the NADPH-dependent reduction of αKG to d-2-hydroxyglutarate (D2HG). D2HG is a proposed oncometabolite that can competitively inhibit αKG-dependent enzymes. Some kinetic parameters have been reported for several IDH1 mutations, and there is evidence that mutant IDH1 enzymes vary widely in their ability to produce D2HG. We report that most IDH1 mutations identified in tumors are severely deficient in catalyzing the normal oxidation reaction, but that D2HG production efficiency varies among mutant enzymes up to ∼640-fold. Common IDH1 mutations have moderate catalytic efficiencies for D2HG production, whereas rarer mutations exhibit either very low or very high efficiencies. We then designed a series of experimental IDH1 mutants to understand the features that support D2HG production. We show that this new catalytic activity observed in tumors is supported by mutations at residue 132 that have a smaller van der Waals volume and are more hydrophobic. We report that one mutation can support both the normal and neomorphic reactions. These studies illuminate catalytic features of mutations found in the majority of patients with lower grade gliomas. PMID:28330869

Mutation screening of Chinese Treacher Collins syndrome patients identified novel TCOF1 mutations.

PubMed

Chen, Ying; Guo, Luo; Li, Chen-Long; Shan, Jing; Xu, Hai-Song; Li, Jie-Ying; Sun, Shan; Hao, Shao-Juan; Jin, Lei; Chai, Gang; Zhang, Tian-Yu

2018-04-01

Treacher Collins syndrome (TCS) (OMIM 154500) is a rare congenital craniofacial disorder with an autosomal dominant manner of inheritance in most cases. To date, three pathogenic genes (TCOF1, POLR1D and POLR1C) have been identified. In this study, we conducted mutational analysis on Chinese TCS patients to reveal a mutational spectrum of known causative genes and show phenotype-genotype data to provide more information for gene counselling and future studies on the pathogenesis of TCS. Twenty-two TCS patients were recruited from two tertiary referral centres, and Sanger sequencing for the coding exons and exon-intron boundaries of TCOF1, POLR1D and POLR1C was performed. For patients without small variants, further copy number variations (CNVs) analysis was conducted using high-density SNP array platforms. The Sanger sequencing overall mutation detection rate was as high as 86.3% (19/22) for our cohort. Fifteen TCOF1 pathogenic variants, including ten novel mutations, were identified in nineteen patients. No causative mutations in POLR1D and POLR1C genes and no CNVs mutations were detected. A suspected autosomal dominant inheritance case that implies germinal mosaicism was described. Our study confirmed that TCOF1 was the main disease-causing gene for the Chinese TCS population and revealed its mutation spectrum. We also addressed the need for more studies of mosaicism in TCS cases, which could explain the mechanism of autosomal dominant inheritance in TCS cases and benefit the prevention of TCS.

Mutations in SULT2B1 Cause Autosomal-Recessive Congenital Ichthyosis in Humans.

PubMed

Heinz, Lisa; Kim, Gwang-Jin; Marrakchi, Slaheddine; Christiansen, Julie; Turki, Hamida; Rauschendorf, Marc-Alexander; Lathrop, Mark; Hausser, Ingrid; Zimmer, Andreas D; Fischer, Judith

2017-06-01

Ichthyoses are a clinically and genetically heterogeneous group of genodermatoses associated with abnormal scaling of the skin over the whole body. Mutations in nine genes are known to cause non-syndromic forms of autosomal-recessive congenital ichthyosis (ARCI). However, not all genetic causes for ARCI have been discovered to date. Using whole-exome sequencing (WES) and multigene panel screening, we identified 6 ARCI-affected individuals from three unrelated families with mutations in Sulfotransferase family 2B member 1 (SULT2B1), showing their causative association with ARCI. Cytosolic sulfotransferases form a large family of enzymes that are involved in the synthesis and metabolism of several steroids in humans. We identified four distinct mutations including missense, nonsense, and splice site mutations. We demonstrated the loss of SULT2B1 expression at RNA and protein levels in keratinocytes from individuals with ARCI by functional analyses. Furthermore, we succeeded in reconstructing the morphologic skin alterations in a 3D organotypic tissue culture model with SULT2B1-deficient keratinocytes and fibroblasts. By thin layer chromatography (TLC) of extracts from these organotypic cultures, we could show the absence of cholesterol sulfate, the metabolite of SULT2B1, and an increased level of cholesterol, indicating a disturbed cholesterol metabolism of the skin upon loss-of-function mutation in SULT2B1. In conclusion, our study reveals an essential role for SULT2B1 in the proper development of healthy human skin. Mutation in SULT2B1 leads to an ARCI phenotype via increased proliferation of human keratinocytes, thickening of epithelial layers, and altered epidermal cholesterol metabolism. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Impact of genotype on leukaemic transformation in polycythaemia vera and essential thrombocythaemia.

PubMed

Alvarez-Larrán, Alberto; Senín, Alicia; Fernández-Rodríguez, Concepción; Pereira, Arturo; Arellano-Rodrigo, Eduardo; Gómez, Montse; Ferrer-Marin, Francisca; Martínez-López, Joaquín; Camacho, Laura; Colomer, Dolors; Angona, Anna; Navarro, Blanca; Cervantes, Francisco; Besses, Carlos; Bellosillo, Beatriz; Hernández-Boluda, Juan Carlos

2017-09-01

The influence of driver mutations on leukaemic transformation was analysed in 1747 patients with polycythaemia vera or essential thrombocythaemia. With a median follow-up of 7·2 years, 349 patients died and 62 progressed to acute leukaemia or myelodysplastic syndrome. Taking death as a competing risk, CALR genotype was associated with a lower risk of transformation [subdistribution hazard ratio (SHR): 0·13, 95% confidence interval (CI): 0·2-0·9, P = 0·039], whereas JAK2 V617F showed borderline significance for higher risk (SHR: 2·05, 95% CI: 0·9-4·6, P = 0·09). Myelofibrotic transformation increased leukaemic risk, except in CALR-mutated patients. Next generation sequencing of 51 genes at the time of transformation showed additional mutations (median number: 3; range: 1-5) in 25 out of 29 (86%) assessable cases. Mutations (median: 1; range: 1-3) were detected in 67% of paired samples from the chronic phase. Leukaemia appeared in a JAK2 V617F negative clone in 17 (58%) cases, eleven of them being previously JAK2 V617F-positive. JAK2 V617F-mutated leukaemia was significantly associated with complex karyotype and acquisition of TP53 mutations, whereas EZH2 and RUNX1 mutations were more frequent in JAK2 V617F-negative leukaemia. Survival was longer in JAK2 V617F-unmutated leukaemia (343 days vs. 95 days, P = 0·003). In conclusion, CALR genotype is associated with a lower risk of leukaemic transformation. Leukaemia arising in a JAK2 V617F-negative clone is TP53 independent and shows better survival. © 2017 John Wiley & Sons Ltd.

[Retinal vasculopathy with cerebral leukoencephalopathy carrying TREX1 mutation diagnosed by the intracranial calcification: a case report].

PubMed

Komaki, Ryouhei; Ueda, Takehiro; Tsuji, Yukio; Miyawaki, Toko; Kusuhara, Sentaro; Hara, Shigeo; Toda, Tatsushi

2018-02-28

A 40-year-old woman with renal dysfunction for 2 years was admitted to our hospital suffering from a headache. Family history revealed that her mother had a headache, renal dysfunction, and brain infarction in younger age. She had a retinal hemorrhage, a retinal atrophy, pitting edema in her lower extremities. Her neurological findings were unremarkable. Brain imaging showed multiple white matter lesions accompanied with calcifications and slightly enhancement. Kidney biopsy showed the thrombotic microangiopathy, Gene analysis demonstrated a causative mutation in three-prime repair exonuclease-1 (TREX1) gene, c.703_704insG (p.Val235GlyfsX6), thereby we diagnosed her as retinal vasculopathy with cerebral leukoencephalopathy (RVCL). RVCL is an autosomal dominant condition caused by C-terminal frame-shift mutation in TREX1. TREX1 protein is a major 3' to 5' DNA exonuclease, which are important in DNA repair. While TREX1 mutations identified in Aicardi-Goutieres syndrome patients lead to a reduction of enzyme activity, it is suggested that mutations in RVCL alter an intracellular location of TREX1 protein. There are no treatments based evidences in RVCL. We administered cilostazol to protect endothelial function, and her brain lesions and renal function have not become worse for 10 months after. It is necessary to consider RVCL associated with TREX1 mutation if a patient has retinal lesions, white matter lesions accompanied with calcifications, and multiple organ dysfunction.

Leigh syndrome T8993C mitochondrial DNA mutation: Heteroplasmy and the first clinical presentation in a Vietnamese family.

PubMed

Weerasinghe, Chamara Arachchighe Lahiru; Bui, Bich-Hong Thi; Vu, Thu Thi; Nguyen, Hong-Loan Thi; Phung, Bao-Khanh; Nguyen, Van-Minh; Pham, Van-Anh; Cao, Vu-Hung; Phan, Tuan-Nghia

2018-05-01

Leigh syndrome is a rare inherited, heterogeneous and progressive neurometabolic disorder that is mainly caused by specific mutations in nuclear DNA (nDNA) or mitochondrial DNA (mtDNA). The present study reported a case of childhood Leigh syndrome with a point mutation at bp 8,993 in the mitochondrial ATPase6 gene. A 21‑month‑old male child had developed epilepsy, muscular weakness and vomiting, which was accompanied by high fever. Magnetic resonance imaging indicated typical characteristics of Leigh syndrome, including a symmetric abnormal signal in the dorsal medulla oblongata and Sylvian fissure enlargement in association with an abnormal signal in the periventricular white matter and in the putamina and caudate heads. The diagnosis was further supported with genetic tests including polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), sequencing, and quantitative PCR. The patient was found to carry a mitochondrial T8993C (m.T8993C) mutation in peripheral blood with 94.00±1.34% heteroplasmy. Eight of his relatives were also subjected to quantification of the m.T8993C mutation. The percentages of heteroplasmy in samples taken from the grandmother, mother, aunt, cousin 1, and cousin 2 were 16.33±1.67, 66.81±0.85, 71.66±3.22, 87.00±1.79, and 91.24±2.50%, respectively. The mutation was not found in samples taken from the father, the husband of the aunt, or the grandfather of the patient. The obtained data showed that the mutation was maternally inherited and accumulated through generations. Even though the heteroplasmy levels of his mother, aunt, cousin 1, and cousin 2 were relatively high (66.81‑91.24%), they remained asymptomatic, indicating that the threshold at which this mutation shows effects is high. To the best of our knowledge, this is the first report of a case of Leigh syndrome in a Vietnamese individual harboring a mtDNA mutation at the 8,993 bp site, and showing a correlation between the heteroplasmy and clinical phenotype. These findings may be useful in helping to improve the clinical diagnosis and treatment of Leigh syndrome.

Characterization of highly efficient heavy-ion mutagenesis in Arabidopsis thaliana.

PubMed

Kazama, Yusuke; Hirano, Tomonari; Saito, Hiroyuki; Liu, Yang; Ohbu, Sumie; Hayashi, Yoriko; Abe, Tomoko

2011-11-15

Heavy-ion mutagenesis is recognised as a powerful technology to generate new mutants, especially in higher plants. Heavy-ion beams show high linear energy transfer (LET) and thus more effectively induce DNA double-strand breaks than other mutagenic techniques. Previously, we determined the most effective heavy-ion LET (LETmax: 30.0 keV μm(-1)) for Arabidopsis mutagenesis by analysing the effect of LET on mutation induction. However, the molecular structure of mutated DNA induced by heavy ions with LETmax remains unclear. Knowledge of the structure of mutated DNA will contribute to the effective exploitation of heavy-ion beam mutagenesis. Dry Arabidopsis thaliana seeds were irradiated with carbon (C) ions with LETmax at a dose of 400 Gy and with LET of 22.5 keV μm(-1) at doses of 250 Gy or 450 Gy. The effects on mutation frequency and alteration of DNA structure were compared. To characterise the structure of mutated DNA, we screened the well-characterised mutants elongated hypocotyls (hy) and glabrous (gl) and identified mutated DNA among the resulting mutants by high-resolution melting curve, PCR and sequencing analyses. The mutation frequency induced by C ions with LETmax was two-fold higher than that with 22.5 keV μm(-1) and similar to the mutation frequency previously induced by ethyl methane sulfonate. We identified the structure of 22 mutated DNAs. Over 80% of the mutations caused by C ions with both LETs were base substitutions or deletions/insertions of less than 100 bp. The other mutations involved large rearrangements. The C ions with LETmax showed high mutation efficiency and predominantly induced base substitutions or small deletions/insertions, most of which were null mutations. These small alterations can be determined by single-nucleotide polymorphism (SNP) detection systems. Therefore, C ions with LETmax might be useful as a highly efficient reverse genetic system in conjunction with SNP detection systems, and will be beneficial for forward genetics and plant breeding.

Episodic ataxia and SCA6 within the same family due to the D302N CACNA1A gene mutation.

PubMed

Pradotto, Luca; Mencarelli, Monica; Bigoni, Matteo; Milesi, Alessandra; Di Blasio, Anna; Mauro, Alessandro

2016-12-15

Several dominant mutations of CACNA1A gene were associated with at least three different allelic disorders: spino-cerebellar ataxia type 6 (SCA6), episodic ataxia type 2 (EA2), and familial hemiplegic migraine-1 (FHM1). It is generally thought that loss-of-function mutations are associated with EA2, gain-of-function missense mutations with FHM1, and abnormal CAG expansions with SCA6. But, overlapping features, atypical symptoms and co-occurrence of distinct phenotypes within the same family were reported. We describe a four generation family showing different phenotypes ranging from EA2 to SCA6 and carrying the p.D302N CACNA1A gene mutation. In our family the phenotypes maintained separate and gender differences corresponding to different phenotypes were observed. Copyright © 2016 Elsevier B.V. All rights reserved.

Investigating the Impact of Asp181 Point Mutations on Interactions between PTP1B and Phosphotyrosine Substrate

NASA Astrophysics Data System (ADS)

Liu, Mengyuan; Wang, Lushan; Sun, Xun; Zhao, Xian

2014-05-01

Protein tyrosine phosphatase 1B (PTP1B) is a key negative regulator of insulin and leptin signaling, which suggests that it is an attractive therapeutic target in type II diabetes and obesity. The aim of this research is to explore residues which interact with phosphotyrosine substrate can be affected by D181 point mutations and lead to increased substrate binding. To achieve this goal, molecular dynamics simulations were performed on wild type (WT) and two mutated PTP1B/substrate complexes. The cross-correlation and principal component analyses show that point mutations can affect the motions of some residues in the active site of PTP1B. Moreover, the hydrogen bond and energy decomposition analyses indicate that apart from residue 181, point mutations have influence on the interactions of substrate with several residues in the active site of PTP1B.

Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1

PubMed Central

Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui

2013-01-01

Purpose To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). Methods An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Results Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. Conclusions In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A. PMID:23559863

Cone Structure in Patients With Usher Syndrome Type III and Mutations in the Clarin 1 Gene

PubMed Central

Ratnam, Kavitha; Västinsalo, Hanna; Roorda, Austin; Sankila, Eeva-Marja K.; Duncan, Jacque L.

2015-01-01

Objective To study macular structure and function in patients with Usher syndrome type III (USH3) caused by mutations in the Clarin 1 gene (CLRN1). Methods High-resolution macular images were obtained by adaptive optics scanning laser ophthalmoscopy and spectral domain optical coherence tomography in 3 patients with USH3 and were compared with those of age-similar control subjects. Vision function measures included best-corrected visual acuity, kinetic and static perimetry, and full-field electroretinography. Coding regions of the CLRN1 gene were sequenced. Results CLRN1 mutations were present in all the patients; a 20-year-old man showed compound heterozygous mutations (p.N48K and p.S188X), and 2 unrelated women aged 25 and 32 years had homozygous mutations (p.N48K). Best-corrected visual acuity ranged from 20/16 to 20/40, with scotomas beginning at 3° eccentricity. The inner segment-outer segment junction or the inner segment ellipsoid band was disrupted within 1° to 4° of the fovea, and the foveal inner and outer segment layers were significantly thinner than normal. Cones near the fovea in patients 1 and 2 showed normal spacing, and the preserved region ended abruptly. Retinal pigment epithelial cells were visible in patient 3 where cones were lost. Conclusions Cones were observed centrally but not in regions with scotomas, and retinal pigment epithelial cells were visible in regions without cones in patients with CLRN1 mutations. High-resolution measures of retinal structure demonstrate patterns of cone loss associated with CLRN1 mutations. Clinical Relevance These findings provide insight into the effect of CLRN1 mutations on macular cone structure, which has implications for the development of treatments for USH3. Trial Registration clinicaltrials.gov Identifier: NCT00254605 PMID:22964989

8-oxoguanine causes spontaneous de novo germline mutations in mice.

PubMed

Ohno, Mizuki; Sakumi, Kunihiko; Fukumura, Ryutaro; Furuichi, Masato; Iwasaki, Yuki; Hokama, Masaaki; Ikemura, Toshimichi; Tsuzuki, Teruhisa; Gondo, Yoichi; Nakabeppu, Yusaku

2014-04-15

Spontaneous germline mutations generate genetic diversity in populations of sexually reproductive organisms, and are thus regarded as a driving force of evolution. However, the cause and mechanism remain unclear. 8-oxoguanine (8-oxoG) is a candidate molecule that causes germline mutations, because it makes DNA more prone to mutation and is constantly generated by reactive oxygen species in vivo. We show here that endogenous 8-oxoG caused de novo spontaneous and heritable G to T mutations in mice, which occurred at different stages in the germ cell lineage and were distributed throughout the chromosomes. Using exome analyses covering 40.9 Mb of mouse transcribed regions, we found increased frequencies of G to T mutations at a rate of 2 × 10(-7) mutations/base/generation in offspring of Mth1/Ogg1/Mutyh triple knockout (TOY-KO) mice, which accumulate 8-oxoG in the nuclear DNA of gonadal cells. The roles of MTH1, OGG1, and MUTYH are specific for the prevention of 8-oxoG-induced mutation, and 99% of the mutations observed in TOY-KO mice were G to T transversions caused by 8-oxoG; therefore, we concluded that 8-oxoG is a causative molecule for spontaneous and inheritable mutations of the germ lineage cells.

Mutations of the Imprinted CDKN1C Gene as a Cause of the Overgrowth Beckwith-Wiedemann Syndrome: Clinical Spectrum and Functional Characterization.

PubMed

Brioude, Frederic; Netchine, Irène; Praz, Francoise; Le Jule, Marilyne; Calmel, Claire; Lacombe, Didier; Edery, Patrick; Catala, Martin; Odent, Sylvie; Isidor, Bertrand; Lyonnet, Stanislas; Sigaudy, Sabine; Leheup, Bruno; Audebert-Bellanger, Séverine; Burglen, Lydie; Giuliano, Fabienne; Alessandri, Jean-Luc; Cormier-Daire, Valérie; Laffargue, Fanny; Blesson, Sophie; Coupier, Isabelle; Lespinasse, James; Blanchet, Patricia; Boute, Odile; Baumann, Clarisse; Polak, Michel; Doray, Berenice; Verloes, Alain; Viot, Géraldine; Le Bouc, Yves; Rossignol, Sylvie

2015-09-01

Beckwith-Wiedemann syndrome (BWS) is an imprinting disorder associating macroglossia, abdominal wall defects, visceromegaly, and a high risk of childhood tumor. Molecular anomalies are mostly epigenetic; however, mutations of CDKN1C are implicated in 8% of cases, including both sporadic and familial forms. We aimed to describe the phenotype of BWS patients with CDKN1C mutations and develop a functional test for CDKN1C mutations. For each propositus, we sequenced the three exons and intron-exon boundaries of CDKN1C in patients presenting a BWS phenotype, including abdominal wall defects, without 11p15 methylation defects. We developed a functional test based on flow cytometry. We identified 37 mutations in 38 pedigrees (50 patients and seven fetuses). Analysis of parental samples when available showed that all mutations tested but one was inherited from the mother. The four missense mutations led to a less severe phenotype (lower frequency of exomphalos) than the other 33 mutations. The following four tumors occurred: one neuroblastoma, one ganglioneuroblastoma, one melanoma, and one acute lymphoid leukemia. Cases of BWS caused by CDKN1C mutations are not rare. CDKN1C sequencing should be performed for BWS patients presenting with abdominal wall defects or cleft palate without 11p15 methylation defects or body asymmetry, or in familial cases of BWS. © 2015 WILEY PERIODICALS, INC.

Cancer-associated IDH1 mutations produce 2-hydroxyglutarate

PubMed Central

Dang, Lenny; White, David W.; Gross, Stefan; Bennett, Bryson D.; Bittinger, Mark A.; Driggers, Edward M.; Fantin, Valeria R.; Jang, Hyun Gyung; Jin, Shengfang; Keenan, Marie C.; Marks, Kevin M.; Prins, Robert M.; Ward, Patrick S.; Yen, Katharine E.; Liau, Linda M.; Rabinowitz, Joshua D.; Cantley, Lewis C.; Thompson, Craig B.; Vander Heiden, Matthew G.; Su, Shinsan M.

2009-01-01

Summary Mutations in the enzyme cytosolic isocitrate dehydrogenase 1 (IDH1) are a common feature of a major subset of primary human brain cancers. These mutations occur at a single amino acid residue of the IDH1 active site resulting in loss of the enzyme’s ability to catalyze conversion of isocitrate to α-ketoglutarate. However, only a single copy of the gene is mutated in tumors, raising the possibility that the mutations do not result in a simple loss of function. Here we show that cancer-associated IDH1 mutations result in a new ability of the enzyme to catalyze the NADPH-dependent reduction of α-ketoglutarate to R(−)-2-hydroxyglutarate (2HG). Structural studies demonstrate that when R132 is mutated to histidine, residues in the active site are shifted to produce structural changes consistent with reduced oxidative decarboxylation of isocitrate and acquisition of the ability to convert α-ketoglutarate to 2HG. Excess accumulation of 2HG has been shown to lead to an elevated risk of malignant brain tumors in patients with inborn errors of 2HG metabolism. Similarly, in human malignant gliomas harboring IDH1 mutations, we find dramatically elevated levels of 2HG. These data demonstrate that the IDH1 mutations result in production of the onco-metabolite 2HG, and suggest that the excess 2HG which accumulates in vivo contributes to the formation and malignant progression of gliomas. PMID:19935646

MSH6 and MSH3 are rarely involved in genetic predisposition to nonpolypotic colon cancer.

PubMed

Huang, J; Kuismanen, S A; Liu, T; Chadwick, R B; Johnson, C K; Stevens, M W; Richards, S K; Meek, J E; Gao, X; Wright, F A; Mecklin, J P; Järvinen, H J; Grönberg, H; Bisgaard, M L; Lindblom, A; Peltomäki, P

2001-02-15

A set of 90 nonpolypotic colon cancer families in which germ-line mutations of MSH2 and MLH1 had been excluded were screened for mutations in two additional DNA mismatch repair genes, MSH6 and MSH3. Kindreds fulfilling and not fulfilling the Amsterdam I criteria, showing early and late onset colorectal (and other) cancers, and having microsatellite stable and unstable tumors were included. Two partly parallel approaches were used: genetic linkage analysis (19 large families) and the protein truncation test (85, mostly smaller, families). Whereas MSH3 was not involved in any family, a large Amsterdam-positive, late-onset family showed a novel germ-line mutation in MSH6 (deletion of CT at nucleotide 3052 in exon 4). The mutation was identified through genetic linkage (multipoint lod score 2.4) and subsequent sequencing of MSH6. Furthermore, the entire MSH6 gene was sequenced exon by exon in families with frameshift mutations in the (C)8 tract in tumors, previously suggested as a predictor of MSH6 germ-line mutations; no mutations were found. We conclude that germ-line involvement of MSH6 and MSH3 is rare and that other genes are likely to account for a majority of MSH2-, MLH1-mutation negative families with nonpolypotic colon cancer.

The impact of KRAS mutations on VEGF-A production and tumour vascular network

PubMed Central

2013-01-01

Background The malignant potential of tumour cells may be influenced by the molecular nature of KRAS mutations being codon 13 mutations less aggressive than codon 12 ones. Their metabolic profile is also different, with an increased anaerobic glycolytic metabolism in cells harbouring codon 12 KRAS mutations compared with cells containing codon 13 mutations. We hypothesized that this distinct metabolic behaviour could be associated with different HIF-1α expression and a distinct angiogenic profile. Methods Codon13 KRAS mutation (ASP13) or codon12 KRAS mutation (CYS12) NIH3T3 transfectants were analyzed in vitro and in vivo. Expression of HIF-1α, and VEGF-A was studied at RNA and protein levels. Regulation of VEGF-A promoter activity was assessed by means of luciferase assays using different plasmid constructs. Vascular network was assessed in tumors growing after subcutaneous inoculation. Non parametric statistics were used for analysis of results. Results Our results show that in normoxic conditions ASP13 transfectants exhibited less HIF-1α protein levels and activity than CYS12. In contrast, codon 13 transfectants exhibited higher VEGF-A mRNA and protein levels and enhanced VEGF-A promoter activity. These differences were due to a differential activation of Sp1/AP2 transcription elements of the VEGF-A promoter associated with increased ERKs signalling in ASP13 transfectants. Subcutaneous CYS12 tumours expressed less VEGF-A and showed a higher microvessel density (MVD) than ASP13 tumours. In contrast, prominent vessels were only observed in the latter. Conclusion Subtle changes in the molecular nature of KRAS oncogene activating mutations occurring in tumour cells have a major impact on the vascular strategy devised providing with new insights on the role of KRAS mutations on angiogenesis. PMID:23506169

A novel STXBP1 mutation causes typical Rett syndrome in a Japanese girl.

PubMed

Yuge, Kotaro; Iwama, Kazuhiro; Yonee, Chihiro; Matsufuji, Mayumi; Sano, Nozomi; Saikusa, Tomoko; Yae, Yukako; Yamashita, Yushiro; Mizuguchi, Takeshi; Matsumoto, Naomichi; Matsuishi, Toyojiro

2018-06-01

Rett syndrome (RTT) is a neurodevelopmental disorder mostly caused by mutations in Methyl-CpG-binding protein 2 (MECP2); however, mutations in various other genes may lead to RTT-like phenotypes. Here, we report the first case of a Japanese girl with RTT caused by a novel syntaxin-binding protein 1 (STXBP1) frameshift mutation (c.60delG, p.Lys21Argfs*16). She showed epilepsy at one year of age, regression of acquired psychomotor abilities thereafter, and exhibited stereotypic hand and limb movements at 3 years of age. Her epilepsy onset was earlier than is typical for RTT patients. However, she fully met the 2010 diagnostic criteria of typical RTT. STXBP1 mutations cause early infantile epileptic encephalopathy (EIEE), various intractable epilepsies, and neurodevelopmental disorders. However, the case described here presented a unique clinical presentation of typical RTT without EIEE and a novel STXBP1 mutation. Copyright © 2018 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Stickler syndrome caused by COL2A1 mutations: genotype–phenotype correlation in a series of 100 patients

PubMed Central

Hoornaert, Kristien P; Vereecke, Inge; Dewinter, Chantal; Rosenberg, Thomas; Beemer, Frits A; Leroy, Jules G; Bendix, Laila; Björck, Erik; Bonduelle, Maryse; Boute, Odile; Cormier-Daire, Valerie; De Die-Smulders, Christine; Dieux-Coeslier, Anne; Dollfus, Hélène; Elting, Mariet; Green, Andrew; Guerci, Veronica I; Hennekam, Raoul C M; Hilhorts-Hofstee, Yvonne; Holder, Muriel; Hoyng, Carel; Jones, Kristi J; Josifova, Dragana; Kaitila, Ilkka; Kjaergaard, Suzanne; Kroes, Yolande H; Lagerstedt, Kristina; Lees, Melissa; LeMerrer, Martine; Magnani, Cinzia; Marcelis, Carlo; Martorell, Loreto; Mathieu, Michèle; McEntagart, Meriel; Mendicino, Angela; Morton, Jenny; Orazio, Gabrielli; Paquis, Véronique; Reish, Orit; Simola, Kalle O J; Smithson, Sarah F; Temple, Karen I; Van Aken, Elisabeth; Van Bever, Yolande; van den Ende, Jenneke; Van Hagen, Johanna M; Zelante, Leopoldo; Zordania, Riina; De Paepe, Anne; Leroy, Bart P; De Buyzere, Marc; Coucke, Paul J; Mortier, Geert R

2010-01-01

Stickler syndrome is an autosomal dominant connective tissue disorder caused by mutations in different collagen genes. The aim of our study was to define more precisely the phenotype and genotype of Stickler syndrome type 1 by investigating a large series of patients with a heterozygous mutation in COL2A1. In 188 probands with the clinical diagnosis of Stickler syndrome, the COL2A1 gene was analyzed by either a mutation scanning technique or bidirectional fluorescent DNA sequencing. The effect of splice site alterations was investigated by analyzing mRNA. Multiplex ligation-dependent amplification analysis was used for the detection of intragenic deletions. We identified 77 different COL2A1 mutations in 100 affected individuals. Analysis of the splice site mutations showed unusual RNA isoforms, most of which contained a premature stop codon. Vitreous anomalies and retinal detachments were found more frequently in patients with a COL2A1 mutation compared with the mutation-negative group (P<0.01). Overall, 20 of 23 sporadic patients with a COL2A1 mutation had either a cleft palate or retinal detachment with vitreous anomalies. The presence of vitreous anomalies, retinal tears or detachments, cleft palate and a positive family history were shown to be good indicators for a COL2A1 defect. In conclusion, we confirm that Stickler syndrome type 1 is predominantly caused by loss-of-function mutations in the COL2A1 gene as >90% of the mutations were predicted to result in nonsense-mediated decay. On the basis of binary regression analysis, we developed a scoring system that may be useful when evaluating patients with Stickler syndrome. PMID:20179744

Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

PubMed

Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

2014-05-01

Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

[Study of gene mutation in 62 hemophilia A children].

PubMed

Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

2017-11-02

Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense mutation; the most frequent gene mutation in medium hemophilia A is missense mutation.

A novel A781V mutation in the CSF1R gene causes hereditary diffuse leucoencephalopathy with axonal spheroids☆

PubMed Central

Ahmed, Rebekah; Guerreiro, Rita; Rohrer, Jonathan D.; Guven, Gamze; Rossor, Martin N.; Hardy, John; Fox, Nick C.

2013-01-01

We report a family with a novel CSF1R mutation causing hereditary diffuse leucoencephalopathy with axonal spheroids. Family members presented with neuropsychiatric and behavioural symptoms, with subsequent development of motor symptoms and gait disturbance. MRI brain showed extensive white matter change with a frontal predominance and associated atrophy in two members of the family. Genetic testing revealed a novel mutation c.2342C > T (p.A781V) in the CSF1R gene in two brothers of the family. This report highlights the difficulties in diagnosing HDLS and discusses the indications for testing for mutations in the CSF1R gene. PMID:23816250

[Molecular characterization of atypical chronic myeloid leukemia and chronic neutrophilic leukemia].

PubMed

Senín, Alicia; Arenillas, Leonor; Martínez-Avilés, Luz; Fernández-Rodríguez, Concepción; Bellosillo, Beatriz; Florensa, Lourdes; Besses, Carles; Álvarez-Larrán, Alberto

2015-06-08

Atypical chronic myeloid leukemia (aCML) and chronic neutrophilic leukemia (CNL) display similar clinical and hematological characteristics. The objective of the present study was to determine the mutational status of SETBP1 and CSF3R in these diseases. The mutational status of SETBP1 and CSF3R was studied in 7 patients with aCML (n = 3), CNL (n = 1) and unclassifiable myeloproliferative neoplasms (MPN-u) (n = 3). Additionally, mutations in ASXL1, SRSF2, IDH1/2, DNMT3A, and RUNX1 were also analyzed. SETBP1 mutations (G870S and G872R) were detected in 2 patients with MPN-u, and one of them also presented mutations in SRSF2 (P95H) and ASXL1 (E635fs). The CNL case showed mutations in CSFR3 (T618I), SETBP1 (G870S) and SRSF2 (P95H). No patient classified as aCML had mutations in SETBP1 or CSF3R. One of the patients with mutations evolved to acute myeloid leukemia, while the other 2 had disease progression without transformation to overt leukemia. The knowledge of the molecular alterations involved in these rare diseases is useful in the diagnosis and may have an impact on both prognosis and therapy. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

Identification of a founder BRCA1 mutation in the Moroccan population.

PubMed

Quiles, F; Teulé, À; Martinussen Tandstad, N; Feliubadaló, L; Tornero, E; Del Valle, J; Menéndez, M; Salinas, M; Wethe Rognlien, V; Velasco, A; Izquierdo, A; Capellá, G; Brunet, J; Lázaro, C

2016-10-01

Breast cancer (BC) is the most frequent cancer among women in Morocco. However, the role of the most prevalent BC-predisposing genes, BRCA1 and BRCA2, has been largely unexplored. To help define the role of BRCA1 in BC in Morocco, we characterized the first potential BRCA1 founder mutation in this population. Genetic testing of BRCA1 and BRCA2 in BC high-risk families identified mutation BRCA1 c.5309G>T, p.(Gly1770Val) or G1770V in five independent families from Morocco, suggesting a founder effect. To confirm this hypothesis, haplotype construction was performed using seven intragenic and flanking BRCA1 microsatellite markers. Clinical data were also compiled. Clinical data from carriers of mutation G1770V correspond to data from carriers of BRCA1 pathogenic mutations. Microsatellite analysis showed a common haplotype for the five families in a region comprising 1.54 Mb, confirming G1770V as the first specific founder BRCA1 mutation in the Moroccan population. Our findings contribute to a better understanding of BC genetics in the Moroccan population. Nevertheless, comprehensive studies of mutation G1770V in large series of BC patients from Morocco are needed to assess the real prevalence of this mutation and to improve genetic testing and risk assessment in this population. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A dizygotic twin pregnancy in a MODY 3-affected woman.

PubMed

Bitterman, O; Iafusco, D; Torcia, F; Tinto, N; Napoli, A

2016-10-01

MODY diabetes includes rare familiar forms due to genetic mutations resulting in β-cell dysfunction. MODY 3 is due to mutations in the gene transcription factor HNF-1α, with diabetes diagnosis in adolescence or early adult life. Few data are available about MODY 3 in pregnancy. A 36-year-old Italian woman came to our unit at the 5th week of pregnancy. She was diagnosed with diabetes at 18 years, with negative autoimmunity and a strong familiarity for diabetes. She was treated with gliclazide and metformin. She had a previous pregnancy in which she was treated with insulin, giving birth at 38 weeks to a 3.210 kg baby girl, who showed neonatal hypoglycemia. We switched her to insulin treatment according to guidelines. We asked for genetic molecular testing, resulting in a HNF-1α gene mutation. A US examination at 7 weeks revealed a twin, bicorial, biamniotic pregnancy. At 37 weeks of gestation, she gave birth to two normal-weight baby girls; only one showed neonatal hypoglycemia and a genetic test revealed that she was affected by HNF-1α gene mutation. Subsequently, entire family of the woman was tested, showing that the father, the sister and the first daughter had the same HNF-1α mutation. A MODY 3 foetus needs a near-normal maternal glycemic control, because the exposure to intrauterine hyperglycemia can lead to an earlier age of diabetes onset. Neonatal hypoglycemia is generally observed in MODY 1 infants, but it is possible to hypothesize that some HNF-1α mutations could lead to a functionally impaired protein that might dysregulate HNF-4α expression determining hypoglycemia.

Overlapping spectra of SMAD4 mutations in juvenile polyposis (JP) and JP-HHT syndrome.

PubMed

Gallione, Carol; Aylsworth, Arthur S; Beis, Jill; Berk, Terri; Bernhardt, Barbara; Clark, Robin D; Clericuzio, Carol; Danesino, Cesare; Drautz, Joanne; Fahl, Jeffrey; Fan, Zheng; Faughnan, Marie E; Ganguly, Arupa; Garvie, John; Henderson, Katharine; Kini, Usha; Leedom, Tracey; Ludman, Mark; Lux, Andreas; Maisenbacher, Melissa; Mazzucco, Sara; Olivieri, Carla; Ploos van Amstel, Johannes K; Prigoda-Lee, Nadia; Pyeritz, Reed E; Reardon, Willie; Vandezande, Kirk; Waldman, J Deane; White, Robert I; Williams, Charles A; Marchuk, Douglas A

2010-02-01

Juvenile polyposis (JP) and hereditary hemorrhagic telangiectasia (HHT) are clinically distinct diseases caused by mutations in SMAD4 and BMPR1A (for JP) and endoglin and ALK1 (for HHT). Recently, a combined syndrome of JP-HHT was described that is also caused by mutations in SMAD4. Although both JP and JP-HHT are caused by SMAD4 mutations, a possible genotype:phenotype correlation was noted as all of the SMAD4 mutations in the JP-HHT patients were clustered in the COOH-terminal MH2 domain of the protein. If valid, this correlation would provide a molecular explanation for the phenotypic differences, as well as a pre-symptomatic diagnostic test to distinguish patients at risk for the overlapping but different clinical features of the disorders. In this study, we collected 19 new JP-HHT patients from which we identified 15 additional SMAD4 mutations. We also reviewed the literature for other reports of JP patients with HHT symptoms with confirmed SMAD4 mutations. Our combined results show that although the SMAD4 mutations in JP-HHT patients do show a tendency to cluster in the MH2 domain, mutations in other parts of the gene also cause the combined syndrome. Thus, any mutation in SMAD4 can cause JP-HHT. Any JP patient with a SMAD4 mutation is, therefore, at risk for the visceral manifestations of HHT and any HHT patient with SMAD4 mutation is at risk for early onset gastrointestinal cancer. In conclusion, a patient who tests positive for any SMAD4 mutation must be considered at risk for the combined syndrome of JP-HHT and monitored accordingly. Copyright 2010 Wiley-Liss, Inc.

Recessive mutations in the INS gene result in neonatal diabetes through reduced insulin biosynthesis

PubMed Central

Garin, Intza; Edghill, Emma L.; Akerman, Ildem; Rubio-Cabezas, Oscar; Rica, Itxaso; Locke, Jonathan M.; Maestro, Miguel Angel; Alshaikh, Adnan; Bundak, Ruveyde; del Castillo, Gabriel; Deeb, Asma; Deiss, Dorothee; Fernandez, Juan M.; Godbole, Koumudi; Hussain, Khalid; O’Connell, Michele; Klupa, Thomasz; Kolouskova, Stanislava; Mohsin, Fauzia; Perlman, Kusiel; Sumnik, Zdenek; Rial, Jose M.; Ugarte, Estibaliz; Vasanthi, Thiruvengadam; Johnstone, Karen; Flanagan, Sarah E.; Martínez, Rosa; Castaño, Carlos; Patch, Ann-Marie; Fernández-Rebollo, Eduardo; Raile, Klemens; Morgan, Noel; Harries, Lorna W.; Castaño, Luis; Ellard, Sian; Ferrer, Jorge; de Nanclares, Guiomar Perez; Hattersley, Andrew T.

2010-01-01

Heterozygous coding mutations in the INS gene that encodes preproinsulin were recently shown to be an important cause of permanent neonatal diabetes. These dominantly acting mutations prevent normal folding of proinsulin, which leads to beta-cell death through endoplasmic reticulum stress and apoptosis. We now report 10 different recessive INS mutations in 15 probands with neonatal diabetes. Functional studies showed that recessive mutations resulted in diabetes because of decreased insulin biosynthesis through distinct mechanisms, including gene deletion, lack of the translation initiation signal, and altered mRNA stability because of the disruption of a polyadenylation signal. A subset of recessive mutations caused abnormal INS transcription, including the deletion of the C1 and E1 cis regulatory elements, or three different single base-pair substitutions in a CC dinucleotide sequence located between E1 and A1 elements. In keeping with an earlier and more severe beta-cell defect, patients with recessive INS mutations had a lower birth weight (−3.2 SD score vs. −2.0 SD score) and were diagnosed earlier (median 1 week vs. 10 weeks) compared to those with dominant INS mutations. Mutations in the insulin gene can therefore result in neonatal diabetes as a result of two contrasting pathogenic mechanisms. Moreover, the recessively inherited mutations provide a genetic demonstration of the essential role of multiple sequence elements that regulate the biosynthesis of insulin in man. PMID:20133622

Functional Analyses of a Novel CITED2 Nonsynonymous Mutation in Chinese Tibetan Patients with Congenital Heart Disease.

PubMed

Liu, Shiming; Su, Zhaobing; Tan, Sainan; Ni, Bin; Pan, Hong; Liu, Beihong; Wang, Jing; Xiao, Jianmin; Chen, Qiuhong

2017-08-01

CITED2 gene is an important cardiac transcription factor that plays a fundamental role in the formation and development of embryonic cardiovascular. Previous studies have showed that knock-out of CITED2 in mice might result in various cardiac malformations. However, the mechanisms of CITED2 mutation on congenital heart disease (CHD) in Chinese Tibetan population are still poorly understood. In the present study, 187 unrelated Tibetan patients with CHD and 200 unrelated Tibetan healthy controls were screened for variants in the CITED2 gene; we subsequently identified one potential disease-causing mutation p.G143A in a 6-year-old girl with PDA and functional analyses of the mutation were carried out. Our study showed that the novel mutation of CITED2 significantly enhanced the expression activity of vascular endothelial growth factor (VEGF) under the role of co-receptor hypoxia inducible factor 1-aipha (HIF-1A), which is closely related with embryonic cardiac development. As a result, CITED2 gene mutation may play a significant role in the development of pediatric congenital heart disease.

A new mutation in the calcium-sensing receptor gene causing hypocalcaemia: case report of a father and two sons.

PubMed

Schoutteten, M K; Bravenboer, B; Seneca, S; Stouffs, K; Velkeniers, B

2017-07-01

Regulation of calcium is mediated by parathyroid hormone (PTH) and 1.25-dihydroxyvitamine D3. The calcium-sensing receptor (CaSR) regulates PTH release by a negative feedback system. Gain-of-function mutations in the CaSR gene reset the calcium-PTH axis, leading to hypocalcaemia. We analysed a family with hypocalcaemia. The proband was a 47-year-old man (index, patient I1), who presented with paraesthesias in both limbs. He has two sons (patient II1 a nd I I2). The probands' lab results showed: serum calcium of 1.95 mmol/l, albumin 41 g/l, phosphate 0.81 mmol/l and PTH 6.6 ng/l (normal 15-65 ng/l). Based on this analysis, we suspected a hereditary form of hypocalcaemia and performed genetic testing by polymerase chain reaction and Sanger sequencing of the coding regions and intron boundaries of the CaSR gene. Genetic analysis revealed a new heterozygous mutation: c.2195A>G, p.(Asn732Ser) in exon 7. The lab results of patient II1 showed: serum calcium of 1.93 mmol/l, phosphate 1.31 mmol/l, albumin 41 g/l, and PTH 24.3 ng/l. His genotype revealed the same activating mutation and, like his father, he also lost his scalp hair at an early adolescent age. Patient II2 is asymptomatic, and has neither biochemical abnormalities, nor the familial CaSR gene mutation. He still has all his scalp hair. 1) The c.2195A>G, p.(Asn732Ser) mutation in exon 7 of the CaSR gene leads to hypocalcaemia, and has not been reported before in the medical literature. 2) Possibly, this mutation is linked to premature baldness.

Mechanistic Basis for Type 2 Long QT Syndrome Caused by KCNH2 Mutations that Disrupt Conserved Arginine Residue in the Voltage Sensor

PubMed Central

McBride, Christie M.; Smith, Ashley M.; Smith, Jennifer L.; Reloj, Allison R.; Velasco, Ellyn J.; Powell, Jonathan; Elayi, Claude S.; Bartos, Daniel C.; Burgess, Don E.

2013-01-01

KCNH2 encodes the Kv11.1 channel, which conducts the rapidly activating delayed rectifier K+ current (IKr) in the heart. KCNH2 mutations cause type 2 long QT syndrome (LQT2), which increases the risk for life-threatening ventricular arrhythmias. LQT2 mutations are predicted to prolong the cardiac action potential (AP) by reducing IKr during repolarization. Kv11.1 contains several conserved basic amino acids in the fourth transmembrane segment (S4) of the voltage sensor that are important for normal channel trafficking and gating. This study sought to determine the mechanism(s) by which LQT2 mutations at conserved arginine residues in S4 (R531Q, R531W or R534L) alter Kv11.1 function. Western blot analyses of HEK293 cells transiently expressing R531Q, R531W or R534L suggested that only R534L inhibited Kv11.1 trafficking. Voltage-clamping experiments showed that R531Q or R531W dramatically altered Kv11.1 current (IKv11.1) activation, inactivation, recovery from inactivation and deactivation. Coexpression of wild type (to mimic the patients’ genotypes) mostly corrected the changes in IKv11.1 activation and inactivation, but deactivation kinetics were still faster. Computational simulations using a human ventricular AP model showed that accelerating deactivation rates was sufficient to prolong the AP, but these effects were minimal compared to simply reducing IKr. These are the first data to demonstrate that coexpressing wild type can correct activation and inactivation dysfunction caused by mutations at a critical voltage-sensing residue in Kv11.1. We conclude that some Kv11.1 mutations might accelerate deactivation to cause LQT2 but that the ventricular AP duration is much more sensitive to mutations that decrease IKr. This likely explains why most LQT2 mutations are nonsense or trafficking-deficient. PMID:23546015

Mechanistic basis for type 2 long QT syndrome caused by KCNH2 mutations that disrupt conserved arginine residues in the voltage sensor.

PubMed

McBride, Christie M; Smith, Ashley M; Smith, Jennifer L; Reloj, Allison R; Velasco, Ellyn J; Powell, Jonathan; Elayi, Claude S; Bartos, Daniel C; Burgess, Don E; Delisle, Brian P

2013-05-01

KCNH2 encodes the Kv11.1 channel, which conducts the rapidly activating delayed rectifier K+ current (I Kr) in the heart. KCNH2 mutations cause type 2 long QT syndrome (LQT2), which increases the risk for life-threatening ventricular arrhythmias. LQT2 mutations are predicted to prolong the cardiac action potential (AP) by reducing I Kr during repolarization. Kv11.1 contains several conserved basic amino acids in the fourth transmembrane segment (S4) of the voltage sensor that are important for normal channel trafficking and gating. This study sought to determine the mechanism(s) by which LQT2 mutations at conserved arginine residues in S4 (R531Q, R531W or R534L) alter Kv11.1 function. Western blot analyses of HEK293 cells transiently expressing R531Q, R531W or R534L suggested that only R534L inhibited Kv11.1 trafficking. Voltage-clamping experiments showed that R531Q or R531W dramatically altered Kv11.1 current (I Kv11.1) activation, inactivation, recovery from inactivation and deactivation. Coexpression of wild type (to mimic the patients' genotypes) mostly corrected the changes in I Kv11.1 activation and inactivation, but deactivation kinetics were still faster. Computational simulations using a human ventricular AP model showed that accelerating deactivation rates was sufficient to prolong the AP, but these effects were minimal compared to simply reducing I Kr. These are the first data to demonstrate that coexpressing wild type can correct activation and inactivation dysfunction caused by mutations at a critical voltage-sensing residue in Kv11.1. We conclude that some Kv11.1 mutations might accelerate deactivation to cause LQT2 but that the ventricular AP duration is much more sensitive to mutations that decrease I Kr. This likely explains why most LQT2 mutations are nonsense or trafficking-deficient.

MET exon 14 skipping mutation in triple-negative pulmonary adenocarcinomas and pleomorphic carcinomas: An analysis of intratumoral MET status heterogeneity and clinicopathological characteristics.

PubMed

Kwon, Dohee; Koh, Jaemoon; Kim, Sehui; Go, Heounjeong; Kim, Young A; Keam, Bhumsuk; Kim, Tae Min; Kim, Dong-Wan; Jeon, Yoon Kyung; Chung, Doo Hyun

2017-04-01

MET mutations leading to exon 14 skipping rarely occur in non-small cell lung cancer (NSCLC). Recently, small molecule inhibitors targeting MET mutations showed clinical benefit. However, the clinicopathological characteristics of NSCLC harboring MET mutations, and the correlation among mutations, protein expression, and gene copy number of MET in NSCLC remain unclear. Therefore, we address these issues. MET exon 14 skipping mutations were evaluated using real-time quantitative reverse-transcription-PCR (qRT-PCR) in 102 triple-negative (i.e., EGFR mutation (-)/ALK translocation (-)/KRAS mutation (-)) pulmonary adenocarcinomas, and 45 pleomorphic carcinomas. MET mutation and gene copy were also examined in microdissected tissues obtained from tumor areas with heterogeneous MET immunohistochemical expression. MET mutations were detected in 8.8% (9/102) of triple-negative adenocarcinomas and 20% (9/45) of pleomorphic carcinomas of the lung. Patients with MET-mutated adenocarcinomas was significantly older than those without MET mutations (P=0.015). The male to female and ever-to never-smoker ratios were 3:6 and 2:7, respectively, among patients with MET-mutated adenocarcinomas. All (9/9) of the MET-mutated adenocarcinomas showed acinar predominant histology with associated lepidic patterns. In contrast, the male to female and ever- to never-smoker ratios were 8:1 and 7:1, respectively, among patients with MET-mutated pleomorphic carcinomas. The carcinoma component of MET-mutated pleomorphic carcinomas was mostly adenocarcinoma of acinar pattern (8/9). MET mutation was detected by qRT-PCR in all samples with heterogeneous MET expression microdissected from five cases with MET-mutated adenocarcinoma, while MET gene amplification was detected in tumor areas expressing high MET protein levels among MET-mutated adenocarcinomas. MET-mutated NSCLC is characterized by older age in patients with adenocarcinoma and by an acinar histology and variable MET expression in patients with adenocarcinoma and pleomorphic carcinomas. Moreover, MET gene amplification might occur in the tumor cells harboring the MET mutation. Copyright © 2017 Elsevier B.V. All rights reserved.

Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma.

PubMed

Saida, Kosuke; Murase, Takayuki; Ito, Mayuko; Fujii, Kana; Takino, Hisashi; Masaki, Ayako; Kawakita, Daisuke; Ijichi, Kei; Tada, Yuichiro; Kusafuka, Kimihide; Iida, Yoshiyuki; Onitsuka, Tetsuro; Yatabe, Yasushi; Hanai, Nobuhiro; Hasegawa, Yasuhisa; Shinomiya, Hitomi; Nibu, Ken-Ichi; Shimozato, Kazuo; Inagaki, Hiroshi

2018-03-30

Adenoid cystic carcinoma (AdCC), one of the most common salivary gland carcinomas, usually has a fatal outcome. Epidermal growth factor receptor (EGFR) pathway gene mutations are important in predicting a patient's prognosis and estimating the efficacy of molecular therapy targeting the EGFR pathway. In this study of salivary gland AdCC (SAdCC), we looked for gene mutations in EGFR, RAS family ( KRAS, HRAS, and NRAS ), PIK3CA, BRAF, and AKT1 , using a highly sensitive single-base extension multiplex assay, SNaPshot. Out of 70 cases, EGFR pathway missense mutations were found in 13 (18.6%): RAS mutations in 10 (14.3%), EGFR in one (1.4%), and PIK3CA in 5 (7.1%). None of the cases showed an EGFR deletion by direct sequencing. Concurrent gene mutations were found in three cases (4.3%). EGFR pathway mutations were significantly associated with a shorter disease-free ( p = 0.011) and overall survival ( p = 0.049) and RAS mutations were as well; ( p = 0.010) and ( p = 0.024), respectively. The gene fusion status as determined by a FISH assay had no significant association with mutations of the genes involved in the EGFR pathway. In conclusion, EGFR pathway mutations, especially RAS mutations, may be frequent in SAdCC, and associated with a poor prognosis for the patient.

High Frequency of Alkaptonuria in Slovakia: Evidence for the Appearance of Multiple Mutations in HGO Involving Different Mutational Hot Spots

PubMed Central

Zatková, Andrea; de Bernabé, Daniel Beltrán Valero; Poláková, Helena; Zvarík, Marek; Feráková, Eva; Bošák, Vladimir; Ferák, Vladimír; Kádasi, L'udovít; de Córdoba , Santiago Rodríguez

2000-01-01

Alkaptonuria (AKU) is an autosomal recessive disorder caused by the deficiency of homogentisate 1,2 dioxygenase (HGO) activity. AKU shows a very low prevalence (1:100,000–250,000) in most ethnic groups. One notable exception is in Slovakia, where the incidence of AKU rises to 1:19,000. This high incidence is difficult to explain by a classical founder effect, because as many as 10 different AKU mutations have been identified in this relatively small country. We have determined the allelic associations of 11 HGO intragenic polymorphisms for 44 AKU chromosomes from 20 Slovak pedigrees. These data were compared to the HGO haplotype data available in our laboratory for >80 AKU chromosomes from different European and non-European countries. The results show that common European AKU chromosomes have had only a marginal contribution to the Slovak AKU gene pool. Six of the ten Slovak AKU mutations, including the prevalent G152fs, G161R, G270R, and P370fs mutations, most likely originated in Slovakia. Data available for 17 Slovak AKU pedigrees indicate that most of the AKU chromosomes have their origins in a single very small region in the Carpathian mountains, in the northwestern part of the country. Since all six Slovak AKU mutations are associated with HGO mutational hot spots, we suggest that an increased mutation rate at the HGO gene is responsible for the clustering of AKU mutations in such a small geographical region. PMID:11017803

The ABCA4 2588G>C Stargardt mutation: single origin and increasing frequency from South-West to North-East Europe.

PubMed

Maugeri, Alessandra; Flothmann, Kris; Hemmrich, Nadine; Ingvast, Sofie; Jorge, Paula; Paloma, Eva; Patel, Reshma; Rozet, Jean-Michel; Tammur, Jaana; Testa, Francesco; Balcells, Susana; Bird, Alan C; Brunner, Han G; Hoyng, Carel B; Metspalu, Andres; Simonelli, Francesca; Allikmets, Rando; Bhattacharya, Shomi S; D'Urso, Michele; Gonzàlez-Duarte, Roser; Kaplan, Josseline; te Meerman, Gerard J; Santos, Rosário; Schwartz, Marianne; Van Camp, Guy; Wadelius, Claes; Weber, Bernhard H F; Cremers, Frans P M

2002-03-01

Inherited retinal dystrophies represent the most important cause of vision impairment in adolescence, affecting approximately 1 out of 3000 individuals. Mutations of the photoreceptor-specific gene ABCA4 (ABCR) are a common cause of retinal dystrophy. A number of mutations have been repeatedly reported for this gene, notably the 2588G>C mutation which is frequent in both patients and controls. Here we ascertained the frequency of the 2588G>C mutation in a total of 2343 unrelated random control individuals from 11 European countries and 241 control individuals from the US, as well as in 614 patients with STGD both from Europe and the US. We found an overall carrier frequency of 1 out of 54 in Europe, compared with 1 out of 121 in the US, confirming that the 2588G>C ABCA4 mutation is one of the most frequent autosomal recessive mutations in the European population. Carrier frequencies show an increasing gradient in Europe from South-West to North-East. The lowest carrier frequency, 0 out of 199 (0%), was found in Portugal; the highest, 11 out of 197 (5.5%), was found in Sweden. Haplotype analysis in 16 families segregating the 2588G>C mutation showed four intragenic polymorphisms invariably present in all 16 disease chromosomes and sharing of the same allele for several markers flanking the ABCA4 locus in most of the disease chromosomes. These results indicate a single origin of the 2588G>C mutation which, to our best estimate, occurred between 2400 and 3000 years ago.

Identification of HNF4A Mutation p.T130I and HNF1A Mutations p.I27L and p.S487N in a Han Chinese Family with Early-Onset Maternally Inherited Type 2 Diabetes.

PubMed

Yang, Ying; Zhou, Tai-Cheng; Liu, Yong-Ying; Li, Xiao; Wang, Wen-Xue; Irwin, David M; Zhang, Ya-Ping

2016-01-01

Maturity-onset diabetes of the young (MODY) is characterized by the onset of diabetes before the age of 25 years, positive family history, high genetic predisposition, monogenic mutations, and an autosomal dominant mode of inheritance. Here, we aimed to investigate the mutations and to characterize the phenotypes of a Han Chinese family with early-onset maternally inherited type 2 diabetes. Detailed clinical assessments and genetic screening for mutations in the HNF4α, GCK, HNF-1α, IPF-1, HNF1β, and NEUROD1 genes were carried out in this family. One HNF4A mutation (p.T130I) and two HNF1A polymorphisms (p.I27L and p.S487N) were identified. Mutation p.T130I was associated with both early-onset and late-onset diabetes and caused downregulated HNF4A expression, whereas HNF1A polymorphisms p.I27L and p.S487N were associated with the age of diagnosis of diabetes. We demonstrated that mutation p.T130I in HNF4A was pathogenic as were the predicted polymorphisms p.I27L and p.S487N in HNF1A by genetic and functional analysis. Our results show that mutations in HNF4A and HNF1A genes might account for this early-onset inherited type 2 diabetes.

Prognostic value of mutational characteristics in gastrointestinal stromal tumors: a single-center experience in 275 cases.

PubMed

Wang, Ming; Xu, Jia; Zhao, Wenyi; Tu, Lin; Qiu, Weiqing; Wang, Chaojie; Shen, Yangyin; Liu, Qiang; Cao, Hui

2014-01-01

The objective of this study was to investigate the impact of KIT/PDGFRA mutations on the prognosis of gastrointestinal stromal tumors (GISTs). In the present study, genotype analyses were performed based on GIST samples from 275 patients. The relationship between mutation and clinicopathological characteristics were explored. All factors were evaluated for their impacts on relapse-free survival (RFS). Briefly, the results of genotype analyses showed that mutations were identified in 258 (93.8 %) patients, and deletion was the most frequent type of mutation accounting for 47.3 % (122/258) of all mutation cases, followed by substitution (87/258, 33.7 %) and duplication (49/258, 19.0 %). Moreover, for KIT exon 11 mutation, the most frequently involved area was from codon 557 to 560. Deep analyses showed that the mutation types were correlated with tumor location (P = 0.005), tumor size (P = 0.022), mitosis rate (P < 0.001), risk grade (P < 0.001), and relapse (P = 0.004). Furthermore, delW557-K558 correlated with mitosis rate (P = 0.042) and relapse (P = 0.036), and delTyr568/570 correlated with tumor origin (P = 0.018). Most importantly, mitotic rate [HR = 2.901 (95 % CI 1.094-7.695), P = 0.032] and risk grade [HR = 9.629 (95 % CI 1.997-46.416), P = 0.005] would be the representative traditional prognostic factors, and deletion with >3 codons would be an novel independent predictor of poor outcome for RFS in GIST patients with deletion mutation of KIT exon 11 [HR = 7.970 (95 % CI 1.774-35.803), P = 0.007]. All results indicated that mutation determined clinicopathological features and prognosis of GISTs, and more than three codons involvement may be a novel adverse indicator.

Mutations in TP53 are a prognostic factor in colorectal hepatic metastases undergoing surgical resection.

PubMed

Molleví, David G; Serrano, Teresa; Ginestà, Mireia M; Valls, Joan; Torras, Jaume; Navarro, Matilde; Ramos, Emilio; Germà, Josep R; Jaurrieta, Eduardo; Moreno, Víctor; Figueras, Joan; Capellà, Gabriel; Villanueva, Alberto

2007-06-01

The aim of this study was to analyze the prognostic value of TP53 mutations in a consecutive series of patients with hepatic metastases (HMs) from colorectal cancer undergoing surgical resection. Ninety-one patients with liver metastases from colorectal carcinoma were included. Mutational analysis of TP53, exons 4-10, was performed by single-strand conformation polymorphism and sequencing. P53 and P21 protein immunostaining was assessed. Multivariate Cox models were adjusted for gender, number of metastasis, resection margin, presence of TP53 mutations and chemotherapy treatment. Forty-six of 91 (50.05%) metastases showed mutations in TP53, observed mainly in exons 5-8, although 14.3% (n = 13) were located in exons 9 and 10. Forty percent (n = 22) were protein-truncating mutations. TP53 status associated with multiple (> or =3) metastases (65.6%, P = 0.033), advanced primary tumor Dukes' stage (P = 0.011) and younger age (<57 years old, P = 0.03). Presence of mutation associated with poor prognosis in univariate (P = 0.017) and multivariate Cox model [hazard ratio (HR) = 1.80, 95% confidence interval (CI) = 1.07-3.06, P = 0.028]. Prognostic value was maintained in patients undergoing radical resection (R0 series, n = 79, P = 0.014). Mutation associated with a worse outcome in chemotherapy-treated patients (HR = 2.54, 95% CI = 1.12-5.75, P = 0.026). The combination of > or =3 metastases and TP53 mutation identified a subset of patients with very poor prognosis (P = 0.009). P53 and P21 protein immunostaining did not show correlation with survival. TP53 mutational status seems to be an important prognostic factor in patients undergoing surgical resection of colorectal cancer HMs.

Mutation spectrum of RB1 mutations in retinoblastoma cases from Singapore with implications for genetic management and counselling.

PubMed

Tomar, Swati; Sethi, Raman; Sundar, Gangadhara; Quah, Thuan Chong; Quah, Boon Long; Lai, Poh San

2017-01-01

Retinoblastoma (RB) is a rare childhood malignant disorder caused by the biallelic inactivation of RB1 gene. Early diagnosis and identification of carriers of heritable RB1 mutations can improve disease outcome and management. In this study, mutational analysis was conducted on fifty-nine matched tumor and peripheral blood samples from 18 bilateral and 41 unilateral unrelated RB cases by a combinatorial approach of Multiplex Ligation-dependent Probe Amplification (MLPA) assay, deletion screening, direct sequencing, copy number gene dosage analysis and methylation assays. Screening of both blood and tumor samples yielded a mutation detection rate of 94.9% (56/59) while only 42.4% (25/59) of mutations were detected if blood samples alone were analyzed. Biallelic mutations were observed in 43/59 (72.9%) of tumors screened. There were 3 cases (5.1%) in which no mutations could be detected and germline mutations were detected in 19.5% (8/41) of unilateral cases. A total of 61 point mutations were identified, of which 10 were novel. There was a high incidence of previously reported recurrent mutations, occurring at 38.98% (23/59) of all cases. Of interest were three cases of mosaic RB1 mutations detected in the blood from patients with unilateral retinoblastoma. Additionally, two germline mutations previously reported to be associated with low-penetrance phenotypes: missense-c.1981C>T and splice variant-c.607+1G>T, were observed in a bilateral and a unilateral proband, respectively. These findings have implications for genetic counselling and risk prediction for the affected families. This is the first published report on the spectrum of mutations in RB patients from Singapore and shows that further improved mutation screening strategies are required in order to provide a definitive molecular diagnosis for every case of RB. Our findings also underscore the importance of genetic testing in supporting individualized disease management plans for patients and asymptomatic family members carrying low-penetrance, germline mosaicism or heritable unilateral mutational phenotypes.

Functional and splicing defect analysis of 23 ACVRL1 mutations in a cohort of patients affected by Hereditary Hemorrhagic Telangiectasia

PubMed Central

Alaa el Din, Ferdos; Patri, Sylvie; Thoreau, Vincent; Rodriguez-Ballesteros, Montserrat; Hamade, Eva; Bailly, Sabine; Gilbert-Dussardier, Brigitte; Abou Merhi, Raghida; Kitzis, Alain

2015-01-01

Hereditary Hemorrhagic Telangiectasia syndrome (HHT) or Rendu-Osler-Weber (ROW) syndrome is an autosomal dominant vascular disorder. Two most common forms of HHT, HHT1 and HHT2, have been linked to mutations in the endoglin (ENG) and activin receptor-like kinase 1 (ACVRL1or ALK1) genes respectively. This work was designed to examine the pathogenicity of 23 nucleotide variations in ACVRL1 gene detected in more than 400 patients. Among them, 14 missense mutations and one intronic variant were novels, and 8 missense mutations were previously identified with questionable implication in HHT2. The functionality of missense mutations was analyzed in response to BMP9 (specific ligand of ALK1), the maturation of the protein products and their localization were analyzed by western blot and fluorescence microscopy. The splicing impairment of the intronic and of two missense mutations was examined by minigene assay. Functional analysis showed that 18 out of 22 missense mutations were defective. Splicing analysis revealed that one missense mutation (c.733A>G, p.Ile245Val) affects the splicing of the harboring exon 6. Similarly, the intronic mutation outside the consensus splicing sites (c.1048+5G>A in intron 7) was seen pathogenic by splicing study. Both mutations induce a frame shift creating a premature stop codon likely resulting in mRNA degradation by NMD surveillance mechanism. Our results confirm the haploinsufficiency model proposed for HHT2. The affected allele of ACVRL1 induces mRNA degradation or the synthesis of a protein lacking the receptor activity. Furthermore, our data demonstrate that functional and splicing analyses together, represent two robust diagnostic tools to be used by geneticists confronted with novel or conflicted ACVRL1 mutations. PMID:26176610

GRIN1 mutations cause encephalopathy with infantile-onset epilepsy, and hyperkinetic and stereotyped movement disorders.

PubMed

Ohba, Chihiro; Shiina, Masaaki; Tohyama, Jun; Haginoya, Kazuhiro; Lerman-Sagie, Tally; Okamoto, Nobuhiko; Blumkin, Lubov; Lev, Dorit; Mukaida, Souichi; Nozaki, Fumihito; Uematsu, Mitsugu; Onuma, Akira; Kodera, Hirofumi; Nakashima, Mitsuko; Tsurusaki, Yoshinori; Miyake, Noriko; Tanaka, Fumiaki; Kato, Mitsuhiro; Ogata, Kazuhiro; Saitsu, Hirotomo; Matsumoto, Naomichi

2015-06-01

Recently, de novo mutations in GRIN1 have been identified in patients with nonsyndromic intellectual disability and epileptic encephalopathy. Whole exome sequencing (WES) analysis of patients with genetically unsolved epileptic encephalopathies identified four patients with GRIN1 mutations, allowing us to investigate the phenotypic spectrum of GRIN1 mutations. Eighty-eight patients with unclassified early onset epileptic encephalopathies (EOEEs) with an age of onset <1 year were analyzed by WES. The effect of mutations on N-methyl-D-aspartate (NMDA) receptors was examined by mapping altered amino acids onto three-dimensional models. We identified four de novo missense GRIN1 mutations in 4 of 88 patients with unclassified EOEEs. In these four patients, initial symptoms appeared within 3 months of birth, including hyperkinetic movements in two patients (2/4, 50%), and seizures in two patients (2/4, 50%). Involuntary movements, severe developmental delay, and intellectual disability were recognized in all four patients. In addition, abnormal eye movements resembling oculogyric crises and stereotypic hand movements were observed in two and three patients, respectively. All the four patients exhibited only nonspecific focal and diffuse epileptiform abnormality, and never showed suppression-burst or hypsarrhythmia during infancy. A de novo mosaic mutation (c.1923G>A) with a mutant allele frequency of 16% (in DNA of blood leukocytes) was detected in one patient. Three mutations were located in the transmembrane domain (3/4, 75%), and one in the extracellular loop near transmembrane helix 1. All the mutations were predicted to impair the function of the NMDA receptor. Clinical features of de novo GRIN1 mutations include infantile involuntary movements, seizures, and hand stereotypies, suggesting that GRIN1 mutations cause encephalopathy resulting in seizures and movement disorders. Wiley Periodicals, Inc. © 2015 International League Against Epilepsy.

Event-related potential markers of brain changes in preclinical familial Alzheimer disease

PubMed Central

Ally, B.A.; Celone, K.; McKeever, J.; Ruiz-Rizzo, A.L.; Lopera, F.; Stern, C.E.; Budson, A.E.

2011-01-01

Objectives: Event-related potentials (ERPs) can reflect differences in brain electrophysiology underlying cognitive functions in brain disorders such as dementia and mild cognitive impairment. To identify individuals at risk for Alzheimer disease (AD) we used high-density ERPs to examine brain physiology in young presymptomatic individuals (average age 34.2 years) who carry the E280A mutation in the presenilin-1 (PSEN1) gene and will go on to develop AD around the age of 45. Methods: Twenty-one subjects from a Colombian population with familial AD participated: 10 presymptomatic subjects positive for the PSEN1 mutation (carriers) and 11 siblings without the mutation (controls). Subjects performed a visual recognition memory test while 128-channel ERPs were recorded. Results: Despite identical behavioral performance, PSEN1 mutation carriers showed less positivity in frontal regions and more positivity in occipital regions, compared to controls. These differences were more pronounced during the 200–300 msec period. Discriminant analysis at this time interval showed promising sensitivity (72.7%) and specificity (81.8%) of the ERP measures to predict the presence of AD pathology. Conclusions: Presymptomatic PSEN1 mutation carriers show changes in brain physiology that can be detected by high-density ERPs. The relative differences observed showing greater frontal positivity in controls and greater occipital positivity in carriers indicates that control subjects may use frontally mediated processes to distinguish between studied and unstudied visual items, whereas carriers appear to rely more upon perceptual details of the items to distinguish between them. These findings also demonstrate the potential usefulness of ERP brain correlates as preclinical markers of AD. PMID:21775732

A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan.

PubMed

Abid, Aiysha; Khaliq, Shagufta; Shahid, Saba; Lanewala, Ali; Mubarak, Mohammad; Hashmi, Seema; Kazi, Javed; Masood, Tahir; Hafeez, Farkhanda; Naqvi, Syed Ali Anwar; Rizvi, Syed Adeebul Hasan; Mehdi, Syed Qasim

2012-07-10

Mutations in the NPHS1 and NPHS2 genes are among the main causes of early-onset and familial steroid resistant nephrotic syndrome respectively. This study was carried out to assess the frequencies of mutations in these two genes in a cohort of Pakistani pediatric NS patients. Mutation analysis was carried out by direct sequencing of the NPHS1 and NPHS2 genes in 145 nephrotic syndrome (NS) patients. This cohort included 36 samples of congenital or infantile onset NS cases and 39 samples of familial cases obtained from 30 families. A total of 7 homozygous (6 novel) mutations were found in the NPHS1 gene and 4 homozygous mutations in the NPHS2 gene. All mutations in the NPHS1 gene were found in the early onset cases. Of these, one patient has a family history of NS. Homozygous p.R229Q mutation in the NPHS2 gene was found in two children with childhood-onset NS. Our results show a low prevalence of disease causing mutations in the NPHS1 (22% early onset, 5.5% overall) and NPHS2 (3.3% early onset and 3.4% overall) genes in the Pakistani NS children as compared to the European populations. In contrast to the high frequency of the NPHS2 gene mutations reported for familial SRNS in Europe, no mutation was found in the familial Pakistani cases. To our knowledge, this is the first comprehensive screening of the NPHS1 and NPHS2 gene mutations in sporadic and familial NS cases from South Asia. Copyright © 2012 Elsevier B.V. All rights reserved.

Evolution of the Pseudomonas aeruginosa mutational resistome in an international Cystic Fibrosis clone.

PubMed

López-Causapé, Carla; Sommer, Lea Mette; Cabot, Gabriel; Rubio, Rosa; Ocampo-Sosa, Alain A; Johansen, Helle Krogh; Figuerola, Joan; Cantón, Rafael; Kidd, Timothy J; Molin, Soeren; Oliver, Antonio

2017-07-17

Emergence of epidemic clones and antibiotic resistance development compromises the management of Pseudomonas aeruginosa cystic fibrosis (CF) chronic respiratory infections. Whole genome sequencing (WGS) was used to decipher the phylogeny, interpatient dissemination, WGS mutator genotypes (mutome) and resistome of a widespread clone (CC274), in isolates from two highly-distant countries, Australia and Spain, covering an 18-year period. The coexistence of two divergent CC274 clonal lineages was revealed, but without evident geographical barrier; phylogenetic reconstructions and mutational resistome demonstrated the interpatient transmission of mutators. The extraordinary capacity of P. aeruginosa to develop resistance was evidenced by the emergence of mutations in >100 genes related to antibiotic resistance during the evolution of CC274, catalyzed by mutator phenotypes. While the presence of classical mutational resistance mechanisms was confirmed and correlated with resistance phenotypes, results also showed a major role of unexpected mutations. Among them, PBP3 mutations, shaping up β-lactam resistance, were noteworthy. A high selective pressure for mexZ mutations was evidenced, but we showed for the first time that high-level aminoglycoside resistance in CF is likely driven by mutations in fusA1/fusA2, coding for elongation factor G. Altogether, our results provide valuable information for understanding the evolution of the mutational resistome of CF P. aeruginosa.

Saccharomyces cerevisiae Msh2-Msh3 acts in repair of base-base mispairs.

PubMed

Harrington, Jill M; Kolodner, Richard D

2007-09-01

DNA mismatch repair is thought to act through two subpathways involving the recognition of base-base and insertion/deletion mispairs by the Msh2-Msh6 heterodimer and the recognition of insertion/deletion mispairs by the Msh2-Msh3 heterodimer. Here, through genetic and biochemical approaches, we describe a previously unidentified role of the Msh2-Msh3 heterodimer in the recognition of base-base mispairs and the suppression of homology-mediated duplication and deletion mutations. Saccharomyces cerevisiae msh3 mutants did not show an increase in the rate of base substitution mutations by the CAN1 forward mutation assay compared to the rate for the wild type but did show an altered spectrum of base substitution mutations, including an increased accumulation of base pair changes from GC to CG and from AT to TA; msh3 mutants also accumulated homology-mediated duplication and deletion mutations. The mutation spectrum of mlh3 mutants paralleled that of msh3 mutants, suggesting that the Mlh1-Mlh3 heterodimer may also play a role in the repair of base-base mispairs and in the suppression of homology-mediated duplication and deletion mutations. Mispair binding analysis with purified Msh2-Msh3 and DNA substrates derived from CAN1 sequences found to be mutated in vivo demonstrated that Msh2-Msh3 exhibited robust binding to specific base-base mispairs that was consistent with functional mispair binding.

Saccharomyces cerevisiae Msh2-Msh3 Acts in Repair of Base-Base Mispairs▿ †

PubMed Central

Harrington, Jill M.; Kolodner, Richard D.

2007-01-01

DNA mismatch repair is thought to act through two subpathways involving the recognition of base-base and insertion/deletion mispairs by the Msh2-Msh6 heterodimer and the recognition of insertion/deletion mispairs by the Msh2-Msh3 heterodimer. Here, through genetic and biochemical approaches, we describe a previously unidentified role of the Msh2-Msh3 heterodimer in the recognition of base-base mispairs and the suppression of homology-mediated duplication and deletion mutations. Saccharomyces cerevisiae msh3 mutants did not show an increase in the rate of base substitution mutations by the CAN1 forward mutation assay compared to the rate for the wild type but did show an altered spectrum of base substitution mutations, including an increased accumulation of base pair changes from GC to CG and from AT to TA; msh3 mutants also accumulated homology-mediated duplication and deletion mutations. The mutation spectrum of mlh3 mutants paralleled that of msh3 mutants, suggesting that the Mlh1-Mlh3 heterodimer may also play a role in the repair of base-base mispairs and in the suppression of homology-mediated duplication and deletion mutations. Mispair binding analysis with purified Msh2-Msh3 and DNA substrates derived from CAN1 sequences found to be mutated in vivo demonstrated that Msh2-Msh3 exhibited robust binding to specific base-base mispairs that was consistent with functional mispair binding. PMID:17636021

The de novo Q167K mutation in the POU1F1 gene leads to combined pituitary hormone deficiency in an Italian patient.

PubMed

Malvagia, Sabrina; Poggi, Giovanni Maria; Pasquini, Elisabetta; Donati, Maria Alice; Pela, Ivana; Morrone, Amelia; Zammarchi, Enrico

2003-11-01

The POU1F1 gene encodes a transcription factor that is important for the development and differentiation of the cells producing GH, prolactin, and TSH in the anterior pituitary gland. Patients with POU1F1 mutations show a combined pituitary hormone deficiency with low or absent levels of GH, prolactin, and TSH. Fourteen mutations have been reported in the POU1F1 gene up to now. These genetic lesions can be inherited either in an autosomal dominant or an autosomal recessive mode. We report on the first Italian patient, a girl, affected by combined pituitary hormone deficiency. The patient was found to be positive for congenital hypothyroidism (with low TSH levels) at neonatal screening. Substitutive therapy was started, but subsequent growth was very poor, although psychomotor development was substantially normal. Hospitalized at 10 mo she showed hypotonic crises, growth retardation, delayed bone age, and facial dysmorphism. In addition to congenital hypothyroidism, GH and prolactin deficiencies were found. Mutation DNA analysis of the patient's POU1F1 gene identified the novel Q167K amino acid change at the heterozygous level. The highly conserved Q167 residue is located in the POU-specific domain. No mutation was detected in the other allele. DNA analysis in the proband's parents did not identify this amino acid substitution, suggesting a de novo genetic lesion. From these data it can be hypothesized that the Q167K mutation has a dominant negative effect.

TERT, HRAS, and EIF1AX Mutations in a Patient with Follicular Adenoma.

PubMed

Topf, Michael C; Wang, Zi-Xuan; Tuluc, Madalina; Pribitkin, Edmund A

2018-06-01

Molecular markers are increasingly used as diagnostic tools in the management of thyroid nodules. There is a paucity of studies evaluating the prevalence of molecular markers in benign lesions. A 68-year-old woman with hypothyroidism presented with a right thyroid nodule, which was atypia of undetermined significance on cytology. The fine-needle aspirate of the nodule was examined with next-generation sequencing and found to harbor a C228T mutation in the TERT gene, a Q61R mutation in the HRAS gene, and an A113_splice mutation in the EIF1AX gene. Right thyroid lobectomy was performed, with final pathology showing follicular adenoma. All three mutations detected in the original fine-needle aspirate specimen were detected in the final surgical specimen as well. A rare case of TERT, HRAS, and EIF1AX mutations is reported in a patient with follicular adenoma. TERT promoter mutations may be an early genetic event in the molecular pathogenesis of follicular thyroid carcinoma.

ESCRT-III-Associated Protein ALIX Mediates High-Affinity Phosphate Transporter Trafficking to Maintain Phosphate Homeostasis in Arabidopsis

PubMed Central

Cardona-López, Ximena; Cuyas, Laura; Marín, Elena; Irigoyen, María Luisa; Gil, Erica; Puga, María Isabel; Bligny, Richard; Nussaume, Laurent; Geldner, Niko; Paz-Ares, Javier

2015-01-01

Prior to the release of their cargoes into the vacuolar lumen, sorting endosomes mature into multivesicular bodies (MVBs) through the action of ENDOSOMAL COMPLEX REQUIRED FOR TRANSPORT (ESCRT) protein complexes. MVB-mediated sorting of high-affinity phosphate transporters (PHT1) to the vacuole limits their plasma membrane levels under phosphate-sufficient conditions, a process that allows plants to maintain phosphate homeostasis. Here, we describe ALIX, a cytosolic protein that associates with MVB by interacting with ESCRT-III subunit SNF7 and mediates PHT1;1 trafficking to the vacuole in Arabidopsis thaliana. We show that the partial loss-of-function mutant alix-1 displays reduced vacuolar degradation of PHT1;1. ALIX derivatives containing the alix-1 mutation showed reduced interaction with SNF7, providing a simple molecular explanation for impaired cargo trafficking in alix-1 mutants. In fact, the alix-1 mutation also hampered vacuolar sorting of the brassinosteroid receptor BRI1. We also show that alix-1 displays altered vacuole morphogenesis, implying a new role for ALIX proteins in vacuolar biogenesis, likely acting as part of ESCRT-III complexes. In line with a presumed broad target spectrum, the alix-1 mutation is pleiotropic, leading to reduced plant growth and late flowering, with stronger alix mutations being lethal, indicating that ALIX participates in diverse processes in plants essential for their life. PMID:26342016

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaneko, Mika Kato; Molecular Tumor Marker Research Team, Global COE Program, Yamagata University Faculty of Medicine, 2-2-2 Iida-nishi, Yamagata 990-9585; Morita, Shunpei

Highlights: ► IDH1/2 mutations are early and frequent genetic alterations in gliomas. ► We established anti-mutated IDH2-specific mAbs KMab-1 and MMab-1. ► KMab-1 or MMab-1 specifically reacted with mutated IDH2 in ELISA. ► MMab-1 specifically stained IDH2-R172M-expressing CHO cells in ICC. ► MMab-1 specifically stained IDH2-R172M-expressing gliomas in IHC. - Abstract: Isocitrate dehydrogenase 1/2 (IDH1/2) mutations have been detected in gliomas, cartilaginous tumors, and leukemias. IDH1/2 mutations are early and frequent genetic alterations, are specific to a single codon in the conserved and functionally important Arginine 132 (R132) in IDH1 and Arginine 172 (R172) in IDH2. We previously established severalmore » monoclonal antibodies (mAbs), which are specific for IDH1 mutations: clones IMab-1 or HMab-1 against IDH1-R132H or clone SMab-1 against IDH1-R132S. However, specific mAbs against IDH2 mutations have not been reported. To establish IDH2-mutation-specific mAbs, we immunized mice or rats with each mutation-containing IDH2 peptides including IDH2-R172K and IDH2-R172M. After cell fusion, IDH2 mutation-specific mAbs were screened in Enzyme-Linked Immunosorbent Assay (ELISA). Established mAbs KMab-1 and MMab-1 reacted with the IDH2-R172K and IDH2-R172M peptides, respectively, but not with IDH2-wild type (WT) in ELISA. Western-blot analysis also showed that KMab-1 and MMab-1 reacted with the IDH2-R172K and IDH2-R172M recombinant proteins, respectively, not with IDH2-WT or other IDH2 mutants, indicating that KMab-1 and MMab-1 are IDH2-mutation-specific. Furthermore, MMab-1 specifically stained the IDH2-R172M-expressing cells in immunocytochemistry, but did not stain IDH2-WT and other IDH2-mutation-containing cells. In immunohistochemical analysis, MMab-1 specifically stained IDH2-R172M-expressing glioma. This is the first report to establish anti-IDH2-mutation-specific mAbs, which could be useful in diagnosis of mutation-bearing tumors.« less

FSensitive detection of mono- and polyclonal ESR1 mutations in primary tumors, metastatic lesions and cell free DNA of breast cancer patients

PubMed Central

Wang, Peilu; Bahreini, Amir; Gyanchandani, Rekha; Lucas, Peter C.; Hartmaier, Ryan J.; Watters, Rebecca J.; Jonnalagadda, Amruth R.; Trejo Bittar, Humberto E.; Berg, Aaron; Hamilton, Ronald L.; Kurland, Brenda F.; Weiss, Kurt R.; Mathew, Aju; Leone, Jose Pablo; Davidson, Nancy E; Nikiforova, Marina N.; Brufsky, Adam M.; Ambros, Tadeu F.; Stern, Andrew M.; Puhalla, Shannon L.; Lee, Adrian V.; Oesterreich, Steffi

2015-01-01

Purpose Given the clinical relevance of ESR1 mutations as potential drivers of resistance to endocrine therapy, this study used sensitive detection methods to determine the frequency of ESR1 mutations in primary and metastatic breast cancer, and in cell free DNA (cfDNA). Patients and Methods Six ESR1 mutations (K303R, S463P, Y537C, Y537N, Y537S, D538G) were assessed by digital droplet PCR (ddPCR), with lower limits of detection of 0.05% to 0.16%, in primary tumors (n=43), bone (n=12) and brain metastases (n=38), and cfDNA (n=29). Correlations between ESR1 mutations in metastatic lesions and single (1 patient) or serial blood draws (4 patients) were assessed. Results ESR1 mutations were detected for D538G (n=13), Y537S (n=3) and Y537C (n=1), and not for K303R, S463P or Y537N. Mutation rates were 7.0% (3/43 primary tumors), 9.1% (1/11 bone metastases), 12.5% (3/24 brain metastases), and 24.1% (7/29 cfDNA). Two patients showed polyclonal disease with more than one ESR1 mutation. Mutation allele frequencies were 0.07% to 0.2% in primary tumors, 1.4% in bone metastases, 34.3 to 44.9% in brain metastases, and 0.2% to 13.7% in cfDNA. In cases with both cfDNA and metastatic samples (n=5), mutations were detected in both (n=3) or in cfDNA only (n=2). Treatment was associated with changes in ESR1 mutation detection and allele frequency. Conclusions ESR1 mutations were detected at very low allele frequencies in some primary breast cancers, and at high allele frequency in metastases, suggesting that in some tumors rare ESR1 mutant clones are enriched by endocrine therapy. Further studies should address if sensitive detection of ESR1 mutations in primary breast cancer and in serial blood draws may be predictive for development of resistant disease. PMID:26500237

Sensitive Detection of Mono- and Polyclonal ESR1 Mutations in Primary Tumors, Metastatic Lesions, and Cell-Free DNA of Breast Cancer Patients.

PubMed

Wang, Peilu; Bahreini, Amir; Gyanchandani, Rekha; Lucas, Peter C; Hartmaier, Ryan J; Watters, Rebecca J; Jonnalagadda, Amruth R; Trejo Bittar, Humberto E; Berg, Aaron; Hamilton, Ronald L; Kurland, Brenda F; Weiss, Kurt R; Mathew, Aju; Leone, Jose Pablo; Davidson, Nancy E; Nikiforova, Marina N; Brufsky, Adam M; Ambros, Tadeu F; Stern, Andrew M; Puhalla, Shannon L; Lee, Adrian V; Oesterreich, Steffi

2016-03-01

Given the clinical relevance of ESR1 mutations as potential drivers of resistance to endocrine therapy, this study used sensitive detection methods to determine the frequency of ESR1 mutations in primary and metastatic breast cancer, and in cell-free DNA (cfDNA). Six ESR1 mutations (K303R, S463P, Y537C, Y537N, Y537S, D538G) were assessed by digital droplet PCR (ddPCR), with lower limits of detection of 0.05% to 0.16%, in primary tumors (n = 43), bone (n = 12) and brain metastases (n = 38), and cfDNA (n = 29). Correlations between ESR1 mutations in metastatic lesions and single (1 patient) or serial blood draws (4 patients) were assessed. ESR1 mutations were detected for D538G (n = 13), Y537S (n = 3), and Y537C (n = 1), and not for K303R, S463P, or Y537N. Mutation rates were 7.0% (3/43 primary tumors), 9.1% (1/11 bone metastases), 12.5% (3/24 brain metastases), and 24.1% (7/29 cfDNA). Two patients showed polyclonal disease with more than one ESR1 mutation. Mutation allele frequencies were 0.07% to 0.2% in primary tumors, 1.4% in bone metastases, 34.3% to 44.9% in brain metastases, and 0.2% to 13.7% in cfDNA. In cases with both cfDNA and metastatic samples (n = 5), mutations were detected in both (n = 3) or in cfDNA only (n = 2). Treatment was associated with changes in ESR1 mutation detection and allele frequency. ESR1 mutations were detected at very low allele frequencies in some primary breast cancers, and at high allele frequency in metastases, suggesting that in some tumors rare ESR1-mutant clones are enriched by endocrine therapy. Further studies should address whether sensitive detection of ESR1 mutations in primary breast cancer and in serial blood draws may be predictive for development of resistant disease. See related commentary by Gu and Fuqua, p. 1034. ©2015 American Association for Cancer Research.

Germline Mutations in BMPR1A/ALK3 Cause a Subset of Cases of Juvenile Polyposis Syndrome and of Cowden and Bannayan-Riley-Ruvalcaba Syndromes*

PubMed Central

Zhou, Xiao-Ping; Woodford-Richens, Kelly; Lehtonen, Rainer; Kurose, Keisuke; Aldred, Micheala; Hampel, Heather; Launonen, Virpi; Virta, Sanno; Pilarski, Robert; Salovaara, Reijo; Bodmer, Walter F.; Conrad, Beth A.; Dunlop, Malcolm; Hodgson, Shirley V.; Iwama, Takeo; Järvinen, Heikki; Kellokumpu, Ilmo; Kim, J. C.; Leggett, Barbara; Markie, David; Mecklin, Jukka-Pekka; Neale, Kay; Phillips, Robin; Piris, Juan; Rozen, Paul; Houlston, Richard S.; Aaltonen, Lauri A.; Tomlinson, Ian P. M.; Eng, Charis

2001-01-01

Juvenile polyposis syndrome (JPS) is an inherited hamartomatous-polyposis syndrome with a risk for colon cancer. JPS is a clinical diagnosis by exclusion, and, before susceptibility genes were identified, JPS could easily be confused with other inherited hamartoma syndromes, such as Bannayan-Riley-Ruvalcaba syndrome (BRRS) and Cowden syndrome (CS). Germline mutations of MADH4 (SMAD4) have been described in a variable number of probands with JPS. A series of familial and isolated European probands without MADH4 mutations were analyzed for germline mutations in BMPR1A, a member of the transforming growth-factor β–receptor superfamily, upstream from the SMAD pathway. Overall, 10 (38%) probands were found to have germline BMPR1A mutations, 8 of which resulted in truncated receptors and 2 of which resulted in missense alterations (C124R and C376Y). Almost all available component tumors from mutation-positive cases showed loss of heterozygosity (LOH) in the BMPR1A region, whereas those from mutation-negative cases did not. One proband with CS/CS-like phenotype was also found to have a germline BMPR1A missense mutation (A338D). Thus, germline BMPR1A mutations cause a significant proportion of cases of JPS and might define a small subset of cases of CS/BRRS with specific colonic phenotype. PMID:11536076

Gain-of-function mutations in SCN11A cause familial episodic pain.

PubMed

Zhang, Xiang Yang; Wen, Jingmin; Yang, Wei; Wang, Cheng; Gao, Luna; Zheng, Liang Hong; Wang, Tao; Ran, Kaikai; Li, Yulei; Li, Xiangyang; Xu, Ming; Luo, Junyu; Feng, Shenglei; Ma, Xixiang; Ma, Hongying; Chai, Zuying; Zhou, Zhuan; Yao, Jing; Zhang, Xue; Liu, Jing Yu

2013-11-07

Many ion channel genes have been associated with human genetic pain disorders. Here we report two large Chinese families with autosomal-dominant episodic pain. We performed a genome-wide linkage scan with microsatellite markers after excluding mutations in three known genes (SCN9A, SCN10A, and TRPA1) that cause similar pain syndrome to our findings, and we mapped the genetic locus to a 7.81 Mb region on chromosome 3p22.3-p21.32. By using whole-exome sequencing followed by conventional Sanger sequencing, we identified two missense mutations in the gene encoding voltage-gated sodium channel Nav1.9 (SCN11A): c.673C>T (p.Arg225Cys) and c.2423C>G (p.Ala808Gly) (one in each family). Each mutation showed a perfect cosegregation with the pain phenotype in the corresponding family, and neither of them was detected in 1,021 normal individuals. Both missense mutations were predicted to change a highly conserved amino acid residue of the human Nav1.9 channel. We expressed the two SCN11A mutants in mouse dorsal root ganglion (DRG) neurons and showed that both mutations enhanced the channel's electrical activities and induced hyperexcitablity of DRG neurons. Taken together, our results suggest that gain-of-function mutations in SCN11A can be causative of an autosomal-dominant episodic pain disorder. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

A de novo mutation in the AGXT gene causing primary hyperoxaluria type 1.

PubMed

Williams, Emma L; Kemper, Markus J; Rumsby, Gill

2006-09-01

Primary hyperoxaluria type 1 is caused by mutations in the alanine-glyoxylate aminotransferase (AGXT) gene. In cases in which no mutation was identified, linkage analysis can be used to confirm or exclude the diagnosis in other siblings. We present a family in which a sibling of the index case predicted to have primary hyperoxaluria type 1 by means of linkage analysis failed to show hyperoxaluria during the following 7 years, putting the diagnosis into question. Whole-gene sequence analysis identified 2 causative mutations in the index case, of which only 1, c.646A (Gly216Arg), was inherited. The other sequence change, c.33_34insC, was a de novo mutation occurring on the paternal allele. This particular mutation is a relatively common cause of primary hyperoxaluria type 1. It occurs in a run of 8 cytosines and therefore potentially is susceptible to polymerase slippage. This case illustrates 2 important points. First, biochemical confirmation of a genetic diagnosis should always be made in siblings diagnosed by using genetic tests. Second, de novo mutations should be considered as a potential, albeit rare, cause of primary hyperoxaluria type 1.

Inter- and intra-patient clonal and subclonal heterogeneity of chronic lymphocytic leukaemia: evidence from circulating and lymph nodal compartments

PubMed Central

Bonina, Silvia; Messina, Monica; Chiaretti, Sabina; Ilari, Caterina; Cafforio, Luciana; Raponi, Sara; Mauro, Francesca Romana; Di Maio, Valeria; De Propris, Maria Stefania; Nanni, Mauro; Ciardullo, Carmela; Rossi, Davide; Gaidano, Gianluca; Guarini, Anna; Rabadan, Raul; Foà, Robin

2015-01-01

Summary Whole exome sequencing and copy number aberration (CNA) analysis was performed on cells taken from peripheral blood (PB) and lymph nodes (LN) of patients with chronic lymphocytic leukaemia (CLL). Of 64 non-silent somatic mutations, 54 (84.4%) were clonal in both compartments, 3 (4.7%) were PB-specific and 7 (10.9%) were LN-specific. Most of the LN- or PB-specific mutations were subclonal in the other corresponding compartment (variant frequency 0.5-5.3%). Of 41 CNAs, 27 (65.8%) were shared by both compartments and 7 (17.1%) were LN- or PB-specific. Overall, 6 of 9 cases (66.7%) showed genomic differences between the compartments. At subsequent relapse, Case 10, with 6 LN-specific lesions, and Case 100, with 6 LN-specific and 8 PB-specific lesions, showed, in the PB, the clonal expansion of LN-derived lesions with an adverse impact: SF3B1 mutation, BIRC3 deletion, del8(p23.3-p11.1), del9(p24.3-p13.1) and gain 2(p25.3-p14). CLL shows an intra-patient clonal heterogeneity according to the disease compartment, with both LN and PB-specific mutations/CNAs. The LN microenvironment might contribute to the clonal selection of unfavourable lesions, as LN-derived mutations/CNAs can appear in the PB at relapse. PMID:26597680

Genetic Analysis of Japanese Children With Acute Recurrent and Chronic Pancreatitis.

PubMed

Saito, Nobutomo; Suzuki, Mitsuyoshi; Sakurai, Yumiko; Nakano, Satoshi; Naritaka, Nakayuki; Minowa, Kei; Sai, Jin K; Shimizu, Toshiaki

2016-10-01

Causes of acute recurrent pancreatitis (ARP) or chronic pancreatitis (CP) are sometimes difficult to determine in children. In such patients, genetic analysis may prove helpful. The present study analyzed mutations of cationic trypsinogen (PRSS1), serine protease inhibitor Kazal type 1 (SPINK1), chymotrypsin C (CTRC), and carboxypeptidase A1 (CPA1) and investigated the clinical features of children with these mutations. Genetic analyses of mutations in these 4 genes were conducted in 128 patients with ARP or CP. Characteristics of the patients showing mutations were investigated using medical records. Fifty of the 128 (39.1%) subjects had at least 1 mutation (median age at onset, 7.6 years). Abdominal pain was the presenting symptom of pancreatitis in 48 of the 50 patients (96%). Fifteen of those 50 patients (30.0%) had a family history of pancreatitis. Gene mutations were present in PRSS1 in 26 patients, SPINK1 in 23, CTRC in 3, and CPA1 in 5. In the 31 patients with mutations in SPINK1, CTRC, or CPA1, 16 (51.6%) had homozygous or heterozygous mutations with other mutations. Three patients underwent surgery and another 4 patients underwent endoscopy to manage ARP or CP. Although 3 of the 7 patients complained of mild abdominal pain, none of those 7 patients experienced any obvious episode of ARP after treatment. In pediatric patients with idiopathic ARP and CP, genetic analysis is useful for identifying the cause of pancreatitis. Early endoscopic or surgical treatment prevents ARP by extending the interval between episodes of pancreatitis in this population.

Loss-of-function CARD8 mutation causes NLRP3 inflammasome activation and Crohn's disease.

PubMed

Mao, Liming; Kitani, Atsushi; Similuk, Morgan; Oler, Andrew J; Albenberg, Lindsey; Kelsen, Judith; Aktay, Atiye; Quezado, Martha; Yao, Michael; Montgomery-Recht, Kim; Fuss, Ivan J; Strober, Warren

2018-05-01

In these studies, we evaluated the contribution of the NLRP3 inflammasome to Crohn's disease (CD) in a kindred containing individuals having a missense mutation in CARD8, a protein known to inhibit this inflammasome. Whole exome sequencing and PCR studies identified the affected individuals as having a V44I mutation in a single allele of the T60 isoform of CARD8. The serum levels of IL-1β in the affected individuals were increased compared with those in healthy controls, and their peripheral monocytes produced increased amounts of IL-1β when stimulated by NLRP3 activators. Immunoblot studies probing the basis of these findings showed that mutated T60 CARD8 failed to downregulate the NLRP3 inflammasome because it did not bind to NLRP3 and inhibit its oligomerization. In addition, these studies showed that mutated T60 CARD8 exerted a dominant-negative effect by its capacity to bind to and form oligomers with unmutated T60 or T48 CARD8 that impeded their binding to NLRP3. Finally, inflammasome activation studies revealed that intact but not mutated CARD8 prevented NLRP3 deubiquitination and serine dephosphorylation. CD due to a CARD8 mutation was not effectively treated by anti-TNF-α, but did respond to IL-1β inhibitors. Thus, patients with anti-TNF-α-resistant CD may respond to this treatment option.

Confirmation of the pathogenicity of a mutation p.G337C in the COL1A2 gene associated with osteogenesis imperfecta

PubMed Central

Jia, Mingrui; Shi, Ranran; Zhao, Xuli; Fu, Zhijian; Bai, Zhijing; Sun, Tao; Zhao, Xuejun; Wang, Wenbo; Xu, Chao; Yan, Fang

2017-01-01

Abstract Mutation analysis as the gold standard is particularly important in diagnosis of osteogenesis imperfecta (OI) and it may be preventable upon early diagnosis. In this study, we aimed to analyze the clinical and genetic materials of an OI pedigree as well as to confirm the deleterious property of the mutation. A pedigree with OI was identified. All family members received careful clinical examinations and blood was drawn for genetic analyses. Genes implicated in OI were screened for mutation. The function and structure of the mutant protein were predicted using bioinformatics analysis. The proband, a 9-month fetus, showed abnormal sonographic images. Disproportionately short and triangular face with blue sclera was noticed at birth. She can barely walk and suffered multiple fractures till 2-year old. Her mother appeared small stature, frequent fractures, blue sclera, and deformity of extremities. A heterozygous missense mutation c.1009G>T (p.G337C) in the COL1A2 gene was identified in her mother and her. Bioinformatics analysis showed p.G337 was well-conserved among multiple species and the mutation probably changed the structure and damaged the function of collagen. We suggest that the mutation p.G337C in the COL1A2 gene is pathogenic for OI by affecting the protein structure and the function of collagen. PMID:28953610

Arrestin gene mutations in autosomal recessive retinitis pigmentosa.

PubMed

Nakazawa, M; Wada, Y; Tamai, M

1998-04-01

To assess the clinical and molecular genetic studies of patients with autosomal recessive retinitis pigmentosa associated with a mutation in the arrestin gene. Results of molecular genetic screening and case reports with DNA analysis and clinical features. University medical center. One hundred twenty anamnestically unrelated patients with autosomal recessive retinitis pigmentosa. DNA analysis was performed by single strand conformation polymorphism followed by nucleotide sequencing to search for a mutation in exon 11 of the arrestin gene. Clinical features were characterized by visual acuity slitlamp biomicroscopy, fundus examinations, fluorescein angiography, kinetic visual field testing, and electroretinography. We identified 3 unrelated patients with retinitis pigmentosa associated with a homozygous 1-base-pair deletion mutation in codon 309 of the arrestin gene designated as 1147delA. All 3 patients showed pigmentary retinal degeneration in the midperipheral area with or without macular involvement. Patient 1 had a sibling with Oguchi disease associated with the same mutation. Patient 2 demonstrated pigmentary retinal degeneration associated with a golden-yellow reflex in the peripheral fundus. Patients 1 and 3 showed features of retinitis pigmentosa without the golden-yellow fundus reflex. Although the arrestin 1147delA has been known as a frequent cause of Oguchi disease, this mutation also may be related to the pathogenesis of autosomal recessive retinitis pigmentosa. This phenomenon may provide evidence of variable expressivity of the mutation in the arrestin gene.

CFTR allelic heterogeneity in Mexican patients with cystic fibrosis: implications for molecular screening.

PubMed

Chávez-Saldaña, Margarita; Yokoyama, Emiy; Lezana, José Luis; Carnevale, Alessandra; Macías, Miguel; Vigueras, Rosa M; López, Marisol; Orozco, Lorena

2010-01-01

Cystic fibrosis, the most common autosomal recessive disorder, is caused by defects in the CF transmembrane conductance regulator gene (CFTR) that encodes a chloride channel. To date, over 1,800 mutations have been described related to the causative gene of CF, showing a variable frequency among populations. In a previous extensive analysis of the CFTR locus in 97 Mexican patients, 34 different mutations (75% of CF alleles) were found using several strategies for mutation screening; however, 63% had at least an uncharacterized allele. Despite the combined technologies used, there are still a great number of unknown mutations in the Mexican population. Screening of the CFTR gene to provide additional evidence of the mutational wide spectrum responsible for CF in Mexican patients. In this study, the number of unrelated CF patients was increased to 230, 133 new cases and the 97 previously reported to include 63% with at least an uncharacterized allele. Additional tools were used to improve the detection rate of CF mutations, such as a commercial kit for 36 mutations plus a single chain conformational polymorphism method and DNA sequencing. By using a combination of these strategies we characterized 77.7% of all the CF alleles, resulting in a total of 46 different mutations detected, including the identification of 12 additional mutations (p.R334W, p.A455E, c.3120+1G > A, c.3272-26A > G, c.711+1G > T, p.Q552X, p.W1282X, c.IVS8-5T, p.R1162X and p.R347P, p.D1152H and p.T1036N). Although these 12 mutations have been reported in other populations, they have not yet been reported in Mexican patients. This report shows that Mexico has one of the widest spectra of CFTR mutations worldwide. The knowledge of the ethnic and geographic distribution of CFTR mutations in this population will allow the development of more effective methods for diagnosis and treatment.

Molecular analysis of mucopolysaccharidosis IVA: Common mutations and racial difference

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomatsu, S.; Hori, T.; Nakashima, Y.

1994-09-01

Mucopolysaccharidosis IVA (MPS IVA) is an autosomal recessive disorder caused by a deficiency in N-acetylgalactosamine -6-sulfate sulfatase (GALNS). Studies on the molecular basis of MPS IVA have been facilitated following cloning of the full-length cDNA and genomic DNA. In this study we detected mutations from 20 Caucasian and 19 Japanese MPS IVA patients using SSCP system and compared mutations of Caucasian origin with those of Japanese origin. The results showed the presence of 16 various mutations (3 small, deletions, 2 nonsense and 11 missense mutations) for Caucasian patients and 15 (1 deletion, 1 large alteration and 13 missense mutations) formore » Japanese. Moreover, two common mutations existed; one is double gene deletion characteristic for Japanese (6 alleles; 15%) and the other is a point mutation (1113F A{yields}T transition) characteristic for Caucasian (9 alleles; 22.5%). And the clear genotype/phenotype relationship among 1342delCA, IVS1(-2), P151S, Q148X, R386C, I113F, Q473X, W220G, P151L, A291T, R90W, and P77R, for a severe type, G96B N204K and V138A for a milder type, was observed. Only R386 mutation was seen in both of the populations. Further, the precise DNA analysis for double gene deletion of a common double gene deletion has been performed by defining the breakpoints and the results showed that one deletion was caused by homologous recombination due to Alu repetitive sequences and the other was due to nonhomologous recombination of short direct repeat. Haplotype analysis for six alleles with double deletion were different, indicating the different origin of this mutation or the frequent recombination events before a mutational event. Thus the mutations in GALNS gene are very heterogeneous and the racial difference is characteristic.« less

Visual impairment in FOXG1-mutated individuals and mice.

PubMed

Boggio, E M; Pancrazi, L; Gennaro, M; Lo Rizzo, C; Mari, F; Meloni, I; Ariani, F; Panighini, A; Novelli, E; Biagioni, M; Strettoi, E; Hayek, J; Rufa, A; Pizzorusso, T; Renieri, A; Costa, M

2016-06-02

The Forkead Box G1 (FOXG1 in humans, Foxg1 in mice) gene encodes for a DNA-binding transcription factor, essential for the development of the telencephalon in mammalian forebrain. Mutations in FOXG1 have been reported to be involved in the onset of Rett Syndrome, for which sequence alterations of MECP2 and CDKL5 are known. While visual alterations are not classical hallmarks of Rett syndrome, an increasing body of evidence shows visual impairment in patients and in MeCP2 and CDKL5 animal models. Herein we focused on the functional role of FOXG1 in the visual system of animal models (Foxg1(+/Cre) mice) and of a cohort of subjects carrying FOXG1 mutations or deletions. Visual physiology of Foxg1(+/Cre) mice was assessed by visually evoked potentials, which revealed a significant reduction in response amplitude and visual acuity with respect to wild-type littermates. Morphological investigation showed abnormalities in the organization of excitatory/inhibitory circuits in the visual cortex. No alterations were observed in retinal structure. By examining a cohort of FOXG1-mutated individuals with a panel of neuro-ophthalmological assessments, we found that all of them exhibited visual alterations compatible with high-level visual dysfunctions. In conclusion our data show that Foxg1 haploinsufficiency results in an impairment of mouse and human visual cortical function. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boustany, R.M.; Qian, W.H.; Suzuki, K.

The authors describe four new mutations in the [beta]-galactosidase gene. These are the first mutations causing infantile and juvenile GM[sub 1]-gangliosidosis to be described in American patients. Cell lines from two patients with juvenile and from six patients with infantile GM[sub 1]-gangliosidosis were analyzed. Northern blot analysis showed the acid [beta]-galactosidase message to be of normal size and quantity in two juvenile and four infantile cases and of normal size but reduced quantity in two infantile cases. The mutations are distinct from the Japanese mutations. All are point mutations leading to amino acid substitutions: Lys[sup 577] [yields] Arg, Arg[sup 590]more » [yields] His, and Glu[sup 632] [yields] Gly. The fourth mutation, Arg[sup 208] [yields] Cys, accounts for 10 of 16 possible alleles. Two infantile cases from Puerto Rico of Spanish ancestry are homozygous for this mutation, suggesting that this allele may have come to South America and North America via Puerto Rico. That these mutations cause clinical disease was confirmed by marked reduction in catalytic activity of the mutant proteins in the Cos-1 cell expression system. 12 refs., 5 figs., 2 tabs.« less

HSJ1-related hereditary neuropathies: novel mutations and extended clinical spectrum.

PubMed

Gess, Burkhard; Auer-Grumbach, Michaela; Schirmacher, Anja; Strom, Tim; Zitzelsberger, Manuela; Rudnik-Schöneborn, Sabine; Röhr, Dominik; Halfter, Hartmut; Young, Peter; Senderek, Jan

2014-11-04

To determine the nature and frequency of HSJ1 mutations in patients with hereditary motor and hereditary motor and sensory neuropathies. Patients were screened for mutations by genome-wide or targeted linkage and homozygosity studies, whole-exome sequencing, and Sanger sequencing. RNA and protein studies of skin fibroblasts were used for functional characterization. We describe 2 additional mutations in the HSJ1 gene in a cohort of 90 patients with autosomal recessive distal hereditary motor neuropathy (dHMN) and Charcot-Marie-Tooth disease type 2 (CMT2). One family with a dHMN phenotype showed the homozygous splice-site mutation c.229+1G>A, which leads to retention of intron 4 in the HSJ1 messenger RNA with a premature stop codon and loss of protein expression. Another family, presenting with a CMT2 phenotype, carried the homozygous missense mutation c.14A>G (p.Tyr5Cys). This mutation was classified as likely disease-related by several automatic algorithms for prediction of possible impact of an amino acid substitution on the structure and function of proteins. Both mutations cosegregated with autosomal recessive inheritance of the disease and were absent from the general population. Taken together, in our cohort of 90 probands, we confirm that HSJ1 mutations are a rare but detectable cause of autosomal recessive dHMN and CMT2. We provide clinical and functional information on an HSJ1 splice-site mutation and report the detailed phenotype of 2 patients with CMT2, broadening the phenotypic spectrum of HSJ1-related neuropathies. © 2014 American Academy of Neurology.

A calcium-sensing receptor mutation causing hypocalcemia disrupts a transmembrane salt bridge to activate β-arrestin-biased signaling.

PubMed

Gorvin, Caroline M; Babinsky, Valerie N; Malinauskas, Tomas; Nissen, Peter H; Schou, Anders J; Hanyaloglu, Aylin C; Siebold, Christian; Jones, E Yvonne; Hannan, Fadil M; Thakker, Rajesh V

2018-02-20

The calcium-sensing receptor (CaSR) is a G protein-coupled receptor (GPCR) that signals through G q/11 and G i/o to stimulate cytosolic calcium (Ca 2+ i ) and mitogen-activated protein kinase (MAPK) signaling to control extracellular calcium homeostasis. Studies of loss- and gain-of-function CASR mutations, which cause familial hypocalciuric hypercalcemia type 1 (FHH1) and autosomal dominant hypocalcemia type 1 (ADH1), respectively, have revealed that the CaSR signals in a biased manner. Thus, some mutations associated with FHH1 lead to signaling predominantly through the MAPK pathway, whereas mutations associated with ADH1 preferentially enhance Ca 2+ i responses. We report a previously unidentified ADH1-associated R680G CaSR mutation, which led to the identification of a CaSR structural motif that mediates biased signaling. Expressing CaSR R680G in HEK 293 cells showed that this mutation increased MAPK signaling without altering Ca 2+ i responses. Moreover, this gain of function in MAPK activity occurred independently of G q/11 and G i/o and was mediated instead by a noncanonical pathway involving β-arrestin proteins. Homology modeling and mutagenesis studies showed that the R680G CaSR mutation selectively enhanced β-arrestin signaling by disrupting a salt bridge formed between Arg 680 and Glu 767 , which are located in CaSR transmembrane domain 3 and extracellular loop 2, respectively. Thus, our results demonstrate CaSR signaling through β-arrestin and the importance of the Arg 680 -Glu 767 salt bridge in mediating signaling bias. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Mutanlallemand (mtl) and Belly Spot and Deafness (bsd) Are Two New Mutations of Lmx1a Causing Severe Cochlear and Vestibular Defects

PubMed Central

Pearson, Selina; Brooker, Rachael H.; Spiden, Sarah; Kiernan, Amy E.; Guénet, Jean-Louis; Steel, Karen P.

2012-01-01

Mutanlallemand (mtl) and Belly Spot and Deafness (bsd) are two new spontaneous alleles of the Lmx1a gene in mice. Homozygous mutants show head tossing and circling behaviour, indicative of vestibular defects, and they have short tails and white belly patches of variable size. The analysis of auditory brainstem responses (ABR) showed that mtl and bsd homozygotes are deaf, whereas heterozygous and wildtype littermates have normal hearing. Paint-filled inner ears at E16.5 revealed that mtl and bsd homozygotes lack endolymphatic ducts and semicircular canals and have short cochlear ducts. These new alleles show similarities with dreher (Lmx1a) mutants. Complementation tests between mtl and dreher and between mtl and bsd suggest that mtl and bsd are new mutant alleles of the Lmx1a gene. To determine the Lmx1a mutation in mtl and bsd mutant mice we performed PCR followed by sequencing of genomic DNA and cDNA. The mtl mutation is a single point mutation in the 3′ splice site of exon 4 leading to an exon extension and the activation of a cryptic splice site 44 base pairs downstream, whereas the bsd mutation is a genomic deletion that includes exon 3. Both mutations lead to a truncated LMX1A protein affecting the homeodomain (mtl) or LIM2-domain (bsd), which is critical for LMX1A protein function. Moreover, the levels of Lmx1a transcript in mtl and bsd mutants are significantly down-regulated. Hmx2/3 and Pax2 expression are also down-regulated in mtl and bsd mutants, suggesting a role of Lmx1a upstream of these transcription factors in early inner ear morphogenesis. We have found that these mutants develop sensory patches although they are misshapen. The characterization of these two new Lmx1a alleles highlights the critical role of this gene in the development of the cochlea and vestibular system. PMID:23226461

Identification of the Pr1 gene product completes the anthocyanin biosynthesis pathway of maize

USDA-ARS?s Scientific Manuscript database

In maize, mutations in the pr1 locus lead to the accumulation of pelargonidin (red) rather than cyanidin (purple) pigments in aleurone cells where the anthocyanin biosynthetic pathway is active. We characterized pr1 mutation and isolated a putative F3'H encoding gene (Zmf3'h1), and showed by segrega...

Germline mutations affecting the proofreading domains of POLE and POLD1 predispose to colorectal adenomas and carcinomas.

PubMed

Palles, Claire; Cazier, Jean-Baptiste; Howarth, Kimberley M; Domingo, Enric; Jones, Angela M; Broderick, Peter; Kemp, Zoe; Spain, Sarah L; Guarino, Estrella; Guarino Almeida, Estrella; Salguero, Israel; Sherborne, Amy; Chubb, Daniel; Carvajal-Carmona, Luis G; Ma, Yusanne; Kaur, Kulvinder; Dobbins, Sara; Barclay, Ella; Gorman, Maggie; Martin, Lynn; Kovac, Michal B; Humphray, Sean; Lucassen, Anneke; Holmes, Christopher C; Bentley, David; Donnelly, Peter; Taylor, Jenny; Petridis, Christos; Roylance, Rebecca; Sawyer, Elinor J; Kerr, David J; Clark, Susan; Grimes, Jonathan; Kearsey, Stephen E; Thomas, Huw J W; McVean, Gilean; Houlston, Richard S; Tomlinson, Ian

2013-02-01

Many individuals with multiple or large colorectal adenomas or early-onset colorectal cancer (CRC) have no detectable germline mutations in the known cancer predisposition genes. Using whole-genome sequencing, supplemented by linkage and association analysis, we identified specific heterozygous POLE or POLD1 germline variants in several multiple-adenoma and/or CRC cases but in no controls. The variants associated with susceptibility, POLE p.Leu424Val and POLD1 p.Ser478Asn, have high penetrance, and POLD1 mutation was also associated with endometrial cancer predisposition. The mutations map to equivalent sites in the proofreading (exonuclease) domain of DNA polymerases ɛ and δ and are predicted to cause a defect in the correction of mispaired bases inserted during DNA replication. In agreement with this prediction, the tumors from mutation carriers were microsatellite stable but tended to acquire base substitution mutations, as confirmed by yeast functional assays. Further analysis of published data showed that the recently described group of hypermutant, microsatellite-stable CRCs is likely to be caused by somatic POLE mutations affecting the exonuclease domain.

Clinical features of X linked juvenile retinoschisis associated with new mutations in the XLRS1 gene in Italian families

PubMed Central

Simonelli, F; Cennamo, G; Ziviello, C; Testa, F; de Crecchio, G; Nesti, A; Manitto, M P; Ciccodicola, A; Banfi, S; Brancato, R; Rinaldi, E

2003-01-01

Aims: To describe the clinical phenotype of X linked juvenile retinoschisis in eight Italian families with six different mutations in the XLRS1 gene. Methods: Complete ophthalmic examinations, electroretinography and A and B-scan standardised echography were performed in 18 affected males. The coding sequences of the XLRS1 gene were amplified by polymerase chain reaction and directly sequenced on an automated sequencer. Results: Six different XLRS1 mutations were identified; two of these mutations Ile81Asn and the Trp122Cys, have not been previously described. The affected males showed an electronegative response to the standard white scotopic stimulus and a prolonged implicit time of the 30 Hz flicker. In the families with Trp112Cys and Trp122Cys mutations we observed a more severe retinoschisis (RS) clinical picture compared with the other genotypes. Conclusion: The severe RS phenotypes associated with Trp112Cys and to Trp122Cys mutations suggest that these mutations determine a notable alteration in the function of the retinoschisin protein. PMID:12928282

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yuchi, Zhiguang; Lau, Kelvin; Van Petegem, Filip

Ryanodine Receptors (RyRs) are huge Ca{sup 2+} release channels in the endoplasmic reticulum membrane and form targets for phosphorylation and disease mutations. We present crystal structures of a domain in three RyR isoforms, containing the Ser2843 (RyR1) and Ser2808/Ser2814 (RyR2) phosphorylation sites. The RyR1 domain is the target for 11 disease mutations. Several of these are clustered near the phosphorylation sites, suggesting that phosphorylation and disease mutations may affect the same interface. The L2867G mutation causes a drastic thermal destabilization and aggregation at room temperature. Crystal structures for other disease mutants show that they affect surface properties and intradomain saltmore » bridges. In vitro phosphorylation experiments show that up to five residues in one long loop of RyR2 can be phosphorylated by PKA or CaMKII. Docking into cryo-electron microscopy maps suggests a putative location in the clamp region, implying that mutations and phosphorylation may affect the allosteric motions within this area.« less

Mutations in ORC1, encoding the largest subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome.

PubMed

Bicknell, Louise S; Walker, Sarah; Klingseisen, Anna; Stiff, Tom; Leitch, Andrea; Kerzendorfer, Claudia; Martin, Carol-Anne; Yeyati, Patricia; Al Sanna, Nouriya; Bober, Michael; Johnson, Diana; Wise, Carol; Jackson, Andrew P; O'Driscoll, Mark; Jeggo, Penny A

2011-02-27

Studies into disorders of extreme growth failure (for example, Seckel syndrome and Majewski osteodysplastic primordial dwarfism type II) have implicated fundamental cellular processes of DNA damage response signaling and centrosome function in the regulation of human growth. Here we report that mutations in ORC1, encoding a subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome. We establish that these mutations disrupt known ORC1 functions including pre-replicative complex formation and origin activation. ORC1 deficiency perturbs S-phase entry and S-phase progression. Additionally, we show that Orc1 depletion in zebrafish is sufficient to markedly reduce body size during rapid embryonic growth. Our data suggest a model in which ORC1 mutations impair replication licensing, slowing cell cycle progression and consequently impeding growth during development, particularly at times of rapid proliferation. These findings establish a novel mechanism for the pathogenesis of microcephalic dwarfism and show a surprising but important developmental impact of impaired origin licensing.

New mutations affecting induced mutagenesis in yeast.

PubMed

Lawrence, C W; Krauss, B R; Christensen, R B

1985-01-01

Previously isolated mutations in baker's yeast, Saccharomyces cerevisiae, that impair induced mutagenesis were all identified with the aid of tests that either exclusively or predominantly detect base-pair substitutions. To avoid this bias, we have screened 11 366 potentially mutant clones for UV-induced reversion of the frameshift allele, his4-38, and have identified 10 mutants that give much reduced yields of revertants. Complementation and recombination tests show that 6 of these carry mutations at the previously known REV1, REV1 and REV3 loci, while the remaining 4 define 3 new genes, REV4 (2 mutations), REV5 and REV6. The rev4 mutations are readily suppressed in many genetic backgrounds and, like the rev5 mutation, impart only a limited deficiency for induced mutagenesis: it is likely, therefore that the REV4+ and REV5+ gene functions are only remotely concerned with this process. The rev6 mutants have a more general deficiency, however, as well as marked sensitivity to UV and an increased spontaneous mutation rate, properties that suggest the REV6 gene is directly involved in mutation induction. The REV5 gene is located about 1 cM proximal to CYC1 on chromosome X.

The use of Imatinib resistance mutation analysis to direct therapy in Philadelphia chromosome/BCR-ABL1 positive chronic myeloid leukaemia patients failing Imatinib treatment, in Patan Hospital, Nepal.

PubMed

Kayastha, Gyan K; Ranjitkar, Nora; Gurung, Radha; Kc, Raj Kumar; Karki, Sanjit; Shrestha, Roshan; Rajbhandari, Piyush; Thapa, Raj K; Poudyal, Buddhi; Acharya, Paras; Roberts, David J; Hayes, Bruce; Zimmerman, Mark; Basnyat, Buddha

2017-06-01

Philadelphia chromosome/BCR-ABL1 positive chronic myeloid leukaemia (CML) can be successfully treated with Glivec (Imatinib), which is available free of cost through the Glivec International Patient Assistance programme (GIPAP) to patients with proven CML without means to pay for the drug. We review the acquired mutations in the tyrosine kinase encoded by the BCR-ABL1 gene underlying Glivec failure or resistance in a cohort of 388 imatinib-treated CML patients (149 Female and 239 male) registered between February 2003 and June 2016 in Nepal. Forty-five patients (11 female 34 male) were studied; 18 different BCR-ABL1 mutations were seen in 33 patients. P-loop mutation, Kinase domain and A-loop mutations were seen in 9, 16 and 4 patients respectively. Other mutations were seen in five patients. A T315I mutation was the most common mutation, followed by F359V and M244V. Sixteen mutations showed intermediate activity to complete resistance to Glivec. Among the 45 patients evaluated for BCR-ABL1 mutations, 4 were lost to follow-up, 14 died and 27 are still alive. Among the surviving patients, 16 are receiving Nilotinib, 5 Dasatinib and 3 Ponatinib, while 3 patients were referred to India, one of who received allogenic bone marrow transplantation. Understanding the spectrum of further acquired mutations in BCR-ABL1 may help to choose more specific targeted tyrosine kinase inhibitors that can be provided by GIPAP. © 2017 John Wiley & Sons Ltd.

U2AF1 mutations alter splice site recognition in hematological malignancies.

PubMed

Ilagan, Janine O; Ramakrishnan, Aravind; Hayes, Brian; Murphy, Michele E; Zebari, Ahmad S; Bradley, Philip; Bradley, Robert K

2015-01-01

Whole-exome sequencing studies have identified common mutations affecting genes encoding components of the RNA splicing machinery in hematological malignancies. Here, we sought to determine how mutations affecting the 3' splice site recognition factor U2AF1 alter its normal role in RNA splicing. We find that U2AF1 mutations influence the similarity of splicing programs in leukemias, but do not give rise to widespread splicing failure. U2AF1 mutations cause differential splicing of hundreds of genes, affecting biological pathways such as DNA methylation (DNMT3B), X chromosome inactivation (H2AFY), the DNA damage response (ATR, FANCA), and apoptosis (CASP8). We show that U2AF1 mutations alter the preferred 3' splice site motif in patients, in cell culture, and in vitro. Mutations affecting the first and second zinc fingers give rise to different alterations in splice site preference and largely distinct downstream splicing programs. These allele-specific effects are consistent with a computationally predicted model of U2AF1 in complex with RNA. Our findings suggest that U2AF1 mutations contribute to pathogenesis by causing quantitative changes in splicing that affect diverse cellular pathways, and give insight into the normal function of U2AF1's zinc finger domains. © 2015 Ilagan et al.; Published by Cold Spring Harbor Laboratory Press.

Sequestration of Mutated α1-Antitrypsin into Inclusion Bodies Is a Cell-protective Mechanism to Maintain Endoplasmic Reticulum Function

PubMed Central

Granell, Susana; Baldini, Giovanna; Mohammad, Sameer; Nicolin, Vanessa; Narducci, Paola; Storrie, Brian

2008-01-01

A variant α1-antitrypsin with E342K mutation has a high tendency to form intracellular polymers, and it is associated with liver disease. In the hepatocytes of individuals carrying the mutation, α1-antitrypsin localizes both to the endoplasmic reticulum (ER) and to membrane-surrounded inclusion bodies (IBs). It is unclear whether the IBs contribute to cell toxicity or whether they are protective to the cell. We found that in hepatoma cells, mutated α1-antitrypsin exited the ER and accumulated in IBs that were negative for autophagosomal and lysosomal markers, and contained several ER components, but not calnexin. Mutated α1-antitrypsin induced IBs also in neuroendocrine cells, showing that formation of these organelles is not cell type specific. In the presence of IBs, ER function was largely maintained. Increased levels of calnexin, but not of protein disulfide isomerase, inhibited formation of IBs and lead to retention of mutated α1-antitrypsin in the ER. In hepatoma cells, shift of mutated α1-antitrypsin localization to the ER by calnexin overexpression lead to cell shrinkage, ER stress, and impairment of the secretory pathway at the ER level. We conclude that segregation of mutated α1-antitrypsin from the ER to the IBs is a protective cell response to maintain a functional secretory pathway. PMID:18045994

Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

PubMed

Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

2014-01-01

The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

[Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

PubMed

Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

2014-10-18

To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in the different subtype have the similar clinical manifestations, signs, enzyme detection and electromyography changes. Muscle biopsy plays an important role in the selection of genes to be detected. Hot spot mutation in C-terminal of the RYR1 gene can only be identified in patients with central core disease, so we suggest this hot spot gene mutation screening apply to the suspicious patient with central core disease only.

p53 mutation and expression in lymphoma.

PubMed Central

Adamson, D. J.; Thompson, W. D.; Dawson, A. A.; Bennett, B.; Haites, N. E.

1995-01-01

Mutation and abnormal expression of p53 was studied in 38 lymphomas [five Hodgkin's disease and 33 non-Hodgkin's lymphoma (NHL)]. CM1 polyclonal antibody was used to detect overexpression of p53. Three missense mutations were characterised in three cases of NHL after screening exons 5-8 of p53 of all the tumours with single-strand conformation polymorphism (SSCP) analysis. Only two out of three tumours with a missense mutation showed abnormal expression of p53 as measured by CM1. Conversely, seven out of nine tumours with positive CM1 staining had no point mutation demonstrated. Overexpression of p53 in the cases of NHL occurred in three out of twenty four low-grade tumours and five out of nine high-grade tumours (Kiel classification). The results suggest that abnormalities of p53 are commoner in high-grade than low-grade NHL, and that positive immunocytochemistry cannot be used to determine which tumours have mutations of p53. Images Figure 1 Figure 2 PMID:7599045

Loss of the tumor suppressor BAP1 causes myeloid transformation

PubMed Central

Dey, Anwesha; Seshasayee, Dhaya; Noubade, Rajkumar; French, Dorothy M.; Liu, Jinfeng; Chaurushiya, Mira S.; Kirkpatrick, Donald S.; Pham, Victoria C.; Lill, Jennie R.; Bakalarski, Corey E.; Wu, Jiansheng; Phu, Lilian; Katavolos, Paula; Saunders, Lindsay M.; Abdel-Wahab, Omar; Modrusan, Zora; Seshagiri, Somasekar; Dong, Ken; Lin, Zhonghua; Balazs, Mercedesz; Suriben, Rowena; Newton, Kim; Hymowitz, Sarah; Garcia-Manero, Guillermo; Martin, Flavius; Levine, Ross L.; Dixit, Vishva M.

2016-01-01

Deubiquitinating enzyme BAP1 is mutated in a hereditary cancer syndrome with increased risk of mesothelioma and uveal melanoma. Somatic BAP1 mutations occur in various malignancies. We show that mouse Bap1 gene deletion is lethal during embryogenesis, but systemic or hematopoietic-restricted deletion in adults recapitulates features of human myelodysplastic syndrome (MDS). Knock-in mice expressing BAP1 with a 3xFlag tag revealed that BAP1 interacts with HCF-1, OGT, and the polycomb group proteins ASXL1 and ASXL2 in vivo. OGT and HCF-1 levels were decreased by Bap1 deletion, indicating a critical role for BAP1 in stabilizing these epigenetic regulators. Human ASXL1 is mutated frequently in chronic myelomonocytic leukemia (CMML) so an ASXL/BAP1 complex may suppress CMML. A novel BAP1 catalytic mutation found in a MDS patient implies that BAP1 loss of function has similar consequences in mouse and man. PMID:22878500

High-risk long QT syndrome mutations in the Kv7.1 (KCNQ1) pore disrupt the molecular basis for rapid K(+) permeation.

PubMed

Burgess, Don E; Bartos, Daniel C; Reloj, Allison R; Campbell, Kenneth S; Johnson, Jonathan N; Tester, David J; Ackerman, Michael J; Fressart, Véronique; Denjoy, Isabelle; Guicheney, Pascale; Moss, Arthur J; Ohno, Seiko; Horie, Minoru; Delisle, Brian P

2012-11-13

Type 1 long QT syndrome (LQT1) is caused by loss-of-function mutations in the KCNQ1 gene, which encodes the K(+) channel (Kv7.1) that underlies the slowly activating delayed rectifier K(+) current in the heart. Intragenic risk stratification suggests LQT1 mutations that disrupt conserved amino acid residues in the pore are an independent risk factor for LQT1-related cardiac events. The purpose of this study is to determine possible molecular mechanisms that underlie the loss of function for these high-risk mutations. Extensive genotype-phenotype analyses of LQT1 patients showed that T322M-, T322A-, or G325R-Kv7.1 confers a high risk for LQT1-related cardiac events. Heterologous expression of these mutations with KCNE1 revealed they generated nonfunctional channels and caused dominant negative suppression of WT-Kv7.1 current. Molecular dynamics simulations of analogous mutations in KcsA (T85M-, T85A-, and G88R-KcsA) demonstrated that they disrupted the symmetrical distribution of the carbonyl oxygen atoms in the selectivity filter, which upset the balance between the strong attractive and K(+)-K(+) repulsive forces required for rapid K(+) permeation. We conclude high-risk LQT1 mutations in the pore likely disrupt the architectural and physical properties of the K(+) channel selectivity filter.

Genetic analysis of rice mutants responsible for narrow leaf phenotype and reduced vein number.

PubMed

Kubo, Fumika Clara; Yasui, Yukiko; Kumamaru, Toshihiro; Sato, Yutaka; Hirano, Hiro-Yuki

2017-03-17

Leaves are a major site for photosynthesis and a key determinant of plant architecture. Rice produces thin and slender leaves, which consist of the leaf blade and leaf sheath separated by the lamina joint. Two types of vasculature, the large and small vascular bundles, run in parallel, together with a strong structure, the midrib. In this paper, we examined the function of four genes that regulate the width of the leaf blade and the vein number: NARROW LEAF1 (NAL1), NAL2, NAL3 and NAL7. We backcrossed original mutants of these genes with the standard wild-type rice, Taichung 65. We then compared the effect of each mutation on similar genetic backgrounds and examined genetic interactions of these genes. The nal1 single mutation and the nal2 nal3 double mutation showed a severe effect on leaf width, resulting in very narrow leaves. Although vein number was also reduced in the nal1 and nal2 nal3 mutants, the small vein number was more strongly reduced than the large vein number. In contrast, the nal7 mutation showed a milder effect on leaf width and vein number, and both the large and small veins were similarly affected. Thus, the genes responsible for narrow leaf phenotype seem to play distinct roles. The nal7 mutation showed additive effects on both leaf width and vein number, when combined with the nal1 single or the nal2 nal3 double mutation. In addition, observations of inner tissues revealed that cell differentiation was partially compromised in the nal2 nal3 nal7 mutant, consistent with the severe reduction in leaf width in this triple mutant.

Potential Use of a Weak Ethylene Receptor Mutant, Sletr1-2, as Breeding Material To Extend Fruit Shelf Life of Tomato.

PubMed

Mubarok, Syariful; Okabe, Yoshihiro; Fukuda, Naoya; Ariizumi, Tohru; Ezura, Hiroshi

2015-09-16

Mutations in the ethylene receptor gene (SlETR1), Sletr1-1 and Sletr1-2, are effective in reducing ethylene sensitivity and improving fruit shelf life. In this study the effect of Sletr1-1 and Sletr1-2 mutations was investigated in F1 hybrid lines. These two mutants and control were crossed with four commercial pure-line tomatoes. The Sletr1-1 mutation showed undesirable pleiotropic effects in the F1 hybrid lines. The Sletr1-2 mutation was effective in improving fruit shelf life of F1 hybrid lines for 4-5 days longer. It was also effective in improving fruit firmness without change in fruit size, ethylene production, respiration rate, and total soluble solids or a great reduction in fruit color, lycopene, and β-carotene, although the titratable acidity was increased by Sletr1-2 mutation. These results indicate that the Sletr1-2 mutant allele has the potential to improve fruit shelf life via incorporation in tomato breeding programs.

A Mutation in the Rett Syndrome Gene, MECP2, Causes X-Linked Mental Retardation and Progressive Spasticity in Males

PubMed Central

Meloni, Ilaria; Bruttini, Mirella; Longo, Ilaria; Mari, Francesca; Rizzolio, Flavio; D’Adamo, Patrizia; Denvriendt, Koenraad; Fryns, Jean-Pierre; Toniolo, Daniela; Renieri, Alessandra

2000-01-01

Heterozygous mutations in the X-linked MECP2 gene cause Rett syndrome, a severe neurodevelopmental disorder of young females. Only one male presenting an MECP2 mutation has been reported; he survived only to age 1 year, suggesting that mutations in MECP2 are male lethal. Here we report a three-generation family in which two affected males showed severe mental retardation and progressive spasticity, previously mapped in Xq27.2-qter. Two obligate carrier females showed either normal or borderline intelligence, simulating an X-linked recessive trait. The two males and the two obligate carrier females presented a mutation in the MECP2 gene, demonstrating that, in males, MECP2 can be responsible for severe mental retardation associated with neurological disorders. PMID:10986043

Identification of proteins that interact with TANK binding kinase 1 and testing for mutations associated with glaucoma.

PubMed

Seo, Seongjin; Solivan-Timpe, Frances; Roos, Ben R; Robin, Alan L; Stone, Edwin M; Kwon, Young H; Alward, Wallace L M; Fingert, John H

2013-02-01

Copy number variations (duplications) of TANK binding kinase 1 (TBK1) have been associated with normal tension glaucoma (NTG), a common cause of blindness worldwide. Mutations in other genes involved in autophagy (TLR4 and OPTN) have been associated with NTG. Here we report searching for additional proteins involved in autophagy that may also have roles in NTG. HEK-293T cells were transfected to produce synthetic TBK1 protein with FLAG and S tags. Proteins that associate with TBK1 were isolated from HEK-293T lysates using tandem affinity purification (TAP) and polyacrylamide gel electrophoresis (PAGE). Isolated proteins were identified with mass spectrometry. A cohort of 148 NTG patients and 77 controls from Iowa were tested for glaucoma-causing mutations in genes that encode identified proteins that interact with TBK1 using high resolution melt (HRM) analysis and DNA sequencing. TAP studies show that three proteins expressed in HEK-293T cells (NAP1, TANK and TBKBP1) interact with TBK1. Testing cohorts of NTG and normal controls for disease-causing mutations in TANK, identified a total of nine unique variants including three non-synonymous changes, one synonymous changes and five intronic changes. When analyzed alone or as a group, the non-synonymous TBK1 coding sequence changes were not associated with either NTG or primary open angle glaucoma. TAP showed that NAP1, TANK and TBKBP1 interact with TBK1 and are good candidates for contributing to NTG. A mutation screen of TANK detected three non-synonymous variants. Although, it remains possible that one or more of these TANK mutations may have a role in NTG, the data in this report do not provide statistical support for an association between TANK variants and NTG.

FGFR2 Point Mutations in 466 Endometrioid Endometrial Tumors: Relationship with MSI, KRAS, PIK3CA, CTNNB1 Mutations and Clinicopathological Features

PubMed Central

Powell, Matthew A.; Wellens, Candice L.; Gao, Feng; Mutch, David G.; Goodfellow, Paul J.; Pollock, Pamela M.

2012-01-01

Mutations in multiple oncogenes including KRAS, CTNNB1, PIK3CA and FGFR2 have been identified in endometrial cancer. The aim of this study was to provide insight into the clinicopathological features associated with patterns of mutation in these genes, a necessary step in planning targeted therapies for endometrial cancer. 466 endometrioid endometrial tumors were tested for mutations in FGFR2, KRAS, CTNNB1, and PIK3CA. The relationships between mutation status, tumor microsatellite instability (MSI) and clinicopathological features including overall survival (OS) and disease-free survival (DFS) were evaluated using Kaplan-Meier survival analysis and Cox proportional hazard models. Mutations were identified in FGFR2 (48/466); KRAS (87/464); CTNNB1 (88/454) and PIK3CA (104/464). KRAS and FGFR2 mutations were significantly more common, and CTNNB1 mutations less common, in MSI positive tumors. KRAS and FGFR2 occurred in a near mutually exclusive pattern (p = 0.05) and, surprisingly, mutations in KRAS and CTNNB1 also occurred in a near mutually exclusive pattern (p = 0.0002). Multivariate analysis revealed that mutation in KRAS and FGFR2 showed a trend (p = 0.06) towards longer and shorter DFS, respectively. In the 386 patients with early stage disease (stage I and II), FGFR2 mutation was significantly associated with shorter DFS (HR = 3.24; 95% confidence interval, CI, 1.35–7.77; p = 0.008) and OS (HR = 2.00; 95% CI 1.09–3.65; p = 0.025) and KRAS was associated with longer DFS (HR = 0.23; 95% CI 0.05–0.97; p = 0.045). In conclusion, although KRAS and FGFR2 mutations share similar activation of the MAPK pathway, our data suggest very different roles in tumor biology. This has implications for the implementation of anti-FGFR or anti-MEK biologic therapies. PMID:22383975

Bilateral granulosa cell tumors: a novel malignant manifestation of multiple endocrine neoplasia 1 syndrome found in a patient with a rare menin in-frame deletion

PubMed Central

Hall, Michael J; Innocent, Julie; Rybak, Christina; Veloski, Colleen; Scott, Walter J; Wu, Hong; Ridge, John A; Hoffman, John P; Borghaei, Hossein; Turaka, Aruna; Daly, Mary B

2015-01-01

Introduction Multiple endocrine neoplasia 1 (MEN1) is a cancer syndrome resulting from mutations of the MEN1 gene. The syndrome is characterized by neoplasia of the parathyroid and pituitary glands, and malignant tumors of the endocrine pancreas. Other manifestations include benign lipomas, angiofibromas, and carcinoid tumors commonly originating in the colon, thymus, and lung. This is the first report of MEN1 syndrome manifesting as bilateral granulosa cell ovarian tumors, and which is associated with a rare intronic mutation of the MEN1 gene. Case report A 41-year-old woman presented with abdominal pain, increasing abdominal girth, and dysmenorrhea. Ultrasound demonstrated enlarged ovaries and uterine fibroids. After an exploratory laparotomy, she subsequently underwent bilateral salpingo–oophorectomy with hysterectomy where the pathology revealed bilateral cystic granulosa cell tumors of the ovaries. Additional workup including computed tomography imaging discovered a thymic mass, which the pathology showed was malignant, along with a pancreatic mass suspicious for a neuroendocrine tumor. Hyperparathyroidism was also discovered and was found to be secondary to a parathyroid adenoma. Genetic testing revealed an exceedingly rare mutation in the MEN1 gene (c.654 + 1 G>A). Discussion Mutations of the menin gene leading to MEN1 syndrome are classically nonsense or missense mutations producing a dysfunctional protein product. Recently, researchers described a novel mutation of MEN1 (c.654 + 1 G>A) in a male proband meeting the criteria for clinical MEN1 syndrome. Functional analysis performed on the stable mutant protein showed selective disruption of the transforming growth factor beta signaling pathway, yet it maintained its wild-type ability to inhibit nuclear factor kappa B and to suppress JunD transcriptional activity. Conclusion To our knowledge, this is the first report of MEN1 syndrome associated with bilateral granulosa cell malignancy. We postulate that this presentation may be due to the novel menin gene mutation recently described. PMID:25733923

Clinical significance of monitoring ESR1 mutations in circulating cell-free DNA in estrogen receptor positive breast cancer patients.

PubMed

Takeshita, Takashi; Yamamoto, Yutaka; Yamamoto-Ibusuki, Mutsuko; Inao, Toko; Sueta, Aiko; Fujiwara, Saori; Omoto, Yoko; Iwase, Hirotaka

2016-05-31

The measurement of circulating cell-free DNA (cfDNA) may transform the management of breast cancer patients. We aimed to investigate the clinical significance of sequential measurements of ESR1 mutations in primary breast cancer (PBC) and metastatic breast cancer (MBC) patients. ESR1 mutations ratio in the PBC groups was used as the minimum cutoff for determining increases in cfDNA ESR1 mutation ratio. An increase in cfDNA ESR1 mutations was found in 13 samples of cfDNA from 12 (28.6%) out of 42 MBC patients. A total of 10 (83.3%) out of 12 MBC patients with increase cfDNA ESR1 mutations showed a poor response to treatment. In survival analysis, increase cfDNA ESR1 mutations may predict a shorter duration of post-endocrine-therapy effectiveness (P = 0.0033). A total of 119 patients (253 plasma samples) with breast carcinoma were enrolled in this study. Cases were selected if archival plasma samples were available from PBC before and after treatment and from MBC gathered more than twice at the time of progression. cfDNA was isolated from the 77 PBC patients (154 plasma samples) and from the 42 MBC patients (99 plasma samples). To investigate any changes in each cfDNA ESR1 mutation before and after treatment, we analyzed the difference with cfDNA ESR1 mutations ratio in the first blood sample using droplet digital polymerase chain reaction (ddPCR). We demonstrate that ddPCR monitoring of the recurrent ESR1 mutation in cfDNA of MBC patients is a feasible and useful method of providing relevant predictive information.

Clinical significance of monitoring ESR1 mutations in circulating cell-free DNA in estrogen receptor positive breast cancer patients

PubMed Central

Takeshita, Takashi; Yamamoto, Yutaka; Yamamoto-Ibusuki, Mutsuko; Inao, Toko; Sueta, Aiko; Fujiwara, Saori; Omoto, Yoko; Iwase, Hirotaka

2016-01-01

Background The measurement of circulating cell-free DNA (cfDNA) may transform the management of breast cancer patients. We aimed to investigate the clinical significance of sequential measurements of ESR1 mutations in primary breast cancer (PBC) and metastatic breast cancer (MBC) patients. Results ESR1 mutations ratio in the PBC groups was used as the minimum cutoff for determining increases in cfDNA ESR1 mutation ratio. An increase in cfDNA ESR1 mutations was found in 13 samples of cfDNA from 12 (28.6%) out of 42 MBC patients. A total of 10 (83.3%) out of 12 MBC patients with increase cfDNA ESR1 mutations showed a poor response to treatment. In survival analysis, increase cfDNA ESR1 mutations may predict a shorter duration of post-endocrine-therapy effectiveness (P = 0.0033). Methods A total of 119 patients (253 plasma samples) with breast carcinoma were enrolled in this study. Cases were selected if archival plasma samples were available from PBC before and after treatment and from MBC gathered more than twice at the time of progression. cfDNA was isolated from the 77 PBC patients (154 plasma samples) and from the 42 MBC patients (99 plasma samples). To investigate any changes in each cfDNA ESR1 mutation before and after treatment, we analyzed the difference with cfDNA ESR1 mutations ratio in the first blood sample using droplet digital polymerase chain reaction (ddPCR). Conclusions We demonstrate that ddPCR monitoring of the recurrent ESR1 mutation in cfDNA of MBC patients is a feasible and useful method of providing relevant predictive information. PMID:27102299

In vitro and ex vivo suppression by aminoglycosides of PCDH15 nonsense mutations underlying type 1 Usher syndrome.

PubMed

Rebibo-Sabbah, Annie; Nudelman, Igor; Ahmed, Zubair M; Baasov, Timor; Ben-Yosef, Tamar

2007-11-01

Type 1 Usher syndrome (USH1) is a recessively inherited condition, characterized by profound prelingual deafness, vestibular areflexia, and prepubertal onset of retinitis pigmentosa (RP). While the auditory component of USH1 can be treated by cochlear implants, to date there is no effective treatment for RP. USH1 can be caused by mutations in each of at least six genes. While truncating mutations of these genes cause USH1, some missense mutations of the same genes cause nonsyndromic deafness. These observations suggest that partial or low level activity of the encoded proteins may be sufficient for normal retinal function, although not for normal hearing. In individuals with USH1 due to nonsense mutations, interventions enabling partial translation of a full-length functional protein may delay the onset and/or progression of RP. One such possible therapeutic approach is suppression of nonsense mutations by small molecules such as aminoglycosides. We decided to test this approach as a potential therapy for RP in USH1 patients due to nonsense mutations. We initially focused on nonsense mutations of the PCDH15 gene, underlying USH1F. Here, we show suppression of several PCDH15 nonsense mutations, both in vitro and ex vivo. Suppression was achieved both by commercial aminoglycosides and by NB30, a new aminoglycoside-derivative developed by us. NB30 has reduced cytotoxicity in comparison to commercial aminoglycosides, and thus may be more efficiently used for therapeutic purposes. The research described here has important implications for the development of targeted interventions that are effective for patients with USH1 caused by various nonsense mutations.

A novel COLD-PCR/FMCA assay enhances the detection of low-abundance IDH1 mutations in gliomas.

PubMed

Pang, Brendan; Durso, Mary B; Hamilton, Ronald L; Nikiforova, Marina N

2013-03-01

Point mutations in isocitrate dehydrogenase 1 (IDH1) have been identified in many gliomas. The detection of IDH1 mutations becomes challenging on suboptimal glioma biopsies when a limited number of tumor cells is available for analysis. Coamplification at lower denaturing-polymerase chain reaction (COLD-PCR) is a PCR technique that deliberately lowers the denaturing cycle temperature to selectively favor amplification of mutant alleles, allowing for the sensitive detection of low-abundance mutations. We developed a novel COLD-PCR assay on the LightCycler platform (Roche, Applied Science, Indianapolis, IN), using post-PCR fluorescent melting curve analysis (FMCA) for the detection of mutant IDH1 with a detection limit of 1%. Thirty-five WHO grade I to IV gliomas and 9 non-neoplastic brain and spinal cord biopsies were analyzed with this technique and the results were compared with the conventional real-time PCR and the Sanger sequencing analysis. COLD-PCR/FMCA was able to detect the most common IDH1 R132H mutation and rare mutation types including R132H, R132C, R132L, R132S, and R132G mutations. Twenty-five glioma cases were positive for IDH1 mutations by COLD-PCR/FMCA, and 23 gliomas were positive by the conventional real-time PCR and Sanger sequencing. A pilocytic astrocytoma (PA I) and a glioblastoma multiforme (GBM IV) showed low-abundance IDH1 mutations detected by COLD-PCR/FMCA. The remaining 10 glioma and 9 non-neoplastic samples were negative by all the 3 methods. In summary, we report a novel COLD-PCR/FMCA method that provides rapid and sensitive detection of IDH1 mutations in formalin-fixed paraffin-embedded tissue and can be used in the clinical setting to assess the small brain biopsies.

The PCBP1 gene encoding poly(rC) binding protein I is recurrently mutated in Burkitt lymphoma.

PubMed

Wagener, Rabea; Aukema, Sietse M; Schlesner, Matthias; Haake, Andrea; Burkhardt, Birgit; Claviez, Alexander; Drexler, Hans G; Hummel, Michael; Kreuz, Markus; Loeffler, Markus; Rosolowski, Maciej; López, Cristina; Möller, Peter; Richter, Julia; Rohde, Marius; Betts, Matthew J; Russell, Robert B; Bernhart, Stephan H; Hoffmann, Steve; Rosenstiel, Philip; Schilhabel, Markus; Szczepanowski, Monika; Trümper, Lorenz; Klapper, Wolfram; Siebert, Reiner

2015-09-01

The genetic hallmark of Burkitt lymphoma is the translocation t(8;14)(q24;q32), or one of its light chain variants, resulting in IG-MYC juxtaposition. However, these translocations alone are insufficient to drive lymphomagenesis, which requires additional genetic changes for malignant transformation. Recent studies of Burkitt lymphoma using next generation sequencing approaches have identified various recurrently mutated genes including ID3, TCF3, CCND3, and TP53. Here, by using similar approaches, we show that PCBP1 is a recurrently mutated gene in Burkitt lymphoma. By whole-genome sequencing, we identified somatic mutations in PCBP1 in 3/17 (18%) Burkitt lymphomas. We confirmed the recurrence of PCBP1 mutations by Sanger sequencing in an independent validation cohort, finding mutations in 3/28 (11%) Burkitt lymphomas and in 6/16 (38%) Burkitt lymphoma cell lines. PCBP1 is an intron-less gene encoding the 356 amino acid poly(rC) binding protein 1, which contains three K-Homology (KH) domains and two nuclear localization signals. The mutations predominantly (10/12, 83%) affect the KH III domain, either by complete domain loss or amino acid changes. Thus, these changes are predicted to alter the various functions of PCBP1, including nuclear trafficking and pre-mRNA splicing. Remarkably, all six primary Burkitt lymphomas with a PCBP1 mutation expressed MUM1/IRF4, which is otherwise detected in around 20-40% of Burkitt lymphomas. We conclude that PCBP1 mutations are recurrent in Burkitt lymphomas and might contribute, in cooperation with other mutations, to its pathogenesis. © 2015 Wiley Periodicals, Inc.

TET2 mutations in B cells of patients affected by angioimmunoblastic T-cell lymphoma.

PubMed

Schwartz, Friederike H; Cai, Qian; Fellmann, Eva; Hartmann, Sylvia; Mäyränpää, Mikko I; Karjalainen-Lindsberg, Marja-Liisa; Sundström, Christer; Scholtysik, René; Hansmann, Martin-Leo; Küppers, Ralf

2017-06-01

Angioimmunoblastic T-cell lymphomas (AITLs) frequently carry mutations in the TET2 and IDH2 genes. TET2 mutations represent early genetic lesions as they had already been detected in haematopoietic precursor cells of AITL patients. We show by analysis of whole-tissue sections and microdissected PD1 + cells that the frequency of TET2-mutated AITL is presumably even higher than reported (12/13 cases in our collection; 92%). In two-thirds of informative AITLs (6/9), a fraction of B cells was also TET2-mutated. Investigation of four AITLs by TET2 and IGHV gene sequencing of single microdissected B cells showed that between 10% and 60% of polyclonal B cells in AITL lymph nodes harboured the identical TET2 mutations of the respective T-cell lymphoma clone. Thus, TET2-mutated haematopoietic precursor cells in AITL patients not only give rise to the T-cell lymphoma but also generate a large population of mutated mature B cells. Future studies will show whether this is a reason why AITL patients frequently also develop B-cell lymphomas. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

TP53 mutations in primary breast carcinomas from white and African-Brazilian patients.

PubMed

Nagai, Maria Aparecida; Schaer Barbosa, Helenemarie; Zago, Marco Antonio; Araújo Silva, Wilson; Nishimoto, Inês Nobuko; Salaorni, Sibeli; Guerreiro Costa, Lívia Nery Franco; Silva Araújo, Marcos; Caldas Oliveira, Ana Gabriela; Mourâo Neto, Mário; Brentani, Maria Mitzi

2003-07-01

We have attempted to determine the incidence, nature and clinical significance of TP53 mutation in a group of white (242 cases) and African-Brazilian (52 cases) patients with breast cancer. The interethnic admixture as estimated by STR markers showed that white subjects displayed 67.9+/-0.4%, 25.0+/-1.7% and 7.0%+/-1.6% and the black populations had 34.4+/-1.9%, 56.2+/-1.9 and 9.4+/-2.2% respectively of European, African and Amerindian genes. Clinical parameters such as age, lymph node status and steroid receptors were similar in both groups. African-Brazilian patients presented more advanced lesions. Mutation screening was performed using polymerase chain reaction-single strand conformation analysis followed by sequencing. Compared to whites (13.6%), a relatively high frequency of TP53 mutation was found in blacks (32.7%) (p=0.001). African-Brazilian women have a larger proportion of mutations in exons 5 and 7, whereas white women have more mutations in exon 8. Mutations within exon 4 were found only in tumors of white patients. The spectra of TP53 mutations show that A:T-->G:C nucleotide transversion and G:C-->C:G transition were more common in African-Brazilian women whereas G:C-->T:A transversion occurs very frequently in whites. A high prevalence of G:C-->A:T nucleotide transitions and deletions was detected in both groups. No association was found between p53 gene mutation and tumor or clinical parameters independently of the ethnic group. With a median follow-up of 35.6 months for whites and 43.4 months for the blacks, no differences in overall survival were found. If white patients were stratified according to the type and location of TP53 mutations, patients with mutations affecting amino acids directly involved in DNA or Zn binding displayed a poor prognosis. The pattern of mutations found in our population seems to reflect a base line pattern observed in populations with similar ethnic profile with some modifications, which might be derived from specific etiological factors.

Identification of bovine NPC1 gene cSNPs and their effects on body size traits of Qinchuan cattle.

PubMed

Dang, Yonglong; Li, Mingxun; Yang, Mingjuan; Cao, Xiukai; Lan, Xianyong; Lei, Chuzhao; Zhang, Chunlei; Lin, Qing; Chen, Hong

2014-05-01

NPC1 gene is an important gene closely related to the Niemann-Pick type C (NPC). Mutations in the NPC1 gene tend to cause Niemann-Pick type C, a lysosomal storage disorder. Previous studies have shown that NPC1 protein plays an important role in subcellular lipid transport, homeostasis, platelet function and formation, which are basic metabolic activities in the process of development. In this study, to explore the association between the NPC1 gene variation and body size traits in Qinchuan cattle, we detected four novel coding single nucleotide polymorphisms (cSNPs) in the bovine NPC1 gene, including one missense mutation (SNP1) and three synonymous mutations (SNP2, SNP3 and SNP4). Population genetic analyses of 518 individuals and association correlations between cSNPs and bovine body size traits were conducted in this research. A missense mutation at SNP1 locus was found to be significantly related to the heart girth, hip width and body weight (P<0.01 or P<0.05, 3.5-year-old). Two synonymous mutations at SNP2 and SNP3 loci also showed significant effects on hip width (P<0.05, 3.5-year-old). One synonymous mutation at SNP4 locus showed significant effect on body weight (P<0.05, 2.0-year-old). Combined haplotypes H2H6 and H6H6 showed significant effects on body size traits such as heart girth, hip width, and body weight (3.5-year-old, P<0.01 or P<0.05). This study provides evidence that the NPC1 gene might be involved in the regulation of bovine growth and body development, and may be considered as a candidate gene for marker assisted selection (MAS) in beef cattle breeding industry. Copyright © 2014. Published by Elsevier B.V.

Exome sequencing identifies DYNC2H1 mutations as a common cause of asphyxiating thoracic dystrophy (Jeune syndrome) without major polydactyly, renal or retinal involvement

PubMed Central

Schmidts, Miriam; Arts, Heleen H; Bongers, Ernie M H F; Yap, Zhimin; Oud, Machteld M; Antony, Dinu; Duijkers, Lonneke; Emes, Richard D; Stalker, Jim; Yntema, Jan-Bart L; Plagnol, Vincent; Hoischen, Alexander; Gilissen, Christian; Forsythe, Elisabeth; Lausch, Ekkehart; Veltman, Joris A; Roeleveld, Nel; Superti-Furga, Andrea; Kutkowska-Kazmierczak, Anna; Kamsteeg, Erik-Jan; Elçioğlu, Nursel; van Maarle, Merel C; Graul-Neumann, Luitgard M; Devriendt, Koenraad; Smithson, Sarah F; Wellesley, Diana; Verbeek, Nienke E; Hennekam, Raoul C M; Kayserili, Hulya; Scambler, Peter J; Beales, Philip L; Knoers, Nine VAM; Roepman, Ronald; Mitchison, Hannah M

2013-01-01

Background Jeune asphyxiating thoracic dystrophy (JATD) is a rare, often lethal, recessively inherited chondrodysplasia characterised by shortened ribs and long bones, sometimes accompanied by polydactyly, and renal, liver and retinal disease. Mutations in intraflagellar transport (IFT) genes cause JATD, including the IFT dynein-2 motor subunit gene DYNC2H1. Genetic heterogeneity and the large DYNC2H1 gene size have hindered JATD genetic diagnosis. Aims and methods To determine the contribution to JATD we screened DYNC2H1 in 71 JATD patients JATD patients combining SNP mapping, Sanger sequencing and exome sequencing. Results and conclusions We detected 34 DYNC2H1 mutations in 29/71 (41%) patients from 19/57 families (33%), showing it as a major cause of JATD especially in Northern European patients. This included 13 early protein termination mutations (nonsense/frameshift, deletion, splice site) but no patients carried these in combination, suggesting the human phenotype is at least partly hypomorphic. In addition, 21 missense mutations were distributed across DYNC2H1 and these showed some clustering to functional domains, especially the ATP motor domain. DYNC2H1 patients largely lacked significant extra-skeletal involvement, demonstrating an important genotype–phenotype correlation in JATD. Significant variability exists in the course and severity of the thoracic phenotype, both between affected siblings with identical DYNC2H1 alleles and among individuals with different alleles, which suggests the DYNC2H1 phenotype might be subject to modifier alleles, non-genetic or epigenetic factors. Assessment of fibroblasts from patients showed accumulation of anterograde IFT proteins in the ciliary tips, confirming defects similar to patients with other retrograde IFT machinery mutations, which may be of undervalued potential for diagnostic purposes. PMID:23456818

Presenilin 1 mutation decreases both calcium and contractile responses in cerebral arteries.

PubMed

Toussay, Xavier; Morel, Jean-Luc; Biendon, Nathalie; Rotureau, Lolita; Legeron, François-Pierre; Boutonnet, Marie-Charlotte; Cho, Yoon H; Macrez, Nathalie

2017-10-01

Mutations or upregulation in presenilin 1 (PS1) gene are found in familial early-onset Alzheimer's disease or sporadic late-onset Alzheimer's disease, respectively. PS1 has been essentially studied in neurons and its mutation was shown to alter intracellular calcium (Ca 2+ ) signals. Here, we showed that PS1 is expressed in smooth muscle cells (SMCs) of mouse cerebral arteries, and we assessed the effects of the deletion of exon 9 of PS1 (PS1dE9) on Ca 2+ signals and contractile responses of vascular SMC. Agonist-induced contraction of cerebral vessels was significantly decreased in PS1dE9 both in vivo and ex vivo. Spontaneous activity of Ca 2+ sparks through ryanodine-sensitive channels (RyR) was unchanged, whereas the RyR-mediated Ca 2+ -release activated by caffeine was shorter in PS1dE9 SMC when compared with control. Moreover, PS1dE9 mutation decreased the caffeine-activated capacitive Ca 2+ entry, and inhibitors of SERCA pumps reversed the effects of PS1dE9 on Ca 2+ signals. PS1dE9 mutation also leads to the increased expression of SERCA3, phospholamban, and RyR3. These results show that PS1 plays a crucial role in the cerebrovascular system and the vascular reactivity is decreased through altered Ca 2+ signals in PS1dE9 mutant mice. Copyright © 2017 Elsevier Inc. All rights reserved.

SMAD4 and NF1 mutations as potential biomarkers for poor prognosis to cetuximab-based therapy in Chinese metastatic colorectal cancer patients.

PubMed

Mei, Zhu; Shao, Yang W; Lin, Peinan; Cai, Xiaomin; Wang, Biao; Ding, Yan; Ma, Xiangyuan; Wu, Xue; Xia, Yewei; Zhu, Dongqin; Shu, Yongqian; Fu, Zan; Gu, Yanhong

2018-04-27

Cetuximab, an anti-EGFR monoclonal antibody, is used in combination with chemotherapy in clinic to enhance the outcome in metastatic colorectal cancer (mCRC) patients with only ~ 20% response rate. To date only activating mutations in KRAS and NRAS have been identified as poor prognosis biomarkers in cetuximab-based treatment, which makes an urgent need for identification of novel prognosis biomarkers to precisely predict patients' response in order to maximize the benefit. In this study, we analysed the mutation profiles of 33 Chinese mCRC patients using comprehensive next-generation sequencing (NGS) targeting 416 cancer-relevant genes before cetuximab treatment. Upon receiving cetuximab-based therapy, patients were evaluated for drug response, and the progression-free survival (PFS) was monitored. The association of specific genetic alterations and cetuximab efficacy was analyzed. Patients carrying SMAD4 mutations (SMAD4 mut , n = 8) or NF1 mutations (NF1 mut , n = 4) had significantly shorter PFS comparing to those carrying wildtype SMAD4 (SMAD4 wt , n = 25) (P = 0.0081) or wildtype NF1 (NF1 wt , n = 29) (P = 0.0028), respectively. None of the SMAD4 mut or NF1 mut patients showed response to cetuximab when assessed at 12-week post-treatment. Interestingly, two patients carrying both SMAD4 mut and NF1 mut showed the shortest PFS among all the patients. Our results demonstrated that SMAD4 and NF1 mutations can serve as potential biomarkers for poor prognosis to cetuximab-based therapy in Chinese mCRC patients.

Nras and Kras mutation in Japanese lung cancer patients: Genotyping analysis using LightCycler.

PubMed

Sasaki, Hidefumi; Okuda, Katsuhiro; Kawano, Osamu; Endo, Katsuhiko; Yukiue, Haruhiro; Yokoyama, Tomoki; Yano, Motoki; Fujii, Yoshitaka

2007-09-01

Activating mutations of Ras gene families have been found in a variety of human malignancies, including lung cancer, suggesting their dominant role in tumorigenesis. Many studies have showed that the Kras gene is activated by point mutations in approximately 15-20% of non-small cell lung cancers (NSCLCs), however, there are only a few reports on Nras mutations in NSCLC. We have genotyped Nras mutation status (n=195) and Kras mutation status (n=190) in surgically treated lung adenocarcinoma cases. The presence or absence of Nras and Kras mutations was analyzed by real-time quantitative polymerase chain reaction (PCR) with mutation-specific sensor and anchor probes. EGFR mutation status at kinase domain has already been reported. Nras mutation was found in 1 of 195 patients. This mutation was a G-to-T transversion, involving the substitution of the normal glycine (GGT) with cystein (TGT) and thought to be a somatic mutation. The patient was male and a smoker. Kras mutant patients (11.1%; 21/190) had a significantly worse prognosis than wild-type patients (p=0.0013). Eighty-two EGFR mutations at kinase domain had exclusively Nras or Kras mutations. Although Nras gene mutation might be one of the mechanisms of oncogenesis of lung adenocarcinoma, this was a very rare event. Further studies are needed to confirm the mechanisms of Nras mutations for the sensitivity of molecular target therapy for lung cancer.

Acquired copy-neutral loss of heterozygosity of chromosome 1p as a molecular event associated with marrow fibrosis in MPL-mutated myeloproliferative neoplasms.

PubMed

Rumi, Elisa; Pietra, Daniela; Guglielmelli, Paola; Bordoni, Roberta; Casetti, Ilaria; Milanesi, Chiara; Sant'Antonio, Emanuela; Ferretti, Virginia; Pancrazzi, Alessandro; Rotunno, Giada; Severgnini, Marco; Pietrelli, Alessandro; Astori, Cesare; Fugazza, Elena; Pascutto, Cristiana; Boveri, Emanuela; Passamonti, Francesco; De Bellis, Gianluca; Vannucchi, Alessandro; Cazzola, Mario

2013-05-23

We studied mutations of MPL exon 10 in patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF), first investigating a cohort of 892 consecutive patients. MPL mutation scanning was performed on granulocyte genomic DNA by using a high-resolution melt assay, and the mutant allele burden was evaluated by using deep sequencing. Somatic mutations of MPL, all but one involving codon W515, were detected in 26/661 (4%) patients with ET, 10/187 (5%) with PMF, and 7/44 (16%) patients with post-ET myelofibrosis. Comparison of JAK2 (V617F)-mutated and MPL-mutated patients showed only minor phenotypic differences. In an extended group of 62 MPL-mutated patients, the granulocyte mutant allele burden ranged from 1% to 95% and was significantly higher in patients with PMF or post-ET myelofibrosis compared with those with ET. Patients with higher mutation burdens had evidence of acquired copy-neutral loss of heterozygosity (CN-LOH) of chromosome 1p in granulocytes, consistent with a transition from heterozygosity to homozygosity for the MPL mutation in clonal cells. A significant association was found between MPL-mutant allele burden greater than 50% and marrow fibrosis. These observations suggest that acquired CN-LOH of chromosome 1p involving the MPL location may represent a molecular mechanism of fibrotic transformation in MPL-mutated myeloproliferative neoplasms.

Acquired copy-neutral loss of heterozygosity of chromosome 1p as a molecular event associated with marrow fibrosis in MPL-mutated myeloproliferative neoplasms

PubMed Central

Pietra, Daniela; Guglielmelli, Paola; Bordoni, Roberta; Casetti, Ilaria; Milanesi, Chiara; Sant’Antonio, Emanuela; Ferretti, Virginia; Pancrazzi, Alessandro; Rotunno, Giada; Severgnini, Marco; Pietrelli, Alessandro; Astori, Cesare; Fugazza, Elena; Pascutto, Cristiana; Boveri, Emanuela; Passamonti, Francesco; De Bellis, Gianluca; Vannucchi, Alessandro; Cazzola, Mario

2013-01-01

We studied mutations of MPL exon 10 in patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF), first investigating a cohort of 892 consecutive patients. MPL mutation scanning was performed on granulocyte genomic DNA by using a high-resolution melt assay, and the mutant allele burden was evaluated by using deep sequencing. Somatic mutations of MPL, all but one involving codon W515, were detected in 26/661 (4%) patients with ET, 10/187 (5%) with PMF, and 7/44 (16%) patients with post-ET myelofibrosis. Comparison of JAK2 (V617F)–mutated and MPL-mutated patients showed only minor phenotypic differences. In an extended group of 62 MPL-mutated patients, the granulocyte mutant allele burden ranged from 1% to 95% and was significantly higher in patients with PMF or post-ET myelofibrosis compared with those with ET. Patients with higher mutation burdens had evidence of acquired copy-neutral loss of heterozygosity (CN-LOH) of chromosome 1p in granulocytes, consistent with a transition from heterozygosity to homozygosity for the MPL mutation in clonal cells. A significant association was found between MPL-mutant allele burden greater than 50% and marrow fibrosis. These observations suggest that acquired CN-LOH of chromosome 1p involving the MPL location may represent a molecular mechanism of fibrotic transformation in MPL-mutated myeloproliferative neoplasms. PMID:23575445

HSAN1 mutations in serine palmitoyltransferase reveal a close structure-function-phenotype relationship.

PubMed

Bode, Heiko; Bourquin, Florence; Suriyanarayanan, Saranya; Wei, Yu; Alecu, Irina; Othman, Alaa; Von Eckardstein, Arnold; Hornemann, Thorsten

2016-03-01

Hereditary sensory and autonomic neuropathy type 1 (HSAN1) is a rare autosomal dominant inherited peripheral neuropathy caused by mutations in the SPTLC1 and SPTLC2 subunits of serine palmitoyltransferase (SPT). The mutations induce a permanent shift in the substrate preference from L-serine to L-alanine, which results in the pathological formation of atypical and neurotoxic 1-deoxy-sphingolipids (1-deoxySL). Here we compared the enzymatic properties of 11 SPTLC1 and six SPTLC2 mutants using a uniform isotope labelling approach. In total, eight SPT mutants (STPLC1p.C133W, p.C133Y, p.S331F, p.S331Y and SPTLC2p.A182P, p.G382V, p.S384F, p.I504F) were associated with increased 1-deoxySL synthesis. Despite earlier reports, canonical activity with l-serine was not reduced in any of the investigated SPT mutants. Three variants (SPTLC1p.S331F/Y and SPTLC2p.I505Y) showed an increased canonical activity and increased formation of C20 sphingoid bases. These three mutations are associated with an exceptionally severe HSAN1 phenotype, and increased C20 sphingosine levels were also confirmed in plasma of patients. A principal component analysis of the analysed sphingoid bases clustered the mutations into three separate entities. Each cluster was related to a distinct clinical outcome (no, mild and severe HSAN1 phenotype). A homology model based on the protein structure of the prokaryotic SPT recapitulated the same grouping on a structural level. Mutations associated with the mild form clustered around the active site, whereas mutations associated with the severe form were located on the surface of the protein. In conclusion, we showed that HSAN1 mutations in SPT have distinct biochemical properties, which allowed for the prediction of the clinical symptoms on the basis of the plasma sphingoid base profile. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Steroid-resistant nephrotic syndrome: impact of genetic testing.

PubMed

Kari, Jameela A; El-Desoky, Sherif M; Gari, Mamdooh; Malik, Khalid; Vega-Warner, Virginia; Lovric, Svjetlana; Bockenhauer, Detlef

2013-01-01

Mutations in several genes are known to cause steroid-resistant nephrotic syndome (SRNS), most commonly in NPHS1, NPHS2, and WT1. Our aims were to determine the frequency of mutations in these genes in children with SRNS, the response of patients with SRNS to various immunosuppressants, and the disease outcome, and to review the predictive value of genetic testing and renal biopsy result. A retrospective review was performed of the medical records for all children with SRNS who were treated and followed-up in the Pediatric Nephrology Unit of King Abdulaziz University Hospital (KAUH), Jeddah, Saudi Arabia from 2002-2012. We retrospectively reviewed the medical records of children above 1 year of age, who presented with SRNS to KAUH, Jeddah, Saudi Arabia, in the 10-year interval from 2002-2012 and for whom the results of genetic testing for NPHS1, NPHS2, and WT1 were available. We compared the clinical phenotype, including response to treatment and renal outcome to genotype data. We identified 44 children with a clinical diagnosis of SRNS in whom results of genetic testing were available. Presumably disease-causing mutations were detected in 5 children (11.4%) of which 3 (6.8%) had NPHS2 mutation and 2 (4.5%) had NPHS1 mutation. Renal biopsy revealed minimal change disease (MCD) or variants in 17 children, focal segmental glomerulosclerosis (FSGS) in 23 children, membranoproliferative changes (MPGN) in 2 children, and IgA nephropathy in another 2 children. Children with MCD on biopsy were more likely to respond to treatment than those with FSGS. None of those with an identified genetic cause showed any response to treatment. The frequency of identified disease-causing mutations in children older than 1 year with SRNS presented to KAUH was 11.4%, and these patients showed no response to treatment. Initial testing for gene mutation in children with SRNS may obviate the need for biopsy, and the use of immunosuppressive treatment in children with disease due to NPHS1 or NPHS2 mutations. Renal biopsy was useful in predicting response in those without genetic mutations.

A novel DNMT1 mutation associated with early onset hereditary sensory and autonomic neuropathy, cataplexy, cerebellar atrophy, scleroderma, endocrinopathy, and common variable immune deficiency.

PubMed

Fox, Robin; Ealing, John; Murphy, Helen; Gow, David P; Gosal, David

2016-09-01

DNA methyltransferase 1 (DNMT1) is an enzyme which has a role in methylation of DNA, gene regulation, and chromatin stability. Missense mutations in the DNMT1 gene have been previously associated with two neurological syndromes: hereditary sensory and autonomic neuropathy type 1 with dementia and deafness (HSAN1E) and autosomal dominant cerebellar ataxia, deafness, and narcolepsy (ADCA-DN). We report a case showing overlap of both of these syndromes plus associated clinical features of common variable immune deficiency, scleroderma, and endocrinopathy that could also be mutation associated. Our patient was found to be heterozygous for a previously unreported frameshift mutation, c.1635_1637delCAA p.(Asn545del) in the DNMT1 gene exon 20. This case displays both the first frameshift mutation described in the literature which is associated with a phenotype with a high degree of overlap between HSAN1E and ADCA-DN and early age of onset (c. 8 years). Our case is also of interest as the patient displays a number of new non-neurological features, which could also be DNMT1 mutation related. © 2016 Peripheral Nerve Society.

Recurrent and functional regulatory mutations in breast cancer.

PubMed

Rheinbay, Esther; Parasuraman, Prasanna; Grimsby, Jonna; Tiao, Grace; Engreitz, Jesse M; Kim, Jaegil; Lawrence, Michael S; Taylor-Weiner, Amaro; Rodriguez-Cuevas, Sergio; Rosenberg, Mara; Hess, Julian; Stewart, Chip; Maruvka, Yosef E; Stojanov, Petar; Cortes, Maria L; Seepo, Sara; Cibulskis, Carrie; Tracy, Adam; Pugh, Trevor J; Lee, Jesse; Zheng, Zongli; Ellisen, Leif W; Iafrate, A John; Boehm, Jesse S; Gabriel, Stacey B; Meyerson, Matthew; Golub, Todd R; Baselga, Jose; Hidalgo-Miranda, Alfredo; Shioda, Toshi; Bernards, Andre; Lander, Eric S; Getz, Gad

2017-07-06

Genomic analysis of tumours has led to the identification of hundreds of cancer genes on the basis of the presence of mutations in protein-coding regions. By contrast, much less is known about cancer-causing mutations in non-coding regions. Here we perform deep sequencing in 360 primary breast cancers and develop computational methods to identify significantly mutated promoters. Clear signals are found in the promoters of three genes. FOXA1, a known driver of hormone-receptor positive breast cancer, harbours a mutational hotspot in its promoter leading to overexpression through increased E2F binding. RMRP and NEAT1, two non-coding RNA genes, carry mutations that affect protein binding to their promoters and alter expression levels. Our study shows that promoter regions harbour recurrent mutations in cancer with functional consequences and that the mutations occur at similar frequencies as in coding regions. Power analyses indicate that more such regions remain to be discovered through deep sequencing of adequately sized cohorts of patients.

Computational Analysis Reveals the Association of Threonine 118 Methionine Mutation in PMP22 Resulting in CMT-1A

PubMed Central

Swetha, Rayapadi G.

2014-01-01

The T118M mutation in PMP22 gene is associated with Charcot Marie Tooth, type 1A (CMT1A). CMT1A is a form of Charcot-Marie-Tooth disease, the most common inherited disorder of the peripheral nervous system. Mutations in CMT related disorder are seen to increase the stability of the protein resulting in the diseased state. We performed SNP analysis for all the nsSNPs of PMP22 protein and carried out molecular dynamics simulation for T118M mutation to compare the stability difference between the wild type protein structure and the mutant protein structure. The mutation T118M resulted in the overall increase in the stability of the mutant protein. The superimposed structure shows marked structural variation between the wild type and the mutant protein structures. PMID:25400662

[A sporadic case of episodic ataxia with nystagmus (EA-2)].

PubMed

Namekawa, M; Takiyama, Y; Ueno, N; Nishizawa, M

1998-05-01

A 39-year-old man with episodic ataxia with nystagmus (EA-2) was reported. He showed intermittent cerebellar dysfunction, i.e., ataxia, nystagmus, dysarthria and vertigo, since he was 10 years old. Although this attack lasted for several hours, he was normal with exception of interictal nystagmus. His parents and sister showed no episodic ataxia. We ruled out the diseases, which may cause episodic ataxia, such as multiple sclerosis, vascular disorders, metabolic disorders and congenital anomalies. He was released from the attack by treatment with acetazolamide. EA-2 has been associated with mutations in the alpha 1A-voltage dependent calcium channel gene (CACNL1A4), which is also affected in familial hemiplegic migraine (FMH) and spinocerebellar ataxia type 6 (SCA6). In EA-2, frame-shift mutation leading to premature stop and splice-site mutation leading to truncated, non-functional channel protein have been reported. However, our patient did not have the mutations in the CACNL1A4 gene that were previously reported. In addition, our patient did not have an expanded CAG allele in the CACNL1A4 gene which is responsible for SCA6. Further examination is required to address whether a new mutation exists in the CACNL1A4 gene in our patient.

Circadian Rhythms in Neurospora crassa: Clock Mutant Effects in the Absence of a frq-Based Oscillator

PubMed Central

Lombardi, Laura; Schneider, Kevin; Tsukamoto, Michelle; Brody, Stuart

2007-01-01

In Neurospora, the circadian rhythm is expressed as rhythmic conidiation driven by a feedback loop involving the protein products of frq (frequency), wc-1 (white collar-1), and wc-2, known as the frq/wc (FWC) oscillator. Although strains carrying null mutations such as frq10 or wc-2Δ lack a functional FWC oscillator and do not show a rhythm under most conditions, a rhythm can be observed in them by the addition of geraniol or farnesol to the media. Employing this altered media as an assay, the effect of other clock mutations in a frq10- or wc-2Δ-null background can be measured. It was found that the existing clock mutations fall into three classes: (1) those, such as prd-3 or prd-4 or frq1, that showed no effect in a clock null background; (2) those, such as prd-1 or prd-2 or prd-6, that did have a measurable effect in the frq10 background; and (3) those, such as the new mutation ult, that suppressed the frq10 or wc-2Δ effect, i.e., geraniol/farnesol was not required for a visible rhythm. This classification suggests that some of the known clock mutations are part of a broader multioscillator system. PMID:17237512

SF3B1 mutations constitute a novel therapeutic target in breast cancer

PubMed Central

Maguire, Sarah L; Leonidou, Andri; Wai, Patty; Marchiò, Caterina; Ng, Charlotte KY; Sapino, Anna; Salomon, Anne-Vincent; Reis-Filho, Jorge S; Weigelt, Britta; Natrajan, Rachael C

2015-01-01

Mutations in genes encoding proteins involved in RNA splicing have been found to occur at relatively high frequencies in several tumour types including myelodysplastic syndromes, chronic lymphocytic leukaemia, uveal melanoma, and pancreatic cancer, and at lower frequencies in breast cancer. To investigate whether dysfunction in RNA splicing is implicated in the pathogenesis of breast cancer, we performed a re-analysis of published exome and whole genome sequencing data. This analysis revealed that mutations in spliceosomal component genes occurred in 5.6% of unselected breast cancers, including hotspot mutations in the SF3B1 gene, which were found in 1.8% of unselected breast cancers. SF3B1 mutations were significantly associated with ER-positive disease, AKT1 mutations, and distinct copy number alterations. Additional profiling of hotspot mutations in a panel of special histological subtypes of breast cancer showed that 16% and 6% of papillary and mucinous carcinomas of the breast harboured the SF3B1 K700E mutation. RNA sequencing identified differentially spliced events expressed in tumours with SF3B1 mutations including the protein coding genes TMEM14C, RPL31, DYNL11, UQCC, and ABCC5, and the long non-coding RNA CRNDE. Moreover, SF3B1 mutant cell lines were found to be sensitive to the SF3b complex inhibitor spliceostatin A and treatment resulted in perturbation of the splicing signature. Albeit rare, SF3B1 mutations result in alternative splicing events, and may constitute drivers and a novel therapeutic target in a subset of breast cancers. © 2014 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland. PMID:25424858

Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

PubMed

Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

2014-03-15

Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Distinct Brca1 Mutations Differentially Reduce Hematopoietic Stem Cell Function.

PubMed

Mgbemena, Victoria E; Signer, Robert A J; Wijayatunge, Ranjula; Laxson, Travis; Morrison, Sean J; Ross, Theodora S

2017-01-24

BRCA1 is a well-known DNA repair pathway component and a tissue-specific tumor suppressor. However, its role in hematopoiesis is uncertain. Here, we report that a cohort of patients heterozygous for BRCA1 mutations experienced more hematopoietic toxicity from chemotherapy than those with BRCA2 mutations. To test whether this reflects a requirement for BRCA1 in hematopoiesis, we generated mice with Brca1 mutations in hematopoietic cells. Mice homozygous for a null Brca1 mutation in the embryonic hematopoietic system (Vav1-iCre;Brca1 F22-24/F22-24 ) developed hematopoietic defects in early adulthood that included reduced hematopoietic stem cells (HSCs). Although mice homozygous for a huBRCA1 knockin allele (Brca1 BRCA1/BRCA1 ) were normal, mice with a mutant huBRCA1/5382insC allele and a null allele (Mx1-Cre;Brca1 F22-24/5382insC ) had severe hematopoietic defects marked by a complete loss of hematopoietic stem and progenitor cells. Our data show that Brca1 is necessary for HSC maintenance and normal hematopoiesis and that distinct mutations lead to different degrees of hematopoietic dysfunction. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Donglai; Zuo, Tao; Hora, Bhavna

Background: Fitness costs and slower disease progression are associated with a cytolytic T lymphocyte (CTL) escape mutation T242N in Gag in HIV-1-infected individuals carrying HLA-B*57/5801 alleles. However, the impact of different context in diverse HIV-1 strains on the fitness costs due to the T242N mutation has not been well characterized. To better understand the extent of fitness costs of the T242N mutation and the repair of fitness loss through compensatory amino acids, we investigated its fitness impact in different transmitted/founder (T/F) viruses. Results: The T242N mutation resulted in various levels of fitness loss in four different T/F viruses. However, themore » fitness costs were significantly compromised by preexisting compensatory amino acids in (Isoleucine at position 247) or outside (glutamine at position 219) the CTL epitope. Moreover, the transmitted T242N escape mutant in subject CH131 was as fit as the revertant N242T mutant and the elimination of the compensatory amino acid I247 in the T/F viral genome resulted in significant fitness cost, suggesting the fitness loss caused by the T242N mutation had been fully repaired in the donor at transmission. Analysis of the global circulating HIV-1 sequences in the Los Alamos HIV Sequence Database showed a high prevalence of compensatory amino acids for the T242N mutation and other T cell escape mutations. Conclusions: Our results show that the preexisting compensatory amino acids in the majority of circulating HIV-1 strains could significantly compromise the fitness loss due to CTL escape mutations and thus increase challenges for T cell based vaccines.« less

A founder mutation in PET100 causes isolated complex IV deficiency in Lebanese individuals with Leigh syndrome.

PubMed

Lim, Sze Chern; Smith, Katherine R; Stroud, David A; Compton, Alison G; Tucker, Elena J; Dasvarma, Ayan; Gandolfo, Luke C; Marum, Justine E; McKenzie, Matthew; Peters, Heidi L; Mowat, David; Procopis, Peter G; Wilcken, Bridget; Christodoulou, John; Brown, Garry K; Ryan, Michael T; Bahlo, Melanie; Thorburn, David R

2014-02-06

Leigh syndrome (LS) is a severe neurodegenerative disorder with characteristic bilateral lesions, typically in the brainstem and basal ganglia. It usually presents in infancy and is genetically heterogeneous, but most individuals with mitochondrial complex IV (or cytochrome c oxidase) deficiency have mutations in the biogenesis factor SURF1. We studied eight complex IV-deficient LS individuals from six families of Lebanese origin. They differed from individuals with SURF1 mutations in having seizures as a prominent feature. Complementation analysis suggested they had mutation(s) in the same gene but targeted massively parallel sequencing (MPS) of 1,034 genes encoding known mitochondrial proteins failed to identify a likely candidate. Linkage and haplotype analyses mapped the location of the gene to chromosome 19 and targeted MPS of the linkage region identified a homozygous c.3G>C (p.Met1?) mutation in C19orf79. Abolishing the initiation codon could potentially still allow initiation at a downstream methionine residue but we showed that this would not result in a functional protein. We confirmed that mutation of this gene was causative by lentiviral-mediated phenotypic correction. C19orf79 was recently renamed PET100 and predicted to encode a complex IV biogenesis factor. We showed that it is located in the mitochondrial inner membrane and forms a ∼300 kDa subcomplex with complex IV subunits. Previous proteomic analyses of mitochondria had overlooked PET100 because its small size was below the cutoff for annotating bona fide proteins. The mutation was estimated to have arisen at least 520 years ago, explaining how the families could have different religions and different geographic origins within Lebanon. Copyright © 2014 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Inhibition of Mutated Isocitrate Dehydrogenase 1 in Cancer.

PubMed

Wu, Fangrui; Cheng, Gang; Yao, Yuan; Kogiso, Mari; Jiang, Hong; Li, Xiao-Nan; Song, Yongcheng

2018-05-23

R132H mutation of isocitrate dehydrogenase 1 (IDH1) are found in ~75% of low-grade gliomas and secondary glioblastomas as well as in several other types of cancer. More chemotypes of inhibitors of IDH1(R132H) are therefore needed. To develop a new class of IDH1(R132H) inhibitors as potent antitumor agents. A biochemical assay was developed to find inhibitors of IDH1(R132H) mutant enzyme. Chemical synthesis and structure activity relationship studies were used to find compounds with improved potency. Antitumor activities of selected compounds were evaluated. A series of aromatic sulfonamide compounds were found to be novel, potent inhibitors of IDH1(R132H) with Ki values as low as 0.6 µM. Structure activity relationships of these compounds are discussed. Enzyme kinetics studies showed that one compound is a competitive inhibitor against the substrate α-KG and a non-competitive inhibitor against the cofactor NADPH. Several inhibitors were found to have no activity against wild-type IDH1, showing a high selectivity. Two potent inhibitors exhibited strong activity against proliferation of BT142 glioma cells with IDH1 R132H mutation, while these compounds did not significantly affect growth of glioma cells without IDH1 mutation. This novel series of IDH1(R132H) inhibitors have potential to be further developed for the treatment of glioma with IDH1 mutation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Prediction of BRCA1 and BRCA2 mutation status using post-irradiation assays of lymphoblastoid cell lines is compromised by inter-cell-line phenotypic variability.

PubMed

Lovelock, Paul K; Wong, Ee Ming; Sprung, Carl N; Marsh, Anna; Hobson, Karen; French, Juliet D; Southey, Melissa; Sculley, Tom; Pandeya, Nirmala; Brown, Melissa A; Chenevix-Trench, Georgia; Spurdle, Amanda B; McKay, Michael J

2007-09-01

Assays to determine the pathogenicity of unclassified sequence variants in disease-associated genes include the analysis of lymphoblastoid cell lines (LCLs). We assessed the ability of several assays of LCLs to distinguish carriers of germline BRCA1 and BRCA2 gene mutations from mutation-negative controls to determine their utility for use in a diagnostic setting. Post-ionising radiation cell viability and micronucleus formation, and telomere length were assayed in LCLs carrying BRCA1 or BRCA2 mutations, and in unaffected mutation-negative controls. Post-irradiation cell viability and micronucleus induction assays of LCLs from individuals carrying pathogenic BRCA1 mutations, unclassified BRCA1 sequence variants or wildtype BRCA1 sequence showed significant phenotypic heterogeneity within each group. Responses were not consistent with predicted functional consequences of known pathogenic or normal sequences. Telomere length was also highly heterogeneous within groups of LCLs carrying pathogenic BRCA1 or BRCA2 mutations, and normal BRCA1 sequences, and was not predictive of mutation status. Given the significant degree of phenotypic heterogeneity of LCLs after gamma-irradiation, and the lack of association with BRCA1 or BRCA2 mutation status, we conclude that the assays evaluated in this study should not be used as a means of differentiating pathogenic and non-pathogenic sequence variants for clinical application. We suggest that a range of normal controls must be included in any functional assays of LCLs to ensure that any observed differences between samples reflect the genotype under investigation rather than generic inter-individual variation.

Clinical resistance associated with a novel MAP2K1 mutation in a patient with Langerhans cell histiocytosis.

PubMed

Azorsa, David O; Lee, David W; Wai, Daniel H; Bista, Ranjan; Patel, Apurvi R; Aleem, Eiman; Henry, Michael M; Arceci, Robert J

2018-05-16

Patients with Langerhans cell histiocytosis (LCH) harbor BRAF V600E and activating mutations of MAP2K1/MEK1 in 50% and 25% of cases, respectively. We evaluated a patient with treatment-refractory LCH for mutations in the RAS-RAF-MEK-ERK pathway and identified a novel mutation in the MAP2K1 gene resulting in a p.L98_K104 > Q deletion and predicted to be auto-activating. During treatment with the MEK inhibitor trametinib, the patient's disease showed significant progression. In vitro characterization of the MAP2K1 p.L98_K104 > Q deletion confirmed its effect on cellular activation of the ERK pathway and drug resistance. © 2018 Wiley Periodicals, Inc.

MKS1 regulates ciliary INPP5E levels in Joubert syndrome

PubMed Central

Slaats, Gisela G.; Isabella, Christine R.; Kroes, Hester Y.; Dempsey, Jennifer C.; Gremmels, Hendrik; Monroe, Glen R.; Phelps, Ian G.; Duran, Karen J.; Adkins, Jonathan; Kumar, Sairam A.; Knutzen, Dana M.; Knoers, Nine V.; Mendelsohn, Nancy J.; Neubauer, David; Mastroyianni, Sotiria D.; Vogt, Julie; Worgan, Lisa; Karp, Natalya; Bowdin, Sarah; Glass, Ian A.; Parisi, Melissa A.; Otto, Edgar A.; Johnson, Colin A.; Hildebrandt, Friedhelm; van Haaften, Gijs; Giles, Rachel H.; Doherty, Dan

2016-01-01

Background Joubert syndrome (JS) is a recessive ciliopathy characterized by a distinctive brain malformation “the molar tooth sign”. Mutations in >27 genes cause JS, and mutations in 12 of these genes also cause Meckel syndrome (MKS). The goals of this work are to describe the clinical features of MKS1-related JS and determine whether disease causing MKS1 mutations affect cellular phenotypes such as cilium number, length and protein content as potential mechanisms underlying JS. Methods We measured cilium number, length and protein content (ARL13B and INPP5E) by immunofluorescence in fibroblasts from individuals with MKS1-related JS and in a 3D spheroid rescue assay to test the effects of disease-related MKS1 mutations. Results We report MKS1 mutations (eight of them previously unreported) in nine individuals with JS. A minority of the individuals with MKS1-related JS have MKS features. In contrast to the truncating mutations associated with MKS, all of the individuals with MKS1-related JS carry ≥1 non-truncating mutation. Fibroblasts from individuals with MKS1-related JS make normal or fewer cilia than control fibroblasts, their cilia are more variable in length than controls, and show decreased ciliary ARL13B and INPP5E. Additionally, MKS1 mutant alleles have similar effects in 3D spheroids. Conclusions MKS1 functions in the transition zone at the base of the cilium to regulate ciliary INPP5E content, through an ARL13B-dependent mechanism. Mutations in INPP5E also cause JS, so our findings in patient fibroblasts support the notion that loss of INPP5E function, due to either mutation or mislocalization, is a key mechanism underlying JS, downstream of MKS1 and ARL13B. PMID:26490104

Leigh syndrome associated with mitochondrial complex I deficiency due to a novel mutation in the NDUFS1 gene.

PubMed

Martín, Miguel A; Blázquez, Alberto; Gutierrez-Solana, Luis G; Fernández-Moreira, Daniel; Briones, Paz; Andreu, Antoni L; Garesse, Rafael; Campos, Yolanda; Arenas, Joaquín

2005-04-01

Mutations in the nuclear-encoded subunits of complex I of the mitochondrial respiratory chain are a recognized cause of Leigh syndrome (LS). Recently, 6 mutations in the NDUFS1 gene were identified in 3 families. To describe a Spanish family with LS, complex I deficiency in muscle, and a novel mutation in the NDUFS1 gene. Using molecular genetic approaches, we identified the underlying molecular defect in a patient with LS with a complex I defect. The proband was a child who displayed the clinical features of LS. Muscle biochemistry results showed a complex I defect of the mitochondrial respiratory chain. Sequencing analysis of the mitochondrial DNA-encoded ND genes, the nuclear DNA-encoded NDUFV1, NDUFS1, NDUFS2, NDUFS4, NDUFS6, NDUFS7, NDUFS8, and NDUFAB1 genes, and the complex I assembly factor CIA30 gene revealed a novel homozygous L231V mutation (c.691C-->G) in the NDUFS1 gene. The parents were heterozygous carriers of the L231V mutation. Identifying nuclear mutations as a cause of respiratory chain disorders will enhance the possibility of prenatal diagnosis and help us understand how molecular defects can lead to complex I deficiency.

Novel USH2A compound heterozygous mutations cause RP/USH2 in a Chinese family.

PubMed

Liu, Xiaowen; Tang, Zhaohui; Li, Chang; Yang, Kangjuan; Gan, Guanqi; Zhang, Zibo; Liu, Jingyu; Jiang, Fagang; Wang, Qing; Liu, Mugen

2010-03-17

To identify the disease-causing gene in a four-generation Chinese family affected with retinitis pigmentosa (RP). Linkage analysis was performed with a panel of microsatellite markers flanking the candidate genetic loci of RP. These loci included 38 known RP genes. The complete coding region and exon-intron boundaries of Usher syndrome 2A (USH2A) were sequenced with the proband DNA to screen the disease-causing gene mutation. Restriction fragment length polymorphism (RFLP) analysis and direct DNA sequence analysis were done to demonstrate co-segregation of the USH2A mutations with the family disease. One hundred normal controls were used without the mutations. The disease-causing gene in this Chinese family was linked to the USH2A locus on chromosome 1q41. Direct DNA sequence analysis of USH2A identified two novel mutations in the patients: one missense mutation p.G1734R in exon 26 and a splice site mutation, IVS32+1G>A, which was found in the donor site of intron 32 of USH2A. Neither the p.G1734R nor the IVS32+1G>A mutation was found in the unaffected family members or the 100 normal controls. One patient with a homozygous mutation displayed only RP symptoms until now, while three patients with compound heterozygous mutations in the family of study showed both RP and hearing impairment. This study identified two novel mutations: p.G1734R and IVS32+1G>A of USH2A in a four-generation Chinese RP family. In this study, the heterozygous mutation and the homozygous mutation in USH2A may cause Usher syndrome Type II or RP, respectively. These two mutations expand the mutant spectrum of USH2A.

Fragment length analysis screening for detection of CEBPA mutations in intermediate-risk karyotype acute myeloid leukemia.

PubMed

Fuster, Oscar; Barragán, Eva; Bolufer, Pascual; Such, Esperanza; Valencia, Ana; Ibáñez, Mariam; Dolz, Sandra; de Juan, Inmaculada; Jiménez, Antonio; Gómez, Maria Teresa; Buño, Ismael; Martínez, Joaquín; Cervera, José; Montesinos, Pau; Moscardó, Federico; Sanz, Miguel Ángel

2012-01-01

During last years, molecular markers have been increased as prognostic factors routinely screened in acute myeloid leukemia (AML). Recently, an increasing interest has been reported in introducing to clinical practice screening for mutations in the CCAAT/enhancer-binding protein α (CEBPA) gene in AML, as it seems to be a good prognostic factor. However, there is no reliable established method for assessing CEBPA mutations during the diagnostic work-up of AMLs. We describe here a straightforward and reliable fragment analysis method based in PCR capillary electrophoresis (PCR-CE) for screening of CEBPA mutations; moreover, we present the results obtained in 151 intermediate-risk karyotype AML patients (aged 16-80 years). The method gave a specificity of 100% and sensitivity of 93% with a lower detection limit of 1-5% for CEBPA mutations. The series found 19 mutations and four polymorphisms in 12 patients, seven of whom (58%) presented two mutations. The overall frequency of CEBPA mutations in AML was 8% (n = 12). CEBPA mutations showed no coincidence with FLT3-ITD or NPM1 mutations. CEBPA mutation predicted better disease-free survival in the group of patients without FLT3-ITD, NPM, or both genes mutated (HR 3.6, IC 95%; 1.0-13.2, p = 0.05) and better overall survival in patients younger than 65 of this group without molecular markers (HR 4.0, IC 95%; 1.0-17.4, p = 0.05). In conclusion, the fragment analysis method based in PCR-CE is a rapid, specific, and sensitive method for CEBPA mutation screening and our results confirm that CEBPA mutations can identify a subgroup of patients with favorable prognosis in AML with intermediate-risk karyotype.

Preleukemic and second-hit mutational events in an acute myeloid leukemia patient with a novel germline RUNX1 mutation.

PubMed

Ng, Isaac Ks; Lee, Joanne; Ng, Christopher; Kosmo, Bustamin; Chiu, Lily; Seah, Elaine; Mok, Michelle Meng Huang; Tan, Karen; Osato, Motomi; Chng, Wee-Joo; Yan, Benedict; Tan, Lip Kun

2018-01-01

Germline mutations in the RUNX1 transcription factor give rise to a rare autosomal dominant genetic condition classified under the entity: Familial Platelet Disorders with predisposition to Acute Myeloid Leukaemia (FPD/AML). While several studies have identified a myriad of germline RUNX1 mutations implicated in this disorder, second-hit mutational events are necessary for patients with hereditary thrombocytopenia to develop full-blown AML. The molecular picture behind this process remains unclear. We describe a patient of Malay descent with an unreported 7-bp germline RUNX1 frameshift deletion, who developed second-hit mutations that could have brought about the leukaemic transformation from a pre-leukaemic state. These mutations were charted through the course of the treatment and stem cell transplant, showing a clear correlation between her clinical presentation and the mutations present. The patient was a 27-year-old Malay woman who presented with AML on the background of hereditary thrombocytopenia affecting her father and 3 brothers. Initial molecular testing revealed the same novel RUNX1 mutation in all 5 individuals. The patient received standard induction, consolidation chemotherapy, and a haploidentical stem cell transplant from her mother with normal RUNX1 profile. Comprehensive genomic analyses were performed at diagnosis, post-chemotherapy and post-transplant. A total of 8 mutations ( RUNX1 , GATA2 , DNMT3A , BCORL1 , BCOR , 2 PHF6 and CDKN2A ) were identified in the pre-induction sample, of which 5 remained ( RUNX1 , DNMT3A , BCORL1 , BCOR and 1 out of 2 PHF6 ) in the post-treatment sample and none were present post-transplant. In brief, the 3 mutations which were lost along with the leukemic cells at complete morphological remission were most likely acquired leukemic driver mutations that were responsible for the AML transformation from a pre-leukemic germline RUNX1 -mutated state. On the contrary, the 5 mutations that persisted post-treatment, including the germline RUNX1 mutation, were likely to be part of the preleukemic clone. Further studies are necessary to assess the prevalence of these preleukemic and secondary mutations in the larger FPD/AML patient cohort and establish their prognostic significance. Given the molecular heterogeneity of FPD/AML and other AML subtypes, a better understanding of mutational classes and their involvement in AML pathogenesis can improve risk stratification of patients for more effective and targeted therapy.

Prognostic implications of mutation-specific QTc standard deviation in congenital long QT syndrome.

PubMed

Mathias, Andrew; Moss, Arthur J; Lopes, Coeli M; Barsheshet, Alon; McNitt, Scott; Zareba, Wojciech; Robinson, Jennifer L; Locati, Emanuela H; Ackerman, Michael J; Benhorin, Jesaia; Kaufman, Elizabeth S; Platonov, Pyotr G; Qi, Ming; Shimizu, Wataru; Towbin, Jeffrey A; Michael Vincent, G; Wilde, Arthur A M; Zhang, Li; Goldenberg, Ilan

2013-05-01

Individual corrected QT interval (QTc) may vary widely among carriers of the same long QT syndrome (LQTS) mutation. Currently, neither the mechanism nor the implications of this variable penetrance are well understood. To hypothesize that the assessment of QTc variance in patients with congenital LQTS who carry the same mutation provides incremental prognostic information on the patient-specific QTc. The study population comprised 1206 patients with LQTS with 95 different mutations and ≥ 5 individuals who carry the same mutation. Multivariate Cox proportional hazards regression analysis was used to assess the effect of mutation-specific standard deviation of QTc (QTcSD) on the risk of cardiac events (comprising syncope, aborted cardiac arrest, and sudden cardiac death) from birth through age 40 years in the total population and by genotype. Assessment of mutation-specific QTcSD showed large differences among carriers of the same mutations (median QTcSD 45 ms). Multivariate analysis showed that each 20 ms increment in QTcSD was associated with a significant 33% (P = .002) increase in the risk of cardiac events after adjustment for the patient-specific QTc duration and the family effect on QTc. The risk associated with QTcSD was pronounced among patients with long QT syndrome type 1 (hazard ratio 1.55 per 20 ms increment; P<.001), whereas among patients with long QT syndrome type 2, the risk associated with QTcSD was not statistically significant (hazard ratio 0.99; P = .95; P value for QTcSD-by-genotype interaction = .002). Our findings suggest that mutations with a wider variation in QTc duration are associated with increased risk of cardiac events. These findings appear to be genotype-specific, with a pronounced effect among patients with the long QT syndrome type 1 genotype. Copyright © 2013. Published by Elsevier Inc.

Identification of a novel functional JAK1 S646P mutation in acute lymphoblastic leukemia

PubMed Central

Hu, Liangding; Ning, Hongmei; Jiang, Min; Wang, Danhong; Liu, Tingting; Zhang, Bin; Chen, Hu

2017-01-01

The survival rate of childhood acute lymphoblastic leukemia (ALL) is approaching 90%, while the prognosis of adults remains poor due to the limited therapeutic approaches. In order to identify new targets for ALL, we performed whole-exome sequencing on four adults with B-ALL and discovered a somatic JAK1 S646P mutation. Sanger sequencing of JAK1 was conducted on 53 ALL patients, and two cases exhibited A639G and P960S mutations separately. Functional studies demonstrated that only JAK1 S646P mutation could activate multiple signaling pathways, drive cytokine-independent cell growth, and promote proliferation of malignant cells in nude mice. Moreover, a high sensitivity to the JAK1/2 inhibitor ruxolitinib was observed in S646P mutant model. Exploration in a total of 209 ALL cases showed that JAK1 mutations occur at a frequency of 10.5% in T-ALL (2/19) and 1.6% in B-ALL (3/190). Collectively, our results suggested that JAK1 S646P is an activating mutation in vitro and in vivo. JAK-STAT pathway might represent a promising therapeutic target for ALL. PMID:28410228

Identification of a novel functional JAK1 S646P mutation in acute lymphoblastic leukemia.

PubMed

Li, Qian; Li, Botao; Hu, Liangding; Ning, Hongmei; Jiang, Min; Wang, Danhong; Liu, Tingting; Zhang, Bin; Chen, Hu

2017-05-23

The survival rate of childhood acute lymphoblastic leukemia (ALL) is approaching 90%, while the prognosis of adults remains poor due to the limited therapeutic approaches. In order to identify new targets for ALL, we performed whole-exome sequencing on four adults with B-ALL and discovered a somatic JAK1 S646P mutation. Sanger sequencing of JAK1 was conducted on 53 ALL patients, and two cases exhibited A639G and P960S mutations separately. Functional studies demonstrated that only JAK1 S646P mutation could activate multiple signaling pathways, drive cytokine-independent cell growth, and promote proliferation of malignant cells in nude mice. Moreover, a high sensitivity to the JAK1/2 inhibitor ruxolitinib was observed in S646P mutant model. Exploration in a total of 209 ALL cases showed that JAK1 mutations occur at a frequency of 10.5% in T-ALL (2/19) and 1.6% in B-ALL (3/190). Collectively, our results suggested that JAK1 S646P is an activating mutation in vitro and in vivo. JAK-STAT pathway might represent a promising therapeutic target for ALL.

BRAFV600E mutation in the diagnosis of unicystic ameloblastoma.

PubMed

Pereira, Núbia Braga; Pereira, Karuza Maria Alves; Coura, Bruna Pizziolo; Diniz, Marina Gonçalves; de Castro, Wagner Henriques; Gomes, Carolina Cavalieri; Gomez, Ricardo Santiago

2016-11-01

Unicystic ameloblastoma, an odontogenic neoplasm, presents clinical and radiographic similarities with dentigerous and radicular cysts, non-neoplastic lesions. It is not always possible to reach a final diagnosis with the incisional biopsy, leading to inappropriate treatment. The BRAFV600E activating mutation has been reported in a high proportion of ameloblastomas. The purpose of the study was to assess the utility of the detection of the BRAFV600E mutation in the differential diagnosis of unicystic ameloblastoma with dentigerous and radicular cysts. Twenty-six archival samples were included, comprising eight unicystic ameloblastomas (UAs), nine dentigerous and nine radicular cysts. The mutation was assessed in all samples by anti-BRAFV600E (clone VE1) immunohistochemistry (IHC) and by TaqMan mutation detection qPCR assay. Sanger sequencing was further carried out when samples showed conflicting results in the IHC and qPCR. Although all UAs (8/8) showed positive uniform BRAFV600E staining along the epithelial lining length, the mutation was not confirmed by qPCR and Sanger sequencing in three samples. Positive staining for the BRAFV600E protein was observed in one dentigerous cyst, but it was not confirmed by the molecular methods. Furthermore, 2/9 dentigerous cysts and 2/9 radicular cysts showed non-specific immunostaining of the epithelium or plasma cells. None of the dentigerous or radicular cysts cases presented the BRAFV600E mutation in the qPCR assay. The BRAFV600E antibody (clone VE1) IHC may show non-specific staining, but molecular assays may be useful for the diagnosis of unicystic ameloblastoma, in conjunction with clinical, radiological and histopathological features. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

[Construction and characterization of an epitope-mutated Asia 1 type foot-and-mouth disease virus].

PubMed

Zhang, Yan; Hu, Yonghao; Yang, Fan; Yang, Bo; Wang, Songhao; Zhu, Zixiang; Zheng, Haixue

2015-01-01

To generate an epitope-mutated foot-and-mouth disease virus (FMDV) as a marker vaccine, the infectious clone pAsia 1-FMDV containing the complete genomic cDNA of Asia 1 type FMDV was used as backbone, the residues at positions 27 and 31 in the 3D gene were mutated (H27Y and N31R). The resulting plasmid pAsia 1-FMDV-3DM encoding a mutated epitope was transfected into BHK-21 cells and the recombinant virus rAsia 1-3DM was rescued. The recombinant virus showed similar biological characteristics comparable with the parental virus. In serological neutralization test the antisera against recombine virus have a good reactivity with parental virus. The antisera against the mutant virus were shown to be reactive with the mutated epitope but not the wild-type one. The results indicated that the two virus strains could be distinguished by western blotting using synthetic peptides. This epitope-mutated FMDV strain will be evaluated as a potential marker vaccine against FMDV infections.

Germline mutations in lysine specific demethylase 1 (LSD1/KDM1A) confer susceptibility to multiple myeloma.

PubMed

Wei, Xiaomu; Calvo-Vidal, M Nieves; Chen, Siwei; Wu, Gang; Revuelta, Maria V; Sun, Jian; Zhang, Jinghui; Walsh, Michael F; Nichols, Kim E; Joseph, Vijai; Snyder, Carrie; Vachon, Celine M; McKay, James D; Wang, Shu-Ping; Jayabalan, David S; Jacobs, Lauren M; Becirovic, Dina; Waller, Rosalie G; Artomov, Mykyta; Viale, Agnes; Patel, Jayeshkumar; Phillip, Jude M; Chen-Kiang, Selina; Curtin, Karen; Salama, Mohamed; Atanackovic, Djordje; Niesvizky, Ruben; Landgren, Ola; Slager, Susan L; Godley, Lucy A; Churpek, Jane; Garber, Judy E; Anderson, Kenneth C; Daly, Mark J; Roeder, Robert G; Dumontet, Charles; Lynch, Henry T; Mullighan, Charles G; Camp, Nicola J; Offit, Kenneth; Klein, Robert J; Yu, Haiyuan; Cerchietti, Leandro; Lipkin, Steven M

2018-03-20

Given the frequent and largely incurable occurrence of multiple myeloma (MM), identification of germline genetic mutations that predispose cells to MM may provide insight into disease etiology and the developmental mechanisms of its cell of origin, the plasma cell. Here we identified familial and early-onset MM kindreds with truncating mutations in lysine-specific demethylase 1 (LSD1/KDM1A), an epigenetic transcriptional repressor that primarily demethylates histone H3 on lysine 4 and regulates hematopoietic stem cell self-renewal. Additionally, we found higher rates of germline truncating and predicted deleterious missense KDM1A mutations in MM patients unselected for family history compared to controls. Both monoclonal gammopathy of unknown significance (MGUS) and MM cells have significantly lower KDM1A transcript levels compared with normal plasma cells. Transcriptome analysis of MM cells from KDM1A mutation carriers shows enrichment of pathways and MYC target genes previously associated with myeloma pathogenesis. In mice, antigen challenge followed by pharmacological inhibition of KDM1A promoted plasma cell expansion, enhanced secondary immune response, elicited appearance of serum paraprotein, and mediated upregulation of MYC transcriptional targets. These changes are consistent with the development of MGUS. Collectively, our findings show KDM1A is the first autosomal dominant MM germline predisposition gene, providing new insights into its mechanistic roles as a tumor suppressor during post-germinal center B cell differentiation. Copyright ©2018, American Association for Cancer Research.

Postzygotic HRAS mutation causing both keratinocytic epidermal nevus and thymoma and associated with bone dysplasia and hypophosphatemia due to elevated FGF23.

PubMed

Avitan-Hersh, Emily; Tatur, Sameh; Indelman, Margarita; Gepstein, Vardit; Shreter, Roni; Hershkovitz, Dov; Brick, Riva; Bergman, Reuven; Tiosano, Dov

2014-01-01

Epidermal nevus syndrome is a rare group of disorders characterized by the combination of congenital epidermal nevi and extracutaneous features, including skeletal, neurological, ocular, and other systemic findings. We report a case of keratinocytic epidermal nevus syndrome that includes a thymoma, bone dysplasia, and hypophosphatemia with elevated fibroblast growth factor 23 (FGF23) levels associated with postzygotic HRAS mutation. A 14-year-old boy was admitted due to recent limping. The physical examination revealed multiple right-sided linear epidermal nevi along Blaschko's lines. Magnetic resonance imaging showed cystic lesions in cervical bones and thymoma, and x-ray examination showed cystic lesions in the hands. Biochemical studies demonstrated severe hypophosphatemia, normocalcemia, high normal PTH, low 25-hydroxyvitamin D and low 1,25-dihydroxyvitamin D levels. The serum FGF23 C-terminal level was normal, but the intact FGF23 level was found to be elevated. Genetic evaluation revealed a heterozygote mutation in the HRAS gene in both the keratinocytic epidermal nevus and thymoma but not in DNA extracted from blood lymphocytes, thus establishing the mutation as postzygotic. Postzygotic mutations in HRAS lead to elevation of FGF23 levels, as found in mutated PHEX, FGF23, DMP1, and ENPP1 genes, which lead to hypophosphatemia. An identical postzygotic HRAS mutation was shown to be present in both keratinocytic epidermal nevus and thymoma and to be associated with bone lesions and hypophosphatemia due to elevated FGF23 levels. These may all be related to the HRAS mutation.

Pitfalls in molecular analysis for mismatch repair deficiency in a family with biallelic pms2 germline mutations.

PubMed

Leenen, C H M; Geurts-Giele, W R R; Dubbink, H J; Reddingius, R; van den Ouweland, A M; Tops, C M J; van de Klift, H M; Kuipers, E J; van Leerdam, M E; Dinjens, W N M; Wagner, A

2011-12-01

Heterozygous germline mutations in the mismatch repair (MMR) genes MLH1, MSH2, MSH6 and PMS2 cause Lynch syndrome. Biallelic mutations in the MMR genes are associated with a childhood cancer syndrome [constitutional mismatch repair deficiency (CMMR-D)]. This is predominantly characterized by hematological malignancies and tumors of the bowel and brain, often associated with signs of neurofibromatosis type 1 (NF1). Diagnostic strategies for selection of patients for MMR gene analysis include analysis of microsatellite instability (MSI) and immunohistochemical (IHC) analysis of MMR proteins in tumor tissue. We report the clinical characterization and molecular analyses of tumor specimens from a family with biallelic PMS2 germline mutations. This illustrates the pitfalls of present molecular screening strategies. Tumor tissues of five family members were analyzed for MSI and IHC. MSI was observed in only one of the analyzed tissues. However, IHC analysis of brain tumor tissue of the index patient and his sister showed absence of PMS2 expression, and germline mutation analyses showed biallelic mutations in PMS2: p.Ser46IIe and p.Pro246fs. The same heterozygous mutations were confirmed in the father and mother, respectively. These data support the conclusion that in case of a clinical phenotype of CMMR-D, it is advisable to routinely combine MSI analysis with IHC analysis for the expression of MMR proteins. With inconclusive or conflicting results, germline mutation analysis of the MMR genes should be considered after thorough counselling of the patients and/or their relatives. © 2011 John Wiley & Sons A/S.

De novo constitutional MLH1 epimutations confer early-onset colorectal cancer in two new sporadic Lynch syndrome cases, with derivation of the epimutation on the paternal allele in one.

PubMed

Goel, Ajay; Nguyen, Thuy-Phuong; Leung, Hon-Chiu E; Nagasaka, Takeshi; Rhees, Jennifer; Hotchkiss, Erin; Arnold, Mildred; Banerji, Pia; Koi, Minoru; Kwok, Chau-To; Packham, Deborah; Lipton, Lara; Boland, C Richard; Ward, Robyn L; Hitchins, Megan P

2011-02-15

Lynch syndrome is an autosomal dominant cancer predisposition syndrome classically caused by germline mutations of the mismatch repair genes, MLH1, MSH2, MSH6 and PMS2. Constitutional epimutations of the MLH1 gene, characterized by soma-wide methylation of a single allele of the promoter and allelic transcriptional silencing, have been identified in a subset of Lynch syndrome cases lacking a sequence mutation in MLH1. We report two individuals with no family history of colorectal cancer who developed that disease at age 18 and 20 years. In both cases, cancer had arisen because of the de novo occurrence of a constitutional MLH1 epimutation and somatic loss-of-heterozygosity of the functional allele in the tumors. We show for the first time that the epimutation in one case arose on the paternally inherited allele. Analysis of 13 tumors from seven individuals with constitutional MLH1 epimutations showed eight tumors had lost the second MLH1 allele, two tumors had a novel pathogenic missense mutation and three had retained heterozygosity. Only 1 of 12 tumors demonstrated the BRAF V600E mutation and 3 of 11 tumors harbored a mutation in KRAS. The finding that epimutations can originate on the paternal allele provides important new insights into the mechanism of origin of epimutations. It is clear that the second hit in MLH1 epimutation-associated tumors typically has a genetic not epigenetic basis. Individuals with mismatch repair-deficient cancers without the BRAF V600E mutation are candidates for germline screening for sequence or methylation changes in MLH1. Copyright © 2010 UICC.

De novo constitutional MLH1 epimutations confer early-onset colorectal cancer in two new sporadic Lynch syndrome cases, with derivation of the epimutation on the paternal allele in one

PubMed Central

Goel, Ajay; Nguyen, Thuy-Phuong; Leung, Hon-Chiu E.; Nagasaka, Takeshi; Rhees, Jennifer; Hotchkiss, Erin; Arnold, Mildred; Banerji, Pia; Koi, Minoru; Kwok, Chau-To; Packham, Deborah; Lipton, Lara; Boland, C. Richard; Ward, Robyn L.; Hitchins, Megan P.

2013-01-01

Lynch syndrome is an autosomal dominant cancer predisposition syndrome classically caused by germline mutations of the mismatch repair genes, MLH1, MSH2, MSH6 and PMS2. Constitutional epimutations of the MLH1 gene, characterized by soma-wide methylation of a single allele of the promoter and allelic transcriptional silencing, have been identified in a subset of Lynch syndrome cases lacking a sequence mutation in MLH1. We report two individuals with no family history of colorectal cancer who developed that disease at age 18 and 20 years. In both cases, cancer had arisen because of the de novo occurrence of a constitutional MLH1 epimutation and somatic loss-of-heterozygosity of the functional allele in the tumors. We show for the first time that the epimutation in one case arose on the paternally inherited allele. Analysis of 13 tumors from seven individuals with constitutional MLH1 epimutations showed eight tumors had lost the second MLH1 allele, two tumors had a novel pathogenic missense mutation and three had retained heterozygosity. Only 1 of 12 tumors demonstrated the BRAF V600E mutation and 3 of 11 tumors harbored a mutation in KRAS. The finding that epimutations can originate on the paternal allele provides important new insights into the mechanism of origin of epimutations. It is clear that the second hit in MLH1 epimutation-associated tumors typically has a genetic not epigenetic basis. Individuals with mismatch repair–deficient cancers without the BRAF V600E mutation are candidates for germline screening for sequence or methylation changes in MLH1. PMID:20473912

Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnb1.

PubMed

Fang, Ling; Du, William W; Lyu, Juanjuan; Dong, Jun; Zhang, Chao; Yang, Weining; He, Alina; Kwok, Yat Sze Sheila; Ma, Jian; Wu, Nan; Li, Feiya; Awan, Faryal Mehwish; He, Chengyan; Yang, Bing L; Peng, Chun; MacKay, Helen J; Yee, Albert J; Yang, Burton B

2018-05-23

TP53 mutations occur in many different types of cancers that produce mutant p53 proteins. The mutant p53 proteins have lost wild-type p53 activity and gained new functions that contribute to malignant tumor progression. Different p53 mutations create distinct profiles in loss of wild-type p53 activity and gain of functions. Targeting the consequences generated by the great number of p53 mutations would be extremely complex. Therefore, in this study we used a workaround and took advantage of the fact that mutant p53 cannot bind H2AX. Using this, we developed a new approach to repress the acquisition of mutant p53 functions. We show here that the delivery of a circular RNA circ-Ccnb1 inhibited the function of three p53 mutations. By microarray analysis and real-time PCR, we detected decreased circ-Ccnb1 expression levels in patients bearing breast carcinoma. Ectopic delivery of circ-Ccnb1 inhibited tumor growth and extended mouse viability. Using proteomics, we found that circ-Ccnb1 precipitated p53 in p53 wild-type cells, but instead precipitated Bclaf1 in p53 mutant cells. Further experiments showed that H2AX serves as a bridge, linking the interaction of circ-Ccnb1 and wild-type p53, thus allowing Bclaf1 to bind Bcl2 resulting in cell survival. In the p53 mutant cells, circ-Ccnb1 formed a complex with H2AX and Bclaf1, resulting in the induction of cell death. We found that this occurred in three p53 mutations. These results shed light on the possible development of new approaches to inhibit the malignancy of p53 mutations.

In vivo dopaminergic and serotonergic dysfunction in DCTN1 gene mutation carriers

PubMed Central

Felicio, Andre C.; Dinelle, Katherine; Agarwal, Pankaj A.; McKenzie, Jessamyn; Heffernan, Nicole; Road, Jeremy D.; Appel-Cresswell, Silke; Wszolek, Zbigniew K.; Farrer, Matthew J.; Schulzer, Michael; Sossi, Vesna; Stoessl, A. Jon

2014-01-01

Introduction We have used positron emission tomography (PET) to assess dopaminergic and serotonergic terminal density in three subjects carrying a mutation in the DCT1 gene, two clinically affected with Perry syndrome. Methods All subjects had brain imaging using 18F-6-fluoro-L-dopa (FDOPA, dopamine synthesis and storage), (+)-11C-dihydrotetrabenazine (DTBZ, vesicular monoamine transporter type 2), and 11C-raclopride (RAC, dopamine D2/D3 receptors). One subject also underwent PET with 11C-3-amino-4-(2-dimethylaminomethyl-phenylsulfanyl)-benzonitrile (DASB, serotonin transporter). Results FDOPA-PET and DTBZ-PET in the affected individuals showed a reduction of striatal tracer uptake. Also, RAC-PET showed higher uptake in these area. DASB-PET showed significant uptake changes in left orbitofrontal cortex, bilateral anterior insula, left dorsolateral prefrontal cortex, left orbitofrontal cortex, left posterior cingulate cortex, left caudate and left ventral striatum. Conclusions Our data showed evidence of both striatal dopaminergic and widespread cortical/subcortical serotonergic dysfunctions in individuals carrying a mutation in the DCTN1 gene. PMID:24797316

A novel lipoprotein lipase gene missense mutation in Chinese patients with severe hypertriglyceridemia and pancreatitis

PubMed Central

2014-01-01

Background Alterations or mutations in the lipoprotein lipase (LPL) gene contribute to severe hypertriglyceridemia (HTG). This study reported on two patients in a Chinese family with LPL gene mutations and severe HTG and acute pancreatitis. Methods Two patients with other five family members were included in this study for DNA-sequences of hyperlipidemia-related genes (such as LPL, APOC2, APOA5, LMF1, and GPIHBP1) and 43 healthy individuals and 70 HTG subjects were included for the screening of LPL gene mutations. Results Both patients were found to have a compound heterozygote for a novel LPL gene mutation (L279V) and a known mutation (A98T). Furthermore, one HTG subject out of 70 was found to carry this novel LPL L279V mutation. Conclusions The data from this study showed that compound heterozygote mutations of A98T and L279V inactivate lipoprotein lipase enzymatic activity and contribute to severe HTG and acute pancreatitis in two Chinese patients. Further study will investigate how these LPL gene mutations genetically inactivate the LPL enzyme. PMID:24646025

Mitochondrial recessive ataxia syndrome mimicking dominant spinocerebellar ataxia.

PubMed

Palin, Eino J H; Hakonen, Anna H; Korpela, Mari; Paetau, Anders; Suomalainen, Anu

2012-04-15

We studied the genetic background of a family with SCA, showing dominant inheritance and anticipation. Muscle histology, POLG1 gene sequence, neuropathology and mitochondrial DNA analyses in a mother and a son showed typical findings for a mitochondrial disorder, and both were shown to be homozygous for a recessive POLG1 mutation, underlying mitochondrial recessive ataxia syndrome, MIRAS. The healthy father was a heterozygous carrier for the same mutation. Recessively inherited MIRAS mutations should be tested in dominantly inherited SCAs cases of unknown cause, as the high carrier frequency of MIRAS may result in two independent introductions of the mutant allele in the family and thereby mimic dominant inheritance. Copyright © 2011 Elsevier B.V. All rights reserved.

Molecular diagnosis of generalized arterial calcification of infancy (GACI).

PubMed

Kalal, Iravathy Goud; Seetha, Dayakar; Panda, Anuradha; Nitschke, Yvonne; Rutsch, Frank

2012-04-01

Generalized arterial calcification of infancy (GACI) is a life-threatening disorder in young infants. Cardiovascular symptoms are usually apparent within the first month of life. The symptoms are caused by calcification of large and medium-sized arteries, including the aorta, coronary arteries, and renal arteries. Most of the patients die by 6 months of age because of heart failure. Recently, homozygous or compound heterozygous mutations for the ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) gene were reported as causative for the disorder. ENPP1 regulates extracellular inorganic pyrophosphate (PP(i)), a major inhibitor of extracellular matrix calcification. A newborn was diagnosed with GACI. The infant died at the age of 7 weeks of cardiac failure and the parents were referred to Molecular Biology and Cytogenetic lab for further workup. Cytogenetics analysis was performed on the parents, which showed normal karyotypes and mutational analysis for the ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) gene was also performed. The mutational analysis showed that both father and mother of the deceased infant were heterozygous carriers of the mutation c.749C>T (p.P250L) in exon 7 of ENPP1 and it was likely, that the deceased child carried the same mutation homozygous on both alleles and died of GACI resulting from this ENPP1 mutation. The couple was counseled and monitored for the second pregnancy. Amniocentesis was performed at 15 weeks of gestation for mutational analysis of the same gene in the second pregnancy. The analysis was negative for the parental mutations. One month after the birth of a healthy infant, peripheral blood was collected from the baby and sent for reconfirmation. The results again were negative for the mutation and the baby was on 6 months follow up and no major symptoms were seen. The parents of the child benefited enormously by learning about the disease much in advance and also its risk of recurrence. The main aim of this study is to emphasize on two aspects: (i) the importance of modern molecular techniques in diagnosis such a syndrome and (2) the difficulties faced by the physician to provide appropriate diagnosis and the adequate genetic counseling to the family without molecular facilities.

Molecular diagnosis of generalized arterial calcification of infancy (GACI)

PubMed Central

Kalal, Iravathy Goud; Seetha, Dayakar; Panda, Anuradha; Nitschke, Yvonne; Rutsch, Frank

2012-01-01

Generalized arterial calcification of infancy (GACI) is a life-threatening disorder in young infants. Cardiovascular symptoms are usually apparent within the first month of life. The symptoms are caused by calcification of large and medium-sized arteries, including the aorta, coronary arteries, and renal arteries. Most of the patients die by 6 months of age because of heart failure. Recently, homozygous or compound heterozygous mutations for the ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) gene were reported as causative for the disorder. ENPP1 regulates extracellular inorganic pyrophosphate (PPi), a major inhibitor of extracellular matrix calcification. A newborn was diagnosed with GACI. The infant died at the age of 7 weeks of cardiac failure and the parents were referred to Molecular Biology and Cytogenetic lab for further workup. Cytogenetics analysis was performed on the parents, which showed normal karyotypes and mutational analysis for the ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) gene was also performed. The mutational analysis showed that both father and mother of the deceased infant were heterozygous carriers of the mutation c.749C>T (p.P250L) in exon 7 of ENPP1 and it was likely, that the deceased child carried the same mutation homozygous on both alleles and died of GACI resulting from this ENPP1 mutation. The couple was counseled and monitored for the second pregnancy. Amniocentesis was performed at 15 weeks of gestation for mutational analysis of the same gene in the second pregnancy. The analysis was negative for the parental mutations. One month after the birth of a healthy infant, peripheral blood was collected from the baby and sent for reconfirmation. The results again were negative for the mutation and the baby was on 6 months follow up and no major symptoms were seen. The parents of the child benefited enormously by learning about the disease much in advance and also its risk of recurrence. The main aim of this study is to emphasize on two aspects: (i) the importance of modern molecular techniques in diagnosis such a syndrome and (2) the difficulties faced by the physician to provide appropriate diagnosis and the adequate genetic counseling to the family without molecular facilities. PMID:22629037

KIT pathway alterations in mucosal melanomas of the vulva and other sites.

PubMed

Omholt, Katarina; Grafström, Eva; Kanter-Lewensohn, Lena; Hansson, Johan; Ragnarsson-Olding, Boel K

2011-06-15

A significant proportion of mucosal melanomas contain alterations in KIT. The aim of this study was to characterize the pattern of KIT, NRAS, and BRAF mutations in mucosal melanomas at specific sites and to assess activation of the KIT downstream RAF/MEK/extracellular signal-regulated kinase (ERK) and phosphoinositide 3-kinase (PI3K)/AKT pathways in mucosal melanoma specimens. Seventy-one primary mucosal melanomas from various sites were studied. Mutation analysis was done by DNA sequencing. Expression of KIT, phosphorylated (p)-ERK, and p-AKT was evaluated by immunohistochemistry. KIT mutations were detected in 35% (8 of 23) of vulvar, 9% (2 of 22) of anorectal, 7% (1 of 14) of nasal cavity, and 20% (1 of 5) of penile melanomas. No KIT mutations were found in 7 vaginal melanomas. The difference in KIT mutation frequency between vulvar and nonvulvar cases was statistically significant (P = 0.014). The overall frequencies of NRAS and BRAF mutations were 10% and 6%, respectively. Notably, vaginal melanomas showed a NRAS mutation rate of 43%. KIT gene amplification (≥4 copies), as assessed by quantitative real-time PCR, was observed in 19% of cases. KIT expression was associated with KIT mutation status (P < 0.001) and was more common in vulvar than nonvulvar tumors (P = 0.016). Expression of p-ERK and p-AKT was observed in 42% and 59% of tumors, respectively, and occurred irrespective of KIT/NRAS/BRAF mutation status. NRAS mutation was associated with worse overall survival in univariate analysis. Results show that KIT mutations are more common in vulvar melanomas than other types of mucosal melanomas and that both the RAF/MEK/ERK and PI3K/AKT pathways are activated in mucosal melanoma specimens. ©2011 AACR.

Identification of novel point mutations in splicing sites integrating whole-exome and RNA-seq data in myeloproliferative diseases

PubMed Central

Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo

2013-01-01

Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC3 (NM_003786.3:c.1783-1G>A), KLHDC1 (NM_172193.1:c.568-2A>G), HOOK1 (NM_015888.4:c.1662-1G>A), SMAD9 (NM_001127217.2:c.1004-1C>T), and DNAH9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC3, HOOK1. In ABCC3 and HOOK1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4–6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis. PMID:24498620

First somatic mutation of E2F1 in a critical DNA binding residue discovered in well-differentiated papillary mesothelioma of the peritoneum

PubMed Central

2011-01-01

Background Well differentiated papillary mesothelioma of the peritoneum (WDPMP) is a rare variant of epithelial mesothelioma of low malignancy potential, usually found in women with no history of asbestos exposure. In this study, we perform the first exome sequencing of WDPMP. Results WDPMP exome sequencing reveals the first somatic mutation of E2F1, R166H, to be identified in human cancer. The location is in the evolutionarily conserved DNA binding domain and computationally predicted to be mutated in the critical contact point between E2F1 and its DNA target. We show that the R166H mutation abrogates E2F1's DNA binding ability and is associated with reduced activation of E2F1 downstream target genes. Mutant E2F1 proteins are also observed in higher quantities when compared with wild-type E2F1 protein levels and the mutant protein's resistance to degradation was found to be the cause of its accumulation within mutant over-expressing cells. Cells over-expressing wild-type E2F1 show decreased proliferation compared to mutant over-expressing cells, but cell proliferation rates of mutant over-expressing cells were comparable to cells over-expressing the empty vector. Conclusions The R166H mutation in E2F1 is shown to have a deleterious effect on its DNA binding ability as well as increasing its stability and subsequent accumulation in R166H mutant cells. Based on the results, two compatible theories can be formed: R166H mutation appears to allow for protein over-expression while minimizing the apoptotic consequence and the R166H mutation may behave similarly to SV40 large T antigen, inhibiting tumor suppressive functions of retinoblastoma protein 1. PMID:21955916

CXCR4 WHIM-like frameshift and nonsense mutations promote ibrutinib resistance but do not supplant MYD88(L265P) -directed survival signalling in Waldenström macroglobulinaemia cells.

PubMed

Cao, Yang; Hunter, Zachary R; Liu, Xia; Xu, Lian; Yang, Guang; Chen, Jie; Tsakmaklis, Nickolas; Kanan, Sandra; Castillo, Jorge J; Treon, Steven P

2015-03-01

CXCR4(WHIM) frameshift and nonsense mutations follow MYD88(L265P) as the most common somatic variants in Waldenström Macroglobulinaemia (WM), and impact clinical presentation and ibrutinib response. While the nonsense (CXCR4(S338X) ) mutation has been investigated, little is known about CXCR4 frameshift (CXCR4(FS) ) mutations. We engineered WM cells to express CXCR4(FS) mutations present in patients, and compared their CXCL12 (SDF-1a) induced signalling and ibrutinib sensitivity to CXCR4(wild-type (WT)) and CXCR4(S338X) cells. Following CXCL12 stimulation, CXCR4(FS) and CXCR4(S338X) WM cells showed impaired CXCR4 receptor internalization, and enhanced AKT1 (also termed AKT) and MAPK1 (also termed ERK) activation versus CXCR(WT) cells (P < 0·05), though MAPK1 activation was more prolonged in CXCR4(S338X) cells (P < 0·05). CXCR4(FS) and CXCR4(S338X) cells, but not CXCR4(WT) cells, were rescued from ibrutinib-triggered apoptosis by CXCL12 that was reversed by AKT1, MAPK1 or CXCR4 antagonists. Treatment with an inhibitor that blocks MYD88(L265P) signalling triggered similar levels of apoptosis that was not abrogated by CXCL12 treatment in CXCR4(WT) and CXCR4(WHIM) cells. These studies show a functional role for CXCR4(FS) mutations in WM, and provide a framework for the investigation of CXCR4 antagonists with ibrutinib in CXCR4(WHIM) -mutated WM patients. Direct inhibition of MYD88(L265P) signalling overcomes CXCL12 triggered survival effects in CXCR4(WHIM) -mutated cells supporting a primary role for this survival pathway in WM. © 2014 John Wiley & Sons Ltd.

A novel CDKL5 mutation in a Japanese patient with atypical Rett syndrome.

PubMed

Christianto, Antonius; Katayama, Syouichi; Kameshita, Isamu; Inazu, Tetsuya

2016-08-01

Rett syndrome (RTT) is a severe X-linked dominant inheritance disorder with a wide spectrum of clinical manifestations. Mutations in Methyl CpG binding protein 2 (MECP2), Cyclin dependent kinase-like 5 (CDKL5) and Forkhead box G1 (FOXG1) have been associated with classic and/or variant RTT. This study was conducted to identify the responsible gene(s) in atypical RTT patient, and to examine the effect of the mutation on protein function. DNA sequence analysis showed a novel heterozygous mutation in CDKL5 identified as c.530A>G which resulted in an amino acid substitution at position 177, from tyrosine to cysteine. Genotyping analysis indicated that the mutation was not merely a single nucleotide polymorphism (SNP). We also revealed that patient's blood lymphocytes had random X-chromosome inactivation (XCI) pattern. Further examination by bioinformatics analysis demonstrated the mutation caused damage or deleterious in its protein. In addition, we demonstrated in vitro kinase assay of mutant protein showed impairment of its activity. Taken together, the results suggested the mutant CDKL5 was responsible for the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

Cytochrome C oxydase deficiency: SURF1 gene investigation in patients with Leigh syndrome.

PubMed

Maalej, Marwa; Kammoun, Thouraya; Alila-Fersi, Olfa; Kharrat, Marwa; Ammar, Marwa; Felhi, Rahma; Mkaouar-Rebai, Emna; Keskes, Leila; Hachicha, Mongia; Fakhfakh, Faiza

2018-03-18

Leigh syndrome (LS) is a rare progressive neurodegenerative disorder occurring in infancy. The most common clinical signs reported in LS are growth retardation, optic atrophy, ataxia, psychomotor retardation, dystonia, hypotonia, seizures and respiratory disorders. The paper reported a manifestation of 3 Tunisian patients presented with LS syndrome. The aim of this study is the MT[HYPHEN]ATP6 and SURF1 gene screening in Tunisian patients affected with classical Leigh syndrome and the computational investigation of the effect of detected mutations on its structure and functions by clinical and bioinformatics analyses. After clinical investigations, three Tunisian patients were tested for mutations in both MT-ATP6 and SURF1 genes by direct sequencing followed by in silico analyses to predict the effects of sequence variation. The result of mutational analysis revealed the absence of mitochondrial mutations in MT-ATP6 gene and the presence of a known homozygous splice site mutation c.516-517delAG in sibling patients added to the presence of a novel double het mutations in LS patient (c.752-18 A > C/c. c.751 + 16G > A). In silico analyses of theses intronic variations showed that it could alters splicing processes as well as SURF1 protein translation. Leigh syndrome (LS) is a rare progressive neurodegenerative disorder occurring in infancy. The most common clinical signs reported in LS are growth retardation, optic atrophy, ataxia, psychomotor retardation, dystonia, hypotonia, seizures and respiratory disorders. The paper reported a manifestation of 3 Tunisian patients presented with LS syndrome. The aim of this study is MT-ATP6 and SURF1 genes screening in Tunisian patients affected with classical Leigh syndrome and the computational investigation of the effect of detected mutations on its structure and functions. After clinical investigations, three Tunisian patients were tested for mutations in both MT-ATP6 and SURF1 genes by direct sequencing followed by in silico analysis to predict the effects of sequence variation. The result of mutational analysis revealed the absence of mitochondrial mutations in MT-ATP6 gene and the presence of a known homozygous splice site mutation c.516-517delAG in sibling patients added to the presence of a novel double het mutations in LS patient (c.752-18 A>C/ c.751+16G>A). In silico analysis of theses intronic vaiations showed that it could alters splicing processes as well as SURF1 protein translation. Copyright © 2018 Elsevier Inc. All rights reserved.

Identification of a novel splicing mutation in the growth hormone (GH)-releasing hormone receptor gene in a Chinese family with pituitary dwarfism.

PubMed

Wang, Qi; Diao, Ying; Xu, Zhenping; Li, Xiaohui; Luo, Xiao Ping; Xu, Haibo; Ouyang, Ping; Liu, Mugen; Hu, Zhongli; Wang, Qing K; Liu, Jing Yu

2009-12-10

A Chinese family with autosomal recessive pituitary dwarfism was identified and the proband was evaluated by MRI and hormonal analysis, which revealed pituitary dwarfism with a complete growth hormone deficiency. MRI showed a pituitary gland with a small anterior pituitary of 2.2mm and evidence of hypoplastic pituitary. Linkage analysis with markers spanning 17 known genes for dwarfism revealed linkage of the family to the growth hormone-releasing hormone receptor (GHRHR) gene. Mutational analysis of all exons and exon-intron boundaries of GHRHR was carried out using direct DNA sequence analysis. A novel homozygosis mutation, a G to A transition located in the splice donor site at the beginning of intron 8 (IVS8+1G>A), was identified in the proband. The two other patients in the family are homozygous, whereas the living mother of the proband is heterozygous for the IVS8+1G>A mutation. The mutation was not found in 100 normal chromosomes from healthy Chinese individuals of Han nationality. An in vitro splicing assay using HeLa cells transfected with expression vectors containing the normal or the mutant GHRHR minigenes consisting of genomic fragments spanning exons 7-9 showed that the IVS8+1G>A mutation caused abnormal splicing, which is predicted to give rise to truncation or frameshift, leading to severely truncated GHRHR proteins. These results provide strong evidence that the splicing mutation IVS8+1G>A of GHRHR is a cause of pituitary dwarfism in the Chinese family.

Development of a practical NF1 genetic testing method through the pilot analysis of five Japanese families with neurofibromatosis type 1.

PubMed

Okumura, Akiko; Ozaki, Mamoru; Niida, Yo

2015-08-01

Mutation analysis of NF1, the responsible gene for neurofibromatosis type 1 (NF1), is still difficult due to its large size, lack of mutational hotspots, the presence of many pseudogenes, and its wide spectrum of mutations. To develop a simple and inexpensive NF1 genetic testing for clinical use, we analyzed five Japanese families with NF1 as a pilot study. Our original method, CEL endonuclease mediated heteroduplex incision with polyacrylamide gel electrophoresis and silver staining (CHIPS) was optimized for NF1 mutation screening, and reverse transcription polymerase chain reaction (RT-PCR) was performed to determine the effect of transcription. Also, we employed DNA microarray analysis to evaluate the break points of the large deletion. A new nonsense mutation, p.Gln209(∗), was detected in family 1 and the splicing donor site mutation, c.2850+1G>T, was detected in family 2. In family 3, c.4402A>G was detected in exon 34 and the p.Ser1468Gly missense mutation was predicted. However mRNA analysis revealed that this substitution created an aberrant splicing acceptor site, thereby causing the p.Phe1457(∗) nonsense mutation. In the other two families, type-1 and unique NF1 microdeletions were detected by DNA microarray analysis. Our results show that the combination of CHIPS and RT-PCR effectively screen and characterize NF1 point mutations, and both DNA and RNA level analysis are required to understand the nature of the NF1 mutation. Our results also suggest the possibility of a higher incidence and unique profile of NF1 large deletions in the Japanese population as compared to previous studies performed in Europe. Copyright © 2014 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Molecular Pathology of Anaplastic Thyroid Carcinomas: A Retrospective Study of 144 Cases.

PubMed

Bonhomme, Benjamin; Godbert, Yann; Perot, Gaelle; Al Ghuzlan, Abir; Bardet, Stéphane; Belleannée, Geneviève; Crinière, Lise; Do Cao, Christine; Fouilloux, Geneviève; Guyetant, Serge; Kelly, Antony; Leboulleux, Sophie; Buffet, Camille; Leteurtre, Emmanuelle; Michels, Jean-Jacques; Tissier, Frédérique; Toubert, Marie-Elisabeth; Wassef, Michel; Pinard, Clémence; Hostein, Isabelle; Soubeyran, Isabelle

2017-05-01

Anaplastic thyroid carcinoma (ATC) is a rare tumor, with poorly defined oncogenic molecular mechanisms and limited therapeutic options contributing to its poor prognosis. The aims of this retrospective study were to determine the frequency of anaplastic lymphoma kinase (ALK) translocations and to identify the mutational profile of ATC including TERT promoter mutations. One hundred and forty-four ATC cases were collected from 10 centers that are a part of the national French network for management of refractory thyroid tumors. Fluorescence in situ hybridization analysis for ALK rearrangement was performed on tissue microarrays. A panel of 50 genes using next-generation sequencing and TERT promoter mutations using Sanger sequencing were also screened. Fluorescence in situ hybridization was interpretable for 90 (62.5%) cases. One (1.1%) case was positive for an ALK rearrangement with a borderline threshold (15% positive cells). Next-generation sequencing results were interpretable for 94 (65.3%) cases, and Sanger sequencing (TERT) for 98 (68.1%) cases. A total of 210 mutations (intronic and exonic) were identified. TP53 alterations were the most frequent (54.4%). Forty-three percent harbored a mutation in the (H-K-N)RAS genes, 13.8% a mutation in the BRAF gene (essentially p.V600E), 17% a PI3K-AKT pathway mutation, 6.4% both RAS and PI3K pathway mutations, and 4.3% both TP53 and PTEN mutations. Nearly 10% of the cases showed no mutations of the RAS, PI3K-AKT pathways, or TP53, with mutations of ALK, ATM, APC, CDKN2A, ERBB2, RET, or SMAD4, including mutations not yet described in thyroid tumors. Genes encoding potentially druggable targets included: mutations in the ATM gene in four (4.3%) cases, in ERBB2 in one (1.1%) case, in MET in one (1.1%) case, and in ALK in one (1.1%) case. A TERT promoter alteration was found in 53 (54.0%) cases, including 43 C228T and 10 C250T mutations. Three out of our cases did not harbor mutations in the panel of genes with therapeutic interest. This study confirms that ALK rearrangements in ATC are rare and that the mutational landscape of ATC is heterogeneous, with many genes implicated in the follicular epithelial cell dedifferentiation process. This may explain the limited effectiveness of targeted therapeutic options tested so far.

Determining the Location of DNA Modification and Mutation Caused by UVB Light in Skin Cancer

DTIC Science & Technology

2015-09-01

Award Number: W81XWH-12-1-0333 TITLE: Determining the Location of DNA Modification and Mutation Caused by UVB Light in Skin Cancer PRINCIPAL...COVERED 15 Aug 2012 – 14 Aug 2015 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER W81XWH-12-1-0333 Determining the Location of DNA Modification and Mutation ...sequencing libraries generated for both yeast and human cells show pyrimidine bias on the 5’ end, indicating that we are sequencing the dimers

Identification of a single ancestral CYP1B1 mutation in Slovak Gypsies (Roms) affected with primary congenital glaucoma.

PubMed

Plásilová, M; Stoilov, I; Sarfarazi, M; Kádasi, L; Feráková, E; Ferák, V

1999-04-01

Primary congenital glaucoma (PCG) is an autosomal recessive eye disease that occurs at an unusually high frequency in the ethnic isolate of Roms (Gypsies) in Slovakia. Recently, we linked the disease in this population to the GLC3A locus on 2p21. At this locus, mutations in the cytochrome P4501B1 (CYP1B1) gene have been identified as a molecular basis for this condition. Here, we report the results of CYP1B1 mutation screening of 43 PCG patients from 26 Slovak Rom families. A homozygous G-->A transition at nucleotide 1505 in the highly conserved region of exon 3 was detected in all families. This mutation results in the E387K substitution, which affects the conserved K helix region of the cytochrome P450 molecule. Determination of the CYP1B1 polymorphic background showed a common DNA haplotype in all patients, thus indicating that the E387K mutation in Roms has originated from a single ancestral mutational event. The Slovak Roms represent the first population in which PCG is found to result from a single mutation in the CYP1B1 gene, so that a founder effect is the most plausible explanation of its increased incidence. An ARMS-PCR assay has been developed for fast detection of this mutation, thus allowing direct DNA based prenatal diagnosis as well as gene carrier detection in this particular population. Screening of 158 healthy Roms identified 17 (10.8%) mutation carriers, indicating that the frequency of PCG in this population may be even higher than originally estimated.

Long-Term Clinical Outcome and Carrier Phenotype in Autosomal Recessive Hypophosphatemia Caused by a Novel DMP1 Mutation

PubMed Central

Mäkitie, Outi; Pereira, Renata C; Kaitila, Ilkka; Turan, Serap; Bastepe, Murat; Laine, Tero; Kröger, Heikki; Cole, William G; Jüppner, Harald

2010-01-01

Homozygous inactivating mutations in DMP1 (dentin matrix protein 1), the gene encoding a noncollagenous bone matrix protein expressed in osteoblasts and osteocytes, cause autosomal recessive hypophosphatemia (ARHP). Herein we describe a family with ARHP owing to a novel homozygous DMP1 mutation and provide a detailed description of the associated skeletal dysplasia and carrier phenotype. The two adult patients with ARHP, a 78-year-old man and his 66-year-old sister, have suffered from bone pain and lower extremity varus deformities since early childhood. With increasing age, both patients developed severe joint pain, contractures, and complete immobilization of the spine. Radiographs showed short and deformed long bones, significant cranial hyperostosis, enthesopathies, and calcifications of the paraspinal ligaments. Biochemistries were consistent with hypophosphatemia owing to renal phosphate wasting; markers of bone turnover and serum fibroblast growth factor 23 (FGF-23) levels were increased significantly. Nucleotide sequence analysis of DMP1 revealed a novel homozygous mutation at the splice acceptor junction of exon 6 (IVS5-1G > A). Two heterozygous carriers of the mutation also showed mild hypophosphatemia, and bone biopsy in one of these individuals showed focal areas of osteomalacia. In bone, DMP1 expression was absent in the homozygote but normal in the heterozygote, whereas FGF-23 expression was increased in both subjects but higher in the ARHP patient. The clinical and laboratory observations in this family confirm that DMP1 has an important role in normal skeletal development and mineral homeostasis. The skeletal phenotype in ARHP may be significantly more severe than in other forms of hypophosphatemic rickets. © 2010 American Society for Bone and Mineral Research. PMID:20499351

Long-term clinical outcome and carrier phenotype in autosomal recessive hypophosphatemia caused by a novel DMP1 mutation.

PubMed

Mäkitie, Outi; Pereira, Renata C; Kaitila, Ilkka; Turan, Serap; Bastepe, Murat; Laine, Tero; Kröger, Heikki; Cole, William G; Jüppner, Harald

2010-10-01

Homozygous inactivating mutations in DMP1 (dentin matrix protein 1), the gene encoding a noncollagenous bone matrix protein expressed in osteoblasts and osteocytes, cause autosomal recessive hypophosphatemia (ARHP). Herein we describe a family with ARHP owing to a novel homozygous DMP1 mutation and provide a detailed description of the associated skeletal dysplasia and carrier phenotype. The two adult patients with ARHP, a 78-year-old man and his 66-year-old sister, have suffered from bone pain and lower extremity varus deformities since early childhood. With increasing age, both patients developed severe joint pain, contractures, and complete immobilization of the spine. Radiographs showed short and deformed long bones, significant cranial hyperostosis, enthesopathies, and calcifications of the paraspinal ligaments. Biochemistries were consistent with hypophosphatemia owing to renal phosphate wasting; markers of bone turnover and serum fibroblast growth factor 23 (FGF-23) levels were increased significantly. Nucleotide sequence analysis of DMP1 revealed a novel homozygous mutation at the splice acceptor junction of exon 6 (IVS5-1G > A). Two heterozygous carriers of the mutation also showed mild hypophosphatemia, and bone biopsy in one of these individuals showed focal areas of osteomalacia. In bone, DMP1 expression was absent in the homozygote but normal in the heterozygote, whereas FGF-23 expression was increased in both subjects but higher in the ARHP patient. The clinical and laboratory observations in this family confirm that DMP1 has an important role in normal skeletal development and mineral homeostasis. The skeletal phenotype in ARHP may be significantly more severe than in other forms of hypophosphatemic rickets.

An 8-generation family with X-linked Charcot-Marie-Tooth: Confirmation Of the pathogenicity Of a 3' untranslated region mutation in GJB1 and its clinical features.

PubMed

Chen, Dong-Hui; Ma, Maxwell; Scavina, Mena; Blue, Elizabeth; Wolff, John; Karna, Prasanthi; Dorschner, Michael O; Raskind, Wendy H; Bird, Thomas D

2018-05-01

Mutations in gap junction protein beta 1 (GJB1) on the X chromosome represent one of the most common causes of hereditary neuropathy. We assessed manifestations associated with a rare 3' untranslated region mutation (UTR) of GJB1 in a large family with X-linked Charcot-Marie-Tooth disease (CMTX). Clinical, electrophysiological, and molecular genetic analyses were performed on an 8-generation family with CMTX. There were 22 affected males and 19 symptomatic females, including an 83-year-old woman followed for 40 years. Electrophysiological studies showed a primarily axonal neuropathy. The c.*15C>T mutation in the GJB1 3' UTR was identified in 4 branches of the family with a log of odds (LOD) of 4.91. This created a BstE II enzyme recognition site that enabled detection by restriction digestion. The c.*15C>T mutation in the GJB1 3' UTR segregates with CMTX1 in 8 generations. Penetrance in males and females is essentially complete. A straightforward genetic method to detect this mutation is described. Muscle Nerve 57: 859-862, 2018. © 2017 Wiley Periodicals, Inc.

Hcn1 Is a Tremorgenic Genetic Component in a Rat Model of Essential Tremor

PubMed Central

Ohno, Yukihiro; Shimizu, Saki; Tatara, Ayaka; Imaoku, Takuji; Ishii, Takahiro; Sasa, Masashi; Serikawa, Tadao; Kuramoto, Takashi

2015-01-01

Genetic factors are thought to play a major role in the etiology of essential tremor (ET); however, few genetic changes that induce ET have been identified to date. In the present study, to find genes responsible for the development of ET, we employed a rat model system consisting of a tremulous mutant strain, TRM/Kyo (TRM), and its substrain TRMR/Kyo (TRMR). The TRM rat is homozygous for the tremor (tm) mutation and shows spontaneous tremors resembling human ET. The TRMR rat also carries a homozygous tm mutation but shows no tremor, leading us to hypothesize that TRM rats carry one or more genes implicated in the development of ET in addition to the tm mutation. We used a positional cloning approach and found a missense mutation (c. 1061 C>T, p. A354V) in the hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene. The A354V HCN1 failed to conduct hyperpolarization-activated currents in vitro, implicating it as a loss-of-function mutation. Blocking HCN1 channels with ZD7288 in vivo evoked kinetic tremors in nontremulous TRMR rats. We also found neuronal activation of the inferior olive (IO) in both ZD7288-treated TRMR and non-treated TRM rats and a reduced incidence of tremor in the IO-lesioned TRM rats, suggesting a critical role of the IO in tremorgenesis. A rat strain carrying the A354V mutation alone on a genetic background identical to that of the TRM rats showed no tremor. Together, these data indicate that body tremors emerge when the two mutant loci, tm and Hcn1A354V, are combined in a rat model of ET. In this model, HCN1 channels play an important role in the tremorgenesis of ET. We propose that oligogenic, most probably digenic, inheritance is responsible for the genetic heterogeneity of ET. PMID:25970616

R213W mutation in the retinoschisis 1 gene causes X-linked juvenile retinoschisis in a large Chinese family.

PubMed

Xu, Jun; Gu, Hong; Ma, Kai; Liu, Xipu; Snellingen, Torkel; Sun, Erdan; Wang, Ningli; Liu, Ningpu

2010-08-12

We identified a large Chinese family with X-linked juvenile retinoschisis. The purpose of this study was to report the clinical findings of the family and to identify the genetic mutation by screening the retinoschisis 1 (RS1) gene. Family history was collected and all family members underwent routine ophthalmic examination. Venous blood was collected from family members and genomic DNA was extracted. The exons of RS1 were screened by PCR followed by direct sequencing and/or restriction enzyme digestion. The pedigree of interest was a four-generation family with 52 family members, including seven affected individuals. The proband was a 5-year-old boy showing highly elevated bullous retinoschisis with moderate vitreous hemorrhage in both eyes. Vitrectomy was performed in the left eye of the proband. Five affected males showed large peripheral retinoschisis in both eyes, either involving the macula or combined with foveal stellate cystic change. One of the affected family members showed only a foveal stellate cystic change in both eyes without periphery retinoschisis. Visual acuity of affected individuals ranged from hand motion to 0.4. The R213W mutation in exon 6 of RS1 was identified in all affected individuals, predicting an amino acid substitution of arginine to tryptophan at codon 213. Our data show that the R213W mutation in RS1 causes various severities of retinoschisis in a large Chinese family, providing further evidence for X-linked juvenile retinoschisis phenotypic variability.

Characterizing genomic differences of human cancer stratified by the TP53 mutation status.

PubMed

Wang, Mengyao; Yang, Chao; Zhang, Xiuqing; Li, Xiangchun

2018-06-01

The key roles of the TP53 mutation in cancer have been well established. TP53 is the most frequently mutated gene, and its inactivation is widespread among human cancer types. However, the landscape of genomic alterations in human cancers stratified by the TP53 mutation has not yet been described. We obtained somatic mutation and copy number change data of 6551 regular-mutated samples from the Cancer Genome Atlas (TCGA) and compared significantly mutated genes (SMGs), copy number alterations, mutational signatures and mutational strand asymmetries between cancer samples with and without the TP53 mutation. We identified 126 SMGs, 30 of which were statistically significant in both the TP53 mutant and wild-type groups. Several SMGs, such as VHL, SMAD4 and PTEN, showed a mutation bias towards the TP53 wild-type group, whereas ATRX, IDH1 and RB1 were more prevalent in the TP53 mutant group. Five mutational signatures were extracted from the combined TCGA dataset on which mutational asymmetry analysis was performed, revealing that the TP53 mutant group exhibited substantially greater replication and transcription biases. Furthermore, we found that alterations of multiple genes in a merged mutually exclusive network composed of BRAF, EGFR, PAK1, PIK3CA, PTEN, APC and TERT were related to shortened survival in the TP53 wild-type group. In summary, we characterized the genomic differences and similarities underlying human cancers stratified by the TP53 mutation and identified multi-gene alterations of a merged mutually exclusive network to be a poor prognostic factor for the TP53 wild-type group.

TBC1D24 genotype–phenotype correlation

PubMed Central

Balestrini, Simona; Milh, Mathieu; Castiglioni, Claudia; Lüthy, Kevin; Finelli, Mattea J.; Verstreken, Patrik; Cardon, Aaron; Stražišar, Barbara Gnidovec; Holder, J. Lloyd; Lesca, Gaetan; Mancardi, Maria M.; Poulat, Anne L.; Repetto, Gabriela M.; Banka, Siddharth; Bilo, Leonilda; Birkeland, Laura E.; Bosch, Friedrich; Brockmann, Knut; Cross, J. Helen; Doummar, Diane; Félix, Temis M.; Giuliano, Fabienne; Hori, Mutsuki; Hüning, Irina; Kayserili, Hulia; Kini, Usha; Lees, Melissa M.; Meenakshi, Girish; Mewasingh, Leena; Pagnamenta, Alistair T.; Peluso, Silvio; Mey, Antje; Rice, Gregory M.; Rosenfeld, Jill A.; Taylor, Jenny C.; Troester, Matthew M.; Stanley, Christine M.; Ville, Dorothee; Walkiewicz, Magdalena; Falace, Antonio; Fassio, Anna; Lemke, Johannes R.; Biskup, Saskia; Tardif, Jessica; Ajeawung, Norbert F.; Tolun, Aslihan; Corbett, Mark; Gecz, Jozef; Afawi, Zaid; Howell, Katherine B.; Oliver, Karen L.; Berkovic, Samuel F.; Scheffer, Ingrid E.; de Falco, Fabrizio A.; Oliver, Peter L.; Striano, Pasquale; Zara, Federico

2016-01-01

Objective: To evaluate the phenotypic spectrum associated with mutations in TBC1D24. Methods: We acquired new clinical, EEG, and neuroimaging data of 11 previously unreported and 37 published patients. TBC1D24 mutations, identified through various sequencing methods, can be found online (http://lovd.nl/TBC1D24). Results: Forty-eight patients were included (28 men, 20 women, average age 21 years) from 30 independent families. Eighteen patients (38%) had myoclonic epilepsies. The other patients carried diagnoses of focal (25%), multifocal (2%), generalized (4%), and unclassified epilepsy (6%), and early-onset epileptic encephalopathy (25%). Most patients had drug-resistant epilepsy. We detail EEG, neuroimaging, developmental, and cognitive features, treatment responsiveness, and physical examination. In silico evaluation revealed 7 different highly conserved motifs, with the most common pathogenic mutation located in the first. Neuronal outgrowth assays showed that some TBC1D24 mutations, associated with the most severe TBC1D24-associated disorders, are not necessarily the most disruptive to this gene function. Conclusions: TBC1D24-related epilepsy syndromes show marked phenotypic pleiotropy, with multisystem involvement and severity spectrum ranging from isolated deafness (not studied here), benign myoclonic epilepsy restricted to childhood with complete seizure control and normal intellect, to early-onset epileptic encephalopathy with severe developmental delay and early death. There is no distinct correlation with mutation type or location yet, but patterns are emerging. Given the phenotypic breadth observed, TBC1D24 mutation screening is indicated in a wide variety of epilepsies. A TBC1D24 consortium was formed to develop further research on this gene and its associated phenotypes. PMID:27281533

The National Niemann-Pick Type C1 Disease Database: correlation of lipid profiles, mutations, and biochemical phenotypes

PubMed Central

Garver, William S.; Jelinek, David; Meaney, F. John; Flynn, James; Pettit, Kathleen M.; Shepherd, Glen; Heidenreich, Randall A.; Vockley, Cate M. Walsh; Castro, Graciela; Francis, Gordon A.

2010-01-01

Niemann-Pick type C1 disease (NPC1) is an autosomal recessive lysosomal storage disorder characterized by neonatal jaundice, hepatosplenomegaly, and progressive neurodegeneration. The present study provides the lipid profiles, mutations, and corresponding associations with the biochemical phenotype obtained from NPC1 patients who participated in the National NPC1 Disease Database. Lipid profiles were obtained from 34 patients (39%) in the survey and demonstrated significantly reduced plasma LDL cholesterol (LDL-C) and increased plasma triglycerides in the majority of patients. Reduced plasma HDL cholesterol (HDL-C) was the most consistent lipoprotein abnormality found in male and female NPC1 patients across age groups and occurred independent of changes in plasma triglycerides. A subset of 19 patients for whom the biochemical severity of known NPC1 mutations could be correlated with their lipid profile showed a strong inverse correlation between plasma HDL-C and severity of the biochemical phenotype. Gene mutations were available for 52 patients (59%) in the survey, including 52 different mutations and five novel mutations (Y628C, P887L, I923V, A1151T, and 3741_3744delACTC). Together, these findings provide novel information regarding the plasma lipoprotein changes and mutations in NPC1 disease, and suggest plasma HDL-C represents a potential biomarker of NPC1 disease severity. PMID:19744920

Genetic characterization and antiretroviral resistance mutations among treatment-naive HIV-infected individuals in Jiaxing, China.

PubMed

Guo, Jinlei; Yan, Yong; Zhang, Jiafeng; Ji, Jimei; Ge, Zhijian; Ge, Rui; Zhang, Xiaofei; Wang, Henghui; Chen, Zhongwen; Luo, Jianyong

2017-03-14

The aim of this study was to characterize HIV-1 genotypes and antiretroviral resistance mutations among treatment-naive HIV-infected individuals in Jiaxing, China. The HIV-1 partial polymerase (pol) genes in 93 of the 99 plasma samples were successfully amplified and analyzed. Phylogenetic analysis revealed the existence of five HIV-1 genotypes, of which the most prevalent genotype was CRF01_AE (38.7%), followed by CRF07_BC (34.4%), CRF08_BC (16.1%), subtype B/B' (5.4%), and CRF55_01B (2.1%). Besides, three types of unique recombination forms (URFs) were also observed, including C/F2/A1, CRF01_AE/B, and CRF08_BC/CRF07_BC. Among 93 amplicons, 46.2% had drug resistance-associated mutations, including 23.7% for protease inhibitors (PIs) mutations, 1.1% for nucleoside reverse transcriptase inhibitors (NRTIs) mutations, and 20.4% for non-nucleoside reverse transcriptase inhibitors (NNRTIs) mutations. Six (6.5%) out of 93 treatment-naive subjects were identified to be resistant to one or more NNRTIs, while resistance to NRTIs or PIs was not observed. Our study showed the genetic diversity of HIV-1 strains circulating in Jiaxing and a relative high proportion of antiretroviral resistance mutations among treatment-naive patients, indicating a serious challenge for HIV prevention and treatment program.

Mutation spectrum of RB1 mutations in retinoblastoma cases from Singapore with implications for genetic management and counselling

PubMed Central

Tomar, Swati; Sethi, Raman; Sundar, Gangadhara; Quah, Thuan Chong; Quah, Boon Long; Lai, Poh San

2017-01-01

Retinoblastoma (RB) is a rare childhood malignant disorder caused by the biallelic inactivation of RB1 gene. Early diagnosis and identification of carriers of heritable RB1 mutations can improve disease outcome and management. In this study, mutational analysis was conducted on fifty-nine matched tumor and peripheral blood samples from 18 bilateral and 41 unilateral unrelated RB cases by a combinatorial approach of Multiplex Ligation-dependent Probe Amplification (MLPA) assay, deletion screening, direct sequencing, copy number gene dosage analysis and methylation assays. Screening of both blood and tumor samples yielded a mutation detection rate of 94.9% (56/59) while only 42.4% (25/59) of mutations were detected if blood samples alone were analyzed. Biallelic mutations were observed in 43/59 (72.9%) of tumors screened. There were 3 cases (5.1%) in which no mutations could be detected and germline mutations were detected in 19.5% (8/41) of unilateral cases. A total of 61 point mutations were identified, of which 10 were novel. There was a high incidence of previously reported recurrent mutations, occurring at 38.98% (23/59) of all cases. Of interest were three cases of mosaic RB1 mutations detected in the blood from patients with unilateral retinoblastoma. Additionally, two germline mutations previously reported to be associated with low-penetrance phenotypes: missense-c.1981C>T and splice variant-c.607+1G>T, were observed in a bilateral and a unilateral proband, respectively. These findings have implications for genetic counselling and risk prediction for the affected families. This is the first published report on the spectrum of mutations in RB patients from Singapore and shows that further improved mutation screening strategies are required in order to provide a definitive molecular diagnosis for every case of RB. Our findings also underscore the importance of genetic testing in supporting individualized disease management plans for patients and asymptomatic family members carrying low-penetrance, germline mosaicism or heritable unilateral mutational phenotypes. PMID:28575107

Two novel mutations in the BCKDK (branched-chain keto-acid dehydrogenase kinase) gene are responsible for a neurobehavioral deficit in two pediatric unrelated patients.

PubMed

García-Cazorla, Angels; Oyarzabal, Alfonso; Fort, Joana; Robles, Concepción; Castejón, Esperanza; Ruiz-Sala, Pedro; Bodoy, Susanna; Merinero, Begoña; Lopez-Sala, Anna; Dopazo, Joaquín; Nunes, Virginia; Ugarte, Magdalena; Artuch, Rafael; Palacín, Manuel; Rodríguez-Pombo, Pilar; Alcaide, Patricia; Navarrete, Rosa; Sanz, Paloma; Font-Llitjós, Mariona; Vilaseca, Ma Antonia; Ormaizabal, Aida; Pristoupilova, Anna; Agulló, Sergi Beltran

2014-04-01

Inactivating mutations in the BCKDK gene, which codes for the kinase responsible for the negative regulation of the branched-chain α-keto acid dehydrogenase complex (BCKD), have recently been associated with a form of autism in three families. In this work, two novel exonic BCKDK mutations, c.520C>G/p.R174G and c.1166T>C/p.L389P, were identified at the homozygous state in two unrelated children with persistently reduced body fluid levels of branched-chain amino acids (BCAAs), developmental delay, microcephaly, and neurobehavioral abnormalities. Functional analysis of the mutations confirmed the missense character of the c.1166T>C change and showed a splicing defect r.[520c>g;521_543del]/p.R174Gfs1*, for c.520C>G due to the presence of a new donor splice site. Mutation p.L389P showed total loss of kinase activity. Moreover, patient-derived fibroblasts showed undetectable (p.R174Gfs1*) or barely detectable (p.L389P) levels of BCKDK protein and its phosphorylated substrate (phospho-E1α), resulting in increased BCKD activity and the very rapid BCAA catabolism manifested by the patients' clinical phenotype. Based on these results, a protein-rich diet plus oral BCAA supplementation was implemented in the patient homozygous for p.R174Gfs1*. This treatment normalized plasma BCAA levels and improved growth, developmental and behavioral variables. Our results demonstrate that BCKDK mutations can result in neurobehavioral deficits in humans and support the rationale for dietary intervention. © 2014 WILEY PERIODICALS, INC.

Cellular/intramuscular myxoma and grade I myxofibrosarcoma are characterized by distinct genetic alterations and specific composition of their extracellular matrix

PubMed Central

Willems, Stefan M; Mohseny, Alex B; Balog, Crina; Sewrajsing, Raj; Briaire-de Bruijn, Inge H; Knijnenburg, Jeroen; Cleton-Jansen, Anne-Marie; Sciot, Raf; Fletcher, Christopher D M; Deelder, André M; Szuhai, Karoly; Hensbergen, Paul J; Hogendoorn, Pancras C W

2009-01-01

Cellular myxoma and grade I myxofibrosarcoma are mesenchymal tumours that are characterized by their abundant myxoid extracellular matrix (ECM). Despite their histological overlap, they differ clinically. Diagnosis is therefore difficult though important. We investigated their (cyto) genetics and ECM. GNAS1-activating mutations have been described in intramuscular myxoma, and lead to downstream activation of cFos. KRAS and TP53 mutations are commonly involved in sarcomagenesis whereby KRAS subsequently activates c-Fos. A well-documented series of intramuscular myxoma (three typical cases and seven cases of the more challenging cellular variant) and grade I myxofibrosarcoma (n= 10) cases were karyotyped, analyzed for GNAS1, KRAS and TP53 mutations and downstream activation of c-Fos mRNA and protein expression. ECM was studied by liquid chromatography mass spectrometry and expression of proteins identified was validated by immunohistochemistry and qPCR. Grade I myxofibrosarcoma showed variable, non-specific cyto-genetic aberrations in 83,5% of cases (n= 6) whereas karyotypes of intramuscular myxoma were all normal (n= 7). GNAS1-activating mutations were exclusively found in 50% of intramuscular myxoma. Both tumour types showed over-expression of c-Fos mRNA and protein. No mutations in KRAS codon 12/13 or in TP53 were detected. Liquid chromatography mass spectrometry revealed structural proteins (collagen types I, VI, XII, XIV and decorin) in grade I myxofibrosarcoma lacking in intramuscular myxoma. This was confirmed by immunohistochemistry and qPCR. Intramuscular/cellular myxoma and grade I myxofibrosarcoma show different molecular genetic aberrations and different composition of their ECM that probably contribute to their diverse clinical behaviour. GNAS1 mutation analysis can be helpful to distinguish intramuscular myxoma from grade I myxofibrosarcoma in selected cases. PMID:19320777

Inherited thrombophilic risk factors and venous thromboembolism: distinct role in peripheral deep venous thrombosis and pulmonary embolism.

PubMed

Margaglione, M; Brancaccio, V; De Lucia, D; Martinelli, I; Ciampa, A; Grandone, E; Di Minno, G

2000-11-01

To investigate whether the FII A(20210) mutation is associated with isolated pulmonary embolism (PE). Case-control study. Five thrombosis centers in southern Italy. Six hundred forty-seven consecutive referred patients with objectively documented venous thrombosis and 1,329 control subjects. Medical histories were collected. The G-to-A transition at nucleotide 1691 within the factor V gene (FV Leiden) and the G-to-A transition at nucleotide position 20210 within the prothrombin gene locus (FII A(20210)), levels of anticoagulant factors, and levels of antiphospholipid antibodies were determined by standard techniques. Patients with deep venous thrombosis (DVT) of the lower extremities (n = 346) or with additional PEs (n = 175) showed similar prevalences of FV Leiden mutation (24.3% and 16.6%, respectively) and FII A(20210) mutation (14.2% and 12.6%, respectively), and similar deficiencies of natural anticoagulants (4.9% and 2.3%, respectively). In both groups, the frequencies of FV Leiden and/or FII A(20210) mutation were higher than those observed among 1,329 apparently healthy control subjects (4.8% and 4.4%, respectively; p < 0.0001). Among patients with isolated PE (n = 126), prevalences of FV Leiden (7.1%) and FII A(20210) mutation (8.7%) were similar to those of control subjects. Inherited thrombophilic abnormalities were less frequent among patients with PE only (15.6%) than among those with DVT only (37.0%; p < 0.001) or whose conditions were complicated by PE (28. 0%; p = 0.020). Adjusting for age and sex, FV Leiden mutation, FII A(20210) mutation, or both mutations were associated with DVT with PE (FV Leiden mutation: odds ratio [OR], 3.0; 95% confidence interval [CI], 1.6 to 5.5; FII A(20210) mutation: OR, 2.6; 95% CI, 1. 3 to 5.2; and both mutations: OR, 82.1; 95% CI, 7.5 to 901.2) or without PE (FV Leiden mutation: OR, 6.1; 95% CI, 4.0 to 9.3; FII A(20210) mutation: OR, 2.8; 95% CI, 1.7 to 4.8; and both mutations: OR, 167.5; 95% CI, 21.6 to 1,297.7), but not with isolated PE (FV Leiden mutation: OR, 1.2; 95% CI, 0.5 to 2.8; FII A(20210) mutation: OR, 1.2; 95% CI, 0.5 to 3.1; and both mutations: OR, 22.1; 95% CI, 1. 3 to 370.2). FII A(20210) mutation is associated with DVT in the lower extremities alone or when complicated by PE, but it is not associated with isolated PE.

A novel heterozygous intronic mutation in POU1F1 is associated with combined pituitary hormone deficiency.

PubMed

Takagi, Masaki; Kamasaki, Hotaka; Yagi, Hiroko; Fukuzawa, Ryuji; Narumi, Satoshi; Hasegawa, Tomonobu

2017-02-27

POU class 1 homeobox 1 (POU1F1) regulates pituitary cell-specific gene expression of somatotropes, lactotropes, and thyrotropes. In humans, two POU1F1 isoforms (long and short isoform), which are generated by the alternative use of the splice acceptor site for exon 2, have been identified. To date, more than 30 POU1F1 mutations in patients with combined pituitary hormone deficiency (CPHD) have been described. All POU1F1 variants reported to date affect both the short and long isoforms of the POU1F1 protein; therefore, it is unclear at present whether a decrease in the function of only one of these two isoforms is sufficient for disease onset in humans. Here, we described a sibling case of CPHD carrying a heterozygous mutation in intron 1 of POU1F1. In vitro experiments showed that this mutation resulted in exon 2-skipping of only in the short isoform of POU1F1, while the long isoform remained intact. This result strongly suggests the possibility, for the first time, that isolated mutations in the short isoform of POU1F1 could be sufficient for induction of POU1F1-related CPHD. This finding improves our understanding of the molecular mechanisms, and developmental course associated with mutations in POU1F1.

Naturally occurring hepatitis C virus protease inhibitors resistance-associated mutations among chronic hepatitis C genotype 1b patients with or without HIV co-infection.

PubMed

Cao, Ying; Zhang, Yu; Bao, Yi; Zhang, Renwen; Zhang, Xiaxia; Xia, Wei; Wu, Hao; Xu, Xiaoyuan

2016-05-01

The aim of this study was to measure the frequency of natural mutations in hepatitis C virus (HCV) mono-infected and HIV/HCV co-infected protease inhibitor (PI)-naive patients. Population sequence of the non-structural (NS)3 protease gene was evaluated in 90 HCV mono-infected and 96 HIV/HCV co-infected PI treatment-naive patients. The natural prevalence of PI resistance mutations in both groups was compared. Complete HCV genotype 1b NS3 sequence information was obtained for 152 (81.72%) samples. Seven sequences (8.33%) of the 84 HCV mono-infected patients and 21 sequences (30.88%) of the 68 HIV/HCV co-infected patients showed amino acid substitutions associated with HCV PI resistance. There was a significant difference in the natural prevalence of PI resistance mutations between these two groups (P = 0.000). The mutations T54S, R117H and N174F were observed in 1.19%, 5.95% and 1.19% of HCV mono-infected patients. The mutations F43S, T54S, Q80K/R, R155K, A156G/V, D168A/E/G and V170A were found in 1.47%, 4.41%, 1.47%/1.47%, 2.94%, 23.53%/1.47%, 1.47%/1.47%/1.47% and 1.47% of HIV/HCV co-infected patients, respectively. In addition, the combination mutations in the NS3 region were detected only in HIV/HCV genotype 1b co-infected patients. Naturally occurring HCV PI resistance mutations existed in HCV mono-infected and HIV/HCV co-infected genotype 1b PI-naive patients. HIV co-infection was associated with a greater frequency of PI resistance mutations. The impact of HIV infection on baseline HCV PI resistance mutations and treatment outcome in chronic hepatitis C (CHC) patients should be further analyzed. © 2015 The Japan Society of Hepatology.

MAX mutations status in Swedish patients with pheochromocytoma and paraganglioma tumours.

PubMed

Crona, Joakim; Maharjan, Rajani; Delgado Verdugo, Alberto; Stålberg, Peter; Granberg, Dan; Hellman, Per; Björklund, Peyman

2014-03-01

Pheochromocytoma (PCC) and Paraganglioma are rare tumours originating from neuroendocrine cells. Up to 60% of cases have either germline or somatic mutation in one of eleven described susceptibility loci, SDHA, SDHB, SDHC, SDHD, SDHAF2, VHL, EPAS1, RET, NF1, TMEM127 and MYC associated factor-X (MAX). Recently, germline mutations in MAX were found to confer susceptibility to PCC and paraganglioma (PGL). A subsequent multicentre study found about 1% of PCCs and PGLs to have germline or somatic mutations in MAX. However, there has been no study investigating the frequency of MAX mutations in a Scandinavian cohort. We analysed tumour specimens from 63 patients with PCC and PGL treated at Uppsala University hospital, Sweden, for re-sequencing of MAX using automated Sanger sequencing. Our results show that 0% (0/63) of tumours had mutations in MAX. Allele frequencies of known single nucleotide polymorphisms rs4902359, rs45440292, rs1957948 and rs1957949 corresponded to those available in the Single Nucleotide Polymorphism Database. We conclude that MAX mutations remain unusual events and targeted genetic screening should be considered after more common genetic events have been excluded.

Complex inheritance in Pulmonary Arterial Hypertension patients with several mutations

PubMed Central

Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana

2016-01-01

Pulmonary Arterial Hypertension (PAH) is a rare and progressive disease with low incidence and prevalence, and elevated mortality. PAH is characterized by increased mean pulmonary artery pressure. The aim of this study was to analyse patients with combined mutations in BMPR2, ACVRL1, ENG and KCNA5 genes and to establish a genotype-phenotype correlation. Major genes were analysed by polymerase chain reaction (PCR) and direct sequencing. Genotype-phenotype correlation was performed. Fifty-seven (28 idiopathic PAH, 29 associated PAH group I) were included. Several mutations in different genes, classified as pathogenic by in silico analysis, were present in 26% of PAH patients. The most commonly involved gene was BMPR2 (12 patients) followed by ENG gene (9 patients). ACVRL1 and KCNA5 genes showed very low incidence of mutations (5 and 1 patients, respectively). Genotype-phenotype correlation showed statistically significant differences for gender (p = 0.045), age at diagnosis (p = 0.035), pulmonary vascular resistance (p = 0.030), cardiac index (p = 0.035) and absence of response to treatment (p = 0.011). PAH is consequence of a heterogeneous constellation of genetic arrangements. Patients with several pathogenic mutations seem to display a more severe phenotype. PMID:27630060

Laboratory diagnosis of von Willebrand disease type 1/2E (2A subtype IIE), type 1 Vicenza and mild type 1 caused by mutations in the D3, D4, B1-B3 and C1-C2 domains of the von Willebrand factor gene. Role of von Willebrand factor multimers and the von Willebrand factor propeptide/antigen ratio.

PubMed

Gadisseur, Alain; Berneman, Zwi; Schroyens, Wilfried; Michiels, Jan Jacques

2009-01-01

Autosomal dominant von Willebrand disease (VWD) type 1/2E is a quantitative/qualitative defect in the von Willebrand factor (VWF) caused by heterozygous cysteine and non-cysteine mutations in the D3 domain of the VWF gene and results in a secretion-multimerization-clearance defect in mutant VWF with the loss of large VWF multimers not due to proteolysis. The multimers of patients with dominant VWD type 1/2E due to mutations in the D3 domain show an aberrant triplet structure with lack of outer bands but with pronounced inner bands of the triplet structure combined with a relative decrease in large multimers reflecting heterozygosity for multimerization defects. There is a good response to desmopressin (DDAVP) followed by rapid clearance of VWF:antigen (Ag), factor VIII coagulant activity (FVIII:C) and VWF:ristocetin cofactor activity (RCo) as the main cause of VWD type 1 or 2 with typical 2E multimeric pattern (VWD type 1/2E). Cysteine mutations in the D3 domains (C1130, C1149 and C1190) show pronounced features of VWD 1/2E with the relative loss of large and relative increase in small VWF multimers with abnormal triplet structure in heterozygotes. Such abnormalities are less pronounced in patients with a milder form of VWD type 1 due to non-cysteine mutations W1144G, T1156M and W1120S in the D3 domain. VWD type 1 Vicenza is caused by the R1205H mutation in the D3 domain and characterized by equally low levels of FVIII:C, VWF:Ag and VWF:RCo. The response to DDAVP in VWD Vicenza is good for FVIII:C, VWF:Ag and VWF:RCo, which is followed by a rapid clearance in less than a few hours of FVIII:C and VWF parameters. The ratios for FVIII:C/VWF:Ag, VWF:RCo/Ag and VWF:CB/Ag remain normal before and after DDAVP indicating that VWD Vicenza clearly differs from VWD type 1, 1/2E and 2M. A new set of missense mutations in D4, B1-B3 and C1-C2 domains has been discovered as the cause of a mild VWD type 1 secretion defect with normal VWF multimers or smeary VWF multimeric pattern. Cysteine mutations in exons 38, 40, 42 and 43 (D4, B1-B3 and C1 domain), show smeary patterns (either smf or sm), with the presence of large VWF multimers and a laboratory phenotype of mild VWD type 1 with variable penetrance of bleeding manifestations. Recent studies showed that the ratio of VWF propeptide (pp) to VWF:Ag can be used to predict a shorter than normal half-life for VWF:Ag. There is a strong inverse correlation between rapid clearance of VWF:Ag after DDAVP and increased VWFpp/Ag ratios >10 in VWD type 1 Vicenza, and >2 in VWD type 1/2E but normal or slightly increased (1-<2) VWFpp/Ag ratios in mild-type VWD due to nonsense or missense mutations in the D1, D2, D4, B and C domains. Copyright (c) 2009 S. Karger AG, Basel.

Rathke's Cleft Cyst as Origin of a Pediatric Papillary Craniopharyngioma.

PubMed

Schlaffer, Sven-Martin; Buchfelder, Michael; Stoehr, Robert; Buslei, Rolf; Hölsken, Annett

2018-01-01

A 6-year old patient presented with an intra and suprasellar cystic lesion accompanied with impairment of the hypothalamic-pituitary axis and partial hypopituitarism. The most likely cause of sellar lesions in this age group are adamantinomatous craniopharyngioma (adaCP) or Rathke´s cleft cysts (RCCs). AdaCP are characterized by CTNNB1 mutations accompanied with aberrant nuclear beta-catenin expression. RCC show neither nuclear beta-catenin expression nor BRAF mutation. The latter is a hallmark of papillary craniopharyngiomas (papCP) that exhibit remarkable histological similarity with metaplasia of RCC. Diagnosis of the patient was elucidated by CTNNB1 and BRAF mutation screening, utilizing different approaches, as well as histological examination of markers, e.g., beta-catenin, claudin-1, EpCAM and the mutated BRAFV600E protein, which are known to be differentially expressed in sellar lesions. The case presented reveals extraordinary aspects for two reasons. Firstly, the lesion appeared clinically, on MRI, intraoperatively and histologically as RCC with prominent squamous metaplasia, but showing an expression pattern of markers also found in papCP, whilst exhibiting a hitherto undescribed BRAF V 600 E mutation. This important result documents a supposable transition of RCC metaplasia into a papillary craniopharyngioma (papCP). Secondly, this intriguing case shows unexpectedly that although papCP usually occurs almost exclusively in adults, it can also arise in childhood.

Exercise-induced mitochondrial p53 repairs mtDNA mutations in mutator mice.

PubMed

Safdar, Adeel; Khrapko, Konstantin; Flynn, James M; Saleem, Ayesha; De Lisio, Michael; Johnston, Adam P W; Kratysberg, Yevgenya; Samjoo, Imtiaz A; Kitaoka, Yu; Ogborn, Daniel I; Little, Jonathan P; Raha, Sandeep; Parise, Gianni; Akhtar, Mahmood; Hettinga, Bart P; Rowe, Glenn C; Arany, Zoltan; Prolla, Tomas A; Tarnopolsky, Mark A

2016-01-01

Human genetic disorders and transgenic mouse models have shown that mitochondrial DNA (mtDNA) mutations and telomere dysfunction instigate the aging process. Epidemiologically, exercise is associated with greater life expectancy and reduced risk of chronic diseases. While the beneficial effects of exercise are well established, the molecular mechanisms instigating these observations remain unclear. Endurance exercise reduces mtDNA mutation burden, alleviates multisystem pathology, and increases lifespan of the mutator mice, with proofreading deficient mitochondrial polymerase gamma (POLG1). We report evidence for a POLG1-independent mtDNA repair pathway mediated by exercise, a surprising notion as POLG1 is canonically considered to be the sole mtDNA repair enzyme. Here, we show that the tumor suppressor protein p53 translocates to mitochondria and facilitates mtDNA mutation repair and mitochondrial biogenesis in response to endurance exercise. Indeed, in mutator mice with muscle-specific deletion of p53, exercise failed to prevent mtDNA mutations, induce mitochondrial biogenesis, preserve mitochondrial morphology, reverse sarcopenia, or mitigate premature mortality. Our data establish a new role for p53 in exercise-mediated maintenance of the mtDNA genome and present mitochondrially targeted p53 as a novel therapeutic modality for diseases of mitochondrial etiology.

Germline mutations in the proof-reading domains of POLE and POLD1 predispose to colorectal adenomas and carcinomas

PubMed Central

Palles, Claire; Cazier, Jean-Baptiste; Howarth, Kimberley M; Domingo, Enric; Jones, Angela M.; Broderick, Peter; Kemp, Zoe; Spain, Sarah L; Almeida, Estrella Guarino; Salguero, Israel; Sherborne, Amy; Chubb, Daniel; Carvajal-Carmona, Luis G; Ma, Yusanne; Kaur, Kulvinder; Dobbins, Sara; Barclay, Ella; Gorman, Maggie; Martin, Lynn; Kovac, Michal B; Humphray, Sean; Lucassen, Anneke; Holmes, Christopher; Bentley, David; Donnelly, Peter; Taylor, Jenny; Petridis, Christos; Roylance, Rebecca; Sawyer, Elinor J; Kerr, David J.; Clark, Susan; Grimes, Jonathan; Kearsey, Stephen E; Thomas, Huw JW; McVean, Gilean; Houlston, Richard S; Tomlinson, Ian

2013-01-01

Many individuals with multiple or large colorectal adenomas, or early-onset colorectal cancer (CRC), have no detectable germline mutations in the known cancer predisposition genes. Using whole-genome sequencing, supplemented by linkage and association analysis, we identified specific heterozygous POLE or POLD1 germline variants in several multiple adenoma and/or CRC cases, but in no controls. The susceptibility variants appear to have high penetrance. POLD1 is also associated with endometrial cancer predisposition. The mutations map to equivalent sites in the proof-reading (exonuclease) domain of DNA polymerases ε and δ, and are predicted to impair correction of mispaired bases inserted during DNA replication. In agreement with this prediction, mutation carriers’ tumours were microsatellite-stable, but tended to acquire base substitution mutations, as confirmed by yeast functional assays. Further analysis of published data showed that the recently-described group of hypermutant, microsatellite-stable CRCs is likely to be caused by somatic POLE exonuclease domain mutations. PMID:23263490

All-Atom Simulations Reveal How Single-Point Mutations Promote Serpin Misfolding

NASA Astrophysics Data System (ADS)

Wang, Fang; Orioli, Simone; Ianeselli, Alan; Spagnolli, Giovanni; a Beccara, Silvio; Gershenson, Anne; Faccioli, Pietro; Wintrode, Patrick L.

2018-05-01

Protein misfolding is implicated in many diseases, including the serpinopathies. For the canonical inhibitory serpin {\\alpha}1-antitrypsin (A1AT), mutations can result in protein deficiencies leading to lung disease, and misfolded mutants can accumulate in hepatocytes leading to liver disease. Using all-atom simulations based on the recently developed Bias Functional algorithm we elucidate how wild-type A1AT folds and how the disease-associated S (Glu264Val) and Z (Glu342Lys) mutations lead to misfolding. The deleterious Z mutation disrupts folding at an early stage, while the relatively benign S mutant shows late stage minor misfolding. A number of suppressor mutations ameliorate the effects of the Z mutation and simulations on these mutants help to elucidate the relative roles of steric clashes and electrostatic interactions in Z misfolding. These results demonstrate a striking correlation between atomistic events and disease severity and shine light on the mechanisms driving chains away from their correct folding routes.

Mutations in the quinolone resistance determining region in Staphylococcus epidermidis recovered from conjunctiva and their association with susceptibility to various fluoroquinolones.

PubMed

Yamada, M; Yoshida, J; Hatou, S; Yoshida, T; Minagawa, Y

2008-06-01

Staphylococcus epidermidis is one of the prominent pathogens in ocular infection. The prevalence of mutations in the quinolone resistance determining region (QRDR) area in S epidermidis isolated from the ocular surface and its association with fluoroquinolone resistance has not been fully elucidated. Mutations in the QRDR of gyrA, gyrB, parC, and parE genes of 138 isolates of S epidermidis recovered from the human conjunctival flora were analysed. The minimal inhibitory concentrations (MICs) of four fluoroquinolones (levofloxacin, gatifloxacin, moxifloxacin and tosufloxacin) against these isolates were also determined using agar dilution methods. The MIC(90) values of levofloxacin, gatifloxacin, moxifloxacin and tosufloxacin were 3.13, 1.56, 0.78 and 3.13 microg/ml, respectively. The MIC values of all fluoroquinolones showed a bimodal distribution (susceptible strain and less susceptible strain). Mutations with amino acid substitution in the QRDR were present in 70 (50.7%) isolates. 19 different combinations of mutations were detected: 3 isolates (2.2%) had four mutations, 8 (5.8%) had three mutations, 43 (31.2%) had double mutations and 16 (11.6%) had single mutations. Isolates with mutations in the QRDR of both gyrA and parC (n = 53) were less susceptible to fluoroquinolones. The present findings show that approximately half the S epidermidis isolates from the normal human conjunctiva have mutation(s) in the QRDR. The presence of mutations in both gyrA and parC is strongly associated with reduced susceptibility to fluoroquinolones.

High-risk Long QT Syndrome Mutations in the Kv7.1 (KCNQ1) Pore Disrupt the Molecular Basis for Rapid K+ Permeation

PubMed Central

Burgess, Don E.; Bartos, Daniel C.; Reloj, Allison R.; Campbell, Kenneth S.; Johnson, Jonathan N.; Tester, David J.; Ackerman, Michael J.; Fressart, Véronique; Denjoy, Isabelle; Guicheney, Pascale; Moss, Arthur J.; Ohno, Seiko; Horie, Minoru; Delisle, Brian P.

2012-01-01

Type 1 long QT syndrome (LQT1) syndrome is caused by loss-of-function mutations in the KCNQ1, which encodes the K+ channel (Kv7.1) that underlies the slowly activating delayed rectifier K+ current in the heart. Intragenic risk stratification suggests LQT1 mutations that disrupt conserved amino acid residues in the pore are an independent risk factor for LQT1-related cardiac events. The purpose of this study is to determine possible molecular mechanisms that underlie the loss-of-function for these high-risk mutations. Extensive genotype-phenotype analyses of LQT1 patients showed that T322M-, T322A-, or G325R-Kv7.1 confer a high risk for LQT1-related cardiac events. Heterologous expression of these mutations with KCNE1 revealed they generated non-functional channels and caused dominant negative suppression of WT-Kv7.1 current. Molecular dynamic simulations (MDS) of analogous mutations in KcsA (T85M-, T85A-, and G88R-KcsA) demonstrated that they disrupted the symmetrical distribution of the carbonyl oxygen atoms in the selectivity filter, which upset the balance between the strong attractive and K+-K+ repulsive forces required for rapid K+ permeation. We conclude high-risk LQT1 mutations in the pore likely disrupt the architectural and physical properties of the K+ channel selectivity filter. PMID:23092362

dRTA and hemolytic anemia: first detailed description of SLC4A1 A858D mutation in homozygous state.

PubMed

Fawaz, Naglaa A; Beshlawi, Ismail O; Al Zadjali, Shoaib; Al Ghaithi, Hamed K; Elnaggari, Mohamed A; Elnour, Ibtisam; Wali, Yasser A; Al-Said, Bushra B; Rehman, Jalil U; Pathare, Anil V; Knox-Macaulay, Huxley; Alkindi, Salam S

2012-04-01

Mutations in the anion exchanger 1 (AE1) gene encoding the erythroid and kidney anion (chloride-bicarbonate) exchanger 1 may result in familial distal renal tubular acidosis (dRTA) in association with membrane defect hemolytic anemia. Seven children presenting with hyperchloremic normal anion gap metabolic acidosis, failure to thrive, and compensated hemolytic anemia were studied. Analysis of red cell AE1/Band 3 surface expression by Eosin 5'-maleimide (E5M) was performed in patients and their family members using flow cytometry. Genetic studies showed that all patients carried a common SLC4A1 mutation, c.2573C>A; p.Ala858Asp in exon 19, found as homozygous (A858D/A858D) mutation in the patients and heterozygous (A858D/N) in the parents. Analysis by flowcytometry revealed a single uniform fluorescence peak, with the mean channel fluorescence (MCF) markedly reduced in cases with homozygous mutation, along with a left shift of fluorescence signal but was only mildly reduced in the heterozygous state. Red cell morphology showed striking acanthocytosis in the homozygous state [patients] and only a mild acanthocytosis in heterozygous state [parents]. In conclusion, this is the first description of a series of homozygous cases with the A858D mutation. The E5M flowcytometry test is specific for reduction in the Band 3 membrane protein and was useful in conjunction with a careful morphological examination of peripheral blood smears in our patient cohort. © 2012 John Wiley & Sons A/S.

Neoplasia of the ampulla of Vater. Ki-ras and p53 mutations.

PubMed Central

Scarpa, A.; Capelli, P.; Zamboni, G.; Oda, T.; Mukai, K.; Bonetti, F.; Martignoni, G.; Iacono, C.; Serio, G.; Hirohashi, S.

1993-01-01

Eleven tumors of the ampulla of Vater (5 stage IV and 2 stage II adenocarcinomas, 1 stage II papillary carcinoma, 1 neuroendocrine carcinoma, and 2 adenomas, one with foci of carcinoma) were examined for Ki-ras and p53 gene mutations by single-strand conformation polymorphism analysis and direct sequencing of polymerase chain reaction-amplified DNA fragments. Ki-ras mutations were found in one adenocarcinoma and in the adenoma with foci of carcinoma, both involving mainly the intraduodenal bile duct component of the ampulla. Seven cases showed p53 gene mutations: four advanced-stage adenocarcinomas, the papillary carcinoma, the neuroendocrine carcinoma, and the adenoma with foci of carcinoma. Nuclear accumulation of p53 protein was immunohistochemically detected in the morphologically high-grade areas of the five cancers harboring a p53 gene missense point mutation. The adenomas, the two frame shift-mutated cancers, and the adenomatous and low-grade cancer areas of mutated carcinomas were immunohistochemically negative. Our data suggest that in ampullary neoplasia 1) p53 mutations are common abnormalities associated with the transformation of adenomas and low-grade cancers into morphologically high-grade carcinomas, and 2) Ki-ras mutations are relatively less frequent and might be restricted to tumors originating from the bile duct component of the ampulla. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:8475992

Rarity of PIT1 involvement in children from Russia with combined pituitary hormone deficiency.

PubMed

Fofanova, O V; Takamura, N; Kinoshita, E; Yoshimoto, M; Tsuji, Y; Peterkova, V A; Evgrafov, O V; Dedov, I I; Goncharov, N P; Yamashita, S

1998-06-05

To ascertain the molecular background of combined pituitary hormone deficiency, screening for mutations in the pituitary-specific transcription factor (Pit-1/GHF-1) gene (PIT1) was performed on a cohort of 15 children from Russia with combined growth hormone (GH)/prolactin (Prl)/thyroid-stimulating hormone (TSH) deficiency. The group of patients, suspected of PIT1 mutations, consisted of four familial cases (seven patients) and eight sporadic cases. All had complete GH deficiency and complete or partial Prl and TSH deficiency. Direct sequencing of all six exons of PIT1 and its promoter region showed a C to T transition mutation at codon 14 of exon 1 in a 3 8/12-year-old girl. This novel PIT1 mutation results in a proline to leucine substitution (P14L). The patient was heterozygous for mutant and normal alleles. The heterozygous P14L mutation was also present in her mother as well as in her maternal aunt and grandmother, all of whom were phenotypically normal. There was no mutation in the father's DNA, suggesting the need for reevaluation of genomic imprinting. In other children of our series, no mutation in PIT1 or in its promotor region was identified. This is the first report on the analysis of PIT1 and its promoter region in Russian children with GH/Prl/TSH deficiency. However, as the involvement of PIT1 mutation is rare in Russia, the other negative cases need to be analyzed for another candidate gene responsible for combined GH/Pr/TSH deficiency.

Characterization of IDH1 p.R132H Mutant Clones Using Mutation-specific Antibody in Myeloid Neoplasms.

PubMed

Kurt, Habibe; Bueso-Ramos, Carlos E; Khoury, Joseph D; Routbort, Mark J; Kanagal-Shamanna, Rashmi; Patel, Umang V; Jorgensen, Jeffrey L; Wang, Sa A; Ravandi, Farhad; DiNardo, Courtney; Luthra, Rajyalakshmi; Medeiros, L Jeffrey; Patel, Keyur P

2018-05-01

Isocitrate dehydrogenase 1 (IDH1) and IDH2 mutations occur in a variety of myeloid neoplasms. Immunohistochemistry (IHC)-based direct visualization of mutant clones of hematopoietic cells can be useful for rapid diagnostic screening and for monitoring treatment response. In this study, we first evaluated the sensitivity and specificity of the IDH1 p.R132H mutation-specific antibody by IHC. All IDH1 wild type cases (n=11) and IDH1 mutant cases with a non-p.R132H mutation (n=30) were negative by IHC, demonstrating 100% antibody specificity. All the initial diagnostic specimens with IDH1 p.R132H mutation including acute myeloid leukemia (n=30), myelodysplastic syndromes (MDS) (n=10), MDS/myeloproliferative neoplasms (MPN) (n=4), and MPN (n=5) were positive by IHC, demonstrating 100% antibody sensitivity. Both immature and mature myeloid cells showed immunoreactivity. Erythroid precursors, lymphoid cells, endothelial cells, and osteoblasts were consistently negative by IHC. We then evaluated the follow-up specimens with a known IDH1 mutation status including acute myeloid leukemia (n=23), MDS (n=2), MDS/MPN (n=2), and MPN (n=2). Thirty-three IDH1 p.R132H mutant cases were positive by IHC and 12 IDH1 mutation negative cases were negative by IHC. However, IHC reactivity in up to 25% of bone marrow cells was noted in 8 of 20 polymerase chain reaction-negative cases, all from patients with a known history of IDH1 p.R132H mutation indicating sampling error or a sensitivity issue with molecular tests. These data indicate that IHC is a highly specific and sensitive tool to detect IDH1 p.R132H mutation in bone marrow involved by myeloid neoplasms. In addition, IDH1 p.R132H IHC also allows localization and assessment of the maturation stage of the clones carrying the mutation.

Carrier screening of RTEL1 mutations in the Ashkenazi Jewish population.

PubMed

Fedick, A M; Shi, L; Jalas, C; Treff, N R; Ekstein, J; Kornreich, R; Edelmann, L; Mehta, L; Savage, S A

2015-08-01

Hoyeraal-Hreidarsson syndrome (HH) is a clinically severe variant of dyskeratosis congenita (DC), characterized by cerebellar hypoplasia, microcephaly, intrauterine growth retardation, and severe immunodeficiency in addition to features of DC. Germline mutations in the RTEL1 gene have recently been identified as causative of HH. In this study, the carrier frequency for five RTEL1 mutations that occurred in individuals of Ashkenazi Jewish descent was investigated in order to advise on including them in existing clinical mutation panels for this population. Our screening showed that the carrier frequency for c.3791G>A (p.R1264H) was higher than expected, 1% in the Ashkenazi Orthodox and 0.45% in the general Ashkenazi Jewish population. Haplotype analyses suggested the presence of a common founder. We recommend that the c.3791G>A RTEL1 mutation be considered for inclusion in carrier screening panels in the Ashkenazi population. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A double mutation in exon 6 of the [beta]-hexosaminidase [alpha] subunit in a patient with the B1 variant of Tay-Sachs disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ainsworth, P.J.; Coulter-Mackie, M.B.

1992-10-01

The B1 variant form of Tay-Sachs disease is enzymologically unique in that the causative mutation(s) appear to affect the active site in the [alpha] subunit of [beta]-hexosaminidase A without altering its ability to associate with the [beta] subunit. Most previously reported B1 variant mutations were found in exon 5 within codon 178. The coding sequence of the [alpha] subunit gene of a patient with the B1 variant form was examined with a combination of reverse transcription of mRNA to cDNA, PCR, and dideoxy sequencing. A double mutation in exon 6 has been identified: a G[sub 574][yields]C transversion causing a val[submore » 192][yields]leu change and a G[sub 598][yields] A transition resulting in a val[sub 200][yields]met alteration. The amplified cDNAs were otherwise normal throughout their sequence. The 574 and 598 alterations have been confirmed by amplification directly from genomic DNA from the patient and her mother. Transient-expression studies of the two exon 6 mutations (singly or together) in COS-1 cells show that the G[sub 574][yields]C change is sufficient to cause the loss of enzyme activity. The biochemical phenotype of the 574 alteration in transfection studies is consistent with that expected for a B1 variant mutation. As such, this mutation differs from previously reported B1 variant mutations, all of which occur in exon 5. 31 refs., 2 figs., 2 tabs.« less

An Usher syndrome type 1 patient diagnosed before the appearance of visual symptoms by MYO7A mutation analysis.

PubMed

Yoshimura, Hidekane; Iwasaki, Satoshi; Kanda, Yukihiko; Nakanishi, Hiroshi; Murata, Toshinori; Iwasa, Yoh-ichiro; Nishio, Shin-ya; Takumi, Yutaka; Usami, Shin-ichi

2013-02-01

Usher syndrome type 1 (USH1) appears to have only profound non-syndromic hearing loss in childhood and retinitis pigmentosa develops in later years. This study examined the frequency of USH1 before the appearance of visual symptoms in Japanese deaf children by MYO7A mutation analysis. We report the case of 6-year-old male with profound hearing loss, who did not have visual symptoms. The frequency of MYO7A mutations in profound hearing loss children is also discussed. We sequenced all exons of the MYO7A gene in 80 Japanese children with severe to profound non-syndromic HL not due to mutations of the GJB2 gene (ages 0-14 years). A total of nine DNA variants were found and six of them were presumed to be non-pathogenic variants. In addition, three variants of them were found in two patients (2.5%) with deafness and were classified as possible pathogenic variants. Among them, at least one nonsense mutation and one missense mutation from the patient were confirmed to be responsible for deafness. After MYO7A mutation analysis, the patient was diagnosed with RP, and therefore, also diagnosed with USH1. This is the first case report to show the advantage of MYO7A mutation analysis to diagnose USH1 before the appearance of visual symptoms. We believed that MYO7A mutation analysis is valid for the early diagnosis of USH1. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Primary genotypic resistance of HIV-1 to the maturation inhibitor PA-457 in protease inhibitor-experienced patients.

PubMed

Malet, Isabelle; Wirden, Marc; Derache, Anne; Simon, Anne; Katlama, Christine; Calvez, Vincent; Marcelin, Anne-Geneviève

2007-04-23

Sequences from 82 protease inhibitors (PI)-experienced patients were analysed for the presence of previously described in-vitro resistance mutations to PA-457 located in the C-terminal capside (H226Y, L231F, L231M) and in the N-terminal SP1 (A1V, A3T, A3V) within the CA-SP1 boundary domain. Overall, the CA-SP1 cleavage site was highly conserved in PI pre-treated patients and only one patient showed an L231M mutation. The impact of this mutation should be further addressed in vivo.

Differential Effects of CSF-1R D802V and KIT D816V Homologous Mutations on Receptor Tertiary Structure and Allosteric Communication

PubMed Central

Da Silva Figueiredo Celestino Gomes, Priscila; Panel, Nicolas; Laine, Elodie; Pascutti, Pedro Geraldo; Solary, Eric; Tchertanov, Luba

2014-01-01

The colony stimulating factor-1 receptor (CSF-1R) and the stem cell factor receptor KIT, type III receptor tyrosine kinases (RTKs), are important mediators of signal transduction. The normal functions of these receptors can be compromised by gain-of-function mutations associated with different physiopatological impacts. Whereas KIT D816V/H mutation is a well-characterized oncogenic event and principal cause of systemic mastocytosis, the homologous CSF-1R D802V has not been identified in human cancers. The KIT D816V oncogenic mutation triggers resistance to the RTK inhibitor Imatinib used as first line treatment against chronic myeloid leukemia and gastrointestinal tumors. CSF-1R is also sensitive to Imatinib and this sensitivity is altered by mutation D802V. Previous in silico characterization of the D816V mutation in KIT evidenced that the mutation caused a structure reorganization of the juxtamembrane region (JMR) and facilitated its departure from the kinase domain (KD). In this study, we showed that the equivalent CSF-1R D802V mutation does not promote such structural effects on the JMR despite of a reduction on some key H-bonds interactions controlling the JMR binding to the KD. In addition, this mutation disrupts the allosteric communication between two essential regulatory fragments of the receptors, the JMR and the A-loop. Nevertheless, the mutation-induced shift towards an active conformation observed in KIT D816V is not observed in CSF-1R D802V. The distinct impact of equivalent mutation in two homologous RTKs could be associated with the sequence difference between both receptors in the native form, particularly in the JMR region. A local mutation-induced perturbation on the A-loop structure observed in both receptors indicates the stabilization of an inactive non-inhibited form, which Imatinib cannot bind. PMID:24828813

Turbidostat Culture of Saccharomyces cerevisiae W303-1A under Selective Pressure Elicited by Ethanol Selects for Mutations in SSD1 and UTH1

PubMed Central

Avrahami-Moyal, Liat; Engelberg, David; Wenger, Jared. W.; Sherlock, Gavin; Braun, Sergei

2012-01-01

We investigated the genetic causes of ethanol tolerance by characterizing mutations selected in Saccharomyces cerevisiae W303-1A under the selective pressure of ethanol. W303-1A was subjected to three rounds of turbidostat, in medium supplemented with increasing amounts of ethanol. By the end of selection, the growth rate of the culture has increased from 0.029 h-1 to 0.32 h-1. Unlike the progenitor strain, all yeast cells isolated from this population were able to form colonies on medium supplemented with 7% ethanol within six days, our definition of ethanol tolerance. Several clones selected from all three stages of selection were able to form dense colonies within two days on solid medium supplemented with 9% ethanol. We sequenced the whole genomes of 6 clones and identified mutations responsible for ethanol tolerance. Thirteen additional clones were tested for the presence of similar mutations. In 15 out of 19 tolerant clones the stop-codon in ssd1-d was replaced with an aminoacid-encoding codon. Three other clones contained one of two mutations in UTH1, and one clone did not contain mutations in either SSD1 or UTH1. We showed that the mutations in SSD1 and UTH1 increased tolerance of the cell wall to zymolyase and conclude that stability of the cell wall is a major factor in increased tolerance to ethanol. PMID:22443114

Phenotypic heterogeneity and mutational spectrum in a cohort of 45 Italian males subjects with X-linked ectodermal dysplasia.

PubMed

Guazzarotti, L; Tadini, G; Mancini, G E; Giglio, S; Willoughby, C E; Callea, M; Sani, I; Nannini, P; Mameli, C; Tenconi, A A; Mauri, S; Bottero, A; Caimi, A; Morelli, M; Zuccotti, G V

2015-04-01

Ectodermal dysplasias (EDs) are a group of genetic disorders characterized by the abnormal development of the ectodermal-derived structures. X-linked hypohidrotic ectodermal dysplasia, resulting from mutations in ED1 gene, is the most common form. The main purpose of this study was to characterize the phenotype spectrum in 45 males harboring ED1 mutations. The study showed that in addition to the involvement of the major ectodermal tissues, the majority of patients also have alterations of several minor ectodermal-derived structures. Characterizing the clinical spectrum resulting from ED1 gene mutations improves diagnosis and can direct clinical care. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Presenilin 1 mutations influence processing and trafficking of the ApoE receptor apoER2.

PubMed

Wang, Wei; Moerman-Herzog, Andrea M; Slaton, Arthur; Barger, Steven W

2017-01-01

Presenilin (PS)-1 is an intramembrane protease serving as the catalytic component of γ-secretase. Mutations in the PS1 gene are the most common cause of familial Alzheimer's disease (FAD). The low-density lipoprotein (LDL)-receptor family member apoER2 is a γ-secretase substrate that has been associated with AD in several ways, including acting as a receptor for apolipoprotein E (ApoE). ApoER2 is processed by γ-secretase into a C-terminal fragment (γ-CTF) that appears to regulate gene expression. FAD PS1 mutations were tested for effects on apoER2. PS1 mutation R278I showed impaired γ-secretase activity for apoER2 in the basal state or after exposure to Reelin. PS1 M146V mutation permitted accumulation of apoER2 CTFs after Reelin treatment, whereas no difference was seen between wild-type (WT) and M146V in the basal state. PS1 L282V mutation, combined with the γ-secretase inhibitor N-(N-[3,5-Difluorophenacetyl]-L-alanyl)-S-phenylglycine t-butyl ester, greatly reduced the cell-surface levels of apoER2 without affecting total apoER2 levels, suggesting a defect in receptor trafficking. These findings indicate that impaired processing or localization of apoER2 may contribute to the pathogenic effects of FAD mutations in PS1. Published by Elsevier Inc.

The mutation-drift balance in spatially structured populations.

PubMed

Schneider, David M; Martins, Ayana B; de Aguiar, Marcus A M

2016-08-07

In finite populations the action of neutral mutations is balanced by genetic drift, leading to a stationary distribution of alleles that displays a transition between two different behaviors. For small mutation rates most individuals will carry the same allele at equilibrium, whereas for high mutation rates of the alleles will be randomly distributed with frequencies close to one half for a biallelic gene. For well-mixed haploid populations the mutation threshold is μc=1/2N, where N is the population size. In this paper we study how spatial structure affects this mutation threshold. Specifically, we study the stationary allele distribution for populations placed on regular networks where connected nodes represent potential mating partners. We show that the mutation threshold is sensitive to spatial structure only if the number of potential mates is very small. In this limit, the mutation threshold decreases substantially, increasing the diversity of the population at considerably low mutation rates. Defining kc as the degree of the network for which the mutation threshold drops to half of its value in well-mixed populations we show that kc grows slowly as a function of the population size, following a power law. Our calculations and simulations are based on the Moran model and on a mapping between the Moran model with mutations and the voter model with opinion makers. Copyright © 2016 Elsevier Ltd. All rights reserved.

Three patients with Schaaf-Yang syndrome exhibiting arthrogryposis and endocrinological abnormalities.

PubMed

Enya, Takuji; Okamoto, Nobuhiko; Iba, Yoshinori; Miyazawa, Tomoki; Okada, Mitsuru; Ida, Shinobu; Naruto, Takuya; Imoto, Issei; Fujita, Atsushi; Miyake, Noriko; Matsumoto, Naomichi; Sugimoto, Keisuke; Takemura, Tsukasa

2018-03-01

MAGEL2 is the paternally expressed gene within Prader-Willi syndrome critical region at 15q11.2. We encountered three individuals in whom truncating mutations of MAGEL2 were identified. Patients 1 and 2, siblings born to healthy, non-consanguineous Japanese parents, showed generalized hypotonia, lethargy, severe respiratory difficulty, poor feeding, and multiple anomalies including arthrogryposis soon after birth. We carried out whole-exome sequencing, which detected a MAGEL2 mutation (c.1912C>T, p.Gln638*, heterozygous). The patients' father was heterozygous for the mutation. Patient 3 was a female infant, showed respiratory difficulty reflecting pulmonary hypoplasia, generalized hypotonia, feeding difficulty and multiple anomalies soon after birth. Targeted next-generation sequencing detected a novel heterozygous mutation in MAGEL2 (c.3131C>A, p.Ser1044*). This mutation was not found in the parents. MAGEL2 mutations, first reported to be the cause of the Prader-Willi like syndrome with autism by Schaaf et al. (2013) Nature Genetics, 45: 1405-1408 show the wide range of phenotypic spectrum from lethal arthrogryposis multiplex congenital to autism spectrum disorder (ASD) and mild intellectual disability (ID). Our results indicate that MAGEL2 mutations cause multiple congenital anomalies and intellectual disability accompanied by arthrogryposis multiplex congenita and various endocrinologic abnormalities, supporting that the view that clinical phenotypes of MAGEL2 mutations are variable. © 2018 Wiley Periodicals, Inc.

Combined "Infiltrating Astrocytoma/Pleomorphic Xanthoastrocytoma" Harboring IDH1 R132H and BRAF V600E Mutations.

PubMed

Yamada, Seiji; Kipp, Benjamin R; Voss, Jesse S; Giannini, Caterina; Raghunathan, Aditya

2016-02-01

Pleomorphic xanthoastrocytoma (PXA) has rarely been reported in combination with infiltrating glioma, historically interpreted as a "collision tumor." Isocitrate dehydrogenase 1 (IDH1) and BRAF V600E mutations are usually not concurrent. The former is typical of adult infiltrating gliomas, and the latter is identified in a variety of primary central nervous system neoplasms, including PXA, ganglioglioma, pilocytic astrocytoma, and rarely infiltrating gliomas. We report the case of a 56-year-old man presenting with seizures and headaches. Magnetic resonance imaging revealed a large right temporal lobe mass with low T1 and high T2/FLAIR signal and a discrete contrast-enhancing focus. Histologically, the tumor showed 2 distinct components: an infiltrating astrocytoma harboring 5 mitoses/10 high-power fields and a relatively circumscribed focus, resembling PXA with, at most, 2 mitoses/10 high-power fields. No microvascular proliferation or necrosis was present in either component. The infiltrating astrocytoma component contained numerous axons, whereas the PXA-like component had sparse axons, as demonstrated by the neurofilament immunostain. Both components were positive for the mutant IDH1 R132H and showed loss of ATRX expression, whereas BRAF V600E was restricted to the PXA-like component. On sequencing of the 2 components separately after microdissection, both showed identical IDH1 R132H and TP53 R273C point mutations, whereas the BRAF V600E mutation was limited to the PXA-like component. These findings are consistent with clonal expansion of a morphologically distinct focus, harboring a private BRAF V600E mutation within an IDH1-mutant glioma. Intratumoral heterogeneity and clonal evolution, as seems to have occurred here, suggest reevaluation of "collision tumors" as a concept.

Identification of mutations in the AIPL1, CRB1, GUCY2D, RPE65, and RPGRIP1 genes in patients with juvenile retinitis pigmentosa.

PubMed

Booij, J C; Florijn, R J; ten Brink, J B; Loves, W; Meire, F; van Schooneveld, M J; de Jong, P T V M; Bergen, A A B

2005-11-01

To identify mutations in the AIPL1, CRB1, GUCY2D, RPE65, and RPGRIP1 genes in patients with juvenile retinitis pigmentosa. Mutation analysis was carried out in a group of 35 unrelated patients with juvenile autosomal recessive retinitis pigmentosa (ARRP), Leber's congenital amaurosis (LCA), or juvenile isolated retinitis pigmentosa (IRP), by denaturing high performance liquid chromatography followed by direct sequencing. All three groups of patients showed typical combinations of eye signs associated with retinitis pigmentosa: pale optic discs, narrow arterioles, pigmentary changes, and nystagmus. Mutations were found in 34% of in CRB1 (11%), GUCY2D (11%), RPE65 (6%), and RPGRIP1 (6%). Nine mutations are reported, including a new combination of two mutations in CRB1, and new mutations in GUCY2D and RPGRIP1. The new GUCY2D mutation (c.3283delC, p.Pro1069ArgfsX37) is the first pathological sequence change reported in the intracellular C-terminal domain of GUCY2D, and did not lead to the commonly associated LCA, but to a juvenile retinitis pigmentosa phenotype. The polymorphic nature of three previously described (pathological) sequence changes in AIPL1, CRB1, and RPGRIP1 was established. Seven new polymorphic changes, useful for further association studies, were found. New and previously described sequence changes were detected in retinitis pigmentosa in CRB1, GUCY2D, and RPGRIP1; and in LCA patients in CRB1, GUCY2D, and RPE65. These data, combined with previous reports, suggest that LCA and juvenile ARRP are closely related and belong to a continuous spectrum of juvenile retinitis pigmentosa.

Down syndrome-associated haematopoiesis abnormalities created by chromosome transfer and genome editing technologies.

PubMed

Kazuki, Yasuhiro; Yakura, Yuwna; Abe, Satoshi; Osaki, Mitsuhiko; Kajitani, Naoyo; Kazuki, Kanako; Takehara, Shoko; Honma, Kazuhisa; Suemori, Hirofumi; Yamazaki, Satoshi; Sakuma, Tetsushi; Toki, Tsutomu; Shimizu, Ritsuko; Nakauchi, Hiromitsu; Yamamoto, Takashi; Oshimura, Mitsuo

2014-08-27

Infants with Down syndrome (DS) are at a high risk of developing transient abnormal myelopoiesis (TAM). A GATA1 mutation leading to the production of N-terminally truncated GATA1 (GATA1s) in early megakaryocyte/erythroid progenitors is linked to the onset of TAM and cooperated with the effect of trisomy 21 (Ts21). To gain insights into the underlying mechanisms of the progression to TAM in DS patients, we generated human pluripotent stem cells harbouring Ts21 and/or GATA1s by combining microcell-mediated chromosome transfer and genome editing technologies. In vitro haematopoietic differentiation assays showed that the GATA1s mutation blocked erythropoiesis irrespective of an extra chromosome 21, while Ts21 and the GATA1s mutation independently perturbed megakaryopoiesis and the combination of Ts21 and the GATA1s mutation synergistically contributed to an aberrant accumulation of skewed megakaryocytes. Thus, the DS model cells generated by these two technologies are useful in assessing how GATA1s mutation is involved in the onset of TAM in patients with DS.

The Amelioration of Myelofibrosis with Thrombocytopenia by a JAK1/2 Inhibitor, Ruxolitinib, in a Post-polycythemia Vera Myelofibrosis Patient with a JAK2 Exon 12 Mutation.

PubMed

Ikeda, Kazuhiko; Ueda, Koki; Sano, Takahiro; Ogawa, Kazuei; Ikezoe, Takayuki; Hashimoto, Yuko; Morishita, Soji; Komatsu, Norio; Ohto, Hitoshi; Takeishi, Yasuchika

2017-01-01

Less than 5% of patients with polycythemia vera (PV) show JAK2 exon 12 mutations. Although PV patients with JAK2 exon 12 mutations are known to develop post-PV myelofibrosis (MF) as well as PV with JAK2V617F, the role of JAK inhibitors in post-PV MF patients with JAK2 exon 12 mutations remains unknown. We describe how treatment with a JAK1/2 inhibitor, ruxolitinib, led to the rapid amelioration of marrow fibrosis, erythrocytosis and thrombocytopenia in a 77-year-old man with post-PV MF who carried a JAK2 exon 12 mutation (JAK2H538QK539L). This case suggests that ruxolitinib is a treatment option for post-PV MF in patients with thrombocytopenia or JAK2 exon 12 mutations.

Germ-line PHD1 and PHD2 mutations detected in patients with pheochromocytoma/paraganglioma-polycythemia.

PubMed

Yang, Chunzhang; Zhuang, Zhengping; Fliedner, Stephanie M J; Shankavaram, Uma; Sun, Michael G; Bullova, Petra; Zhu, Roland; Elkahloun, Abdel G; Kourlas, Peter J; Merino, Maria; Kebebew, Electron; Pacak, Karel

2015-01-01

We have investigated genetic/pathogenetic factors associated with a new clinical entity in patients presenting with pheochromocytoma/paraganglioma (PHEO/PGL) and polycythemia. Two patients without hypoxia-inducible factor 2α (HIF2A) mutations, who presented with similar clinical manifestations, were analyzed for other gene mutations, including prolyl hydroxylase (PHD) mutations. We have found for the first time a germ-line mutation in PHD1 in one patient and a novel germ-line PHD2 mutation in a second patient. Both mutants exhibited reduced protein stability with substantial quantitative protein loss and thus compromised catalytic activities. Due to the unique association of patients' polycythemia with borderline or mildly elevated erythropoietin (EPO) levels, we also performed an in vitro sensitivity assay of erythroid progenitors to EPO and for EPO receptor (EPOR) expression. The results show inappropriate hypersensitivity of erythroid progenitors to EPO in these patients, indicating increased EPOR expression/activity. In addition, the present study indicates that HIF dysregulation due to PHD mutations plays an important role in the pathogenesis of these tumors and associated polycythemia. The PHD1 mutation appears to be a new member contributing to the genetic landscape of this novel clinical entity. Our results support the existence of a specific PHD1- and PHD2-associated PHEO/PGL-polycythemia disorder. • A novel germ-l i n e PHD1 mutation causing heochromocytoma/paraganglioma and polycythemia. • Increased EPOR activity and inappropriate hypersensitivity of erythroid progenitors to EPO.

Nevirapine resistance mutation at codon 181 of the HIV-1 reverse transcriptase confers stavudine resistance by increasing nucleotide substrate discrimination and phosphorolytic activity.

PubMed

Blanca, Giuseppina; Baldanti, Fausto; Paolucci, Stefania; Skoblov, Alexander Yu; Victorova, Lyubov; Hübscher, Ulrich; Gerna, Giuseppe; Spadari, Silvio; Maga, Giovanni

2003-05-02

Recombinant HIV-1 reverse transcriptase (RT) carrying non-nucleoside inhibitors (NNRTIs) resistance mutation at codon 181 showed reduced incorporation and high efficiency of phosphorolytic removal of stavudine, a nucleoside RT inhibitor. These results reveal a new mechanism for cross-resistance between different classes of HIV-1 RT inhibitors.

Clinical and mutation-type analysis from an international series of 198 probands with a pathogenic FBN1 exons 24–32 mutation

PubMed Central

Faivre, L; Collod-Beroud, G; Callewaert, B; Child, A; Binquet, C; Gautier, E; Loeys, B L; Arbustini, E; Mayer, K; Arslan-Kirchner, M; Stheneur, C; Kiotsekoglou, A; Comeglio, P; Marziliano, N; Wolf, J E; Bouchot, O; Khau-Van-Kien, P; Beroud, C; Claustres, M; Bonithon-Kopp, C; Robinson, P N; Adès, L; De Backer, J; Coucke, P; Francke, U; De Paepe, A; Jondeau, G; Boileau, C

2009-01-01

Mutations in the FBN1 gene cause Marfan syndrome (MFS) and a wide range of overlapping phenotypes. The severe end of the spectrum is represented by neonatal MFS, the vast majority of probands carrying a mutation within exons 24–32. We previously showed that a mutation in exons 24–32 is predictive of a severe cardiovascular phenotype even in non-neonatal cases, and that mutations leading to premature truncation codons are under-represented in this region. To describe patients carrying a mutation in this so-called ‘neonatal' region, we studied the clinical and molecular characteristics of 198 probands with a mutation in exons 24–32 from a series of 1013 probands with a FBN1 mutation (20%). When comparing patients with mutations leading to a premature termination codon (PTC) within exons 24–32 to patients with an in-frame mutation within the same region, a significantly higher probability of developing ectopia lentis and mitral insufficiency were found in the second group. Patients with a PTC within exons 24–32 rarely displayed a neonatal or severe MFS presentation. We also found a higher probability of neonatal presentations associated with exon 25 mutations, as well as a higher probability of cardiovascular manifestations. A high phenotypic heterogeneity could be described for recurrent mutations, ranging from neonatal to classical MFS phenotype. In conclusion, even if the exons 24–32 location appears as a major cause of the severity of the phenotype in patients with a mutation in this region, other factors such as the type of mutation or modifier genes might also be relevant. PMID:19002209

Identification of an Nav1.1 sodium channel (SCN1A) loss-of-function mutation associated with familial simple febrile seizures

PubMed Central

Mantegazza, Massimo; Gambardella, Antonio; Rusconi, Raffaella; Schiavon, Emanuele; Annesi, Ferdinanda; Cassulini, Rita Restano; Labate, Angelo; Carrideo, Sara; Chifari, Rosanna; Canevini, Maria Paola; Canger, Raffaele; Franceschetti, Silvana; Annesi, Grazia; Wanke, Enzo; Quattrone, Aldo

2005-01-01

Febrile seizures (FS) affect 5–12% of infants and children up to 6 years of age. There is now epidemiological evidence that FS are associated with subsequent afebrile and unprovoked seizures in ≈7% of patients, which is 10 times more than in the general population. Extensive genetic studies have demonstrated that various loci are responsible for familial FS, and the FEB3 autosomal-dominant locus has been identified on chromosome 2q23–24, where the SCN1A gene is mapped. However, gene mutations causing simple FS have not been found yet. Here we show that the M145T mutation of a well conserved amino acid in the first transmembrane segment of domain I of the human Nav1.1 channel α-subunit cosegregates in all 12 individuals of a large Italian family affected by simple FS. Functional studies in mammalian cells demonstrate that the mutation causes a 60% reduction of current density and a 10-mV positive shift of the activation curve. Thus, M145T is a loss-of-function mutant. These results show that monogenic FS should also be considered a channelopathy. PMID:16326807

R124C mutation of the betaIGH3 gene leads to remarkable phenotypic variability in a Greek four-generation family with lattice corneal dystrophy type 1.

PubMed

Hellenbroich, Y; Tzivras, G; Neppert, B; Schwinger, E; Zühlke, C

2001-01-01

Five autosomal dominantly inherited corneal dystrophies are caused by missense mutations in the betaIGH3 gene on chromosome 5q31. Here we describe the clinical features and the analysis of the betaIGH3 gene in a Greek four-generation family with lattice corneal dystrophy type 1 (CDL1). Sequencing of the betaIGH3 cDNA from an affected family member revealed the R124C mutation. More recent data indicate that this is probably a mutation hot spot in CDL1. We could not find a common haplotype with another CDL1 family with the R124C mutation demonstrating that this mutation occurs independently in different families. The clinical course of the disease showed a remarkable variability between the affected family members. To investigate a possible role between the phenotypic variability and apolipoprotein E (ApoE), which co-localises with amyloid deposits in CDL1, we determined the ApoE genotype of all family members. The resulting data revealed no association with the variable clinical course. Copyright 2001 S. Karger AG, Basel

Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

PubMed

Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

2017-01-01

The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Primary hyperoxaluria type 1: a cluster of new mutations in exon 7 of the AGXT gene.

PubMed

von Schnakenburg, C; Rumsby, G

1997-06-01

Primary hyperoxaluria type 1 (PH1) is a severe autosomal recessive inborn error of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase. This enzyme is encoded by the AGXT gene on chromosome 2q37.3. DNA samples from 79 PH1 patients were studied using single strand conformation polymorphism analysis to detect sequence variants, which were then characterised by direct sequencing and confirmed by restriction enzyme digestion. Four novel mutations were identified in exon 7 of AGXT: a point mutation T853C, which leads to a predicted Ile244Thr amino acid substitution, occurred in nine patients. Two other mutations in adjacent nucleotides, C819T and G820A, mutated the same codon at residue 233 from arginine to cysteine and histidine, respectively. The fourth mutation, G860A, introduced a stop codon at amino acid residue 246. Enzyme studies in these patients showed that AGT catalytic activity was either very low or absent and that little or no immunoreactive protein was present. Together with a new polymorphism in exon 11 (C1342A) these findings underline the genetic heterogeneity of the AGXT gene. The novel mutation T853C is the second most common mutation found to date with an allelic frequency of 9% and will therefore be of clinical importance for the diagnosis of PH1.

Primary hyperoxaluria type 1: a cluster of new mutations in exon 7 of the AGXT gene.

PubMed Central

von Schnakenburg, C; Rumsby, G

1997-01-01

Primary hyperoxaluria type 1 (PH1) is a severe autosomal recessive inborn error of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase. This enzyme is encoded by the AGXT gene on chromosome 2q37.3. DNA samples from 79 PH1 patients were studied using single strand conformation polymorphism analysis to detect sequence variants, which were then characterised by direct sequencing and confirmed by restriction enzyme digestion. Four novel mutations were identified in exon 7 of AGXT: a point mutation T853C, which leads to a predicted Ile244Thr amino acid substitution, occurred in nine patients. Two other mutations in adjacent nucleotides, C819T and G820A, mutated the same codon at residue 233 from arginine to cysteine and histidine, respectively. The fourth mutation, G860A, introduced a stop codon at amino acid residue 246. Enzyme studies in these patients showed that AGT catalytic activity was either very low or absent and that little or no immunoreactive protein was present. Together with a new polymorphism in exon 11 (C1342A) these findings underline the genetic heterogeneity of the AGXT gene. The novel mutation T853C is the second most common mutation found to date with an allelic frequency of 9% and will therefore be of clinical importance for the diagnosis of PH1. Images PMID:9192270

The first case of NSHL by direct impression on EYA1 gene and identification of one novel mutation in MYO7A in the Iranian families.

PubMed

Razmara, Ehsan; Bitarafan, Fatemeh; Esmaeilzadeh-Gharehdaghi, Elika; Almadani, Navid; Garshasbi, Masoud

2018-03-01

Targeted next-generation sequencing (NGS) provides a consequential opportunity to elucidate genetic factors in known diseases, particularly in profoundly heterogeneous disorders such as non-syndromic hearing loss (NSHL). Hearing impairments could be classified into syndromic and non-syndromic types. This study intended to assess the significance of mutations in these genes to the autosomal recessive/dominant non-syndromic genetic load among Iranian families. Two families were involved in this research and two patients were examined by targeted next-generation sequencing. Here we report two novel mutations in the MYO7A and EYA1 genes in two patients detected by targeted NGS. They were confirmed by Sanger sequencing and quantitative real-time PCR techniques. In this investigation, we identified a novel mutation in MYO7A , c.3751G>C, p.A1251P, along with another previously identified mutation (c.1708C>T) in one of the cases. This mutation is located in the MYTH4 protein domain which is a pivotal domain for the myosin function. Another finding in this research was a novel de-novo deletion which deletes the entire EYA1 coding region (EX1-18 DEL). Mutations in EYA1 gene have been found in branchiootorenal (BOR) syndrome. Interestingly the patient with EYA1 deletion did not show any other additional clinical implications apart from HL. This finding might argue for the sole involvement of EYA1 function in the mechanism of hearing. This investigation exhibited that the novel mutations in MYO7A , c.3751G>C, p.A1251P, and EYA1 , EX1-18 DEL, were associated with NSHL. Our research increased the mutation spectrum of hearing loss in the Iranian population.

Phenotypic Variation in 46,XX Disorders of Sex Development due to the NR5A1 p.R92W Variant: A Sibling Case Report and Literature Review.

PubMed

Takasawa, Kei; Igarashi, Maki; Ono, Makoto; Takemoto, Akira; Takada, Shuji; Yamataka, Atsuyuki; Ogata, Tsutomu; Morio, Tomohiro; Fukami, Maki; Kashimada, Kenichi

2017-01-01

Recently, a heterozygous missense mutation in NR5A1, p.R92W, was identified as a cause of 46,XX testicular/ovo-testicular disorders of sexual development (DSD). We report a sibling pair with 46,XX DSD due to an NR5A1 mutation with distinct phenotypes, including external and internal genitalia and gonads, for whom different rearing sexes were selected. Thus, the phenotypes of p.R92W vary, even within a family. The father of the patients showed oligozoospermia with the p.R92W mutation, suggesting that in 46,XY individuals, the mutation would cause various gonadal phenotypes. We review and discuss the general role of the R92W mutation in sexual development. © 2018 S. Karger AG, Basel.

Clinical ascertainment of Nijmegen breakage syndrome (NBS) and prevalence of the major mutation, 657del5, in three Slav populations.

PubMed

Varon, R; Seemanova, E; Chrzanowska, K; Hnateyko, O; Piekutowska-Abramczuk, D; Krajewska-Walasek, M; Sykut-Cegielska, J; Sperling, K; Reis, A

2000-11-01

Nijmegen breakage syndrome (NBS) is a chromosomal instability disorder, clinically characterised by microcephaly, immunodeficiency, radiosensitivity and a very high predisposition to lymphoid malignancy. Recently, it was demonstrated that mutations in the NBS1 gene are responsible for NBS. Most of the NBS patients known so far are of Slav origin and carry a major founder mutation 657del5 in exon 6 of the NBS1 gene. In this study we estimated the prevalence of the 657del5 mutation in the Czech Republic, Poland and the Ukraine. We found an unexpectedly high carrier frequency of the 657del5 mutation (1/177) in the three Slav populations, a factor that may contribute to cancer frequency in those countries. In addition, we show that NBS patients are often diagnosed late and therefore receive inappropriate therapy.

Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.

PubMed

Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z

2016-10-31

To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.

Autophagy and Oxidative Stress in Gliomas with IDH1 Mutations

PubMed Central

Gilbert, Misty R.; Liu, Yinxing; Neltner, Janna; Pu, Hong; Morris, Andrew; Sunkara, Manjula; Pittman, Thomas; Kyprianou, Natasha; Horbinski, Craig

2013-01-01

IDH1 mutations in gliomas associate with longer survival. Prooxidant and antiproliferative effects of IDH1 mutations and its D-2-hydroxyglutarate (2-HG) product have been described in vitro, but inconsistently observed. It is also unclear whether overexpression of mutant IDH1 in wild-type cells accurately phenocopies the effects of endogenous IDH1-mutations on tumor apoptosis and autophagy. Herein we investigated the effects of 2-HG and mutant IDH1 overexpression on proliferation, apoptosis, oxidative stress, and autophagy in IDH1 wild-type glioma cells, and compared those results with patient-derived tumors. 2-HG reduced viability and proliferation of U87MG and LN18 cells, triggered apoptosis in LN18 cells, and autophagy in U87MG cells. In vitro studies and flank xenografts of U87MG cells overexpressing R132H IDH1 exhibited increased oxidative stress, including increases of both manganese superoxide dismutase (MnSOD) and p62. Patient-derived IDH1-mutant tumors showed no significant differences in apoptosis or autophagy, but showed p62 accumulation and actually trended toward reduced MnSOD expression. These data indicate that mutant IDH1 and 2-HG can induce oxidative stress, autophagy, and apoptosis, but these effects vary greatly according to cell type. PMID:24150401

Myocardial 123I-metaiodobenzylguanidine scintigraphy in patients with homozygous and heterozygous parkin mutations.

PubMed

De Rosa, Anna; Pellegrino, Teresa; Pappatà, Sabina; Pellecchia, Maria Teresa; Peluso, Silvio; Saccà, Francesco; Barone, Paolo; Cuocolo, Alberto; De Michele, Giuseppe

2017-02-01

PARK2 is an autosomal recessive parkinsonism caused by parkin gene mutations. Several Parkinson's Disease (PD) cases harbor single parkin mutations, raising a debate about the pathogenic meaning of heterozygous mutations. Here, we evaluate cardiac autonomic innervation in patients with either two or one parkin mutations compared to patients with idiopathic PD (IPD). Myocardial 123 I-metaiodobenzylguanidine (MIBG) scintigraphy was performed in six PD patients with single parkin mutations (HET), four with two mutations (PARK2), and eight with IPD. In comparison to control group, IPD patients showed lower early and late heart-to-mediastinum (H/M) ratios and higher washout rates, whereas HET patients had only lower early H/M ratio, and PARK2 patients were not different for any parameter. At individual level, MIBG findings were abnormal in 7/8 IPD, in 4/6 HET and in 1/4 PARK2 patients. Preserved cardiac 123 I-MIBG uptake confirms that PARK2 pathogenic mechanism, at least partially, differs from that responsible for IPD. HET subjects show intermediate findings, suggesting possible heterogeneity.

Use of multivariate analysis to suggest a new molecular classification of colorectal cancer

PubMed Central

Domingo, Enric; Ramamoorthy, Rajarajan; Oukrif, Dahmane; Rosmarin, Daniel; Presz, Michal; Wang, Haitao; Pulker, Hannah; Lockstone, Helen; Hveem, Tarjei; Cranston, Treena; Danielsen, Havard; Novelli, Marco; Davidson, Brian; Xu, Zheng-Zhou; Molloy, Peter; Johnstone, Elaine; Holmes, Christopher; Midgley, Rachel; Kerr, David; Sieber, Oliver; Tomlinson, Ian

2013-01-01

Abstract Molecular classification of colorectal cancer (CRC) is currently based on microsatellite instability (MSI), KRAS or BRAF mutation and, occasionally, chromosomal instability (CIN). Whilst useful, these categories may not fully represent the underlying molecular subgroups. We screened 906 stage II/III CRCs from the VICTOR clinical trial for somatic mutations. Multivariate analyses (logistic regression, clustering, Bayesian networks) identified the primary molecular associations. Positive associations occurred between: CIN and TP53 mutation; MSI and BRAF mutation; and KRAS and PIK3CA mutations. Negative associations occurred between: MSI and CIN; MSI and NRAS mutation; and KRAS mutation, and each of NRAS, TP53 and BRAF mutations. Some complex relationships were elucidated: KRAS and TP53 mutations had both a direct negative association and a weaker, confounding, positive association via TP53–CIN–MSI–BRAF–KRAS. Our results suggested a new molecular classification of CRCs: (1) MSI+ and/or BRAF-mutant; (2) CIN+ and/or TP53– mutant, with wild-type KRAS and PIK3CA; (3) KRAS- and/or PIK3CA-mutant, CIN+, TP53-wild-type; (4) KRAS– and/or PIK3CA-mutant, CIN–, TP53-wild-type; (5) NRAS-mutant; (6) no mutations; (7) others. As expected, group 1 cancers were mostly proximal and poorly differentiated, usually occurring in women. Unexpectedly, two different types of CIN+ CRC were found: group 2 cancers were usually distal and occurred in men, whereas group 3 showed neither of these associations but were of higher stage. CIN+ cancers have conventionally been associated with all three of these variables, because they have been tested en masse. Our classification also showed potentially improved prognostic capabilities, with group 3, and possibly group 1, independently predicting disease-free survival. Copyright © 2012 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. PMID:23165447

Mixed and Ambiguous Endometrial Carcinomas: A Heterogenous Group of Tumors With Different Clinicopathologic and Molecular Genetic Features.

PubMed

Espinosa, Iñigo; D'Angelo, Emanuela; Palacios, José; Prat, Jaime

2016-07-01

Besides endometrioid, serous, and clear cell carcinomas, there are endometrial carcinomas exhibiting mixed and ambiguous morphologic features. We have analyzed the immunophenotype (p53, p16, β-catenin, ER, HNF-1B, MLH1, and Ki-67) and mutational status (PTEN, KRAS, PIK3CA, and POLE) of 7 mixed carcinomas and 13 ambiguous carcinomas, all of them classified initially as mixed carcinomas. Only 2 of the 7 (28%) mixed carcinomas showed different immunophenotypes in different components. All but 2 tumors (5/7, 71%) overexpressed p53 and p16 and were negative for ER. Both carcinomas (2/7, 28%) showed a prominent micropapillary component that resembled an ovarian low-grade serous carcinoma and merged with villoglandular endometrioid carcinoma. The ambiguous carcinomas exhibited glandular architecture, high nuclear grade, and overlapping features of endometrioid and serous carcinomas. All tumors overexpressed p53 and p16, and the majority of cases (12/13, 92%) were negative for ER. KRAS mutations were identified in 3 of 7 (42%) mixed carcinomas, including the 2 cases with a "low-grade" serous-like component. PIK3CA mutations occurred in 2 (2/13, 15%) ambiguous carcinomas and PTEN mutations in 1 (1/7, 14%) mixed and 1 (1/13, 8%) ambiguous carcinoma. POLE exonuclease domain mutations were encountered in a case of mixed undifferentiated and well-differentiated (dedifferentiated) carcinoma. Two of the 7 (29%) mixed endometrial carcinomas and 5 of the 13 (38%) ambiguous carcinomas had extended beyond the pelvis (stages III and IV). Two of the 7 (29%) patients with mixed endometrial carcinoma and 6 of 12 (50%) patients with ambiguous endometrial carcinoma were alive with disease or had died of tumor. Our results show that, biologically, many so-called mixed carcinomas represent serous carcinomas with ambiguous morphology. Our series include 2 true mixed endometrial carcinomas with a "low-grade serous"-like component, microcystic, elongated, or fragmented features, KRAS mutations, and aggressive behavior.

KIAA1549-BRAF fusions and IDH mutations can coexist in diffuse gliomas of adults.

PubMed

Badiali, Manuela; Gleize, Vincent; Paris, Sophie; Moi, Loredana; Elhouadani, Selma; Arcella, Antonietta; Morace, Roberta; Antonelli, Manila; Buttarelli, Francesca Romana; Figarella-Branger, Dominique; Kim, Young-Ho; Ohgaki, Hiroko; Mokhtari, Karima; Sanson, Marc; Giangaspero, Felice

2012-11-01

KIAA1549-BRAF fusion gene and isocitrate dehydrogenase (IDH) mutations are considered two mutually exclusive genetic events in pilocytic astrocytomas and diffuse gliomas, respectively. We investigated the presence of the KIAA1549-BRAF fusion gene in conjunction with IDH mutations and 1p/19q loss in 185 adult diffuse gliomas. Moreover BRAF(v600E) mutation was also screened. The KIAA1549-BRAF fusion gene was evaluated by reverse-transcription polymerase chain reaction (RT-PCR) and sequencing. We found IDH mutations in 125 out 175 cases (71.4%). There were KIAA1549-BRAF fusion gene in 17 out of 180 (9.4%) cases and BRAF(v600E) in 2 out of 133 (1.5%) cases. In 11 of these 17 cases, both IDH mutations and the KIAA1549-BRAF fusion were present, as independent molecular events. Moreover, 6 of 17 cases showed co-presence of 1p/19q loss, IDH mutations and KIAA1549-BRAF fusion. Among the 17 cases with KIAA1549-BRAF fusion gene 15 (88.2%) were oligodendroglial neoplasms. Similarly, the two cases with BRAF(v600E) mutation were both oligodendroglioma and one had IDH mutations and 1p/19q co-deletion. Our results suggest that in a small fraction of diffuse gliomas, KIAA1549-BRAF fusion gene and BRAF(v600E) mutation may be responsible for deregulation of the Ras-RAF-ERK signaling pathway. Such alterations are more frequent in oligodendroglial neoplasm and may be co-present with IDH mutations and 1p/19q loss. © 2012 The Authors; Brain Pathology © 2012 International Society of Neuropathology.

Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

PubMed

Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

2017-04-03

During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs

PubMed Central

De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude

2017-01-01

During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung−/−Pms2−/− mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. PMID:28283534

Metastatic site location influences the diagnostic accuracy of ctDNA EGFR- mutation testing in NSCLC patients: a pooled analysis.

PubMed

Passiglia, Francesco; Rizzo, Sergio; Rolfo, Christian; Galvano, Antonio; Bronte, Enrico; Incorvaia, Lorena; Listi, Angela; Barraco, Nadia; Castiglia, Marta; Calo, Valentina; Bazan, Viviana; Russo, Antonio

2018-03-08

Recent studies evaluated the diagnostic accuracy of circulating tumor DNA (ctDNA) in the detection of epidermal growth factor receptor (EGFR) mutations from plasma of NSCLC patients, overall showing a high concordance as compared to standard tissue genotyping. However it is less clear if the location of metastatic site may influence the ability to identify EGFR mutations in plasma. This pooled analysis aims to evaluate the association between the metastatic site location and the sensitivity of ctDNA analysis in detecting EGFR mutations in NSCLC patients. Data from all published studies, evaluating the sensitivity of plasma-based EGFR-mutation testing, stratified by metastatic site location (extrathoracic (M1b) vs intrathoracic (M1a)) were collected by searching in PubMed, Cochrane Library, American Society of Clinical Oncology, and World Conference of Lung Cancer, meeting proceedings. Pooled Odds ratio (OR) and 95% confidence intervals (95% CIs) were calculated for the ctDNA analysis sensitivity, according to metastatic site location. A total of ten studies, with 1425 patients, were eligible. Pooled analysis showed that the sensitivity of ctDNA-based EGFR-mutation testing is significantly higher in patients with M1b vs M1a disease (OR: 5.09; 95% CIs: 2.93 - 8.84). A significant association was observed for both EGFR-activating (OR: 4.30, 95% CI: 2.35-7.88) and resistant T790M mutations (OR: 11.89, 95% CI: 1.45-97.22), regardless of the use of digital-PCR (OR: 5.85, 95% CI: 3.56-9.60) or non-digital PCR technologies (OR: 2.96, 95% CI: 2.24-3.91). These data suggest that the location of metastatic sites significantly influences the diagnostic accuracy of ctDNA analysis in detecting EGFR mutations in NSCLC patients. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Response of head and neck squamous cell carcinoma cells carrying PIK3CA mutations to selected targeted therapies.

PubMed

Wirtz, Eric D; Hoshino, Daisuke; Maldonado, Anthony T; Tyson, Darren R; Weaver, Alissa M

2015-06-01

The PIK3CA mutation is one of the most common mutations in head and neck squamous cell carcinoma (HNSCC). Through this research we attempt to elicit the role of oncogene dependence and effects of targeted therapy on this PIK3CA mutation. (1) To determine the role of oncogene dependence on PIK3CA-one of the more common and targetable oncogenes in HNSCC, and (2) to evaluate the consequence of this oncogene on the effectiveness of newly developed targeted therapies. This was a cell culture-based, in vitro study performed at an academic research laboratory assessing the viability of PIK3CA-mutated head and neck cell lines when treated with targeted therapy. PIK3CA-mutated head and neck cell lines were treated with 17-AAG, GDC-0941, trametinib, and BEZ-235. Assessment of cell viability of HNSCC cell lines characterized for PIK3CA mutations or SCC25 cells engineered to express the PIK3CA hotspot mutations E545K or H1047R. Surprisingly, in engineered cell lines, the hotspot E545K and H1047R mutations conferred increased, rather than reduced, IC50 assay measurements when treated with the respective HSP90, PI3K, and MEK inhibitors, 17-AAG, GDC-0941, and trametinib, compared with the SCC25 control cell lines. When treated with BEZ-235, H1047R-expressing cell lines showed increased sensitivity to inhibition compared with control, whereas those expressing E545K showed slightly increased sensitivity of unclear significance. (1) The PIK3CA mutations within our engineered cell model did not lead to enhanced oncogene-dependent cell death when treated with direct inhibition of the PI3K enzyme yet did show increased sensitivity compared with control with dual PI3K/mTOR inhibition. (2) Oncogene addiction to PIK3CA hotspot mutations, if it occurs, is likely to evolve in vivo in the context of additional molecular changes that remain to be identified. Additional study is required to develop new model systems and approaches to determine the role of targeted therapy in the treatment of PI3K-overactive HNSCC tumors.

Reinforcement of a minor alternative splicing event in MYO7A due to a missense mutation results in a mild form of retinopathy and deafness.

PubMed

Ben Rebeh, Imen; Morinière, Madeleine; Ayadi, Leila; Benzina, Zeineb; Charfedine, Ilhem; Feki, Jamel; Ayadi, Hammadi; Ghorbel, Abdelmonem; Baklouti, Faouzi; Masmoudi, Saber

2010-09-30

Recessive mutations of the myosin VIIA (MYO7A) gene are reported to be responsible for both a deaf-blindness syndrome (Usher type 1B [USH1B] and atypical Usher syndrome) and nonsyndromic hearing loss (HL; Deafness, Neurosensory, Autosomal Recessive 2 [DFNB2]). The existence of DFNB2 is controversial, and often there is no relationship between the type and location of the MYO7A mutations corresponding to the USH1B and DFNB2 phenotype. We investigated the molecular determinant of a mild form of retinopathy in association with a subtle splicing modulation of MYO7A mRNA. Affected members underwent detailed audiologic and ocular characterization. DNA samples from family members were genotyped with polymorphic microsatellite markers. Sequencing of MYO7A was performed. Endogenous lymphoid RNA analysis and a splicing minigene assay were used to study the effect of the c.1935G>A mutation. Funduscopy showed mild retinitis pigmentosa in adults with HL. Microsatellite analysis showed linkage to markers in the region on chromosome 11q13.5. Sequencing of MYO7A revealed a mutation in the last nucleotide of exon 16 (c.1935G>A), which corresponds to a substitution of a methionine to an isoleucine residue at amino acid 645 of the myosin VIIA. However, structural prediction of the molecular model of myosin VIIA shows that this amino acid replacement induces only minor structural changes in the immediate environment of the mutation and thus does not alter the overall native structure. We found that, although predominantly included in mature mRNA, exon 16 is in fact alternatively spliced in control cells and that the mutation at the very last position is associated with a switch toward a predominant exclusion of that exon. This observation was further supported using a splicing minigene transfection assay; the c.1935G>A mutation was found to trigger a partial impairment of the adjacent donor splice site, suggesting that the unique change at the last position of the exon is responsible for the enhanced exon exclusion in this family. This study shows how an exonic mutation that weakens the 5' splice site enhances a minor alternative splicing without abolishing a complete exclusion of the exon and therefore causes a less severe retinitis pigmentosa than the USH1B-associated alleles. It would be interesting to examine a possible correlation between intrafamilial phenotypic variability and the subtle variation in exon 16 inclusion, probably related to genetic background specificities.

Promoter-dependent activity on androgen receptor N-terminal domain mutations in androgen insensitivity syndrome.

PubMed

Tadokoro-Cuccaro, Rieko; Davies, John; Mongan, Nigel P; Bunch, Trevor; Brown, Rosalind S; Audi, Laura; Watt, Kate; McEwan, Iain J; Hughes, Ieuan A

2014-01-01

Androgen receptor (AR) mutations are associated with androgen insensitivity syndrome (AIS). Missense mutations identified in the AR-N-terminal domain (AR-NTD) are rare, and clinical phenotypes are typically mild. We investigated 7 missense mutations and 2 insertion/deletions located in the AR-NTD. This study aimed to elucidate the pathogenic role of AR-NTD mutants in AIS and to use this knowledge to further define AR-NTD function. AR-NTD mutations (Q120E, A159T, G216R, N235K, G248V, L272F, and P380R) were introduced into AR-expression plasmids. Stably expressing cell lines were established for del57L and ins58L. Transactivation was measured using luciferase reporter constructs under the control of GRE and Pem promoters. Intrinsic fluorescence spectroscopy and partial proteolysis studies were performed for mutations which showed reduced activities by using a purified AR-AF1 protein. Pem-luciferase reporter activation was reduced for A159T, N235K, and G248V but not the GRE-luciferase reporter. Protein structure analysis detected no significant change in the AR-AF1 region for these mutations. Reduced cellular expression and transactivation activity were observed for ins58L. The mutations Q120E, G216R, L272F, P380R, and del57L showed small or no detectable changes in function. Thus, clinical and experimental analyses have identified novel AR-signalling defects associated with mutations in the structurally disordered AR-NTD domain in patients with AIS. © 2014 S. Karger AG, Basel.

Nucleotide selectivity defect and mutator phenotype conferred by a colon cancer-associated DNA polymerase δ mutation in human cells

PubMed Central

Mertz, Tony M.; Baranovskiy, Andrey G.; Wang, Jing; Tahirov, Tahir H.; Shcherbakova, Polina V.

2017-01-01

Mutations in the POLD1 and POLE genes encoding DNA polymerases δ (Polδ) and ε (Polε) cause hereditary colorectal cancer (CRC) and have been found in many sporadic colorectal and endometrial tumors. Much attention has been focused on POLE exonuclease domain mutations, which occur frequently in hypermutated DNA mismatch repair (MMR)-proficient tumors and appear to be responsible for the bulk of genomic instability in these tumors. In contrast, somatic POLD1 mutations are seen less frequently and typically occur in MMR-deficient tumors. Their functional significance is often unclear. Here we demonstrate that expression of the cancer-associated POLD1-R689W allele is strongly mutagenic in human cells. The mutation rate increased synergistically when the POLD1-R689W expression was combined with a MMR defect, indicating that the mutator effect of POLD1-R689W results from a high rate of replication errors. Purified human Polδ-R689W has normal exonuclease activity, but the nucleotide selectivity of the enzyme is severely impaired, providing a mechanistic explanation for the increased mutation rate in the POLD1-R689W-expressing cells. The vast majority of mutations induced by the POLD1-R689W are GC→TA transversions and GC→AT transitions, with transversions showing a strong strand bias and a remarkable preference for polypurine/polypyrimidine sequences. The mutational specificity of the Polδ variant matches that of the hypermutated CRC cell line, HCT15, in which this variant was first identified. The results provide compelling evidence for the pathogenic role of the POLD1-R689W mutation in the development of the human tumor and emphasize the need to experimentally determine the significance of Polδ variants present in sporadic tumors. PMID:28368425

Description of polymerase chain reaction and sequencing DNA Mycobacterium tuberculosis from specimen sputum of tuberculosis patients in Medan

NASA Astrophysics Data System (ADS)

Lily; Siregar, Y.; Ilyas, S.

2018-03-01

This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.

Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krauthammer, Michael; Kong, Yong; Ha, Byung Hak

We characterized the mutational landscape of melanoma, the form of skin cancer with the highest mortality rate, by sequencing the exomes of 147 melanomas. Sun-exposed melanomas had markedly more ultraviolet (UV)-like C>T somatic mutations compared to sun-shielded acral, mucosal and uveal melanomas. Among the newly identified cancer genes was PPP6C, encoding a serine/threonine phosphatase, which harbored mutations that clustered in the active site in 12% of sun-exposed melanomas, exclusively in tumors with mutations in BRAF or NRAS. Notably, we identified a recurrent UV-signature, an activating mutation in RAC1 in 9.2% of sun-exposed melanomas. This activating mutation, the third most frequentmore » in our cohort of sun-exposed melanoma after those of BRAF and NRAS, changes Pro29 to serine (RAC1{sup P29S}) in the highly conserved switch I domain. Crystal structures, and biochemical and functional studies of RAC1{sup P29S} showed that the alteration releases the conformational restraint conferred by the conserved proline, causes an increased binding of the protein to downstream effectors, and promotes melanocyte proliferation and migration. These findings raise the possibility that pharmacological inhibition of downstream effectors of RAC1 signaling could be of therapeutic benefit.« less

Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients.

PubMed

Riahi, Zied; Bonnet, Crystel; Zainine, Rim; Lahbib, Saida; Bouyacoub, Yosra; Bechraoui, Rym; Marrakchi, Jihène; Hardelin, Jean-Pierre; Louha, Malek; Largueche, Leila; Ben Yahia, Salim; Kheirallah, Moncef; Elmatri, Leila; Besbes, Ghazi; Abdelhak, Sonia; Petit, Christine

2015-01-01

Usher syndrome (USH) is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3) are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys), in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24), and a nonsense mutation, c.52A>T (p.Lys18*). Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

Context-Dependent Sensitivity to Mutations Disrupting the Structural Integrity of Individual EGF Repeats in the Mouse Notch Ligand DLL1

PubMed Central

Schuster-Gossler, Karin; Cordes, Ralf; Müller, Julia; Geffers, Insa; Delany-Heiken, Patricia; Taft, Manuel; Preller, Matthias; Gossler, Achim

2016-01-01

The highly conserved Notch-signaling pathway mediates cell-to-cell communication and is pivotal for multiple developmental processes and tissue homeostasis in adult organisms. Notch receptors and their ligands are transmembrane proteins with multiple epidermal-growth-factor-like (EGF) repeats in their extracellular domains. In vitro the EGF repeats of mammalian ligands that are essential for Notch activation have been defined. However, in vivo the significance of the structural integrity of each EGF repeat in the ligand ectodomain for ligand function is still unclear. Here, we analyzed the mouse Notch ligand DLL1. We expressed DLL1 proteins with mutations disrupting disulfide bridges in each individual EGF repeat from single-copy transgenes in the HPRT locus of embryonic stem cells. In Notch transactivation assays all mutations impinged on DLL1 function and affected both NOTCH1 and NOTCH2 receptors similarly. An allelic series in mice that carried the same point mutations in endogenous Dll1, generated using a mini-gene strategy, showed that early developmental processes depending on DLL1-mediated NOTCH activation were differently sensitive to mutation of individual EGF repeats in DLL1. Notably, some mutations affected only somite patterning and resulted in vertebral column defects resembling spondylocostal dysostosis. In conclusion, the structural integrity of each individual EGF repeat in the extracellular domain of DLL1 is necessary for full DLL1 activity, and certain mutations in Dll1 might contribute to spondylocostal dysostosis in humans. PMID:26801181

AIP mutations in Brazilian patients with sporadic pituitary adenomas: a single-center evaluation

PubMed Central

Kasuki, Leandro; de Azeredo Lima, Carlos Henrique; Ogino, Liana; Camacho, Aline H S; Chimelli, Leila; Korbonits, Márta

2017-01-01

Aryl hydrocarbon receptor-interacting protein (AIP) gene mutations (AIPmut) are the most frequent germline mutations found in apparently sporadic pituitary adenomas (SPA). Our aim was to evaluate the frequency of AIPmut among young Brazilian patients with SPA. We performed an observational cohort study between 2013 and 2016 in a single referral center. AIPmut screening was carried out in 132 SPA patients with macroadenomas diagnosed up to 40 years or in adenomas of any size diagnosed until 18 years of age. Twelve tumor samples were also analyzed. Leukocyte DNA and tumor tissue DNA were sequenced for the entire AIP-coding region for evaluation of mutations. Eleven (8.3%) of the 132 patients had AIPmut, comprising 9/74 (12%) somatotropinomas, 1/38 (2.6%) prolactinoma, 1/10 (10%) corticotropinoma and no non-functioning adenomas. In pediatric patients (≤18 years), AIPmut frequency was 13.3% (2/15). Out of the 5 patients with gigantism, two had AIPmut, both truncating mutations. The Y268* mutation was described in Brazilian patients and the K273Rfs*30 mutation is a novel mutation in our patient. No somatic AIP mutations were found in the 12 tumor samples. A tumor sample from an acromegaly patient harboring the A299V AIPmut showed loss of heterozygosity. In conclusion, AIPmut frequency in SPA Brazilian patients is similar to other populations. Our study identified two mutations exclusively found in Brazilians and also shows, for the first time, loss of heterozygosity in tumor DNA from an acromegaly patient harboring the A299V AIPmut. Our findings corroborate previous observations that AIPmut screening should be performed in young patients with SPA. PMID:29074612

TP53 Mutational Status Is a Potential Marker for Risk Stratification in Wilms Tumour with Diffuse Anaplasia

PubMed Central

Chagtai, Tasnim; Popov, Sergey D.; Sebire, Neil J.; Vujanic, Gordan; Perlman, Elizabeth; Anderson, James R.; Grundy, Paul; Dome, Jeffrey S.; Pritchard-Jones, Kathy

2014-01-01

Purpose The presence of diffuse anaplasia in Wilms tumours (DAWT) is associated with TP53 mutations and poor outcome. As patients receive intensified treatment, we sought to identify whether TP53 mutational status confers additional prognostic information. Patients and Methods We studied 40 patients with DAWT with anaplasia in the tissue from which DNA was extracted and analysed for TP53 mutations and 17p loss. The majority of cases were profiled by copy number (n = 32) and gene expression (n = 36) arrays. TP53 mutational status was correlated with patient event-free and overall survival, genomic copy number instability and gene expression profiling. Results From the 40 cases, 22 (55%) had TP53 mutations (2 detected only after deep-sequencing), 20 of which also had 17p loss (91%); 18 (45%) cases had no detectable mutation but three had 17p loss. Tumours with TP53 mutations and/or 17p loss (n = 25) had an increased risk of recurrence as a first event (p = 0.03, hazard ratio (HR), 3.89; 95% confidence interval (CI), 1.26–16.0) and death (p = 0.04, HR, 4.95; 95% CI, 1.36–31.7) compared to tumours lacking TP53 abnormalities. DAWT carrying TP53 mutations showed increased copy number alterations compared to those with wild-type, suggesting a more unstable genome (p = 0.03). These tumours showed deregulation of genes associated with cell cycle and DNA repair biological processes. Conclusion This study provides evidence that TP53 mutational analysis improves risk stratification in DAWT. This requires validation in an independent cohort before clinical use as a biomarker. PMID:25313908

TP53 mutational status is a potential marker for risk stratification in Wilms tumour with diffuse anaplasia.

PubMed

Maschietto, Mariana; Williams, Richard D; Chagtai, Tasnim; Popov, Sergey D; Sebire, Neil J; Vujanic, Gordan; Perlman, Elizabeth; Anderson, James R; Grundy, Paul; Dome, Jeffrey S; Pritchard-Jones, Kathy

2014-01-01

The presence of diffuse anaplasia in Wilms tumours (DAWT) is associated with TP53 mutations and poor outcome. As patients receive intensified treatment, we sought to identify whether TP53 mutational status confers additional prognostic information. We studied 40 patients with DAWT with anaplasia in the tissue from which DNA was extracted and analysed for TP53 mutations and 17p loss. The majority of cases were profiled by copy number (n = 32) and gene expression (n = 36) arrays. TP53 mutational status was correlated with patient event-free and overall survival, genomic copy number instability and gene expression profiling. From the 40 cases, 22 (55%) had TP53 mutations (2 detected only after deep-sequencing), 20 of which also had 17p loss (91%); 18 (45%) cases had no detectable mutation but three had 17p loss. Tumours with TP53 mutations and/or 17p loss (n = 25) had an increased risk of recurrence as a first event (p = 0.03, hazard ratio (HR), 3.89; 95% confidence interval (CI), 1.26-16.0) and death (p = 0.04, HR, 4.95; 95% CI, 1.36-31.7) compared to tumours lacking TP53 abnormalities. DAWT carrying TP53 mutations showed increased copy number alterations compared to those with wild-type, suggesting a more unstable genome (p = 0.03). These tumours showed deregulation of genes associated with cell cycle and DNA repair biological processes. This study provides evidence that TP53 mutational analysis improves risk stratification in DAWT. This requires validation in an independent cohort before clinical use as a biomarker.

Cardiomyopathy mutations in the tail of β-cardiac myosin modify the coiled-coil structure and affect integration into thick filaments in muscle sarcomeres in adult cardiomyocytes.

PubMed

Wolny, Marcin; Colegrave, Melanie; Colman, Lucy; White, Ed; Knight, Peter J; Peckham, Michelle

2013-11-01

It is unclear why mutations in the filament-forming tail of myosin heavy chain (MHC) cause hypertrophic or dilated cardiomyopathy as these mutations should not directly affect contraction. To investigate this, we first investigated the impact of five hypertrophic cardiomyopathy-causing (N1327K, E1356K, R1382W, E1555K, and R1768K) and one dilated cardiomyopathy-causing (R1500W) tail mutations on their ability to incorporate into muscle sarcomeres in vivo. We used adenoviral delivery to express full-length wild type or mutant enhanced GFP-MHC in isolated adult cardiomyocytes. Three mutations (N1327K, E1356K, and E1555K) reduced enhanced GFP-MHC incorporation into muscle sarcomeres, whereas the remainder had no effect. No mutations significantly affected contraction. Fluorescence recovery after photobleaching showed that fluorescence recovery for the mutation that incorporated least well (N1327K) was significantly faster than that of WT with half-times of 25.1 ± 1.8 and 32.2 ± 2.5 min (mean ± S.E.), respectively. Next, we determined the effects of each mutation on the helical properties of wild type and seven mutant peptides (7, 11, or 15 heptads long) from the myosin tail by circular dichroism. R1382W and E1768K slightly increased the α-helical nature of peptides. The remaining mutations reduced α-helical content, with N1327K showing the greatest reduction. Only peptides containing residues 1301-1329 were highly α-helical suggesting that this region helps in initiation of coiled coil. These results suggest that small effects of mutations on helicity translate into a reduced ability to incorporate into sarcomeres, which may elicit compensatory hypertrophy.

Mutation analysis of the COL1A1 and COL1A2 genes in Vietnamese patients with osteogenesis imperfecta.

PubMed

Ho Duy, Binh; Zhytnik, Lidiia; Maasalu, Katre; Kändla, Ivo; Prans, Ele; Reimann, Ene; Märtson, Aare; Kõks, Sulev

2016-08-12

The genetics of osteogenesis imperfecta (OI) have not been studied in a Vietnamese population before. We performed mutational analysis of the COL1A1 and COL1A2 genes in 91 unrelated OI patients of Vietnamese origin. We then systematically characterized the mutation profiles of these two genes which are most commonly related to OI. Genomic DNA was extracted from EDTA-preserved blood according to standard high-salt extraction methods. Sequence analysis and pathogenic variant identification was performed with Mutation Surveyor DNA variant analysis software. Prediction of the pathogenicity of mutations was conducted using Alamut Visual software. The presence of variants was checked against Dalgleish's osteogenesis imperfecta mutation database. The sample consisted of 91 unrelated osteogenesis imperfecta patients. We identified 54 patients with COL1A1/2 pathogenic variants; 33 with COL1A1 and 21 with COL1A2. Two patients had multiple pathogenic variants. Seventeen novel COL1A1 and 10 novel COL1A2 variants were identified. The majority of identified COL1A1/2 pathogenic variants occurred in a glycine substitution (36/56, 64.3 %), usually serine (23/36, 63.9 %). We found two pathogenic variants of the COL1A1 gene c.2461G > A (p.Gly821Ser) in four unrelated patients and one, c.2005G > A (p.Ala669Thr), in two unrelated patients. Our data showed a lower number of collagen OI pathogenic variants in Vietnamese patients compared to reported rates for Asian populations. The OI mutational profile of the Vietnamese population is unique and related to the presence of a high number of recessive mutations in non-collagenous OI genes. Further analysis of OI patients negative for collagen mutations, is required.

[Correlation of clinicopathologic features and driver gene mutation in non-small cell lung cancer].

PubMed

Chen, L F; Chen, X Y; Yu, X B

2016-04-08

To study the relationship between mutations of well-known driver genes and clinicopathologic characteristics of non-small cell lung cancers (NSCLC). Scorpions amplification refractory mutation system (scorpions ARMS) fluorescence quantitative PCR was performed to investigate 205 driver gene mutation status in NSCLC in correlation with clinicopathological characteristics of the patients. Driver gene mutations were detected in 146 of 205 (71.2%) patients with NSCLC, including 81.7%(138/169) adenocarcinomas, in which mutations of nine genes were found: EGFR (63.3%, 107/169), KRAS (5.9%, 10/169), PIK3CA (4.1%, 7/169), ALK (4.1%, 7/169), ROS1 (3.0%, 5/169), RET (3.6%, 6/169), HER2 (1.8%, 3/169), NRAS (0.6%, 1/169) and BRAF (0.6%, 1/169). The frequencies of driver gene mutations were higher in adenocarcinomas, female patients and non-smokers (P<0.01, P=0.003, P<0.01, respectively). Driver gene mutation status showed no correlation with either the age or the clinical stage (P=0.281, P=0.490, respectively). However, EGFR mutations tended to occur in adenocarcinoma, female, non-smokers, and patients of ≥62 years of age (P<0.01, P<0.01, P=0.002, P=0.012, respectively). The frequency of EGFR mutation was positively correlated with the tumor histology of lepidic, acinar, papillary and micropapillary predominant growth patterns. There was no relationship between EGFR mutation and the clinical stage (P=0.237). The frequency of KRAS mutation was higher in solid predominant and invasive mucinous adenocarcinomas (P=0.015); that of PIK3CA mutation was higher in patients of ≥62 years of age, invasive mucinous adenocarcinoma and fetal adenocarcinoma (P=0.015, P=0.006, respectively). ALK, ROS1 or RET mutation positive NSCLC tended to occur in nonsmokers and have solid predominant tumors and invasive mucinous adenocarcinoma (P=0.012, P=0.017 respectively). The frequency of EML4-ALK mutation was higher in the early stage patients with solid predominant tumors and invasive mucinous adenocarcinomas (P=0.025, P=0.014, respectively); that of ROS1 rearrangement was higher in invasive mucinous adenocarcinomas (P=0.049). NRAS, BRAF and HER2 gene mutations were infrequent and their clinical significance remained to be elucidated. The relationship between mutations of well-known driver genes and clinicopathological characteristics in patients with NSCLC has diversity, the rate of mutations is higher in non-smoking female patients with adenocarcinoma.

Telomere length and somatic mutations in correlation with response to immunosuppressive treatment in aplastic anaemia.

PubMed

Park, Hee S; Park, Si N; Im, Kyongok; Kim, Sung-Min; Kim, Jung-Ah; Hwang, Sang M; Lee, Dong S

2017-08-01

We investigated the frequencies of cytogenetic aberrations and somatic mutations of prognostic relevance in 393 patients with aplastic anaemia (AA). Clonality was determined by G-banding/fluorescence in situ hybridization (FISH) (n = 245), and targeted capture sequencing was performed for 88 haematopoiesis-related genes (n = 70). The telomere length (TL) of bone marrow nucleated cells was measured at the single cell level by FISH (n = 135). Eighteen (4·6%) patients showed disease progression, and monosomy 7 (50·0%) was the most predominant cytogenetic evolution at disease transformation. One third of patients (32·9%) presented at least 1 mutation; the most frequently mutated genes were NOTCH1, NF1, SCRIB, BCOR and DNMT3A. The patient group with clonal changes (30·7%) showed an adverse response to immunosuppressive treatment (IST), compared to the non-clonal group, but this finding did not show statistical significance. The TL of AA patients was significantly shorter than normal control and patients with clonal changes showed significantly shorter TLs. Patients with TL>5·9 showed a higher response rate to IST (P = 0·048). In conclusion, the patients with clonal changes or TL attrition showed a poor response to IST. Shorter TL can be used not only as a biomarker, but also as a predictive marker for treatment response to IST. © 2017 John Wiley & Sons Ltd.

Clonal hematopoiesis in acquired aplastic anemia.

PubMed

Ogawa, Seishi

2016-07-21

Clonal hematopoiesis (CH) in aplastic anemia (AA) has been closely linked to the evolution of late clonal disorders, including paroxysmal nocturnal hemoglobinuria and myelodysplastic syndromes (MDS)/acute myeloid leukemia (AML), which are common complications after successful immunosuppressive therapy (IST). With the advent of high-throughput sequencing of recent years, the molecular aspect of CH in AA has been clarified by comprehensive detection of somatic mutations that drive clonal evolution. Genetic abnormalities are found in ∼50% of patients with AA and, except for PIGA mutations and copy-neutral loss-of-heterozygosity, or uniparental disomy (UPD) in 6p (6pUPD), are most frequently represented by mutations involving genes commonly mutated in myeloid malignancies, including DNMT3A, ASXL1, and BCOR/BCORL1 Mutations exhibit distinct chronological profiles and clinical impacts. BCOR/BCORL1 and PIGA mutations tend to disappear or show stable clone size and predict a better response to IST and a significantly better clinical outcome compared with mutations in DNMT3A, ASXL1, and other genes, which are likely to increase their clone size, are associated with a faster progression to MDS/AML, and predict an unfavorable survival. High frequency of 6pUPD and overrepresentation of PIGA and BCOR/BCORL1 mutations are unique to AA, suggesting the role of autoimmunity in clonal selection. By contrast, DNMT3A and ASXL1 mutations, also commonly seen in CH in the general population, indicate a close link to CH in the aged bone marrow, in terms of the mechanism for selection. Detection and close monitoring of somatic mutations/evolution may help with prediction and diagnosis of clonal evolution of MDS/AML and better management of patients with AA. © 2016 by The American Society of Hematology.

Clonal hematopoiesis in acquired aplastic anemia

PubMed Central

2016-01-01

Clonal hematopoiesis (CH) in aplastic anemia (AA) has been closely linked to the evolution of late clonal disorders, including paroxysmal nocturnal hemoglobinuria and myelodysplastic syndromes (MDS)/acute myeloid leukemia (AML), which are common complications after successful immunosuppressive therapy (IST). With the advent of high-throughput sequencing of recent years, the molecular aspect of CH in AA has been clarified by comprehensive detection of somatic mutations that drive clonal evolution. Genetic abnormalities are found in ∼50% of patients with AA and, except for PIGA mutations and copy-neutral loss-of-heterozygosity, or uniparental disomy (UPD) in 6p (6pUPD), are most frequently represented by mutations involving genes commonly mutated in myeloid malignancies, including DNMT3A, ASXL1, and BCOR/BCORL1. Mutations exhibit distinct chronological profiles and clinical impacts. BCOR/BCORL1 and PIGA mutations tend to disappear or show stable clone size and predict a better response to IST and a significantly better clinical outcome compared with mutations in DNMT3A, ASXL1, and other genes, which are likely to increase their clone size, are associated with a faster progression to MDS/AML, and predict an unfavorable survival. High frequency of 6pUPD and overrepresentation of PIGA and BCOR/BCORL1 mutations are unique to AA, suggesting the role of autoimmunity in clonal selection. By contrast, DNMT3A and ASXL1 mutations, also commonly seen in CH in the general population, indicate a close link to CH in the aged bone marrow, in terms of the mechanism for selection. Detection and close monitoring of somatic mutations/evolution may help with prediction and diagnosis of clonal evolution of MDS/AML and better management of patients with AA. PMID:27121470

Clinical Utility of Genetic Testing in Children and Adults with Steroid-Resistant Nephrotic Syndrome

PubMed Central

Santín, Sheila; Bullich, Gemma; Tazón-Vega, Bárbara; García-Maset, Rafael; Giménez, Isabel; Silva, Irene; Ruíz, Patricia; Ballarín, José

2011-01-01

Summary Background and objectives The increasing number of podocyte-expressed genes implicated in steroid-resistant nephrotic syndrome (SRNS), the phenotypic variability, and the uncharacterized relative frequency of mutations in these genes in pediatric and adult patients with SRNS complicate their routine genetic analysis. Our aim was to compile the clinical and genetic data of eight podocyte genes analyzed in 110 cases (125 patients) with SRNS (ranging from congenital to adult onset) to provide a genetic testing approach. Design, setting, participants, & measurements Mutation analysis was performed by sequencing the NPHS1, NPHS2, TRPC6, CD2AP, PLCE1, INF2, WT1 (exons 8 and 9), and ACTN4 (exons 1 to 10) genes. Results We identified causing mutations in 34% (37/110) of SRNS patients, representing 67% (16/24) familial and 25% (21/86) sporadic cases. Mutations were detected in 100% of congenital-onset, 57% of infantile-onset, 24 and 36% of early and late childhood-onset, 25% of adolescent-onset, and 14% of adult-onset patients. The most frequently mutated gene was NPHS1 in congenital onset and NPHS2 in the other groups. A partial remission was observed in 7 of 26 mutation carriers treated with immunosuppressive agents and/or angiotensin-converting enzyme inhibitors. Patients with NPHS1 mutations showed a faster progression to ESRD than patients with NPHS2 mutations. None of these mutation carriers relapsed after kidney transplantation. Conclusions We propose a genetic testing algorithm for SRNS based on the age at onset and the familial/sporadic status. Mutation analysis of specific podocyte-genes has a clinical value in all age groups, especially in children. PMID:21415313

Insight on Mutation-Induced Resistance from Molecular Dynamics Simulations of the Native and Mutated CSF-1R and KIT

PubMed Central

Da Silva Figueiredo Celestino Gomes, Priscila; Chauvot De Beauchêne, Isaure; Panel, Nicolas; Lopez, Sophie; De Sepulveda, Paulo; Geraldo Pascutti, Pedro; Solary, Eric; Tchertanov, Luba

2016-01-01

The receptors tyrosine kinases (RTKs) for the colony stimulating factor-1, CSF-1R, and for the stem cell factor, SCFR or KIT, are important mediators of signal transduction. The abnormal function of these receptors, promoted by gain-of-function mutations, leads to their constitutive activation, associated with cancer or other proliferative diseases. A secondary effect of the mutations is the alteration of receptors’ sensitivity to tyrosine kinase inhibitors, compromising effectiveness of these molecules in clinical treatment. In particular, the mutation V560G in KIT increases its sensitivity to Imatinib, while the D816V in KIT, and D802V in CSF-1R, triggers resistance to the drug. We analyzed the Imatinib binding affinity to the native and mutated KIT (mutations V560G, S628N and D816V) and CSF-1R (mutation D802V) by using molecular dynamics simulations and energy calculations of Imatinib•target complexes. Further, we evaluated the sensitivity of the studied KIT receptors to Imatinib by measuring the inhibition of KIT phosphorylation. Our study showed that (i) the binding free energy of Imatinib to the targets is highly correlated with their experimentally measured sensitivity; (ii) the electrostatic interactions are a decisive factor affecting the binding energy; (iii) the most deleterious impact to the Imatinib sensitivity is promoted by D802V (CSF-1R) and D816V (KIT) mutations; (iv) the role of the juxtamembrane region, JMR, in the imatinib binding is accessory. These findings contribute to a better description of the mutation-induced effects alternating the targets sensitivity to Imatinib. PMID:27467080

Insight on Mutation-Induced Resistance from Molecular Dynamics Simulations of the Native and Mutated CSF-1R and KIT.

PubMed

Da Silva Figueiredo Celestino Gomes, Priscila; Chauvot De Beauchêne, Isaure; Panel, Nicolas; Lopez, Sophie; De Sepulveda, Paulo; Geraldo Pascutti, Pedro; Solary, Eric; Tchertanov, Luba

2016-01-01

The receptors tyrosine kinases (RTKs) for the colony stimulating factor-1, CSF-1R, and for the stem cell factor, SCFR or KIT, are important mediators of signal transduction. The abnormal function of these receptors, promoted by gain-of-function mutations, leads to their constitutive activation, associated with cancer or other proliferative diseases. A secondary effect of the mutations is the alteration of receptors' sensitivity to tyrosine kinase inhibitors, compromising effectiveness of these molecules in clinical treatment. In particular, the mutation V560G in KIT increases its sensitivity to Imatinib, while the D816V in KIT, and D802V in CSF-1R, triggers resistance to the drug. We analyzed the Imatinib binding affinity to the native and mutated KIT (mutations V560G, S628N and D816V) and CSF-1R (mutation D802V) by using molecular dynamics simulations and energy calculations of Imatinib•target complexes. Further, we evaluated the sensitivity of the studied KIT receptors to Imatinib by measuring the inhibition of KIT phosphorylation. Our study showed that (i) the binding free energy of Imatinib to the targets is highly correlated with their experimentally measured sensitivity; (ii) the electrostatic interactions are a decisive factor affecting the binding energy; (iii) the most deleterious impact to the Imatinib sensitivity is promoted by D802V (CSF-1R) and D816V (KIT) mutations; (iv) the role of the juxtamembrane region, JMR, in the imatinib binding is accessory. These findings contribute to a better description of the mutation-induced effects alternating the targets sensitivity to Imatinib.

Mapping autosomal recessive intellectual disability: combined microarray and exome sequencing identifies 26 novel candidate genes in 192 consanguineous families.

PubMed

Harripaul, R; Vasli, N; Mikhailov, A; Rafiq, M A; Mittal, K; Windpassinger, C; Sheikh, T I; Noor, A; Mahmood, H; Downey, S; Johnson, M; Vleuten, K; Bell, L; Ilyas, M; Khan, F S; Khan, V; Moradi, M; Ayaz, M; Naeem, F; Heidari, A; Ahmed, I; Ghadami, S; Agha, Z; Zeinali, S; Qamar, R; Mozhdehipanah, H; John, P; Mir, A; Ansar, M; French, L; Ayub, M; Vincent, J B

2018-04-01

Approximately 1% of the global population is affected by intellectual disability (ID), and the majority receive no molecular diagnosis. Previous studies have indicated high levels of genetic heterogeneity, with estimates of more than 2500 autosomal ID genes, the majority of which are autosomal recessive (AR). Here, we combined microarray genotyping, homozygosity-by-descent (HBD) mapping, copy number variation (CNV) analysis, and whole exome sequencing (WES) to identify disease genes/mutations in 192 multiplex Pakistani and Iranian consanguineous families with non-syndromic ID. We identified definite or candidate mutations (or CNVs) in 51% of families in 72 different genes, including 26 not previously reported for ARID. The new ARID genes include nine with loss-of-function mutations (ABI2, MAPK8, MPDZ, PIDD1, SLAIN1, TBC1D23, TRAPPC6B, UBA7 and USP44), and missense mutations include the first reports of variants in BDNF or TET1 associated with ID. The genes identified also showed overlap with de novo gene sets for other neuropsychiatric disorders. Transcriptional studies showed prominent expression in the prenatal brain. The high yield of AR mutations for ID indicated that this approach has excellent clinical potential and should inform clinical diagnostics, including clinical whole exome and genome sequencing, for populations in which consanguinity is common. As with other AR disorders, the relevance will also apply to outbred populations.

Accumulation of Pol Mutations Selected by HLA-B*52:01-C*12:02 Protective Haplotype-Restricted Cytotoxic T Lymphocytes Causes Low Plasma Viral Load Due to Low Viral Fitness of Mutant Viruses

PubMed Central

Murakoshi, Hayato; Koyanagi, Madoka; Chikata, Takayuki; Rahman, Mohammad Arif; Kuse, Nozomi; Sakai, Keiko; Gatanaga, Hiroyuki; Oka, Shinichi

2016-01-01

ABSTRACT HLA-B*52:01-C*12:02, which is the most abundant haplotype in Japan, has a protective effect on disease progression in HIV-1-infected Japanese individuals, whereas HLA-B*57 and -B*27 protective alleles are very rare in Japan. A previous study on HLA-associated polymorphisms demonstrated that the number of HLA-B*52:01-associated mutations at four Pol positions was inversely correlated with plasma viral load (pVL) in HLA-B*52:01-negative individuals, suggesting that the transmission of HIV-1 with these mutations could modulate the pVL in the population. However, it remains unknown whether these mutations were selected by HLA-B*52:01-restricted CTLs and also reduced viral fitness. In this study, we identified two HLA-B*52:01-restricted and one HLA-C*12:02-restricted novel cytotoxic T-lymphocyte (CTL) epitopes in Pol. Analysis using CTLs specific for these three epitopes demonstrated that these CTLs failed to recognize mutant epitopes or more weakly recognized cells infected with mutant viruses than wild-type virus, supporting the idea that these mutations were selected by the HLA-B*52:01- or HLA-C*12:02-restricted T cells. We further showed that these mutations reduced viral fitness, although the effect of each mutation was weak. The present study demonstrated that the accumulation of these Pol mutations selected by HLA-B*52:01- or HLA-C*12:02-restricted CTLs impaired viral replication capacity and thus reduced the pVL. The fitness cost imposed by the mutations partially accounted for the effect of the HLA-B*52:01-C*12:02 haplotype on clinical outcome, together with the effect of HLA-B*52:01-restricted CTLs on viral replication, which had been previously demonstrated. IMPORTANCE Numerous population-based studies identified HLA-associated HIV-1 mutations to predict HIV-1 escape mutations from cytotoxic T lymphocytes (CTLs). However, the majority of these HLA-associated mutations have not been identified as CTL escape mutations. Our previous population-based study showed that five HLA-B*52:01-associated mutations at four Pol positions were inversely correlated with the plasma viral load in HLA-B*52:01-negative Japanese individuals. In the present study, we demonstrated that these mutations were indeed selected by CTLs specific for novel B*52:01- and C*12:02-restricted epitopes and that the accumulation of these mutations reduced the viral fitness in vitro. This study elucidated the mechanism by which the accumulation of these CTL escape mutations contributed to the protective effect of the HLA-B*52:01-HLA-C*12:02 haplotype on disease progression in HIV-1-infected Japanese individuals. PMID:27903797

Accumulation of Pol Mutations Selected by HLA-B*52:01-C*12:02 Protective Haplotype-Restricted Cytotoxic T Lymphocytes Causes Low Plasma Viral Load Due to Low Viral Fitness of Mutant Viruses.

PubMed

Murakoshi, Hayato; Koyanagi, Madoka; Chikata, Takayuki; Rahman, Mohammad Arif; Kuse, Nozomi; Sakai, Keiko; Gatanaga, Hiroyuki; Oka, Shinichi; Takiguchi, Masafumi

2017-02-15

HLA-B*52:01-C*12:02, which is the most abundant haplotype in Japan, has a protective effect on disease progression in HIV-1-infected Japanese individuals, whereas HLA-B*57 and -B*27 protective alleles are very rare in Japan. A previous study on HLA-associated polymorphisms demonstrated that the number of HLA-B*52:01-associated mutations at four Pol positions was inversely correlated with plasma viral load (pVL) in HLA-B*52:01-negative individuals, suggesting that the transmission of HIV-1 with these mutations could modulate the pVL in the population. However, it remains unknown whether these mutations were selected by HLA-B*52:01-restricted CTLs and also reduced viral fitness. In this study, we identified two HLA-B*52:01-restricted and one HLA-C*12:02-restricted novel cytotoxic T-lymphocyte (CTL) epitopes in Pol. Analysis using CTLs specific for these three epitopes demonstrated that these CTLs failed to recognize mutant epitopes or more weakly recognized cells infected with mutant viruses than wild-type virus, supporting the idea that these mutations were selected by the HLA-B*52:01- or HLA-C*12:02-restricted T cells. We further showed that these mutations reduced viral fitness, although the effect of each mutation was weak. The present study demonstrated that the accumulation of these Pol mutations selected by HLA-B*52:01- or HLA-C*12:02-restricted CTLs impaired viral replication capacity and thus reduced the pVL. The fitness cost imposed by the mutations partially accounted for the effect of the HLA-B*52:01-C*12:02 haplotype on clinical outcome, together with the effect of HLA-B*52:01-restricted CTLs on viral replication, which had been previously demonstrated. Numerous population-based studies identified HLA-associated HIV-1 mutations to predict HIV-1 escape mutations from cytotoxic T lymphocytes (CTLs). However, the majority of these HLA-associated mutations have not been identified as CTL escape mutations. Our previous population-based study showed that five HLA-B*52:01-associated mutations at four Pol positions were inversely correlated with the plasma viral load in HLA-B*52:01-negative Japanese individuals. In the present study, we demonstrated that these mutations were indeed selected by CTLs specific for novel B*52:01- and C*12:02-restricted epitopes and that the accumulation of these mutations reduced the viral fitness in vitro This study elucidated the mechanism by which the accumulation of these CTL escape mutations contributed to the protective effect of the HLA-B*52:01-HLA-C*12:02 haplotype on disease progression in HIV-1-infected Japanese individuals. Copyright © 2017 American Society for Microbiology.

Autoinhibition of Munc18-1 modulates synaptobrevin binding and helps to enable Munc13-dependent regulation of membrane fusion.

PubMed

Sitarska, Ewa; Xu, Junjie; Park, Seungmee; Liu, Xiaoxia; Quade, Bradley; Stepien, Karolina; Sugita, Kyoko; Brautigam, Chad A; Sugita, Shuzo; Rizo, Josep

2017-05-06

Munc18-1 orchestrates SNARE complex assembly together with Munc13-1 to mediate neurotransmitter release. Munc18-1 binds to synaptobrevin, but the relevance of this interaction and its relation to Munc13 function are unclear. NMR experiments now show that Munc18-1 binds specifically and non-specifically to synaptobrevin. Specific binding is inhibited by a L348R mutation in Munc18-1 and enhanced by a D326K mutation designed to disrupt the 'furled conformation' of a Munc18-1 loop. Correspondingly, the activity of Munc18-1 in reconstitution assays that require Munc18-1 and Munc13-1 for membrane fusion is stimulated by the D326K mutation and inhibited by the L348R mutation. Moreover, the D326K mutation allows Munc13-1-independent fusion and leads to a gain-of-function in rescue experiments in Caenorhabditis elegans unc-18 nulls. Together with previous studies, our data support a model whereby Munc18-1 acts as a template for SNARE complex assembly, and autoinhibition of synaptobrevin binding contributes to enabling regulation of neurotransmitter release by Munc13-1.

Biallelic germline and somatic mutations in malignant mesothelioma: multiple mutations in transcription regulators including mSWI/SNF genes.

PubMed

Yoshikawa, Yoshie; Sato, Ayuko; Tsujimura, Tohru; Otsuki, Taiichiro; Fukuoka, Kazuya; Hasegawa, Seiki; Nakano, Takashi; Hashimoto-Tamaoki, Tomoko

2015-02-01

We detected low levels of acetylation for histone H3 tail lysines in malignant mesothelioma (MM) cell lines resistant to histone deacetylase inhibitors. To identify the possible genetic causes related to the low histone acetylation levels, whole-exome sequencing was conducted with MM cell lines established from eight patients. A mono-allelic variant of BRD1 was common to two MM cell lines with very low acetylation levels. We identified 318 homozygous protein-damaging variants/mutations (18-78 variants/mutations per patient); annotation analysis showed enrichment of the molecules associated with mammalian SWI/SNF (mSWI/SNF) chromatin remodeling complexes and co-activators that facilitate initiation of transcription. In seven of the patients, we detected a combination of variants in histone modifiers or transcription factors/co-factors, in addition to variants in mSWI/SNF. Direct sequencing showed that homozygous mutations in SMARCA4, PBRM1 and ARID2 were somatic. In one patient, homozygous germline variants were observed for SMARCC1 and SETD2 in chr3p22.1-3p14.2. These exhibited extended germline homozygosity and were in regions containing somatic mutations, leading to a loss of BAP1 and PBRM1 expression in MM cell line. Most protein-damaging variants were heterozygous in normal tissues. Heterozygous germline variants were often converted into hemizygous variants by mono-allelic deletion, and were rarely homozygous because of acquired uniparental disomy. Our findings imply that MM might develop through the somatic inactivation of mSWI/SNF complex subunits and/or histone modifiers, including BAP1, in subjects that have rare germline variants of these transcription regulators and/or transcription factors/co-factors, and in regions prone to mono-allelic deletion during oncogenesis. © 2014 UICC.

Secondary mutation in a coding mononucleotide tract in MSH6 causes loss of immunoexpression of MSH6 in colorectal carcinomas with MLH1/PMS2 deficiency.

PubMed

Shia, Jinru; Zhang, Liying; Shike, Moshe; Guo, Min; Stadler, Zsofia; Xiong, Xiaoling; Tang, Laura H; Vakiani, Efsevia; Katabi, Nora; Wang, Hangjun; Bacares, Ruben; Ruggeri, Jeanine; Boland, C Richard; Ladanyi, Marc; Klimstra, David S

2013-01-01

Immunohistochemical staining for DNA mismatch repair proteins may be affected by various biological and technical factors. Staining variations that could potentially lead to erroneous interpretations have been recognized. A recently recognized staining variation is the significant reduction of staining for MSH6 in some colorectal carcinomas. The frequency and specific characteristics of this aberrant MSH6 staining pattern, however, have not been well analyzed. In this study of 420 colorectal carcinoma samples obtained from patients fulfilling the Revised Bethesda Guidelines, we detected 9 tumors (2%) showing extremely limited staining for MSH6 with positive staining present in <5% of the tumor cells. Our analyses showed that these tumors belonged to two distinct categories: (1) MLH1 and/or PMS2 protein-deficient carcinomas (n=5, including 1 with a pathogenic mutation in PMS2); and (2) MLH1, PMS2 and MSH2 normal but with chemotherapy or chemoradiation therapy before surgery (n=4). To test our hypothesis that somatic mutation in the coding region microsatellite of the MSH6 gene might be a potential underlying mechanism for such limited MSH6 staining, we evaluated frameshift mutation in a (C)(8) tract in exon 5 of the MSH6 gene in seven tumors that had sufficient DNA for analysis, and detected mutation in four; all four tumors belonged to the MLH1/PMS2-deficient group. In conclusion, our data outline the main scenarios where significant reduction of MSH6 staining is more likely to occur in colorectal carcinoma, and suggest that somatic mutations of the coding region microsatellites of the MSH6 gene is an underlying mechanism for this staining phenomenon in MLH1/PMS2-deficient carcinomas.

Coexistence of CLCN1 and SCN4A mutations in one family suffering from myotonia.

PubMed

Maggi, Lorenzo; Ravaglia, Sabrina; Farinato, Alessandro; Brugnoni, Raffaella; Altamura, Concetta; Imbrici, Paola; Camerino, Diana Conte; Padovani, Alessandro; Mantegazza, Renato; Bernasconi, Pia; Desaphy, Jean-François; Filosto, Massimiliano

2017-12-01

Non-dystrophic myotonias are characterized by clinical overlap making it challenging to establish genotype-phenotype correlations. We report clinical and electrophysiological findings in a girl and her father concomitantly harbouring single heterozygous mutations in SCN4A and CLCN1 genes. Functional characterization of N1297S hNav1.4 mutant was performed by patch clamp. The patients displayed a mild phenotype, mostly resembling a sodium channel myotonia. The CLCN1 c.501C>G (p.F167L) mutation has been already described in recessive pedigrees, whereas the SCN4A c.3890A>G (p.N1297S) variation is novel. Patch clamp experiments showed impairment of fast and slow inactivation of the mutated Nav1.4 sodium channel. The present findings suggest that analysis of both SCN4A and CLCN1 genes should be considered in myotonic patients with atypical clinical and neurophysiological features.

[The role of remodeling complexes CHD1 and ISWI in spontaneous and UV-induced mutagenesis control in yeast Saccharomyces cerevisiae].

PubMed

Evstiukhina, T A; Alekseeva, E A; Fedorov, D V; Peshekhonov, V T; Korolev, V G

2017-02-01

Chromatin remodulators are special multiprotein machines capable of transforming the structure, constitution, and positioning of nucleosomes on DNA. Biochemical activities of remodeling complexes CHD1 and ISWI from the SWI2/SNF2 family are well established. They ensure correct positioning of nucleosomes along the genome, which is probably critical for genome stability, in particular, after action of polymerases, repair enzymes, and transcription. In this paper, we show that single mutations in genes ISW1, ISW2, and CHD1 weakly affect repair and mutagenic processes in yeast cells. At the same time, there are differences in the effect of these mutations on spontaneous mutation levels, which indicates certain specificity of action of protein complexes ISW1, ISW2, and CHD1 on expression of different genes that control repair and mutation processes in yeast.

Mutation covariation of HIV-1 CRF07_BC reverse transcriptase during antiretroviral therapy.

PubMed

Li, Zhenpeng; Huang, Yang; Ouyang, Yabo; Xing, Hui; Liao, Lingjie; Jiang, Shibo; Shao, Yiming; Ma, Liying

2013-11-01

To understand the effect of HIV-1 drug resistance mutations in the context of antiretroviral therapy (ART), we compared the prevalence of protease (PR) and reverse transcriptase (RT) mutations in HIV-1 CRF07_BC sequences from blood samples of treatment-naive and ART-treated patients. Mutation covariation in the RT and PR of HIV-1 CRF07_BC viruses from 542 treatment-naive patients and 261 patients treated with lamivudine/zidovudine/nevirapine or lamivudine/zidovudine/efavirenz was analysed. Stratified networks were used to display the mutation covariation. Based on the comparison between treatment-naive and ART-treated patients, three types of featured mutations for RT and PR were initially identified: treatment-associated mutations, treatment-agonistic mutations and overlapping polymorphisms. Twelve significant covariation pairs were found between five treatment-associated mutations (K103N, M184V, Q197K, G190A and Y181C) and nine overlapping polymorphisms (A36E, D39N, Y121H, D123E, R135I, T200A, R277K, L283I and D291E). Meanwhile, three covariation pairs between three treatment-associated mutations (I132L and M184V for RT and I15V for PR) and three overlapping polymorphisms (L10I, L36M and A71V) for PR were also detected. Finally, the overlapping polymorphisms for RT and PR were both found to have significant correlations with treatment-associated mutations, indicating a possible association between polymorphisms and drug resistance. When compared with HIV-1 subtype B under the same regimens as CRF07_BC, the mutation covariations of CRF07_BC showed a distinct pattern of RT and PR mutation covariation. The role of polymorphisms in the development of drug resistance has been widely reported. Here, we found a significant correlation between overlapping polymorphisms for RT and PR and treatment-associated mutations, indicating that polymorphisms exert a global influence on treatment-associated mutations. Polymorphism mutations might therefore be considered before initiating ART to improve the efficacy of drug combinations.

Mutations in CTC1, Encoding the CTS Telomere Maintenance Complex Component 1, Cause Cerebroretinal Microangiopathy with Calcifications and Cysts

PubMed Central

Polvi, Anne; Linnankivi, Tarja; Kivelä, Tero; Herva, Riitta; Keating, James P.; Mäkitie, Outi; Pareyson, Davide; Vainionpää, Leena; Lahtinen, Jenni; Hovatta, Iiris; Pihko, Helena; Lehesjoki, Anna-Elina

2012-01-01

Cerebroretinal microangiopathy with calcifications and cysts (CRMCC) is a rare multisystem disorder characterized by extensive intracranial calcifications and cysts, leukoencephalopathy, and retinal vascular abnormalities. Additional features include poor growth, skeletal and hematological abnormalities, and recurrent gastrointestinal bleedings. Autosomal-recessive inheritance has been postulated. The pathogenesis of CRMCC is unknown, but its phenotype has key similarities with Revesz syndrome, which is caused by mutations in TINF2, a gene encoding a member of the telomere protecting shelterin complex. After a whole-exome sequencing approach in four unrelated individuals with CRMCC, we observed four recessively inherited compound heterozygous mutations in CTC1, which encodes the CTS telomere maintenance complex component 1. Sanger sequencing revealed seven more compound heterozygous mutations in eight more unrelated affected individuals. Two individuals who displayed late-onset cerebral findings, a normal fundus appearance, and no systemic findings did not have CTC1 mutations, implying that systemic findings are an important indication for CTC1 sequencing. Of the 11 mutations identified, four were missense, one was nonsense, two resulted in in-frame amino acid deletions, and four were short frameshift-creating deletions. All but two affected individuals were compound heterozygous for a missense mutation and a frameshift or nonsense mutation. No individuals with two frameshift or nonsense mutations were identified, which implies that severe disturbance of CTC1 function from both alleles might not be compatible with survival. Our preliminary functional experiments did not show evidence of severely affected telomere integrity in the affected individuals. Therefore, determining the underlying pathomechanisms associated with deficient CTC1 function will require further studies. PMID:22387016

[A novel mutation in KCNB1 gene in a child with neuropsychiatric comorbidities with both intellectual disability and epilepsy and review of literature].

PubMed

Miao, P; Peng, J; Chen, C; Gai, N; Yin, F

2017-02-02

Objective: To explore the association between the phenotype and KCNB1 gene mutation. Method: Clinical information including physical features, laboratory and genetic data of one patient of mental retardation with refractory epilepsy from Department of Pediatrics, Xiangya Hospital in January 2016 was analyzed. This patient was discovered to have KCNB1 gene mutations through whole exome sequencing. Relevant information about KCNB1 gene mutation was searched and collected from Pubmed, CNKI, Human Gene Mutation Database(HGMD) and Online Mendelian Inheritance in Man(OMIM). Searching was done using "KCNB1" as a keyword. Result: A 3.5 years old boy who visited our hospital firstly at the age of 2 years because of development delay came for follow up as he developed seizures.The forms included tonic, clonic seizures and spasm. The condition became more severe 10 months later. Electroencephalogram(EEG) showed high frequency discharge (>85%). He had poor response to multiple anti-epileptic drugs, methylprednisolone and ketogenic diet. At the age of 3, he started to have mental regression. Whole exome-sequencing study (trios) identified a novel heterozygous mutation c. G1136T (p.G379V) in KCNB1, which is not available in the databases mentioned above. This is the first case report of KCNB1 gene mutation in China. Eight cases have been reported so far worldwide and all of them were diagnosed with refractory epilepsy. Those 8 reported cases of encephalopathy were all due to de novo mutation. Conclusion: The main clinical features of patients with KCNB1 mutations include severe to profound intellectual disability, intractable seizures, hypotonia and regression of cognition and motor activity which lead to poor prognosis.

4-Hydroxy-2(E)-nonenal metabolism differs in Apc(+/+) cells and in Apc(Min/+) cells: it may explain colon cancer promotion by heme iron.

PubMed

Baradat, Maryse; Jouanin, Isabelle; Dalleau, Sabine; Taché, Sylviane; Gieules, Mathilde; Debrauwer, Laurent; Canlet, Cécile; Huc, Laurence; Dupuy, Jacques; Pierre, Fabrice H F; Guéraud, Françoise

2011-11-21

Animal and epidemiological studies suggest that dietary heme iron would promote colorectal cancer. Oxidative properties of heme could lead to the formation of cytotoxic and genotoxic secondary lipid oxidation products, such as 4-hydroxy-2(E)-nonenal (HNE). This compound is more cytotoxic to mouse wild-type colon cells than to isogenic cells with a mutation on the adenomatous polyposis coli (APC) gene. The latter thus have a selective advantage, possibly leading to cancer promotion. This mutation is an early and frequent event in human colorectal cancer. To explain this difference, the HNE biotransformation capacities of the two cell types have been studied using radiolabeled and stable isotope-labeled HNE. Apc-mutated cells showed better biotransformation capacities than nonmutated cells did. Thiol compound conjugation capacities were higher for mutated cells, with an important advantage for the extracellular conjugation to cysteine. Both cells types were able to reduce HNE to 4-hydroxynonanal, a biotransformation pathway that has not been reported for other intestinal cells. Mutated cells showed higher capacities to oxidize 4-hydroxynonanal into 4-hydroxynonanoic acid. The mRNA expression of different enzymes involved in HNE metabolism such as aldehyde dehydrogenase 1A1, 2 and 3A1, glutathione transferase A4-4, or cystine transporter xCT was upregulated in mutated cells compared with wild-type cells. In conclusion, this study suggests that Apc-mutated cells are more efficient than wild-type cells in metabolizing HNE into thiol conjugates and 4-hydroxynonanoic acid due to the higher expression of key biotransformation enzymes. These differential biotransformation capacities would explain the differences of susceptibility between normal and Apc-mutated cells regarding secondary lipid oxidation products.

Kindler syndrome with severe mucosal involvement in childhood.

PubMed

Krishna, C V; Parmar, N V; Has, C

2014-04-01

Kindler syndrome (KS) is an inherited dermatosis linked to the FERMT1 gene, and is characterized clinically by trauma-induced acral skin blisters in infancy and childhood, photosensitivity, and progressive poikiloderma. We report a case of KS in a 7-year-old Indian girl with severe mucosal involvement of the oral cavity and genitourinary tract. Mutation analysis in the girl showed a homozygous FERMT1 mutation, c.862C>T, p.R288*. The clinical manifestations in patients with KS show significant inter individual variation, even with the same type of mutations and within members of the same family. Our case highlights the role of environmental modifiers in regulating the clinical features of KS. © 2014 British Association of Dermatologists.

Rapid BRAF mutation tests in patients with advanced melanoma: comparison of immunohistochemistry, Droplet Digital PCR, and the Idylla Mutation Platform

PubMed Central

Bisschop, Cornelis; ter Elst, Arja; Bosman, Lisette J.; Platteel, Inge; Jalving, Mathilde; van den Berg, Anke; Diepstra, Arjan; van Hemel, Bettien; Diercks, Gilles F.H.; Hospers, Geke A.P.

2018-01-01

BRAF mutational testing has become a common practice in the diagnostic process of patients with advanced melanoma. Although time-consuming, DNA sequencing techniques are the current gold standard for mutational testing. However, in certain clinical situations, a rapid test result is required. In this study, the performance of three rapid BRAF mutation tests was compared. Thirty-nine formalin-fixed paraffin-embedded melanoma tissue samples collected between 2007 and 2014 at a single center were included. These samples were analyzed by immunohistochemistry using the anti-BRAF-V600E (VE1) mouse monocolonal antibody (BRAF-VE1 IHC), a V600E-specific Droplet Digital PCR Test, and the Idylla BRAF- Mutation Test (Idylla). Results were compared with the results of conventional BRAF mutation testing, performed using high-resolution melting analysis followed by Sanger sequencing. Next-generation sequencing was performed on samples with discordant results. The Idylla test and Droplet Digital PCR Test correctly identified all mutated and wild-type samples. BRAF-VE1 IHC showed one discordant result. The Idylla test could identify BRAF-V600 mutations other than BRAF-V600E and was the fastest and least laborious test. The Idylla Mutation Test is the most suitable test for rapid BRAF testing in clinical situations on the basis of the broad coverage of treatment-responsive mutations and the fast procedure without the need to perform a DNA isolation step. PMID:29232304

T antigen mutations are a human tumor-specific signature for Merkel cell polyomavirus

PubMed Central

Shuda, Masahiro; Feng, Huichen; Kwun, Hyun Jin; Rosen, Steven T.; Gjoerup, Ole; Moore, Patrick S.; Chang, Yuan

2008-01-01

Merkel cell polyomavirus (MCV) is a virus discovered in our laboratory at the University of Pittsburgh that is monoclonally integrated into the genome of ≈80% of human Merkel cell carcinomas (MCCs). Transcript mapping was performed to show that MCV expresses transcripts in MCCs similar to large T (LT), small T (ST), and 17kT transcripts of SV40. Nine MCC tumor-derived LT genomic sequences have been examined, and all were found to harbor mutations prematurely truncating the MCV LT helicase. In contrast, four presumed episomal viruses from nontumor sources did not possess this T antigen signature mutation. Using coimmunoprecipitation and origin replication assays, we show that tumor-derived virus mutations do not affect retinoblastoma tumor suppressor protein (Rb) binding by LT but do eliminate viral DNA replication capacity. Identification of an MCC cell line (MKL-1) having monoclonal MCV integration and the signature LT mutation allowed us to functionally test both tumor-derived and wild type (WT) T antigens. Only WT LT expression activates replication of integrated MCV DNA in MKL-1 cells. Our findings suggest that MCV-positive MCC tumor cells undergo selection for LT mutations to prevent autoactivation of integrated virus replication that would be detrimental to cell survival. Because these mutations render the virus replication-incompetent, MCV is not a “passenger virus” that secondarily infects MCC tumors. PMID:18812503

Disease-associated mitochondrial mutations and the evolution of primate mitogenomes

PubMed Central

Tavares, William Corrêa

2017-01-01

Several human diseases have been associated with mutations in mitochondrial genes comprising a set of confirmed and reported mutations according to the MITOMAP database. An analysis of complete mitogenomes across 139 primate species showed that most confirmed disease-associated mutations occurred in aligned codon positions and gene regions under strong purifying selection resulting in a strong evolutionary conservation. Only two confirmed variants (7.1%), coding for the same amino acids accounting for severe human diseases, were identified without apparent pathogenicity in non-human primates, like the closely related Bornean orangutan. Conversely, reported disease-associated mutations were not especially concentrated in conserved codon positions, and a large fraction of them occurred in highly variable ones. Additionally, 88 (45.8%) of reported mutations showed similar variants in several non-human primates and some of them have been present in extinct species of the genus Homo. Considering that recurrent mutations leading to persistent variants throughout the evolutionary diversification of primates are less likely to be severely damaging to fitness, we suggest that these 88 mutations are less likely to be pathogenic. Conversely, 69 (35.9%) of reported disease-associated mutations occurred in extremely conserved aligned codon positions which makes them more likely to damage the primate mitochondrial physiology. PMID:28510580

Common variants at the 19p13.1 and ZNF365 loci are associated with ER subtypes of breast cancer and ovarian cancer risk in BRCA1 and BRCA2 mutation carriers

PubMed Central

Couch, Fergus J.; Gaudet, Mia M.; Antoniou, Antonis C.; Ramus, Susan J.; Kuchenbaecker, Karoline B.; Soucy, Penny; Beesley, Jonathan; Chen, Xiaoqing; Wang, Xianshu; Kirchhoff, Tomas; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; Healey, Sue; Sinilnikova, Olga M.; Andrulis, Irene L.; Ozcelik, Hilmi; Mulligan, Anna Marie; Thomassen, Mads; Gerdes, Anne-Marie; Jensen, Uffe Birk; Skytte, Anne-Bine; Kruse, Torben A.; Caligo, Maria A.; von Wachenfeldt, Anna; Barbany-Bustinza, Gisela; Loman, Niklas; Soller, Maria; Ehrencrona, Hans; Karlsson, Per; Nathanson, Katherine L.; Rebbeck, Timothy R.; Domchek, Susan M.; Jakubowska, Ania; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Złowocka, Elżbieta; Huzarski, Tomasz; Byrski, Tomasz; Gronwald, Jacek; Cybulski, Cezary; Górski, Bohdan; Osorio, Ana; Durán, Mercedes; Tejada, María Isabel; Benitez, Javier; Hamann, Ute; Hogervorst, Frans B.L.; van Os, Theo A.; van Leeuwen, Flora E.; Meijers-Heijboer, Hanne E.J.; Wijnen, Juul; Blok, Marinus J.; Kets, Marleen; Hooning, Maartje J.; Oldenburg, Rogier A.; Ausems, Margreet G.E.M.; Peock, Susan; Frost, Debra; Ellis, Steve D.; Platte, Radka; Fineberg, Elena; Evans, D. Gareth; Jacobs, Chris; Eeles, Rosalind A.; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana M.; Cole, Trevor; Cook, Jackie; Paterson, Joan; Brewer, Carole; Douglas, Fiona; Hodgson, Shirley V.; Morrison, Patrick J.; Walker, Lisa; Porteous, Mary E.; Kennedy, M. John; Side, Lucy E.; Bove, Betsy; Godwin, Andrew K.; Stoppa-Lyonnet, Dominique; Fassy-Colcombet, Marion; Castera, Laurent; Cornelis, François; Mazoyer, Sylvie; Léoné, Mélanie; Boutry-Kryza, Nadia; Bressac-de Paillerets, Brigitte; Caron, Olivier; Pujol, Pascal; Coupier, Isabelle; Delnatte, Capucine; Akloul, Linda; Lynch, Henry T.; Snyder, Carrie L.; Buys, Saundra S.; Daly, Mary B.; Terry, MaryBeth; Chung, Wendy K.; John, Esther M.; Miron, Alexander; Southey, Melissa C.; Hopper, John L.; Goldgar, David E.; Singer, Christian F.; Rappaport, Christine; Tea, Muy-Kheng M.; Fink-Retter, Anneliese; Hansen, Thomas V. O.; Nielsen, Finn C.; Arason, Aðalgeir; Vijai, Joseph; Shah, Sohela; Sarrel, Kara; Robson, Mark E.; Piedmonte, Marion; Phillips, Kelly; Basil, Jack; Rubinstein, Wendy S.; Boggess, John; Wakeley, Katie; Ewart-Toland, Amanda; Montagna, Marco; Agata, Simona; Imyanitov, Evgeny N.; Isaacs, Claudine; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Feliubadalo, Lidia; Brunet, Joan; Gayther, Simon A; Pharoah, Paul PD; Odunsi, Kunle O.; Karlan, Beth Y.; Walsh, Christine S.; Olah, Edith; Teo, Soo Hwang; Ganz, Patricia A.; Beattie, Mary S.; van Rensburg, Elizabeth J.; Dorfling, Cecelia M.; Diez, Orland; Kwong, Ava; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Heidemann, Simone; Niederacher, Dieter; Preisler-Adams, Sabine; Gadzicki, Dorothea; Varon-Mateeva, Raymonda; Deissler, Helmut; Gehrig, Andrea; Sutter, Christian; Kast, Karin; Fiebig, Britta; Heinritz, Wolfram; Caldes, Trinidad; de la Hoya, Miguel; Muranen, Taru A.; Nevanlinna, Heli; Tischkowitz, Marc D.; Spurdle, Amanda B.; Neuhausen, Susan L.; Ding, Yuan Chun; Lindor, Noralane M.; Fredericksen, Zachary; Pankratz, V. Shane; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Barile, Monica; Bernard, Loris; Viel, Alessandra; Giannini, Giuseppe; Varesco, Liliana; Radice, Paolo; Greene, Mark H.; Mai, Phuong L.; Easton, Douglas F.; Chenevix-Trench, Georgia; Offit, Kenneth; Simard, Jacques

2012-01-01

Background Genome-wide association studies (GWAS) identified variants at 19p13.1 and ZNF365 (10q21.2) as risk factors for breast cancer among BRCA1 and BRCA2 mutation carriers, respectively. We explored associations with ovarian cancer and with breast cancer by tumor histopathology for these variants in mutation carriers from the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). Methods Genotyping data for 12,599 BRCA1 and 7,132 BRCA2 mutation carriers from 40 studies were combined. Results We confirmed associations between rs8170 at 19p13.1 and breast cancer risk for BRCA1 mutation carriers (hazard ratio (HR)=1.17; 95%CI 1.07–1.27; p=7.42×10−4) and between rs16917302 at ZNF365 (HR=0.84; 95%CI 0.73–0.97; p=0.017) but not rs311499 at 20q13.3 (HR=1.11; 95%CI 0.94–1.31; p=0.22) and breast cancer risk for BRCA2 mutation carriers. Analyses based on tumor histopathology showed that 19p13 variants were predominantly associated with estrogen receptor (ER)-negative breast cancer for both BRCA1 and BRCA2 mutation carriers, whereas rs16917302 at ZNF365 was mainly associated with ER-positive breast cancer for both BRCA1 and BRCA2 mutation carriers. We also found for the first time that rs67397200 at 19p13.1 was associated with an increased risk of ovarian cancer for BRCA1 (HR=1.16; 95%CI 1.05–1.29; p=3.8×10−4) and BRCA2 mutation carriers (HR=1.30; 95%CI 1.10–1.52; p=1.8×10−3). Conclusions 19p13.1 and ZNF365 are susceptibility loci for ovarian cancer and ER subtypes of breast cancer among BRCA1 and BRCA2 mutation carriers. Impact These findings can lead to an improved understanding of tumor development and may prove useful for breast and ovarian cancer risk prediction for BRCA1 and BRCA2 mutation carriers. PMID:22351618

High Incidence of Noonan Syndrome Features Including Short Stature and Pulmonic Stenosis in Patients carrying NF1 Missense Mutations Affecting p.Arg1809: Genotype-Phenotype Correlation.

PubMed

Rojnueangnit, Kitiwan; Xie, Jing; Gomes, Alicia; Sharp, Angela; Callens, Tom; Chen, Yunjia; Liu, Ying; Cochran, Meagan; Abbott, Mary-Alice; Atkin, Joan; Babovic-Vuksanovic, Dusica; Barnett, Christopher P; Crenshaw, Melissa; Bartholomew, Dennis W; Basel, Lina; Bellus, Gary; Ben-Shachar, Shay; Bialer, Martin G; Bick, David; Blumberg, Bruce; Cortes, Fanny; David, Karen L; Destree, Anne; Duat-Rodriguez, Anna; Earl, Dawn; Escobar, Luis; Eswara, Marthanda; Ezquieta, Begona; Frayling, Ian M; Frydman, Moshe; Gardner, Kathy; Gripp, Karen W; Hernández-Chico, Concepcion; Heyrman, Kurt; Ibrahim, Jennifer; Janssens, Sandra; Keena, Beth A; Llano-Rivas, Isabel; Leppig, Kathy; McDonald, Marie; Misra, Vinod K; Mulbury, Jennifer; Narayanan, Vinodh; Orenstein, Naama; Galvin-Parton, Patricia; Pedro, Helio; Pivnick, Eniko K; Powell, Cynthia M; Randolph, Linda; Raskin, Salmo; Rosell, Jordi; Rubin, Karol; Seashore, Margretta; Schaaf, Christian P; Scheuerle, Angela; Schultz, Meredith; Schorry, Elizabeth; Schnur, Rhonda; Siqveland, Elizabeth; Tkachuk, Amanda; Tonsgard, James; Upadhyaya, Meena; Verma, Ishwar C; Wallace, Stephanie; Williams, Charles; Zackai, Elaine; Zonana, Jonathan; Lazaro, Conxi; Claes, Kathleen; Korf, Bruce; Martin, Yolanda; Legius, Eric; Messiaen, Ludwine

2015-11-01

Neurofibromatosis type 1 (NF1) is one of the most frequent genetic disorders, affecting 1:3,000 worldwide. Identification of genotype-phenotype correlations is challenging because of the wide range clinical variability, the progressive nature of the disorder, and extreme diversity of the mutational spectrum. We report 136 individuals with a distinct phenotype carrying one of five different NF1 missense mutations affecting p.Arg1809. Patients presented with multiple café-au-lait macules (CALM) with or without freckling and Lisch nodules, but no externally visible plexiform neurofibromas or clear cutaneous neurofibromas were found. About 25% of the individuals had Noonan-like features. Pulmonic stenosis and short stature were significantly more prevalent compared with classic cohorts (P < 0.0001). Developmental delays and/or learning disabilities were reported in over 50% of patients. Melanocytes cultured from a CALM in a segmental NF1-patient showed two different somatic NF1 mutations, p.Arg1809Cys and a multi-exon deletion, providing genetic evidence that p.Arg1809Cys is a loss-of-function mutation in the melanocytes and causes a pigmentary phenotype. Constitutional missense mutations at p.Arg1809 affect 1.23% of unrelated NF1 probands in the UAB cohort, therefore this specific NF1 genotype-phenotype correlation will affect counseling and management of a significant number of patients. © 2015 The Authors. **Human Mutation published by Wiley Periodicals, Inc.

Loss of mutL homolog-1 (MLH1) expression promotes acquisition of oncogenic and inhibitor-resistant point mutations in tyrosine kinases.

PubMed

Springuel, Lorraine; Losdyck, Elisabeth; Saussoy, Pascale; Turcq, Béatrice; Mahon, François-Xavier; Knoops, Laurent; Renauld, Jean-Christophe

2016-12-01

Genomic instability drives cancer progression by promoting genetic abnormalities that allow for the multi-step clonal selection of cells with growth advantages. We previously reported that the IL-9-dependent TS1 cell line sequentially acquired activating substitutions in JAK1 and JAK3 upon successive selections for growth factor independent and JAK inhibitor-resistant cells, suggestive of a defect in mutation avoidance mechanisms. In the first part of this paper, we discovered that the gene encoding mutL homolog-1 (MLH1), a key component of the DNA mismatch repair system, is silenced by promoter methylation in TS1 cells. By means of stable ectopic expression and RNA interference methods, we showed that the high frequencies of growth factor-independent and inhibitor-resistant cells with activating JAK mutations can be attributed to the absence of MLH1 expression. In the second part of this paper, we confirm the clinical relevance of our findings by showing that chronic myeloid leukemia relapses upon ABL-targeted therapy correlated with a lower expression of MLH1 messenger RNA. Interestingly, the mutational profile observed in our TS1 model, characterized by a strong predominance of T:A>C:G transitions, was identical to the one described in the literature for primitive cells derived from chronic myeloid leukemia patients. Taken together, our observations demonstrate for the first time a causal relationship between MLH1-deficiency and incidence of oncogenic point mutations in tyrosine kinases driving cell transformation and acquired resistance to kinase-targeted cancer therapies.

Survey of familial glaucoma shows a high incidence of cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) mutations in non-consanguineous congenital forms in a Spanish population

PubMed Central

Millá, Elena; Mañé, Begoña; Duch, Susana; Hernan, Imma; Borràs, Emma; Planas, Ester; Dias, Miguel de Sousa; Carballo, Miguel

2013-01-01

Purpose To identify myocilin (MYOC) and cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) mutations in a Spanish population with different clinical forms of familial glaucoma or ocular hypertension (OHT). Methods Index patients from 226 families participated in this study. Patients were diagnosed with familial glaucoma or OHT by complete ophthalmologic examination. Screening for MYOC mutations was performed in 207 index patients: 96 with adult-onset primary open-angle glaucoma (POAG), 21 with primary congenital glaucoma (PCG), 18 with juvenile-onset open-angle glaucoma (JOAG), five with Axenfeld-Rieger syndrome (ARS), and 67 with other types of glaucoma. One hundred two of the families (including all those in whom a MYOC mutation was detected) were also screened for CYP1B1 mutations: 45 POAG, 25 PCG, 21 JOAG, four ARS, and seven others. Results We examined 292 individuals (patients and relatives) with a positive family history of glaucoma or OHT. We identified two novel MYOC variants, p.Lys39Arg and p.Glu218Lys, in two families with POAG, and six previously reported MYOC mutations in seven families with POAG (four), JOAG (one), PCG (one), and normotensive glaucoma (one). CYP1B1 mutations were found in 16 index patients with PCG (nine), POAG (three), JOAG (two), and ARS (two). Conclusions The high percentage (9/25=36%) of mutations in CYP1B1 found in non-consanguineous patients with congenital glaucoma mandates genetic testing. However, the percentage of mutations (9/207=4.4%) in MYOC associated with glaucoma is relatively low in our population. The variable phenotype expression of glaucoma, even in families, cannot be explained with a digenic mechanism between MYOC and CYP1B1. PMID:23922489

A novel missense mutation of the TYR gene in a pedigree with oculocutaneous albinism type 1 from China.

PubMed

Lin, Yu-Ying; Wei, Ai-Hua; Zhou, Zhi-Yong; Zhu, Wei; He, Xin; Lian, Shi

2011-10-01

The mutation of the tyrosinase (TYR) gene results in oculocutaneous albinism type 1 (OCA1), an autosomal recessive genetic disorder. OCA1 is the most common type of OCA in the Chinese population. Hence, the TYR gene was tested in this study. We also delineated the genetic analysis of OCA1 in a Chinese family. Genomic DNA was isolated from the blood leukocytes of a proband and his family. Mutational analysis at the TYR locus by DNA sequencing was used to screen five exons, including the intron/exon junctions. A pedigree chart was drawn and the fundus of the eyes of the proband was also examined. A novel missense mutation p.I151S on exon 1, and homozygous TYR mutant alleles were identified in the proband. None of the mutants was identified among the 100 normal control subjects. Genetic analysis of the proband's wife showed normal alleles in the TYR gene. Thus, the fetus was predicated a carrier of OCA1 with a normal appearance. This study provided new information about a novel mutation, p.I151S, in the TYR gene in a Chinese family with OCA1. Further investigation of the proband would be helpful to determine the effects of this mutation on TYR activity.

Gene therapy restores vision in rd1 mice after removal of a confounding mutation in Gpr179.

PubMed

Nishiguchi, Koji M; Carvalho, Livia S; Rizzi, Matteo; Powell, Kate; Holthaus, Sophia-Martha kleine; Azam, Selina A; Duran, Yanai; Ribeiro, Joana; Luhmann, Ulrich F O; Bainbridge, James W B; Smith, Alexander J; Ali, Robin R

2015-01-23

The rd1 mouse with a mutation in the Pde6b gene was the first strain of mice identified with a retinal degeneration. However, AAV-mediated gene supplementation of rd1 mice only results in structural preservation of photoreceptors, and restoration of the photoreceptor-mediated a-wave, but not in restoration of the bipolar cell-mediated b-wave. Here we show that a mutation in Gpr179 prevents the full restoration of vision in rd1 mice. Backcrossing rd1 with C57BL6 mice reveals the complete lack of b-wave in a subset of mice, consistent with an autosomal recessive Mendelian inheritance pattern. We identify a mutation in the Gpr179 gene, which encodes for a G-protein coupled receptor localized to the dendrites of ON-bipolar cells. Gene replacement in rd1 mice that are devoid of the mutation in Gpr179 successfully restores the function of both photoreceptors and bipolar cells, which is maintained for up to 13 months. Our discovery may explain the failure of previous gene therapy attempts in rd1 mice, and we propose that Grp179 mutation status should be taken into account in future studies involving rd1 mice.

Dual role of the integrated stress response in medulloblastoma tumorigenesis

PubMed Central

Li, Xiting; Jamison, Stephanie; Harding, Heather P.; Ron, David; Lin, Wensheng

2016-01-01

In response to endoplasmic reticulum (ER) stress, activation of pancreatic ER kinase (PERK) coordinates an adaptive program known as the integrated stress response (ISR) by phosphorylating translation initiation factor 2α (eIF2α). Phosphorylated eIF2α is quickly dephosphorylated by the protein phosphatase 1 and growth arrest and DNA damage 34 (GADD34) complex. Data indicate that the ISR can either promote or suppress tumor development. Our previous studies showed that the ISR is activated in medulloblastoma in both human patients and animal models, and that the decreased ISR via PERK heterozygous deficiency attenuates medulloblastoma formation in Patched1 heterozygous deficient (Ptch1+/−) mice by enhancing apoptosis of pre-malignant granule cell precursors (GCPs) during cell transformation. We showed here that GADD34 heterozygous mutation moderately enhanced the ISR and noticeably increased the incidence of medulloblastoma in adult Ptch1+/− mice. Surprisingly, GADD34 homozygous mutation strongly enhanced the ISR, but significantly decreased the incidence of medulloblastoma in adult Ptch1+/− mice. Intriguingly, GADD34 homozygous mutation significantly enhanced pre-malignant GCP apoptosis in cerebellar hyperplastic lesions and reduced the lesion numbers in young Ptch1+/− mice. Nevertheless, neither GADD34 heterozygous mutation nor GADD34 homozygous mutation had a significant effect on medulloblastoma cells in adult Ptch1+/− mice. Collectively, these data imply the dual role of the ISR, promoting and inhibiting, in medulloblastoma tumorigenesis by regulating apoptosis of pre-malignant GCPs during the course of malignant transformation. PMID:27802424

Dual role of the integrated stress response in medulloblastoma tumorigenesis.

PubMed

Stone, Sarrabeth; Ho, Yeung; Li, Xiting; Jamison, Stephanie; Harding, Heather P; Ron, David; Lin, Wensheng

2016-09-27

In response to endoplasmic reticulum (ER) stress, activation of pancreatic ER kinase (PERK) coordinates an adaptive program known as the integrated stress response (ISR) by phosphorylating translation initiation factor 2α (eIF2α). Phosphorylated eIF2α is quickly dephosphorylated by the protein phosphatase 1 and growth arrest and DNA damage 34 (GADD34) complex. Data indicate that the ISR can either promote or suppress tumor development. Our previous studies showed that the ISR is activated in medulloblastoma in both human patients and animal models, and that the decreased ISR via PERK heterozygous deficiency attenuates medulloblastoma formation in Patched1 heterozygous deficient (Ptch1+/-) mice by enhancing apoptosis of pre-malignant granule cell precursors (GCPs) during cell transformation. We showed here that GADD34 heterozygous mutation moderately enhanced the ISR and noticeably increased the incidence of medulloblastoma in adult Ptch1+/- mice. Surprisingly, GADD34 homozygous mutation strongly enhanced the ISR, but significantly decreased the incidence of medulloblastoma in adult Ptch1+/- mice. Intriguingly, GADD34 homozygous mutation significantly enhanced pre-malignant GCP apoptosis in cerebellar hyperplastic lesions and reduced the lesion numbers in young Ptch1+/- mice. Nevertheless, neither GADD34 heterozygous mutation nor GADD34 homozygous mutation had a significant effect on medulloblastoma cells in adult Ptch1+/- mice. Collectively, these data imply the dual role of the ISR, promoting and inhibiting, in medulloblastoma tumorigenesis by regulating apoptosis of pre-malignant GCPs during the course of malignant transformation.

PSO4: a novel gene involved in error-prone repair in Saccharomyces cerevisiae.

PubMed

Henriques, J A; Vicente, E J; Leandro da Silva, K V; Schenberg, A C

1989-09-01

The haploid xs9 mutant, originally selected for on the basis of a slight sensitivity to the lethal effect of X-rays, was found to be extremely sensitive to inactivation by 8-methoxypsoralen (8MOP) photoaddition, especially when cells are treated in the G2 phase of the cell cycle. As the xs9 mutation showed no allelism with any of the 3 known pso mutations, it was now given the name of pso4-1. Regarding inactivation, the pso4-1 mutant is also sensitive to mono- (HN1) or bi-functional (HN2) nitrogen mustards, it is slightly sensitive to 254 nm UV radiation (UV), and shows nearly normal sensitivity to 3-carbethoxypsoralen (3-CPs) photoaddition or methyl methanesulfonate (MMS). Regarding mutagenesis, the pso4-1 mutation completely blocks reverse and forward mutations induced by either 8MOP or 3CPs photoaddition, or by gamma-rays. In the cases of UV, HN1, HN2 or MMS treatments, while reversion induction is still completely abolished, forward mutagenesis is only partially inhibited for UV, HN1, or MMS, and it is unaffected for HN2. Besides severely inhibiting induced mutagenesis, the pso4-1 mutation was found to be semi-dominant, to block sporulation, to abolish the diploid resistance effect, and to block induced mitotic recombination, which indicates that the PSO4 gene is involved in a recombinational pathway of error-prone repair, comparable to the E. coli SOS repair pathway.

Mutation of SIMPLE in Charcot–Marie–Tooth 1C alters production of exosomes

PubMed Central

Zhu, Hong; Guariglia, Sara; Yu, Raymond Y. L.; Li, Wenjing; Brancho, Deborah; Peinado, Hector; Lyden, David; Salzer, James; Bennett, Craig; Chow, Chi-Wing

2013-01-01

Charcot–Marie–Tooth (CMT) disease is an inherited neurological disorder. Mutations in the small integral membrane protein of the lysosome/late endosome (SIMPLE) account for the rare autosomal-dominant demyelination in CMT1C patients. Understanding the molecular basis of CMT1C pathogenesis is impeded, in part, by perplexity about the role of SIMPLE, which is expressed in multiple cell types. Here we show that SIMPLE resides within the intraluminal vesicles of multivesicular bodies (MVBs) and inside exosomes, which are nanovesicles secreted extracellularly. Targeting of SIMPLE to exosomes is modulated by positive and negative regulatory motifs. We also find that expression of SIMPLE increases the number of exosomes and secretion of exosome proteins. We engineer a point mutation on the SIMPLE allele and generate a physiological mouse model that expresses CMT1C-mutated SIMPLE at the endogenous level. We find that CMT1C mouse primary embryonic fibroblasts show decreased number of exosomes and reduced secretion of exosome proteins, in part due to improper formation of MVBs. CMT1C patient B cells and CMT1C mouse primary Schwann cells show similar defects. Together the data indicate that SIMPLE regulates the production of exosomes by modulating the formation of MVBs. Dysregulated endosomal trafficking and changes in the landscape of exosome-mediated intercellular communications may place an overwhelming burden on the nervous system and account for CMT1C molecular pathogenesis. PMID:23576546

Double mutation of cell wall proteins CspB and PBP1a increases secretion of the antibody Fab fragment from Corynebacterium glutamicum

PubMed Central

2014-01-01

Background Among other advantages, recombinant antibody-binding fragments (Fabs) hold great clinical and commercial potential, owing to their efficient tissue penetration compared to that of full-length IgGs. Although production of recombinant Fab using microbial expression systems has been reported, yields of active Fab have not been satisfactory. We recently developed the Corynebacterium glutamicum protein expression system (CORYNEX®) and demonstrated improved yield and purity for some applications, although the system has not been applied to Fab production. Results The Fab fragment of human anti-HER2 was successfully secreted by the CORYNEX® system using the conventional C. glutamicum strain YDK010, but the productivity was very low. To improve the secretion efficiency, we investigated the effects of deleting cell wall-related genes. Fab secretion was increased 5.2 times by deletion of pbp1a, encoding one of the penicillin-binding proteins (PBP1a), mediating cell wall peptidoglycan (PG) synthesis. However, this Δpbp1a mutation did not improve Fab secretion in the wild-type ATCC13869 strain. Because YDK010 carries a mutation in the cspB gene encoding a surface (S)-layer protein, we evaluated the effect of ΔcspB mutation on Fab secretion from ATCC13869. The Δpbp1a mutation showed a positive effect on Fab secretion only in combination with the ΔcspB mutation. The ΔcspBΔpbp1a double mutant showed much greater sensitivity to lysozyme than either single mutant or the wild-type strain, suggesting that these mutations reduced cell wall resistance to protein secretion. Conclusion There are at least two crucial permeability barriers to Fab secretion in the cell surface structure of C. glutamicum, the PG layer, and the S-layer. The ΔcspBΔpbp1a double mutant allows efficient Fab production using the CORYNEX® system. PMID:24731213

Genomic structures of dysplastic nodule and concurrent hepatocellular carcinoma.

PubMed

Lee, Minho; Kim, Kyung; Kim, Shinn Young; Jung, Seung-Hyun; Yoon, Jonghwan; Kim, Min Sung; Park, Hyeon-Chun; Jung, Eun Sun; Chung, Yeun-Jun; Lee, Sug Hyung

2018-06-24

Although high-grade dysplastic nodule (HGDN) is a preneoplastic lesion that precedes hepatocellular carcinoma (HCC), the genomic structures of HGDN in conjunction with HCC remain elusive. The objective of this study was to identify genomic alterations of HGDN and its difference from HCC that may drive HGDN progression to HCC. We analyzed 16 regions of paired HGDN and HCC from 6 patients using whole-exome sequencing to find somatic mutation and copy number alteration (CNA) profiles of HGDN and HCC. The number of mutations, driver mutations, and CNAs of HGDNs were not significantly different from those of HCCs. We identified that the CNA gain of 1q25.3-1q42.13 was predominant in the HCCs compared to that in the HGDNs. Two cases (one nodule-in-nodule case and another case with closely attached HCC and HGDN) showed several overlapped driver mutations (CTNNB1 and CEBPA) and CNAs (losses of CDKN2A, RB1 and TP53) between HGDNs and HCCs, suggesting their roles in the early HCC development. The other 4 cases with spatially separated HCCs and HGDNs showed few overlapped alterations between the paired HCCs and HGDNs. Mutations in ERBB2 and CCND1, and CNAs (gains of CTNNB1, MET and SMO and losses of PTEN, TP53 and SETD2) were identified as 'HCC-predominant', suggesting their roles in the progression of HGDN to HCC. Our data show that HCCs are direct descendants of HGDNs in some cases, but there is no direct evidence of such relationship in spatially separated cases. Genomic features of HGDN identified in this study provide a useful resource for dissecting clues for the genetic diagnosis of HGDN and HCC. Copyright © 2018. Published by Elsevier Inc.

High incidence of biallelic point mutations in the Runt domain of the AML1/PEBP2 alpha B gene in Mo acute myeloid leukemia and in myeloid malignancies with acquired trisomy 21.

PubMed

Preudhomme, C; Warot-Loze, D; Roumier, C; Grardel-Duflos, N; Garand, R; Lai, J L; Dastugue, N; Macintyre, E; Denis, C; Bauters, F; Kerckaert, J P; Cosson, A; Fenaux, P

2000-10-15

The AML1 gene, situated in 21q22, is often rearranged in acute leukemias through t(8;21) translocation, t(12;21) translocation, or less often t(3;21) translocation. Recently, point mutations in the Runt domain of the AML1 gene have also been reported in leukemia patients. Observations for mutations of the Runt domain of the AML1 gene in bone marrow cells were made in 300 patients, including 131 with acute myeloid leukemia (AML), 94 with myelodysplastic syndrome (MDS), 28 with blast crisis chronic myeloid leukemia (CML), 3 with atypical CML, 41 with acute lymphoblastic leukemia (ALL), and 3 with essential thrombocythemia (ET). Forty-one of the patients had chromosome 21 abnormalities, including t(8;21) in 6 of the patients with AML, t(12;21) in 8 patients with ALL, acquired trisomy 21 in 17 patients, tetrasomy 21 in 7 patients, and constitutional trisomy 21 (Down syndrome) in 3 patients. A point mutation was found in 14 cases (4.7%), including 9 (22%) of the 41 patients with AML of the Mo type (MoAML) (none of them had detectable chromosome 21 rearrangement) and 5 (38%) of the 13 myeloid malignancies with acquired trisomy 21 (1 M1AML, 2 M2AML, 1 ET, and 1 atypical CML). In at least 8 of 9 mutated cases of MoAML, both AML alleles were mutated: 3 patients had different stop codon mutations of the 2 AML1 alleles, and 5 patients had the same missense or stop codon mutation in both AML1 alleles, which resulted in at least 3 of the patients having duplication of the mutated allele and deletion of the normal residual allele, as shown by FISH analysis and by comparing microsatellite analyses of several chromosome 21 markers on diagnosis and remission samples. In the remaining mutated cases, with acquired trisomy 21, a missense mutation of AML1, which involved 2 of the 3 copies of the AML1 gene, was found. Four of the 7 mutated cases could be reanalyzed in complete remission, and no AML1 mutation was found, showing that mutations were acquired in the leukemic clone. In conclusion, these findings confirm the possibility of mutations of the Runt domain of the AML1 gene in leukemias, mainly in MoAML and in myeloid malignancies with acquired trisomy 21. AML1 mutations, in MoAML, involved both alleles and probably lead to nonfunctional AML1 protein. As AML1 protein regulates the expression of the myeloperoxidase gene, the relationship between AML1 mutations and Mo phenotype in AML will have to be further explored. (Blood. 2000;96:2862-2869)

Characterization of a Spontaneous Novel Mutation in the NPC2 Gene in a Cat Affected by Niemann Pick Type C Disease

PubMed Central

Zampieri, Stefania; Bianchi, Ezio; Cantile, Carlo; Saleri, Roberta; Bembi, Bruno; Dardis, Andrea

2014-01-01

Niemann-Pick C disease (NPC) is an autosomal recessive lysosomal storage disorder characterized by accumulation of unesterified cholesterol and other lipids within the lysosomes due to mutation in NPC1 or NPC2 genes. A feline model of NPC carrying a mutation in NPC1 gene has been previously described. We have identified two kittens affected by NPC disease due to a mutation in NPC2 gene. They manifested with tremors at the age of 3 months, which progressed to dystonia and severe ataxia. At 6 months of age cat 2 was unable to stand without assistance and had bilaterally reduced menace response. It died at the age of 10 months. Post-mortem histological analysis of the brain showed the presence of neurons with cytoplasmic swelling and vacuoles, gliosis of the substantia nigra and degeneration of the white matter. Spheroids with accumulation of ubiquitinated aggregates were prominent in the cerebellar cortex. Purkinje cells were markedly reduced in number and they showed prominent intracytoplasmic storage. Scattered perivascular aggregates of lymphocytes and microglial cells proliferation were present in the thalamus and midbrain. Proliferation of Bergmann glia was also observed. In the liver, hepatocytes were swollen because of accumulation of small vacuoles and foamy Kupffer cells were also detected. Foamy macrophages were observed within the pulmonary interstitium and alveoli as well. At 9 months cat 1 was unable to walk, developed seizures and it was euthanized at 21 months. Filipin staining of cultured fibroblasts showed massive storage of unesterified cholesterol. Molecular analysis of NPC1 and NPC2 genes showed the presence of a homozygous intronic mutation (c.82+5G>A) in the NPC2 gene. The subsequent analysis of the mRNA showed that the mutation causes the retention of 105 bp in the mature mRNA, which leads to the in frame insertion of 35 amino acids between residues 28 and 29 of NPC2 protein (p.G28_S29ins35). PMID:25396745

A novel NF1 mutation in a Chinese patient with giant café-au-lait macule in neurofibromatosis type 1 associated with a malignant peripheral nerve sheath tumor and bone abnormality.

PubMed

Tong, H-X; Li, M; Zhang, Y; Zhu, J; Lu, W-Q

2012-08-29

Neurofibromatosis type 1 (NF1; OMIM#162200) is a common neurocutaneous disorder that is characterized by multiple café-au-lait, skinfold freckling, Lisch nodules, and neurofibromas. Mutations in the NF1 gene, which encodes the neurofibromin protein, have been identified as the pathogenic gene of NF1. In this study, we present a clinical and molecular study of a Chinese patient with giant café-au-lait in NF1. The patient showed >6 café-au-lait spots on the body, axillary freckling, and multiple subcutaneous neurofibromas. He also had a malignant peripheral nerve sheath tumor and bone abnormalities. The germline mutational analysis of the NF1 gene revealed a novel missense mutation in exon 13. It is a novel heterozygous nucleotide G>A transition at position 2241 of the NF1 gene. We found no mutation in malignant peripheral nerve sheath tumor DNA from this patient. This expands the database for NF1 gene mutations in NF1. Its absence in the normal chromosomes suggests that it is responsible for the NF1 phenotype. To our knowledge, this is the first case of giant café-au-lait macule in NF1 associated with a malignant peripheral nerve sheath tumor and bone abnormality.

Mutations in ATP6V1B1 and ATP6V0A4 genes cause recessive distal renal tubular acidosis in Mexican families.

PubMed

Escobar, Laura I; Simian, Christopher; Treard, Cyrielle; Hayek, Donia; Salvador, Carolina; Guerra, Norma; Matos, Mario; Medeiros, Mara; Enciso, Sandra; Camargo, María Dolores; Vargas-Poussou, Rosa

2016-05-01

Autosomal recessive distal renal tubular acidosis (dRTA) is a rare disease characterized by a hyperchloremic metabolic acidosis with normal anion gap, hypokalemia, hypercalciuria, hypocitraturia, nephrocalcinosis, and conserved glomerular filtration rate. In some cases, neurosensorial deafness is associated. dRTA is developed during the first months of life and the main manifestations are failure to thrive, vomiting, dehydration, and anorexia. Nine unrelated families were studied: seven children, a teenager, and an adult with dRTA. Hearing was preserved in four children. Coding regions of the genes responsible for recessive dRTA were analysed by Sanger sequencing. Molecular defects were found in the genes ATP6V1B1 and ATP6V0A4. We identified three homozygous variants in ATP6V1B: a frameshift mutation (p.Ile386Hisfs*56), a nucleotide substitution in exon 10 (p.Pro346Arg), and a new splicing mutation in intron 5. Three patients were homozygous for one novel (p.Arg743Trp) and one known (p.Asp411Tyr) missense mutations in the ATP6V0A4 gene. Three patients were compound heterozygous: one proband displayed two novel mutations, the frameshift mutation p.Val52Metfs*25, and a large deletion of exons 18-21; two probands showed the missense mutation p.Asp411Tyr and as a second mutation, p.Arg194Ter and c.1691+2dup, respectively. ATP6V0A4 and ATP6V1B1 genes were involved in recessive dRTA of Mexican families. All ATP6V1B1 mutations detected were homozygous and all patients developed sensorineural hearing loss (SNHL) early in infancy. ATP6V0A4 mutations were found in one infant and three children without SNHL, and in one teenager and one adult with SNHL confirming the phenotypic variability in this trait. The mutation p.Asp411Tyr detected in four Mexican families was due to a founder effect. Screening of these mutations could provide a rapid and valuable tool for diagnosis of dRTA in this population.

Functional Consequences of Seven Novel Mutations in the CYP11B1 Gene: Four Mutations Associated with Nonclassic and Three Mutations Causing Classic 11β-Hydroxylase Deficiency

PubMed Central

Parajes, Silvia; Loidi, Lourdes; Reisch, Nicole; Dhir, Vivek; Rose, Ian T.; Hampel, Rainer; Quinkler, Marcus; Conway, Gerard S.; Castro-Feijóo, Lidia; Araujo-Vilar, David; Pombo, Manuel; Dominguez, Fernando; Williams, Emma L.; Cole, Trevor R.; Kirk, Jeremy M.; Kaminsky, Elke; Rumsby, Gill; Arlt, Wiebke; Krone, Nils

2010-01-01

Context: Steroid 11β-hydroxylase (CYP11B1) deficiency (11OHD) is the second most common form of congenital adrenal hyperplasia (CAH). Cases of nonclassic 11OHD are rare compared with the incidence of nonclassic 21-hydroxylase deficiency. Objective: The aim of the study was to analyze the functional consequences of seven novel CYP11B1 mutations (p.M88I, p.W116G, p.P159L, p.A165D, p.K254_A259del, p.R366C, p.T401A) found in three patients with classic 11OHD, two patients with nonclassic 11OHD, and three heterozygous carriers for CYP11B1 mutations. Methods: We conducted functional studies employing a COS7 cell in vitro expression system comparing wild-type (WT) and mutant CYP11B1 activity. Mutants were examined in a computational three-dimensional model of the CYP11B1 protein. Results: All mutations (p.W116G, p.A165D, p.K254_A259del) found in patients with classic 11OHD have absent or very little 11β-hydroxylase activity relative to WT. The mutations detected in patients with nonclassic 11OHD showed partial functional impairment, with one patient being homozygous (p.P159L; 25% of WT) and the other patient compound heterozygous for a novel mild p.M88I (40% of WT) and the known severe p.R383Q mutation. The two mutations detected in heterozygous carriers (p.R366C, p.T401A) also reduced CYP11B1 activity by 23 to 37%, respectively. Conclusion: Functional analysis results allow for the classification of novel CYP11B1 mutations as causative for classic and nonclassic 11OHD, respectively. Four partially inactivating mutations are predicted to result in nonclassic 11OHD. These findings double the number of mild CYP11B1 mutations previously described as associated with mild 11OHD. Our data are important to predict phenotypic expression and provide important information for clinical and genetic counseling in 11OHD. PMID:20089618

The Norwegian PMS2 founder mutation c.989-1G > T shows high penetrance of microsatellite instable cancers with normal immunohistochemistry.

PubMed

Grindedal, Eli Marie; Aarset, Harald; Bjørnevoll, Inga; Røyset, Elin; Mæhle, Lovise; Stormorken, Astrid; Heramb, Cecilie; Medvik, Heidi; Møller, Pål; Sjursen, Wenche

2014-01-01

Using immunohistochemistry (IHC) to select cases for mismatch repair (MMR) genetic testing, we failed to identify a large kindred with the deleterious PMS2 mutation c.989-1G > T. The purpose of the study was to examine the sensitivity of IHC and microsatellite instability-analysis (MSI) to identify carriers of the mutation, and to estimate its penetrance and expressions. All carriers and obligate carriers of the mutation were identified. All cancer diagnoses were confirmed. IHC and MSI-analysis were performed on available tumours. Penetrances of cancers included in the Amsterdam and the Bethesda Criteria, for MSI-high tumours and MSI-high and low tumours were calculated by the Kaplan-Meier algorithm. Probability for co-segregation of the mutation and cancers by chance was 0.000004. Fifty-six carriers or obligate carriers were identified. There was normal staining for PMS2 in 15/18 (83.3%) of tumours included in the AMS1/AMS2/Bethesda criteria. MSI-analysis showed that 15/21 (71.4%) of tumours were MSI-high and 4/21 (19.0%) were MSI-low. Penetrance at 70 years was 30.6% for AMS1 cancers (colorectal cancers), 42.8% for AMS2 cancers, 47.2% for Bethesda cancers, 55.6% for MSI-high and MSI-low cancers and 52.2% for MSI-high cancers. The mutation met class 5 criteria for pathogenicity. IHC was insensitive in detecting tumours caused by the mutation. Penetrance of cancers that displayed MSI was 56% at 70 years. Besides colorectal cancers, the most frequent expressions were carcinoma of the endometrium and breast in females and stomach and prostate in males.

The Norwegian PMS2 founder mutation c.989-1G > T shows high penetrance of microsatellite instable cancers with normal immunohistochemistry

PubMed Central

2014-01-01

Background Using immunohistochemistry (IHC) to select cases for mismatch repair (MMR) genetic testing, we failed to identify a large kindred with the deleterious PMS2 mutation c.989-1G > T. The purpose of the study was to examine the sensitivity of IHC and microsatellite instability-analysis (MSI) to identify carriers of the mutation, and to estimate its penetrance and expressions. Methods All carriers and obligate carriers of the mutation were identified. All cancer diagnoses were confirmed. IHC and MSI-analysis were performed on available tumours. Penetrances of cancers included in the Amsterdam and the Bethesda Criteria, for MSI-high tumours and MSI-high and low tumours were calculated by the Kaplan-Meier algorithm. Results Probability for co-segregation of the mutation and cancers by chance was 0.000004. Fifty-six carriers or obligate carriers were identified. There was normal staining for PMS2 in 15/18 (83.3%) of tumours included in the AMS1/AMS2/Bethesda criteria. MSI-analysis showed that 15/21 (71.4%) of tumours were MSI-high and 4/21 (19.0%) were MSI-low. Penetrance at 70 years was 30.6% for AMS1 cancers (colorectal cancers), 42.8% for AMS2 cancers, 47.2% for Bethesda cancers, 55.6% for MSI-high and MSI-low cancers and 52.2% for MSI-high cancers. Conclusions The mutation met class 5 criteria for pathogenicity. IHC was insensitive in detecting tumours caused by the mutation. Penetrance of cancers that displayed MSI was 56% at 70 years. Besides colorectal cancers, the most frequent expressions were carcinoma of the endometrium and breast in females and stomach and prostate in males. PMID:24790682

Biochemical and genetic diagnosis of the primary hyperoxalurias: a review.

PubMed

Rumsby, G

2000-01-01

The primary hyperoxalurias are a group of inherited disorders of endogenous oxalate overproduction. Diagnosis of the two best-characterized disorders, primary hyperoxaluria (PH) Types 1 and 2, is achieved by sequential measurement of alanine:glyoxylate aminotransferase and glyoxylate reductase enzyme activity in a single needle liver biopsy. While genetic analysis of PH2 is still at a relatively early stage, the AGXT gene defective in the Type 1 disorder is well characterized, and a number of mutations have been identified. To determine whether mutation analysis could replace enzymatic analysis for the diagnosis of PH1, DNA samples from 127 consecutive unrelated patients in whom there was a high clinical suspicion of primary hyperoxaluria were analyzed for the presence of the G630A and T853C mutations, which together account for approximately 34% of the mutant alleles in our patient cohort. The sensitivity of mutation detection was 47% in those patients with enzymologically confirmed Type 1 disease, showing that mutation analysis cannot effectively replace enzymology at the present time. However, there is little doubt of the value of genetic methods (mutation and linkage analysis) for diagnosing PH1 (and eventually PH2) in other family members and for prenatal diagnosis and carrier testing.

Spontaneous Mutation at Amino Acid 544 of the Ebola Virus Glycoprotein Potentiates Virus Entry and Selection in Tissue Culture

PubMed Central

Ladner, Jason T.; Ettinger, Chelsea R.; Palacios, Gustavo

2017-01-01

ABSTRACT Ebolaviruses have a surface glycoprotein (GP1,2) that is required for virus attachment and entry into cells. Mutations affecting GP1,2 functions can alter virus growth properties. We generated a recombinant vesicular stomatitis virus encoding Ebola virus Makona variant GP1,2 (rVSV-MAK-GP) and observed emergence of a T544I mutation in the Makona GP1,2 gene during tissue culture passage in certain cell lines. The T544I mutation emerged within two passages when VSV-MAK-GP was grown on Vero E6, Vero, and BS-C-1 cells but not when it was passaged on Huh7 and HepG2 cells. The mutation led to a marked increase in virus growth kinetics and conferred a robust growth advantage over wild-type rVSV-MAK-GP on Vero E6 cells. Analysis of complete viral genomes collected from patients in western Africa indicated that this mutation was not found in Ebola virus clinical samples. However, we observed the emergence of T544I during serial passage of various Ebola Makona isolates on Vero E6 cells. Three independent isolates showed emergence of T544I from undetectable levels in nonpassaged virus or virus passaged once to frequencies of greater than 60% within a single passage, consistent with it being a tissue culture adaptation. Intriguingly, T544I is not found in any Sudan, Bundibugyo, or Tai Forest ebolavirus sequences. Furthermore, T544I did not emerge when we serially passaged recombinant VSV encoding GP1,2 from these ebolaviruses. This report provides experimental evidence that the spontaneous mutation T544I is a tissue culture adaptation in certain cell lines and that it may be unique for the species Zaire ebolavirus. IMPORTANCE The Ebola virus (Zaire) species is the most lethal species of all ebolaviruses in terms of mortality rate and number of deaths. Understanding how the Ebola virus surface glycoprotein functions to facilitate entry in cells is an area of intense research. Recently, three groups independently identified a polymorphism in the Ebola glycoprotein (I544) that enhanced virus entry, but they did not agree in their conclusions regarding its impact on pathogenesis. Our findings here address the origins of this polymorphism and provide experimental evidence showing that it is the result of a spontaneous mutation (T544I) specific to tissue culture conditions, suggesting that it has no role in pathogenesis. We further show that this mutation may be unique to the species Zaire ebolavirus, as it does not occur in Sudan, Bundibugyo, and Tai Forest ebolaviruses. Understanding the mechanism behind this mutation can provide insight into functional differences that exist in culture conditions and among ebolavirus glycoproteins. PMID:28539437

Deletion Mutagenesis Downstream of the 5′ Long Terminal Repeat of Human Immunodeficiency Virus Type 1 Is Compensated for by Point Mutations in both the U5 Region and gag Gene

PubMed Central

Liang, Chen; Rong, Liwei; Russell, Rodney S.; Wainberg, Mark A.

2000-01-01

We have studied the role of an RNA region at nucleotides (nt) +200 to +233, just downstream of the 5′ long terminal repeat, in encapsidation of human immunodeficiency virus type 1 genomic RNA. Three deletion mutations, namely, BH-D0, BH-D1, and BH-D2, were generated to eliminate sequences at positions nt +200 to +219, +200 to +226, and +200 to +233. The result in each case was decreased levels of packaging of viral RNA into the mutated viruses, with the BH-D2 virus being the most severely affected. Consistently, all three deletions resulted in impaired viral infectiousness and the BH-D2 mutation showed the most dramatic impact in this regard. Further analysis revealed additional defects in Gag precursor processing and in the extension efficiency of the tRNA3Lys primer in reverse transcription reactions performed with these mutated viruses. To shed further light on the function of these deleted sequences in viral replication, the mutated viruses were cultured in MT-2 cells over prolonged periods to enable them to reacquire wild-type replication kinetics. Sequencing of the reverted viruses revealed point mutations in both the noncoding region and the gag gene. In the case of the BH-D0 revertant, two mutations were observed at positions G112A in the U5 region, termed M1, and T24I in the nucleocapsid protein, termed MNC, respectively. Either of these two mutations was able to confer wild-type replication capacity on BH-D0. In the case of BH-D1, each of the M1 mutations, a mutation termed M2, i.e., C227T, just downstream of the primer binding site, a mutation termed MP2 (T12I) in the p2 protein, and the MNC mutation were observed. A combination of either M1 and M2 or MP2 and MNC was able to rescue BH-D1. In the case of the BH-D2 deletion-containing viruses, three point mutations, i.e., M1, MP2, and MNC, were observed and the presence of all three was required to restore viral replication to wild-type levels. PMID:10864634

Four novel RS1 gene mutations in Polish patients with X-linked juvenile retinoschisis.

PubMed

Skorczyk, Anna; Krawczyński, Maciej R

2012-01-01

To determine the clinical features and to identify mutations in the retinoschisis gene (RS1) in ten patients with X-linked retinoschisis (XLRS). Ten male patients from nine Polish families were included in this study. Ophthalmologic examinations, including optical coherence tomography (OCT) and full-field electroretinography (ERG), were performed in all affected boys. The entire coding region encompassing six exons of the RS1 gene was amplified with PCR and directly sequenced in all the patients. All affected individuals showed typical retinoschisis signs and symptoms, and all appeared to have a mutation in the RS1 gene. Seven different mutations were identified, including two novel missense substitutions: c.176G>C (p.Cys59Ser), c.451T>A (p.Tyr151Asp); one novel nonsense substitution: c.218C>A (p.Ser73*); and one novel frameshift mutation: c.354_355delCA (p.Asp118Glufs*2). We also found two missense substitutions that had been previously described: c.214G>A (p.Glu72Lys) and c.626G>T (p.Arg209Leu) and one known splice site mutation in intron 5: c.522+1G>T (IVS5+1G>T). This study provides the first molecular genetic characteristics of patients with juvenile retinoschisis from the previously unexplored Polish population. We investigated the molecular background of XLRS in ten boys. The present study reports for the first time four novel mutations, including two missense substitutions, one nonsense substitution, and one frameshift deletion. One of these substitutions and 2-bp deletion created stop codons. Moreover, we described three substitutions that had been previously reported (one is a splicing mutation). Further genetic characterization of Polish patients with XLRS will be helpful in understanding the worldwide spectrum of RS1 mutations. Despite the mutation heterogeneity found in a small group of our patients, they presented a relatively uniform clinical picture. Identifying the causative mutation is helpful in confirming diagnosis and counseling, but cannot provide prognostic data.

Distinct clinical outcomes of two CIMP-positive colorectal cancer subtypes based on a revised CIMP classification system.

PubMed

Bae, Jeong Mo; Kim, Jung Ho; Kwak, Yoonjin; Lee, Dae-Won; Cha, Yongjun; Wen, Xianyu; Lee, Tae Hun; Cho, Nam-Yun; Jeong, Seung-Yong; Park, Kyu Joo; Han, Sae Won; Lee, Hye Seung; Kim, Tae-You; Kang, Gyeong Hoon

2017-04-11

Colorectal cancer (CRC) is a heterogeneous disease in terms of molecular carcinogenic pathways. Based on recent findings regarding the multiple serrated neoplasia pathway, we revised an eight-marker panel for a new CIMP classification system. 1370 patients who received surgical resection for CRCs were classified into three CIMP subtypes (CIMP-N: 0-4 methylated markers, CIMP-P1: 5-6 methylated markers and CIMP-P2: 7-8 methylated markers). Our findings were validated in a separate set of high-risk stage II or stage III CRCs receiving adjuvant fluoropyrimidine plus oxaliplatin (n=950). A total of 1287/62/21 CRCs cases were classified as CIMP-N/CIMP-P1/CIMP-P2, respectively. CIMP-N showed male predominance, distal location, lower T, N category and devoid of BRAF mutation, microsatellite instability (MSI) and MLH1 methylation. CIMP-P1 showed female predominance, proximal location, advanced TNM stage, mild decrease of CK20 and CDX2 expression, mild increase of CK7 expression, BRAF mutation, MSI and MLH1 methylation. CIMP-P2 showed older age, female predominance, proximal location, advanced T category, markedly reduced CK20 and CDX2 expression, rare KRAS mutation, high frequency of CK7 expression, BRAF mutation, MSI and MLH1 methylation. CIMP-N showed better 5-year cancer-specific survival (CSS; HR=0.47; 95% CI: 0.28-0.78) in discovery set and better 5-year relapse-free survival (RFS; HR=0.50; 95% CI: 0.29-0.88) in validation set compared with CIMP-P1. CIMP-P2 showed marginally better 5-year CSS (HR=0.28, 95% CI: 0.07-1.22) in discovery set and marginally better 5-year RFS (HR=0.21, 95% CI: 0.05-0.92) in validation set compared with CIMP-P1. CIMP subtypes classified using our revised system showed different clinical outcomes, demonstrating the heterogeneity of multiple serrated precursors of CIMP-positive CRCs.

Enhancing the Predictive Power of Mutations in the C-Terminus of the KCNQ1-Encoded Kv7.1 Voltage-Gated Potassium Channel.

PubMed

Kapplinger, Jamie D; Tseng, Andrew S; Salisbury, Benjamin A; Tester, David J; Callis, Thomas E; Alders, Marielle; Wilde, Arthur A M; Ackerman, Michael J

2015-04-01

Despite the overrepresentation of Kv7.1 mutations among patients with a robust diagnosis of long QT syndrome (LQTS), a background rate of innocuous Kv7.1 missense variants observed in healthy controls creates ambiguity in the interpretation of LQTS genetic test results. A recent study showed that the probability of pathogenicity for rare missense mutations depends in part on the topological location of the variant in Kv7.1's various structure-function domains. Since the Kv7.1's C-terminus accounts for nearly 50 % of the overall protein and nearly 50 % of the overall background rate of rare variants falls within the C-terminus, further enhancement in mutation calling may provide guidance in distinguishing pathogenic long QT syndrome type 1 (LQT1)-causing mutations from rare non-disease-causing variants in the Kv7.1's C-terminus. Therefore, we have used conservation analysis and a large case-control study to generate topology-based estimative predictive values to aid in interpretation, identifying three regions of high conservation within the Kv7.1's C-terminus which have a high probability of LQT1 pathogenicity.

Missense variants in plakophilin-2 in arrhythmogenic right ventricular cardiomyopathy patients--disease-causing or innocent bystanders?

PubMed

Christensen, Alex Hørby; Benn, Marianne; Tybjaerg-Hansen, Anne; Haunso, Stig; Svendsen, Jesper Hastrup

2010-01-01

Mutations in genes encoding desmosomal proteins have been linked to arrhythmogenic right ventricular cardiomyopathy/dysplasia (ARVC/D). We hypothesized that a Scandinavian ARVC/D population would have a different spectrum of plakophilin-2 (PKP2) mutations and that some of the reported missense mutations may not be pathogenic. We screened 53 unrelated patients fulfilling Task Force criteria for ARVC/D for mutations in PKP2 by direct sequencing. Seven different mutations were identified: two insertion/deletions (E329fsX352, P401fsX406), 1 splice site (2146-2A>T), 1 non-sense (R79X) and 4 missense mutations (Q62K in 2 patients, G489R, G673V) of undeterminable pathogeneity. None of these mutations was present in 650 controls. Five of the mutations were novel. Seven patients carried reported missense mutations (D26N, S140F, V587I); however, these mutations were identified in our healthy controls, although at a lower frequency. Evaluation of all reported missense mutations in PKP2 showed unclear pathogeneity of several reported mutations. Fifteen percent of Danish ARVC/D patients carried PKP2 mutations. Our finding of reported disease-causing mutations at a low frequency among healthy controls suggests that these variants are disease modifying but not directly disease causing. We recommend conservative interpretation of missense variants in PKP2, functional characterization and large-scale sequencing to clarify normal variation in the gene.

A Novel ENU-Mutation in Ankyrin-1 Disrupts Malaria Parasite Maturation in Red Blood Cells of Mice

PubMed Central

Greth, Andreas; Lampkin, Shelley; Mayura-Guru, Preethi; Rodda, Fleur; Drysdale, Karen; Roberts-Thomson, Meredith; McMorran, Brendan J.; Foote, Simon J.; Burgio, Gaétan

2012-01-01

The blood stage of the plasmodium parasite life cycle is responsible for the clinical symptoms of malaria. Epidemiological studies have identified coincidental malarial endemicity and multiple red blood cell (RBC) disorders. Many RBC disorders result from mutations in genes encoding cytoskeletal proteins and these are associated with increased protection against malarial infections. However the mechanisms underpinning these genetic, host responses remain obscure. We have performed an N-ethyl-N-nitrosourea (ENU) mutagenesis screen and have identified a novel dominant (haploinsufficient) mutation in the Ank-1 gene (Ank1MRI23420) of mice displaying hereditary spherocytosis (HS). Female mice, heterozygous for the Ank-1 mutation showed increased survival to infection by Plasmodium chabaudi adami DS with a concomitant 30% decrease in parasitemia compared to wild-type, isogenic mice (wt). A comparative in vivo red cell invasion and parasite growth assay showed a RBC-autonomous effect characterised by decreased proportion of infected heterozygous RBCs. Within approximately 6–8 hours post-invasion, TUNEL staining of intraerythrocytic parasites, showed a significant increase in dead parasites in heterozygotes. This was especially notable at the ring and trophozoite stages in the blood of infected heterozygous mutant mice compared to wt (p<0.05). We conclude that increased malaria resistance due to ankyrin-1 deficiency is caused by the intraerythrocytic death of P. chabaudi parasites. PMID:22723917

Characterization of Aryl Hydrocarbon Receptor Interacting Protein (AIP) Mutations in Familial Isolated Pituitary Adenoma Families

PubMed Central

Igreja, Susana; Chahal, Harvinder S; King, Peter; Bolger, Graeme B; Srirangalingam, Umasuthan; Guasti, Leonardo; Chapple, J Paul; Trivellin, Giampaolo; Gueorguiev, Maria; Guegan, Katie; Stals, Karen; Khoo, Bernard; Kumar, Ajith V; Ellard, Sian; Grossman, Ashley B; Korbonits, Márta

2010-01-01

Familial isolated pituitary adenoma (FIPA) is an autosomal dominant condition with variable genetic background and incomplete penetrance. Germline mutations of the aryl hydrocarbon receptor interacting protein (AIP) gene have been reported in 15–40% of FIPA patients. Limited data are available on the functional consequences of the mutations or regarding the regulation of the AIP gene. We describe a large cohort of FIPA families and characterize missense and silent mutations using minigene constructs, luciferase and β-galactosidase assays, as well as in silico predictions. Patients with AIP mutations had a lower mean age at diagnosis (23.6±11.2 years) than AIP mutation-negative patients (40.4±14.5 years). A promoter mutation showed reduced in vitro activity corresponding to lower mRNA expression in patient samples. Stimulation of the protein kinase A-pathway positively regulates the AIP promoter. Silent mutations led to abnormal splicing resulting in truncated protein or reduced AIP expression. A two-hybrid assay of protein–protein interaction of all missense variants showed variable disruption of AIP-phosphodiesterase-4A5 binding. In summary, exonic, promoter, splice-site, and large deletion mutations in AIP are implicated in 31% of families in our FIPA cohort. Functional characterization of AIP changes is important to identify the functional impact of gene sequence variants. Hum Mutat 31:1–11, 2010. © 2010 Wiley-Liss, Inc. PMID:20506337