Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.
Streiff, John H; Jones, Keith A
2008-10-01
The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.
Cutsforth, G A; Koppaka, V; Krishnaswamy, S; Wu, J R; Mann, K G; Lentz, B R
1996-01-01
The mechanism of binding of blood coagulation cofactor factor Va to acidic-lipid-containing membranes has been addressed. Binding isotherms were generated at room temperature using the change in fluorescence anisotropy of pyrene-labeled bovine factor Va to detect binding to sonicated membrane vesicles containing either bovine brain phosphatidylserine (PS) or 1,2-dioleoyl-3-sn-phosphatidylglycerol (DOPG) in combination with 1-palmitoyl-2-oleoyl-3-sn-phosphatidylcholine (POPC). The composition of the membranes was varied from 0 to 40 mol% for PS/POPC and from 0 to 65 mol % for DOPG/POPC membranes. Fitting the data to a classical Langmuir adsorption model yielded estimates of the dissociation constant (Kd) and the stoichiometry of binding. The values of Kd defined in this way displayed a maximum at low acidic lipid content but were nearly constant at intermediate to high fractions of acidic lipid. Fitting the binding isotherms to a two-process binding model (nonspecific adsorption in addition to binding of acidic lipids to sites on the protein) suggested a significant acidic-lipid-independent binding affinity in addition to occupancy of three protein sites that bind PS in preference to DOPG. Both analyses indicated that interaction of factor Va with an acidic-lipid-containing membrane is much more complex than those of factor Xa or prothrombin. Furthermore, a change in the conformation of bound pyrene-labeled factor Va with surface concentration of acidic lipid was implied by variation of both the saturating fluorescence anisotropy and the binding parameters with the acidic lipid content of the membrane. Finally, the results cannot support the contention that binding occurs through nonspecific adsorption to a patch or domain of acidic lipids in the membrane. Factor Va is suggested to associate with membranes by a complex process that includes both acidic-lipid-specific and acidic-lipid-independent sites and a protein structure change induced by occupancy of acidic-lipid-specific sites on the factor Va molecule. Images FIGURE 5 PMID:8744332
Shiroguchi, Katsuyuki; Chin, Harvey F; Hannemann, Diane E; Muneyuki, Eiro; De La Cruz, Enrique M; Kinosita, Kazuhiko
2011-04-01
Myosins are ATP-driven linear molecular motors that work as cellular force generators, transporters, and force sensors. These functions are driven by large-scale nucleotide-dependent conformational changes, termed "strokes"; the "power stroke" is the force-generating swinging of the myosin light chain-binding "neck" domain relative to the motor domain "head" while bound to actin; the "recovery stroke" is the necessary initial motion that primes, or "cocks," myosin while detached from actin. Myosin Va is a processive dimer that steps unidirectionally along actin following a "hand over hand" mechanism in which the trailing head detaches and steps forward ∼72 nm. Despite large rotational Brownian motion of the detached head about a free joint adjoining the two necks, unidirectional stepping is achieved, in part by the power stroke of the attached head that moves the joint forward. However, the power stroke alone cannot fully account for preferential forward site binding since the orientation and angle stability of the detached head, which is determined by the properties of the recovery stroke, dictate actin binding site accessibility. Here, we directly observe the recovery stroke dynamics and fluctuations of myosin Va using a novel, transient caged ATP-controlling system that maintains constant ATP levels through stepwise UV-pulse sequences of varying intensity. We immobilized the neck of monomeric myosin Va on a surface and observed real time motions of bead(s) attached site-specifically to the head. ATP induces a transient swing of the neck to the post-recovery stroke conformation, where it remains for ∼40 s, until ATP hydrolysis products are released. Angle distributions indicate that the post-recovery stroke conformation is stabilized by ≥ 5 k(B)T of energy. The high kinetic and energetic stability of the post-recovery stroke conformation favors preferential binding of the detached head to a forward site 72 nm away. Thus, the recovery stroke contributes to unidirectional stepping of myosin Va.
Regulation of IL-8 promoter activity by verrucarin A in human monocytic THP-1 cells.
Liu, Jun; Simmons, Steve O; Pei, Ruoting
2014-01-01
Macrocyclic trichothecenes have been frequently detected in fungi in water-damaged buildings and exhibited higher toxicity than the well-studied trichothecenes; however, the mechanism underlying their toxicity has been poorly understood. In this study, transcriptional regulation of the cytokine interleukin (IL)-8 by a macrocyclic trichothecene, verrucarin A (VA), in human monocytic THP-1 cells is reported. Consistent with previous findings, VA was 100-fold more cytotoxic than deoxynivalenol (DON), while ochratoxin A (OA) was not cytotoxic. In cells transduced with the wild-type IL-8 promoter luciferase construct, VA induced a biphasic dose response composed of an upregulation of luciferase expression at low concentrations of 0.01-1 ng/ml and a downregulation at high levels of 10 ng/ml and higher. In contrast, DON induced a sigmoid-shaped dose response with the EC50 of 11.6 ng/ml, while OA did not markedly affect the IL-8 expression. When cells were transduced with IL-8 promoter with a mutation of transcription factor nuclear factor-κB (NF-κB)-binding site, VA (1 ng/ml), DON (1000 ng/ml), and tumor necrosis factor (TNF) α (20 ng/ml)-induced luciferase expression were impaired. In addition, the NF-κB inhibitor caffeic acid phenethyl ester inhibited VA-, DON-, and TNFα-induced luciferase expression. Mutation of the CCAAT/enhancer-binding protein (CEBP) β binding site of the IL-8 promoter affected only DON-, but not VA- and TNFα-induced luciferase expression. Taken together, these results suggested that VA activated IL-8 promoter via an NF-κB-dependent, but not CEBPβ-dependent, pathway in human monocytes.
A chemokine-binding domain in the tumor necrosis factor receptor from variola (smallpox) virus
Alejo, Alí; Ruiz-Argüello, M. Begoña; Ho, Yin; Smith, Vincent P.; Saraiva, Margarida; Alcami, Antonio
2006-01-01
Variola virus (VaV) is the causative agent of smallpox, one of the most devastating diseases encountered by man, that was eradicated in 1980. The deliberate release of VaV would have catastrophic consequences on global public health. However, the mechanisms that contribute to smallpox pathogenesis are poorly understood at the molecular level. The ability of viruses to evade the host defense mechanisms is an important determinant of viral pathogenesis. Here we show that the tumor necrosis factor receptor (TNFR) homologue CrmB encoded by VaV functions not only as a soluble decoy TNFR but also as a highly specific binding protein for several chemokines that mediate recruitment of immune cells to mucosal surfaces and the skin, sites of virus entry and viral replication at late stages of smallpox. CrmB binds chemokines through its C-terminal domain, which is unrelated to TNFRs, was named smallpox virus-encoded chemokine receptor (SECRET) domain and uncovers a family of poxvirus chemokine inhibitors. An active SECRET domain was found in another viral TNFR (CrmD) and three secreted proteins encoded by orthopoxviruses. These findings identify a previously undescribed chemokine-binding and inhibitory domain unrelated to host chemokine receptors and a mechanism of immune modulation in VaV that may influence smallpox pathogenesis. PMID:16581912
A chemokine-binding domain in the tumor necrosis factor receptor from variola (smallpox) virus.
Alejo, Alí; Ruiz-Argüello, M Begoña; Ho, Yin; Smith, Vincent P; Saraiva, Margarida; Alcami, Antonio
2006-04-11
Variola virus (VaV) is the causative agent of smallpox, one of the most devastating diseases encountered by man, that was eradicated in 1980. The deliberate release of VaV would have catastrophic consequences on global public health. However, the mechanisms that contribute to smallpox pathogenesis are poorly understood at the molecular level. The ability of viruses to evade the host defense mechanisms is an important determinant of viral pathogenesis. Here we show that the tumor necrosis factor receptor (TNFR) homologue CrmB encoded by VaV functions not only as a soluble decoy TNFR but also as a highly specific binding protein for several chemokines that mediate recruitment of immune cells to mucosal surfaces and the skin, sites of virus entry and viral replication at late stages of smallpox. CrmB binds chemokines through its C-terminal domain, which is unrelated to TNFRs, was named smallpox virus-encoded chemokine receptor (SECRET) domain and uncovers a family of poxvirus chemokine inhibitors. An active SECRET domain was found in another viral TNFR (CrmD) and three secreted proteins encoded by orthopoxviruses. These findings identify a previously undescribed chemokine-binding and inhibitory domain unrelated to host chemokine receptors and a mechanism of immune modulation in VaV that may influence smallpox pathogenesis.
Myosin Va Bound to Phagosomes Binds to F-Actin and Delays Microtubule-dependent Motility
Al-Haddad, Ahmed; Shonn, Marion A.; Redlich, Bärbel; Blocker, Ariel; Burkhardt, Janis K.; Yu, Hanry; Hammer, John A.; Weiss, Dieter G.; Steffen, Walter; Griffiths, Gareth; Kuznetsov, Sergei A.
2001-01-01
We established a light microscopy-based assay that reconstitutes the binding of phagosomes purified from mouse macrophages to preassembled F-actin in vitro. Both endogenous myosin Va from mouse macrophages and exogenous myosin Va from chicken brain stimulated the phagosome–F-actin interaction. Myosin Va association with phagosomes correlated with their ability to bind F-actin in an ATP-regulated manner and antibodies to myosin Va specifically blocked the ATP-sensitive phagosome binding to F-actin. The uptake and retrograde transport of phagosomes from the periphery to the center of cells in bone marrow macrophages was observed in both normal mice and mice homozygous for the dilute-lethal spontaneous mutation (myosin Va null). However, in dilute-lethal macrophages the accumulation of phagosomes in the perinuclear region occurred twofold faster than in normal macrophages. Motion analysis revealed saltatory phagosome movement with temporarily reversed direction in normal macrophages, whereas almost no reversals in direction were observed in dilute-lethal macrophages. These observations demonstrate that myosin Va mediates phagosome binding to F-actin, resulting in a delay in microtubule-dependent retrograde phagosome movement toward the cell center. We propose an “antagonistic/cooperative mechanism” to explain the saltatory phagosome movement toward the cell center in normal macrophages. PMID:11553713
Discovery of Novel Nonactive Site Inhibitors of the Prothrombinase Enzyme Complex.
Kapoor, Karan; McGill, Nicole; Peterson, Cynthia B; Meyers, Harold V; Blackburn, Michael N; Baudry, Jerome
2016-03-28
The risk of serious bleeding is a major liability of anticoagulant drugs that are active-site competitive inhibitors targeting the Factor Xa (FXa) prothrombin (PT) binding site. The present work identifies several new classes of small molecule anticoagulants that can act as nonactive site inhibitors of the prothrombinase (PTase) complex composed of FXa and Factor Va (FVa). These new classes of anticoagulants were identified, using a novel agnostic computational approach to identify previously unrecognized binding pockets at the FXa-FVa interface. From about three million docking calculations of 281,128 compounds in a conformational ensemble of FXa heavy chains identified by molecular dynamics (MD) simulations, 97 compounds and their structural analogues were selected for experimental validation, through a series of inhibition assays. The compound selection was based on their predicted binding affinities to FXa and their ability to successfully bind to multiple protein conformations while showing selectivity for particular binding sites at the FXa/FVa interface. From these, thirty-one (31) compounds were experimentally identified as nonactive site inhibitors. Concentration-based assays further identified 10 compounds represented by four small-molecule families of inhibitors that achieve dose-independent partial inhibition of PTase activity in a nonactive site-dependent and self-limiting mechanism. Several compounds were identified for their ability to bind to protein conformations only seen during MD, highlighting the importance of accounting for protein flexibility in structure-based drug discovery approaches.
Identification and characterization of the sodium-binding site of activated protein C.
He, X; Rezaie, A R
1999-02-19
Activated protein C (APC) requires both Ca2+ and Na+ for its optimal catalytic function. In contrast to the Ca2+-binding sites, the Na+-binding site(s) of APC has not been identified. Based on a recent study with thrombin, the 221-225 loop is predicted to be a potential Na+-binding site in APC. The sequence of this loop is not conserved in trypsin. We engineered a Gla domainless form of protein C (GDPC) in which the 221-225 loop was replaced with the corresponding loop of trypsin. We found that activated GDPC (aGDPC) required Na+ (or other alkali cations) for its amidolytic activity with dissociation constant (Kd(app)) = 44.1 +/- 8.6 mM. In the presence of Ca2+, however, the requirement for Na+ by aGDPC was eliminated, and Na+ stimulated the cleavage rate 5-6-fold with Kd(app) = 2.3 +/- 0.3 mM. Both cations were required for efficient factor Va inactivation by aGDPC. In the presence of Ca2+, the catalytic function of the mutant was independent of Na+. Unlike aGDPC, the mutant did not discriminate among monovalent cations. We conclude that the 221-225 loop is a Na+-binding site in APC and that an allosteric link between the Na+ and Ca2+ binding loops modulates the structure and function of this anticoagulant enzyme.
Cecere, Roberto; Gross, Joachim; Willis, Ashleigh; Thut, Gregor
2017-05-24
In multisensory integration, processing in one sensory modality is enhanced by complementary information from other modalities. Intersensory timing is crucial in this process because only inputs reaching the brain within a restricted temporal window are perceptually bound. Previous research in the audiovisual field has investigated various features of the temporal binding window, revealing asymmetries in its size and plasticity depending on the leading input: auditory-visual (AV) or visual-auditory (VA). Here, we tested whether separate neuronal mechanisms underlie this AV-VA dichotomy in humans. We recorded high-density EEG while participants performed an audiovisual simultaneity judgment task including various AV-VA asynchronies and unisensory control conditions (visual-only, auditory-only) and tested whether AV and VA processing generate different patterns of brain activity. After isolating the multisensory components of AV-VA event-related potentials (ERPs) from the sum of their unisensory constituents, we ran a time-resolved topographical representational similarity analysis (tRSA) comparing the AV and VA ERP maps. Spatial cross-correlation matrices were built from real data to index the similarity between the AV and VA maps at each time point (500 ms window after stimulus) and then correlated with two alternative similarity model matrices: AV maps = VA maps versus AV maps ≠ VA maps The tRSA results favored the AV maps ≠ VA maps model across all time points, suggesting that audiovisual temporal binding (indexed by synchrony perception) engages different neural pathways depending on the leading sense. The existence of such dual route supports recent theoretical accounts proposing that multiple binding mechanisms are implemented in the brain to accommodate different information parsing strategies in auditory and visual sensory systems. SIGNIFICANCE STATEMENT Intersensory timing is a crucial aspect of multisensory integration, determining whether and how inputs in one modality enhance stimulus processing in another modality. Our research demonstrates that evaluating synchrony of auditory-leading (AV) versus visual-leading (VA) audiovisual stimulus pairs is characterized by two distinct patterns of brain activity. This suggests that audiovisual integration is not a unitary process and that different binding mechanisms are recruited in the brain based on the leading sense. These mechanisms may be relevant for supporting different classes of multisensory operations, for example, auditory enhancement of visual attention (AV) and visual enhancement of auditory speech (VA). Copyright © 2017 Cecere et al.
Affinity, Avidity, and Kinetics of Target Sequence Binding to LC8 Dynein Light Chain Isoforms*
Radnai, László; Rapali, Péter; Hódi, Zsuzsa; Süveges, Dániel; Molnár, Tamás; Kiss, Bence; Bécsi, Bálint; Erdödi, Ferenc; Buday, László; Kardos, József; Kovács, Mihály; Nyitray, László
2010-01-01
LC8 dynein light chain (DYNLL) is a highly conserved eukaryotic hub protein with dozens of binding partners and various functions beyond being a subunit of dynein and myosin Va motor proteins. Here, we compared the kinetic and thermodynamic parameters of binding of both mammalian isoforms, DYNLL1 and DYNLL2, to two putative consensus binding motifs (KXTQTX and XG(I/V)QVD) and report only subtle differences. Peptides containing either of the above motifs bind to DYNLL2 with micromolar affinity, whereas a myosin Va peptide (lacking the conserved Gln) and the noncanonical Pak1 peptide bind with Kd values of 9 and 40 μm, respectively. Binding of the KXTQTX motif is enthalpy-driven, although that of all other peptides is both enthalpy- and entropy-driven. Moreover, the KXTQTX motif shows strikingly slower off-rate constant than the other motifs. As most DYNLL partners are homodimeric, we also assessed the binding of bivalent ligands to DYNLL2. Compared with monovalent ligands, a significant avidity effect was found as follows: Kd values of 37 and 3.5 nm for a dimeric myosin Va fragment and a Leu zipper dimerized KXTQTX motif, respectively. Ligand binding kinetics of DYNLL can best be described by a conformational selection model consisting of a slow isomerization and a rapid binding step. We also studied the binding of the phosphomimetic S88E mutant of DYNLL2 to the dimeric myosin Va fragment, and we found a significantly lower apparent Kd value (3 μm). We conclude that the thermodynamic and kinetic fine-tuning of binding of various ligands to DYNLL could have physiological relevance in its interaction network. PMID:20889982
Kuroda, Taruho S; Fukuda, Mitsunori
2005-01-01
Slac2-c/MyRIP is a specific Rab27A-binding protein that contains an N-terminal synaptotagmin-like protein (Slp) homology domain (SHD, a newly identified GTP-Rab27A-binding motif), but in contrast to the Slp family proteins, it lacks C-terminal tandem C2 domains. In vitro Slac2-c simultaneously directly interacts with both Rab27A and an actin-based motor protein, myosin Va, via its N-terminal SHD and middle region, respectively, consistent with the fact that the overall structure of Slac2-c is similar to that of Slac2-a/melanophilin, a linker protein between Rab27A and myosin Va in the melanosome transport in melanocytes. Unlike Slac2-a, however, the middle region of Slac2-c interacts with two types of myosins, myosin Va and myosin VIIa. In addition, the most C-terminal part of both Slac2-a and Slac2-c functions as an actin-binding domain: it directly interacts with globular and fibrous actin in vitro, and the actin-binding domain of Slac2-a and Slac2-c colocalizes with actin filaments when it is expressed in living cells (i.e., PC12 cells and mouse melanocytes). In this chapter we describe the methods that have been used to analyze the protein-protein interactions of Slac2-c, specifically with Rab27A, myosin Va/VIIa, and actin.
2017-01-01
In multisensory integration, processing in one sensory modality is enhanced by complementary information from other modalities. Intersensory timing is crucial in this process because only inputs reaching the brain within a restricted temporal window are perceptually bound. Previous research in the audiovisual field has investigated various features of the temporal binding window, revealing asymmetries in its size and plasticity depending on the leading input: auditory–visual (AV) or visual–auditory (VA). Here, we tested whether separate neuronal mechanisms underlie this AV–VA dichotomy in humans. We recorded high-density EEG while participants performed an audiovisual simultaneity judgment task including various AV–VA asynchronies and unisensory control conditions (visual-only, auditory-only) and tested whether AV and VA processing generate different patterns of brain activity. After isolating the multisensory components of AV–VA event-related potentials (ERPs) from the sum of their unisensory constituents, we ran a time-resolved topographical representational similarity analysis (tRSA) comparing the AV and VA ERP maps. Spatial cross-correlation matrices were built from real data to index the similarity between the AV and VA maps at each time point (500 ms window after stimulus) and then correlated with two alternative similarity model matrices: AVmaps = VAmaps versus AVmaps ≠ VAmaps. The tRSA results favored the AVmaps ≠ VAmaps model across all time points, suggesting that audiovisual temporal binding (indexed by synchrony perception) engages different neural pathways depending on the leading sense. The existence of such dual route supports recent theoretical accounts proposing that multiple binding mechanisms are implemented in the brain to accommodate different information parsing strategies in auditory and visual sensory systems. SIGNIFICANCE STATEMENT Intersensory timing is a crucial aspect of multisensory integration, determining whether and how inputs in one modality enhance stimulus processing in another modality. Our research demonstrates that evaluating synchrony of auditory-leading (AV) versus visual-leading (VA) audiovisual stimulus pairs is characterized by two distinct patterns of brain activity. This suggests that audiovisual integration is not a unitary process and that different binding mechanisms are recruited in the brain based on the leading sense. These mechanisms may be relevant for supporting different classes of multisensory operations, for example, auditory enhancement of visual attention (AV) and visual enhancement of auditory speech (VA). PMID:28450537
Physicochemical characterization of native and modified sodium caseinate- Vitamin A complexes.
Gupta, Chitra; Arora, Sumit; Syama, M A; Sharma, Apurva
2018-04-01
Native and modified sodium caseinate- Vitamin A complexes {Sodium caseinate- Vit A complex by stirring (NaCas-VA ST), succinylated sodium caseinate- Vit A complex by stirring (SNaCas-VA ST), reassembled sodium caseinate- Vit A complex (RNaCas-VA) and reassembled succinylated sodium caseinate- Vit A complex (RSNaCas-VA)} were prepared and characterized for their physicochemical characteristics e.g. particle size, zeta potential, turbidity analysis and tryptophan intensities which confirmed structural modification of both native (NaCas-VA ST) and modified (SNaCas-VA ST, RNaCas-VA and RSNaCas- VA) proteins upon complex formation with vitamin A. Binding of vitamin A to milk protein reduced the turbidity caused by vitamin A, however, the particle size and zeta potential of milk protein increased after complexation. Microstructure details of NaCas (spray dried) showed uniform spherical structure, however, other milk proteins and milk protein- Vit A complexes (freeze dried) showed broken glass and flaky structures. Tiny particles were observed on the surface of reassembled protein and reassembled protein- Vit A complexes. Binding of vitamin A to milk protein did not have an influence on the electrophoretic mobility and elution profile (RP-HPLC). Copyright © 2018 Elsevier Ltd. All rights reserved.
Valenstein, Paul N; Wang, Edward; O'Donohue, Tom
2003-12-01
The Veterans Health Administration (VA) operates the largest integrated laboratory network in the United States. To assess whether the unique characteristics of VA laboratories impact efficiency of operations, we compared the productivity of VA and non-VA facilities. Financial and activity data were prospectively collected from 124 VA and 131 non-VA laboratories enrolled in the College of American Pathologists Laboratory Management Index Program (LMIP) during 2002. In addition, secular trends in 5 productivity ratios were calculated for VA and non-VA laboratories enrolled in LMIP from 1997 through 2002. Veterans Health Administration and non-VA facilities did not differ significantly in size. Inpatients accounted for a lower percentage of testing at VA facilities than non-VA facilities (21.7% vs 37.3%; P <.001). Technical staff at the median VA facility were paid more than at non-VA facilities (28.11/h dollars vs 22.60/h dollars, salaries plus benefits; P <.001), VA laboratories employed a smaller percentage of nontechnical staff (30.0% vs 41.9%; P <.001), and workers at VA laboratories worked less time per hour paid (85.5% vs 88.5%; P <.001). However, labor productivity was significantly higher at VA than at non-VA facilities (30 448 test results/total full-time equivalent (FTE)/y vs 19 260 results/total FTE; P <.001), resulting in lower labor expense per on-site test at VA sites than at non-VA sites (1.79 dollars/result vs 2.08 dollars/result; P <.001). Veterans Health Administration laboratories paid less per test for consumables (P =.003), depreciation, and maintenance than their non-VA counterparts (all P <.001), resulting in lower overall cost per on-site test result (2.64 dollars vs 3.40 dollars; P <.001). Cost per referred (sent-out) test did not differ significantly between the 2 groups. Analysis of 6-year trends showed significant increases in both VA (P <.001) and non-VA (P =.02) labor productivity (on-site tests/total FTE). Expenses at VA laboratories for labor per test, consumables per test, overall expense per test, and overall laboratory expense per discharge decreased significantly during the 6-year period (P <.001), while in non-VA facilities the corresponding ratios showed no significant change. Overall productivity of VA laboratories is superior to that of non-VA facilities enrolled in LMIP. The principal advantages enjoyed by the VA are higher-than-average labor productivity (tests/FTE) and lower-than-average consumable expenses.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-05-11
... DEPARTMENT OF VETERANS AFFAIRS [OMB Control No. 2900-New (VA Form 10-0511)] Agency Information.... 2900-New (VA Form 10-0511).'' SUPPLEMENTARY INFORMATION: Titles: a. Cooperative Studies Program (CSP) Site Survey, VA Form 10-0511. b. Cooperative Studies Program (CSP) Meeting Evaluation, VA Form 10...
Comparing homeless persons' care experiences in tailored versus nontailored primary care programs.
Kertesz, Stefan G; Holt, Cheryl L; Steward, Jocelyn L; Jones, Richard N; Roth, David L; Stringfellow, Erin; Gordon, Adam J; Kim, Theresa W; Austin, Erika L; Henry, Stephen Randal; Kay Johnson, N; Shanette Granstaff, U; O'Connell, James J; Golden, Joya F; Young, Alexander S; Davis, Lori L; Pollio, David E
2013-12-01
We compared homeless patients' experiences of care in health care organizations that differed in their degree of primary care design service tailoring. We surveyed homeless-experienced patients (either recently or currently homeless) at 3 Veterans Affairs (VA) mainstream primary care settings in Pennsylvania and Alabama, a homeless-tailored VA clinic in California, and a highly tailored non-VA Health Care for the Homeless Program in Massachusetts (January 2011-March 2012). We developed a survey, the "Primary Care Quality-Homeless Survey," to reflect the concerns and aspirations of homeless patients. Mean scores at the tailored non-VA site were superior to those from the 3 mainstream VA sites (P < .001). Adjusting for patient characteristics, these differences remained significant for subscales assessing the patient-clinician relationship (P < .001) and perceptions of cooperation among providers (P = .004). There were 1.5- to 3-fold increased odds of an unfavorable experience in the domains of the patient-clinician relationship, cooperation, and access or coordination for the mainstream VA sites compared with the tailored non-VA site; the tailored VA site attained intermediate results. Tailored primary care service design was associated with a superior service experience for patients who experienced homelessness.
Verbal autopsy: current practices and challenges.
Soleman, Nadia; Chandramohan, Daniel; Shibuya, Kenji
2006-01-01
Cause-of-death data derived from verbal autopsy (VA) are increasingly used for health planning, priority setting, monitoring and evaluation in countries with incomplete or no vital registration systems. In some regions of the world it is the only method available to obtain estimates on the distribution of causes of death. Currently, the VA method is routinely used at over 35 sites, mainly in Africa and Asia. In this paper, we present an overview of the VA process and the results of a review of VA tools and operating procedures used at demographic surveillance sites and sample vital registration systems. We asked for information from 36 field sites about field-operating procedures and reviewed 18 verbal autopsy questionnaires and 10 cause-of-death lists used in 13 countries. The format and content of VA questionnaires, field-operating procedures, cause-of-death lists and the procedures to derive causes of death from VA process varied substantially among sites. We discuss the consequences of using varied methods and conclude that the VA tools and procedures must be standardized and reliable in order to make accurate national and international comparisons of VA data. We also highlight further steps needed in the development of a standard VA process. PMID:16583084
Medical Student Psychiatry Examination Performance at VA and Non-VA Clerkship Sites
ERIC Educational Resources Information Center
Tucker, Phebe; von Schlageter, Margo Shultes; Park, EunMi; Rosenberg, Emily; Benjamin, Ashley B.; Nawar, Ola
2009-01-01
Objective: The authors examined the effects of medical student assignment to U.S. Department of Veterans Affairs (VA) Medical Center inpatient and outpatient psychiatry clerkship sites versus other university and community sites on the performance outcome measure of National Board of Medical Examiners (NBME) subject examination scores. Methods:…
Comparing Homeless Persons’ Care Experiences in Tailored Versus Nontailored Primary Care Programs
Holt, Cheryl L.; Steward, Jocelyn L.; Jones, Richard N.; Roth, David L.; Stringfellow, Erin; Gordon, Adam J.; Kim, Theresa W.; Austin, Erika L.; Henry, Stephen Randal; Kay Johnson, N.; Shanette Granstaff, U.; O’Connell, James J.; Golden, Joya F.; Young, Alexander S.; Davis, Lori L.; Pollio, David E.
2013-01-01
Objectives. We compared homeless patients’ experiences of care in health care organizations that differed in their degree of primary care design service tailoring. Methods. We surveyed homeless-experienced patients (either recently or currently homeless) at 3 Veterans Affairs (VA) mainstream primary care settings in Pennsylvania and Alabama, a homeless-tailored VA clinic in California, and a highly tailored non-VA Health Care for the Homeless Program in Massachusetts (January 2011-March 2012). We developed a survey, the “Primary Care Quality-Homeless Survey," to reflect the concerns and aspirations of homeless patients. Results. Mean scores at the tailored non-VA site were superior to those from the 3 mainstream VA sites (P < .001). Adjusting for patient characteristics, these differences remained significant for subscales assessing the patient–clinician relationship (P < .001) and perceptions of cooperation among providers (P = .004). There were 1.5- to 3-fold increased odds of an unfavorable experience in the domains of the patient–clinician relationship, cooperation, and access or coordination for the mainstream VA sites compared with the tailored non-VA site; the tailored VA site attained intermediate results. Conclusions. Tailored primary care service design was associated with a superior service experience for patients who experienced homelessness. PMID:24148052
The Dual Regulatory Role of Amino Acids Leu480 and Gln481 of Prothrombin*
Wiencek, Joesph R.; Hirbawi, Jamila; Yee, Vivien C.; Kalafatis, Michael
2016-01-01
Prothrombin (FII) is activated to α-thrombin (IIa) by prothrombinase. Prothrombinase is composed of a catalytic subunit, factor Xa (fXa), and a regulatory subunit, factor Va (fVa), assembled on a membrane surface in the presence of divalent metal ions. We constructed, expressed, and purified several mutated recombinant FII (rFII) molecules within the previously determined fVa-dependent binding site for fXa (amino acid region 473–487 of FII). rFII molecules bearing overlapping deletions within this significant region first established the minimal stretch of amino acids required for the fVa-dependent recognition exosite for fXa in prothrombinase within the amino acid sequence Ser478–Val479–Leu480–Gln481–Val482. Single, double, and triple point mutations within this stretch of rFII allowed for the identification of Leu480 and Gln481 as the two essential amino acids responsible for the enhanced activation of FII by prothrombinase. Unanticipated results demonstrated that although recombinant wild type α-thrombin and rIIaS478A were able to induce clotting and activate factor V and factor VIII with rates similar to the plasma-derived molecule, rIIaSLQ→AAA with mutations S478A/L480A/Q481A was deficient in clotting activity and unable to efficiently activate the pro-cofactors. This molecule was also impaired in protein C activation. Similar results were obtained with rIIaΔSLQ (where rIIaΔSLQ is recombinant human α-thrombin with amino acids Ser478/Leu480/Gln481 deleted). These data provide new evidence demonstrating that amino acid sequence Leu480–Gln481: 1) is crucial for proper recognition of the fVa-dependent site(s) for fXa within prothrombinase on FII, required for efficient initial cleavage of FII at Arg320; and 2) is compulsory for appropriate tethering of fV, fVIII, and protein C required for their timely activation by IIa. PMID:26601957
SNMP is a signaling component required for pheromone sensitivity in Drosophila.
Jin, Xin; Ha, Tal Soo; Smith, Dean P
2008-08-05
The only known volatile pheromone in Drosophila, 11-cis-vaccenyl acetate (cVA), mediates a variety of behaviors including aggregation, mate recognition, and sexual behavior. cVA is detected by a small set of olfactory neurons located in T1 trichoid sensilla on the antennae of males and females. Two components known to be required for cVA reception are the odorant receptor Or67d and the extracellular pheromone-binding protein LUSH. Using a genetic screen for cVA-insensitive mutants, we have identified a third component required for cVA reception: sensory neuron membrane protein (SNMP). SNMP is a homolog of CD36, a scavenger receptor important for lipoprotein binding and uptake of cholesterol and lipids in vertebrates. In humans, loss of CD36 is linked to a wide range of disorders including insulin resistance, dyslipidemia, and atherosclerosis, but how CD36 functions in lipid transport and signal transduction is poorly understood. We show that SNMP is required in pheromone-sensitive neurons for cVA sensitivity but is not required for sensitivity to general odorants. Using antiserum to SNMP infused directly into the sensillum lymph, we show that SNMP function is required on the dendrites of cVA-sensitive neurons; this finding is consistent with a direct role in cVA signal transduction. Therefore, pheromone perception in Drosophila should serve as an excellent model to elucidate the role of CD36 members in transmembrane signaling.
FTIR study of hydrogen bonding interaction between fluorinated alcohol and unsaturated esters
NASA Astrophysics Data System (ADS)
Sheng, Xia; Jiang, Xiaotong; Zhao, Hailiang; Wan, Dongjin; Liu, Yongde; Ngwenya, Cleopatra Ashley; Du, Lin
2018-06-01
The 1:1 complexes of two unsaturated esters with 2,2,2-trifluoroethanol (TFE) were investigated experimentally and computationally. The experimental observations of the spectral shifts of the OH-stretching vibrational transitions were obtained at 113 cm-1 for TFE-methyl acrylate (MA) and 92 cm-1 for TFE-vinyl acetate (VA). There are three docking sites in the two unsaturated esters for the incoming TFE. The predicted red shifts of the OH-stretching vibrational transitions were found to be larger for the Osbnd H⋯Odbnd C hydrogen bonded conformer than those for the Osbnd H⋯π and Osbnd H⋯O ones. The binding energies further prove that the Osbnd H⋯Odbnd C hydrogen bonded conformers are the most stable ones. On the basis of the DFT calculations as well as previous works, the carbonyl group is the best docking site for TFE. Furthermore, the thermodynamic equilibrium constants of TFE-MA and TFE-VA were obtained at 0.28 and 0.15 by combining the experimental spectra data and the DFT calculations. Consequently, the Gibbs free energies of formation were determined to be 3.2 and 4.8 kJ mol-1 for TFE-MA and TFE-VA, respectively. The quantum theory of atoms in molecules (AIM) and generalized Kohn-Sham energy decomposition analysis (GKS-EDA) were carried out for further characterization of the hydrogen bonding interactions. GKS-EDA shows an "electrostatic" dominated hydrogen bonding character for the Osbnd H⋯Odbnd C hydrogen bonds.
Structural Insights into Functional Overlapping and Differentiation among Myosin V Motors*
Nascimento, Andrey F. Z.; Trindade, Daniel M.; Tonoli, Celisa C. C.; de Giuseppe, Priscila O.; Assis, Leandro H. P.; Honorato, Rodrigo V.; de Oliveira, Paulo S. L.; Mahajan, Pravin; Burgess-Brown, Nicola A.; von Delft, Frank; Larson, Roy E.; Murakami, Mario T.
2013-01-01
Myosin V (MyoV) motors have been implicated in the intracellular transport of diverse cargoes including vesicles, organelles, RNA-protein complexes, and regulatory proteins. Here, we have solved the cargo-binding domain (CBD) structures of the three human MyoV paralogs (Va, Vb, and Vc), revealing subtle structural changes that drive functional differentiation and a novel redox mechanism controlling the CBD dimerization process, which is unique for the MyoVc subclass. Moreover, the cargo- and motor-binding sites were structurally assigned, indicating the conservation of residues involved in the recognition of adaptors for peroxisome transport and providing high resolution insights into motor domain inhibition by CBD. These results contribute to understanding the structural requirements for cargo transport, autoinhibition, and regulatory mechanisms in myosin V motors. PMID:24097982
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Hongmin; Astrof, Nathan S.; Liu, Jin-Huan
2009-09-15
Volatile anesthetics (VAs), such as isoflurane, induce a general anesthetic state by binding to specific targets (i.e., ion channels) in the central nervous system (CNS). Simultaneously, VAs modulate immune functions, possibly via direct interaction with alternative targets on leukocytes. One such target, the integrin lymphocyte function-associated antigen-1 (LFA-1), has been shown previously to be inhibited by isoflurane. A better understanding of the mechanism by which isoflurane alters protein function requires the detailed information about the drug-protein interaction at an atomic level. Here, we describe the crystal structure of the LFA-1 ligand-binding domain (I domain) in complex with isoflurane at 1.6more » {angstrom}. We discovered that isoflurane binds to an allosteric cavity previously implicated as critical for the transition of LFA-1 from the low- to the high-affinity state. The isoflurane binding site in the I domain involves an array of amphiphilic interactions, thereby resembling a 'common anesthetic binding motif' previously predicted for authentic VA binding sites. These results suggest that the allosteric modulation of protein function by isoflurane, as demonstrated for the integrin LFA-1, might represent a unified mechanism shared by the interactions of volatile anesthetics with targets in the CNS. Crystal structure of isoflurane bound to integrin LFA-1 supports a unified mechanism of volatile anesthetic action in the immune and central nervous systems.« less
Temperini, Claudia; Scozzafava, Andrea; Vullo, Daniela; Supuran, Claudiu T
2006-05-18
Activation of six human brain carbonic anhydrases (hCAs, EC 4.2.1.1), hCA I, II, IV, VA, VII, and XIV, with l-/d-phenylalanine was investigated kinetically and by X-ray crystallography. l-Phe was a potent activator of isozymes I, II, and XIV (K(A)s of 13-240 nM), a weaker activator of hCA VA and VII (K(A)s of 9.8-10.9 microM), and a quite inefficient hCA IV activator (K(A) of 52 microM). d-Phe showed good hCA II activatory properties (K(A) of 35 nM), being a moderate hCA VA, VII, and XIV (K(A)s of 4.6-9.7 microM) and a weak hCA I and IV activator (K(A)s of 63-86 microM). X-ray crystallography of the hCA II-l-Phe/d-Phe adducts showed the activators to be anchored at the entrance of the active site, participating in numerous bonds and hydrophobic interactions with amino acid residues His64, Thr200, Trp5, and Pro201. This is the first study showing different binding modes of stereoisomeric activators within the hCA II active site, with consequences for overall proton transfer processes (rate-determining for the catalytic cycle). It also points out differences of activation efficiency between various isozymes with structurally related activators, exploitable for designing alternative proton transfer pathways. CA activators may lead to the design of pharmacologically useful derivatives for the enhancement of synaptic efficacy, which may represent a conceptually new approach for the treatment of Alzheimer's disease, aging, and other conditions in which spatial learning and memory therapy must be enhanced. As the blood and brain concentrations of l-Phe are quite variable (30-73 microM), activity of some brain CAs may strongly be influenced by the level of activator(s) present in such tissues.
Exosites in the substrate specificity of blood coagulation reactions.
Bock, P E; Panizzi, P; Verhamme, I M A
2007-07-01
The specificity of blood coagulation proteinases for substrate, inhibitor, and effector recognition is mediated by exosites on the surfaces of the catalytic domains, physically separated from the catalytic site. Some thrombin ligands bind specifically to either exosite I or II, while others engage both exosites. The involvement of different, overlapping constellations of exosite residues enables binding of structurally diverse ligands. The flexibility of the thrombin structure is central to the mechanism of complex formation and the specificity of exosite interactions. Encounter complex formation is driven by electrostatic ligand-exosite interactions, followed by conformational rearrangement to a stable complex. Exosites on some zymogens are in low affinity proexosite states and are expressed concomitant with catalytic site activation. The requirement for exosite expression controls the specificity of assembly of catalytic complexes on the coagulation pathway, such as the membrane-bound factor Xa*factor Va (prothrombinase) complex, and prevents premature assembly. Substrate recognition by prothrombinase involves a two-step mechanism with initial docking of prothrombin to exosites, followed by a conformational change to engage the FXa catalytic site. Prothrombin and its activation intermediates bind prothrombinase in two alternative conformations determined by the zymogen to proteinase transition that are hypothesized to involve prothrombin (pro)exosite I interactions with FVa, which underpin the sequential activation pathway. The role of exosites as the major source of substrate specificity has stimulated development of exosite-targeted anticoagulants for treatment of thrombosis.
Suppression of RNA Interference by Adenovirus Virus-Associated RNA†
Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran
2005-01-01
We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917
Structural basis of cargo recognitions for class V myosins
Wei, Zhiyi; Liu, Xiaotian; Yu, Cong; Zhang, Mingjie
2013-01-01
Class V myosins (MyoV), the most studied unconventional myosins, recognize numerous cargos mainly via the motor’s globular tail domain (GTD). Little is known regarding how MyoV-GTD recognizes such a diverse array of cargos specifically. Here, we solved the crystal structures of MyoVa-GTD in its apo-form and in complex with two distinct cargos, melanophilin and Rab interacting lysosomal protein-like 2. The apo-MyoVa-GTD structure indicates that most mutations found in patients with Griscelli syndrome, microvillus inclusion disease, or cancers or in “dilute” rodents likely impair the folding of GTD. The MyoVa-GTD/cargo complex structure reveals two distinct cargo-binding surfaces, one primarily via charge–charge interaction and the other mainly via hydrophobic interactions. Structural and biochemical analysis reveal the specific cargo-binding specificities of various isoforms of mammalian MyoV as well as very different cargo recognition mechanisms of MyoV between yeast and higher eukaryotes. The MyoVa-GTD structures resolved here provide a framework for future functional studies of vertebrate class V myosins. PMID:23798443
Rao, Mala V.; Engle, Linda J.; Mohan, Panaiyur S.; Yuan, Aidong; Qiu, Dike; Cataldo, Anne; Hassinger, Linda; Jacobsen, Stephen; Lee, Virginia M-Y.; Andreadis, Athena; Julien, Jean-Pierre; Bridgman, Paul C.; Nixon, Ralph A.
2002-01-01
The identification of molecular motors that modulate the neuronal cytoskeleton has been elusive. Here, we show that a molecular motor protein, myosin Va, is present in high proportions in the cytoskeleton of mouse CNS and peripheral nerves. Immunoelectron microscopy, coimmunoprecipitation, and blot overlay analyses demonstrate that myosin Va in axons associates with neurofilaments, and that the NF-L subunit is its major ligand. A physiological association is indicated by observations that the level of myosin Va is reduced in axons of NF-L–null mice lacking neurofilaments and increased in mice overexpressing NF-L, but unchanged in NF-H–null mice. In vivo pulse-labeled myosin Va advances along axons at slow transport rates overlapping with those of neurofilament proteins and actin, both of which coimmunoprecipitate with myosin Va. Eliminating neurofilaments from mice selectively accelerates myosin Va translocation and redistributes myosin Va to the actin-rich subaxolemma and membranous organelles. Finally, peripheral axons of dilute-lethal mice, lacking functional myosin Va, display selectively increased neurofilament number and levels of neurofilament proteins without altering axon caliber. These results identify myosin Va as a neurofilament-associated protein, and show that this association is essential to establish the normal distribution, axonal transport, and content of myosin Va, and the proper numbers of neurofilaments in axons. PMID:12403814
75 FR 76953 - Foreign-Trade Zone 238-Dublin, VA Site Renumbering Notice
Federal Register 2010, 2011, 2012, 2013, 2014
2010-12-10
... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Foreign-Trade Zone 238--Dublin, VA Site Renumbering Notice Foreign-Trade Zone 238 was approved by the Foreign-Trade Zones Board on August 5, 1999 (Board Order 1047). FTZ 238 currently consists of 1 ``site'' totaling 50 acres in the Dublin area. The...
NASA Astrophysics Data System (ADS)
Pei, Zheng; Shi, Guoli; Kondo, Saki; Ito, Masahiko; Maekawa, Aya; Suzuki, Mariko; Saito, Izumu; Suzuki, Tetsuro; Kanegae, Yumi
2013-12-01
First-generation adenovirus vectors (FG AdVs) expressing short-hairpin RNA (shRNA) effectively downregulate the expressions of target genes. However, this vector, in fact, expresses not only the transgene product, but also virus-associated RNAs (VA RNAs) that disturb cellular RNAi machinery. We have established a production method for VA-deleted AdVs lacking expression of VA RNAs. Here, we showed that the highest shRNA activity was obtained when the shRNA was inserted not at the popularly used E1 site, but at the E4 site. We then compared the activities of shRNAs against hepatitis C virus (HCV) expressed from VA-deleted AdVs or conventional AdVs. The VA-deleted AdVs inhibited HCV production much more efficiently. Therefore, VA-deleted AdVs were more effective than the currently used AdVs for shRNA downregulation, probably because of the lack of competition between VA RNAs and the shRNAs. These VA-deleted AdVs might enable more effective gene therapies for chronic hepatitis C.
38 CFR 59.100 - Payment of grant award.
Code of Federal Regulations, 2010 CFR
2010-07-01
... engineering inspection approved by VA, must obtain VA approval of the final equipment list submitted by the... the internet Web site provided in § 59.170). The equipment list and the completed VA Form 10-0388-13...
38 CFR 59.100 - Payment of grant award.
Code of Federal Regulations, 2011 CFR
2011-07-01
... engineering inspection approved by VA, must obtain VA approval of the final equipment list submitted by the... the internet Web site provided in § 59.170). The equipment list and the completed VA Form 10-0388-13...
Bentzur, Assa; Shmueli, Anat; Omesi, Liora; Ryvkin, Julia; Knapp, Jon-Michael; Parnas, Moshe; Davis, Fred P; Shohat-Ophir, Galit
2018-04-01
Living in a social environment requires the ability to respond to specific social stimuli and to incorporate information obtained from prior interactions into future ones. One of the mechanisms that facilitates social interaction is pheromone-based communication. In Drosophila melanogaster, the male-specific pheromone cis-vaccenyl acetate (cVA) elicits different responses in male and female flies, and functions to modulate behavior in a context and experience-dependent manner. Although it is the most studied pheromone in flies, the mechanisms that determine the complexity of the response, its intensity and final output with respect to social context, sex and prior interaction, are still not well understood. Here we explored the functional link between social interaction and pheromone-based communication and discovered an odorant binding protein that links social interaction to sex specific changes in cVA related responses. Odorant binding protein 69a (Obp69a) is expressed in auxiliary cells and secreted into the olfactory sensilla. Its expression is inversely regulated in male and female flies by social interactions: cVA exposure reduces its levels in male flies and increases its levels in female flies. Increasing or decreasing Obp69a levels by genetic means establishes a functional link between Obp69a levels and the extent of male aggression and female receptivity. We show that activation of cVA-sensing neurons is sufficeint to regulate Obp69a levels in the absence of cVA, and requires active neurotransmission between the sensory neuron to the second order olfactory neuron. The cross-talk between sensory neurons and non-neuronal auxiliary cells at the olfactory sensilla, represents an additional component in the machinery that promotes behavioral plasticity to the same sensory stimuli in male and female flies.
Hachiya, Hitoshi; Yamauchi, Yasuteru; Iesaka, Yoshito; Yagishita, Atsuhiko; Sasaki, Takeshi; Higuchi, Koji; Kawabata, Mihoko; Sugiyama, Koji; Tanaka, Yasuaki; Kusa, Shigeki; Nakamura, Hiroaki; Miyazaki, Shinsuke; Taniguchi, Hiroshi; Isobe, Mitsuaki; Hirao, Kenzo
2013-10-01
Although coronary cusp (CC) ventricular arrhythmia (VA) can be treated by catheter ablation, reliable indicators of successful ablation sites have not been fully identified. This study comprised 392 patients undergoing radiofrequency catheter ablation for outflow tract-VA at 3 institutions from January 2007 to August 2012. The successful ablation site was on the left CC or right CC in 35 (8.9%) of the 392 patients. In 9 (26%) of these 35 patients, a discrete prepotential was recognized, 5 of whom had left CC-VAs and 4 of whom had right CC-VAs. Radiofrequency catheter ablation was successful at the site of the prepotential in all 9 of these patients. The duration of the isoelectric line between the end of the discrete prepotential and the onset of the ventricular electrogram was 27±13 ms. The time from onset of the discrete prepotential at the successful ablation site on the CC to the QRS onset (activation time) was 69±20 ms (range, 50-98 ms). Pace mapping was graded as excellent at the successful ablation site in only 1 patient. No discrete prepotential was recorded in any successful right outflow tract-VA ablation case in this study. A discrete prepotential was seen in 9 (26%) of 35 patients with CC-VA. In left and right CC-VA, the site of a discrete prepotential with ≥50 ms activation time may indicate a successful ablation site.
Targeting a KH-domain protein with RNA decoys.
Makeyev, Aleksandr V; Eastmond, Dawn L; Liebhaber, Stephen A
2002-09-01
RNA-binding proteins are involved in the regulation of many aspects of eukaryotic gene expression. Targeted interference with RNA-protein interactions could offer novel approaches to modulation of expression profiles, alteration of developmental pathways, and reversal of certain disease processes. Here we investigate a decoy strategy for the study of the alphaCP subgroup of KH-domain RNA-binding proteins. These poly(C)-binding proteins have been implicated in a wide spectrum of posttranscriptional controls. Three categories of RNA decoys to alphaCPs were studied: poly(C) homopolymers, native mRNA-binding sites, and a high-affinity structure selected from a combinatorial library. Native chemistry was found to be essential for alphaCP decoy action. Because alphaCP proteins are found in both the nucleus and cytoplasm, decoy cassettes were incorporated within both nuclear (U1 snRNA) and cytoplasmic (VA1 RNA) RNA frameworks. Several sequences demonstrated optimal decoy properties when assayed for protein-binding and decoy bioactivity in vitro. A subset of these transcripts was shown to mediate targeted inhibition of alphaCP-dependent translation when expressed in either the nucleus or cytoplasm of transfected cells. Significantly, these studies establish the feasibility of developing RNA decoys that can selectively target biologic functions of abundant and widely expressed RNA binding proteins.
Targeting a KH-domain protein with RNA decoys.
Makeyev, Aleksandr V; Eastmond, Dawn L; Liebhaber, Stephen A
2002-01-01
RNA-binding proteins are involved in the regulation of many aspects of eukaryotic gene expression. Targeted interference with RNA-protein interactions could offer novel approaches to modulation of expression profiles, alteration of developmental pathways, and reversal of certain disease processes. Here we investigate a decoy strategy for the study of the alphaCP subgroup of KH-domain RNA-binding proteins. These poly(C)-binding proteins have been implicated in a wide spectrum of posttranscriptional controls. Three categories of RNA decoys to alphaCPs were studied: poly(C) homopolymers, native mRNA-binding sites, and a high-affinity structure selected from a combinatorial library. Native chemistry was found to be essential for alphaCP decoy action. Because alphaCP proteins are found in both the nucleus and cytoplasm, decoy cassettes were incorporated within both nuclear (U1 snRNA) and cytoplasmic (VA1 RNA) RNA frameworks. Several sequences demonstrated optimal decoy properties when assayed for protein-binding and decoy bioactivity in vitro. A subset of these transcripts was shown to mediate targeted inhibition of alphaCP-dependent translation when expressed in either the nucleus or cytoplasm of transfected cells. Significantly, these studies establish the feasibility of developing RNA decoys that can selectively target biologic functions of abundant and widely expressed RNA binding proteins. PMID:12358435
47 CFR 25.203 - Choice of sites and frequencies.
Code of Federal Regulations, 2014 CFR
2014-10-01
... National Radio Astronomy Observatory: In order to minimize possible harmful interference at the National Radio Astronomy Observatory site at Green Bank, Pocahontas County, W. Va., and at the Naval Radio..., simultaneously notify the Director, National Radio Astronomy Observatory, P.O. Box No. 2, Green Bank, W. Va...
DOT National Transportation Integrated Search
2016-05-31
We developed and implemented a traffic count program in Blacksburg, VA to estimate performance measures of bicycle and pedestrian traffic. We deployed and validated automated counters at 101 count sites; the count sites consisted of 4 permanent refer...
Federal Register 2010, 2011, 2012, 2013, 2014
2012-03-12
... Procurement Policy (OFPP). OFPP's guidance is available at http:// www.whitehouse.gov/sites/default/files... a summary of the inventory on the VA Web site at: http://www.va.gov/oal/library/scaInventory.asp... to Marilyn Harris, Director, Procurement Policy and Warrant Management Service, in the Office of...
Kan, Peter; Yashar, Parham; Langer, David J; Siddiqui, Adnan H; Levy, Elad I
2012-11-01
Bow hunter's syndrome is a rare cause of vertebrobasilar insufficiency arising from mechanical compression of the vertebral artery (VA) during rotation of the head. Surgical treatment usually involves direct decompression of the VA at the site of compression. We describe what is to our knowledge the first reported case of a posterior inferior cerebellar artery (PICA)-to-PICA in situ bypass for treatment of Bow hunter's-type ischemia in a patient with a VA dissection. The patient was a 41-year-old man who developed disabling symptoms of vertebrobasilar insufficiency after trauma when he rotated his head to the right. Dynamic angiography demonstrated a chronic dissection and stasis of flow in the right VA when his head was rotated to the right, with no obvious site of focal compression. The right VA ended in the PICA and the left VA was of good caliber. A single-photon emission computed tomography study with acetazolamide challenge confirmed brainstem ischemia and poor cerebrovascular reserve. He ultimately underwent a PICA-to-PICA in situ bypass to revascularize his right PICA territory with complete symptom resolution. The PICA-to-PICA in situ bypass is a useful option in the treatment of Bow hunter's-type ischemia in the absence of focal structural compression of the VA or VA stenosis. Copyright © 2012 Elsevier Inc. All rights reserved.
MyHealtheVet (VA's personal health record)
... Overview Site Map Help & User Guides FAQ Privacy & Security Terms and Conditions Policies Privacy Policy Web Policies FOIA Accessibility System Use Important Links VA Home White House USA.gov Inspector ...
Homeless Veterans: Management Improvements Could Help VA Better Identify Supportive Housing Projects
2016-12-01
HOMELESS VETERANS Management Improvements Could Help VA Better Identify Supportive-Housing Projects Report to...VETERANS Management Improvements Could Help VA Better Identify Supportive-Housing Projects What GAO Found As of September 2016, for veterans who...disabled veterans. These supportive-housing EULs receive project -based HUD-VASH vouchers, which provide housing subsidies, on-site case management
The Impact of VA and Navy Hospital Collaboration on Medical School Education
ERIC Educational Resources Information Center
Atre-Vaidya, Nutan; Ross, Arthur, III; Sandu, Ioana C.; Hassan, Tariq
2009-01-01
Objective: The U.S. Department of Veterans Affairs (VA) is the largest single provider of medical education in the United States and is often the preferred training site for medical students and residents. However, changing priorities of patients and the marketplace are forcing medical schools and the VA to consider new ways of practicing medicine…
Jung, Dawoon; Matson, Cole W; Collins, Leonard B; Laban, Geoff; Stapleton, Heather M; Bickham, John W; Swenberg, James A; Di Giulio, Richard T
2011-11-01
The Atlantic Wood Industries Superfund site (AWI) on the Elizabeth River in Portsmouth, VA is heavily contaminated with polycyclic aromatic hydrocarbons (PAHs) from a wood treatment facility. Atlantic killifish, or mummichog (Fundulus heteroclitus), at this Superfund site are exposed to very high concentrations of several carcinogens. In this study, we measured PAH concentrations in both fish tissues and sediments. Concurrently, we assessed different aspects of genotoxicity in the killifish exposed in situ. Both sediment and tissue PAH levels were significantly higher in AWI samples, relative to a reference site, but the chemistry profile was different between sediments and tissues. Killifish at AWI exhibited higher levels of DNA damage compared to reference fish, as measured via the flow cytometric method (FCM), and the damage was consistent with sediment PAH concentrations. Covalent binding of benzo[a]pyrene (BaP) metabolites to DNA, as measured via LC-MS/MS adduct detection methods, were also elevated and could be partially responsible for the DNA damage. Using similar LC-MS/MS methods, we found no evidence that oxidative DNA adducts had a role in observed genotoxicity.
JFACC Information Management (IM) Capability: Operational Concept
2006-01-01
designated by other documentation. ©2006 The MITRE Corporation. All Rights Reserved. Langley Site Operations Hampton, Virginia Report...1204, Arlington VA 22202-4302. Respondents should be aware that notwithstanding any other provision of law, no person shall be subject to a penalty...ORGANIZATION NAME(S) AND ADDRESS(ES) MITRE Corporation,Langley Site Operations,Hampton,VA,23666 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING
Pregnancy and maternal iron deficiency stimulate hepatic CRBPII expression in rats.
Cottin, Sarah C; Gambling, Lorraine; Hayes, Helen E; Stevens, Valerie J; McArdle, Harry J
2016-06-01
Iron deficiency impairs vitamin A (VA) metabolism in the rat but the mechanisms involved are unknown and the effect during development has not been investigated. We investigated the effect of pregnancy and maternal iron deficiency on VA metabolism in the mother and fetus. 54 rats were fed either a control or iron deficient diet for 2weeks prior to mating and throughout pregnancy. Another 15 female rats followed the same diet and were used as non-pregnant controls. Maternal liver, placenta and fetal liver were collected at d21 for total VA, retinol and retinyl ester (RE) measurement and VA metabolic gene expression analysis. Iron deficiency increased maternal hepatic RE (P<.05) and total VA (P<.0001), fetal liver RE (P<.05), and decreased placenta total VA (P<.05). Pregnancy increased Cellular Retinol Binding Protein (CRBP)-II gene expression by 7 fold (P=.001), decreased VA levels (P=.0004) and VA metabolic gene expression (P<.0001) in the liver. Iron deficiency increased hepatic CRBPII expression by a further 2 fold (P=.044) and RBP4 by~20% (P=.005), increased RBPR2 and decreased CRBPII, LRAT, and TTR in fetal liver, while it had no effect on VA metabolic gene expression in the placenta. Hepatic CRBPII expression is increased by pregnancy and further increased by iron deficiency, which may play an important role in VA metabolism and homeostasis. Maternal iron deficiency also alters VA metabolism in the fetus, which is likely to have consequences for development. Copyright © 2016 Elsevier Inc. All rights reserved.
Cestaro, Alessandro; Sterck, Lieven; Fontana, Paolo; Van de Peer, Yves; Viola, Roberto; Velasco, Riccardo; Salamini, Francesco
2012-01-01
Plants have followed a reticulate type of evolution and taxa have frequently merged via allopolyploidization. A polyploid structure of sequenced genomes has often been proposed, but the chromosomes belonging to putative component genomes are difficult to identify. The 19 grapevine chromosomes are evolutionary stable structures: their homologous triplets have strongly conserved gene order, interrupted by rare translocations. The aim of this study is to examine how the grapevine nucleotide-binding site (NBS)-encoding resistance (NBS-R) genes have evolved in the genomic context and to understand mechanisms for the genome evolution. We show that, in grapevine, i) helitrons have significantly contributed to transposition of NBS-R genes, and ii) NBS-R gene cluster similarity indicates the existence of two groups of chromosomes (named as Va and Vc) that may have evolved independently. Chromosome triplets consist of two Va and one Vc chromosomes, as expected from the tetraploid and diploid conditions of the two component genomes. The hexaploid state could have been derived from either allopolyploidy or the separation of the Va and Vc component genomes in the same nucleus before fusion, as known for Rosaceae species. Time estimation indicates that grapevine component genomes may have fused about 60 mya, having had at least 40–60 mya to evolve independently. Chromosome number variation in the Vitaceae and related families, and the gap between the time of eudicot radiation and the age of Vitaceae fossils, are accounted for by our hypothesis. PMID:22253773
Mitchinson, Allison R.; Trumble, Erika; Hinshaw, Daniel B.; Dusek, Jeffery A.
2017-01-01
Abstract Objectives: Use of complementary and integrative health (CIH) therapies is being promoted by the Veterans Health Administration (VA), but promotion may not equate to adoption. The purpose of this study was to explore whether perceptions regarding CIH at one VA medical center (VAMC) were similar to perceptions from a sample of other VAMCs. Design: This article reports a subset of qualitative findings from a mixed-methods study. Setting/Participants: Sites were recruited through a VA-wide CIH listserver. On the basis of site description (e.g., therapies offered, interest in CIH), sustained site interest, and geographic location, recorded interviews of 22 persons were conducted at 6 sites across the country. Outcome measures: Interviewees were asked the same questions as the single-site VAMC study respondents. Results: Variable access to CIH services across the VA created the need for workarounds. Multiple barriers (e.g., limited space and challenging credentialing) and facilitators (e.g., strong champion and high veteran demand) were cited. Respondents described nonpharmacologic pain control, the usefulness in treating mental health and/or post-traumatic stress disorder issues, and improvement of staff morale as additional reasons to promote CIH. Findings confirmed those from the earlier single-site VAMC phase of the study. Even the highest-performing sites reported struggling to meet veterans' demands for delivery of CIH. Conclusions: Almost half of active-duty military personnel report the use of at least one type of CIH therapy. As active-duty personnel transition to veteran status, both their physical and mental healthcare needs can potentially benefit from CIH therapies. The VA must actively support local enthusiastic CIH proponents and receive congressional support if it is to actually meet its stated goal of providing personalized, proactive, patient-driven healthcare through the promotion of comprehensive CIH services to veterans. PMID:27925776
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jacewicz, Agata; Schwer, Beate; Smith, Paul
Yeast Prp28 is a DEAD-box pre-mRNA splicing factor implicated in displacing U1 snRNP from the 5' splice site. Here we report that the 588-aa Prp28 protein consists of a trypsin-sensitive 126-aa N-terminal segment (of which aa 1–89 are dispensable for Prp28 function in vivo) fused to a trypsin-resistant C-terminal catalytic domain. Purified recombinant Prp28 and Prp28-(127–588) have an intrinsic RNA-dependent ATPase activity, albeit with a low turnover number. The crystal structure of Prp28-(127–588) comprises two RecA-like domains splayed widely apart. AMPPNP•Mg 2+ is engaged by the proximal domain, with proper and specific contacts from Phe194 and Gln201 (Q motif) tomore » the adenine nucleobase. The triphosphate moiety of AMPPNP•Mg 2+ is not poised for catalysis in the open domain conformation. Guided by the Prp28•AMPPNP structure, and that of the Drosophila Vasa•AMPPNP•Mg 2+•RNA complex, we targeted 20 positions in Prp28 for alanine scanning. ATP-site components Asp341 and Glu342 (motif II) and Arg527 and Arg530 (motif VI) and RNA-site constituent Arg476 (motif Va) are essential for Prp28 activity in vivo. Synthetic lethality of double-alanine mutations highlighted functionally redundant contacts in the ATP-binding (Phe194-Gln201, Gln201-Asp502) and RNA-binding (Arg264-Arg320) sites. As a result, overexpression of defective ATP-site mutants, but not defective RNA-site mutants, elicited severe dominant-negative growth defects.« less
Jacewicz, Agata; Schwer, Beate; Smith, Paul; ...
2014-10-10
Yeast Prp28 is a DEAD-box pre-mRNA splicing factor implicated in displacing U1 snRNP from the 5' splice site. Here we report that the 588-aa Prp28 protein consists of a trypsin-sensitive 126-aa N-terminal segment (of which aa 1–89 are dispensable for Prp28 function in vivo) fused to a trypsin-resistant C-terminal catalytic domain. Purified recombinant Prp28 and Prp28-(127–588) have an intrinsic RNA-dependent ATPase activity, albeit with a low turnover number. The crystal structure of Prp28-(127–588) comprises two RecA-like domains splayed widely apart. AMPPNP•Mg 2+ is engaged by the proximal domain, with proper and specific contacts from Phe194 and Gln201 (Q motif) tomore » the adenine nucleobase. The triphosphate moiety of AMPPNP•Mg 2+ is not poised for catalysis in the open domain conformation. Guided by the Prp28•AMPPNP structure, and that of the Drosophila Vasa•AMPPNP•Mg 2+•RNA complex, we targeted 20 positions in Prp28 for alanine scanning. ATP-site components Asp341 and Glu342 (motif II) and Arg527 and Arg530 (motif VI) and RNA-site constituent Arg476 (motif Va) are essential for Prp28 activity in vivo. Synthetic lethality of double-alanine mutations highlighted functionally redundant contacts in the ATP-binding (Phe194-Gln201, Gln201-Asp502) and RNA-binding (Arg264-Arg320) sites. As a result, overexpression of defective ATP-site mutants, but not defective RNA-site mutants, elicited severe dominant-negative growth defects.« less
Multisite experimental cost study of intensive psychiatric community care.
Rosenheck, R; Neale, M; Leaf, P; Milstein, R; Frisman, L
1995-01-01
A 2-year experimental cost study of 10 Intensive Psychiatric Community Care (IPCC) programs was conducted at Department of Veterans Affairs (VA) medical centers in the Northeast. High hospital users were randomly assigned to either IPCC (n = 454) or standard VA care (n = 419) at four neuropsychiatric (NP) and six general medical and surgical (GMS) hospitals. National computerized data were used to track all VA health care service usage and costs for 2 years following program entry. At 9 of the 10 sites, IPCC treatment resulted in reduced inpatient service usage. Overall, for IPCC patients compared with control patients, average inpatient usage was 89 days (33%) less while average cost per patient (for IPCC inpatient, and outpatient services) was $15,556 (20%) less. Additionally, costs for IPCC patients compared with control patients were $33,295 (29%) less at NP sites but were $6,273 (15%) greater at GMS sites. At both NP and GMS sites, costs were lower for IPCC patients in two subgroups: veterans over age 45 and veterans with high levels of inpatient service use before program entry. No interaction was noted between the impact of IPCC on costs and other clinical or sociodemographic characteristics. Similarly, no linear relationship was observed between the intensity of IPCC services and the impact of IPCC on VA costs, although the two sites that did not fully implement the IPCC program had the poorest results. With these sites excluded, the total cost of care for IPCC patients at GMS sites was $579 (3%) more per year than that for the control patients.
Gao, Chunyan; Xie, Rui; Yu, Chengyuan; Ma, Ruishuang; Dong, Weijun; Meng, Huan; Zhang, Yan; Si, Yu; Zhang, Zhuo; Novakovic, Valerie; Zhang, Yong; Kou, Junjie; Bi, Yayan; Li, Baoxin; Xie, Rujuan; Gilbert, Gary E.; Zhou, Jin; Shi, Jialan
2015-01-01
The mechanisms contributing to an increased risk of thrombosis in uremia are complex and require clarification. There is scant morphological evidence of membrane-dependent binding of factor Xa (FXa) and factor Va (FVa) on endothelial cells (EC) in vitro. Our objectives were to confirm that exposed phosphatidylserine (PS) on microparticle (MP), EC, and peripheral blood cell (PBC) has a prothrombotic role in uremic patients and to provide visible and morphological evidence of PS-dependent prothrombinase assembly in vitro. We found that uremic patients had more circulating MP (derived from PBC and EC) than controls. Additionally, patients had more exposed PS on their MPs and PBCs, especially in the hemodialysis group. In vitro, EC exposed more PS in uremic toxins or serum. Moreover, reconstitution experiments showed that at the early stages, PS exposure was partially reversible. Using confocal microscopy, we observed that PS-rich membranes of EC and MP provided binding sites for FVa and FXa. Further, exposure of PS in uremia resulted in increased generation of FXa, thrombin, and fibrin and significantly shortened coagulation time. Lactadherin, a protein that blocks PS, reduced 80% of procoagulant activity on PBC, EC, and MP. Our results suggest that PBC and EC in uremic milieu are easily injured or activated, which exposes PS and causes a release of MP, providing abundant procoagulant membrane surfaces and thus facilitating thrombus formation. Blocking PS binding sites could become a new therapeutic target for preventing thrombosis. PMID:26580207
Engle-Stone, Reina; Nankap, Martin; Ndjebayi, Alex; Gimou, Marie-Madeleine; Friedman, Avital; Haskell, Marjorie J.; Tarini, Ann; Brown, Kenneth H.
2017-01-01
Vitamin A (VA) fortification of cooking oil is considered a cost-effective strategy for increasing VA status, but few large-scale programs have been evaluated. We conducted representative surveys in Yaoundé and Douala, Cameroon, 2 years before and 1 year after the introduction of a mandatory national program to fortify cooking oil with VA. In each survey, 10 different households were selected within each of the same 30 clusters (n = ~300). Malaria infection and plasma indicators of inflammation and VA (retinol-binding protein, pRBP) status were assessed among women aged 15–49 years and children aged 12–59 months, and casual breast milk samples were collected for VA and fat measurements. Refined oil intake was measured by a food frequency questionnaire, and VA was measured in household oil samples post-fortification. Pre-fortification, low inflammation-adjusted pRBP was common among children (33% <0.83 µmol/L), but not women (2% <0.78 µmol/L). Refined cooking oil was consumed by >80% of participants in the past week. Post-fortification, only 44% of oil samples were fortified, but fortified samples contained VA concentrations close to the target values. Controlling for age, inflammation, and other covariates, there was no difference in the mean pRBP, mean breast milk VA, prevalence of low pRBP, or prevalence of low milk VA between the pre- and post-fortification surveys. The frequency of refined oil intake was not associated with VA status indicators post-fortification. In sum, after a year of cooking oil fortification with VA, we did not detect evidence of increased plasma RBP or milk VA among urban women and preschool children, possibly because less than half of the refined oil was fortified. The enforcement of norms should be strengthened, and the program should be evaluated in other regions where the prevalence of VA deficiency was greater pre-fortification. PMID:28531099
2012-04-24
PHENYTOIN/SORAFENIB [VA Drug Interaction]; Liver Neoplasms; Carcinoma, Hepatocellular; Digestive System Neoplasms; Neoplasms by Site; Liver Diseases; Adenocarcinoma; Carcinoma; Neoplasms, Glandular and Epithelial; Neoplasms by Histologic Type; DOXORUBICIN/TRASTUZUMAB [VA Drug Interaction]; HBV
Engle, Mark A.; Kolker, Allan; Mose, Douglas E.; East, Joseph A.; McCord, Jamey D.
2008-01-01
The VA-08 Mercury Deposition Network (MDN) site, southwest of Culpeper, Virginia, was established in autumn of 2002. This site, along with nearby VA-28 (~31 km west) at Big Meadows in Shenandoah National Park, fills a spatial gap in the Mid-Atlantic region of the MDN network and provides Hg deposition data immediately west of the Washington, D.C., metropolitan area. Results for the Culpeper site from autumn of 2002 to the end of 2006 suggest that the highest mercury (Hg) deposition (up to 5.0 ug/m2 per quarter of the 6.5-12.6 ug/m2 annual Hg deposition) is measured during the second and third quarters of the year (April-September). This is a result of both elevated Hg precipitation concentrations (up to 27 ng/L) and greater precipitation during these months. The data also exhibit a general statistically significant (p<0.05) negative correlation between weekly total precipitation and Hg concentrations, suggesting a dilution effect during larger precipitation events, especially during winter and spring. Comparison of results between the Culpeper and Big Meadows sites indicates that although quarterly Hg deposition was not significantly different (p<0.05) between sites, quarterly volume-averaged Hg precipitation concentrations were statistically larger (p<0.05) and precipitation was significantly lower (p<0.05) at VA-08. Lower Hg concentrations at the VA-28 site relative to VA-08 are likely a result of greater total precipitation and thus additional dilution of Hg in precipitation. Results from concomitant trace elements in precipitation collected from July, 2005, to December, 2006, were used to better identify possible sources of Hg at the Culpeper MDN site. Principal component analysis of the Hg and trace metal data identified 3 primary source categories, each with large loadings of characteristic elements: 1) Ca, Al, Mg, Sr, La, and Ce (crustal sources); 2) V, Na, and Ni (local wintertime heating oil); and 3) Zn, Cd, Mn, and Hg (regional anthropogenic emission sources). HYSPLIT air mass trajectory modeling and enrichment factor calculations are consistent with this interpretation. A preliminary source attribution model suggests that ~51% of the Hg in wet deposition is due to regional anthropogenic sources, while crustal sources and local oil combustion account for 9.5% and <1%, respectively. This calculation implies that the global Hg burden accounts for ~40% of the Hg in wet deposition.
Mao, Liang; Colosi, Lisa M; Gao, Shixiang; Huang, Qingguo
2011-07-15
We have verified in our previous work that lignin peroxidase (LiP) mediates effective removal of selected natural and synthetic estrogens. The efficiency of these reactions was greatly enhanced in the presence of veratryl alcohol (VA), a chemical that is produced along with LiP by certain white rot fungi, for example, Phanerochaete chrysosporium. In this study, we systematically evaluated the kinetic behaviors of LiP-mediated reactions for six endocrine disrupting compounds (EDCs), that is, steroid estrogens and their structural analogs, in both the presence and absence of VA. Resulting kinetic parameters were then correlated with structural features of LiP/substrate binding complexes, as quantified using molecular simulation, to create quantitative structure-activity relationship (QSAR) equations. These equations suggest that binding distance between a substrate's phenolic proton and δN of HIS47's imidazole ring plays an important role in modulating substrate reactivity toward LiP in both the presence and absence of VA. This information provides insight into an important enzymatic reaction process that occurs in the natural environment affecting EDC transformation, a process that may be used in engineered systems to achieve EDC removal from water.
Xu, Ning; Gkountela, Sofia; Saeed, Khalid; Akusjärvi, Göran
2009-11-01
Human Adenovirus type 5 encodes two short RNA polymerase III transcripts, the virus-associated (VA) RNAI and VA RNAII, which can adopt stable hairpin structures that resemble micro-RNA precursors. The terminal stems of the VA RNAs are processed into small RNAs (mivaRNAs) that are incorporated into RISC. It has been reported that VA RNAI has two transcription initiation sites, which produce two VA RNAI species; a major species, VA RNAI(G), which accounts for 75% of the VA RNAI pool, and a minor species, VA RNAI(A), which initiates transcription three nucleotides upstream compared to VA RNAI(G). We show that this 5'-heterogeneity results in a dramatic difference in RISC assembly. Thus, both VA RNAI(G) and VA RNAI(A) are processed by Dicer at the same position in the terminal stem generating the same 3'-strand mivaRNA. This mivaRNA is incorporated into RISC with 200-fold higher efficiency compared to the 5'-strand of mivaRNAI. Of the small number of 5'-strands used in RISC assembly only VA RNAI(A) generated active RISC complexes. We also show that the 3'-strand of mivaRNAI, although being the preferred substrate for RISC assembly, generates unstable RISC complexes with a low in vitro cleavage activity, only around 2% compared to RISC assembled on the VA RNAI(A) 5'-strand.
Jung, Dawoon; Matson, Cole W.; Collins, Leonard B.; Laban, Geoff; Stapleton, Heather M.; Bickham, John W.; Swenberg, James A.; Giulio, Richard T. Di
2011-01-01
The Atlantic Wood Industries Superfund site (AWI) on the Elizabeth River in Portsmouth, VA is heavily contaminated with polycyclic aromatic hydrocarbons (PAHs) from a wood treatment facility. Atlantic killifish, or mummichog (Fundulus heteroclitus), at this Superfund site are exposed to very high concentrations of several carcinogens. In this study, we measured PAH concentrations in both fish tissues and sediments. Concurrently, we assessed different aspects of genotoxicity in the killifish exposed in situ. Both sediment and tissue PAH levels were significantly higher in AWI samples, relative to a reference site, but the chemistry profile was different between sediments and tissues. Killifish at AWI exhibited higher levels of DNA damage compared to reference fish, as measured via the flow cytometric method (FCM), and the damage was consistent with sediment PAH concentrations. Covalent binding of benzo[a]pyrene (BaP) metabolites to DNA, as measured via LC-MS/MS adduct detection methods, were also elevated and could be partially responsible for the DNA damage. Using similar LC-MS/MS methods, we found no evidence that oxidative DNA adducts had a role in observed genotoxicity. PMID:21706406
NASA Astrophysics Data System (ADS)
Zhang, Qiuzhuo; Wang, Duanchao; Li, Mengmeng; Xiang, Wei-Ning; Achal, Varenyam
2014-03-01
Two indigenous bacteria of petroleum contaminated soil were characterized to utilize diesel fuel as the sole carbon and energy sources in this work. 16S rRNA gene sequence analysis identified these bacteria as Sphingomonas sp. and Acinetobacter junii. The ability to degrade diesel fuel has been demonstrated for the first time by these isolates. The results of IR analyses showed that Sphingomonas sp. VA1 and A. junii VA2 degraded up to 82.6% and 75.8% of applied diesel over 15 days, respectively. In addition, Sphingomonas sp. VA1 possessed the higher cellular hydrophobicities of 94% for diesel compared to 81% by A. junii VA2. The isolates Sphingomonas sp. VA1 and A. junii VA2 exhibited 24% and 18%, respectively emulsification activity. This study reports two new diesel degrading bacterial species, which can be effectively used for bioremediation of petroleum contaminated sites.
Miki, Yuta; Pogni, Rebecca; Acebes, Sandra; Lucas, Fátima; Fernández-Fueyo, Elena; Baratto, Maria Camilla; Fernández, María I; de los Ríos, Vivian; Ruiz-Dueñas, Francisco J; Sinicropi, Adalgisa; Basosi, Riccardo; Hammel, Kenneth E; Guallar, Victor; Martínez, Angel T
2013-06-15
LiP (lignin peroxidase) from Trametopsis cervina has an exposed catalytic tyrosine residue (Tyr181) instead of the tryptophan conserved in other lignin-degrading peroxidases. Pristine LiP showed a lag period in VA (veratryl alcohol) oxidation. However, VA-LiP (LiP after treatment with H2O2 and VA) lacked this lag, and H2O2-LiP (H2O2-treated LiP) was inactive. MS analyses revealed that VA-LiP includes one VA molecule covalently bound to the side chain of Tyr181, whereas H2O2-LiP contains a hydroxylated Tyr181. No adduct is formed in the Y171N variant. Molecular docking showed that VA binding is favoured by sandwich π stacking with Tyr181 and Phe89. EPR spectroscopy after peroxide activation of the pre-treated LiPs showed protein radicals other than the tyrosine radical found in pristine LiP, which were assigned to a tyrosine-VA adduct radical in VA-LiP and a dihydroxyphenyalanine radical in H2O2-LiP. Both radicals are able to oxidize large low-redox-potential substrates, but H2O2-LiP is unable to oxidize high-redox-potential substrates. Transient-state kinetics showed that the tyrosine-VA adduct strongly promotes (>100-fold) substrate oxidation by compound II, the rate-limiting step in catalysis. The novel activation mechanism is involved in ligninolysis, as demonstrated using lignin model substrates. The present paper is the first report on autocatalytic modification, resulting in functional alteration, among class II peroxidases.
Streatfield, P Kim; Khan, Wasif A; Bhuiya, Abbas; Hanifi, Syed M A; Alam, Nurul; Millogo, Ourohiré; Sié, Ali; Zabré, Pascal; Rossier, Clementine; Soura, Abdramane B; Bonfoh, Bassirou; Kone, Siaka; Ngoran, Eliezer K; Utzinger, Juerg; Abera, Semaw F; Melaku, Yohannes A; Weldearegawi, Berhe; Gomez, Pierre; Jasseh, Momodou; Ansah, Patrick; Azongo, Daniel; Kondayire, Felix; Oduro, Abraham; Amu, Alberta; Gyapong, Margaret; Kwarteng, Odette; Kant, Shashi; Pandav, Chandrakant S; Rai, Sanjay K; Juvekar, Sanjay; Muralidharan, Veena; Wahab, Abdul; Wilopo, Siswanto; Bauni, Evasius; Mochamah, George; Ndila, Carolyne; Williams, Thomas N; Khagayi, Sammy; Laserson, Kayla F; Nyaguara, Amek; Van Eijk, Anna M; Ezeh, Alex; Kyobutungi, Catherine; Wamukoya, Marylene; Chihana, Menard; Crampin, Amelia; Price, Alison; Delaunay, Valérie; Diallo, Aldiouma; Douillot, Laetitia; Sokhna, Cheikh; Gómez-Olivé, F Xavier; Mee, Paul; Tollman, Stephen M; Herbst, Kobus; Mossong, Joël; Chuc, Nguyen T K; Arthur, Samuelina S; Sankoh, Osman A; Byass, Peter
2014-01-01
As the HIV/AIDS pandemic has evolved over recent decades, Africa has been the most affected region, even though a large proportion of HIV/AIDS deaths have not been documented at the individual level. Systematic application of verbal autopsy (VA) methods in defined populations provides an opportunity to assess the mortality burden of the pandemic from individual data. To present standardised comparisons of HIV/AIDS-related mortality at sites across Africa and Asia, including closely related causes of death such as pulmonary tuberculosis (PTB) and pneumonia. Deaths related to HIV/AIDS were extracted from individual demographic and VA data from 22 INDEPTH sites across Africa and Asia. VA data were standardised to WHO 2012 standard causes of death assigned using the InterVA-4 model. Between-site comparisons of mortality rates were standardised using the INDEPTH 2013 standard population. The dataset covered a total of 10,773 deaths attributed to HIV/AIDS, observed over 12,204,043 person-years. HIV/AIDS-related mortality fractions and mortality rates varied widely across Africa and Asia, with highest burdens in eastern and southern Africa, and lowest burdens in Asia. There was evidence of rapidly declining rates at the sites with the heaviest burdens. HIV/AIDS mortality was also strongly related to PTB mortality. On a country basis, there were strong similarities between HIV/AIDS mortality rates at INDEPTH sites and those derived from modelled estimates. Measuring HIV/AIDS-related mortality continues to be a challenging issue, all the more so as anti-retroviral treatment programmes alleviate mortality risks. The congruence between these results and other estimates adds plausibility to both approaches. These data, covering some of the highest mortality observed during the pandemic, will be an important baseline for understanding the future decline of HIV/AIDS.
Hamilton, Alison B; Frayne, Susan M; Cordasco, Kristina M; Washington, Donna L
2013-07-01
While prior research characterizes women Veterans' barriers to accessing and using Veterans Health Administration (VA) care, there has been little attention to women who access VA and use services, but then discontinue use. Recent data suggest that among women Veterans, there is a 30 % attrition rate within 3 years of initial VA use. To compare individual characteristics and perceptions about VA care between women Veteran VA attriters (those who discontinue use) and non-attriters (those who continue use), and to compare recent versus remote attriters. Cross-sectional, population-based 2008-2009 national telephone survey. Six hundred twenty-six attriters and 2,065 non-attriters who responded to the National Survey of Women Veterans. Population weighted demographic, military and health characteristics; perceptions about VA healthcare; length of time since last VA use; among attriters, reasons for no longer using VA care. Fifty-four percent of the weighted VA ever user population reported that they no longer use VA. Forty-five percent of attrition was within the past ten years. Attriters had better overall health (p = 0.007), higher income (p < 0.001), and were more likely to have health insurance (p < 0.001) compared with non-attriters. Attriters had less positive perceptions of VA than non-attriters, with attriters having lower ratings of VA quality and of gender-specific features of VA care (p < 0.001). Women Veterans who discontinued VA use since 2001 did not differ from those with more remote VA use on most measures of VA perceptions. Overall, among attriters, distance to VA sites of care and having alternate insurance coverage were the most common reasons for discontinuing VA use. We found high VA attrition despite recent advances in VA care for women Veterans. Women's attrition from VA could reduce the critical mass of women Veterans in VA and affect current system-wide efforts to provide high-quality care for women Veterans. An understanding of reasons for attrition can inform organizational efforts to re-engage women who have attrited, to retain current users, and potentially to attract new VA patients.
Korposh, Sergiy; Chianella, Iva; Guerreiro, Antonio; Caygill, Sarah; Piletsky, Sergey; James, Stephen W; Tatam, Ralph P
2014-05-07
An optical fibre long period grating (LPG) sensor modified with molecularly imprinted polymer nanoparticles (nanoMIPs) for the specific detection of antibiotics is presented. The operation of the sensor is based on the measurement of changes in refractive index induced by the interaction of nanoMIPs deposited onto the cladding of the LPG with free vancomycin (VA). The binding of nanoMIPs to vancomycin was characterised by a binding constant of 4.3 ± 0.1 × 10(-8) M. The lowest concentration of analyte measured by the fibre sensor was 10 nM. In addition, the sensor exhibited selectivity, as much smaller responses were obtained for high concentrations (∼700 μM) of other commonly prescribed antibiotics such as amoxicillin, bleomycin and gentamicin. In addition, the response of the sensor was characterised in a complex matrix, porcine plasma, spiked with 10 μM of VA.
Korposh, Sergiy; Chianella, Iva; Guerreiro, Antonio; Caygill, Sarah; Piletsky, Sergey; James, Stephen W.; Tatam, Ralph P.
2015-01-01
An optical fibre long period grating (LPG) sensor modified with molecularly imprinted polymer nanoparticles (nanoMIPs) for the specific detection of antibiotics is presented. The operation of the sensor is based on the measurement of changes in refractive index induced by the interaction of nanoMIPs deposited onto the cladding of the LPG with free vancomycin (VA). The binding of nanoMIPs to vancomycin was characterised by a binding constant of 4.3±0.1×10−8 M. The lowest concentration of analyte measured by the fibre sensor was 10 nM. In addition, the sensor exhibited selectivity, as much smaller responses were obtained for high concentrations (~ 700 μM) of other commonly prescribed antibiotics such as amoxicillin, bleomycin and gentamicin. In addition, the response of the sensor was characterised in a complex matrix, porcine plasma, spiked with 10 μM of VA. PMID:24634909
Streatfield, P. Kim; Khan, Wasif A.; Bhuiya, Abbas; Hanifi, Syed M.A.; Alam, Nurul; Bagagnan, Cheik H.; Sié, Ali; Zabré, Pascal; Lankoandé, Bruno; Rossier, Clementine; Soura, Abdramane B.; Bonfoh, Bassirou; Kone, Siaka; Ngoran, Eliezer K.; Utzinger, Juerg; Haile, Fisaha; Melaku, Yohannes A.; Weldearegawi, Berhe; Gomez, Pierre; Jasseh, Momodou; Ansah, Patrick; Debpuur, Cornelius; Oduro, Abraham; Wak, George; Adjei, Alexander; Gyapong, Margaret; Sarpong, Doris; Kant, Shashi; Misra, Puneet; Rai, Sanjay K.; Juvekar, Sanjay; Lele, Pallavi; Bauni, Evasius; Mochamah, George; Ndila, Carolyne; Williams, Thomas N.; Laserson, Kayla F.; Nyaguara, Amek; Odhiambo, Frank O.; Phillips-Howard, Penelope; Ezeh, Alex; Kyobutungi, Catherine; Oti, Samuel; Crampin, Amelia; Nyirenda, Moffat; Price, Alison; Delaunay, Valérie; Diallo, Aldiouma; Douillot, Laetitia; Sokhna, Cheikh; Gómez-Olivé, F. Xavier; Kahn, Kathleen; Tollman, Stephen M.; Herbst, Kobus; Mossong, Joël; Chuc, Nguyen T.K.; Bangha, Martin; Sankoh, Osman A.; Byass, Peter
2014-01-01
Background Mortality from non-communicable diseases (NCDs) is a major global issue, as other categories of mortality have diminished and life expectancy has increased. The World Health Organization's Member States have called for a 25% reduction in premature NCD mortality by 2025, which can only be achieved by substantial reductions in risk factors and improvements in the management of chronic conditions. A high burden of NCD mortality among much older people, who have survived other hazards, is inevitable. The INDEPTH Network collects detailed individual data within defined Health and Demographic Surveillance sites. By registering deaths and carrying out verbal autopsies to determine cause of death across many such sites, using standardised methods, the Network seeks to generate population-based mortality statistics that are not otherwise available. Objective To describe patterns of adult NCD mortality from INDEPTH Network sites across Africa and Asia, according to the WHO 2012 verbal autopsy (VA) cause categories, with separate consideration of premature (15–64 years) and older (65+ years) NCD mortality. Design All adult deaths at INDEPTH sites are routinely registered and followed up with VA interviews. For this study, VA archives were transformed into the WHO 2012 VA standard format and processed using the InterVA-4 model to assign cause of death. Routine surveillance data also provide person-time denominators for mortality rates. Results A total of 80,726 adult (over 15 years) deaths were documented over 7,423,497 person-years of observation. NCDs were attributed as the cause for 35.6% of these deaths. Slightly less than half of adult NCD deaths occurred in the 15–64 age group. Detailed results are presented by age and sex for leading causes of NCD mortality. Per-site rates of NCD mortality were significantly correlated with rates of HIV/AIDS-related mortality. Conclusions These findings present important evidence on the distribution of NCD mortality across a wide range of African and Asian settings. This comes against a background of global concern about the burden of NCD mortality, especially among adults aged under 70, and provides an important baseline for future work. PMID:25377326
Impact of the REACH II and REACH VA Dementia Caregiver Interventions on Healthcare Costs.
Nichols, Linda O; Martindale-Adams, Jennifer; Zhu, Carolyn W; Kaplan, Erin K; Zuber, Jeffrey K; Waters, Teresa M
2017-05-01
Examine caregiver and care recipient healthcare costs associated with caregivers' participation in Resources for Enhancing Alzheimer's Caregivers Health (REACH II or REACH VA) behavioral interventions to improve coping skills and care recipient management. RCT (REACH II); propensity-score matched, retrospective cohort study (REACH VA). Five community sites (REACH II); 24 VA facilities (REACH VA). Care recipients with Alzheimer's disease and related dementias (ADRD) and their caregivers who participated in REACH II study (analysis sample of 110 caregivers and 197 care recipients); care recipients whose caregivers participated in REACH VA and a propensity matched control group (analysis sample of 491). Previously collected data plus Medicare expenditures (REACH II) and VA costs plus Medicare expenditures (REACH VA). There was no increase in VA or Medicare expenditures for care recipients or their caregivers who participated in either REACH intervention. For VA care recipients, REACH was associated with significantly lower total VA costs of care (33.6%). VA caregiver cost data was not available. In previous research, both REACH II and REACH VA have been shown to provide benefit for dementia caregivers at a cost of less than $5/day; however, concerns about additional healthcare costs may have hindered REACH's widespread adoption. Neither REACH intervention was associated with additional healthcare costs for caregivers or patients; in fact, for VA patients, there were significantly lower healthcare costs. The VA costs savings may be related to the addition of a structured format for addressing the caregiver's role in managing complex ADRD care to an existing, integrated care system. These findings suggest that behavioral interventions are a viable mechanism to support burdened dementia caregivers without additional healthcare costs. © 2017, Copyright the Authors Journal compilation © 2017, The American Geriatrics Society.
Fernández, Ignacio; Darias, Maria; Andree, Karl B; Mazurais, David; Zambonino-Infante, Jose Luís; Gisbert, Enric
2011-02-09
Vitamin A (VA) has a key role in vertebrate morphogenesis, determining body patterning and growth through the control of cell proliferation and differentiation processes. VA regulates primary molecular pathways of those processes by the binding of its active metabolite (retinoic acid) to two types of specific nuclear receptors: retinoic acid receptors (RARs) and retinoid X receptors (RXRs), which promote transcription of downstream target genes. This process is well known in most of higher vertebrates; however, scarce information is available regarding fishes. Therefore, in order to gain further knowledge of fish larval development and its disruption by nutritional VA imbalance, the relative expression of some RARs and RXRs, as well as several genes involved in morpho- and skeletogenesis such as peroxisome proliferator-activated receptors (PPARA, PPARB and PPARG); retinol-binding protein (RBP); insulin-like growth factors I and II (IGF1 and IGF2, respectively); bone morphogenetic protein 2 (Bmp2); transforming growth factor β-1 (TGFB1); and genes encoding different extracellular matrix (ECM) proteins such as matrix Gla protein (mgp), osteocalcin (bglap), osteopontin (SPP1), secreted protein acidic and rich in cysteine (SPARC) and type I collagen α1 chain (COL1A1) have been studied in gilthead sea bream. During gilthead sea bream larval development, specific expression profiles for each gene were tightly regulated during fish morphogenesis and correlated with specific morphogenetic events and tissue development. Dietary hypervitaminosis A during early larval development disrupted the normal gene expression profile for genes involved in RA signalling (RARA), VA homeostasis (RBP) and several genes encoding ECM proteins that are linked to skeletogenesis, such as bglap and mgp. Present data reflects the specific gene expression patterns of several genes involved in larval fish RA signalling and skeletogenesis; and how specific gene disruption induced by a nutritional VA imbalance underlie the skeletal deformities. Our results are of basic interest for fish VA signalling and point out some of the potential molecular players involved in fish skeletogenesis. Increased incidences of skeletal deformities in gilthead sea bream fed with hypervitaminosis A were the likely ultimate consequence of specific gene expression disruption at critical development stages.
2011-01-01
Background Vitamin A (VA) has a key role in vertebrate morphogenesis, determining body patterning and growth through the control of cell proliferation and differentiation processes. VA regulates primary molecular pathways of those processes by the binding of its active metabolite (retinoic acid) to two types of specific nuclear receptors: retinoic acid receptors (RARs) and retinoid X receptors (RXRs), which promote transcription of downstream target genes. This process is well known in most of higher vertebrates; however, scarce information is available regarding fishes. Therefore, in order to gain further knowledge of fish larval development and its disruption by nutritional VA imbalance, the relative expression of some RARs and RXRs, as well as several genes involved in morpho- and skeletogenesis such as peroxisome proliferator-activated receptors (PPARA, PPARB and PPARG); retinol-binding protein (RBP); insulin-like growth factors I and II (IGF1 and IGF2, respectively); bone morphogenetic protein 2 (Bmp2); transforming growth factor β-1 (TGFB1); and genes encoding different extracellular matrix (ECM) proteins such as matrix Gla protein (mgp), osteocalcin (bglap), osteopontin (SPP1), secreted protein acidic and rich in cysteine (SPARC) and type I collagen α1 chain (COL1A1) have been studied in gilthead sea bream. Results During gilthead sea bream larval development, specific expression profiles for each gene were tightly regulated during fish morphogenesis and correlated with specific morphogenetic events and tissue development. Dietary hypervitaminosis A during early larval development disrupted the normal gene expression profile for genes involved in RA signalling (RARA), VA homeostasis (RBP) and several genes encoding ECM proteins that are linked to skeletogenesis, such as bglap and mgp. Conclusions Present data reflects the specific gene expression patterns of several genes involved in larval fish RA signalling and skeletogenesis; and how specific gene disruption induced by a nutritional VA imbalance underlie the skeletal deformities. Our results are of basic interest for fish VA signalling and point out some of the potential molecular players involved in fish skeletogenesis. Increased incidences of skeletal deformities in gilthead sea bream fed with hypervitaminosis A were the likely ultimate consequence of specific gene expression disruption at critical development stages. PMID:21306609
Girard, Amy Webb; Grant, Frederick; Watkinson, Michelle; Okuku, Haile Selassie; Wanjala, Rose; Cole, Donald; Levin, Carol; Low, Jan
2017-05-01
Background: Orange-fleshed sweet potato (OFSP) improves vitamin A (VA) status of young children; research with pregnant and lactating women is limited. Objective: We examined the effectiveness of the Mama SASHA (Sweetpotato Action for Security and Health in Africa) program to improve nutrition knowledge, diets, and nutritional status of pregnant and lactating women (PLW) in Western Kenya. Methods: Eight health facilities were allocated to the Mama SASHA intervention or comparison arms. PLW in intervention facilities received enhanced nutrition counseling at health clinics, were linked with community-based maternal support groups, and received vouchers for OFSP vine cuttings. Control PLW received clinic-based nutrition counseling only. A total of 505 women in early and midpregnancy, attending their first antenatal care visit, and with no previous engagement in project activities were enrolled from the 8 facilities. Nutrition and health-seeking knowledge, food security, dietary patterns, and anthropometric measurements were collected at 4 time points at ≤9 mo postpartum. VA intakes were assessed with multipass 24-h recalls in a subsample of 206 mothers at 8-10 mo postpartum. VA status was assessed by using serum retinol-binding protein (RBP). Impacts were estimated with multilevel mixed models adjusted for clustering and differences at enrollment. Results: At enrollment, 22.9% of women had RBP <1.17 μmol/L. By 9 mo postpartum, intervention women had significantly higher intakes of VA [adjusted difference = 297.0 retinol activity equivalent (RAE) units; 95% CI: 82, 513 RAE units; P = 0.01; n = 206], greater consumption of VA-rich fruit and vegetables in the previous 7 d (difference-in-difference estimate: 0.40 d; 95% CI: 0.23, 0.56 d; P < 0.01), and a 45% reduction in the odds of RBP <1.17 μmol/L (OR: 0.55; 95% CI: 0.33, 0.92; P = 0.01). Conclusion: Promotion of OFSP to PLW through health services is a feasible strategy to improve women's nutrition knowledge, VA intakes, and maternal RBP.
Goalpha regulates volatile anesthetic action in Caenorhabditis elegans.
van Swinderen, B; Metz, L B; Shebester, L D; Mendel, J E; Sternberg, P W; Crowder, C M
2001-01-01
To identify genes controlling volatile anesthetic (VA) action, we have screened through existing Caenorhabditis elegans mutants and found that strains with a reduction in Go signaling are VA resistant. Loss-of-function mutants of the gene goa-1, which codes for the alpha-subunit of Go, have EC(50)s for the VA isoflurane of 1.7- to 2.4-fold that of wild type. Strains overexpressing egl-10, which codes for an RGS protein negatively regulating goa-1, are also isoflurane resistant. However, sensitivity to halothane, a structurally distinct VA, is differentially affected by Go pathway mutants. The RGS overexpressing strains, a goa-1 missense mutant found to carry a novel mutation near the GTP-binding domain, and eat-16(rf) mutants, which suppress goa-1(gf) mutations, are all halothane resistant; goa-1(null) mutants have wild-type sensitivities. Double mutant strains carrying mutations in both goa-1 and unc-64, which codes for a neuronal syntaxin previously found to regulate VA sensitivity, show that the syntaxin mutant phenotypes depend in part on goa-1 expression. Pharmacological assays using the cholinesterase inhibitor aldicarb suggest that VAs and GOA-1 similarly downregulate cholinergic neurotransmitter release in C. elegans. Thus, the mechanism of action of VAs in C. elegans is regulated by Goalpha, and presynaptic Goalpha-effectors are candidate VA molecular targets. PMID:11404329
Tsai, Jack; Kasprow, Wesley J; Rosenheck, Robert A
2013-12-01
We identified risk and need profiles of homeless veterans and examined the relation between profiles and referrals and admissions to Department of Veterans Affairs (VA) homeless service programs. We examined data from the VA's new Homeless Operations Management and Evaluation System on 120,852 veterans from 142 sites nationally in 2011 and 2012 using latent class analyses based on 9 homeless risk factors. The final 4-class solution compared both referral and admission to VA homeless services. We identified 4 latent classes: relatively few problems, dual diagnosis, poverty-substance abuse-incarceration, and disabling medical problems. Homeless veterans in the first group were more likely to be admitted to the VA's permanent supportive housing program, whereas those in the second group were more likely to be admitted to more restrictive VA residential treatment. Homeless veterans in the third group were more likely to be admitted to the VA's prisoner re-entry program, and those in the fourth group were more likely to be directed to VA medical services. The heterogeneous risk and need profiles of homeless veterans supported the diversity of VA homeless services and encouraged the development of specialized services to meet their diverse needs.
Loss of Drosophila pheromone reverses its role in sexual communication in Drosophila suzukii
Dekker, Teun; Revadi, Santosh; Mansourian, Suzan; Ramasamy, Sukanya; Lebreton, Sebastien; Becher, Paul G.; Angeli, Sergio; Rota-Stabelli, Omar; Anfora, Gianfranco
2015-01-01
The Drosophila pheromone cis-11-octadecenyl acetate (cVA) is used as pheromone throughout the melanogaster group and fulfils a primary role in sexual and social behaviours. Here, we found that Drosophila suzukii, an invasive pest that oviposits in undamaged ripe fruit, does not produce cVA. In fact, its production site, the ejaculatory bulb, is atrophied. Despite loss of cVA production, its receptor, Or67d, and cognate sensillum, T1, which are essential in cVA-mediated behaviours, were fully functional. However, T1 expression was dramatically reduced in D. suzukii, and the corresponding antennal lobe glomerulus, DA1, minute. Behavioural responses to cVA depend on the input balance of Or67d neurons (driving cVA-mediated behaviours) and Or65a neurons (inhibiting cVA-mediated behaviours). Accordingly, the shifted input balance in D. suzukii has reversed cVA's role in sexual behaviour: perfuming D. suzukii males with Drosophila melanogaster equivalents of cVA strongly reduced mating rates. cVA has thus evolved from a generic sex pheromone to a heterospecific signal that disrupts mating in D. suzukii, a saltational shift, mediated through offsetting the input balance that is highly conserved in congeneric species. This study underlines that dramatic changes in a species' sensory preference can result from rather ‘simple’ numerical shifts in underlying neural circuits. PMID:25716789
38 CFR 39.19 - General requirements for site selection and construction of veterans' cemeteries.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) AID TO STATES FOR ESTABLISHMENT, EXPANSION, AND... VA should be documented and justified in the application. (d) The space criteria and area... requirements of the project but are subject to approval by VA. Substantial deviation from the space or area...
ERIC Educational Resources Information Center
Newcomb, Robert D.; Hill, Richard M.
1993-01-01
The Ohio State University School of Optometry affiliation with four Veterans Administration (VA) health care facilities is characterized by a central governing committee, regular faculty appointments for all participating VA staff, substantial interaction with each site, strong orientation for rotating senior optometry students, and joint…
Yokokawa, Miki; Good, Eric; Crawford, Thomas; Chugh, Aman; Pelosi, Frank; Latchamsetty, Rakesh; Jongnarangsin, Krit; Ghanbari, Hamid; Oral, Hakan; Morady, Fred; Bogun, Frank
2013-08-01
The right ventricular outflow tract (RVOT) is the most common site of origin of ventricular arrhythmias (VAs) in patients with idiopathic VAs. A left bundle branch block, inferior axis morphology arrhythmia is the hallmark of RVOT arrhythmias. VAs from other sites of origin can mimic RVOT VAs, and ablation in the RVOT typically fails for these VAs. To analyze reasons for failed ablations of RVOT-like VAs. Among a consecutive series of 197 patients with an RVOT-like electrocardiographic (ECG) morphology who were referred for ablation, 38 patients (13 men; age 46 ± 14 years; left ventricular ejection fraction 47% ± 14%) in whom a prior procedure failed within the RVOT underwent a second ablation procedure. ECG characteristics of the VA were compared to a consecutive series of 50 patients with RVOT VAs. The origin of the VA was identified in 95% of the patients. In 28 of 38 (74%) patients, the arrhythmia origin was not in the RVOT. The VA originated from intramural sites (n = 8, 21%), the pulmonary arteries (n = 7, 18%), the aortic cusps (n = 6, 16%), and the epicardium (n = 5, 13%). The origin was within the RVOT in 10 (26%) patients. In 2 (5%) patients, the origin could not be identified despite biventricular, aortic, and epicardial mapping. The VA was eliminated in 34 of 38 (89%) patients with repeat procedures. The ECG features of patients with failed RVOT-like arrhythmias were different from the characteristics of RVOT arrhythmias. In patients in whom ablation of a VA with an RVOT-like appearance fails, mapping of the pulmonary artery, the aortic cusps, the epicardium, the left ventricular outflow tract, and the aortic cusps will help identify the correct site of origin. The 12-lead ECG is helpful in differentiating these VAs from RVOT VAs. Copyright © 2013 Heart Rhythm Society. All rights reserved.
Innovative approaches to vitamin A assessment.
Craft, N E
2001-05-01
The health and sight of millions of children are compromised each year as a consequence of vitamin A (VA) deficiency. Serum retinol is the most commonly used indicator of VA status. Unfortunately, its use is impractical for national surveys because it involves collection of venous blood, centrifugation and frozen storage before analysis. To make VA assessment more practical, we have developed approaches incorporating dried blood spots (DBS) or portable instrumentation. DBS have been used as a sample matrix to screen neonates for many biochemical compounds. Until recently, it was not thought that VA was stable in DBS. However, we demonstrated that the measure of DBS retinol correlates well with serum retinol in both healthy adults (r(2) = 0.88-0.90) and compromised populations (r(2) = 0.73-0.84). Compared with serum retinol, the sensitivity and specificity of detecting VA deficiency by DBS retinol range from 73 to 93% and from 90 to 100%, respectively. Although few data are available, retinol binding protein (RBP) can also be measured in DBS. RBP has been used as a surrogate marker for serum retinol. Correlations coefficients (r(2)) between serum RBP and serum retinol range from 0.4 to 0.8. In addition, work has been done to develop portable instrumentation to measure VA status in the field. A fluorometer has been optimized for VA fluorescence and is linear into the deficient range for the direct fluorimetric measurement of serum holo-RBP. Progress is being made to use the instrument to directly measure holo-RBP in a drop of whole blood.
Results of a Regional Effort to Improve Warfarin Management.
Rose, Adam J; Park, Angela; Gillespie, Christopher; Van Deusen Lukas, Carol; Ozonoff, Al; Petrakis, Beth Ann; Reisman, Joel I; Borzecki, Ann M; Benedict, Ashley J; Lukesh, William N; Schmoke, Timothy J; Jones, Ellen A; Morreale, Anthony P; Ourth, Heather L; Schlosser, James E; Mayo-Smith, Michael F; Allen, Arthur L; Witt, Daniel M; Helfrich, Christian D; McCullough, Megan B
2017-05-01
Improved anticoagulation control with warfarin reduces adverse events and represents a target for quality improvement. No previous study has described an effort to improve anticoagulation control across a health system. To describe the results of an effort to improve anticoagulation control in the New England region of the Veterans Health Administration (VA). Our intervention encompassed 8 VA sites managing warfarin for more than 5000 patients in New England (Veterans Integrated Service Network 1 [VISN 1]). We provided sites with a system to measure processes of care, along with targeted audit and feedback. We focused on processes of care associated with site-level anticoagulation control, including prompt follow-up after out-of-range international normalized ratio (INR) values, minimizing loss to follow-up, and use of guideline-concordant INR target ranges. We used a difference-in-differences (DID) model to examine changes in anticoagulation control, measured as percentage time in therapeutic range (TTR), as well as process measures and compared VISN 1 sites with 116 VA sites located outside VISN 1. VISN 1 sites improved on TTR, our main indicator of quality, from 66.4% to 69.2%, whereas sites outside VISN 1 improved from 65.9% to 66.4% (DID 2.3%, P < 0.001). Improvement in TTR correlated strongly with the extent of improvement on process-of-care measures, which varied widely across VISN 1 sites. A regional quality improvement initiative, using performance measurement with audit and feedback, improved TTR by 2.3% more than control sites, which is a clinically important difference. Improving relevant processes of care can improve outcomes for patients receiving warfarin.
Heffner, Kathi L; Crean, Hugh F; Kemp, Jan E
2016-05-01
Interest in meditation to manage posttraumatic stress disorder (PTSD) symptoms is increasing. Few studies have examined the effectiveness of meditation programs offered to Veterans within Department of Veterans Affairs (VA) mental health services. The current study addresses this gap using data from a multisite VA demonstration project. Evaluation data collected at 6 VA sites (N = 391 Veterans) before and after a meditation program, and a treatment-as-usual (TAU) program, were examined here using random effects meta-analyses. Site-specific and aggregate between group effect sizes comparing meditation programs to TAU were determined for PTSD severity measured by clinical interview and self-report. Additional outcomes included experiential avoidance and mindfulness. In aggregate, analyses showed medium effect sizes for meditation programs compared to TAU for PTSD severity (clinical interview: effect size (ES) = -0.32; self-report: ES = -0.39). Similarly sized effects of meditation programs were found for overall mindfulness (ES = 0.41) and 1 specific aspect of mindfulness, nonreactivity to inner experience (ES = .37). Additional findings suggested meditation type and program completion differences each moderated program effects. VA-sponsored meditation programs show promise for reducing PTSD severity in Veterans receiving mental health services. Where meditation training fits within mental health services, and for whom programs will be of interest and effective, require further clarification. (PsycINFO Database Record (c) 2016 APA, all rights reserved).
Care coordination in epilepsy: Measuring neurologists' connectivity using social network analysis.
Altalib, Hamada Hamid; Fenton, Brenda T; Cheung, Kei-Hoi; Pugh, Mary Jo V; Bates, Jonathan; Valente, Thomas W; Kerns, Robert D; Brandt, Cynthia A
2017-08-01
The study sought to quantify coordination of epilepsy care, over time, between neurologists and other health care providers using social network analysis (SNA). The Veterans Health Administration (VA) instituted an Epilepsy Center of Excellence (ECOE) model in 2008 to enhance care coordination between neurologists and other health care providers. Provider networks in the 16 VA ECOE facilities (hub sites) were compared to a subset of 33 VA facilities formally affiliated (consortium sites) and 14 unaffiliated VA facilities. The number of connections between neurologists and each provider (node degree) was measured by shared epilepsy patients and tallied to generate estimates at the facility level separately within and across facilities. Mixed models were used to compare change of facility-level node degree over time across the three facility types, adjusted for number of providers per facility. Over the time period 2000-2013, epilepsy care coordination both within and across facilities significantly increased. These increases were seen in all three types of facilities namely hub, consortium, and unaffiliated site, relatively equally. The increase in connectivity was more dramatic with providers across facilities compared to providers within the same facilities. Establishment of the ECOE hub and spoke model contributed to an increase in epilepsy care coordination both within and across facilities from 2000 to 2013, but there was substantial variation across different facilities. SNA is a tool that may help measure coordination of specialty care. Published by Elsevier Inc.
Facts about Infectious Diseases (ID)
... of microorganisms will emerge. Infectious Diseases Society of America 1300 Wilson Boulevard Suite 300 Arlington, VA 22209 | ... Us © Copyright IDSA 2018 Infectious Diseases Society of America Full Site Mobile Site
Herrera, Samantha; Enuameh, Yeetey; Adjei, George; Ae-Ngibise, Kenneth Ayuurebobi; Asante, Kwaku Poku; Sankoh, Osman; Owusu-Agyei, Seth; Yé, Yazoume
2017-10-23
Lack of valid and reliable data on malaria deaths continues to be a problem that plagues the global health community. To address this gap, the verbal autopsy (VA) method was developed to ascertain cause of death at the population level. Despite the adoption and wide use of VA, there are many recognized limitations of VA tools and methods, especially for measuring malaria mortality. This study synthesizes the strengths and limitations of existing VA tools and methods for measuring malaria mortality (MM) in low- and middle-income countries through a systematic literature review. The authors searched PubMed, Cochrane Library, Popline, WHOLIS, Google Scholar, and INDEPTH Network Health and Demographic Surveillance System sites' websites from 1 January 1990 to 15 January 2016 for articles and reports on MM measurement through VA. article presented results from a VA study where malaria was a cause of death; article discussed limitations/challenges related to measurement of MM through VA. Two authors independently searched the databases and websites and conducted a synthesis of articles using a standard matrix. The authors identified 828 publications; 88 were included in the final review. Most publications were VA studies; others were systematic reviews discussing VA tools or methods; editorials or commentaries; and studies using VA data to develop MM estimates. The main limitation were low sensitivity and specificity of VA tools for measuring MM. Other limitations included lack of standardized VA tools and methods, lack of a 'true' gold standard to assess accuracy of VA malaria mortality. Existing VA tools and methods for measuring MM have limitations. Given the need for data to measure progress toward the World Health Organization's Global Technical Strategy for Malaria 2016-2030 goals, the malaria community should define strategies for improving MM estimates, including exploring whether VA tools and methods could be further improved. Longer term strategies should focus on improving countries' vital registration systems for more robust and timely cause of death data.
Bando, Yasuhiko; Yamamoto, Miyuki; Sakiyama, Koji; Sakashita, Hide; Taira, Fuyoko; Miyake, Genki; Iseki, Shoichi; Owada, Yuji; Amano, Osamu
2017-09-01
Septoclasts, which are mononuclear and spindle-shaped cells with many processes, have been considered to resorb the transverse septa of the growth plate (GP) cartilage at the chondro-osseous junction (COJ). We previously reported the expression of epidermal-type fatty acid-binding protein (E-FABP, FABP5) and localization of peroxisome proliferator-activated receptor (PPAR)β/δ, which mediates the cell survival or proliferation, in septoclasts. On the other hand, retinoic acid (RA) can bind to E-FABP and is stored abundantly in the GP cartilage. From these information, it is possible to hypothesize that RA in the GP is incorporated into septoclasts during the cartilage resorption and regulates the growth and/or death of septoclasts. To clarify the mechanism of the cartilage resorption induced by RA, we administered an overdose of RA or its precursor vitamin A (VA)-deficient diet to young mice. In mice of both RA excess and VA deficiency, septoclasts decreased in the number and cell size in association with shorter and lesser processes than those in normal mice, suggesting a substantial suppression of resorption by septoclasts in the GP cartilage. Lack of PPARβ/δ-expression, TUNEL reaction, RA receptor (RAR)β, and cellular retinoic acid-binding protein (CRABP)-II were induced in E-FABP-positive septoclasts under RA excess, suggesting the growth arrest/cell-death of septoclasts, whereas cartilage-derived retinoic acid-sensitive protein (CD-RAP) inducing the cell growth arrest or morphological changes was induced in septoclasts under VA deficiency. These results support and do not conflict with our hypothesis, suggesting that endogenous RA in the GP is possibly incorporated in septoclasts and utilized to regulate the activity of septoclasts resorbing the GP cartilage.
Clark, David J; Chakraborty, Aabir; Roebuck, Derek J; Thompson, Dominic N P
2016-07-01
Ventriculoatrial (VA) shunts are commonly used as a second-line treatment of hydrocephalus when the peritoneum is an unsuitable site for the distal catheter. Many centres now utilise ultrasound and interventional radiology techniques to aid placement of the distal catheter. The purpose of this study was to conduct a contemporary audit of VA shunting in children using interventional radiology techniques for placement of the distal catheter. A retrospective analysis of all patients who had VA shunts inserted between June 2000 and June 2010 was conducted using a prospectively updated surgical database and case notes review. Ninety-four VA shunts were inserted in 38 patients. Thirty-seven patients had been treated initially with ventriculoperitoneal (VP) shunts. Twenty-two patients required at least 1 shunt revision (58 %). The 6-month, 1- and 2-year shunt survival rates were 53, 43 and 27 %, respectively. Blockage was the commonest reason for shunt failure (68 %). The site of failure was proximal (ventricular catheter +/- valve) in 32 % and distal (atrial catheter) in 21 % of cases. The overall infection rate was 6 % per procedure and 11 % per patient. There were 7 deaths, of which 3 were shunt related. VA shunting provides a viable second-line option for shunt placement in complex hydrocephalus. The causes of shunt failure (blockage, infection and equipment failure) are similar to VP shunting though shunt survival rates are inferior to VP shunts. Ultrasound guided VA shunt placement provides a relatively safe, second-line alternative to the placement of a ventriculoperitoneal shunt when this route is unsuitable.
Bean-Mayberry, Bevanne; Yano, Elizabeth M; Bayliss, Nichole; Navratil, Judith; Weisman, Carol S; Scholle, Sarah Hudson
2007-11-01
Women's healthcare has historically been fragmented, given the artificial separation of reproductive care from general medical care. Aiming to advance new care models for delivery of comprehensive, integrated clinical care for women, two federal agencies-the U.S. Department of Health and Human Services (DHHS) and Department of Veterans Affairs (VA)-launched specialized women's health centers (WHCs). Exemplars of comprehensive service delivery, these originally federally funded centers have served as foundations for innovations in delivering comprehensive care to women in diverse practice settings. Little is known, however, about details of their organization, staffing, practice arrangements, and service availability that might inform adoption of similar models in the community. Using comparable key informant surveys, we collected organizational data from the DHHS National Centers of Excellence (CoE) (n = 13) and the original VA comprehensive WHC's (n = 8). We abstracted supplemental data (e.g., academic affiliation) from the 2001 American Hospital Association (AHA) survey. All DHHS and VA women's health programs served urban areas, and nearly all had academic partnerships. DHHS centers had three times the average caseload as did VA centers. Preventive cancer screening and general reproductive services were uniformly available at all centers, although DHHS centers offered extensive reproductive services on-site more frequently, and VA centers more often had on-site mental healthcare. The DHHS and VA comprehensive WHCs share similar missions and comparable organization, education, and clinical services, demonstrating their commitment to reducing fragmented service delivery. Their common structural components present opportunities for further advancing women's quality of care across other systems of care.
Zagré, No l-Marie; Delisle, Hélène; Tarini, Ann; Delpeuch, Francis
2002-01-01
This paper focuses on changes in vitamin A (VA) intakes as part of the evaluation of a pilot project on social marketing of red palm oil (RPO) as a VA supplement for mothers and children in central-north Burkina Faso. The objectives of the 30-month project are to demonstrate the feasibility and effectiveness of introducing RPO in non-consuming areas. RPO is collected from women in the South-West region and it is sold in project sites by village volunteers. RPO is promoted by community workers trained in persuasive communication and social marketing. The target population is free to buy and consume RPO. Evaluation design includes data collected at onset, then 12 and 24 months later, from the same sample of 210 mothers and their children randomly selected in seven project sites. Children were 1 to 3 years old at onset. Blood samples were collected at baseline from mothers and children for serum retinol determination by HPLC. VA intakes are estimated by a semi-quantitative food frequency questionnaire, using the conventional beta-carotene to retinol conversion factors and the newly revised lower factors. VA deficiency is a major public health problem in the area: 64% of mothers and 85% of children had serum retinol concentrations < 0,70 mumol/l at baseline. VA came mainly from plant foods, particularly fruits and dark green vegetables which provided more than 90% of the dietary VA at onset of the project. Mean vitamin A intakes are low. We found 138 106 mug ER for the children and 302 +/- 235 microg ER for the mothers with conventional factors and 64 +/- 58 microg ER and 133 +/- 162 microg ER, respectively, with the revised factors. One year later, one third of respondents had consumed RPO in the previous week, and it supplied around 56% of the VA intake of children and 67% of mothers (36% and 46% respectively for the whole group). VA intakes were significantly increased at 510 +/- 493 microg ER and 801 +/- 913 microg ER for the children and their mothers respectively (347 +/- 443 microg ER and 568 +/- 803 microg ER respectively, with the revised factors). Analyzing serum retinol and dietary data collected at baseline, it was found that VA intakes < 62,5% of safe level of intake were highly sensitive to low serum retinol (< 0,70 micromol/l) and using revised conversion factors to assess total VA intake slightly enhanced sensitivity. The proportion of mothers and children at risk of inadequate VA intake changed from nearly 100% at baseline to 60% one year later. The results show that promoting RPO (and other VA rich foods) was effective in improving VA intakes. This improvement will hopefully be sustained and even further enhanced during the remaining 12 months of the project, after which repeated measurement of serum retinol and VA intakes will allow the actual impact of the project to be truly assessed.
Infectious Disease Specialist: What Is an Infectious Disease Specialist?
... More: Facts about ID Infectious Diseases Society of America 1300 Wilson Boulevard Suite 300 Arlington, VA 22209 | ... Us © Copyright IDSA 2018 Infectious Diseases Society of America Full Site Mobile Site
Tan, Libo; Wray, Amanda E.; Ross, A. Catharine
2012-01-01
Coadministration of retinoic acid (RA) and polyinosinic acid:polycytidylic acid (PIC) has been shown to cooperatively enhance the anti–tetanus toxoid (anti-TT) vaccine response in adult mice. Germinal center formation in the spleen is critical for a normal antibody response. Recent studies have identified Stimulated by Retinoic Acid-6 (Stra6) as the cell membrane receptor for retinol-binding protein (RBP) in many organs, including spleen. The objectives of the present studies were to test whether orally administered vitamin A (VA) itself, either alone or combined with RA, and/or treatment with PIC regulates Stra6 gene expression in mouse spleen and, concomitantly, antibody production. Eight-week-old C57BL/6 mice were immunized with TT. In an initial kinetic study, oral VA (6 mg/kg) increased anti-TT IgM and IgG production as well as splenic Stra6 mRNA expression. In treatment studies that were analyzed 9 d postimmunization, retinoids including VA, RA, VA and RA combined, and PIC significantly increased plasma anti-TT IgM and IgG (P < 0.05) and splenic Stra6 mRNA (P < 0.05). Treatments that included PIC elevated plasma anti-TT IgM and IgG concentrations >20-fold (P < 0.01). Immunohistochemistry of STRA6 protein in mouse spleen confirmed its increase after immunization and retinoid treatment. In conclusion, retinoid treatments that included VA, RA, VA and RA combined, and the combination of retinoid and PIC stimulated the expression of Stra6 in spleen, which potentially could increase the local uptake of retinol. Concomitantly, these treatments increased the systemic antigen-specific antibody response. The ability of oral retinoids to stimulate systemic immunity has implications for public health and therapeutic use of VA. PMID:22739370
HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs
Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne
2015-01-01
Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122
HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.
Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne
2015-01-01
Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.
Lipschitz, Jessica M; Benzer, Justin K; Miller, Christopher; Easley, Siena R; Leyson, Jenniffer; Post, Edward P; Burgess, James F
2017-10-10
The collaborative care model is an evidence-based practice for treatment of depression in which designated care managers provide clinical services, often by telephone. However, the collaborative care model is infrequently adopted in the Department of Veterans Affairs (VA). Almost all VA medical centers have adopted a co-located or embedded approach to integrating mental health care for primary care patients. Some VA medical centers have also adopted a telephone-based collaborative care model where depression care managers support patient education, patient activation, and monitoring of adherence and progress over time. This study evaluated two research questions: (1) What does a dedicated care manager offer in addition to an embedded-only model? (2) What are the barriers to implementing a dedicated depression care manager? This study involved 15 qualitative, multi-disciplinary, key informant interviews at two VA medical centers where reimbursement options were the same- both with embedded mental health staff, but one with a depression care manager. Participant interviews were recorded and transcribed. Thematic analysis was used to identify descriptive and analytical themes. Findings suggested that some of the core functions of depression care management are provided as part of embedded-only mental health care. However, formal structural attention to care management may improve the reliability of care management functions, in particular monitoring of progress over time. Barriers to optimal implementation were identified at both sites. Themes from the care management site included finding assertive care managers to hire, cross-discipline integration and collaboration, and primary care provider burden. Themes from interviews at the embedded site included difficulty getting care management on leaders' agendas amidst competing priorities and logistics (staffing and space). Providers and administrators see depression care management as a valuable healthcare service that improves patient care. Barriers to implementation may be addressed by team-building interventions to improve cross-discipline integration and communication. Findings from this study are limited in scope to the VA healthcare system. Future investigation of whether alternative barriers exist in implementation of depression care management programs in non-VA hospital systems, where reimbursement rates may be a more prominent concern, would be valuable.
Perignon, Marlène; Fiorentino, Marion; Kuong, Khov; Dijkhuizen, Marjoleine A; Burja, Kurt; Parker, Megan; Chamnan, Chhoun; Berger, Jacques; Wieringa, Frank T
2016-01-07
In Cambodia, micronutrient deficiencies remain a critical public health problem. Our objective was to evaluate the impact of multi-micronutrient fortified rice (MMFR) formulations, distributed through a World Food Program school-meals program (WFP-SMP), on the hemoglobin concentrations and iron and vitamin A (VA) status of Cambodian schoolchildren. The FORISCA-UltraRice+NutriRice study was a double-blind, cluster-randomized, placebo-controlled trial. Sixteen schools participating in WFP-SMP were randomly assigned to receive extrusion-fortified rice (UltraRice Original, UltraRice New (URN), or NutriRice) or unfortified rice (placebo) six days a week for six months. Four additional schools not participating in WFP-SMP were randomly selected as controls. A total of 2440 schoolchildren (6-16 years old) participated in the biochemical study. Hemoglobin, iron status, estimated using inflammation-adjusted ferritin and transferrin receptors concentrations, and VA status, assessed using inflammation-adjusted retinol-binding protein concentration, were measured at the baseline, as well as at three and six months. Baseline prevalence of anemia, depleted iron stores, tissue iron deficiency, marginal VA status and VA deficiency were 15.6%, 1.4%, 51.0%, 7.9%, and 0.7%, respectively. The strongest risk factors for anemia were hemoglobinopathy, VA deficiency, and depleted iron stores (all p < 0.01). After six months, children receiving NutriRice and URN had 4 and 5 times less risk of low VA status, respectively, in comparison to the placebo group. Hemoglobin significantly increased (+0.8 g/L) after three months for the URN group in comparison to the placebo group; however, this difference was no longer significant after six months, except for children without inflammation. MMFR containing VA effectively improved the VA status of schoolchildren. The impact on hemoglobin and iron status was limited, partly by sub-clinical inflammation. MMFR combined with non-nutritional approaches addressing anemia and inflammation should be further investigated.
National Structural Survey of Veterans Affairs Home-Based Primary Care Programs.
Karuza, Jurgis; Gillespie, Suzanne M; Olsan, Tobie; Cai, Xeuya; Dang, Stuti; Intrator, Orna; Li, Jiejin; Gao, Shan; Kinosian, Bruce; Edes, Thomas
2017-12-01
To describe the current structural and practice characteristics of the Department of Veterans Affairs (VA) Home-Based Primary Care (HBPC) program. We designed a national survey and surveyed HBPC program directors on-line using REDCap. We received 236 surveys from 394 identified HBPC sites (60% response rate). HBPC site characteristics were quantified using closed-ended formats. HBPC program directors were most often registered nurses, and HBPC programs primarily served veterans with complex chronic illnesses that were at high risk of hospitalization and nursing home care. Primary care was delivered using interdisciplinary teams, with nurses, social workers, and registered dietitians as team members in more than 90% of the sites. Most often, nurse practitioners were the principal primary care providers (PCPs), typically working with nurse case managers. Nearly 60% of the sites reported dual PCPs involving VA and community-based physicians. Nearly all sites provided access to a core set of comprehensive services and programs (e.g., case management, supportive home health care). At the same time, there were variations according to site (e.g., size, location (urban, rural), use of non-VA hospitals, primary care models used). HBPC sites reflected the rationale and mission of HBPC by focusing on complex chronic illness of home-based veterans and providing comprehensive primary care using interdisciplinary teams. Our next series of studies will examine how HBPC site structural characteristics and care models are related to the processes and outcomes of care to determine whether there are best practice standards that define an optimal HBPC structure and care model or whether multiple approaches to HBPC better serve the needs of veterans. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.
Chakravarthy, Usha; Bailey, Clare C; Johnston, Robert L; McKibbin, Martin; Khan, Rehna S; Mahmood, Sajjad; Downey, Louise; Dhingra, Narendra; Brand, Christopher; Brittain, Christopher J; Willis, Jeffrey R; Rabhi, Sarah; Muthutantri, Anushini; Cantrell, Ronald A
2018-06-01
To understand levels of disease burden and progression in a real-world setting among patients from the United Kingdom with bilateral geographic atrophy (GA) secondary to age-related macular degeneration (AMD). Retrospective cohort analysis of a multicenter electronic medical record (EMR) database. Patients who were aged ≥50 years with bilateral GA and no history of choroidal neovascularization (CNV) and who attended 1 of 10 clinical sites using the EMR. A deidentified data set was constructed from the records held at the 10 sites. An algorithm was used to extract cases with a GA diagnosis, of which 1901 had bilateral GA and form the basis of this report. A sample of records randomly selected from each center was used to validate disease definitions. Progression to blindness (visual acuity [VA] <20 letters or Snellen 3/60 in the better-seeing eye), driving ineligibility (VA ≤70 letters or Snellen 6/12 in the better-seeing eye), progression to CNV, loss of 10 or more letters, and mean change in VA over time. At first record of GA, 7.1% had a VA in the better-seeing eye equal to or lower than the cutoff for blindness registration and 71.1% had a VA that would have rendered them ineligible to drive. Over time, 16% became legally blind (median time to outcome, 6.2 years) and 66.7% became ineligible to drive (median time to outcome, 1.6 years). In the worse-seeing eye, 40.1% lost ≥10 letters in 2.4 years. Among patients with baseline and 24-month VA measurements, mean VA decline was 6.1 letters in the worse-seeing eye (n = 413) and 12.4 letters in the better-seeing eye (n = 414). The rate of progression to CNV in either eye was 7.4% per patient-year. At initial diagnosis, based on VA in the better-seeing eye, a high proportion of patients with bilateral GA were ineligible to drive and approximately 7% were eligible for UK blindness registration. The subsequent reduction in VA that occurred in the better-seeing eye would render a further two-thirds ineligible to drive. These findings emphasize the severity of the visual disability associated with GA secondary to AMD. Copyright © 2018 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.
Lew, Henry L; Poole, John H; Vanderploeg, Rodney D; Goodrich, Gregory L; Dekelboum, Sharon; Guillory, Sylvia B; Sigford, Barbara; Cifu, David X
2007-01-01
The conflicts in Iraq and Afghanistan have resulted in a new generation of combat survivors with complex physical injuries and emotional trauma. This article reports the initial implementation of the Polytrauma Network Site (PNS) clinic, which is a key component of the Department of Veterans Affairs (VA) Polytrauma System of Care and serves military personnel returning from combat. The PNS clinic in Palo Alto, California, is described to demonstrate the VA healthcare system's evolving effort to meet the clinical needs of this population. We summarize the following features of this interdisciplinary program: (1) sequential assessment, from initial traumatic brain injury screening throughout our catchment area to evaluation by the PNS clinic team, and (2) clinical evaluation results for the first 62 clinic patients. In summary, this population shows a high prevalence of postconcussion symptoms, posttraumatic stress, poor cognitive performance, head and back pain, auditory and visual symptoms, and problems with dizziness or balance. An anonymous patient feedback survey, which we used to fine-tune the clinic process, reflected high satisfaction with this new program. We hope that the lessons learned at one site will enhance the identification and treatment of veterans with polytrauma across the country.
Remediation System Evaluation, Greenwood Chemical Superfund Site
The Greenwood Chemical Site (“site”) is an inactive chemical manufacturing facility located inNewtown, Albemarle County, Virginia on VA Route 690 approximately 0.75 miles west of the town ofGreenwood, Virginia and approximately 20 miles west...
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1994-09-01
This report provides the input to and results of the Department of Energy (DOE) - Oak Ridge Operations (ORO) DOE Plutonium Environment, Safety and Health (ES & H) Vulnerability Assessment (VA) self-assessment performed by the Site Assessment Team (SAT) for the Oak Ridge National Laboratory (ORNL or X-10) and the Oak Ridge Y-12 Plant (Y-12) sites that are managed by Martin Marietta Energy Systems, Inc. (MMES). As initiated (March 15, 1994) by the Secretary of Energy, the objective of the VA is to identify and rank-order DOE-ES&H vulnerabilities associated for the purpose of decision making on the interim safe managementmore » and ultimate disposition of fissile materials. This assessment is directed at plutonium and other co-located transuranics in various forms.« less
Pan, Eric; Botts, Nathan; Jordan, Harmon; Olinger, Lois; Donahue, Margaret; Hsing, Nelson
2016-01-01
The U.S. Department of Veterans Affairs (VA) Veteran Health Information Exchange (VHIE, formerly Virtual Lifetime Electronic Record, or VLER) had been deployed at all VA sites and used to exchange clinical information with private sector healthcare partners nationally. This paper examined VHIE's effect on allergy documentation. Review of all inbound VHIE transactions in FY14 showed that VHIE use was associated with a nearly eight-fold increase in allergy documentation rate. Preliminary manual document review further showed that VA and partners had shared knowledge of only 38% ofpatient allergies, while VA had exclusive knowledge of another 58% ofpatient allergies, and partners had exclusive knowledge of the last 5% of patient allergies. To our knowledge, this is the first study that examined the effect of HIE on allergy documentation.
Pan, Eric; Botts, Nathan; Jordan, Harmon; Olinger, Lois; Donahue, Margaret; Hsing, Nelson
2016-01-01
The U.S. Department of Veterans Affairs (VA) Veteran Health Information Exchange (VHIE, formerly Virtual Lifetime Electronic Record, or VLER) had been deployed at all VA sites and used to exchange clinical information with private sector healthcare partners nationally. This paper examined VHIE’s effect on allergy documentation. Review of all inbound VHIE transactions in FY14 showed that VHIE use was associated with a nearly eight-fold increase in allergy documentation rate. Preliminary manual document review further showed that VA and partners had shared knowledge of only 38% ofpatient allergies, while VA had exclusive knowledge of another 58% ofpatient allergies, and partners had exclusive knowledge of the last 5% of patient allergies. To our knowledge, this is the first study that examined the effect of HIE on allergy documentation. PMID:28269897
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-12
... Company, Franklin Pulp & Paper Mill, Including On-Site Leased Workers From Railserve, Franklin, VA..., applicable to workers and former workers of International Paper Company, Franklin Pulp & Paper Mill, Franklin... follows: All workers International Paper Company, Franklin Pulp & Paper Mill, including on-site leased...
Kilbourne, Amy M; Almirall, Daniel; Goodrich, David E; Lai, Zongshan; Abraham, Kristen M; Nord, Kristina M; Bowersox, Nicholas W
2014-12-28
Few implementation strategies have been empirically tested for their effectiveness in improving uptake of evidence-based treatments or programs. This study compared the effectiveness of an immediate versus delayed enhanced implementation strategy (Enhanced Replicating Effective Programs (REP)) for providers at Veterans Health Administration (VA) outpatient facilities (sites) on improved uptake of an outreach program (Re-Engage) among sites not initially responding to a standard implementation strategy. One mental health provider from each U.S. VA site (N = 158) was initially given a REP-based package and training program in Re-Engage. The Re-Engage program involved giving each site provider a list of patients with serious mental illness who had not been seen at their facility for at least a year, requesting that providers contact these patients, assessing patient clinical status, and where appropriate, facilitating appointments to VA health services. At month 6, sites considered non-responsive (N = 89, total of 3,075 patients), defined as providers updating documentation for less than <80% of patients on their list, were randomized to two adaptive implementation interventions: Enhanced REP (provider coaching; N = 40 sites) for 6 months followed by Standard REP for 6 months; versus continued Standard REP (N = 49 sites) for 6 months followed by 6 months of Enhanced REP for sites still not responding. Outcomes included patient-level Re-Engage implementation and utilization. Patients from sites that were randomized to receive Enhanced REP immediately compared to Standard REP were more likely to have a completed contact (adjusted OR = 2.13; 95% CI: 1.09-4.19, P = 0.02). There were no differences in patient-level utilization between Enhanced and Standard REP sites. Enhanced REP was associated with greater Re-Engage program uptake (completed contacts) among sites not responding to a standard implementation strategy. Further research is needed to determine whether national implementation of Facilitation results in tangible changes in patient-level outcomes. ISRCTN21059161.
The role of economics in the QUERI program: QUERI Series
Smith, Mark W; Barnett, Paul G
2008-01-01
Background The United States (U.S.) Department of Veterans Affairs (VA) Quality Enhancement Research Initiative (QUERI) has implemented economic analyses in single-site and multi-site clinical trials. To date, no one has reviewed whether the QUERI Centers are taking an optimal approach to doing so. Consistent with the continuous learning culture of the QUERI Program, this paper provides such a reflection. Methods We present a case study of QUERI as an example of how economic considerations can and should be integrated into implementation research within both single and multi-site studies. We review theoretical and applied cost research in implementation studies outside and within VA. We also present a critique of the use of economic research within the QUERI program. Results Economic evaluation is a key element of implementation research. QUERI has contributed many developments in the field of implementation but has only recently begun multi-site implementation trials across multiple regions within the national VA healthcare system. These trials are unusual in their emphasis on developing detailed costs of implementation, as well as in the use of business case analyses (budget impact analyses). Conclusion Economics appears to play an important role in QUERI implementation studies, only after implementation has reached the stage of multi-site trials. Economic analysis could better inform the choice of which clinical best practices to implement and the choice of implementation interventions to employ. QUERI economics also would benefit from research on costing methods and development of widely accepted international standards for implementation economics. PMID:18430199
The role of economics in the QUERI program: QUERI Series.
Smith, Mark W; Barnett, Paul G
2008-04-22
The United States (U.S.) Department of Veterans Affairs (VA) Quality Enhancement Research Initiative (QUERI) has implemented economic analyses in single-site and multi-site clinical trials. To date, no one has reviewed whether the QUERI Centers are taking an optimal approach to doing so. Consistent with the continuous learning culture of the QUERI Program, this paper provides such a reflection. We present a case study of QUERI as an example of how economic considerations can and should be integrated into implementation research within both single and multi-site studies. We review theoretical and applied cost research in implementation studies outside and within VA. We also present a critique of the use of economic research within the QUERI program. Economic evaluation is a key element of implementation research. QUERI has contributed many developments in the field of implementation but has only recently begun multi-site implementation trials across multiple regions within the national VA healthcare system. These trials are unusual in their emphasis on developing detailed costs of implementation, as well as in the use of business case analyses (budget impact analyses). Economics appears to play an important role in QUERI implementation studies, only after implementation has reached the stage of multi-site trials. Economic analysis could better inform the choice of which clinical best practices to implement and the choice of implementation interventions to employ. QUERI economics also would benefit from research on costing methods and development of widely accepted international standards for implementation economics.
Cf-252 Characterization Documents
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feldman, Alexander
2014-03-14
Six documents were written by Vance and Associates under contract to the Off-Site Source Recovery Project of Los Alamos National Laboratory. These Six documents provided the basis for characterization of Californium-252 sealed sources and for the packaging and manifesting of this material for disposal at the Waste Isolation Pilot Project. The Six documents are: 1. VA-OSR-10, Development of radionuclide distributions for Cf-252 sealed sources. 2. VA-OSR-11, Uncertainty analysis for Cf-252 sealed sources. 3. VA-OSR-12, To determine the radionuclides in the waste drums containing Cf-252 sealed source waste that are required to be reported under the requirements of the WIPP WACmore » and the TRAMPAC. 4. VA-OSR-13, Development of the spreadsheet for the radiological calculations for the characterization of Cf-252 sources. 5. VA-OSR-14, Relative importance of neutron-induced fission in Cf-252 sources. 6. VA-OSR-15, Determine upper bound of decay product inventories from a drum of Cf-252 sources. These six documents provide the technical basis for the characterization of Cf-252 sources and will be part of the AK documentation required for submittal to the Central Characterization Project (CCP) of WIPP.« less
Hsieh, Ching-Liang; Ho, Tin-Yun; Su, Shan-Yu; Lo, Wan-Yu; Liu, Chung-Hsiang; Tang, Nou-Ying
2009-01-01
Our previous studies have shown that Uncaria rhynchophylla (UR) can reduce epileptic seizures. We hypothesized that UR and its major component rhynchophylline (RH), reduce epileptic seizures in rats treated with kainic acid (KA) by inhibiting nuclear factor-kappaB (NF-kappaB) and activator-protein-1 (AP-1) activity, and by eliminating superoxide anions. Therefore, the level of superoxide anions and the DNA binding activities of NF-kappaB and AP-1 were measured. Sprague-Dawley (SD) rats were pre-treated with UR (1.0 g/kg, i.p.), RH (0.25 mg/kg, i.p.), or valproic acid (VA, 250 mg/kg, i.p.) for 3 days and then KA was administered intra-peritoneal (i.p.). The results indicated that UR, RH, and VA can reduce epileptic seizures and the level of superoxide anions in the blood. Furthermore, KA was demonstrated to induce the DNA binding activities of NF-kappaB and AP-1. However, these inductions were inhibited by pre-treatment with UR, RH, or VA for 3 days. Moreover, UR and RH were shown to be involved in the suppression of c-Jun N-terminal kinase (JNK) phosphorylation. This study suggested that UR and RH have antiepileptic effects in KA-induced seizures and are associated with the regulation of the innate immune system via a reduction in the level of superoxide anions, JNK phosphorylation, and NF-kappaB activation.
Gelaye, Kassahun Alemu; Tessema, Fasil; Tariku, Befikadu; Abera, Semaw Ferede; Gebru, Alemseged Aregay; Assefa, Nega; Zelalem, Desalew; Dedefo, Melkamu; Kondal, Mekdes; Kote, Mesfin; Sisay, Mitike Molla; Mekonnen, Wubegzier; Terefe, Mamo Wubshet; Biks, Gashaw Andargie; Eshetu, Firehywot; Abera, Mulumebet; Fekadu, Yoseph; Hailu, Gessessew Bugssa; Tilahun, Etsehiwot; Lakew, Yihunie
2018-01-01
ABSTRACT Background: In Ethiopia, though all kinds of mortality due to external causes are an important component of overall mortality often not counted or documented on an individual basis. Objective: The aim of this study was to describe the patterns of mortality from external causes using verbal autopsy (VA) method at the Ethiopian HDSS Network sites. Methods: All deaths at Ethiopian HDSS sites were routinely registered and followed up with VA interviews. The VA forms comprised deaths up to 28 days, between four weeks and 14 years and 15 years and above. The cause of a death was ascertained based on an interview with next of families or other caregivers using a standardized questionnaire that draws information on signs, symptoms, medical history and circumstances preceding death after 45 days mourning period. Two physician assigned probable causes of death as underlying, immediate and contributing factors independently using information in VA forms based on the WHO ICD-10 and VA code system. Disagreed cases sent to third physician for independent review and diagnosis. The final cause of death considered when two of the three physicians assigned underlying cause of death; otherwise, labeled as undetermined. Results: In the period from 2009 to 2013, a total of 9719 deaths were registered. Of the total deaths, 623 (6.4%) were from external causes. Of these, accidental drowning and submersion, 136 (21.8%), accidental fall, 113 (18.1%) and transport-related accidents, 112 (18.0%) were the topmost three leading external causes of deaths. About 436 (70.0%) of deaths were from the age group above 15 years old. Drowning and submersion and transport-related accidents were high in age group between 5 and 14 years old. Conclusion: In this study, external causes of death are significant public health problems and require attention as one of prior health agenda. PMID:29471744
Chaplaincy and mental health in the department of Veterans affairs and department of defense.
Nieuwsma, Jason A; Rhodes, Jeffrey E; Jackson, George L; Cantrell, William C; Lane, Marian E; Bates, Mark J; Dekraai, Mark B; Bulling, Denise J; Ethridge, Keith; Drescher, Kent D; Fitchett, George; Tenhula, Wendy N; Milstein, Glen; Bray, Robert M; Meador, Keith G
2013-01-01
Chaplains play important roles in caring for Veterans and Service members with mental health problems. As part of the Department of Veterans Affairs (VA) and Department of Defense (DoD) Integrated Mental Health Strategy, we used a sequential approach to examining intersections between chaplaincy and mental health by gathering and building upon: 1) input from key subject matter experts; 2) quantitative data from the VA / DoD Chaplain Survey (N = 2,163; response rate of 75% in VA and 60% in DoD); and 3) qualitative data from site visits to 33 VA and DoD facilities. Findings indicate that chaplains are extensively involved in caring for individuals with mental health problems, yet integration between mental health and chaplaincy is frequently limited due to difficulties between the disciplines in establishing familiarity and trust. We present recommendations for improving integration of services, and we suggest key domains for future research.
Tsai, Jack; Rosenheck, Robert A
2015-06-01
There has long been concern that public support payments are used to support addictive behaviors. This study examined the amount of money homeless veterans spend on alcohol and drugs and the association between public support income, including VA disability compensation, and expenditures on alcohol and drugs. Data were from 1,160 veterans from 19 sites on entry into the Housing and Urban Development-Veterans Affairs Supportive Housing program. Descriptive statistics and nonparametric analyses were conducted. About 33% of veterans reported spending money on alcohol and 22% reported spending money on drugs in the past month. No significant association was found between public support income, VA disability compensation, and money spent on alcohol and drugs. A substantial proportion of homeless veterans spend some income on alcohol and drugs, but disability income, including VA compensation, does not seem to be related to substance use or money spent on addictive substances.
NASA Astrophysics Data System (ADS)
Huang, Yanping; Dong, Xiuqin; Yu, Yingzhe; Zhang, Minhua
2017-11-01
On the basis of the activation barriers and reaction energies from DFT calculations, kinetic Monte Carlo (kMC) simulations of vinyl acetate (VA) synthesis from ethylene acetoxylation on Pd(100) and Pd/Au(100) were carried out. Through kMC simulation, it was found that VA synthesis from ethylene acetoxylation proceeds via Moiseev mechanism on both Pd(100) and Pd/Au(100). The addition of Au into Pd can suppress ethylene dehydrogenation while it can promote acetic acid dehydrogenation, which can eventually facilitate VA synthesis as a whole. The addition of Au into Pd can further improve the conversion and selectivity of VA synthesis from ethylene acetoxylation. When the reaction network is analyzed, besides the energetics of each elementary reaction, the surface coverage of each species and the occupancy of the surface sites on the catalyst should also be taken into consideration.
VA's National PTSD Brain Bank: a National Resource for Research.
Friedman, Matthew J; Huber, Bertrand R; Brady, Christopher B; Ursano, Robert J; Benedek, David M; Kowall, Neil W; McKee, Ann C
2017-08-25
The National PTSD Brain Bank (NPBB) is a brain tissue biorepository established to support research on the causes, progression, and treatment of PTSD. It is a six-part consortium led by VA's National Center for PTSD with participating sites at VA medical centers in Boston, MA; Durham, NC; Miami, FL; West Haven, CT; and White River Junction, VT along with the Uniformed Services University of Health Sciences. It is also well integrated with VA's Boston-based brain banks that focus on Alzheimer's disease, ALS, chronic traumatic encephalopathy, and other neurological disorders. This article describes the organization and operations of NPBB with specific attention to: tissue acquisition, tissue processing, diagnostic assessment, maintenance of a confidential data biorepository, adherence to ethical standards, governance, accomplishments to date, and future challenges. Established in 2014, NPBB has already acquired and distributed brain tissue to support research on how PTSD affects brain structure and function.
O'Hara, Ruth; Cassidy-Eagle, Erin L; Beaudreau, Sherry A; Eyler, Lisa T; Gray, Heather L; Giese-Davis, Janine; Hubbard, Jeffrey; Yesavage, Jerome A
2010-01-01
This report highlights the use of multisite training for psychiatry and psychology postdoctoral fellows developing careers in academic clinical research in the field of mental health. The objective is to describe a model of training for young investigators to establish independent academic clinical research careers, including (1) program structure and eligibility, (2) program goals and development of a multisite curriculum, (3) use of technology for implementing the program across multiple sites, and (4) advantages and challenges of this multisite approach. In 2000, in collaboration with the Veterans Affairs (VA) Mental Illness Research, Education and Clinical Centers (MIRECCs), the VA Office of Academic Affiliations launched the Special Fellowship Program in Advanced Psychiatry and Psychology. Each of the 10 currently participating VA sites across the United States is affiliated with a MIRECC and an academic medical institution. In the first five years of this fellowship program, 83 fellows (34 psychiatrists and 49 psychologists) have participated. The success of this multisite approach is evidenced by the 58 fellows who have already graduated from the program: 70% have entered academic clinical research positions, and over 25 have obtained independent extramural grant support from the VA or the National Institutes of Health. Multisite training results in a greater transfer of knowledge and capitalizes on the nationwide availability of experts, creating unique networking and learning opportunities for trainees. The VA's multisite fellowship program plays a valuable role in preparing substantial numbers of psychiatry and psychology trainees for a range of academic clinical research and leadership positions in the field of mental health.
A Neophyte Constructs a Web Site: Lessons Learned.
ERIC Educational Resources Information Center
Bent, Devin
1998-01-01
A political science professor at James Madison University (VA) constructed a Web page to support an undergraduate course in government. This article defines Web-site goals and audience, reviews other sites, and discusses organization of Web links and technical choices for HTML editor, page layout and use of image, audio, and video files. Stresses…
Physical Property Measurements on Samples from an Analogue Soviet Nuclear Test Site: Northern Maine
1991-04-11
A Division of Maxwell Laboratory Berkeley, CA 94720 P.O. Box 1620 La Jolla, CA 92038-1620 Dr. Richard LaCoss Prof. William Menke MIT-Lincoln...90089-0741 Tucson, AZ 85721 Prof. Christopher H. Scholz Dr. William Wortman Lamont-Doherty Geological Observatory Mission Research Corporation of...Stanford, CA 94305 Reston, VA 22091 Mr. William J. Best Prof. Robert W. Clayton 907 Westwood Drive Seismological Laboratory Vienna, VA 22180 Division
Real-time seismic monitoring of instrumented hospital buildings
Kalkan, Erol; Fletcher, Jon Peter B.; Leith, William S.; McCarthy, William S.; Banga, Krishna
2012-01-01
In collaboration with the Department of Veterans Affairs (VA), the U.S. Geological Survey's National Strong Motion Project has recently installed sophisticated seismic monitoring systems to monitor the structural health of two hospital buildings at the Memphis VA Medical Center in Tennessee. The monitoring systems in the Bed Tower and Spinal Cord Injury buildings combine sensing technologies with an on-site computer to capture and analyze seismic performance of buildings in near-real time.
Ozone profiles from tethered balloon measurements in an urban plume experiment
NASA Technical Reports Server (NTRS)
Youngbluth, O., Jr.; Storey, R. W.; Clendenin, C. G.; Jones, S.; Leighty, B.
1981-01-01
NASA Langley Research Center used two tethered balloon systems to measure ozone in the general area of Norfolk, Va. The large balloon system which has an altitude range of 1,500 meters was located at Wallops Island, Va., and the smaller balloon which has an altitude range of 900 meters was located at Chesapeake, Va. Each balloon system measured ozone, temperature, humidity, wind speed, and wind direction from ground to its maximum altitude. From these measurements and from the location of the balloon sites, areas of ozone generation and ozone transport may be inferred. The measurements which were taken during August 1979 are discussed as well as the measurement techniques.
Sun, Jennifer K.; Qin, Haijing; Aiello, Lloyd Paul; Melia, Michele; Beck, Roy W.; Andreoli, Christopher M.; Edwards, Paul A.; Glassman, Adam R.; Pavlica, Michael R.
2012-01-01
Objective To compare visual acuity (VA) scores after autorefraction versus research protocol manual refraction in eyes of patients with diabetes and a wide range of VA. Methods Electronic Early Treatment Diabetic Retinopathy Study (E-ETDRS) VA Test© letter score (EVA) was measured after autorefraction (AR-EVA) and after Diabetic Retinopathy Clinical Research Network (DRCR.net) protocol manual refraction (MR-EVA). Testing order was randomized, study participants and VA examiners were masked to refraction source, and a second EVA utilizing an identical manual refraction (MR-EVAsupl) was performed to determine test-retest variability. Results In 878 eyes of 456 study participants, median MR-EVA was 74 (Snellen equivalent approximately 20/32). Spherical equivalent was often similar for manual and autorefraction (median difference: 0.00, 5th and 95th percentiles −1.75 to +1.13 Diopters). However, on average, MR-EVA results were slightly better than AR-EVA results across the entire VA range. Furthermore, variability between AR-EVA and MR-EVA was substantially greater than the test-retest variability of MR-EVA (P<0.001). Variability of differences was highly dependent on autorefractor model. Conclusions Across a wide range of VA at multiple sites using a variety of autorefractors, VA measurements tend to be worse with autorefraction than manual refraction. Differences between individual autorefractor models were identified. However, even among autorefractor models comparing most favorably to manual refraction, VA variability between autorefraction and manual refraction is higher than the test-retest variability of manual refraction. The results suggest that with current instruments, autorefraction is not an acceptable substitute for manual refraction for most clinical trials with primary outcomes dependent on best-corrected VA. PMID:22159173
47 CFR 25.203 - Choice of sites and frequencies.
Code of Federal Regulations, 2010 CFR
2010-10-01
... National Radio Astronomy Observatory: In order to minimize possible harmful interference at the National Radio Astronomy Observatory site located at Green Bank, Pocahontas County, W. Va., and at the Naval... such application with the Commission, simultaneously notify the Director, National Radio Astronomy...
47 CFR 25.203 - Choice of sites and frequencies.
Code of Federal Regulations, 2011 CFR
2011-10-01
... National Radio Astronomy Observatory: In order to minimize possible harmful interference at the National Radio Astronomy Observatory site located at Green Bank, Pocahontas County, W. Va., and at the Naval... such application with the Commission, simultaneously notify the Director, National Radio Astronomy...
47 CFR 25.203 - Choice of sites and frequencies.
Code of Federal Regulations, 2013 CFR
2013-10-01
... National Radio Astronomy Observatory: In order to minimize possible harmful interference at the National Radio Astronomy Observatory site located at Green Bank, Pocahontas County, W. Va., and at the Naval... such application with the Commission, simultaneously notify the Director, National Radio Astronomy...
47 CFR 25.203 - Choice of sites and frequencies.
Code of Federal Regulations, 2012 CFR
2012-10-01
... National Radio Astronomy Observatory: In order to minimize possible harmful interference at the National Radio Astronomy Observatory site located at Green Bank, Pocahontas County, W. Va., and at the Naval... such application with the Commission, simultaneously notify the Director, National Radio Astronomy...
Code of Federal Regulations, 2011 CFR
2011-07-01
..., Column 4 “Actuarial Present Value”of past payments = $0.00 NET AMOUNT OWED CLAIMANT ($75,000 less APV... Compensation Act Offset Worksheet—On Site Participants [Present CPI = 185.20] VA paymentsyear Payment Indicated...
Luxton, David D; Thomas, Elissa K; Chipps, Joan; Relova, Rona M; Brown, Daphne; McLay, Robert; Lee, Tina T; Nakama, Helenna; Smolenski, Derek J
2014-03-01
Caring letters is a suicide prevention intervention that entails the sending of brief messages that espouse caring concern to patients following discharge from treatment. First tested more than four decades ago, this intervention is one of the only interventions shown in a randomized controlled trial to reduce suicide mortality rates. Due to elevated suicide risk among patients following psychiatric hospitalization and the steady increase in suicide rates among the U.S. military personnel, it is imperative to test interventions that may help prevent suicide among high-risk military personnel and veterans. This paper describes the design, methods, study protocol, and regulatory implementation processes for a multi-site randomized controlled trial that aims to evaluate the effectiveness of a caring emails intervention for suicide prevention in the military and VA healthcare systems. The primary outcome is suicide mortality rates to be determined 24 months post-discharge from index hospital stay. Healthcare re-utilization rates will also be evaluated and comprehensive data will be collected regarding suicide risk factors. Recommendations for navigating the military and VA research regulatory processes and implementing a multi-site clinical trial at military and VA hospitals are discussed. Published by Elsevier Inc.
Implementing a user-driven online quality improvement toolkit for cancer care.
Luck, Jeff; York, Laura S; Bowman, Candice; Gale, Randall C; Smith, Nina; Asch, Steven M
2015-05-01
Peer-to-peer collaboration within integrated health systems requires a mechanism for sharing quality improvement lessons. The Veterans Health Administration (VA) developed online compendia of tools linked to specific cancer quality indicators. We evaluated awareness and use of the toolkits, variation across facilities, impact of social marketing, and factors influencing toolkit use. A diffusion of innovations conceptual framework guided the collection of user activity data from the Toolkit Series SharePoint site and an online survey of potential Lung Cancer Care Toolkit users. The VA Toolkit Series site had 5,088 unique visitors in its first 22 months; 5% of users accounted for 40% of page views. Social marketing communications were correlated with site usage. Of survey respondents (n = 355), 54% had visited the site, of whom 24% downloaded at least one tool. Respondents' awareness of the lung cancer quality performance of their facility, and facility participation in quality improvement collaboratives, were positively associated with Toolkit Series site use. Facility-level lung cancer tool implementation varied widely across tool types. The VA Toolkit Series achieved widespread use and a high degree of user engagement, although use varied widely across facilities. The most active users were aware of and active in cancer care quality improvement. Toolkit use seemed to be reinforced by other quality improvement activities. A combination of user-driven tool creation and centralized toolkit development seemed to be effective for leveraging health information technology to spread disease-specific quality improvement tools within an integrated health care system. Copyright © 2015 by American Society of Clinical Oncology.
Nieuwsma, Jason A; Jackson, George L; DeKraai, Mark B; Bulling, Denise J; Cantrell, William C; Rhodes, Jeffrey E; Bates, Mark J; Ethridge, Keith; Lane, Marian E; Tenhula, Wendy N; Batten, Sonja V; Meador, Keith G
2014-12-01
Recognizing that clergy and spiritual care providers are a key part of mental health care systems, the Department of Veterans Affairs (VA) and Department of Defense (DoD) jointly examined chaplains' current and potential roles in caring for veterans and service members with mental health needs. Our aim was to evaluate the intersection of chaplain and mental health care practices in VA and DoD in order to determine if improvement is needed, and if so, to develop actionable recommendations as indicated by evaluation findings. A 38-member multidisciplinary task group partnered with researchers in designing, implementing, and interpreting a mixed methods study that included: 1) a quantitative survey of VA and DoD chaplains; and 2) qualitative interviews with mental health providers and chaplains. Quantitative: the survey included all full-time VA chaplains and all active duty military chaplains (n = 2,163 completed of 3,464 invited; 62 % response rate). Qualitative: a total of 291 interviews were conducted with mental health providers and chaplains during site visits to 33 VA and DoD facilities. Quantitative: the online survey assessed intersections between chaplaincy and mental health care and took an average of 37 min to complete. Qualitative: the interviews assessed current integration of mental health and chaplain services and took an average of 1 h to complete. When included on interdisciplinary mental health care teams, chaplains feel understood and valued (82.8-100 % of chaplains indicated this, depending on the team). However, findings from the survey and site visits suggest that integration of services is often lacking and can be improved. Closely coordinating with a multidisciplinary task group in conducting a mixed method evaluation of chaplain-mental health integration in VA and DoD helped to ensure that researchers assessed relevant domains and that findings could be rapidly translated into actionable recommendations.
Provider and Site-Level Determinants of Testosterone Prescribing in the Veterans Healthcare System.
Jasuja, Guneet K; Bhasin, Shalender; Rose, Adam J; Reisman, Joel I; Hanlon, Joseph T; Miller, Donald R; Morreale, Anthony P; Pogach, Leonard M; Cunningham, Francesca E; Park, Angela; Wiener, Renda S; Gifford, Allen L; Berlowitz, Dan R
2017-09-01
Testosterone prescribing rates have increased substantially in the past decade. However, little is known about the context within which such prescriptions occur. We evaluated provider- and site-level determinants of receipt of testosterone and of guideline-concordant testosterone prescribing. This study was cross-sectional in design. This study was conducted at the Veterans Health Administration (VA). Study participants were a national cohort of male patients who had received at least one outpatient prescription within the VA during fiscal year (FY) 2008 to FY 2012. A total of 38,648 providers and 130 stations were associated with these patients. This study measured receipt of testosterone and guideline-concordant testosterone prescribing. Providers ranging in age from 31 to 60 years, with less experience in the VA [all adjusted odds ratio (AOR), <2; P < 0.01] and credentialed as medical doctors in endocrinology (AOR, 3.88; P < 0.01) and urology (AOR, 1.48; P < 0.01) were more likely to prescribe testosterone compared with older providers, providers of longer VA tenure, and primary care providers, respectively. Sites located in the West compared with the Northeast [AOR, 1.75; 95% confidence interval (CI), 1.45-2.11] and care received at a community-based outpatient clinic compared with a medical center (AOR, 1.22; 95% CI, 1.20-1.24) also predicted testosterone use. Although they were more likely to prescribe testosterone, endocrinologists were also more likely to obtain an appropriate workup before prescribing compared with primary care providers (AOR, 2.14; 95% CI, 1.54-2.97). Our results highlight the opportunity to intervene at both the provider and the site levels to improve testosterone prescribing. This study also provides a useful example of how to examine contributions to prescribing variation at different levels of the health care system. Copyright © 2017 Endocrine Society
Federal Register 2010, 2011, 2012, 2013, 2014
2012-11-07
... ``subzones'' or ``usage-driven'' FTZ sites for operators/users located within a grantee's ``service area'' in... acres)--Culpeper Business and Office Park, Route 29 and Route 666, Culpeper County; Site 2 (104 acres... Services, 1 Solutions Way, Waynesboro. The grantee's proposed service area under the ASF would be the...
Bullich, Santiago; Seibyl, John; Catafau, Ana M; Jovalekic, Aleksandar; Koglin, Norman; Barthel, Henryk; Sabri, Osama; De Santi, Susan
2017-01-01
Standardized uptake value ratios (SUVRs) calculated from cerebral cortical areas can be used to categorize 18 F-Florbetaben (FBB) PET scans by applying appropriate cutoffs. The objective of this work was first to generate FBB SUVR cutoffs using visual assessment (VA) as standard of truth (SoT) for a number of reference regions (RR) (cerebellar gray matter (GCER), whole cerebellum (WCER), pons (PONS), and subcortical white matter (SWM)). Secondly, to validate the FBB PET scan categorization performed by SUVR cutoffs against the categorization made by post-mortem histopathological confirmation of the Aβ presence. Finally, to evaluate the added value of SUVR cutoff categorization to VA. SUVR cutoffs were generated for each RR using FBB scans from 143 subjects who were visually assessed by 3 readers. SUVR cutoffs were validated in 78 end-of life subjects using VA from 8 independent blinded readers (3 expert readers and 5 non-expert readers) and histopathological confirmation of the presence of neuritic beta-amyloid plaques as SoT. Finally, the number of correctly or incorrectly classified scans according to pathology results using VA and SUVR cutoffs was compared. Composite SUVR cutoffs generated were 1.43 (GCER), 0.96 (WCER), 0.78 (PONS) and 0.71 (SWM). Accuracy values were high and consistent across RR (range 83-94% for histopathology, and 85-94% for VA). SUVR cutoff performed similarly as VA but did not improve VA classification of FBB scans read either by expert readers or the majority read but provided higher accuracy than some non-expert readers. The accurate scan classification obtained in this study supports the use of VA as SoT to generate site-specific SUVR cutoffs. For an elderly end of life population, VA and SUVR cutoff categorization perform similarly in classifying FBB scans as Aβ-positive or Aβ-negative. These results emphasize the additional contribution that SUVR cutoff classification may have compared with VA performed by non-expert readers.
Associations between provider designation and female-specific cancer screening in women Veterans.
Bean-Mayberry, Bevanne; Bastian, Lori; Trentalange, Mark; Murphy, Terrence E; Skanderson, Melissa; Allore, Heather; Reyes-Harvey, Evelyn; Maisel, Natalya C; Gaetano, Vera; Wright, Steven; Haskell, Sally; Brandt, Cynthia
2015-04-01
In 2010, the Department of Veterans Affairs Healthcare System (VA) implemented policy to provide Comprehensive Primary Care (for acute, chronic, and female-specific care) from designated Women's Health providers (DWHPs) at all VA sites. However, since that time no comparisons of quality measures have been available to assess the level of care for women Veterans assigned to these providers. To evaluate the associations between cervical and breast cancer screening rates among age-appropriate women Veterans and designation of primary-care provider (DWHP vs. non-DWHP). Cross-sectional analyses using the fiscal year 2012 data on VA women's health providers, administrative files, and patient-specific quality measures. The sample included 37,128 women Veterans aged 21 through 69 years. Variables included patient demographic and clinical factors (ie, age, race, ethnicity, mental health diagnoses, obesity, and site), and provider factors (ie, DWHP status, sex, and panel size). Screening measures were defined by age-appropriate subgroups using VA national guidelines. Female-specific cancer screening rates were higher among patients assigned to DWHPs (cervical cytology 94.4% vs. 91.9%, P<0.0001; mammography 86.3% vs. 83.3%, P<0.0001). In multivariable models with adjustment for patient and provider characteristics, patients assigned to DWHPs had higher odds of cervical cancer screening (odds ratio, 1.26; 95% confidence interval, 1.07-1.47; P<0.0001) and breast cancer screening (odds ratio, 1.24; 95% CI, 1.10-1.39; P<0.0001). As the proportion of women Veterans increases, assignment to DWHPs may raise rate of female-specific cancer screening within VA. Separate evaluation of sex neutral measures is needed to determine whether other measures accrue benefits for patients with DWHPs.
Li, Yuan; Yang, Kai; Yang, Wei; Chu, Liwei; Chen, Chunhai; Zhao, Bo; Li, Yisong; Jian, Jianbo; Yin, Zhichao; Wang, Tianqi; Wan, Ping
2017-01-01
The adzuki bean ( Vigna angularis ) is an important grain legume. Fine mapping of quantitative trait loci (QTL) and qualitative trait genes plays an important role in gene cloning, molecular-marker-assisted selection (MAS), and trait improvement. However, the genetic control of agronomic traits in the adzuki bean remains poorly understood. Single-nucleotide polymorphisms (SNPs) are invaluable in the construction of high-density genetic maps. We mapped 26 agronomic QTLs and five qualitative trait genes related to pigmentation using 1,571 polymorphic SNP markers from the adzuki bean genome via restriction-site-associated DNA sequencing of 150 members of an F 2 population derived from a cross between cultivated and wild adzuki beans. We mapped 11 QTLs for flowering time and pod maturity on chromosomes 4, 7, and 10. Six 100-seed weight (SD100WT) QTLs were detected. Two major flowering time QTLs were located on chromosome 4, firstly VaFld4.1 (PEVs 71.3%), co-segregating with SNP marker s690-144110, and VaFld4.2 (PEVs 67.6%) at a 0.974 cM genetic distance from the SNP marker s165-116310. Three QTLs for seed number per pod ( Snp3.1, Snp3.2 , and Snp4.1 ) were mapped on chromosomes 3 and 4. One QTL VaSdt4.1 of seed thickness (SDT) and three QTLs for branch number on the main stem were detected on chromosome 4. QTLs for maximum leaf width (LFMW) and stem internode length were mapped to chromosomes 2 and 9, respectively. Trait genes controlling the color of the seed coat, pod, stem and flower were mapped to chromosomes 3 and 1. Three candidate genes, VaAGL, VaPhyE , and VaAP2 , were identified for flowering time and pod maturity. VaAGL encodes an agamous-like MADS-box protein of 379 amino acids. VaPhyE encodes a phytochrome E protein of 1,121 amino acids. Four phytochrome genes ( VaPhyA1, VaPhyA2, VaPhyB , and VaPhyE ) were identified in the adzuki bean genome. We found candidate genes VaAP2/ERF.81 and VaAP2/ERF.82 of SD100WT, VaAP2-s4 of SDT, and VaAP2/ERF.86 of LFMW. A candidate gene VaUGT related to black seed coat color was identified. These mapped QTL and qualitative trait genes provide information helpful for future adzuki bean candidate gene cloning and MAS breeding to improve cultivars with desirable growth periods, yields, and seed coat color types.
Shiner, Brian; Leonard Westgate, Christine; Simiola, Vanessa; Thompson, Richard; Schnurr, Paula P; Cook, Joan M
2018-03-14
Available studies on implementation of evidence-based psychotherapy (EBP) for patients attending Department of Veterans Affairs (VA) residential post-traumatic stress disorder (PTSD) programs rely on therapist self-report of EBP delivery. Patient-level data on receipt of EBP are needed both to corroborate therapist self-report and to understand patient factors that predict receipt of EBPs for PTSD. We identified 159 therapists from 38 VA residential PTSD programs who responded to a survey about EBP implementation during the 2015 fiscal year (FY15). Therapists self-reported their use of two EBPs, including prolonged exposure delivered in an individual format (PE-I) and cognitive processing therapy delivered in individual and group formats (CPT-I and CPT-G). Using electronic medical record (EMR) templates mandated for EBP documentation in FY15, we measured contemporaneous patient-level receipt of EBPs for PTSD. We assessed the degree of correlation between therapist self-reported EBP delivery and patient receipt of EBT as measured by EMR templates using polychoric correlation coefficients. We determined patient and therapist factors that predicted the receipt of EBPs with multivariable logistic regression, using random effects and robust standard error estimation, and controlling for site. The Veterans IRB of Northern New England provided a waiver of informed consent; as this was a retrospective review, no patients or therapists were contacted, and all data were stored, transmitted, and analyzed on secure VA servers. The VA Connecticut Health Care System Human Research Protection Program approved secondary use of therapist survey data for this project. When EMR template use became mandated in FY15, the proportion of patients in residential PTSD programs who received at least one EBP session that was recorded with an EMR template increased dramatically from 8.8% to 33.9%. There was adequate correlation and between survey-based and EMR-based measures of EBP receipt, with polychoric correlation values of 0.77 for PE-I, 0.69 for CPT-I, and 0.82 for CPT-G. Multiple patient factors were positive (e.g., female gender) and negative (e.g., depressive disorders) predictors of receipt of EBPs, even after controlling for site. Among therapist factors, only EBP consultant or trainer status was a positive predictor of EBP provision and only therapist race was a negative predictor of EBT provision after controlling for site. Following a FY15 mandate, EMR templates documenting EBP delivery were widely used by therapists working in VA residential PTSD programs. EBP receipt measured using EMR templates was consistent with therapist self-report of EBT delivery. There were several patient-level predictors of EBP receipt and therapist-level predictors of EBP delivery. However, therapists most likely to deliver EBPs were clustered at a limited number of sites.
2017-10-01
for all project Aims. Timeline- months 3-6. Status: completed. Task 6: Complete primary analyses and hypothesis testing for Aim 2, including...glucose. For each of these lab tests , each VA site can name them something different and can change names over times. Labs should be linked to Logical...Observation Identifiers Names (LOINC) codes, an international standard system that assigns a numeric code to specific lab tests . However, VA data
Ambient Noise Analysis from Selected CTBTO (Comprehensive Test Ban Treaty Organization) Sites
2015-02-11
AGENCY NAME(S) AND ADDRESS(ES) Robert H. Headrick Office of Naval Research 875 North Randolph Street Arlington, VA 22203-1995 10. SPONSOR/MONITOR’S...Canada HA03 Juan Fernandez Island Chile HA04 Crozet Islands France HA05 Guadeloupe France Co HA06 Socorro Island Mexico HA07 Flores Portugal...2), 61- 73 (1974). 8. W.J. Pierson, Jr ., and R.A. Stacy. NASA Report CR-2247, National Technical Information Service, Springfield, VA 22151 (1973
Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.
1991-01-01
Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less
NASA Astrophysics Data System (ADS)
Lengyel, Iván M.; Morelli, Luis G.
2017-04-01
Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.
Validation of verbal autopsy methods using hospital medical records: a case study in Vietnam.
Tran, Hong Thi; Nguyen, Hoa Phuong; Walker, Sue M; Hill, Peter S; Rao, Chalapati
2018-05-18
Information on causes of death (COD) is crucial for measuring the health outcomes of populations and progress towards the Sustainable Development Goals. In many countries such as Vietnam where the civil registration and vital statistics (CRVS) system is dysfunctional, information on vital events will continue to rely on verbal autopsy (VA) methods. This study assesses the validity of VA methods used in Vietnam, and provides recommendations on methods for implementing VA validation studies in Vietnam. This validation study was conducted on a sample of 670 deaths from a recent VA study in Quang Ninh province. The study covered 116 cases from this sample, which met three inclusion criteria: a) the death occurred within 30 days of discharge after last hospitalisation, and b) medical records (MRs) for the deceased were available from respective hospitals, and c) the medical record mentioned that the patient was terminally ill at discharge. For each death, the underlying cause of death (UCOD) identified from MRs was compared to the UCOD from VA. The validity of VA diagnoses for major causes of death was measured using sensitivity, specificity and positive predictive value (PPV). The sensitivity of VA was at least 75% in identifying some leading CODs such as stroke, road traffic accidents and several site-specific cancers. However, sensitivity was less than 50% for other important causes including ischemic heart disease, chronic obstructive pulmonary diseases, and diabetes. Overall, there was 57% agreement between UCOD from VA and MR, which increased to 76% when multiple causes from VA were compared to UCOD from MR. Our findings suggest that VA is a valid method to ascertain UCOD in contexts such as Vietnam. Furthermore, within cultural contexts in which patients prefer to die at home instead of a healthcare facility, using the available MRs as the gold standard may be meaningful to the extent that recall bias from the interval between last hospital discharge and death can be minimized. Therefore, future studies should evaluate validity of MRs as a gold standard for VA studies in contexts similar to the Vietnamese context.
Health care employee perceptions of patient-centered care.
Balbale, Salva Najib; Turcios, Stephanie; LaVela, Sherri L
2015-03-01
Given the importance of health care employees in the delivery of patient-centered care, understanding their unique perspectives is essential for quality improvement. The purpose of this study was to use photovoice to evaluate perceptions and experiences around patient-centered care among U.S. Veterans Affairs (VA) health care employees. We asked participants to take photographs of salient features in their environment related to patient-centered care. We used the photographs to facilitate dialogue during follow-up interviews. Twelve VA health care employees across two VA sites participated in the project. Although most participants felt satisfied with their work environment and experiences at the VA, they identified several areas for improvement. These included a need for more employee health and wellness initiatives and a need for enhanced opportunities for training and professional growth. Application of photovoice enabled us to learn about employees' unique perspectives around patient-centered care while engaging them in an evaluation of care delivery. © The Author(s) 2014.
Health Care Employee Perceptions of Patient-Centered Care: A Photovoice Project
Balbale, Salva Najib; Turcios, Stephanie; LaVela, Sherri L.
2015-01-01
Given the importance of health care employees in the delivery of patient-centered care, understanding their unique perspective is essential for quality improvement. The purpose of this study was to use photovoice to evaluate perceptions and experiences around patient-centered care among Veterans Affairs (VA) health care employees. We asked participants to take photographs of salient features in their environment related to patient-centered care. We used the photographs to facilitate dialogue during follow-up interviews. Twelve VA health care employees across two VA sites participated in the project. Although most participants felt satisfied with their work environment and experiences at the VA, several areas for improvement were identified. These included a need for more employee health and wellness initiatives and a need for enhanced opportunities for training and professional growth. Application of photovoice enabled us to learn about employees' unique perspectives around patient-centered care while engaging them in an evaluation of care delivery. PMID:25274626
Iraq and Afghanistan Veterans: National Findings from VA Residential Treatment Programs
Cook, Joan M.; Dinnen, Stephanie; O’Donnell, Casey; Bernardy, Nancy; Rosenheck, Robert; Desai, Rani
2013-01-01
A quality improvement effort was undertaken in Department of Veterans Affairs’ (VA) residential treatment programs for Posttraumatic Stress Disorder (PTSD) across the United States. Qualitative interviews were conducted with over 250 directors, providers, and staff during site visits of 38 programs. The aims of this report are to describe clinical issues and distinctive challenges in working with veterans from Iraq and Afghanistan and approaches to addressing their needs. Providers indicated that the most commonly reported problems were: acute PTSD symptomotology; other complex mental health symptom presentations; broad readjustment problems; and difficulty with time demands of and readiness for intensive treatment. Additional concerns included working with active duty personnel and mixing different eras in therapy. Programmatic solutions address structure (e.g., blended versus era-specific therapy), content (e.g., physical activity), and adaptations (e.g., inclusion of family; shortened length of stay). Clinical implications for VA managers and policy makers as well as non-VA health care systems and individual health care providers are noted. PMID:23458113
Harada, Nancy D; Traylor, Laural; Rugen, Kathryn Wirtz; Bowen, Judith L; Smith, C Scott; Felker, Bradford; Ludke, Deborah; Tonnu-Mihara, Ivy; Ruberg, Joshua L; Adler, Jayson; Uhl, Kimberly; Gardner, Annette L; Gilman, Stuart C
2018-02-20
This paper describes the Centers of Excellence in Primary Care Education (CoEPCE), a seven-site collaborative project funded by the Office of Academic Affiliations (OAA) within the Veterans Health Administration of the United States Department of Veterans Affairs (VA). The CoEPCE was established to fulfill OAA's vision of large-scale transformation of the clinical learning environment within VA primary care settings. This was accomplished by funding new Centers within VA facilities to develop models of interprofessional education (IPE) to teach health professions trainees to deliver high quality interprofessional team-based primary care to Veterans. Using reports and data collected and maintained by the National Coordinating Center over the first six years of the project, we describe program inputs, the multicomponent intervention, activities undertaken to develop the intervention, and short-term outcomes. The findings have implications for lessons learned that can be considered by others seeking large-scale transformation of education within the clinical workplace and the development of interprofessional clinical learning environments. Within the VA, the CoEPCE has laid the foundation for IPE and collaborative practice, but much work remains to disseminate this work throughout the national VA system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sloan, J.W.
1984-01-01
These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1998-12-29
Langley Air Force Base (Langley AFB) and the National Aeronautics and Space Administration Langley Research Center (NASA LaRC) are located adjacent to each other on a small coastal basin of the Back River, a tidal estuary of the Chesapeake Bay. The Agency for Toxic Substances and Disease Registry (ATSDR) visited the sites in 1994 and 1997. During the 1994 visit, several potential public health concerns were raised. (1) the potential for contaminants to migrate to fish and shellfish (which might be ingested by local residents) in the adjoining estuary, (2) surface soil contamination at a former playground at Langley AFBmore » Site OT-06, (3) surface soil contamination and physical hazards at Langley AFB Sites OT-25 and FT-41, where children or youths might trespass, (4) the use of Langley AFB Site LF-12 for storing fill material, and (5) lead-contaminated soil in the housing areas at Langley AFB. ATSDR made recommendations for several of these sites. During the 1997 visit, ATSDR identified one additional potential concern at NASA LaRC Site 4, an open storage site where surface soil has not been characterized.« less
Assessment of Marine Coatings at a Central California Static Immersion Test Site
2016-10-27
VA 220600-6218 RE: Contract Number N00014-15-1-2321 Assessment of Marine Coatings at a Central California Static Immersion Test Site Principal...Technical Report 05/01/2015 - 07/29/2016 Assessment of Marine Coatings at a Central California Static Immersion Test Site Dean E. Wendt Cal Poly...to test the relationships between the recruitment of fouling organisms to intersite panels and water quality parameters. The static immersion site
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu-Zhong Zhang; Ewart, G.; Capaldi, R.A.
The arrangement of three subunits of beef heart cytochrome c oxidase, subunits Va, VIa, and VIII, has been explored by chemical labeling and protease digestion studies. Subunit Va is an extrinsic protein located on the C side of the mitochondrial inner membrane. This subunit was found to label with N-(4-azido-2-nitrophenyl)-2-aminoethane({sup 35}S)sulfonate and sodium methyl 4-({sup 3}H)formylphenyl phosphate in reconstituted vesicles in which 90% of cytochrome c oxidase complexes were oriented with the C domain outermost. Subunit VIa was cleaved by trypsin both in these reconstituted vesicles and in submitochondrial particles, indicating a transmembrane orientation. The epitope for a monoclonal antibodymore » (mAb) to subunit VIa was lost or destroyed when cleavage occurred in reconstituted vesicles. This epitope was localized to the C-terminal part of the subunit by antibody binding to a fusion protein consisting of glutathione S-transferase (G-ST) and the C-terminal amino acids 55-85 of subunit VIa. No antibody binding was obtained with a fusion protein containing G-ST and the N-terminal amino acids 1-55. The mAb reaction orients subunit VIa with its C-terminus in the C-domain. Subunit VIII was cleaved by trypsin in submitochondrial particles but not in reconstituted vesicles. N-Terminal sequencing of the subunit VIII cleavage produce from submitochondrial particles gave the same sequence as the untreated subunit, i.e., ITA, indicating that it is the C-terminus which is cleaved from the M side. Subunits Va and VIII each contain N-terminal extensions or leader sequences in the precursor polypeptides; subunit VIa is made without an N-terminal extension.« less
Federal Register 2010, 2011, 2012, 2013, 2014
2010-05-12
... Company Franklin Pulp & Paper Mill Including On-Site Leased Workers From Railserve, Franklin, VA; Amended... workers of International Paper Company, Franklin Pulp & Paper Mill, Franklin, Virginia. The notice was... Pulp & Paper Mill. The Department has determined that these workers were sufficiently under the control...
Changes in contaminant fluxes resulting from aggressive remediation of dense nonaqueous phase liquid (DNAPL) source zone were investigated at two sites, one at Hill Air Force Base (AFB), Utah, and the other at Ft. Lewis Military Reservation, WA. Passive Flux Meters (PFM) and a va...
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-30
..., California 95440 and at the Defense Distribution Depot San Joaquin--Tracy Site Public Affairs Office, 2600 S... Distribution Depot San Joaquin--Tracy Site Public Affairs Office at (209) 839-4226. ADDRESSES: You may submit..., VA 22350- 3100. FOR FURTHER INFORMATION CONTACT: Public Affairs Office, Tracy, California, (209) 839...
Cloud water deposition was estimated at three high elevation sites in the Appalachian Mountains of the eastern United States (Whiteface Mountain, NY, Whitetop Mountain, VA, and Clingrnan's Dome, TN) from 1994 through 1999 as part of the Mountain Acid Deposition Program (MADPro). ...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-05-23
... Harvard Resources Solutions, Lebanon, VA; Amended Certification Regarding Eligibility To Apply for Worker..., including on-site leased workers from At- Work Personnel and CJR Solutions, d/b/a Harvard Resources... from At-Work Personnel and CJR Solutions, d/b/a Harvard Resource Solutions, Lebanon, Virginia, who...
... About Combination Therapy About Joining a Clinical Trial Web Resources Clinical Trials Financing Treatment Hotlines return to ... to email VA HOME Notices Privacy FOIA Regulations Web Policies No FEAR Act Whistleblower Rights & Protections Site ...
Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing
Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric
2017-01-01
AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457
Hussain-Alkhateeb, Laith; Fottrell, Edward; Petzold, Max; Kahn, Kathleen; Byass, Peter
2015-01-01
Understanding how lay people perceive the causes of mortality and their associated risk factors is important for public health. In resource-limited settings, where verbal autopsy (VA) is used as the most expedient method of determining cause of death, it is important to understand how pre-existing concepts of cause of death among VA-informants may influence their VA-responses and the consequential impact on cause of death assessment. This study describes the agreement between VA-derived causes of death and informant-perceived causes and associated influential factors, which also reflects lay health literacy in this setting. Using 20 years of VA data (n=11,228) from the Agincourt Health and Demographic Surveillance System (HDSS) site in rural South Africa, we explored the agreement between the causes of death perceived by the VA-informants and those assigned by the automated Inter-VA tool. Kappa statistics and concordance correlation coefficients were applied to measure agreement at individual and population levels, respectively. Multivariable regression models were used to explore factors associated with recognised lay perceptions of causes of mortality. Agreement between informant-perceived and VA-derived causes of death at the individual level was limited, but varied substantially by cause of death. However, agreement at the population level, comparing cause-specific mortality fractions was higher, with the notable exception of bewitchment as a cause. More recent deaths, those in adults aged 15-49 years, deaths outside the home, and those associated with external causes showed higher concordance with InterVA. Overall, informant perception of causes of death was limited, but depended on informant characteristics and causes of death, and to some extent involved non-biomedical constructs. Understanding discordance between perceived and recognised causes of death is important for public health planning; low community understanding of causes of death may be detrimental to public health. These findings also illustrate the importance of using rigorous and standardised VA methods rather than relying on informants' reported causes of death.
Mabey, S.; Watts, B.; Paxton, B.; Smith, F.; Truitt, B.; Dawson, D.
2005-01-01
Many conservation organizations and initiatives including Partners-in-Flight and the U.S. Fish and Wildlife Service's regional Joint Ventures have identified migratory songbird stopover habitat as a priority conservation target. However, the spatial and temporal variability inherent in migration presents a number of challenges to both identifying and characterizing stopover habitat. Scarce conservation resources further demand that stopover sites be classified on a scale of priority so that conservation action can proceed according to ecological value. We are applying weather surveillance radar data collected from the National Weather Service WSR-88D at Wakefield, VA, and NASA's Doppler radar, NPOL, in Oyster, VA, to identify passerine stopover sites in the lower Chesapeake Bay region and develop spatial models to characterize these sites based on relative migrant abundance and consistency of use between and within seasons. We are using the stopover patterns to generate hypotheses regarding the habitat, geographic, and stochastic factors contributing to the distribution of migrants at a regional scale. We are testing these hypotheses with detailed habitat data and ground surveys of migrating birds with the goal of creating a generalized prioritization system for stopover site conservation.
An Electrostatic Funnel in the GABA-Binding Pathway
Lightstone, Felice C.
2016-01-01
The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953
Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.
2013-01-01
Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283
A tool for calculating binding-site residues on proteins from PDB structures.
Hu, Jing; Yan, Changhui
2009-08-03
In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.
Leonard, Chelsea; Lawrence, Emily; McCreight, Marina; Lippmann, Brandi; Kelley, Lynette; Mayberry, Ashlea; Ladebue, Amy; Gilmartin, Heather; Côté, Murray J; Jones, Jacqueline; Rabin, Borsika A; Ho, P Michael; Burke, Robert
2017-10-23
Adapting promising health care interventions to local settings is a critical component in the dissemination and implementation process. The Veterans Health Administration (VHA) rural transitions nurse program (TNP) is a nurse-led, Veteran-centered intervention designed to improve transitional care for rural Veterans funded by VA national offices for dissemination to other VA sites serving a predominantly rural Veteran population. Here, we describe our novel approach to the implementation and evaluation = the TNP. This is a controlled before and after study that assesses both implementation and intervention outcomes. During pre-implementation, we assessed site context using a mixed method approach with data from diverse sources including facility-level quantitative data, key informant and Veteran interviews, observations of the discharge process, and a group brainstorming activity. We used the Practical Robust Implementation and Sustainability Model (PRISM) to inform our inquiries, to integrate data from all sources, and to identify factors that may affect implementation. In the implementation phase, we will use internal and external facilitation, paired with audit and feedback, to encourage appropriate contextual adaptations. We will use a modified Stirman framework to document adaptations. During the evaluation phase, we will measure intervention and implementation outcomes at each site using the RE-AIM framework (Reach, Effectiveness, Adoption, Implementation, and Maintenance). We will conduct a difference-in-differences analysis with propensity-matched Veterans and VA facilities as a control. Our primary intervention outcome is 30-day readmission and Emergency Department visit rates. We will use our findings to develop an implementation toolkit that will inform the larger scale-up of the TNP across the VA. The use of PRISM to inform pre-implementation evaluation and synthesize data from multiple sources, coupled with internal and external facilitation, is a novel approach to engaging sites in adapting interventions while promoting fidelity to the intervention. Our application of PRISM to pre-implementation and midline evaluation, as well as documentation of adaptations, provides an opportunity to identify and address contextual factors that may impede or enhance implementation and sustainability of health interventions and inform dissemination.
Ryden, T A; de Mars, M; Beemon, K
1993-01-01
Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280
The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.
Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried
2017-06-01
Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.
McDowell, Graeme S. V.; Taylor, Graeme P.; Fai, Stephen; Bennett, Steffany A. L.
2014-01-01
The capacity to predict and visualize all theoretically possible glycerophospholipid molecular identities present in lipidomic datasets is currently limited. To address this issue, we expanded the search-engine and compositional databases of the online Visualization and Phospholipid Identification (VaLID) bioinformatic tool to include the glycerophosphoinositol superfamily. VaLID v1.0.0 originally allowed exact and average mass libraries of 736,584 individual species from eight phospholipid classes: glycerophosphates, glyceropyrophosphates, glycerophosphocholines, glycerophosphoethanolamines, glycerophosphoglycerols, glycerophosphoglycerophosphates, glycerophosphoserines, and cytidine 5′-diphosphate 1,2-diacyl-sn-glycerols to be searched for any mass to charge value (with adjustable tolerance levels) under a variety of mass spectrometry conditions. Here, we describe an update that now includes all possible glycerophosphoinositols, glycerophosphoinositol monophosphates, glycerophosphoinositol bisphosphates, and glycerophosphoinositol trisphosphates. This update expands the total number of lipid species represented in the VaLID v2.0.0 database to 1,473,168 phospholipids. Each phospholipid can be generated in skeletal representation. A subset of species curated by the Canadian Institutes of Health Research Training Program in Neurodegenerative Lipidomics (CTPNL) team is provided as an array of high-resolution structures. VaLID is freely available and responds to all users through the CTPNL resources web site. PMID:24701584
McDowell, Graeme S V; Blanchard, Alexandre P; Taylor, Graeme P; Figeys, Daniel; Fai, Stephen; Bennett, Steffany A L
2014-01-01
The capacity to predict and visualize all theoretically possible glycerophospholipid molecular identities present in lipidomic datasets is currently limited. To address this issue, we expanded the search-engine and compositional databases of the online Visualization and Phospholipid Identification (VaLID) bioinformatic tool to include the glycerophosphoinositol superfamily. VaLID v1.0.0 originally allowed exact and average mass libraries of 736,584 individual species from eight phospholipid classes: glycerophosphates, glyceropyrophosphates, glycerophosphocholines, glycerophosphoethanolamines, glycerophosphoglycerols, glycerophosphoglycerophosphates, glycerophosphoserines, and cytidine 5'-diphosphate 1,2-diacyl-sn-glycerols to be searched for any mass to charge value (with adjustable tolerance levels) under a variety of mass spectrometry conditions. Here, we describe an update that now includes all possible glycerophosphoinositols, glycerophosphoinositol monophosphates, glycerophosphoinositol bisphosphates, and glycerophosphoinositol trisphosphates. This update expands the total number of lipid species represented in the VaLID v2.0.0 database to 1,473,168 phospholipids. Each phospholipid can be generated in skeletal representation. A subset of species curated by the Canadian Institutes of Health Research Training Program in Neurodegenerative Lipidomics (CTPNL) team is provided as an array of high-resolution structures. VaLID is freely available and responds to all users through the CTPNL resources web site.
Kasprow, Wesley J.; Rosenheck, Robert A.
2013-01-01
Objectives. We identified risk and need profiles of homeless veterans and examined the relation between profiles and referrals and admissions to Department of Veterans Affairs (VA) homeless service programs. Methods. We examined data from the VA’s new Homeless Operations Management and Evaluation System on 120 852 veterans from 142 sites nationally in 2011 and 2012 using latent class analyses based on 9 homeless risk factors. The final 4-class solution compared both referral and admission to VA homeless services. Results. We identified 4 latent classes: relatively few problems, dual diagnosis, poverty–substance abuse–incarceration, and disabling medical problems. Homeless veterans in the first group were more likely to be admitted to the VA’s permanent supportive housing program, whereas those in the second group were more likely to be admitted to more restrictive VA residential treatment. Homeless veterans in the third group were more likely to be admitted to the VA’s prisoner re-entry program, and those in the fourth group were more likely to be directed to VA medical services. Conclusions. The heterogeneous risk and need profiles of homeless veterans supported the diversity of VA homeless services and encouraged the development of specialized services to meet their diverse needs. PMID:24148048
... VA – HIV/AIDS Basics: Symptoms HIV.gov on Twitter 22 hours 41 min ago. HIV.gov @HIVGov # ... routine. #HIVTestingDay Reply Retweet Favorite HIV.gov on Twitter Search Find HIV Testing Sites & Care Services Connect ...
Dizon, Matthew P; Linos, Eleni; Arron, Sarah T; Hills, Nancy K; Chren, Mary-Margaret
2017-01-01
The Institute of Medicine has identified serious deficiencies in the measurement of cancer care quality, including the effects on quality of life and patient experience. Moreover, comparisons of quality in Veterans Affairs Medical Centers (VA) and other sites are timely now that many Veterans can choose where to seek care. To compare quality of ambulatory surgical care for keratinocyte carcinoma (KC) between a VA and fee-for-service (FFS) practice, we used unique clinical and patient-reported data from a comparative effectiveness study. Patients were enrolled in 1999-2000 and followed for a median of 7.2 years. The practices differed in a few process measures (e.g., median time between biopsy and treatment was 7.5 days longer at VA) but there were no substantial or consistent differences in clinical outcomes or a broad range of patient-reported outcomes. For example, 5-year tumor recurrence rates were equally low (3.6% [2.3-5.5] at VA and 3.4% [2.3-5.1] at FFS), and similar proportions of patients reported overall satisfaction at one year (78% at VA and 80% at FFS, P = 0.69). These results suggest that the quality of care for KC can be compared comprehensively in different health care systems, and suggest that quality of care for KC was similar at a VA and FFS setting.
Ivleva, Natalia P; Huckele, Susanne; Weinzierl, Bernadett; Niessner, Reinhard; Haisch, Christoph; Baumann, Thomas
2013-11-01
We present for the first time the Raman microspectroscopic identification and characterization of individual airborne volcanic ash (VA) particles. The particles were collected in April/May 2010 during research aircraft flights, which were performed by Deutsches Zentrum für Luft- und Raumfahrt in the airspace near the Eyjafjallajökull volcano eruption and over Europe (between Iceland and Southern Germany). In addition, aerosol particles were sampled by an Electrical Low Pressure Impactor in Munich, Germany. As references for the Raman analysis, we used the spectra of VA collected at the ground near the place of eruption, of mineral basaltic rock, and of different minerals from a database. We found significant differences in the spectra of VA and other aerosol particles (e.g., soot, nitrates, sulfates, and clay minerals), which allowed us to identify VA among other atmospheric particulate matter. Furthermore, while the airborne VA shows a characteristic Raman pattern (with broad band from ca. 200 to ca. 700 cm(-1) typical for SiO₂ glasses and additional bands of ferric minerals), the differences between the spectra of aged and fresh particles were observed, suggesting differences in their chemical composition and/or structure. We also analyzed similarities between Eyjafjallajökull VA particles collected at different sampling sites and compared the particles with a large variety of glassy and crystalline minerals. This was done by applying cluster analysis, in order to get information on the composition and structure of volcanic ash.
NASA Technical Reports Server (NTRS)
Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.
2000-01-01
Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase
NASA Astrophysics Data System (ADS)
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-01
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-05
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
NASA Astrophysics Data System (ADS)
D'Aquino, J. Alejandro; Ringe, Dagmar
2006-08-01
The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.
Allosteric binding sites in Rab11 for potential drug candidates
2018-01-01
Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286
Fully Tunable Silicon Nanowire Arrays Fabricated by Soft Nanoparticle Templating.
Rey, By Marcel; Elnathan, Roey; Ditcovski, Ran; Geisel, Karen; Zanini, Michele; Fernandez-Rodriguez, Miguel-Angel; Naik, Vikrant V; Frutiger, Andreas; Richtering, Walter; Ellenbogen, Tal; Voelcker, Nicolas H; Isa, Lucio
2016-01-13
We demonstrate a fabrication breakthrough to produce large-area arrays of vertically aligned silicon nanowires (VA-SiNWs) with full tunability of the geometry of the single nanowires and of the whole array, paving the way toward advanced programmable designs of nanowire platforms. At the core of our fabrication route, termed "Soft Nanoparticle Templating", is the conversion of gradually compressed self-assembled monolayers of soft nanoparticles (microgels) at a water-oil interface into customized lithographical masks to create VA-SiNW arrays by means of metal-assisted chemical etching (MACE). This combination of bottom-up and top-down techniques affords excellent control of nanowire etching site locations, enabling independent control of nanowire spacing, diameter and height in a single fabrication route. We demonstrate the fabrication of centimeter-scale two-dimensional gradient photonic crystals exhibiting continuously varying structural colors across the entire visible spectrum on a single silicon substrate, and the formation of tunable optical cavities supported by the VA-SiNWs, as unambiguously demonstrated through numerical simulations. Finally, Soft Nanoparticle Templating is combined with optical lithography to create hierarchical and programmable VA-SiNW patterns.
Hedrick, S C; Rothman, M L; Chapko, M; Inui, T S; Kelly, J R; Ehreth, J
1991-01-01
The Adult Day Health Care Evaluation Study was developed in response to a congressional mandate to study the medical efficacy and cost effectiveness of the Adult Day Health Care (ADHC) effort in the Department of Veterans Affairs (VA). Four sites providing ADHC in VA facilities are participating in an ongoing randomized controlled trial. Three years of developmental work prior to the study addressed methodological issues that were problematic in previous studies. This developmental work resulted in the methodological approaches described here: (1) a patient recruitment process that actively recruits and screens all potential candidates using empirically developed admission criteria based on predictors of nursing home placement in VA; (2) the selection and development of measures of medical efficacy that assess a wide range of patient and caregiver outcomes with sufficient sensitivity to detect small but clinically important changes; and (3) methods for detailed, accurate, and efficient measurement of utilization and costs of health care within and outside VA. These approaches may be helpful to other researchers and may advance the methodological sophistication of long-term care program evaluation. PMID:1991678
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rosier, A.M.; Vandesande, F.; Orban, G.A.
1991-03-08
The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less
... VA – Work with Your Provider HIV.gov on Twitter 1 day 1 hour ago. HIV.gov @HIVGov # ... routine. #HIVTestingDay Reply Retweet Favorite HIV.gov on Twitter Search Find HIV Testing Sites & Care Services Connect ...
Seeing Your Health Care Provider
... VA – Work with Your Provider HIV.gov on Twitter 23 hours 34 min ago. HIV.gov @HIVGov # ... routine. #HIVTestingDay Reply Retweet Favorite HIV.gov on Twitter Search Find HIV Testing Sites & Care Services Connect ...
Pre-Exposure Prophylaxis (PrEP)
... VA – HIV Pre-Exposure Prophylaxis HIV.gov on Twitter 22 hours 47 min ago. HIV.gov @HIVGov # ... routine. #HIVTestingDay Reply Retweet Favorite HIV.gov on Twitter Search Find HIV Testing Sites & Care Services Connect ...
... VA – How Is HIV Spread? HIV.gov on Twitter 22 hours 41 min ago. HIV.gov @HIVGov # ... routine. #HIVTestingDay Reply Retweet Favorite HIV.gov on Twitter Search Find HIV Testing Sites & Care Services Connect ...
Sleep and Posttraumatic Stress Disorder (PTSD)
... out of your bedroom. Keep your bedroom quiet, dark, and cool. Use curtains or blinds to block ... with VA PTSD Care, Benefits, or Claims For Web site help: Web Policies PTSD Information Voice Mail: ( ...
Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A
1999-01-01
A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-12
... Qimonda AG Sandston, VA; Amended Certification Regarding Eligibility To Apply for Worker Adjustment..., Sandston, Virginia. The notice was published in the Federal Register on December 30, 2008 (73 FR 79914... division of Select Staffing were employed on-site at the Sandston, Virginia location of Qimonda 200MM...
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
NASA Astrophysics Data System (ADS)
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
Sullivan, Jennifer L; Eisenstein, Rina; Price, Thomas; Solimeo, Samantha; Shay, Kenneth
2018-01-01
Here, we describe the implementation of a specialty primary care medical home (PCMH) model called Geriatric Patient-Aligned Care Teams (GeriPACT) in the Veterans' Health Administration (VA) that is focused on serving older complex patients. In particular, our aims in this article are to describe how the GeriPACT model was developed and implemented in VA sites, provide a closer look at how GeriPACT functions by presenting a case study, and highlight data showing national variation in the implementation of GeriPACT staffing models and PCMH practices. Stakeholder feedback regarding the GeriPACT model was obtained from a GeriPACT team and the director of GeriPACT in VA. Here, we present national data regarding variations in GeriPACT staffing and PCMH practices. Following the adoption and implementation of the GeriPACT model and release of the GeriPACT handbook, sites were able to adopt the model's principles. The VA's adoption of PCMH reinforced the mission of patient-centered primary care by integrating psychosocial and environmental determinants of health. This was accomplished with enhancements to staff support through new full-time employment equivalents, but also by optimizing staff productivity through improved team function and interpersonal care. The GeriPACT model was implemented in a bottom-up fashion that has led to variation in how GeriPACTs are structured and staffed, as well as how they conform to various PCMH principles. GeriPACT is one approach for bringing an interdisciplinary, patient-centric perspective to primary care in a manner that can likely support the higher staffing costs with economies realized from diminished reliance on institutional placement and highly technologic health care. It is a model which can provide training for the next generation of providers and clinicians. © Copyright 2018 by the American Board of Family Medicine.
Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.
2013-01-01
Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386
Experience of Primary Care among Homeless Individuals with Mental Health Conditions
Chrystal, Joya G.; Glover, Dawn L.; Young, Alexander S.; Whelan, Fiona; Austin, Erika L.; Johnson, Nancy K.; Pollio, David E.; Holt, Cheryl L.; Stringfellow, Erin; Gordon, Adam J.; Kim, Theresa A.; Daigle, Shanette G.; Steward, Jocelyn L.; Kertesz, Stefan G
2015-01-01
The delivery of primary care to homeless individuals with mental health conditions presents unique challenges. To inform healthcare improvement, we studied predictors of favorable primary care experience among homeless persons with mental health conditions treated at sites that varied in degree of homeless-specific service tailoring. This was a multi-site, survey-based comparison of primary care experiences at three mainstream primary care clinics of the Veterans Administration (VA), one homeless-tailored VA clinic, and one tailored non-VA healthcare program. Persons who accessed primary care service two or more times from July 2008 through June 2010 (N = 366) were randomly sampled. Predictor variables included patient and organization characteristics suggested by the patient perception model developed by Sofaer and Firminger (2005), with an emphasis on mental health. The primary care experience was assessed with the Primary Care Quality-Homeless (PCQ-H) questionnaire, a validated survey instrument. Multiple regression identified predictors of positive experiences (i.e. higher PCQ-H total score). Significant predictors of a positive experience included a site offering tailored service design, perceived choice among providers, and currently domiciled status. There was an interaction effect between site and severe psychiatric symptoms. For persons with severe psychiatric symptoms, a homeless-tailored service design was significantly associated with a more favorable primary care experience. For persons without severe psychiatric symptoms, this difference was not significant. This study supports the importance of tailored healthcare delivery designed for homeless persons’ needs, with such services potentially holding special relevance for persons with mental health conditions. To improve patient experience among the homeless, organizations may want to deliver services that are tailored to homelessness and offer a choice of providers. PMID:25659142
Experience of primary care among homeless individuals with mental health conditions.
Chrystal, Joya G; Glover, Dawn L; Young, Alexander S; Whelan, Fiona; Austin, Erika L; Johnson, Nancy K; Pollio, David E; Holt, Cheryl L; Stringfellow, Erin; Gordon, Adam J; Kim, Theresa A; Daigle, Shanette G; Steward, Jocelyn L; Kertesz, Stefan G
2015-01-01
The delivery of primary care to homeless individuals with mental health conditions presents unique challenges. To inform healthcare improvement, we studied predictors of favorable primary care experience among homeless persons with mental health conditions treated at sites that varied in degree of homeless-specific service tailoring. This was a multi-site, survey-based comparison of primary care experiences at three mainstream primary care clinics of the Veterans Administration (VA), one homeless-tailored VA clinic, and one tailored non-VA healthcare program. Persons who accessed primary care service two or more times from July 2008 through June 2010 (N = 366) were randomly sampled. Predictor variables included patient and organization characteristics suggested by the patient perception model developed by Sofaer and Firminger (2005), with an emphasis on mental health. The primary care experience was assessed with the Primary Care Quality-Homeless (PCQ-H) questionnaire, a validated survey instrument. Multiple regression identified predictors of positive experiences (i.e. higher PCQ-H total score). Significant predictors of a positive experience included a site offering tailored service design, perceived choice among providers, and currently domiciled status. There was an interaction effect between site and severe psychiatric symptoms. For persons with severe psychiatric symptoms, a homeless-tailored service design was significantly associated with a more favorable primary care experience. For persons without severe psychiatric symptoms, this difference was not significant. This study supports the importance of tailored healthcare delivery designed for homeless persons' needs, with such services potentially holding special relevance for persons with mental health conditions. To improve patient experience among the homeless, organizations may want to deliver services that are tailored to homelessness and offer a choice of providers.
Smelson, David A; Chinman, Matthew; McCarthy, Sharon; Hannah, Gordon; Sawh, Leon; Glickman, Mark
2015-05-28
The Housing and Urban Development-Veterans Affairs Supportive Housing (HUD-VASH) program is one of the largest initiatives to end Veteran homelessness. However, mental health and substance use disorders continue to reduce client stability and impede program success. HUD-VASH programs do not consistently employ evidence-based practices that address co-occurring mental health and substance use disorders. This paper presents a study protocol to evaluate the implementation of an evidence-based, co-occurring disorder treatment called Maintaining Independence and Sobriety Through Systems Integration, Outreach, and Networking-Veterans Edition (MISSION-Vet) in HUD-VASH using an implementation strategy called Getting To Outcomes (GTO). In three large VA Medical Centers, this Hybrid Type III trial will randomize case managers and their clients by HUD-VASH sub-teams to receive either MISSION-Vet Implementation as Usual (IU-standard training and access to the MISSION-Vet treatment manuals) or MISSION-Vet implementation augmented by GTO. In addition to testing GTO, effectiveness of the treatment (MISSION-Vet) will be assessed using existing Veteran-level data from the HUD-VASH data monitoring system. This project will compare GTO and IU case managers and their clients on the following variables: (1) fidelity to the MISSION-Vet intervention; (2) proportion of time the Veteran is housed; (3) mental health, substance use, and functional outcomes among Veterans; and (4) factors key to the successful deployment of a new treatment as specified by the Reach, Effectiveness, Adoption, Implementation, and Maintenance (RE-AIM) model. This project is an important step for developing an implementation strategy to increase adoption of evidence-based practice use in VA homeless programs, and to further examine efficacy of MISSION-Vet in HUD-VASH. This project has important implications for program managers, policy makers, and researchers within the homelessness field. VA Central IRB approval for this study was granted in October 2011. The three sites were trained on MISSION-Vet and GTO in the first half of 2013. The first GTO planning meetings began after training occurred, between January 2013 and November 2013, across the three sites. The data collection-via a fidelity measure embedded into the VA Computerized Patient Record System-began as each site initiated MISSION-Vet, between April 2013 and January 2014. ClinicalTrials.gov: NCT01430741.
Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites
Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot
2013-01-01
Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958
Equilibrium defects and solute site preferences in intermetallics: I. thermodynamics
NASA Astrophysics Data System (ADS)
Collins, Gary S.; Zacate, Matthew O.
2001-03-01
A model was developed to describe equilibrium defects and site preferences of dilute solute atoms in compounds having the CsCl and Ni_2Al3 structures. Equilibrium defects considered were combinations of elementary point defects that preserve the composition. Equilibria among possible defect combinations were combined with appropriate equations of constraint to obtain defect concentrations as a function of temperature and possible deviation from the stoichiometric composition. As an application, site-energies of defects and solutes in AB and A_2B_3) systems were estimated using Miedema's empirical model, with A=(Ni, Pd, Pt) and B= (Al, Ga, In). Dominant equilibrium defects in the respective systems were found to be the "triple defect" (2V_A+ A_B) and "octal defect" (5V_A+ 3A_B). Site preferences were found to depend on concentrations of intrinsic defects as well as on site-energy differences, and results reveal how preferences generally depend on temperature and composition. Consider solute S which, based on site energies, prefers to replace atom B. It is found that S always occupies B-sites in B-deficient alloys. In B-rich alloys, however, S may or may not occupy B-sites, depending on site-energy differences and the formation energies of equilibrium defects. For a solute that prefers to replace atom A, analogous results are obtained but with A replacing B in the three preceding sentences. This work was supported in part by the NSF under grant DMR 96-12306.
A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.
Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L
1997-03-11
We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.
Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok
2017-07-01
Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.
2005-01-01
The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less
Exceptional Family Transitional Training Program (EFTTP)
2009-01-01
relationship with Reading for the Blind and Dyslexic® (RFBD), EPGL will be offering recordings for the visually impaired on its Web site in 2009. Experts...EPGL Web site. Stories have included information regarding new Department of Veterans Affairs (VA) rules for housing grants that aid the most seriously...EP also added a special Military Channel to its Web site. The channel provides links to important resources available to military families in a one
Craney Island Disposal Area: Updated Projections for Filling Rates through 1989
1992-08-01
2,500-acre confined dredged material disposal facility located near Norfolk, VA. In 1981, the Cwaney Island Management Plan ( CIMP ) was developed to extend...the useful life of the site for disposal of maintenance material from the project area. The CIMP called for subdivision of the site into three...subcontainments and use of alternating filling and dewatering cycles. Management of the site in general accordance with the CIMP was implemented in 1984
Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*
Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei
2015-01-01
The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883
77 FR 52135 - Advisory Committee on Homeless Veterans, Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-08-28
... an on-going assessment of the effectiveness of the policies, organizational structures, and services... patient privacy to conduct a site visit at the Donald J. Mitchell VA Outpatient Clinic, Griffiss Business...
Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L
2013-07-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.
Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.
2013-01-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967
Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonez, E.; Thiyagarajan, S.; Cook, J.D.
2009-05-22
Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less
NASA Astrophysics Data System (ADS)
Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong
2013-08-01
The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rothman, R.B.; Jacobson, A.E.; Rice, K.C.
1987-11-01
Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh
2013-01-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh
2013-09-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.
Goetz, Matthew B; Bowman, Candice; Hoang, Tuyen; Anaya, Henry; Osborn, Teresa; Gifford, Allen L; Asch, Steven M
2008-03-19
We describe how we used the framework of the U.S. Department of Veterans Affairs (VA) Quality Enhancement Research Initiative (QUERI) to develop a program to improve rates of diagnostic testing for the Human Immunodeficiency Virus (HIV). This venture was prompted by the observation by the CDC that 25% of HIV-infected patients do not know their diagnosis - a point of substantial importance to the VA, which is the largest provider of HIV care in the United States. Following the QUERI steps (or process), we evaluated: 1) whether undiagnosed HIV infection is a high-risk, high-volume clinical issue within the VA, 2) whether there are evidence-based recommendations for HIV testing, 3) whether there are gaps in the performance of VA HIV testing, and 4) the barriers and facilitators to improving current practice in the VA.Based on our findings, we developed and initiated a QUERI step 4/phase 1 pilot project using the precepts of the Chronic Care Model. Our improvement strategy relies upon electronic clinical reminders to provide decision support; audit/feedback as a clinical information system, and appropriate changes in delivery system design. These activities are complemented by academic detailing and social marketing interventions to achieve provider activation. Our preliminary formative evaluation indicates the need to ensure leadership and team buy-in, address facility-specific barriers, refine the reminder, and address factors that contribute to inter-clinic variances in HIV testing rates. Preliminary unadjusted data from the first seven months of our program show 3-5 fold increases in the proportion of at-risk patients who are offered HIV testing at the VA sites (stations) where the pilot project has been undertaken; no change was seen at control stations. This project demonstrates the early success of the application of the QUERI process to the development of a program to improve HIV testing rates. Preliminary unadjusted results show that the coordinated use of audit/feedback, provider activation, and organizational change can increase HIV testing rates for at-risk patients. We are refining our program prior to extending our work to a small-scale, multi-site evaluation (QUERI step 4/phase 2). We also plan to evaluate the durability/sustainability of the intervention effect, the costs of HIV testing, and the number of newly identified HIV-infected patients. Ultimately, we will evaluate this program in other geographically dispersed stations (QUERI step 4/phases 3 and 4).
Goetz, Matthew B; Bowman, Candice; Hoang, Tuyen; Anaya, Henry; Osborn, Teresa; Gifford, Allen L; Asch, Steven M
2008-01-01
Background We describe how we used the framework of the U.S. Department of Veterans Affairs (VA) Quality Enhancement Research Initiative (QUERI) to develop a program to improve rates of diagnostic testing for the Human Immunodeficiency Virus (HIV). This venture was prompted by the observation by the CDC that 25% of HIV-infected patients do not know their diagnosis – a point of substantial importance to the VA, which is the largest provider of HIV care in the United States. Methods Following the QUERI steps (or process), we evaluated: 1) whether undiagnosed HIV infection is a high-risk, high-volume clinical issue within the VA, 2) whether there are evidence-based recommendations for HIV testing, 3) whether there are gaps in the performance of VA HIV testing, and 4) the barriers and facilitators to improving current practice in the VA. Based on our findings, we developed and initiated a QUERI step 4/phase 1 pilot project using the precepts of the Chronic Care Model. Our improvement strategy relies upon electronic clinical reminders to provide decision support; audit/feedback as a clinical information system, and appropriate changes in delivery system design. These activities are complemented by academic detailing and social marketing interventions to achieve provider activation. Results Our preliminary formative evaluation indicates the need to ensure leadership and team buy-in, address facility-specific barriers, refine the reminder, and address factors that contribute to inter-clinic variances in HIV testing rates. Preliminary unadjusted data from the first seven months of our program show 3–5 fold increases in the proportion of at-risk patients who are offered HIV testing at the VA sites (stations) where the pilot project has been undertaken; no change was seen at control stations. Discussion This project demonstrates the early success of the application of the QUERI process to the development of a program to improve HIV testing rates. Preliminary unadjusted results show that the coordinated use of audit/feedback, provider activation, and organizational change can increase HIV testing rates for at-risk patients. We are refining our program prior to extending our work to a small-scale, multi-site evaluation (QUERI step 4/phase 2). We also plan to evaluate the durability/sustainability of the intervention effect, the costs of HIV testing, and the number of newly identified HIV-infected patients. Ultimately, we will evaluate this program in other geographically dispersed stations (QUERI step 4/phases 3 and 4). PMID:18353185
Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben
2017-03-28
Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less
Abou-Zied, Osama K
2015-01-01
Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.
Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.
Pikler, G M; Webster, R A; Spelsberg, T C
1976-01-01
Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147
The VA Ostomy Health-Related Quality of Life Study: objectives, methods, and patient sample.
Krouse, Robert S; Mohler, M Jane; Wendel, Christopher S; Grant, Marcia; Baldwin, Carol M; Rawl, Susan M; McCorkle, Ruth; Rosenfeld, Kenneth E; Ko, Clifford Y; Schmidt, C Max; Coons, Stephen Joel
2006-04-01
To present the design and methods of a multisite study of health-related quality of life (HR-QOL) in veterans living with ostomies. Veterans from Tucson, Indianapolis, and Los Angeles VA Medical Centers were surveyed using the validated City of Hope ostomy-specific tool (mCOH-QOL-Ostomy) and the SF-36V. Cases (ostomates) had a major gastrointestinal procedure that required an intestinal stoma, while controls had similar procedures for which an ostomy was not required. Ostomy subjects were recruited for four focus groups in each of two sites divided by ostomy type (colostomy versus ileostomy) and overall mCOH-QOL-Ostomy HR-QOL score (highest versus lowest quartile). The focus groups further evaluated barriers, concerns, and adaptation methods and skills. This report presents recruitment results, reliability of survey instruments, and demographic characteristics of the sample. The overall response (i.e., recruitment) rate across all sites was 48% and by site was 53%, 57%, and 37%, respectively (p < 0.001). Internal consistency reliability estimates indicated that both instruments remain reliable in this population (Cronbach's alpha for HR-QOL domains/scales: 0.71-0.96). Cases and controls were similar in demographic characteristics. Proportions of minority subjects matched projections from the site patient populations. Subjects with ostomies had significantly longer time since surgery than controls (p < 0.001). Focus groups were comprised of two to six subjects per group and demonstrated racial diversity at the Los Angeles site. The unique design of our study of VA patients with ostomies is an illustration of a successful mixed methods approach to HR-QOL research. We collected meaningful quantitative and qualitative data that will be used in the development of new approaches to care that will lead to improved functioning and well-being in persons living with ostomies. Subsequent reports will provide the results of this research project.
Ferreira, Manuel; Walcott, Brian P; Nahed, Brian V; Sekhar, Laligam N
2011-06-01
Hemifacial spasm (HFS) is caused by arterial or venous compression of cranial nerve VII at its root exit zone. Traditionally, microvascular decompression of the facial nerve has been an effective treatment for posterior inferior and anterior inferior cerebellar artery as well as venous compression. The traditional technique involves Teflon felt or another construct to cushion the offending vessel from the facial nerve, or cautery and division of the offending vein. However, using this technique for severe vertebral artery (VA) compression can be ineffective and fraught with complications. The authors report the use of a new technique of VA pexy to the petrous or clival dura mater in patients with HFS attributed to a severely ectatic and tortuous VA, and detail the results in a series of patients. Six patients with HFS due to VA compression underwent a retrosigmoid craniotomy, combined with a far-lateral approach in some patients. On identification of the site of VA compression, the vessel was mobilized adequately for the decompression. Great care was taken to avoid kinking the perforating vessels arising from the VA. Two 8-0 nylon sutures were passed through to the wall of the VA and then through the clival or petrous dura, and then tied to alleviate compression on cranial nerve VII. Patients were followed for at least 1 year postoperatively (mean 2.7 years, range 1-4 years). All 6 patients had complete resolution of their HFS. Facial function was tested postoperatively, and was stable when compared with the preoperative baseline. Two of the 3 patients with preoperative tinnitus had resolution of this symptom after the procedure. Postoperative imaging demonstrated VA decompression of the facial nerve and no evidence of stroke in all patients. One patient suffered from hearing loss, another developed a postoperative transient unilateral vocal cord paralysis, and a third patient developed a pseudomeningocele that resolved with the placement of a lumbar drain. Hemifacial spasm and other neurovascular syndromes are effectively treated by repositioning the compressing artery. Careful study of the preoperative MR images may identify a select group of patients with HFS due to an ectatic VA. Rather than traditional decompression with only pledget placement, these patients may benefit from a VA pexy to provide an effective, safe, and durable resolution of their symptoms while minimizing surgical complications.
Perspectives on Archeological Site Protection and Preservation
1991-06-01
the West Malpais, created with the establishment of the El Malpais National Conservation Area, have been the scene of intensive loot- ing and...Available from National Technical Information Service, 5285 Port Royal Road, Springfield, VA 22161 i2a. DISTRIBUTION /AVAILABILITY STATEMENT 12b...Peter J. Pilles, Jr ........ ...................... .... 67 The Status of Archeological Site Preservation in the National Park Service--Mark J. Lynott
Code of Federal Regulations, 2010 CFR
2010-07-01
... filed through the Office's web site, at http://www.uspto.gov. Paper documents and cover sheets to be... trademark documents can be ordered through the Office's web site at www.uspto.gov. Paper requests for...: Madrid Processing Unit, 600 Dulany Street, MDE-7B87, Alexandria, VA 22314-5793. [68 FR 48289, Aug. 13...
Bayden, Alexander S.; Fornabaio, Micaela; Scarsdale, J. Neel
2009-01-01
A public web server performing computational titration at the active site in a protein-ligand complex has been implemented. This calculation is based on the Hydropathic INTeraction (HINT) noncovalent force field. From 3D coordinate data for the protein, ligand and bridging waters (if available), the server predicts the best combination of protonation states for each ionizable residue and/or ligand functional group as well as the Gibbs free energy of binding for the ionization-optimized protein-ligand complex. The 3D structure for the modified molecules is available as output. In addition, a graph depicting how this energy changes with acidity, i.e., as a function of added protons, can be obtained. This data may prove to be of use in preparing models for virtual screening and molecular docking. A few illustrative examples are presented. In β secretase (2va7) computational titration flipped the amide groups of Gln12 and Asn37 and protonated a ligand amine yielding an improvement of 6.37 kcal mol−1 in the protein-ligand binding score. Protonation of Glu139 in mutant HIV-1 reverse transcriptase (2opq) allows a water bridge between the protein and inhibitor that increases the protein-ligand interaction score by 0.16 kcal mol−1. In human sialidase NEU2 complexed with an isobutyl ether mimetic inhibitor (2f11) computational titration suggested that protonating Glu218, deprotonating Arg237, flipping the amide bond on Tyr334, and optimizing the positions of several other polar protons would increase the protein-ligand interaction score by 0.71 kcal mol−1. PMID:19554265
Tabani, Halima; Yousef, Sonia; Burkhardt, Jan-Karl; Gandhi, Sirin; Benet, Arnau; Lawton, Michael T
2018-05-21
Most cranial nerve compression syndromes (ie, trigeminal neuralgia and hemifacial spasm) are caused by small arteries impinging on a nerve and are relieved by microvascular decompression. Rarely, cranial nerve compression syndromes can be caused by large artery impingement and can be relieved by macrovascular decompression. When present, this compression often occurs in association with degenerative atherosclerosis in the vertebral arteries (VA) and basilar artery. Conservative treatment is recommended for mild forms, but surgical transposition of the VA away from the root entry zone (REZ) can be considered. This video demonstrates macrovascular decompression of a dolichoectatic VA in a 74-yr-old female with refractory left hemifacial spasm. After obtaining IRB approval, patient consent was sought for the procedure. With the patient in three-quarter-prone position, a far-lateral craniotomy was performed. The dentate ligament was cut to free the VA, and the suprahypoglossal portion of the vagoaccessory triangle was widened. VA compressed the REZ of the facial nerve, but was mobilized anteromedially off the REZ. A muslin sling was wrapped around the VA and its tail brought down to the clival dura, which was punctured with a 19-gauge needle and enlarged with a dissector. The sling was pulled anteromedially to this puncture site and secured to the dura with an aneurysm clip, relieving the REZ of all compression. The patient tolerated the procedure with mild, transient hoarseness and her hemifacial spasm resolved completely. This case demonstrates the macrovascular decompression technique with anteromedial transposition of the vertebrobasilar artery, which can also be used for trigeminal neuralgia.
Veteran-child communication about parental PTSD: A mixed methods pilot study.
Sherman, Michelle D; Larsen, Jessica; Straits-Troster, Kristy; Erbes, Christopher; Tassey, John
2015-08-01
The majority of adults with posttraumatic stress disorder (PTSD) are parents. Parents with PTSD report lower levels of parenting satisfaction, poorer parent-child relationships, and elevated incidence of child distress and behavioral problems in comparison with parents without PTSD. Although literature exists regarding parent-child communication about serious mental illness and physical health problems, research has yet to examine this communication regarding parental PTSD. This 3-site, mixed methods study involved 19 veteran parents who had a diagnosis of PTSD; participants were recruited from VA medical centers. Veterans participated in focus groups or individual interviews and completed questionnaires, responding to questions about motivations and barriers for disclosure of their PTSD to their children, the content of such disclosure, experiences at the VA as a parent, and desired VA family resources. Although many veterans described a desire to talk with their children about PTSD, they experience many barriers to doing so, including both personal reservations and feelings (e.g., avoidance of discussing PTSD, shame) and concerns about the consequences of disclosure on their children (e.g., child distress, loss of child's respect for veteran). Regarding veterans' experience at the VA, 21% reported that none of their providers had assessed if they have children, and 21% experienced the VA system as not welcoming to them as parents, citing both logistical issues (e.g., lack of childcare) and provider neglect of parenting concerns. Veterans indicated they would like the VA to offer parenting classes, workshops for families, child care, and family therapy. (c) 2015 APA, all rights reserved).
Harrod, Molly; Manojlovich, Milisa; Kowalski, Christine P; Saint, Sanjay; Krein, Sarah L
2014-01-01
Health care-associated infection (HAI) is costly to hospitals and potentially life-threatening to patients. Numerous infection prevention programs have been implemented in hospitals across the United States. Yet, little is known about infection prevention practices and implementation in rural hospitals. The purpose of this study was to understand the infection prevention practices used by rural Veterans' Affairs (VA) hospitals and the unique factors they face in implementing these practices. This study used a sequential, mixed methods approach. Survey data to identify the HAI prevention practices used by rural VA hospitals were collected, analyzed, and used to inform the development of a semistructured interview guide. Phone interviews were conducted followed by site visits to rural VA hospitals. We found that most rural VA hospitals were using key recommended infection prevention practices. Nonetheless, a number of challenges with practice implementation were identified. The 3 most prominent themes were: (1) lack of human capital including staff with HAI expertise; (2) having to cultivate needed resources; and (3) operating as a system within a system. Rural VA hospitals are providing key infection prevention services to ensure a safe environment for the veterans they serve. However, certain factors, such as staff expertise, limited resources, and local context impacted how and when these practices were used. The creative use of more accessible alternative resources as well as greater flexibility in implementing HAI-related initiatives may be important strategies to further improve delivery of these important services by rural VA hospitals. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
Lamp, Kristen E; Avallone, Kimberly M; Maieritsch, Kelly P; Buchholz, Katherine R; Rauch, Sheila A M
2018-05-14
In accordance with Veterans Affairs (VA) policy, VA posttraumatic stress disorder (PTSD) clinics offer evidence-based treatments including cognitive processing therapy (CPT). To facilitate access to care, CPT is offered in both group and individual formats in many VA PTSD clinics. Group and individual delivery of CPT have been directly compared in active duty samples, but these findings have not been extended to VA populations. The present article directly compares the effectiveness of group and individual CPT with a written trauma account (CPT+A) across two VA PTSD clinics. Veterans (N = 465) completed initial evaluations and enrolled in either group CPT+A (N = 146) or individual CPT+A (N = 319). Self-report measures of PTSD and depression symptoms were collected at pre-, mid-, and posttreatment; combined across treatment sites; and analyzed using hierarchical linear modeling. PTSD and depression symptoms reduced significantly over the course of group and individual CPT+A. Medium treatment effects were found for group CPT+A (d = .66 for PTSD, d = .68 for depression), and large treatment effects were found for individual CPT+A (d = .96 for PTSD, d = .79 for depression). Individual CPT+A led to significantly greater PTSD and depression symptom reduction than group CPT+A, indicating that in VA outpatient PTSD clinic settings, individual CPT+A may be a more effective approach than group CPT-A. In addition, PTSD symptoms reduced significantly more for Caucasian veterans than for African American veterans during CPT+A, indicating the importance of providing culturally competent trauma-focused care. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo
NASA Astrophysics Data System (ADS)
Schwartz, Rochelle D.; Kellar, Kenneth J.
1983-04-01
Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.
Substance P binding sites in the nucleus tractus solitarius of the cat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maley, B.E.; Sasek, C.A.; Seybold, V.S.
1988-11-01
Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less
Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun
2018-06-16
Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.
Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.
1991-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985
Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul
2008-11-21
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.
Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G
1992-05-05
Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.
Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC
2008-01-01
Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135
Kawasaki, Kazuyoshi; Ogawa, Seturou
2003-01-01
NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.
CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.
Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar
2017-09-01
Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.
Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)
Das, Sourav; Kokardekar, Arshad
2009-01-01
Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089
Alam, Nurul; Chowdhury, Hafizur R; Ahmed, Ali; Rahman, Mahfuzur; Streatfield, P Kim
2014-01-01
This study used the InterVA-4 computerised model to assign probable cause of death (CoD) to verbal autopsies (VAs) generated from two rural areas, with a difference in health service provision, within the Matlab Health and Demographic Surveillance site (HDSS). This study aimed to compare CoD by gender, as well as discussing possible factors which could influence differences in the distribution of CoD between the two areas. Data for this study came from the Matlab the HDSS maintained by the International Centre for Diarrhoeal Disease Research, Bangladesh (icddr,b) since 1966. In late 1977, icddr,b divided HDSS and implemented a high-quality maternal, newborn and child health and family planning (MNCH-FP) services project in one half, called the icddr,b service area (SA), in addition to the usual public and private MNCH-FP services that serve the other half, called the government SA. HDSS field workers registered 12,144 deaths during 2003-2010, and trained interviewers obtained VA for 98.9% of them. The probabilistic model InterVA-4 probabilistic model (version 4.02) was used to derive probable CoD from VA symptoms. Cause-specific mortality rates and fractions were compared across gender and areas. Appropriate statistical tests were applied for significance testing. Mortality rates due to neonatal causes and communicable diseases (CDs) were lower in the icddr,b SA than in the government SA, where mortality rates due to non-communicable diseases (NCDs) were lower. Cause-specific mortality fractions (CSMFs) due to CDs (23.2% versus 18.8%) and neonatal causes (7.4% versus 6%) were higher in the government SA, whereas CSMFs due to NCDs were higher (58.2% versus 50.7%) in the icddr,b SA. The rank-order of CSMFs by age group showed marked variations, the largest category being acute respiratory infection/pneumonia in infancy, injury in 1-4 and 5-14 years, neoplasms in 15-49 and 50-64 years, and stroke in 65+ years. Automated InterVA-4 coding of VA to determine probable CoD revealed the difference in the structure of CoD between areas with prominence of NCDs in both areas. Such information can help local planning of health services for prevention and management of disease burden.
Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine
Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.
2015-01-01
Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408
DOE Office of Scientific and Technical Information (OSTI.GOV)
Poat, J.A.; Cripps, H.E.; Iversen, L.L.
1988-05-01
Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCann, D.J.; Su, T.P.
1991-05-01
The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less
Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.
Suzuki, N; Mihashi, K
1991-01-01
The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.
Characterization of the interaction between the heavy and light chains of bovine factor Va.
Walker, F J
1992-10-05
Bovine factor Va has been previously been shown to consist of heavy (M(r) = 94,000) and light chains (M(r) = 81,000), that interact in a manner dependent upon the presence of either calcium or manganese ions. In an attempt to understand the mechanism of subunit interaction we have studied the effects of temperature and ions on factor Va stability. The rates of formation of factor Va from isolated chains and dissociation were temperature-dependent with an energy of activation of 6.2 and 1.3 kcal mol-1, respectively. The yield of factor Va from isolated chains was inversely related to the amount of time the chains were incubated at 4 degrees C. Incubation of individual chains revealed that the heavy chain is cold-labile, an effect that is reversible. Manganese ion was observed to prevent the conversion to the inactive form. High salt tends to stabilize the two-chain structure of factor Va, but is inhibitory to its formation from isolated chains. High concentrations of either manganese or calcium ions also inhibited reconstitution of activity. The light chain, in particular, was sensitive to the presence of manganese or calcium ion. Heavy chain that had been cleaved by activated protein C had a weakened interaction with the light chain, and the resulting complex had no procoagulant activity. Cooling of the heavy chain to 4 degrees C enhanced its intrinsic fluorescence. Manganese ion prevented some of this enhancement. The heavy chain fluorescence returned to the room temperature value with a half-life of approximately 10 min. In the presence of manganese ion relaxation was accelerated. The intrinsic fluorescence of activated protein C-cleaved heavy chain was not increased when the temperature was decreased. These data suggest that the heavy chain can exist in two forms. Elevated temperature converts it to a form that can bind ions and have a productive interaction with the light chain. However, conditions that prevent the heavy chain from combining with the light chain also stabilize the two subunit structure, suggesting that the high affinity of the complex is due to conformational changes that occur after chain interaction.
Bulson, Ryan; Jun, Weon; Hayes, John
2012-01-01
Advances in protective armor technology and changes in the "patterns of war" have created a population of Operation Iraqi Freedom/Operation Enduring Freedom (OIF/OEF) veterans with traumatic brain injury (TBI) that provide a unique challenge to Department of Veterans Affairs (VA) healthcare practitioners. The purpose of the study was to determine the frequency of symptomatic ocular and visual sequelae of TBI in OIF/OEF veterans at the Portland VA Medical Center, a Polytrauma Support Clinic Team site. A retrospective analysis of 100 OIF/OEF veterans with TBI was conducted to determine the prevalence of ocular and visual complaints. Referral patterns were also investigated. Visual symptoms were reported in approximately 50% of veterans with TBI. Loss of consciousness, but not number of deployments or number of blast exposures, was found to have a statistically significant association with severity of reported visual symptoms. The most commonly reported symptoms included blurred vision (67%), photosensitivity (50%), and accommodative problems (40%). Visual symptoms of OIF/OEF veterans at the Portland VA Medical Center are reported at slightly lower rates than similar studies conducted at the Palo Alto and Edward Hines Jr VA facilities.
ACHP | Section 106 Success Stories
Casa Farnese "Creative Solution Preserves Integrity of Historic Development Project" -site mitigation solution." - Fort A.P. Hill, Caroline County, Virginia Franklin Post Office " "VA Medical Center: consultation leads to innovative solution." - Leavenworth, Kansas
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luthin, G.R.; Wolfe, B.B.
The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less
Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H
1997-02-28
The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-07-05
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.
Existence of three subtypes of bradykinin B2 receptors in guinea pig.
Seguin, L; Widdowson, P S; Giesen-Crouse, E
1992-12-01
We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)
Denys, A; Allain, F; Carpentier, M; Spik, G
1998-12-15
Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.
Nguyen, T V; Juorio, A V
1989-10-01
The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.
Impact of germline and somatic missense variations on drug binding sites.
Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R
2017-03-01
Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.
2013-01-01
Background Alpha-1 proteinase inhibitor (API) is a plasma serpin superfamily member that inhibits neutrophil elastase; variant API M358R inhibits thrombin and activated protein C (APC). Fusing residues 1-75 of another serpin, heparin cofactor II (HCII), to API M358R (in HAPI M358R) was previously shown to accelerate thrombin inhibition over API M358R by conferring thrombin exosite 1 binding properties. We hypothesized that replacing HCII 1-75 region with the 13 C-terminal residues (triskaidecapeptide) of hirudin variant 3 (HV354-66) would further enhance the inhibitory potency of API M358R fusion proteins. We therefore expressed HV3API M358R (HV354-66 fused to API M358R) and HV3API RCL5 (HV354-66 fused to API F352A/L353V/E354V/A355I/I356A/I460L/M358R) API M358R) as N-terminally hexahistidine-tagged polypeptides in E. coli. Results HV3API M358R inhibited thrombin 3.3-fold more rapidly than API M358R; for HV3API RCL5 the rate enhancement was 1.9-fold versus API RCL5; neither protein inhibited thrombin as rapidly as HAPI M358R. While the thrombin/Activated Protein C rate constant ratio was 77-fold higher for HV3API RCL5 than for HV3API M358R, most of the increased specificity derived from the API F352A/L353V/E354V/A355I/I356A/I460L API RCL 5 mutations, since API RCL5 remained 3-fold more specific than HV3API RCL5. An HV3 54-66 peptide doubled the Thrombin Clotting Time (TCT) and halved the binding of thrombin to immobilized HCII 1-75 at lower concentrations than free HCII 1-75. HV3API RCL5 bound active site-inhibited FPR-chloromethyl ketone-thrombin more effectively than HAPI RCL5. Transferring the position of the fused HV3 triskaidecapeptide to the C-terminus of API M358R decreased the rate of thrombin inhibition relative to that mediated by HV3API M358R by 11-to 14-fold. Conclusions Fusing the C-terminal triskaidecapeptide of HV3 to API M358R-containing serpins significantly increased their effectiveness as thrombin inhibitors, but the enhancement was less than that seen in HCII 1-75–API M358R fusion proteins. HCII 1-75 was a superior fusion partner, in spite of the greater affinity of the HV3 triskaidecapeptide, manifested both in isolated and API-fused form, for thrombin exosite 1. Our results suggest that HCII 1-75 binds thrombin exosite 1 and orients the attached serpin scaffold for more efficient interaction with the active site of thrombin than the HV3 triskaidecapeptide. PMID:24215622
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valley, Cary T.; Porter, Douglas F.; Qiu, Chen
2012-06-28
mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.
Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A
2011-05-31
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dissanayake, V.U.; Hughes, J.; Hunter, J.C.
The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less
Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki
2018-06-01
Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.
Distinct p53 genomic binding patterns in normal and cancer-derived human cells
McCorkle, Sean R; McCombie, WR; Dunn, John J
2011-01-01
Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205
Ethylene binding site affinity in ripening apples
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blankenship, S.M.; Sisler, E.C.
1993-09-01
Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less
NASA Technical Reports Server (NTRS)
D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.
2002-01-01
Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.
Functional identification and characterization of sodium binding sites in Na symporters
Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.
2013-01-01
Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006
Navé, Jean-François; Benveniste, Pierre
1984-01-01
The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499
Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris
2015-01-01
The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415
Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.
The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less
1990-12-01
zinc and arsenic levels in vegetation growing on the landfill compared with the control site . This observation may indicate the value of ground-based...Stanford. CA CANADA \\iateur De Champlain. DS.A.. Matane. Quebec LINDA HALL LIBRARY Doc Dept. Kansas City . MO NATL ACADEMY OF ENGRG Alexandria. VA PRESNELL... site and fromn an elclroJplating acid wvaste disposal site near Bangor. Washington. The samples were mecasured with a spectroradiomecter employing
Autoradiographic localization of endothelin-1 binding sites in porcine skin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Y.D.; Springall, D.R.; Wharton, J.
Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less
Withey, Jeffrey H; DiRita, Victor J
2005-05-01
The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.
Verbal autopsy in health policy and systems: a literature review
Balabanova, Dina
2018-01-01
Introduction Estimates suggest that one in two deaths go unrecorded globally every year in terms of medical causes, with the majority occurring in low and middle-income countries (LMICs). This can be related to low investment in civil registration and vital statistics (CRVS) systems. Verbal autopsy (VA) is a method that enables identification of cause of death where no other routine systems are in place and where many people die at home. Considering the utility of VA as a pragmatic, interim solution to the lack of functional CRVS, this review aimed to examine the use of VA to inform health policy and systems improvements. Methods A literature review was conducted including papers published between 2010 and 2017 according to a systematic search strategy. Inclusion of papers and data extraction were assessed by three reviewers. Thereafter, thematic analysis and narrative synthesis were conducted in which evidence was critically examined and key themes were identified. Results Twenty-six papers applying VA to inform health policy and systems developments were selected, including studies in 15 LMICs in Africa, Asia, the Middle East and South America. The majority of studies applied VA in surveillance sites or programmes actively engaging with decision makers and governments in different ways and to different degrees. In the papers reviewed, the value of continuous collection of cause of death data, supplemented by social and community-based investigations and underpinned by electronic data innovations, to establish a robust and reliable evidence base for health policies and programmes was clearly recognised. Conclusion VA has considerable potential to inform policy, planning and measurement of progress towards goals and targets. Working collaboratively at sub-national, national and international levels facilitates data collection, aggregation and dissemination linked to routine information systems. When used in partnerships between researchers and authorities, VA can help to close critical information gaps and guide policy development, implementation, evaluation and investment in health systems. PMID:29736271
Verbal autopsy in health policy and systems: a literature review.
Thomas, Lisa-Marie; D'Ambruoso, Lucia; Balabanova, Dina
2018-01-01
Estimates suggest that one in two deaths go unrecorded globally every year in terms of medical causes, with the majority occurring in low and middle-income countries (LMICs). This can be related to low investment in civil registration and vital statistics (CRVS) systems. Verbal autopsy (VA) is a method that enables identification of cause of death where no other routine systems are in place and where many people die at home. Considering the utility of VA as a pragmatic, interim solution to the lack of functional CRVS, this review aimed to examine the use of VA to inform health policy and systems improvements. A literature review was conducted including papers published between 2010 and 2017 according to a systematic search strategy. Inclusion of papers and data extraction were assessed by three reviewers. Thereafter, thematic analysis and narrative synthesis were conducted in which evidence was critically examined and key themes were identified. Twenty-six papers applying VA to inform health policy and systems developments were selected, including studies in 15 LMICs in Africa, Asia, the Middle East and South America. The majority of studies applied VA in surveillance sites or programmes actively engaging with decision makers and governments in different ways and to different degrees. In the papers reviewed, the value of continuous collection of cause of death data, supplemented by social and community-based investigations and underpinned by electronic data innovations, to establish a robust and reliable evidence base for health policies and programmes was clearly recognised. VA has considerable potential to inform policy, planning and measurement of progress towards goals and targets. Working collaboratively at sub-national, national and international levels facilitates data collection, aggregation and dissemination linked to routine information systems. When used in partnerships between researchers and authorities, VA can help to close critical information gaps and guide policy development, implementation, evaluation and investment in health systems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.
2004-10-28
We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.
Chen, Hsiu-Hui; Vicente, Cristina P.; He, Li; Tollefsen, Douglas M.; Wun, Tze-Chein
2005-01-01
The anionic phospholipid, phosphatidyl-l-serine (PS), is sequestered in the inner layer of the plasma membrane in normal cells. Upon injury, activation, and apoptosis, PS becomes exposed on the surfaces of cells and sheds microparticles, which are procoagulant. Coagulation is initiated by formation of a tissue factor/factor VIIa complex on PS-exposed membranes and propagated through the assembly of intrinsic tenase (factor VIIIa/factor IXa), prothrombinase (factor Va/factor Xa), and factor XIa complexes on PS-exposed activated platelets. We constructed a novel series of recombinant anticoagulant fusion proteins by linking annexin V (ANV), a PS-binding protein, to the Kunitz-type protease inhibitor (KPI) domain of tick anticoagulant protein, an aprotinin mutant (6L15), amyloid β-protein precursor, or tissue factor pathway inhibitor. The resulting ANV-KPI fusion proteins were 6- to 86-fold more active than recombinant tissue factor pathway inhibitor and tick anticoagulant protein in an in vitro tissue factor–initiated clotting assay. The in vivo antithrombotic activities of the most active constructs were 3- to 10-fold higher than that of ANV in a mouse arterial thrombosis model. ANV-KPI fusion proteins represent a new class of anticoagulants that specifically target the anionic membrane-associated coagulation enzyme complexes present at sites of thrombogenesis and are potentially useful as antithrombotic agents. PMID:15677561
Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V
2017-02-07
Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.
Bastian, Lori A; Trentalange, Mark; Murphy, Terrence E; Brandt, Cynthia; Bean-Mayberry, Bevanne; Maisel, Natalya C; Wright, Steven M; Gaetano, Vera S; Allore, Heather; Skanderson, Melissa; Reyes-Harvey, Evelyn; Yano, Elizabeth M; Rose, Danielle; Haskell, Sally
2014-01-01
Women veterans comprise a small percentage of Department of Veterans Affairs (VA) health care users. Prior research on women veterans' experiences with primary care has focused on VA site differences and not individual provider characteristics. In 2010, the VA established policy requiring the provision of comprehensive women's health care by designated women's health providers (DWHPs). Little is known about the quality of health care delivered by DWHPs and women veterans' experience with care from these providers. Secondary data were obtained from the VA Survey of Healthcare Experience of Patients (SHEP) using the Consumer Assessment of Healthcare Providers and Systems (CAHPS) patient-centered medical home (PCMH) survey from March 2012 through February 2013, a survey designed to measure patient experience with care and the DWHPs Assessment of Workforce Capacity that discerns between DWHPs versus non-DWHPs. Of the 28,994 surveys mailed to women veterans, 24,789 were seen by primary care providers and 8,151 women responded to the survey (response rate, 32%). A total of 3,147 providers were evaluated by the SHEP-CAHPS-PCMH survey (40%; n = 1,267 were DWHPs). In a multivariable model, patients seen by DWHPs (relative risk, 1.02; 95% CI, 1.01-1.04) reported higher overall experiences with care compared with patients seen by non-DWHPs. The main finding is that women veterans' overall experiences with outpatient health care are slightly better for those receiving care from DWHPs compared with those receiving care from non-DWHPs. Our findings have important policy implications for how to continue to improve women veterans' experiences. Our work provides support to increase access to DWHPs at VA primary care clinics. Published by Elsevier Inc.
Bastian, Lori A.; Trentalange, Mark; Murphy, Terrence E.; Brandt, Cynthia; Bean-Mayberry, Bevanne; Maisel, Natalya C.; Wright, Steven M.; Gaetano, Vera S.; Allore, Heather; Skanderson, Melissa; Reyes-Harvey, Evelyn; Yano, Elizabeth M.; Rose, Danielle; Haskell, Sally
2016-01-01
Background Women Veterans comprise a small percentage of VA healthcare users. Prior research on women Veterans’ experiences with primary care has focused on VA site differences and not individual provider characteristics. In 2010, the VA established policy requiring the provision of comprehensive women’s healthcare by designated women’s health providers (DWHPs). Little is known about the quality of healthcare delivered by DWHPs and women Veterans’ experience with care from these providers. Methods Secondary data were obtained from the VA Survey of Healthcare Experience of Patients (SHEP) using the Consumer Assessment of Healthcare Providers and Systems (CAHPS) patient-centered medical home (PCMH) survey from March 2012 through February 2013, a survey designed to measure patient experience with care and the DWHPs Assessment of Workforce Capacity (DAWC) that discerns between DWHPs versus non-DWHPs. Findings Of the 28,994 surveys mailed to women Veterans, 24,789 were seen by primary care providers and 8,151 women responded to the survey (response rate 32%). A total of 3,147 providers were evaluated by the SHEP-CAHPS-PCMH survey (40%; n=1,267 were DWHPs). In a multivariable model, patients seen by DWHPs (RR=1.02 95% CI=1.01−1.04) reported higher overall experiences with care compared to patients seen by non-DWHPs. Conclusions The main finding is that women Veterans’ overall experiences with outpatient healthcare are slightly better for those receiving care from DWHPs compared to those receiving care from non-DWHPs. Our findings have important policy implications for how to continue to improve women Veterans’ experiences. Our work provides support to increase access to DWHPs at VA primary care clinics. PMID:25442706
Sunita, S; Schwartz, Samantha L; Conn, Graeme L
2015-11-20
Double-stranded RNA (dsRNA)-activated protein kinase (PKR) is an important component of the innate immune system that presents a crucial first line of defense against viral infection. PKR has a modular architecture comprising a regulatory N-terminal dsRNA binding domain and a C-terminal kinase domain interposed by an unstructured ∼80-residue interdomain linker (IDL). Guided by sequence alignment, we created IDL deletions in human PKR (hPKR) and regulatory/kinase domain swap human-rat chimeric PKRs to assess the contributions of each domain and the IDL to regulation of the kinase activity by RNA. Using circular dichroism spectroscopy, limited proteolysis, kinase assays, and isothermal titration calorimetry, we show that each PKR protein is properly folded with similar domain boundaries and that each exhibits comparable polyinosinic-cytidylic (poly(rI:rC)) dsRNA activation profiles and binding affinities for adenoviral virus-associated RNA I (VA RNAI) and HIV-1 trans-activation response (TAR) RNA. From these results we conclude that the IDL of PKR is not required for RNA binding or mediating changes in protein conformation or domain interactions necessary for PKR regulation by RNA. In contrast, inhibition of rat PKR by VA RNAI and TAR RNA was found to be weaker than for hPKR by 7- and >300-fold, respectively, and each human-rat chimeric domain-swapped protein showed intermediate levels of inhibition. These findings indicate that PKR sequence or structural elements in the kinase domain, present in hPKR but absent in rat PKR, are exploited by viral non-coding RNAs to accomplish efficient inhibition of PKR. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei
2012-01-01
Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Amato, R.J.; Largent, B.L.; Snowman, A.M.
1987-07-01
Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less
1983-05-01
Nirwerly Contribu~tions 6b- Leah Allen 11. itcpAk;i McBr&-de W. Lei Nfilijfl, Miltun B. Newtoni Rohcrl C.. Sonder-lari W n ;, Va , 3 r . .Ai tht...the Tombigbee Historic Townmsites Project -____ 7. Am1A I\\ akwon O"Uef"Z5SE6 now. 146. W. Lee Minnerly, et.aI. r pooemsag GCeavlIO ftevne .. .^"#va.C P...13 ’ Results . . . . . . . . . . . . . . . . . . . .. . 115 I I r w . -w~~~~7 - .1 -. 1 u- - - - - - Site and Unit Descriptions
Jiang, Peng; Singh, Mona; Coller, Hilary A
2013-01-01
Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.
DEPOSITION PATTERNS OF RAGWEED POLLEN IN THE HUMAN RESPIRATORY TRACT
Inhaled particle deposition sites must be identified to effectively treat human airway diseases. e have determined distribution patterns of a selected aeroallergen, ragweed pollen, among human extrathoracic (ET: .e., oro-nasopharyngeal) regions and the lung. A predictive model va...
Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M
2013-03-19
Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.
Tam, S W; Cook, L
1984-01-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851
Effect of PCI on Long-Term Survival in Patients with Stable Ischemic Heart Disease.
Sedlis, Steven P; Hartigan, Pamela M; Teo, Koon K; Maron, David J; Spertus, John A; Mancini, G B John; Kostuk, William; Chaitman, Bernard R; Berman, Daniel; Lorin, Jeffrey D; Dada, Marcin; Weintraub, William S; Boden, William E
2015-11-12
Percutaneous coronary intervention (PCI) relieves angina in patients with stable ischemic heart disease, but clinical trials have not shown that it improves survival. Between June 1999 and January 2004, we randomly assigned 2287 patients with stable ischemic heart disease to an initial management strategy of optimal medical therapy alone (medical-therapy group) or optimal medical therapy plus PCI (PCI group) and did not find a significant difference in the rate of survival during a median follow-up of 4.6 years. We now report the rate of survival among the patients who were followed for up to 15 years. We obtained permission from the patients at the Department of Veterans Affairs (VA) sites and some non-VA sites in the United States to use their Social Security numbers to track their survival after the original trial period ended. We searched the VA national Corporate Data Warehouse and the National Death Index for survival information and the dates of death from any cause. We calculated survival according to the Kaplan-Meier method and used a Cox proportional-hazards model to adjust for significant between-group differences in baseline characteristics. Extended survival information was available for 1211 patients (53% of the original population). The median duration of follow-up for all patients was 6.2 years (range, 0 to 15); the median duration of follow-up for patients at the sites that permitted survival tracking was 11.9 years (range, 0 to 15). A total of 561 deaths (180 during the follow-up period in the original trial and 381 during the extended follow-up period) occurred: 284 deaths (25%) in the PCI group and 277 (24%) in the medical-therapy group (adjusted hazard ratio, 1.03; 95% confidence interval, 0.83 to 1.21; P=0.76). During an extended-follow-up of up to 15 years, we did not find a difference in survival between an initial strategy of PCI plus medical therapy and medical therapy alone in patients with stable ischemic heart disease. (Funded by the VA Cooperative Studies Program and others; COURAGE ClinicalTrials.gov number, NCT00007657.).
Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.
Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M
2007-05-01
The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu
2012-02-05
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S.
2012-05-24
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Location of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.
Locations of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.
Discovering amino acid patterns on binding sites in protein complexes
Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng
2011-01-01
Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838
Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P
2005-04-01
Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.
Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa
2013-01-01
Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin
Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.
2011-01-01
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.
Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes
Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624
Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.
Dubois, B W; Cherian, S F; Evers, A S
1993-01-01
There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659
Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.
The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less
Employing Electron Microscopy integrated with X-ray Spectroscopy for Kuntawa Landslide Assessment
NASA Astrophysics Data System (ADS)
Dikedi, P. N.
2016-12-01
This work centres on Kuntawa landslide assessment owing to the enigmatic nature of a 2003 landslide which buried 4 people and a truck in Kuntawa village, of Nigeria. A Phenom ProX Scanning Electron Microscope (SEM) integrated with Energy dispersive X-ray Spectroscopy (EDS) and Particlemetric software was employed to generate the morphology, particle size data, elemental identification data and topography (at 3500x) of earth samples scooped from the landslide site. For a core sample 1 at depth, d=3.75m, average circle equivalent diameter dav, area a and volume by area Va of 11.5 µm, 249 µm² and 3680µm³ were generated respectively; at d=3.785m, dav , a and Va of 6.19µm, 30.1µm² and 124µm³ were generated respectively; at d=3.82m, dav , a and Va of 11.5 µm, 130 µm² and 1380µm³ were generated respectively. For a core sample 2, at d=3.75m, dav, a and Va of 5.54 µm, 26 µm² and 108µm³ were generated respectively; at d=3.82m, dav , a and Va of 19.4µm, 338µm² and 5240µm³ were generated respectively; a total of 243 particles were scanned. One of the results from specific surface for samples 1 and 2, reveals that it would take twice and four times the amount of water needed to wet an entire surface both at d=3.82m than at d=3.785m and d=3.75m respectively. Additional laboratory facilities reveal that soil water content Š, volumetric water content Vwc, porosity Φ, soil water-filled pore space Wps, increased with increasing d; bulk density ρb, decreased with increasing d. Elemental composition at the landslide site were generated from the EDS: oxygen (O), Silicon (Si), Bromine (Br), iron (Fe), Carbon (C) and Aluminium (Al). O and C had the highest and lowest concentration of elemental compositions of 68.5% at 3.75m depth and 1% at 3.82m depth for samples 1 and 2, respectively. Keywords: EDS, Particlemetric, SEM.
In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites
Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent
2017-01-01
In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biegon, A.; Rainbow, T.C.
1983-05-01
The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less
Yüksel, Harun; Türkcü, Fatih Mehmet; Çınar, Yasin; Cingü, Abdullah Kürşat; Sahin, Alparslan; Sahin, Muhammed; Özkurt, Zeynep; Murat, Mehmet; Çaça, Ihsan
2014-07-01
The purpose of this study was to evaluate the etiologic and prognostic factors of open eye injuries in geriatric patients in the Southeastern region of Anatolia. Forty-five geriatric patients who underwent surgery for an open eye injury in our clinic between the years of 2008 and 2012 were evaluated retrospectively. Age, gender, cause and the mechanism of the trauma, visual acuity (VA), and the time between the trauma and the surgery were obtained from files and evaluated. The mean age of the patients was 70.4±8.2 (65-90) years. Thirty-four of the cases were male and 11 were female. The most frequent mechanism of trauma was a wood strike, while the second most common one was injury with a knife. Corneoscleral penetration was the most frequently observed trauma. The mean VA of the patients was 2.26±0.65 at admission, and was 1.53±0.99 logarithm of the minimum angle of resolution at the final evaluation. The most frequent complications of trauma were iris prolapse and hyphema. There was a significant correlation between the first and final VA. Penetrating ocular injuries are seen less frequently among geriatric patients, and their prognosis may be worse due to less-efficient wound site healing and differences in scleral rigidity. The most important factor affecting the final VA measurement was the VA of the patient at admission.
Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael
2017-01-01
The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023
Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors
NASA Astrophysics Data System (ADS)
Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír
2017-01-01
Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.
STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY
Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.
2008-01-01
The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palacios, J.M.; Chinaglia, G.; Rigo, M.
1991-02-01
Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less
The process of implementing a rural VA wound care program for diabetic foot ulcer patients.
Reiber, Gayle E; Raugi, Gregory J; Rowberg, Donald
2007-10-01
Delivering and documenting evidence-based treatment to all Department of Veterans Affairs (VA) foot ulcer patients has wide appeal. However, primary and secondary care medical centers where 52% of these patients receive care are at a disadvantage given the frequent absence of trained specialists to manage diabetic foot ulcers. A retrospective review of diabetic foot ulcer patient records and a provider survey were conducted to document the foot ulcer problem and to assess practitioner needs. Results showed of the 125 persons with foot ulcers identified through administrative data, only, 21% of diabetic foot patients were correctly coded. Chronic Care and Microsystem models were used to prepare a tailored intervention in a VA primary care medical center. The site Principal Investigators, a multidisciplinary site wound care team, and study investigators jointly implemented a diabetic foot ulcer program. Intervention components include wound care team education and training, standardized good wound care practices based on strong scientific evidence, and a wound care template embedded in the electronic medical record to facilitate data collection, clinical decision making, patient ordering, and coding. A strategy for delivering offloading pressure devices, regular case management support, and 24/7 emergency assistance also was developed. It took 9 months to implement the model. Patients were enrolled and followed for 1 year. Process and outcome evaluations are on-going.
Virtual rapid response: the next evolution of tele-ICU.
Hawkins, Carrie L
2012-01-01
The first of its kind in the Veterans Affairs (VA) system, the Denver VA Medical Center's tele-intensive care unit (ICU) program is unique because it is entirely nurse driven. A nontraditional tele-ICU model, the program was tailored to meet the needs of rural veterans by using critical care nursing expertise in Denver, Colorado. An experienced CCRN-certified nurse manages the system 24 hours a day, 7 days a week, from Eastern Colorado Health Care System. The virtual ICU provides rapid response interventions through virtual technology. This tele-ICU technology allows for a "virtual handshake" by nursing staff at the start of the shift and a report on potential patient issues. Clinical relationships have been strengthened between all 5 VA facilities in the Rocky Mountain Region, increasing the likelihood of early consultation at the onset of clinical decline of a patient. In addition, the tele-ICU nurse is available for immediate nursing consultation and support, coordinates point-to-point virtual consultation between physicians at the rural sites and specialists in Denver, and assists in expediting critical care transfers. The primary objectives for the tele-ICU program include improving quality and access of care to critical care services in rural sites, reducing community fee basis costs and frequency of transfers, and increasing collaboration and collegiality among nursing and medical staff in all Region 19's medical centers.
n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.
Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu
2014-01-01
We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.
High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them
Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha
2011-01-01
Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449
Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R
1996-10-11
In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.
Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya
The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less
Binding Leverage as a Molecular Basis for Allosteric Regulation
Mitternacht, Simon; Berezovsky, Igor N.
2011-01-01
Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347
Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi
2016-12-15
The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.
2011-01-01
Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852
A web-based tree crown condition training and evaluation tool for urban and community forestry
Matthew F. Winn; Neil A. Clark; Philip A. Araman; Sang-Mook Lee
2007-01-01
Training personnel for natural resource related field work can be a costly and time-consuming process. For that reason, web-based training is considered by many to be a more attractive alternative to on-site training. The U.S. Forest Service Southern Research Station unit with Virginia Tech cooperators in Blacksburg, Va., are in the process of constructing a web site...
Annual Systems Engineering Conference (12th). Volume 1
2009-10-29
extended systems have sustainability challenges, e.g.: – Internet applications subject to: overload, environmental disturbance, virus downtime...Sites in MD, DC, VA MHPCC PMRF: Bldg 105 Sites in Hawaii Camp Pendleton: MCTSSA China Lake (2): AV-8B, F/A-18 IBAR Edwards: Ridley Corona : NSWC El...Air Platform Integration 3 Approved for Public Release; Distribution is unlimited. NSWC Carderock West Bethesda, MD NSWC Corona Norco, CA NSWC Crane
Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.
Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G
2016-11-01
Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-01-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-11-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.
BUILDING 67 CENTER, ENGINEERING AND FACILITIES MANAGEMENT TO THE RIGHT. ...
BUILDING 67 CENTER, ENGINEERING AND FACILITIES MANAGEMENT TO THE RIGHT. BUILDING 67 IS SURMISED TO HAVE BEEN A RAILROAD STATION DAYS WHEN SITE WAS A RESORT - National Home for Disabled Volunteer Soldiers, Eastern Branch, 1 VA Center, Augusta, Kennebec County, ME
ADVANCED COMPOSITES TECHNOLOGY CASE STUDY AT NASA LANGLEY RESEARCH CENTER
This report summarizes work conducted at the National Aeronautics and Space Administration's Langley Research Center (NASA-LaRC) in Hampton, VA, under the U.S. Environmental Protection Agency’s (EPA) Waste Reduction Evaluations at Federal Sites (WREAFS) Program. Support for...
78 FR 16301 - Proposal Review Panel for Physics; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-03-14
... NATIONAL SCIENCE FOUNDATION Proposal Review Panel for Physics; Notice of Meeting In accordance... announces the following meeting. Name: LIGO Annual Review Site Visit at Hanford Observatory for Physics... Physics, National Science Foundation, Arlington, VA (703) 292-4432. [[Page 16302
Position specific variation in the rate of evolution in transcription factor binding sites
Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B
2003-01-01
Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zoghbi, M. E.; Altenberg, G. A.
The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less
Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R
2003-01-01
Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471
Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.
Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F
1986-08-15
The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.
Cook, Joan M.; O’Donnell, Casey; Dinnen, Stephanie; Bernardy, Nancy; Rosenheck, Robert; Desai, Rani
2013-01-01
Thirty-eight U.S. Department of Veterans Affairs (VA) residential treatment programs for posttraumatic stress disorder (PTSD) participated in a formative evaluation of their programmatic services, including evidenced-based treatments (EBTs), between July 2008 and March 2011. Face-to-face qualitative interviews were conducted with over 250 staff by an independent psychologist along with on-site participant observations. This evaluation coincided with a national VA dissemination initiative to train providers in two EBTs for PTSD, Prolonged Exposure (PE) and Cognitive Processing Therapy (CPT). A substantial proportion of eligible (based on professional background) residential treatment providers received training in PE (37.4%) or CPT (64.2%), with 9.5% completing case consultation or becoming national trainers in each therapy respectively. In semi-structured interviews, providers reported that their clinical programs had adopted these EBTs at varying levels ranging from no adoption to every patient receiving the full protocol. Suggestions for improving the adoption of PE and CPT are noted, including distilling manualized treatments to essential common elements. PMID:23417875
Brown, Steven H.; Fischetti, Linda F.; Graham, Gail; Bates, Jack; Lancaster, Anne E.; McDaniel, David; Gillon, Joseph; Darbe, Melody; Kolodner, Robert M.
2007-01-01
Objectives. We describe electronic health data use by the Department of Veterans Affairs (VA) in the month after Katrina, including supporting technologies, the extent and nature of information accessed, and lessons learned. Methods. We conducted a retrospective study using cross-sectional panels of data collected sequentially over time. Results. By September 30, 2005, clinical data were accessed electronically for at least 38% (14941 of 39910) of patients cared for prior to Hurricane Katrina by New Orleans–area VA medical facilities. Approximately 1000 patients per day had data accessed during the month following Hurricane Katrina, a rate approximately two thirds of pre-Katrina values. Health care data were transmitted to more than 200 sites in 48 states and to at least 2300 users. Conclusions. The VA electronic health records supported continuity of care for evacuated veterans after Katrina. Our findings suggest that pharmacy and laboratory computerization alone will not be sufficient for future disaster support systems. PMID:17413082
Vertebral artery insult at the transverse foramina by gun shot wounds: report of two cases.
Dalgic, Ali; Okay, Onder; Nacar, Osman; Daglioglu, Ergun; Pasaoglu, Lale; Belen, Deniz
2009-10-01
The vertebral artery (VA) is well protected through its course at the cervical transverse foramina and penetrating injuries of VA are mostly caused by gun shot wounds. The mechanism of injury in these wounds is described as the kinetic energy transferred by the bullet, which always depends on its mass and speed. Thus, the size of the pellet is the most important factor for the tissue damage, shock waves and direct injury. Civilian gun shot wounds are generally caused by low velocity firearms, In this report, we described two cases with cervical gunshot wound characterized with transverse foramina damage and VA insult. The first patient was assaulted by bullet that resulted in vertebral artery occlusion, whereas a smaller pellet was found in the second one and arterial flow was not influenced on the site of the damaged transverse foramina. Successful management of these injuries should include careful analysis of the bullet characteristics that is directly related to the intensity of damage.
Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude
2017-10-01
While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
RBind: computational network method to predict RNA binding sites.
Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie
2018-04-26
Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.
Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten
2017-04-01
BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.
A novel substance P binding site in bovine adrenal medulla.
Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E
1990-05-04
Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tam, S.W.; Cook, L.
1984-09-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less
Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A
1996-01-04
In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.
Proietti, Riccardo; Rivera, Santiago; Dussault, Charles; Essebag, Vidal; Bernier, Martin L; Ayala-Paredes, Felix; Badra-Verdu, Mariano; Roux, Jean-François
2017-01-01
Ventricular arrhythmias (VA) originating from a papillary muscle (PM) have recently been described as a distinct clinical entity with peculiar features that make its treatment with catheter ablation challenging. Here, we report our experience using an intracardiac echo-facilitated 3D electroanatomical mapping approach in a case series of patients undergoing ablation for PM VA. Sixteen patients who underwent catheter ablation for ventricular tachycardia (VT) or symptomatic premature ventricular contractions originating from left ventricular PMs were included in the study. A total of 24 procedures (mean 1.5 per patient) were performed: 15 using a retrograde aortic approach and 9 using a transseptal approach. Integrated intracardiac ultrasound for 3D electroanatomical mapping was used in 15 of the 24 procedures. The posteromedial PM was the most frequent culprit for the clinical arrhythmia, and the body was the part of the PM most likely to be the successful site for ablation. The site of ablation was identified based on the best pace map matching the clinical arrhythmia and the site of earliest the activation. At a mean follow-up of 10.5 ± 7 months, only two patients had recurrent arrhythmias following a repeat ablation procedure. An echo-facilitated 3D electroanatomical mapping allows for real-time creation of precise geometries of cardiac chambers and endocavitary structures. This is useful during procedures such as catheter ablation of VAs originating from PMs, which require detailed representation of anatomical landmarks. Routine adoption of this technique should be considered to improve outcomes of PM VA ablation. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2016. For permissions please email: journals.permissions@oup.com.
Accurate and sensitive quantification of protein-DNA binding affinity.
Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J
2018-04-17
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.
Accurate and sensitive quantification of protein-DNA binding affinity
Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.
2018-01-01
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332
Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul
2012-01-01
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259
Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U
2014-06-02
The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.
Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu
2014-01-01
Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ford, K.A.; LaBarbera, A.R.
1988-11-01
The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less
Warfield, Becka M.
2017-01-01
RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473
Case, S S; Huber, P; Lloyd, J A
1999-11-01
A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.
Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A
2013-01-01
Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571
Wei, Qing; La, David; Kihara, Daisuke
2017-01-01
Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .
Computational Optimization and Characterization of Molecularly Imprinted Polymers
NASA Astrophysics Data System (ADS)
Terracina, Jacob J.
Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.
NASA Astrophysics Data System (ADS)
Poornima, C. S.; Dean, P. M.
1995-12-01
Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sultatos, L.G.; Kaushik, R.
2008-08-01
The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less
The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.
Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki
2017-01-01
Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boyd, S.K.
1987-01-01
Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less
Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther
2011-05-01
The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.
A National Study of Veterans Treatment Court Participants: Who Benefits and Who Recidivates
Tsai, Jack; Finlay, Andrea; Flatley, Bessie; Kasprow, Wesley J.; Clark, Sean
2017-01-01
Although there are now over 400 veterans treatment courts (VTCs) in the country, there have been few studies on participant outcomes in functional domains. Using national data on 7931 veterans in the Veterans Affairs (VA) Veterans Justice Outreach program across 115 VA sites who entered a VTC from 2011 to 2015, we examined the housing, employment, income, and criminal justice outcomes of VTC participants; and identified veteran characteristics predictive of outcomes. VTC participants spent an average of nearly a year in the program and 14% experienced a new incarceration. From program admission to exit, 10% more participants were in their own housing, 12% more were receiving VA benefits, but only 1% more were employed. Controlling for background characteristics, a history of incarceration predicted poor criminal justice, housing, and employment outcomes. Participants with property offenses or probation/parole violations and those with substance use disorders were more likely to experience a new incarceration. Participants with more mental health problems were more likely to be receiving VA benefits and less likely to be employed at program exit. Together, these findings highlight the importance of proper substance abuse treatment as well as employment services for VTC participants so that they can benefit from the diversion process. PMID:28733771
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cosman, M; Zeller, L; Lightstone, F C
2002-01-01
The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less
Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.
Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.
1993-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620
Influence of sulfhydryl sites on metal binding by bacteria
NASA Astrophysics Data System (ADS)
Nell, Ryan M.; Fein, Jeremy B.
2017-02-01
The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.
Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.
Liaw, S. H.; Kuo, I.; Eisenberg, D.
1995-01-01
Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen P.
2006-10-17
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen
2000-01-01
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
Standardized UXO Technology Demonstration Site Scoring Record No. 946
2017-07-01
VA 22350 U.S. Army Test and Evaluation Command Aberdeen Proving Ground, MD 21005-5001 Distribution Unlimited, July 2017. The use of a...Address . . . . . . . . . . . . . . . 4 2.1.2 System Description ...4 2.1.3 Data Processing Description . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 2.1.4 Data Submission
Code of Federal Regulations, 2010 CFR
2010-10-01
...) Radio Astronomy and Radio Research Installations. In order to minimize harmful interference at the National Radio Astronomy Observatory site located at Green Bank, Pocahontas County, W. Va., and at the... Astronomy Observatory, Post Office Box No. 2, Green Bank, WV 24944, in writing, of the technical particulars...
Code of Federal Regulations, 2011 CFR
2011-10-01
...) Radio Astronomy and Radio Research Installations. In order to minimize harmful interference at the National Radio Astronomy Observatory site located at Green Bank, Pocahontas County, W. Va., and at the... Astronomy Observatory, Post Office Box No. 2, Green Bank, WV 24944, in writing, of the technical particulars...
Code of Federal Regulations, 2013 CFR
2013-10-01
...) Radio Astronomy and Radio Research Installations. In order to minimize harmful interference at the National Radio Astronomy Observatory site located at Green Bank, Pocahontas County, W. Va., and at the... Astronomy Observatory, Post Office Box No. 2, Green Bank, WV 24944, in writing, of the technical particulars...
Code of Federal Regulations, 2014 CFR
2014-10-01
...) Radio Astronomy and Radio Research Installations. In order to minimize harmful interference at the National Radio Astronomy Observatory site located at Green Bank, Pocahontas County, W. Va., and at the... Astronomy Observatory, Post Office Box No. 2, Green Bank, WV 24944, in writing, of the technical particulars...
Code of Federal Regulations, 2012 CFR
2012-10-01
...) Radio Astronomy and Radio Research Installations. In order to minimize harmful interference at the National Radio Astronomy Observatory site located at Green Bank, Pocahontas County, W. Va., and at the... Astronomy Observatory, Post Office Box No. 2, Green Bank, WV 24944, in writing, of the technical particulars...
75 FR 3493 - Proposal Review Panel for Physics; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-01-21
... NATIONAL SCIENCE FOUNDATION Proposal Review Panel for Physics; Notice of Meeting In accordance... announces the following meeting. Name: University of Nebraska Site Visit in Physics (1208). Date and Time... Director for Elementary Particle Physics, National Science Foundation, 4201 Wilson Blvd., Arlington, VA...
Acceleration of Binding Site Comparisons by Graph Partitioning.
Krotzky, Timo; Klebe, Gerhard
2015-08-01
The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
GenProBiS: web server for mapping of sequence variants to protein binding sites.
Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka
2017-07-03
Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dennis, C.B.
This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Virginia Army National Guard (VaARNG) property in Sandston, Virginia. The Army Aviation Support Facility (AASF) is contiguous with the Richmond International Airport. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The PA is designed to characterize the site accurately and determine the need for further action by examining site activities, quantities of hazardous substances present, and potential pathwaysmore » by which contamination could affect public health and the environment. The AASF, originally constructed as an active Air Force interceptor base, provides maintenance support for VaARNG aircraft. Hazardous materials used and stored at the facility include JP-4 jet fuel, diesel fuel, gasoline, liquid propane gas, heating oil, and motor oil.« less
Implementing effective policy in a national mental health re-engagement program for Veterans
Smith, Shawna N.; Lai, Zongshan; Almirall, Daniel; Goodrich, David E.; Abraham, Kristen M.; Nord, Kristina M.; Kilbourne, Amy M.
2016-01-01
Policy is a powerful motivator of clinical change, but implementation success can depend on organizational characteristics. This paper used validated measures of organizational resources, culture and climate to predict uptake of a nationwide VA policy aimed at implementing Re-Engage, a brief care management program that re-establishes contact with Veterans with serious mental illness lost to care. Patient care databases were used to identify 2,738 Veterans lost to care. Local Recovery Coordinators (LRCs) were to update disposition for 2,738 Veterans at 158 VA facilities and, as appropriate, facilitate a return to care. Multivariable regression assessed organizational culture and climate as predictors of early policy compliance (via LRC presence) and uptake at six months. Higher composite climate and culture scores were associated with higher odds of having a designated LRC, but were not predictive of higher uptake. Sites with LRCs had significantly higher rates of updated documentation than sites without LRCs. PMID:27668352
Defense Information Systems Agency Technical Integration Support (DISA- TIS). MUMPS Study.
1993-01-01
usable in DoD, MUMPS must continue to improve in its support of DoD and OSE standards such as SQL , X-Windows, POSIX, PHIGS, etc. MUMPS and large AlSs...Language ( SQL ), X-Windows, and Graphical Kernel Services (GKS)) 2.2.2.3 FIPS Adoption by NIST The National Institute of Standards and Technology (NIST...many of the performance tuning mechanisms that must be performed explicitly with other systems. The VA looks forward to the SQL binding (1993 ANS) that
Alam, Nurul; Chowdhury, Hafizur R.; Ahmed, Ali; Rahman, Mahfuzur; Streatfield, P. Kim
2014-01-01
Objective This study used the InterVA-4 computerised model to assign probable cause of death (CoD) to verbal autopsies (VAs) generated from two rural areas, with a difference in health service provision, within the Matlab Health and Demographic Surveillance site (HDSS). This study aimed to compare CoD by gender, as well as discussing possible factors which could influence differences in the distribution of CoD between the two areas. Design Data for this study came from the Matlab the HDSS maintained by the International Centre for Diarrhoeal Disease Research, Bangladesh (icddr,b) since 1966. In late 1977, icddr,b divided HDSS and implemented a high-quality maternal, newborn and child health and family planning (MNCH-FP) services project in one half, called the icddr,b service area (SA), in addition to the usual public and private MNCH-FP services that serve the other half, called the government SA. HDSS field workers registered 12,144 deaths during 2003–2010, and trained interviewers obtained VA for 98.9% of them. The probabilistic model InterVA-4 probabilistic model (version 4.02) was used to derive probable CoD from VA symptoms. Cause-specific mortality rates and fractions were compared across gender and areas. Appropriate statistical tests were applied for significance testing. Results Mortality rates due to neonatal causes and communicable diseases (CDs) were lower in the icddr,b SA than in the government SA, where mortality rates due to non-communicable diseases (NCDs) were lower. Cause-specific mortality fractions (CSMFs) due to CDs (23.2% versus 18.8%) and neonatal causes (7.4% versus 6%) were higher in the government SA, whereas CSMFs due to NCDs were higher (58.2% versus 50.7%) in the icddr,b SA. The rank-order of CSMFs by age group showed marked variations, the largest category being acute respiratory infection/pneumonia in infancy, injury in 1–4 and 5–14 years, neoplasms in 15–49 and 50–64 years, and stroke in 65+ years. Conclusions Automated InterVA-4 coding of VA to determine probable CoD revealed the difference in the structure of CoD between areas with prominence of NCDs in both areas. Such information can help local planning of health services for prevention and management of disease burden. PMID:25377333
Yamakawa, Tomohiro; Ohigashi, Hiroyuki; Hashimoto, Daigo; Hayase, Eiko; Takahashi, Shuichiro; Miyazaki, Miyono; Minomi, Kenjiro; Onozawa, Masahiro; Niitsu, Yoshiro; Teshima, Takanori
2018-03-29
Chronic graft-versus-host disease (GVHD) after allogeneic hematopoietic stem cell transplantation (SCT) is characterized by multiorgan fibrosis and profoundly affects the quality of life of transplant survivors. Heat shock protein 47 (HSP47), a collagen-specific molecular chaperone, plays a critical role in collagen synthesis in myofibroblasts. We explored the role of HSP47 in the fibrotic process of cutaneous chronic GVHD in mice. Immunohistochemical analysis showed massive fibrosis with elevated amounts of collagen deposits and accumulation of F4/80 + macrophages, as well as myofibroblasts expressing HSP47 and retinol-binding protein 1 in the skin after allogeneic SCT. Repeated injection of anti-colony-stimulating factor (CSF-1) receptor-blocking antibodies significantly reduced HSP47 + myofibroblasts in the skin, indicating a macrophage-dependent accumulation of myofibroblasts. Vitamin A-coupled liposomes carrying HSP47 small interfering RNA (siRNA) (VA-lip HSP47) delivered HSP47 siRNA to cells expressing vitamin A receptors and knocked down their HSP47 in vitro. Intravenously injected VA-lip HSP47 were specifically distributed to skin fibrotic lesions and did not affect collagen synthesis in healthy skin. VA-lip HSP47 knocked down HSP47 expression in myofibroblasts and significantly reduced collagen deposition without inducing systemic immunosuppression. It also abrogated fibrosis in the salivary glands. These results highlight a cascade of fibrosis in chronic GVHD; macrophage production of transforming growth factor β mediates fibroblast differentiation to HSP47 + myofibroblasts that produce collagen. VA-lip HSP47 represent a novel strategy to modulate fibrosis in chronic GVHD by targeting HSP47 + myofibroblasts without inducing immunosuppression. © 2018 by The American Society of Hematology.
The linker connecting the two kringles plays a key role in prothrombin activation
Pozzi, Nicola; Chen, Zhiwei; Pelc, Leslie A.; Shropshire, Daniel B.; Di Cera, Enrico
2014-01-01
The zymogen prothrombin is proteolytically converted by factor Xa to the active protease thrombin in a reaction that is accelerated >3,000-fold by cofactor Va. This physiologically important effect is paradigmatic of analogous cofactor-dependent reactions in the coagulation and complement cascades, but its structural determinants remain poorly understood. Prothrombin has three linkers connecting the N-terminal Gla domain to kringle-1 (Lnk1), the two kringles (Lnk2), and kringle-2 to the C-terminal protease domain (Lnk3). Recent developments indicate that the linkers, and particularly Lnk2, confer on the zymogen significant flexibility in solution and enable prothrombin to sample alternative conformations. The role of this flexibility in the context of prothrombin activation was tested with several deletions. Removal of Lnk2 in almost its entirety (ProTΔ146–167) drastically reduces the enhancement of thrombin generation by cofactor Va from >3,000-fold to 60-fold because of a significant increase in the rate of activation in the absence of cofactor. Deletion of Lnk2 mimics the action of cofactor Va and offers insights into how prothrombin is activated at the molecular level. The crystal structure of ProTΔ146–167 reveals a contorted architecture where the domains are not vertically stacked, kringle-1 comes within 9 Å of the protease domain, and the Gla-domain primed for membrane binding comes in contact with kringle-2. These findings broaden our molecular understanding of a key reaction of the blood coagulation cascade where cofactor Va enhances activation of prothrombin by factor Xa by compressing Lnk2 and morphing prothrombin into a conformation similar to the structure of ProTΔ146–167. PMID:24821807
Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe
2011-01-01
Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967
Interaction between phloretin and the red blood cell membrane
1976-01-01
Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575
A peek into tropomyosin binding and unfolding on the actin filament.
Singh, Abhishek; Hitchcock-Degregori, Sarah E
2009-07-24
Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.
sc-PDB: a 3D-database of ligandable binding sites--10 years on.
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ahmed, Ahmed H; Oswald, Robert E
2010-03-11
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.
Ahmed, Ahmed H.; Oswald, Robert E.
2010-01-01
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115
Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.
Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta
2013-07-01
Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.
Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.
Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin
2017-09-14
U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.
Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng
2018-05-10
CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.
LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.
Marshall, J C; Shakespear, R A; Odell, W D
1976-11-01
Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.
MX Siting Investigation Geotechnical Siting Status Report. Volume I.
1978-06-21
and have moderate shear strength. GNU. HAl SUNAL, INC ENGINEERING AND GEOPHYSICAL PROPERTIES Int rrniatd.an. ungur . Aluvial Lacustrine /oNan gdotlS t...an unvarnished, active surface of sediment transport gra A53 stream channel and floodplain deposits. A52 - Unconsolidated to poorly consolidated sand...silt, and sandy gravel, with va c.0 A52 surface gravels forming isolated areas of desert pavement. This fan is in vario Cc surface of sediment
Craney Island Disposal Area. Site Operations and Monitoring Report, 1980-1987
1990-07-01
STCFITE nmpyv FMISCELLANEOUS PAPER EL-90-10 * * *CRANEY ISLAND DISPOSAL AREA SITE OPERATIONS AND MONITORING REPORT, 1980-1987 N by Michael R. Palermo...4. PERFORMING ORGANIZATION REPORT NUMBER(S) 5. MONITORING ORGANIZATION REPORT NUMBER(S) Miscellaneous Paper EL-90-0 0 So. M OF :RFRMING ORGANIZATION...area is a 2,500-acre confined dredged material disposal facility located near Norfolk, VA. In 1981, the Craney Island Management Plan ( CIMP ) was
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strauch, Eva-Maria; Bernard, Steffen M.; La, David
Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less
An alternate binding site for PPARγ ligands
Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.
2014-01-01
PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063
Concerted formation of macromolecular Suppressor–mutator transposition complexes
Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina
1998-01-01
Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711
Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew
2015-11-01
Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.
Oligomycin frames a common drug-binding site in the ATP synthase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric
We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less
Nisius, Britta; Gohlke, Holger
2012-09-24
Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.
Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L
2008-12-09
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.
Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.
2009-01-01
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330
Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.
Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael
2013-01-01
Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome
Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274
[3H]MK-801 binding sites in post-mortem human frontal cortex.
Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P
1989-03-29
The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.
Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J
1999-09-24
We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.
Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T
2018-09-01
Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-03-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-01-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513
32 CFR Appendix B to Part 286 - Addressing FOIA Requests
Code of Federal Regulations, 2012 CFR
2012-07-01
... Administration Under Secretary of Defense (Acquisition & Technology) Deputy Under Secretary of Defense (Logistics... Experiments Command Center On-Site Inspection Agency Under Secretary of Defense (Comptroller) Director..., VA 22314-1651. AP2.2.9. Defense Logistics Agency (DLA). DLA records may be requested from its...
32 CFR Appendix B to Part 286 - Addressing FOIA Requests
Code of Federal Regulations, 2013 CFR
2013-07-01
... Administration Under Secretary of Defense (Acquisition & Technology) Deputy Under Secretary of Defense (Logistics... Experiments Command Center On-Site Inspection Agency Under Secretary of Defense (Comptroller) Director..., VA 22314-1651. AP2.2.9. Defense Logistics Agency (DLA). DLA records may be requested from its...
32 CFR Appendix B to Part 286 - Addressing FOIA Requests
Code of Federal Regulations, 2014 CFR
2014-07-01
... Administration Under Secretary of Defense (Acquisition & Technology) Deputy Under Secretary of Defense (Logistics... Experiments Command Center On-Site Inspection Agency Under Secretary of Defense (Comptroller) Director..., VA 22314-1651. AP2.2.9. Defense Logistics Agency (DLA). DLA records may be requested from its...
32 CFR Appendix B to Part 286 - Addressing FOIA Requests
Code of Federal Regulations, 2011 CFR
2011-07-01
... Administration Under Secretary of Defense (Acquisition & Technology) Deputy Under Secretary of Defense (Logistics... Experiments Command Center On-Site Inspection Agency Under Secretary of Defense (Comptroller) Director..., VA 22314-1651. AP2.2.9. Defense Logistics Agency (DLA). DLA records may be requested from its...
sc-PDB: a 3D-database of ligandable binding sites—10 years on
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483
Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A
2018-05-29
Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.
2008-01-01
The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368
Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level
Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.
2012-01-01
Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804
OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.
Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry
2014-01-01
We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.
Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando
2018-03-23
The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.
Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning
NASA Astrophysics Data System (ADS)
Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay
2018-02-01
Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.
Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M
2011-01-01
Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less
NASA Astrophysics Data System (ADS)
Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh
2017-06-01
In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.
A deep learning framework for modeling structural features of RNA-binding protein targets
Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang
2016-01-01
RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480
Hoffmann, Jana; Altenbuchner, Josef
2015-01-01
A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762
Middendorf, Thomas R.
2017-01-01
A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951
Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.
Mizuno, S; Ogawa, N; Mori, A
1982-12-01
Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.
Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.
Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda
2008-05-01
The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.
Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng
2014-03-01
Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.
Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.
Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry
2006-07-01
High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.
Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo
2010-01-01
The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860
Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard
2017-07-05
Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.
Rogal, Shari S; Yakovchenko, Vera; Waltz, Thomas J; Powell, Byron J; Kirchner, JoAnn E; Proctor, Enola K; Gonzalez, Rachel; Park, Angela; Ross, David; Morgan, Timothy R; Chartier, Maggie; Chinman, Matthew J
2017-05-11
Hepatitis C virus (HCV) is a common and highly morbid illness. New medications that have much higher cure rates have become the new evidence-based practice in the field. Understanding the implementation of these new medications nationally provides an opportunity to advance the understanding of the role of implementation strategies in clinical outcomes on a large scale. The Expert Recommendations for Implementing Change (ERIC) study defined discrete implementation strategies and clustered these strategies into groups. The present evaluation assessed the use of these strategies and clusters in the context of HCV treatment across the US Department of Veterans Affairs (VA), Veterans Health Administration, the largest provider of HCV care nationally. A 73-item survey was developed and sent to all VA sites treating HCV via electronic survey, to assess whether or not a site used each ERIC-defined implementation strategy related to employing the new HCV medication in 2014. VA national data regarding the number of Veterans starting on the new HCV medications at each site were collected. The associations between treatment starts and number and type of implementation strategies were assessed. A total of 80 (62%) sites responded. Respondents endorsed an average of 25 ± 14 strategies. The number of treatment starts was positively correlated with the total number of strategies endorsed (r = 0.43, p < 0.001). Quartile of treatment starts was significantly associated with the number of strategies endorsed (p < 0.01), with the top quartile endorsing a median of 33 strategies, compared to 15 strategies in the lowest quartile. There were significant differences in the types of strategies endorsed by sites in the highest and lowest quartiles of treatment starts. Four of the 10 top strategies for sites in the top quartile had significant correlations with treatment starts compared to only 1 of the 10 top strategies in the bottom quartile sites. Overall, only 3 of the top 15 most frequently used strategies were associated with treatment. These results suggest that sites that used a greater number of implementation strategies were able to deliver more evidence-based treatment in HCV. The current assessment also demonstrates the feasibility of electronic self-reporting to evaluate ERIC strategies on a large scale. These results provide initial evidence for the clinical relevance of the ERIC strategies in a real-world implementation setting on a large scale. This is an initial step in identifying which strategies are associated with the uptake of evidence-based practices in nationwide healthcare systems.
Gold, Nicola D; Jackson, Richard M
2006-02-03
The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.
Analysis of functional importance of binding sites in the Drosophila gap gene network model.
Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria
2015-01-01
The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.
Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E
2011-01-01
CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.
Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.
Dudev, Todor; Chang, Li-Ying; Lim, Carmay
2005-03-23
Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.
Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M
2005-04-19
The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.
Grau, Luis; Collon, Kevin; Alhandi, Ali; Kaimrajh, David; Varon, Maria; Latta, Loren; Vilella, Fernando
2018-06-01
The aim of this study is to evaluate the biomechanical effect of filling locking variable angle (VA) screw holes at the area of metaphyseal fracture comminution in a Sawbones® (Sawbones USA, Vashon, Washington) model (AO/OTA 33A-3 fracture) using a Synthes VA locking compression plate (LCP) (Depuy Synthes, Warsaw, Indiana). Seven Sawbones® femur models had a Synthes VA-LCP placed as indicated by the manufacturers technique. A 4cm osteotomy was then created to simulate an AO/OTA 33-A3 femoral fracture pattern with metaphyseal comminution. The control group consisted of four constructs in which the open screw holes at the area of comminution were left unfilled; the experimental group consisted of three constructs in which the VA screw holes were filled with locking screws. One of the control constructs was statically loaded to failure at a rate of 5mm/min. A value equal to 75% of the ultimate load to failure was used as the loading force for fatigue testing of 250,000 cycles at 3Hz. Cycles to failure was recorded for each construct and averages were compared between groups. The average number of cycles to failure in the control and experimental groups were 37524±8187 and 43304±23835, respectively (p=0.72). No significant difference was observed with respect to cycles to failure or mechanism of failure between groups. In all constructs in both the control and experimental groups, plate failure reproducibly occurred with cracks through the variable angle holes in the area of bridged comminution. The Synthes VA-LCP in a simulated AO/OTA 33-A3 comminuted metaphyseal femoral fracture fails in a reproducible manner at the area of comminution through the "honeycomb" VA screw holes. Filling open VA screw holes at the site of comminution with locking screws does not increase fatigue life of the Synthes VA-LCP in a simulated AO/OTA 33-A3 distal femoral fracture. Further studies are necessary to determine whether use of this particular plate is contraindicated when bridging distal femoral fractures with metaphyseal comminution.
Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.
Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua
2013-11-01
The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.
Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny
2012-11-01
The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giannopoulos, G.; Jackson, K.; Kredentser, J.
The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less
Ventricular arrhythmias in the absence of structural heart disease.
Prystowsky, Eric N; Padanilam, Benzy J; Joshi, Sandeep; Fogel, Richard I
2012-05-15
Ventricular arrhythmia (VA) in structurally normal hearts can be broadly considered under non-life-threatening monomorphic and life-threatening polymorphic rhythms. Monomorphic VA is classified on the basis of site of origin in the heart, and the most common areas are the ventricular outflow tracts and left ventricular fascicles. The morphology of the QRS complexes on electrocardiogram is an excellent tool to identify the site of origin of the rhythm. Although these arrhythmias are common and generally carry an excellent prognosis, rare sudden death events have been reported. Very frequent ventricular ectopy may also result in a cardiomyopathy in a minority of patients. Suppression of VA may be achieved using calcium-channel blockers, beta-adrenergic blockers, and class I or III antiarrhythmic drugs. Radiofrequency ablation has emerged as an excellent option to eliminate these arrhythmias, although certain foci including aortic cusps and epicardium may be technically challenging. Polymorphic ventricular tachycardia (VT) is rare and generally occurs in patients with genetic ion channel disorders including long QT syndrome, Brugada syndrome, catecholaminergic polymorphic VT, and short QT syndrome. Unlike monomorphic VT, these arrhythmic syndromes are associated with sudden death. While the cardiac gross morphology is normal, suggesting a structurally normal heart, abnormalities exist at the molecular level and predispose them to arrhythmias. Another fascinating area, idiopathic ventricular fibrillation and early repolarization syndrome, are undergoing research for a genetic basis. Copyright © 2012 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.
Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.
Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain
2014-11-18
Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.
Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies
NASA Astrophysics Data System (ADS)
Pang, Yuan-Ping; Kozikowski, Alan P.
1994-12-01
We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.
The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Provenzale, J.M.; Morgenlander, J.C.; Gress, D.
The purpose of this study was to determine if typical clinical and neuroradiologic patterns exist in patients with spontaneous vertebral artery (VA) dissection. The medical records and neuroradiologic examinations of 14 patients with spontaneous VA dissection were reviewed. The medical records were examined to exclude patients with a history of trauma and to record evidence of a nontratimatic precipitating event ({open_quotes}trivial trauma{close_quotes}) and presence of possible risk factors such as hypertension. All patients under-went conventional angiography, 13 either CT or MRI (II both CT and MRI), and 3 MRA. Conventional arteriograrris were evaluated for dissection site, evidence of fibromuscular dysplasia,more » luminal stenosis or occlusion, and pseudoaneurysm formation, CT examinations for the presence of infarction or subarachnoid hemorrhage, MR examinations for the presence of infarction or arterial signal abnormality, and MR angiograms for abnormality of the arterial signal column. Seven patients had precipitating events within 24 h of onset of symptoms that may have been causative of dissection and five had hypertension. At catheter angiography, two patients had dissections in two arteries (both VAs in one patient, VA and internal carotid artery in one patient), giving a total of 15 VAs with dissection. Dissection sites included V1 in four patients, V2 in one patient, V3 in three patients, V4 in six patients, and both V3 and V4 in one patient. Luminal stenosis was present in 13 VAs, occlusion in 2, pseudoaneurysm in 1, and evidence of fibromuscular dysplasia in 1. Posterior circulation infarcts were found on CT or MR in five patients. Subarachnoid hemorrhage was found on CT in two patients and by lumbar puncture alone in two patients. Abnormal periarterial signal on MRI was seen in three patients. MRA demonstrated absent VA signal in one patient, pseudoaneurysm in one, and a false-negative examination in one.« less
Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki
2016-06-01
Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Energetics and kinetics of cooperative cofilin-actin filament interactions.
Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M
2006-08-11
We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.
Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.
2008-08-19
Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less
Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC
Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei
2010-01-01
Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424
ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.
Konc, Janez; Janežič, Dušanka
2014-07-01
The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trong, I.Le; Stenkamp, R.E.; Ibarra, C.
2005-08-22
Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less
Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing
Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav
2007-01-01
In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418
Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.
Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F
1994-10-27
Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.
Zappia, Humbert
1996-01-01
Chlordane, DDT (dichlor-diphenyl-trichloroethane), and PCB's (polychlorinated biphenyls) were the most widespread organic contaminants detected during a 1992 survey of aquatic biological tissues in the Potomac River Basin. On the basis of existing U.S. Food and Drug Administration criteria, no new threats to human health were discovered, although chlordane concentrations may pose a threat to fish-eating wildlife. Chlordane exceeded the National Academy of Science and National Academy of Engineering recommended maximum concentration for the protection of fish-eating wildlife at two sites. The survey, conducted by the U.S. Geological Survey's National Water-Quality Assessment Program, sampled Asiatic clams (Corbicula fluminea) and yellow bullhead (Ameiurus natalis) at 16 sites to determine the occurrence and distribution of 29 hydrophobic organic compounds. Thirteen of these organic compounds were detected in the survey. Sites with the greatest number of compounds detected include the Potomac River near Alexandria, Va., with 6 compounds detected in Asiatic clam tissue, and Accotink Creek near Annandale, Va., with 11 compounds in yellow bullhead tissue. Chlordane was detected at six sites, with maximum concentrations of 31.1 ?g/kg (micrograms per kilograms) in Asiatic clam tissue and 127 ?g/kg in yellow bullhead whole-fish tissue. DDT was detected at five sites, with maximum concentrations of 12.9 ?g/kg in Asiatic clam tissue and 7.6 ?g/kg in yellow bullhead whole-fish tissue. PCB's were detected at nine sites, with maximum concentrations of 162 ?g/kg in Asiatic clam tissue and 146 mg/ kg in yellow bullhead whole-fish tissue.
Anisotropic energy flow and allosteric ligand binding in albumin
NASA Astrophysics Data System (ADS)
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin.
Li, Guifeng; Magana, Donny; Dyer, R Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265
Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.
2012-01-01
An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049
Code of Federal Regulations, 2011 CFR
2011-07-01
... information that were involved in the data breach (e.g., full name, Social Security number, date of birth... conspicuous posting on the home page of VA's Web site and notification in major print and broadcast media, including major media in geographic areas where the affected individuals likely reside. Such a notice in...
Code of Federal Regulations, 2014 CFR
2014-07-01
... information that were involved in the data breach (e.g., full name, Social Security number, date of birth... conspicuous posting on the home page of VA's Web site and notification in major print and broadcast media, including major media in geographic areas where the affected individuals likely reside. Such a notice in...
Code of Federal Regulations, 2012 CFR
2012-07-01
... information that were involved in the data breach (e.g., full name, Social Security number, date of birth... conspicuous posting on the home page of VA's Web site and notification in major print and broadcast media, including major media in geographic areas where the affected individuals likely reside. Such a notice in...
Code of Federal Regulations, 2013 CFR
2013-07-01
... information that were involved in the data breach (e.g., full name, Social Security number, date of birth... conspicuous posting on the home page of VA's Web site and notification in major print and broadcast media, including major media in geographic areas where the affected individuals likely reside. Such a notice in...
Code of Federal Regulations, 2010 CFR
2010-07-01
... information that were involved in the data breach (e.g., full name, Social Security number, date of birth... conspicuous posting on the home page of VA's Web site and notification in major print and broadcast media, including major media in geographic areas where the affected individuals likely reside. Such a notice in...
75 FR 68040 - Proposed Information Collection Activity: Comment Request
Federal Register 2010, 2011, 2012, 2013, 2014
2010-11-04
... DEPARTMENT OF VETERANS AFFAIRS [OMB Control No. 2900-0663 (Pay Now Enter Info Page)] Proposed... of automated collection techniques or the use of other forms of information technology. Title: Pay... make online payments through VA's Pay Now Enter Info Page Web site. Data entered on the Pay Now Enter...
49 CFR 384.107 - Matter incorporated by reference.
Code of Federal Regulations, 2011 CFR
2011-10-01
... (CDLIS) State Procedures Manual,” Version 4.1.0, September 2007 (“CDLIS State Procedures Manual”), IBR...://www.archives.gov/federal_register/code_of_federal_regulations/ibr_locations.html. (2) Information and... Association of Motor Vehicle Administrators, Inc., 4301 Wilson Blvd, Suite 400, Arlington, VA 22203; Web site...
49 CFR 384.107 - Matter incorporated by reference.
Code of Federal Regulations, 2010 CFR
2010-10-01
... (CDLIS) State Procedures Manual,” Version 4.1.0, September 2007 (“CDLIS State Procedures Manual”), IBR...://www.archives.gov/federal_register/code_of_federal_regulations/ibr_locations.html. (2) Information and... Association of Motor Vehicle Administrators, Inc., 4301 Wilson Blvd, Suite 400, Arlington, VA 22203; Web site...
USDA-ARS?s Scientific Manuscript database
A standardized plate meter for measuring pasture mass was calibrated at the Agroforestry Research and Demonstration Site in Blacksburg, VA, using six ungrazed plots of established tall fescue (Festuca arundinaceae) overseeded with orchardgrass (Dactylis glomerata). Each plot was interplanted with b...
Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E
2017-01-01
Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.
Pomernacki, Alyssa; Carney, Diane V; Kimerling, Rachel; Nazarian, Deborah; Blakeney, Jill; Martin, Brittany D; Strehlow, Holly; Yosef, Julia; Goldstein, Karen M; Sadler, Anne G; Bean-Mayberry, Bevanne A; Bastian, Lori A; Bucossi, Meggan M; McLean, Caitlin; Sonnicksen, Shannan; Klap, Ruth; Yano, Elizabeth M; Frayne, Susan M
2015-01-01
The Veterans Health Administration (VA) Women's Health Practice-Based Research Network (WH-PBRN) was created to foster innovations for the health care of women veterans. The inaugural study by the WH-PBRN was designed to identify women veterans' own priorities and preferences for mental health services and to inform refinements to WH-PBRN operational procedures. Addressing the latter, this article reports lessons learned from the inaugural study. WH-PBRN site coordinators at the 4 participating sites convened weekly with the study coordinator and the WH-PBRN program manager to address logistical issues and identify lessons learned. Findings were categorized into a matrix of challenges and facilitators related to key study elements. Challenges to the conduct of PBRN-based research included tracking of regulatory documents; cross-site variability in some regulatory processes; and troubleshooting logistics of clinic-based recruitment. Facilitators included a central institutional review board, strong relationships between WH-PBRN research teams and women's health clinic teams, and the perception that women want to help other women veterans. Our experience with the inaugural WH-PBRN study demonstrated the feasibility of establishing productive relationships between local clinicians and researchers, and of recruiting a special population (women veterans) in diverse sites within an integrated health care system. This identified strengths of a PBRN approach. © Copyright 2015 by the American Board of Family Medicine.
Morley, B J; Garner, L L
1990-06-11
Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.
NASA Astrophysics Data System (ADS)
Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie
Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.
Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales
NASA Astrophysics Data System (ADS)
Qian, Long; Kussell, Edo
The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.
Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose
Jalak, Jürgen; Väljamäe, Priit
2014-01-01
Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511
Gibbons, R. J.; Moreno, E. C.; Etherden, I.
1983-01-01
The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416
DOE Office of Scientific and Technical Information (OSTI.GOV)
Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.
1990-01-01
Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less
The Structural Basis of ATP as an Allosteric Modulator
Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian
2014-01-01
Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773
Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy
Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming
2014-01-01
A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048
Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok
2012-06-01
In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.
Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.
Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E
2018-02-01
Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.
Sun, Jennifer K; Qin, Haijing; Aiello, Lloyd Paul; Melia, Michele; Beck, Roy W; Andreoli, Christopher M; Edwards, Paul A; Glassman, Adam R; Pavlica, Michael R
2012-04-01
To compare visual acuity (VA) scores after autorefraction vs manual refraction in eyes of patients with diabetes mellitus and a wide range of VAs. The letter score from the Electronic Visual Acuity (EVA) test from the electronic Early Treatment Diabetic Retinopathy Study was measured after autorefraction (AR-EVA score) and after manual refraction (MR-EVA score), which is the research protocol of the Diabetic Retinopathy Clinical Research Network. Testing order was randomized, study participants and VA examiners were masked to refraction source, and a second EVA test using an identical supplemental manual refraction (MR-EVAsuppl score) was performed to determine test-retest variability. In 878 eyes of 456 study participants, the median MR-EVA score was 74 (Snellen equivalent, approximately 20/32). The spherical equivalent was often similar for manual refraction and autorefraction (median difference, 0.00; 5th-95th percentile range, -1.75 to 1.13 diopters). However, on average, the MR-EVA scores were slightly better than the AR-EVA scores, across the entire VA range. Furthermore, the variability between the AR-EVA scores and the MR-EVA scores was substantially greater than the test-retest variability of the MR-EVA scores (P < .001). The variability of differences was highly dependent on the autorefractor model. Across a wide range of VAs at multiple sites using a variety of autorefractors, VA measurements tend to be worse with autorefraction than manual refraction. Differences between individual autorefractor models were identified. However, even among autorefractor models that compare most favorably with manual refraction, VA variability between autorefraction and manual refraction is higher than the test-retest variability of manual refraction. The results suggest that, with current instruments, autorefraction is not an acceptable substitute for manual refraction for most clinical trials with primary outcomes dependent on best-corrected VA.
The State of Women Veterans' Health Research
Goldzweig, Caroline L; Balekian, Talene M; Rolón, Cony; Yano, Elizabeth M; Shekelle, Paul G
2006-01-01
OBJECTIVE Assess the state of women veterans' health research. DESIGN Systematic review of studies that pertained specifically to or included explicit information about women veterans. A narrative synthesis of studies in 4 domains/topics was conducted: Stress of military life; Health and performance of military/VA women; Health services research/quality of care; and Psychiatric conditions. MEASUREMENTS AND MAIN RESULTS We identified 182 studies. Of these, 2 were randomized-controlled trials (RCTs) and the remainder used observational designs. Forty-five percent of studies were VA funded. We identified 77 studies pertaining to the stress of military life, of which 21 reported on sexual harassment or assault. Rates of harassment ranged from 55% to 79% and rates of sexual assault from 4.2% to 7.3% in active duty military women and 11% to 48% among women veterans. Forty-two studies concerned the health and performance of military/VA women, with 21 studies evaluating sexual assault and posttraumatic stress disorder (PTSD) and their effect on health. Fifty-nine studies assessed various aspects of health services research. Eight studies assessed quality of care and 5, patient satisfaction. Twenty-five studies assessed utilization and health care organization, and findings include that women veterans use the VA less than men, that gender-specific reasons for seeking care were common among female military and veteran personnel, that provision of gender-specific care increased women veterans' use of VA, and that virtually all VAs have available on-site basic women's health services. Fifty studies were classified as psychiatric; 31 of these were about the risk, prevalence, and treatment of PTSD. CONCLUSIONS Most research on VA women's health is descriptive in nature and has concerned PTSD, sexual harassment and assault, the utilization and organization of care, and various psychiatric conditions. Experimental studies and studies of the quality of care are rare. PMID:16637952
Elimination of a ligand gating site generates a supersensitive olfactory receptor.
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I
2016-06-21
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.
Elimination of a ligand gating site generates a supersensitive olfactory receptor
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.
2016-01-01
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish
2009-06-08
The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less
Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart
1999-01-01
Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456
Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants
Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander
2013-01-01
Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254
Architecture of a Fur Binding Site: a Comparative Analysis
Lavrrar, Jennifer L.; McIntosh, Mark A.
2003-01-01
Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.
1988-05-01
Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less
Purification of L-( sup 3 H) Nicotine eliminates low affinity binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Romm, E.; Marks, M.J.; Collins, A.C.
1990-01-01
Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.
Binding of (/sup 3/H)Forskolin to rat brain membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seamon, K.B.; Vaillancourt, R.; Edwards, M.
1984-08-01
(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less
Biophysical Fitness Landscapes for Transcription Factor Binding Sites
Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.
2014-01-01
Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228
Yokoyama, Ken Daigoro; Pollock, David D
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.
Yokoyama, Ken Daigoro; Pollock, David D.
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068
2012-01-01
Background Road traffic injuries (RTIs) are among the leading causes of mortality in Vietnam. However, mortality data collection systems in Vietnam in general and for RTIs in particular, remain inconsistent and incomplete. Underlying distributions of external causes and body injuries are not available from routine data collection systems or from studies till date. This paper presents characteristics, user type pattern, seasonal distribution, and causes of 1,061 deaths attributable to road crashes ascertained from a national sample mortality surveillance system in Vietnam over a two-year period (2008 and 2009). Methods A sample mortality surveillance system was designed for Vietnam, comprising 192 communes in 16 provinces, accounting for approximately 3% of the Vietnamese population. Deaths were identified from commune level data sources, and followed up by verbal autopsy (VA) based ascertainment of cause of death. Age-standardised mortality rates from RTIs were computed. VA questionnaires were analysed in depth to derive descriptive characteristics of RTI deaths in the sample. Results The age-standardized mortality rates from RTIs were 33.5 and 8.5 per 100,000 for males and females respectively. Majority of deaths were males (79%). Seventy three percent of all deaths were aged from 15 to 49 years and 58% were motorcycle users. As high as 80% of deaths occurred on the day of injury, 42% occurred prior to arrival at hospital, and a further 29% occurred on-site. Direct causes of death were identified for 446 deaths (42%) with head injuries being the most common cause attributable to road traffic injuries overall (79%) and to motorcycle crashes in particular (78%). Conclusion The VA method can provide a useful data source to analyse RTI mortality. The observed considerable mortality from head injuries among motorcycle users highlights the need to evaluate current practice and effectiveness of motorcycle helmet use in Vietnam. The high number of deaths occurring on-site or prior to hospital admission indicates a need for effective pre-hospital first aid services and timely access to emergency facilities. In the absence of standardised death certification, sustained efforts are needed to strengthen mortality surveillance sites supplemented by VA to support evidence based monitoring and control of RTI mortality. PMID:22838959
Costs Associated With Surgical Site Infections in Veterans Affairs Hospitals.
Schweizer, Marin L; Cullen, Joseph J; Perencevich, Eli N; Vaughan Sarrazin, Mary S
2014-06-01
Surgical site infections (SSIs) are potentially preventable complications that are associated with excess morbidity and mortality. To determine the excess costs associated with total, deep, and superficial SSIs among all operations and for high-volume surgical specialties. Surgical patients from 129 Veterans Affairs (VA) hospitals were included. The Veterans Health Administration Decision Support System and VA Surgical Quality Improvement Program databases were used to assess costs associated with SSIs among VA patients who underwent surgery in fiscal year 2010. Linear mixed-effects models were used to evaluate incremental costs associated with SSIs, controlling for patient risk factors, surgical risk factors, and hospital-level variation in costs. Costs of the index hospitalization and subsequent 30-day readmissions were included. Additional analysis determined potential cost savings of quality improvement programs to reduce SSI rates at hospitals with the highest risk-adjusted SSI rates. Among 54,233 VA patients who underwent surgery, 1756 (3.2%) experienced an SSI. Overall, 0.8% of the cohort had a deep SSI, and 2.4% had a superficial SSI. The mean unadjusted costs were $31,580 and $52,620 for patients without and with an SSI, respectively. In the risk-adjusted analyses, the relative costs were 1.43 times greater for patients with an SSI than for patients without an SSI (95% CI, 1.34-1.52; difference, $11,876). Deep SSIs were associated with 1.93 times greater costs (95% CI, 1.71-2.18; difference, $25,721), and superficial SSIs were associated with 1.25 times greater costs (95% CI, 1.17-1.35; difference, $7003). Among the highest-volume specialties, the greatest mean cost attributable to SSIs was $23,755 among patients undergoing neurosurgery, followed by patients undergoing orthopedic surgery, general surgery, peripheral vascular surgery, and urologic surgery. If hospitals in the highest 10th percentile (ie, the worst hospitals) reduced their SSI rates to the rates of the hospitals in the 50th percentile, the Veterans Health Administration would save approximately $6.7 million per year. Surgical site infections are associated with significant excess costs. Among analyzed surgery types, deep SSIs and SSIs among neurosurgery patients are associated with the highest risk-adjusted costs. Large potential savings per year may be achieved by decreasing SSI rates.
Jay, Melanie; Chintapalli, Sumana; Squires, Allison; Mateo, Katrina F; Sherman, Scott E; Kalet, Adina L
2015-11-14
Obesity is highly prevalent among Veterans. In the United States, the Veterans Health Administration (VHA) offers a comprehensive weight management program called MOVE!. Yet, fewer than 10 % of eligible patients ever attend one MOVE! visit. The VHA has a patient-centered medical home (PCMH) model of primary care (PC) called Patient-Aligned Care Teams (PACT) at all Veterans Affairs (VA) Medical Centers. PACT teamlets conduct obesity screening, weight management counseling, and refer to MOVE!. As part of a needs assessment to improve delivery of weight management services, the purpose of this study was to assess PACT teamlet and MOVE! staff: 1) current attitudes and perceptions regarding obesity care; 2) obesity-related counseling practices 3) experiences with the MOVE! program; and 4) targets for interventions to improve implementation of obesity care in the PC setting. We recruited 25 PACT teamlet members from a single VA study site-11 PC physicians, 5 registered nurses, 5 licensed practical nurses, 1 clerical assistant, and 3 MOVE! staff (2 dietitians, 1 psychologist)-for individual interviews using a combination of convenience and snowball sampling. Audio recorded interviews were professionally transcribed and iteratively coded by two independent reviewers. The analytic process was guided by discourse analysis in order to discover how the participants perceived and provided weight management care and what specific attitudes affected their practices, all as bounded within the organization. Emerging themes included: 1) role perceptions, 2) anticipated outcomes of weight management counseling and programs, and 3) communication and information dissemination. Perceived role among PCPs was influenced by training, whereas personal experience with their own weight management impacted role perception among LPNs/RNs. Attitudes about whether or not they could impact patients' weight outcomes via counseling or referral to MOVE! varied. System-level communication about VHA priorities through electronic health records and time allocation influenced teams to prioritize referral to MOVE! over weight management counseling. We found a diversity of attitudes, and practices within PACT, and identified factors that can enhance the MOVE! program and inform interventions to improve weight management within primary care. Although findings are site-specific, many are supported in the literature and applicable to other VA and non-VA sites with PCMH models of care.
Nucleotide-dependent bisANS binding to tubulin.
Chakraborty, S; Sarkar, N; Bhattacharyya, B
1999-07-13
Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.
2015-01-01
The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846
Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goldman, M.E.; Mallorga, P.; Pettibone, D.J.
1988-01-01
(/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less
Impact of disruption of secondary binding site S2 on dopamine transporter function.
Zhen, Juan; Reith, Maarten E A
2016-09-01
The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.
Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis
2011-11-14
The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.
Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter
2001-01-01
Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581
Palumbo, Michael J; Newberg, Lee A
2010-07-01
The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).
Autoradiographic demonstration of oxytocin-binding sites in the macula densa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoeckel, M.E.; Freund-Mercier, M.J.
1989-08-01
Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less
High-affinity cannabinoid binding site in brain: A possible marijuana receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nye, J.S.
The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less
Gillard, Michel; Chatelain, Pierre; Fuks, Bruno
2006-04-24
A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.
The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.
positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP
Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas
2010-01-01
Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350
Pharmacophore screening of the protein data bank for specific binding site chemistry.
Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu
2010-03-22
A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca
2011-01-01
The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714
Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis
2017-03-16
Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.
4,6-Diaryl/heteroarylpyrimidin-2(1H)-ones as a new class of xanthine oxidase inhibitors.
Shukla, Shiwani; Kumar, Dinesh; Ojha, Ritu; Gupta, Manish K; Nepali, Kunal; Bedi, Preet M S
2014-07-01
A series of 4,6-diaryl/heteroarylpyrimidones was synthesized employing silica-supported fluoroboric acid under solvent-free conditions in a microwave reactor. The catalytic influence of HBF4-SiO2 was investigated in detail to optimize the reaction conditions. The synthesized compounds were evaluated for in vitro xanthine oxidase (XO) inhibitory activity for the first time. Structure-activity relationship analyses are also presented. Among the synthesized compounds, VA-5, -9, -10, -12, -22, -23, and -25 were the active inhibitors with IC50 values ranging from 6.45 to 13.46 µM. Compound VA-25 with a pyridinyl ring as ring A and a thiophenyl ring as ring B emerged as the most potent XO inhibitor (IC50 = 6.45 µM) in comparison to allopurinol (IC50 = 12.24 µM). Some of the important interactions of VA-25 with the amino acid residues of the active site of XO were figured out by molecular modeling studies. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rick, Cathy; Kearns, Martha A; Thompson, Nancy A
2003-01-01
The health care network and hospital system within the Department of Veterans Affairs (VA), the Veterans Health Administration (VHA), provides employment to more than 56,000 nursing personnel and serves as clinical education site to countless other nursing and health professional students. Nurse administrators and educators are posed with the challenge of providing an environment in which each nurse is able to gain needed knowledge, learn new skills, and share and communicate this knowledge with other colleagues. The education of nurses improves the health status of veterans while also realizing individual professional enhancement. Regional and cultural diversity of the system present challenges to education, in both delivery and content. VHA's learning organizations, the Employee Education System and the Office of Special Projects, have maximized new technologies and information systems to provide innovative, virtual education opportunities, capitalizing on the benefits of informal and formal learning, thus moving VHA to the forefront in knowledge sharing and dissemination. The Virtual Learning Center, VA Knowledge Network, Learning Catalog, and VA Learning Online provide VHA's nurses with interactive, desktop virtual learning opportunities.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gundlach, A.L.; Largent, B.L.; Snyder, S.H.
1986-06-01
(+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less