Sample records for va geoshimiai-ye anasor-e

  1. Y&E Lessons in Learning: Youth and Education Program News, Summer 2003

    ERIC Educational Resources Information Center

    Cournoyer, David, Ed.

    2003-01-01

    This Summer 2003 issue of "Y&E Lessons in Learning" contains the following articles: (1) Playgrounds Where All Kids Are Able to Play; (2) Kellogg Foundation Promotes Youth Voices in Special Comic Book; (3) Families for Kids: A Powerful Approach to System Reform; (4) New Program Focuses Community Leaders on Educational Change; (5)…

  2. Hydration mechanisms of two polymorphs of synthetic ye'elimite

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cuesta, A.; Álvarez-Pinazo, G.; Sanfélix, S.G.

    2014-09-15

    Ye'elimite is the main phase in calcium sulfoaluminate cements and also a key phase in sulfobelite cements. However, its hydration mechanism is not well understood. Here we reported new data on the hydration behavior of ye'elimite using synchrotron and laboratory powder diffraction coupled to the Rietveld methodology. Both internal and external standard methodologies have been used to determine the overall amorphous contents. We have addressed the standard variables: water-to-ye'elimite ratio and additional sulfate sources of different solubilities. Moreover, we report a deep study of the role of the polymorphism of pure ye'elimites. The hydration behavior of orthorhombic stoichiometric and pseudo-cubicmore » solid-solution ye'elimites is discussed. In the absence of additional sulfate sources, stoichiometric-ye'elimite reacts slower than solid-solution-ye'elimite, and AFm-type phases are the main hydrated crystalline phases, as expected. Moreover, solid-solution-ye'elimite produces higher amounts of ettringite than stoichiometric-ye'elimite. However, in the presence of additional sulfates, stoichiometric-ye'elimite reacts faster than solid-solution-ye'elimite.« less

  3. 76 FR 44288 - Establishment of Class E Airspace; New Market, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-25

    ...-380; Airspace Docket No. 11-AEA-12] Establishment of Class E Airspace; New Market, VA AGENCY: Federal... proposes to establish Class E Airspace at New Market, VA, to accommodate the additional airspace needed for the Standard Instrument Approach Procedures developed for New Market Airport. This action would...

  4. Alite-ye'elimite cement: Synthesis and mineralogical analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ma, Suhua; Snellings, Ruben; Li, Xuerun

    2013-03-15

    Alite-ye'elimite cement is an alternative cement that combines desirable characteristics of calcium sulfoaluminate cements and Portland cement in that it shows improved strength development at early age while retaining high portlandite contents. The key problem in the clinkering process is to produce the alite-ye'elimite phase assemblage so that both phases can co-exist. In this study, a new synthesis method is proposed to achieve the coexistence of alite and ye'elimite consisting of a secondary heat treatment step at 1250 °C after regular Portland clinker firing at 1450 °C. Quantitative X-ray powder diffraction and electron microscopy were used to analyze the phasemore » composition of clinker before and after the secondary heat treatment. The results show that ye'elimite develops during secondary heat treatment of calcium sulphate enriched clinker by reaction of C{sub 3}A and sulphate phases. Additional ferrite is formed as result of rejection of Fe originally in solid solution with C{sub 3}A during ye'elimite formation.« less

  5. 75 FR 20774 - Establishment of Class E Airspace; Fort A.P. Hill, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-21

    ...-0739; Airspace Docket No. 09-AEA-14] Establishment of Class E Airspace; Fort A.P. Hill, VA AGENCY... December 7, 2009 that establishes Class E airspace at Fort A.P. Hill, VA. DATES: Effective Date: 0901 UTC... Service Center, Federal Aviation Administration, P.O. Box 20636, Atlanta, Georgia 30320; telephone (404...

  6. Identification and Characterization of Functionally Critical, Conserved Motifs in the Internal Repeats and N-terminal Domain of Yeast Translation Initiation Factor 4B (yeIF4B)*

    PubMed Central

    Zhou, Fujun; Walker, Sarah E.; Mitchell, Sarah F.; Lorsch, Jon R.; Hinnebusch, Alan G.

    2014-01-01

    eIF4B has been implicated in attachment of the 43 S preinitiation complex (PIC) to mRNAs and scanning to the start codon. We recently determined that the internal seven repeats (of ∼26 amino acids each) of Saccharomyces cerevisiae eIF4B (yeIF4B) compose the region most critically required to enhance mRNA recruitment by 43 S PICs in vitro and stimulate general translation initiation in yeast. Moreover, although the N-terminal domain (NTD) of yeIF4B contributes to these activities, the RNA recognition motif is dispensable. We have now determined that only two of the seven internal repeats are sufficient for wild-type (WT) yeIF4B function in vivo when all other domains are intact. However, three or more repeats are needed in the absence of the NTD or when the functions of eIF4F components are compromised. We corroborated these observations in the reconstituted system by demonstrating that yeIF4B variants with only one or two repeats display substantial activity in promoting mRNA recruitment by the PIC, whereas additional repeats are required at lower levels of eIF4A or when the NTD is missing. These findings indicate functional overlap among the 7-repeats and NTD domains of yeIF4B and eIF4A in mRNA recruitment. Interestingly, only three highly conserved positions in the 26-amino acid repeat are essential for function in vitro and in vivo. Finally, we identified conserved motifs in the NTD and demonstrate functional overlap of two such motifs. These results provide a comprehensive description of the critical sequence elements in yeIF4B that support eIF4F function in mRNA recruitment by the PIC. PMID:24285537

  7. 78 FR 20846 - Proposed Establishment of Class E Airspace; Leesburg, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-08

    ... action proposes to establish Class E surface airspace at Leesburg, VA, to aid Potomac TRACON in the safe... airspace required to aid Potomac TRACON in the safe and orderly flow of air traffic at Leesburg Executive...

  8. 75 FR 57215 - Proposed Establishment of Class E Airspace; Crewe, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-20

    ... submitted in triplicate to the Docket Management System (see ADDRESSES section for address and phone number... action proposes to establish Class E Airspace at Crewe, VA, to accommodate the additional airspace needed for the Standard Instrument Approach Procedures (SIAPs) developed for Crewe Municipal Airport. This...

  9. Quantum Quench of the Sachdev-Ye-Kitaev Model

    NASA Astrophysics Data System (ADS)

    Steinberg, Julia; Eberlein, Andreas; Sachdev, Subir

    The Sachdev-Ye-Kitaev model is a single site model containing N flavors of fermions with random infinite range interactions. It is exactly solvable in the large N limit and has an emergent reparameterization symmetry in time at low temperatures and strong coupling. This leads to many interesting properties such as locally critical behavior in correlation functions and the saturation of the chaos bound proposed .We start with the generalized Sachdev-Ye-Kitaev with quadratic and quartic interactions. This Hamiltonian has the form of a 0+1d Fermi liquid and contains long-lived quasiparticles at all values of the quadratic coupling. We quench the system into a locally critical state without quasiparticles by turning off the quadratic coupling at some initial time. We numerically study the spectral function at intermediate and long times and determine the timescale in which the system loses memory of the quasiparticles. J.S. is supported by the National Science Foundation Graduate Research Fellowship under Grant No. DGE1144152.

  10. From climate to global change: Following the footprint of Prof. Duzheng YE's research

    NASA Astrophysics Data System (ADS)

    Fu, Congbin

    2017-10-01

    To commemorate 100 years since the birth of Professor Duzheng YE, this paper reviews the contribution of Ye and his research team to the development from climate to global change science in the past 30 or so years, including: (1) the role of climate change in global change; (2) the critical time scales and predictability of global change; (3) the sensitive regions of global change—transitional zones of climate and ecosystems; and (4) orderly human activities and adaptation to global change, with a focus on the development of a proactive strategy for adaptation to such change.

  11. Veterans' experiences initiating VA-based mental health care.

    PubMed

    Bovin, Michelle J; Miller, Christopher J; Koenig, Christopher J; Lipschitz, Jessica M; Zamora, Kara A; Wright, Patricia B; Pyne, Jeffrey M; Burgess, James F

    2018-05-21

    Military veterans who could benefit from mental health services often do not access them. Research has revealed a range of barriers associated with initiating United States Department of Veterans Affairs (VA) care, including those specific to accessing mental health care (e.g., fear of stigmatization). More work is needed to streamline access to VA mental health-care services for veterans. In the current study, we interviewed 80 veterans from 9 clinics across the United States about initiation of VA mental health care to identify barriers to access. Results suggested that five predominant factors influenced veterans' decisions to initiate care: (a) awareness of VA mental health services; (b) fear of negative consequences of seeking care; (c) personal beliefs about mental health treatment; (d) input from family and friends; and (e) motivation for treatment. Veterans also spoke about the pathways they used to access this care. The four most commonly reported pathways included (a) physical health-care appointments; (b) the service connection disability system; (c) non-VA care; and (d) being mandated to care. Taken together, these data lend themselves to a model that describes both modifiers of, and pathways to, VA mental health care. The model suggests that interventions aimed at the identified pathways, in concert with efforts designed to reduce barriers, may increase initiation of VA mental health-care services by veterans. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  12. Innovative /ye/ and /we/ sequences in recent loans in Japanese

    NASA Astrophysics Data System (ADS)

    Vance, Timothy; Matsugu, Yuka

    2005-04-01

    The GV sequences /ye/ and /we/ do not occur in Japanese except perhaps in recent loans. Katakana spellings of the relevant loans in authoritative dictionaries are inconsistent, and it is not clear whether native speakers treat them as containing the GV sequences /ye/ and /we/ or as containing the VV sequences /ie/ and /ue/. Native speakers of Japanese with minimal exposure to spoken English were recorded producing some relevant loans in response to picture prompts. The same speakers were also recorded producing some native words containing uncontroversial /ie/ and /ue/ sequences. All the productions are being analyzed acoustically to determine whether they show the expected contrast between GV and VV sequences. A VV sequence is disyllabic (and bimoraic) and should therefore have greater duration and more gradual formant movements than a monosyllabic (and monomoraic) GV sequence. Utterance-initially, a VV sequence should have a LH pitch pattern and should be preceded by a nondistinctive glottal stop, whereas a GV sequence should have a H pitch pattern and should have smooth onset.

  13. Inhibition of adenovirus replication by the E1A antisense transcript initiated from hsp70 and VA-1 promoters.

    PubMed

    Miroshnichenko, O I; Borisenko, A S; Ponomareva, T I; Tikhonenko, T I

    1990-03-01

    The E1A region of the adenoviral genome, important for initiation of virus infection and activation of other viral genes, was chosen as a target for engineering antisense RNA (asRNA) to inhibit adenovirus 5 (Ad5) replication in COS-1 cell culture in vitro. The hsp70 promoter, taken from the appropriate heat-shock-protein gene of Drosophila melanogaster, and the VA-1 RNA promoter, derived from the Ad5 gene coding for low-molecular-mass VA-1 RNA and recognized by RNA polymerase III were used as regulatory elements of transcription. The two types of recombinant constructs contained E1A fragments of 710 bp (hsp70 constructs) or 380 or 740 bp (VA-1 RNA constructs) in reverse orientation relative to the promoter position, as well as a transcription termination signal, the SV40 ori, and the gene controlling Geneticin (antibiotic G418) resistance (G418R). After selection of transfected COS-1 cells in the presence of G418, a number of stable G418R cell lines were raised which expressed engineered asRNAs. Plating of Ad5 suspensions of known titre on monolayers of transfected COS-1 cells clearly showed strong inhibition of adenovirus replication by asRNAs: 75% with the hsp70 promoter and 90% with the VA-1 RNA promoter.

  14. Topological Sachdev-Ye-Kitaev model

    NASA Astrophysics Data System (ADS)

    Zhang, Pengfei; Zhai, Hui

    2018-05-01

    In this Rapid Communication, we construct a large-N exactly solvable model to study the interplay between interaction and topology, by connecting the Sachdev-Ye-Kitaev (SYK) model with constant hopping. The hopping forms a band structure that can exhibit both topologically trivial and nontrivial phases. Starting from a topologically trivial insulator with zero Hall conductance, we show that the interaction can drive a phase transition to a topologically nontrivial insulator with quantized nonzero Hall conductance, and a single gapless Dirac fermion emerges when the interaction is fine tuned to the critical point. The finite temperature effect is also considered, and we show that the topological phase with a stronger interaction is less stable against temperature. Our model provides a concrete example to illustrate the interacting topological phases and phase transitions, and can shed light on similar problems in physical systems.

  15. Comparison of outcomes for veterans receiving dialysis care from VA and non-VA providers.

    PubMed

    Wang, Virginia; Maciejewski, Matthew L; Patel, Uptal D; Stechuchak, Karen M; Hynes, Denise M; Weinberger, Morris

    2013-01-18

    Demand for dialysis treatment exceeds its supply within the Veterans Health Administration (VA), requiring VA to outsource dialysis care by purchasing private sector dialysis for veterans on a fee-for-service basis. It is unclear whether outcomes are similar for veterans receiving dialysis from VA versus non-VA providers. We assessed the extent of chronic dialysis treatment utilization and differences in all-cause hospitalizations and mortality between veterans receiving dialysis from VA versus VA-outsourced providers. We constructed a retrospective cohort of veterans in 2 VA regions who received chronic dialysis treatment financed by VA between January 2007 and December 2008. From VA administrative data, we identified veterans who received outpatient dialysis in (1) VA, (2) VA-outsourced settings, or (3) both ("dual") settings. In adjusted analyses, we used two-part and logistic regression to examine associations between dialysis setting and all-cause hospitalization and mortality one-year from veterans' baseline dialysis date. Of 1,388 veterans, 27% received dialysis exclusively in VA, 47% in VA-outsourced settings, and 25% in dual settings. Overall, half (48%) were hospitalized and 12% died. In adjusted analysis, veterans in VA-outsourced settings incurred fewer hospitalizations and shorter hospital stays than users of VA due to favorable selection. Dual-system dialysis patients had lower one-year mortality than veterans receiving VA dialysis. VA expenditures for "buying" outsourced dialysis are high and increasing relative to "making" dialysis treatment within its own system. Outcomes comparisons inform future make-or-buy decisions and suggest the need for VA to consider veterans' access to care, long-term VA savings, and optimal patient outcomes in its placement decisions for dialysis services.

  16. Job satisfaction and burnout among VA and community mental health workers.

    PubMed

    Salyers, Michelle P; Rollins, Angela L; Kelly, Yu-Fan; Lysaker, Paul H; Williams, Jane R

    2013-03-01

    Building on two independent studies, we compared burnout and job satisfaction of 66 VA staff and 86 community mental health center staff in the same city. VA staff reported significantly greater job satisfaction and accomplishment, less emotional exhaustion and lower likelihood of leaving their job. Sources of work satisfaction were similar (primarily working with clients, helping/witnessing change). VA staff reported fewer challenges with job-related aspects (e.g. flexibility, pay) but more challenges with administration. Community mental health administrators and policymakers may need to address job-related concerns (e.g. pay) whereas VA administrators may focus on reducing, and helping workers navigate, administrative policies.

  17. Comparison of outcomes for veterans receiving dialysis care from VA and non-VA providers

    PubMed Central

    2013-01-01

    Background Demand for dialysis treatment exceeds its supply within the Veterans Health Administration (VA), requiring VA to outsource dialysis care by purchasing private sector dialysis for veterans on a fee-for-service basis. It is unclear whether outcomes are similar for veterans receiving dialysis from VA versus non-VA providers. We assessed the extent of chronic dialysis treatment utilization and differences in all-cause hospitalizations and mortality between veterans receiving dialysis from VA versus VA-outsourced providers. Methods We constructed a retrospective cohort of veterans in 2 VA regions who received chronic dialysis treatment financed by VA between January 2007 and December 2008. From VA administrative data, we identified veterans who received outpatient dialysis in (1) VA, (2) VA-outsourced settings, or (3) both (“dual”) settings. In adjusted analyses, we used two-part and logistic regression to examine associations between dialysis setting and all-cause hospitalization and mortality one-year from veterans’ baseline dialysis date. Results Of 1,388 veterans, 27% received dialysis exclusively in VA, 47% in VA-outsourced settings, and 25% in dual settings. Overall, half (48%) were hospitalized and 12% died. In adjusted analysis, veterans in VA-outsourced settings incurred fewer hospitalizations and shorter hospital stays than users of VA due to favorable selection. Dual-system dialysis patients had lower one-year mortality than veterans receiving VA dialysis. Conclusions VA expenditures for “buying” outsourced dialysis are high and increasing relative to “making” dialysis treatment within its own system. Outcomes comparisons inform future make-or-buy decisions and suggest the need for VA to consider veterans’ access to care, long-term VA savings, and optimal patient outcomes in its placement decisions for dialysis services. PMID:23327632

  18. [Design and verification of Luo-Ye pump-based stress formation for cultivation of tissue-engineered blood vessel].

    PubMed

    Liao, Wen-Jun; Chen, Wan-Wen; Wen, Zhang; Wu, Yue-Heng; Li, Dong-Feng; Zhou, Jia-Hui; Zheng, Jian-Yi; Lin, Zhan-Yi

    2016-06-20

    To improve Luo-Ye pump-based stress-forming system and optimize the stimulating effect on smooth muscle cells during cultivation of tissue-engineered blood vessels (TEBV). A new Luo-Ye pump-based TEBV 3D culture system was developed by adding an air pump to the output of the bioreactor. A pressure guide wire was used to measure the stress at different points of the silicone tube inside the TEBV bio-reactor, and fitting curves of the stress changes over time was created using Origin 8.0 software. The TEBVs were constructed by seeding vascular smooth muscle cells (VSMCs) isolated from human umbilical artery on polyglycolic acid (PGA) and cultured under dynamic conditions with 40 mmHg resistance (improved group), dynamic conditions without resistance (control group) or static condition (static group) for 4 weeks. The harvested TEBVs were then examined with HE staining, masson staining, α-SMA immunohistochemical staining, and scanning and transmission electron microscopy with semi-quantitative analysis of collagen content and α-SMA expression. The measured stress values and the fitting curves showed that the stress stimuli from the Luo-Ye pump were enhanced by adding an air pump to the output of the bioreactor. Histological analysis revealed improved VSMC density, collagen content and α-SMA expression in the TEBVs constructed with the improved method as compared with those in the control and static groups. Adding an air pump to the Luo-Ye pump significantly enhances the stress stimulation in the TEBV 3-D culture system to promote the secretion function of VSMCs.

  19. VA Caregiver Support

    MedlinePlus

    ... Performance VA Plans, Budget, & Performance VA Center for Innovation (VACI) Agency Financial Report ... Management Services Veterans Service Organizations Office of Accountability & Whistleblower ...

  20. 76 FR 59502 - Establishment of Class E Airspace; Gordonsville, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-27

    ... at Gordonsville, VA, to accommodate the new Standard Instrument Approach Procedures serving Gordonsville Municipal Airport. This action enhances the safety and airspace management of Instrument Flight... approach procedures developed for Gordonsville Municipal Airport. This action is necessary for the safety...

  1. 76 FR 34576 - Amendment of Class E Airspace; Waynesboro, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-14

    ... Waynesboro, VA, to accommodate the additional airspace need for the Standard Instrument Approach Procedures developed for Eagle's Nest Airport. This action enhances the safety and management of Instrument Flight... upward from 700 feet above the surface to accommodate new standard instrument approach procedures...

  2. Supersymmetric Sachdev-Ye-Kitaev models

    DOE PAGES

    Fu, Wenbo; Gaiotto, Davide; Maldacena, Juan; ...

    2017-01-13

    We discuss a supersymmetric generalization of the Sachdev-Ye-Kitaev (SYK) model. These are quantum mechanical models involving N Majorana fermions. The supercharge is given by a polynomial expression in terms of the Majorana fermions with random coefficients. The Hamiltonian is the square of the supercharge. The N = 1 model with a single supercharge has unbroken supersymmetry at large N , but nonperturbatively spontaneously broken supersymmetry in the exact theory. We analyze the model by looking at the large N equation, and also by performing numerical computations for small values of N . We also compute the large N spectrum ofmore » “singlet” operators, where we find a structure qualitatively similar to the ordinary SYK model. We also discuss an N = 2 version. In this case, the model preserves supersymmetry in the exact theory and we can compute a suitably weighted Witten index to count the number of ground states, which agrees with the large N computation of the entropy. In both cases, we discuss the supersymmetric generalizations of the Schwarzian action which give the dominant effects at low energies.« less

  3. Comparing Catheter-associated Urinary Tract Infection Prevention Programs Between VA and Non-VA Nursing Homes

    PubMed Central

    Mody, Lona; Greene, M. Todd; Saint, Sanjay; Meddings, Jennifer; Trautner, Barbara W.; Wald, Heidi L.; Crnich, Christopher; Banaszak-Holl, Jane; McNamara, Sara E.; King, Beth J.; Hogikyan, Robert; Edson, Barbara; Krein, Sarah L.

    2018-01-01

    OBJECTIVE The impact of healthcare system integration on infection prevention programs is unknown. Using catheter-associated urinary tract infection (CAUTI) prevention as an example, we hypothesize that U.S. Department of Veterans Affairs (VA) nursing homes have a more robust infection prevention infrastructure due to integration and centralization compared with non-VA nursing homes. SETTING VA and non-VA nursing homes participating in the “AHRQ Safety Program for Long-term Care” collaborative. METHODS Nursing homes provided baseline information about their infection prevention programs to assess strengths and gaps related to CAUTI prevention. RESULTS A total of 353 (71%; 47 VA, 306 non-VA) of 494 nursing homes from 41 states responded. VA nursing homes reported more hours/week devoted to infection prevention-related activities (31 vs. 12 hours, P<.001), and were more likely to have committees that reviewed healthcare-associated infections. Compared with non-VA facilities, a higher percentage of VA nursing homes reported tracking CAUTI rates (94% vs. 66%, P<.001), sharing CAUTI data with leadership (94% vs. 70%, P=.014) and nursing personnel (85% vs. 56%, P=.003). However, fewer VA nursing homes reported having policies for appropriate catheter use (64% vs. 81%, P=.004) and catheter insertion (83% vs. 94%, P=.004). CONCLUSIONS Among nursing homes participating in an AHRQ-funded collaborative, VA and non-VA nursing homes differed in their approach to CAUTI prevention. Best practices from both settings should be applied universally to create an optimal infection prevention program within emerging integrated healthcare systems. PMID:27917728

  4. Implementation of online suicide-specific training for VA providers.

    PubMed

    Marshall, Elizabeth; York, Janet; Magruder, Kathryn; Yeager, Derik; Knapp, Rebecca; De Santis, Mark L; Burriss, Louisa; Mauldin, Mary; Sulkowski, Stan; Pope, Charlene; Jobes, David A

    2014-10-01

    Due to the gap in suicide-specific intervention training for mental health students and professionals, e-learning is one solution to improving provider skills in the Veterans Affairs (VA) health system. This study focused on the development and evaluation of an equivalent e-learning alternative to the Collaborative Assessment and Management of Suicidality (CAMS) in-person training approach at a Veteran Health Affairs medical center. The study used a multicenter, randomized, cluster, and three group design. the development of e-CAMS was an iterative process and included pilot testing. Eligible and consenting mental health providers, who completed a CAMS pre-survey, were randomized. Provider satisfaction was assessed using the standard VA evaluation of training consisting of 20 items. Two post training focus groups, divided by learning conditions, were conducted to assess practice adoption using a protocol focused on experiences with training and delivery of CAMS. A total of 215 providers in five sites were randomized to three conditions: 69 to e-learning, 70 to in-person, 76 to the control. The providers were primarily female, Caucasian, midlife providers. Based on frequency scores of satisfaction items, both learning groups rated the trainings positively. In focus groups representing divided by learning conditions, participants described positive reactions to CAMS training and similar individual and institutional barriers to full implementation of CAMS. This is the first evaluation study of a suicide-specific e-learning training within the VA. The e-CAMS appears equivalent to the in-person CAMS in terms of provider satisfaction with training and practice adoption, consistent with other comparisons of training deliveries across specialty areas. Additional evaluation of provider confidence and adoption and patient outcomes is in progress. The e-CAMS has the potential to provide ongoing training for VA and military mental health providers and serve as a tutorial for

  5. 76 FR 24570 - Proposed Information Collection (Application for VA Education Benefits) Activity; Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-02

    ... (Application for VA Education Benefits) Activity; Comment Request AGENCY: Veterans Benefits Administration, Department of Veterans Affairs. ACTION: Notice. SUMMARY: The Veterans Benefits Administration (VBA... Under the Montgomery GI Bill, VA Form 22-1990E. c. Application for VA Education Benefits Under the...

  6. 76 FR 40453 - Agency Information Collection (Application for VA Education Benefits) Activity Under OMB Review

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-08

    ... (Application for VA Education Benefits) Activity Under OMB Review AGENCY: Veterans Benefits Administration... Education Benefits, VA Form 22-1990. b. Application for Family Member to Use Transferred Benefits, VA Form 22-1990E. [[Page 40454

  7. 75 FR 78806 - Agency Information Collection (Create Payment Request for the VA Funding Fee Payment System (VA...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-16

    ... Payment Request for the VA Funding Fee Payment System (VA FFPS); a Computer Generated Funding Fee Receipt.... 2900-0474.'' SUPPLEMENTARY INFORMATION: Title: Create Payment Request for the VA Funding Fee Payment System (VA FFPS); a Computer Generated Funding Fee Receipt, VA Form 26-8986. OMB Control Number: 2900...

  8. 78 FR 59771 - Proposed Information Collection (Create Payment Request for the VA Funding Fee Payment System (VA...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-27

    ... Payment Request for the VA Funding Fee Payment System (VA FFPS); a Computer Generated Funding Fee Receipt.... Title: Create Payment Request for the VA Funding Fee Payment System (VA FFPS); A Computer Generated Funding Fee Receipt, VA Form 26-8986. OMB Control Number: 2900-0474. Type of Review: Revision of a...

  9. A VaR Algorithm for Warrants Portfolio

    NASA Astrophysics Data System (ADS)

    Dai, Jun; Ni, Liyun; Wang, Xiangrong; Chen, Weizhong

    Based on Gamma Vega-Cornish Fish methodology, this paper propose the algorithm for calculating VaR via adjusting the quantile under the given confidence level using the four moments (e.g. mean, variance, skewness and kurtosis) of the warrants portfolio return and estimating the variance of portfolio by EWMA methodology. Meanwhile, the proposed algorithm considers the attenuation of the effect of history return on portfolio return of future days. Empirical study shows that, comparing with Gamma-Cornish Fish method and standard normal method, the VaR calculated by Gamma Vega-Cornish Fish can improve the effectiveness of forecasting the portfolio risk by virture of considering the Gamma risk and the Vega risk of the warrants. The significance test is conducted on the calculation results by employing two-tailed test developed by Kupiec. Test results show that the calculated VaRs of the warrants portfolio all pass the significance test under the significance level of 5%.

  10. VA Health Care: Further Action Needed to Address Weaknesses in Management and Oversight of Non-VA Medical Care

    DTIC Science & Technology

    2014-06-18

    medical centers. VA also provides care to veterans in VA-operated community-based outpatient clinics, community living centers ( nursing homes...facility or nursing home up to the point that the veteran can be safely returned to the VA facility following the emergency care treatment at the non-VA... nursing home care, compensation and pension exams, and most pharmacy expenses paid for through the Non-VA Medical Care Program. (See fig. 1.) 8VA

  11. Iraq and Afghanistan Veterans: National Findings from VA Residential Treatment Programs

    PubMed Central

    Cook, Joan M.; Dinnen, Stephanie; O’Donnell, Casey; Bernardy, Nancy; Rosenheck, Robert; Desai, Rani

    2013-01-01

    A quality improvement effort was undertaken in Department of Veterans Affairs’ (VA) residential treatment programs for Posttraumatic Stress Disorder (PTSD) across the United States. Qualitative interviews were conducted with over 250 directors, providers, and staff during site visits of 38 programs. The aims of this report are to describe clinical issues and distinctive challenges in working with veterans from Iraq and Afghanistan and approaches to addressing their needs. Providers indicated that the most commonly reported problems were: acute PTSD symptomotology; other complex mental health symptom presentations; broad readjustment problems; and difficulty with time demands of and readiness for intensive treatment. Additional concerns included working with active duty personnel and mixing different eras in therapy. Programmatic solutions address structure (e.g., blended versus era-specific therapy), content (e.g., physical activity), and adaptations (e.g., inclusion of family; shortened length of stay). Clinical implications for VA managers and policy makers as well as non-VA health care systems and individual health care providers are noted. PMID:23458113

  12. Myosin Va binding to neurofilaments is essential for correct myosin Va distribution and transport and neurofilament density

    PubMed Central

    Rao, Mala V.; Engle, Linda J.; Mohan, Panaiyur S.; Yuan, Aidong; Qiu, Dike; Cataldo, Anne; Hassinger, Linda; Jacobsen, Stephen; Lee, Virginia M-Y.; Andreadis, Athena; Julien, Jean-Pierre; Bridgman, Paul C.; Nixon, Ralph A.

    2002-01-01

    The identification of molecular motors that modulate the neuronal cytoskeleton has been elusive. Here, we show that a molecular motor protein, myosin Va, is present in high proportions in the cytoskeleton of mouse CNS and peripheral nerves. Immunoelectron microscopy, coimmunoprecipitation, and blot overlay analyses demonstrate that myosin Va in axons associates with neurofilaments, and that the NF-L subunit is its major ligand. A physiological association is indicated by observations that the level of myosin Va is reduced in axons of NF-L–null mice lacking neurofilaments and increased in mice overexpressing NF-L, but unchanged in NF-H–null mice. In vivo pulse-labeled myosin Va advances along axons at slow transport rates overlapping with those of neurofilament proteins and actin, both of which coimmunoprecipitate with myosin Va. Eliminating neurofilaments from mice selectively accelerates myosin Va translocation and redistributes myosin Va to the actin-rich subaxolemma and membranous organelles. Finally, peripheral axons of dilute-lethal mice, lacking functional myosin Va, display selectively increased neurofilament number and levels of neurofilament proteins without altering axon caliber. These results identify myosin Va as a neurofilament-associated protein, and show that this association is essential to establish the normal distribution, axonal transport, and content of myosin Va, and the proper numbers of neurofilaments in axons. PMID:12403814

  13. Animals on VA property. Final rule.

    PubMed

    2015-08-17

    The Department of Veterans Affairs (VA) amends its regulation concerning the presence of animals on VA property. This final rule expands the current VA regulation to authorize the presence of service animals consistent with applicable Federal law when these animals accompany individuals with disabilities seeking admittance to property owned or operated by VA.

  14. VA Vascular Injury Study (VAVIS): VA-DoD extremity injury outcomes collaboration.

    PubMed

    Shireman, Paula K; Rasmussen, Todd E; Jaramillo, Carlos A; Pugh, Mary Jo

    2015-02-03

    Limb injuries comprise 50-60% of U.S. Service member's casualties of wars in Afghanistan and Iraq. Combat-related vascular injuries are present in 12% of this cohort, a rate 5 times higher than in prior wars. Improvements in medical and surgical trauma care, including initial in-theatre limb salvage approaches (IILS) have resulted in improved survival and fewer amputations, however, the long-term outcomes such as morbidity, functional decline, and risk for late amputation of salvaged limbs using current process of care have not been studied. The long-term care of these injured warfighters poses a significant challenge to the Department of Defense (DoD) and Department of Veterans Affairs (VA). The VA Vascular Injury Study (VAVIS): VA-DoD Extremity Injury Outcomes Collaborative, funded by the VA, Health Services Research and Development Service, is a longitudinal cohort study of Veterans with vascular extremity injuries. Enrollment will begin April, 2015 and continue for 3 years. Individuals with a validated extremity vascular injury in the Department of Defense Trauma Registry will be contacted and will complete a set of validated demographic, social, behavioral, and functional status measures during interview and online/ mailed survey. Primary outcome measures will: 1) Compare injury, demographic and geospatial characteristics of patients with IILS and identify late vascular surgery related limb complications and health care utilization in Veterans receiving VA vs. non-VA care, 2) Characterize the preventive services received by individuals with vascular repair and related outcomes, and 3) Describe patient-reported functional outcomes in Veterans with traumatic vascular limb injuries. This study will provide key information about the current process of care for Active Duty Service members and Veterans with polytrauma/vascular injuries at risk for persistent morbidity and late amputation. The results of this study will be the first step for clinicians in VA and

  15. 75 FR 61252 - Proposed Information Collection (Create Payment Request for the VA Funding Fee Payment System (VA...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-04

    ... Payment Request for the VA Funding Fee Payment System (VA FFPS); A Computer Generated Funding Fee Receipt... Payment Request for the VA Funding Fee Payment System (VA FFPS); A Computer Generated Funding Fee Receipt... information through the Federal Docket Management System (FDMS) at http://www.Regulations.gov or to Nancy J...

  16. 75 FR 61859 - Proposed Information Collection (Create Payment Request for the VA Funding Fee Payment System (VA...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-06

    ... Payment Request for the VA Funding Fee Payment System (VA FFPS); A Computer Generated Funding Fee Receipt... Payment Request for the VA Funding Fee Payment System (VA FFPS); A Computer Generated Funding Fee Receipt... information through the Federal Docket Management System (FDMS) at http://www.Regulations.gov or to Nancy J...

  17. Bibliography of Soviet Laser Developments, No. 17, July - September 1974

    DTIC Science & Technology

    1975-01-29

    A . N. Tokare and V . M. Usova (0). Effect of structural differ va. ences in flashlamps on the efficiency of solid state lasers...USATYUK, V.V. USHAKOV. A . Yt». USMANOV, A . G. USMANOV, R.G. USOVA , V . M. UZKIY. A . E. VALYASHKO, YE.G. VAREOLOMEYEV. A.A...ot’ power oulpul In a ruby laser with self-Q- switching. ZhPS, v . 20, no. 6, 1974, 987-989. 2, Kopvillem, U. Kh. , V .

  18. Proceedings of the International Conference on The Performance of Off-Road Vehicles and Machines (8th). Volume 2. Held at Cambridge England, on August 5-11, 1984.

    DTIC Science & Technology

    1984-08-01

    various wheel loads and gecoetries an an aid to vehicle design PO04 299 Flotation tires anc subsurface compaction POMl 300 Tractor power selection...soil copatiml steering computer modelling, vehicle -component design , measuremnt of soil and anow properties and soil bin facilitiesi and vehicle... design . 74 ~ Al i~~s W3 *1oe 9e e1 SALilsasifiLed seCUffiY cLataric*Ye ATWop ’ VA .-I rumo. .. nemraa~sociy m v smuAN vnaaz Yswros 1BR.NM 72 Lym AmI

  19. Determination of VA health care costs.

    PubMed

    Barnett, Paul G

    2003-09-01

    In the absence of billing data, alternative methods are used to estimate the cost of hospital stays, outpatient visits, and treatment innovations in the U.S. Department of Veterans Affairs (VA). The choice of method represents a trade-off between accuracy and research cost. The direct measurement method gathers information on staff activities, supplies, equipment, space, and workload. Since it is expensive, direct measurement should be reserved for finding short-run costs, evaluating provider efficiency, or determining the cost of treatments that are innovative or unique to VA. The pseudo-bill method combines utilization data with a non-VA reimbursement schedule. The cost regression method estimates the cost of VA hospital stays by applying the relationship between cost and characteristics of non-VA hospitalizations. The Health Economics Resource Center uses pseudo-bill and cost regression methods to create an encounter-level database of VA costs. Researchers are also beginning to use the VA activity-based cost allocation system.

  20. 48 CFR 853.215-70 - VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ..., Application for Furnishing Nursing Home Care to Beneficiaries of VA. 853.215-70 Section 853.215-70 Federal... 853.215-70 VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA. VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA, will be used for...

  1. 48 CFR 853.215-70 - VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ..., Application for Furnishing Nursing Home Care to Beneficiaries of VA. 853.215-70 Section 853.215-70 Federal... 853.215-70 VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA. VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA, will be used for...

  2. 48 CFR 853.215-70 - VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ..., Application for Furnishing Nursing Home Care to Beneficiaries of VA. 853.215-70 Section 853.215-70 Federal... 853.215-70 VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA. VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA, will be used for...

  3. 48 CFR 853.215-70 - VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ..., Application for Furnishing Nursing Home Care to Beneficiaries of VA. 853.215-70 Section 853.215-70 Federal... 853.215-70 VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA. VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA, will be used for...

  4. 48 CFR 853.215-70 - VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ..., Application for Furnishing Nursing Home Care to Beneficiaries of VA. 853.215-70 Section 853.215-70 Federal... 853.215-70 VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA. VA Form 10-1170, Application for Furnishing Nursing Home Care to Beneficiaries of VA, will be used for...

  5. Do Older Rural and Urban Veterans Experience Different Rates of Unplanned Readmission to VA and Non-VA Hospitals?

    ERIC Educational Resources Information Center

    Weeks, William B.; Lee, Richard E.; Wallace, Amy E.; West, Alan N.; Bagian, James P.

    2009-01-01

    Context: Unplanned readmission within 30 days of discharge is an indicator of hospital quality. Purpose: We wanted to determine whether older rural veterans who were enrolled in the VA had different rates of unplanned readmission to VA or non-VA hospitals than their urban counterparts. Methods: We used the combined VA/Medicare dataset to examine…

  6. Universality and Thouless energy in the supersymmetric Sachdev-Ye-Kitaev model

    NASA Astrophysics Data System (ADS)

    García-García, Antonio M.; Jia, Yiyang; Verbaarschot, Jacobus J. M.

    2018-05-01

    We investigate the supersymmetric Sachdev-Ye-Kitaev (SYK) model, N Majorana fermions with infinite range interactions in 0 +1 dimensions. We have found that, close to the ground state E ≈0 , discrete symmetries alter qualitatively the spectral properties with respect to the non-supersymmetric SYK model. The average spectral density at finite N , which we compute analytically and numerically, grows exponentially with N for E ≈0 . However the chiral condensate, which is normalized with respect the total number of eigenvalues, vanishes in the thermodynamic limit. Slightly above E ≈0 , the spectral density grows exponentially with the energy. Deep in the quantum regime, corresponding to the first O (N ) eigenvalues, the average spectral density is universal and well described by random matrix ensembles with chiral and superconducting discrete symmetries. The dynamics for E ≈0 is investigated by level fluctuations. Also in this case we find excellent agreement with the prediction of chiral and superconducting random matrix ensembles for eigenvalue separations smaller than the Thouless energy, which seems to scale linearly with N . Deviations beyond the Thouless energy, which describes how ergodicity is approached, are universally characterized by a quadratic growth of the number variance. In the time domain, we have found analytically that the spectral form factor g (t ), obtained from the connected two-level correlation function of the unfolded spectrum, decays as 1 /t2 for times shorter but comparable to the Thouless time with g (0 ) related to the coefficient of the quadratic growth of the number variance. Our results provide further support that quantum black holes are ergodic and therefore can be classified by random matrix theory.

  7. 76 FR 62132 - Virginia Disaster Number VA-00038

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-06

    ... SMALL BUSINESS ADMINISTRATION [Disaster Declaration 12805 and 12806] Virginia Disaster Number VA-00038 AGENCY: U.S. Small Business Administration. ACTION: Amendment 2. SUMMARY: This is an amendment of... Federal Domestic Assistance Numbers 59002 and 59008) James E. Rivera, Associate Administrator for Disaster...

  8. Accessing VA Healthcare During Large-Scale Natural Disasters.

    PubMed

    Der-Martirosian, Claudia; Pinnock, Laura; Dobalian, Aram

    2017-01-01

    Natural disasters can lead to the closure of medical facilities including the Veterans Affairs (VA), thus impacting access to healthcare for U.S. military veteran VA users. We examined the characteristics of VA patients who reported having difficulty accessing care if their usual source of VA care was closed because of natural disasters. A total of 2,264 veteran VA users living in the U.S. northeast region participated in a 2015 cross-sectional representative survey. The study used VA administrative data in a complex stratified survey design with a multimode approach. A total of 36% of veteran VA users reported having difficulty accessing care elsewhere, negatively impacting the functionally impaired and lower income VA patients.

  9. The Impact of a Change in the Price of VA Health Care on Utilization of VA and Medicare Services.

    PubMed

    Nelson, Richard E; Hicken, Bret; Vanneman, Megan; Liu, Chuan-Fen; Rupper, Randall

    2018-05-15

    The passage of the Veterans Access, Choice, and Accountability Act of 2014 has expanded the non-Veteran Affairs (VA) care options for eligible US Veterans. In order for these new arrangements to provide the best care possible for Veterans, it is important to understand the relationship between VA and non-VA care options. The purpose of this study was to use another recent VA policy change, one that increased the reimbursement rate that eligible Veterans receive for travel for health care to VA, to understand the use of VA and Medicare services among Medicare-enrolled Veterans. We used a difference-in-difference technique to compare inpatient and outpatient utilization and cost in VA and Medicare between Veterans who were eligible for travel reimbursement and those who were not eligible following 2 increases in the travel reimbursement rate. We used generalized estimating equation models and 2-part models when cost outcomes were rare. Our cohort consisted of 110,007 Medicare-enrolled Veterans, including 25,076 under 65 and 84,931 over 65 years old. Following the travel reimbursement rate increases, the number of VA outpatient encounters increased for Veterans in our cohort regardless of age group or whether living in an urban or rural area. The number of non-VA outpatient encounters decreased significantly for Veterans in both age groups living in rural areas following these policy changes. Our estimates suggest that VA outpatient care may be a substitute for Medicare outpatient care for Medicare-enrolled Veterans living in rural areas. These results are important because they indicate how Veteran health care utilization might be affected by future policy changes designed to increase access to VA services. They also indicate the ripple effects that may occur in other health systems due to changes in the VA system.

  10. [Concepts of "urinary bladder" and "vesicles (bao)" , "jin ye" (fluid and humor) and "urine" and other associated issues].

    PubMed

    Son, J R; Liu, Y; Ma, Q N; Ju, B Z; Sun, K F; Wu, J D; Zhang, L D; Yang, G L

    2017-09-28

    In the Huang di nei jing ( Huangdi ' s Internal Classic ), jin ye (fluid and humor) is described in two senses, broad and narrow, though not so strictly.Sometimes, jin ye is explained ambiguously as "sweat" and "urine" , as in the phrase "the bladder, being a house of jin ye " , here " jin ye " refers to the urine. In the Qi jue lun pian of Su wen ( Chapter on Qi - Syncope of Plain Questions ) , the " bao " in the sentence "heat of bao moved to bladder" refersto the uterus. In the Shi cong rong lun pian ( Chapter of Readily Inspecting ) of Plain Questions , the "bladder" in the phrase "gallbladder, stomach, large intestine, small intestine, spleen, bao and bladder" , which, being an annotation of " bao " originally, is mistakenly incorporated into the text of the Classic . In the Wu wei lun of Ling shu ( On Five Tastes in Miraculous Pivot ) , the " bao " in " bao of bladder" refers to the external hou (external manifestation) of the bladder, that is the scrotum. In the Bei ji qian jin yao fang ( Essential Prescriptions Worth a Thousand Gold for Emergencies ) , the short sentence " pang guang zou bao " is an error in itself. In the sentence of "settled in the bao and zhi causing to dream of defecation and urination" in the Yin xie fa meng (Dreams due to Evils) of Miraculous Pivot , " bao " refers to uterus, and " zhi " to anus. In Bi lun pian ( Chapter on Impediment ) of Plain Questions , "the man suffered bao bimight feel internal pain when the lesser abdomen and bladder are pressed" , here, " bao " refers to the bladder. In the Wu yin wu wei ( Chapter on Five Sound and Five Tastes ) of Miraculous Pivot , the " bao " in the sentence "thoroughfare vessel and conception vessel all starts from bao " , again, " bao " here refers to the bladder, rather than to the uterus. From the above descriptions of "bladder" and " bao " in the Huangdi ' s Internal Classic , the "bladder" in ancient medical books refers to the substantial bladder, an anatomical organ, and " bao

  11. Women's veteran identity and utilization of VA health services.

    PubMed

    Di Leone, Brooke A L; Wang, Joyce M; Kressin, Nancy; Vogt, Dawne

    2016-02-01

    Women have participated in the United States military since its founding. However, until the mid-20th century, there had been limited recognition of women as official members of the military, and women remain a statistical minority within military and veteran populations. It is therefore important to better understand women's veteran identity (which we define here as one's self-concept as derived from their veteran status) and associated implications for service use and experiences in the Department of Veterans Affairs (VA) health care setting. The present research examined the centrality of, and positive regard for, women's veteran identity among 407 female veterans deployed in support of the recent wars in Iraq and Afghanistan. Data were collected via a mailed national survey. Positive regard for veteran identity, but not veteran identity centrality,was positively associated with participants' age and length of time spent in the military. Results also showed that the centrality of women's veteran identity was positively related to their choice to use VA for health care and their feelings of belonging within VA, and that veteran identity centrality and positive regard for veteran identity are differentially associated with participants' military experiences (e.g., combat exposure, deployment sexual harassment) and mental health symptomatology (e.g., depression). (c) 2016 APA, all rights reserved).

  12. National Dam Safety Program. Upper Apple Mountain & Lower Apple Mountain. Dam (Inventory Number VA 18711 and VA 18709), Potomac River Basin, Warren County, Virginia. Phase I Inspection Report.

    DTIC Science & Technology

    1981-03-01

    pt 3349 tIto . %. 0- Z 20a Z US It - r.422 j - oil too I - i n IN IU w-nj 1.t 1-1 1 1 Uzi bp- r* 93 I .- -CL US0 (1syOWSW!)C 91 00A o Z z 49 W, x _jW4~0...UNCLASSIFIED .’mollIIEIEEIIII l//lEEBhE/h//E IIIEEIIIlIIIII I hhhhhhhhhhhhl POTOAC RIVER BASIN Name Of Dam: UPPER APPLE MTN. 6 LOWER ALE Mt. Location...WARREN COUNTY Inventory Number: VA. 48711 S VA. 16709 PHASE I INSPECTION REPORT NATIONAL DAM SAFETY PROGRAM + I + - SEP3 tell. "=: ~~t PUMP, -We"* li

  13. Hospital Distance and Readmissions Among VA-Medicare Dual-Enrolled Veterans.

    PubMed

    Wong, Edwin S; Rinne, Seppo T; Hebert, Paul L; Cook, Meredith A; Liu, Chuan-Fen

    2016-09-01

    Geographic access to inpatient care at the Veterans Affairs (VA) Health Care System is challenging for many veterans with chronic obstructive pulmonary disease (COPD) given relatively few VA hospitals nationwide. Veterans with lengthy travel distances may obtain non-VA care, particularly those dually enrolled in Medicare. Our primary objective was to assess whether distance from VA patients' residence to the nearest VA and non-VA hospitals was associated with 30-day all-cause readmission and the system where patients were readmitted (VA or Medicare). Using VA and Medicare administrative data, we identified 21,273 patients hospitalized for COPD between October 2008 and September 2011 and dually enrolled in VA and fee-for-service Medicare. Outcome variables were dichotomous measures denoting readmission for any cause within 30 days following discharge and whether the readmission occurred in a non-VA hospital through Medicare. Distance to the nearest hospital was defined as the number of miles between patients' residence ZIP code and the ZIP code of the nearest VA and non-VA hospital accepting Medicare, respectively. Probit models with sample selection were applied to examine the relationship between hospital distance and outcome measures. Respective distances to the nearest VA and non-VA hospital were not associated with 30-day all-cause readmission. Greater distance to the nearest VA hospital was associated with a greater conditional probability of choosing non-VA hospitals for readmission. COPD patients with poor geographic access to VA hospitals did not forgo subsequent inpatient care following their index hospitalization, but they were more likely to seek non-VA substitutes. © 2016 National Rural Health Association.

  14. Proposed comprehensive ototoxicity monitoring program for VA healthcare (COMP-VA)

    PubMed Central

    Konrad-Martin, Dawn; Reavis, Kelly M.; McMillan, Garnett; Helt, Wendy J.; Dille, Marilyn

    2015-01-01

    Prevention and rehabilitation of hearing loss and tinnitus, the two most commonly awarded service-connected disabilities, are high priority initiatives in the Department of Veterans Affairs (VA). At least 4,000 Veterans, most with significant hearing loss, will receive cisplatin this year, with more than half sustaining permanent hearing shift and nearly 40% developing new tinnitus. With improved survivability following cancer treatment, Veterans treated with cisplatin are approached with the dual goals of effective treatment and preserved quality of life. This article describes COMP-VA, a comprehensive ototoxicity monitoring program developed for VA patients receiving cisplatin. The program includes an individualized pretreatment prediction model that identifies the likelihood of hearing shift given cisplatin dose and patient factors. It supports both manual and automated hearing testing with a newly developed portable audiometer capable of performing the recommended procedures on the chemotherapy unit during treatment. It also includes objective methods for identifying outer hair cell changes and predicting audiogram changes using distortion-product otoacoustic emissions. We describe this program of evidence-based ototoxicity monitoring protocols using a case example to give the reader an understanding of how this program would be applied, along with a plan for future work to accomplish the final stages of program development. PMID:24805896

  15. 77 FR 70893 - Authorization for Non-VA Medical Services

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-28

    ... professions, Health records, Homeless, Mental health programs, Nursing homes, Reporting and recordkeeping... restrictive modes of healthcare delivery. Although VA has made great strides to expand the delivery of... expand VA's authority to provide non-VA medical services under the non- VA care authority. As amended...

  16. 77 FR 70967 - Authorization for Non-VA Medical Services

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-28

    ... expand the delivery of healthcare to veterans, VA is, like the rest of the healthcare industry...(a)(2)(B) to expand VA's authority to provide non-VA medical services under the non- VA care... furnished hospital care, nursing home care, domiciliary care, or medical services and who requires medical...

  17. 77 FR 67063 - VA Directive 0005 on Scientific Integrity

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-08

    ... policies that: Foster a culture of transparency, integrity, and ethical behavior in the development and... provided to the VA's Office of Inspector General (OIG), the Office of Government Ethics, and Congress. VA...: VA has amended Directive 0005, ] 5.b., to state that ``VA policy provides an ethical and accountable...

  18. The WHO 2016 verbal autopsy instrument: An international standard suitable for automated analysis by InterVA, InSilicoVA, and Tariff 2.0

    PubMed Central

    Chandramohan, Daniel; Clark, Samuel J.; Jakob, Robert; Leitao, Jordana; Rao, Chalapati; Riley, Ian; Setel, Philip W.

    2018-01-01

    Background Verbal autopsy (VA) is a practical method for determining probable causes of death at the population level in places where systems for medical certification of cause of death are weak. VA methods suitable for use in routine settings, such as civil registration and vital statistics (CRVS) systems, have developed rapidly in the last decade. These developments have been part of a growing global momentum to strengthen CRVS systems in low-income countries. With this momentum have come pressure for continued research and development of VA methods and the need for a single standard VA instrument on which multiple automated diagnostic methods can be developed. Methods and findings In 2016, partners harmonized a WHO VA standard instrument that fully incorporates the indicators necessary to run currently available automated diagnostic algorithms. The WHO 2016 VA instrument, together with validated approaches to analyzing VA data, offers countries solutions to improving information about patterns of cause-specific mortality. This VA instrument offers the opportunity to harmonize the automated diagnostic algorithms in the future. Conclusions Despite all improvements in design and technology, VA is only recommended where medical certification of cause of death is not possible. The method can nevertheless provide sufficient information to guide public health priorities in communities in which physician certification of deaths is largely unavailable. The WHO 2016 VA instrument, together with validated approaches to analyzing VA data, offers countries solutions to improving information about patterns of cause-specific mortality. PMID:29320495

  19. 78 FR 76064 - Authorization for Non-VA Medical Services; Withdrawal

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-16

    ... DEPARTMENT OF VETERANS AFFAIRS 38 CFR Part 17 RIN 2900-AO47 Authorization for Non-VA Medical... November 28, 2012, that would have amended its regulations regarding payment by VA for medical services under VA's statutory authority to provide non-VA medical care. VA sought to remove an outdated...

  20. Strongly Correlated Metal Built from Sachdev-Ye-Kitaev Models

    NASA Astrophysics Data System (ADS)

    Song, Xue-Yang; Jian, Chao-Ming; Balents, Leon

    2017-11-01

    Prominent systems like the high-Tc cuprates and heavy fermions display intriguing features going beyond the quasiparticle description. The Sachdev-Ye-Kitaev (SYK) model describes a (0 +1 )D quantum cluster with random all-to-all four-fermion interactions among N fermion modes which becomes exactly solvable as N →∞ , exhibiting a zero-dimensional non-Fermi-liquid with emergent conformal symmetry and complete absence of quasiparticles. Here we study a lattice of complex-fermion SYK dots with random intersite quadratic hopping. Combining the imaginary time path integral with real time path integral formulation, we obtain a heavy Fermi liquid to incoherent metal crossover in full detail, including thermodynamics, low temperature Landau quasiparticle interactions, and both electrical and thermal conductivity at all scales. We find linear in temperature resistivity in the incoherent regime, and a Lorentz ratio L ≡(κ ρ /T ) varies between two universal values as a function of temperature. Our work exemplifies an analytically controlled study of a strongly correlated metal.

  1. Phase Diagram of Planar Matrix Quantum Mechanics, Tensor, and Sachdev-Ye-Kitaev Models.

    PubMed

    Azeyanagi, Tatsuo; Ferrari, Frank; Massolo, Fidel I Schaposnik

    2018-02-09

    We study the Schwinger-Dyson equations of a fermionic planar matrix quantum mechanics [or tensor and Sachdev-Ye-Kitaev (SYK) models] at leading melonic order. We find two solutions describing a high entropy, SYK black-hole-like phase and a low entropy one with trivial IR behavior. There is a line of first order phase transitions that terminates at a new critical point. Critical exponents are nonmean field and differ on the two sides of the transition. Interesting phenomena are also found in unstable and stable bosonic models, including Kazakov critical points and inconsistency of SYK-like solutions of the IR limit.

  2. Estimating the costs of VA ambulatory care.

    PubMed

    Phibbs, Ciaran S; Bhandari, Aman; Yu, Wei; Barnett, Paul G

    2003-09-01

    This article reports how we matched Common Procedure Terminology (CPT) codes with Medicare payment rates and aggregate Veterans Affairs (VA) budget data to estimate the costs of every VA ambulatory encounter. Converting CPT codes to encounter-level costs was more complex than a simple match of Medicare reimbursements to CPT codes. About 40 percent of the CPT codes used in VA, representing about 20 percent of procedures, did not have a Medicare payment rate and required other cost estimates. Reconciling aggregated estimated costs to the VA budget allocations for outpatient care produced final VA cost estimates that were lower than projected Medicare reimbursements. The methods used to estimate costs for encounters could be replicated for other settings. They are potentially useful for any system that does not generate billing data, when CPT codes are simpler to collect than billing data, or when there is a need to standardize cost estimates across data sources.

  3. VaST: A variability search toolkit

    NASA Astrophysics Data System (ADS)

    Sokolovsky, K. V.; Lebedev, A. A.

    2018-01-01

    Variability Search Toolkit (VaST) is a software package designed to find variable objects in a series of sky images. It can be run from a script or interactively using its graphical interface. VaST relies on source list matching as opposed to image subtraction. SExtractor is used to generate source lists and perform aperture or PSF-fitting photometry (with PSFEx). Variability indices that characterize scatter and smoothness of a lightcurve are computed for all objects. Candidate variables are identified as objects having high variability index values compared to other objects of similar brightness. The two distinguishing features of VaST are its ability to perform accurate aperture photometry of images obtained with non-linear detectors and handle complex image distortions. The software has been successfully applied to images obtained with telescopes ranging from 0.08 to 2.5 m in diameter equipped with a variety of detectors including CCD, CMOS, MIC and photographic plates. About 1800 variable stars have been discovered with VaST. It is used as a transient detection engine in the New Milky Way (NMW) nova patrol. The code is written in C and can be easily compiled on the majority of UNIX-like systems. VaST is free software available at http://scan.sai.msu.ru/vast/.

  4. 38 CFR 77.17 - Recovery of funds by VA.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2014-07-01 2014-07-01 false Recovery of funds by VA....17 Recovery of funds by VA. (a) Recovery of funds. VA may recover from the grantee any funds that are... additional adaptive sports grant payments. When VA makes a final decision that action will be taken to...

  5. 78 FR 62441 - VA Dental Insurance Program-Federalism

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-22

    ... DEPARTMENT OF VETERANS AFFAIRS 38 CFR Part 17 RIN 2900-AO85 VA Dental Insurance Program... Veterans Affairs (VA) is taking direct final action to amend its regulations related to the VA Dental Insurance Program (VADIP), a pilot program to offer premium-based dental insurance to enrolled veterans and...

  6. 78 FR 63143 - VA Dental Insurance Program-Federalism

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-23

    ... DEPARTMENT OF VETERANS AFFAIRS 38 CFR Part 17 RIN 2900-AO86 VA Dental Insurance Program... Affairs (VA) proposes to amend its regulations related to the VA Dental Insurance Program (VADIP), a pilot program to offer premium-based dental insurance to enrolled veterans and certain survivors and dependents...

  7. Visionary leadership and the future of VA health system.

    PubMed

    Bezold, C; Mayer, E; Dighe, A

    1997-01-01

    As the U.S. Department of Veterans Affairs (VA) makes the change over to Veterans Integrated Service Network (VISNs) the need for new and better leadership is warranted if VA wants to not only survive, but thrive in the emerging twenty-first century healthcare system. VA can prepare for the future and meet the challenges facing them by adopting a system of visionary leadership. The use of scenarios and vision techniques are explained as they relate to VA's efforts to move toward their new system of VISNs. The four scenarios provide snapshots of possible futures for the U.S. healthcare system as well as the possible future role and mission of VA--from VA disappearing to its becoming a premier virtual organization.

  8. Malaria epidemiology in the Pakaanóva (Wari') Indians, Brazilian Amazon.

    PubMed

    Sá, D Ribeiro; Souza-Santos, R; Escobar, A L; Coimbra, C E A

    2005-04-01

    This paper reports the results of a longitudinal study of malaria incidence (1998-2002) among the Pakaanóva (Wari') Indians, Brazilian southwest Amazon region, based on data routinely gathered by Brazilian National Health Foundation outposts network in conjunction with the Indian health service. Malaria is present yearlong in the Pakaanóva. Statistically significant differences between seasons or months were not noticed. A total of 1933 cases of malaria were diagnosed in the Pakaanóva during this period. The P. vivax / P. falciparum ratio was 3.4. P. vivax accounted for 76.5% of the cases. Infections with P. malariae were not recorded. Incidence rates did not differ by sex. Most malaria cases were reported in children < 10 years old (45%). About one fourth of all cases were diagnosed on women 10-40 years old. An entomological survey carried out at two Pakaanóva villages yielded a total of 3.232 specimens of anophelines. Anopheles darlingi predominated (94.4%). Most specimens were captured outdoors and peak activity hours were noted at early evening and just before sunrise. It was observed that Pakaanóva cultural practices may facilitate outdoor exposure of individuals of both sexes and all age groups during peak hours of mosquito activities (e.g., coming to the river early in the morning for bathing or to draw water, fishing, engaging in hunting camps, etc). In a context in which anophelines are ubiquitous and predominantly exophilic, and humans of both sexes and all ages are prone to outdoor activities during peak mosquito activity hours, malaria is likely to remain endemic in the Pakaanóva, thus requiring the development of alternative control strategies that are culturally and ecologically sensitive.

  9. Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

    PubMed

    Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

    2013-02-01

    Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

  10. Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains

    PubMed Central

    Walker, Sarah E.; Zhou, Fujun; Mitchell, Sarah F.; Larson, Victoria S.; Valasek, Leos; Hinnebusch, Alan G.; Lorsch, Jon R.

    2013-01-01

    Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B’s domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome’s mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment. PMID:23236192

  11. 78 FR 46497 - Amendment of Class D and E Airspace, and Establishment of Class E Airspace; Oceana NAS, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-01

    ... Soucek Field) now operating on a part time basis. This action enhances the safety and airspace management... Soucek Field), VA, as the air traffic control tower is transitioning from a full time facility to part... DEPARTMENT OF TRANSPORTATION Federal Aviation Administration 14 CFR Part 71 [Docket No. FAA-2013...

  12. 48 CFR 819.7109 - VA review of application.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS VA Mentor-Protégé Program 819.7109 VA review of application. (a) VA OSDBU will review the information to establish the mentor and protégé eligibility and to ensure... charge to apply for the Mentor-Protégé Program. (b) After OSDBU completes its review and provides written...

  13. 38 CFR 1.203 - Information to be reported to VA Police.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... reported to VA Police. 1.203 Section 1.203 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS... be reported to VA Police. Information about actual or possible violations of criminal laws related to... occurs on VA premises, will be reported by VA management officials to the VA police component with...

  14. Poststroke Rehabilitation and Restorative Care Utilization: A Comparison Between VA Community Living Centers and VA-contracted Community Nursing Homes.

    PubMed

    Jia, Huanguang; Pei, Qinglin; Sullivan, Charles T; Cowper Ripley, Diane C; Wu, Samuel S; Bates, Barbara E; Vogel, W Bruce; Bidelspach, Douglas E; Wang, Xinping; Hoffman, Nannette

    2016-03-01

    Effective poststroke rehabilitation care can speed patient recovery and minimize patient functional disabilities. Veterans affairs (VA) community living centers (CLCs) and VA-contracted community nursing homes (CNHs) are the 2 major sources of institutional long-term care for Veterans with stroke receiving care under VA auspices. This study compares rehabilitation therapy and restorative nursing care among Veterans residing in VA CLCs versus those Veterans in VA-contracted CNHs. Retrospective observational. All Veterans diagnosed with stroke, newly admitted to the CLCs or CNHs during the study period who completed at least 2 Minimum Data Set assessments postadmission. The outcomes were numbers of days for rehabilitation therapy and restorative nursing care received by the Veterans during their stays in CLCs or CNHs as documented in the Minimum Data Set databases. For rehabilitation therapy, the CLC Veterans had lower user rates (75.2% vs. 76.4%, P=0.078) and fewer observed therapy days (4.9 vs. 6.4, P<0.001) than CNH Veterans. However, the CLC Veterans had higher adjusted odds for therapy (odds ratio=1.16, P=0.033), although they had fewer average therapy days (coefficient=-1.53±0.11, P<0.001). For restorative nursing care, CLC Veterans had higher user rates (33.5% vs. 30.6%, P<0.001), more observed average care days (9.4 vs. 5.9, P<0.001), higher adjusted odds (odds ratio=2.28, P<0.001), and more adjusted days for restorative nursing care (coefficient=5.48±0.37, P<0.001). Compared with their counterparts at VA-contracted CNHs, Veterans at VA CLCs had fewer average rehabilitation therapy days (both unadjusted and adjusted), but they were significantly more likely to receive restorative nursing care both before and after risk adjustment.

  15. Approximating the Sachdev-Ye-Kitaev model with Majorana wires

    NASA Astrophysics Data System (ADS)

    Chew, Aaron; Essin, Andrew; Alicea, Jason

    The Sachdev-Ye-Kitaev (SYK) model describes a large collection of Majorana fermions coupled via random, `all-to-all' four-fermion interactions. This model enjoys broad interdisciplinary interest because it provides a solvable realization of holography in 0+1 dimensions, exhibits unusual spectral and thermodynamic properties, and shares deep connections to chaos and black holes. We propose a solid-state implementation of the SYK Hamiltonian that employs quantum dots coupled to arrays of topological superconductors hosting Majorana end-states. All-to-all four-Majorana couplings are mediated by interactions in the dot, while the randomness originates from disorder in the hoppings between the Majorana modes and dot levels. Using perturbation theory and explicit numerics, we study the properties of the dot-wire array system under various experimental conditions. Interestingly, our setup not only allows exploration of SYK physics, but also provides a controlled testbed for interaction effects on the topological classification of fermionic phases. Supported by the National Science Foundation (DMR-1341822), Institute for Quantum Information and Matter, and Walter Burke Institute at Caltech. AC gratefully acknowledges support from the Dominic Orr Fellowship.

  16. Dispersive Sachdev-Ye-Kitaev model: Band structure and quantum chaos

    NASA Astrophysics Data System (ADS)

    Zhang, Pengfei

    2017-11-01

    The Sachdev-Ye-Kitaev (SYK) model is a concrete model for a non-Fermi liquid with maximally chaotic behavior in (0 +1 ) dimensions. In order to gain some insights into real materials in higher dimensions where fermions could hop between different sites, here we consider coupling a SYK lattice by constant hopping. We call this the dispersive SYK model. Focusing on (1 +1 ) -dimensional homogeneous hopping, by either tuning the temperature or the relative strength of the random interaction (hopping) and constant hopping, we find a crossover between a dispersive metal to an incoherent metal, where the dynamic exponent z changes from 1 to ∞ . We study the crossover by calculating the spectral function, charge density correlator, and the Lyapunov exponent. We further find the Lyapunov exponent becomes larger when the chemical potential is tuned to approach a van Hove singularity because of the large density of states near the Fermi surface. The effect of the topological nontrivial bands is also discussed.

  17. 78 FR 76412 - Agency Information Collection (VA National Rehabilitation Special Events, Event Registration...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-17

    ... Festival Event Application, VA0929a, b, c, d, e, f, g, h. Type of Review: Revision of an already approved... Age Games, National Veterans Creative Arts Festival, National Veterans TEE Tournament, National...

  18. 78 FR 32126 - VA Dental Insurance Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-29

    ... DEPARTMENT OF VETERANS AFFAIRS 38 CFR Part 17 RIN 2900-AN99 VA Dental Insurance Program AGENCY... its regulations to establish rules and procedures for the VA Dental Insurance Program (VADIP), a pilot program that offers premium-based dental insurance to enrolled veterans and certain survivors and...

  19. 77 FR 12517 - VA Dental Insurance Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-01

    ... DEPARTMENT OF VETERANS AFFAIRS 38 CFR Part 17 RIN 2900-AN99 VA Dental Insurance Program AGENCY... dental insurance to enrolled veterans and certain survivors and dependents of veterans. VA would contract with a private insurer through the Federal contracting process to offer dental insurance, and the...

  20. Factors Related to Attrition from VA Healthcare Use: Findings from the National Survey of Women Veterans

    DTIC Science & Technology

    2013-01-01

    present analysis we draw on aspects of the Andersen Behavioral Model,21 particularly need characteristics (e.g., mental health), as determinants of...converted to number of years ago. Number of years since last VA use was grouped into five-year increments. Statistical Analysis The analytic sample was...healthcare several decades ago. A limitation of our study is that recollections about the decision to discontinue VA care are subject to recall bias

  1. Release of VA Records Relating to HIV. Final rule.

    PubMed

    2017-03-23

    The Department of Veterans Affairs (VA) is amending its medical regulations governing the release of VA medical records. Specifically, VA is eliminating the restriction on sharing a negative test result for the human immunodeficiency virus (HIV) with veterans' outside providers. HIV testing is a common practice today in healthcare and the stigma of testing that may have been seen in the 1980s when HIV was first discovered is no longer prevalent. Continuing to protect negative HIV tests causes delays and an unnecessary burden on veterans when VA tries to share electronic medical information with the veterans' outside providers through electronic health information exchanges. For this same reason, VA will also eliminate restrictions on negative test results of sickle cell anemia. This final rule eliminates the current barriers to electronic medical information exchange.

  2. Validation of the YuWell YE690A upper-arm blood pressure monitor, for clinic use and self-measurement, according to the European Society of Hypertension International Protocol revision 2010.

    PubMed

    Chen, Qi; Lei, Lei; Li, Yan; Wang, Ji-Guang

    2017-10-01

    The present study aimed to evaluate the accuracy of the automated oscillometric upper-arm blood pressure monitor YuWell YE690A for blood pressure measurement according to the International Protocol of the European Society of Hypertension revision 2010. Systolic and diastolic blood pressures were measured sequentially in 33 adult Chinese (12 women, 44.2 years of mean age) using a mercury sphygmomanometer (two observers) and the YE690A device (one supervisor). A total of 99 pairs of comparisons were obtained from 33 participants for judgments in two parts with three grading phases. All the blood pressure requirements were fulfilled. The YuWell YE690A device achieved the targets in part 1 of the validation study. The number of absolute differences between device and observers within 5, 10, and 15 mmHg was 79/99, 96/99, and 97/99, respectively, for systolic blood pressure and 72/99, 95/99, and 98/99, respectively, for diastolic blood pressure. The device also fulfilled the criteria in part 2 of the validation study. Thirty-one and 25 participants for systolic and diastolic blood pressure, respectively, had at least two of the three device-observer differences within 5 mmHg (required ≥24). No participant for systolic and two participants for diastolic blood pressure had all the three device-observer comparisons greater than 5 mmHg. The YuWell blood pressure monitor YE690A has passed the requirements of the International Protocol revision 2010 and hence can be recommended for blood pressure measurement in adults.

  3. 2. Perspective Map of Buena Vista (In Buena Vista, VA, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. Perspective Map of Buena Vista (In Buena Vista, VA, NY:South Publishing Co., 1891 n.p.) (copy on file at Virginia State Library, Richmond, VA) - North River Canal System, West side of Buena Vista, Buena Vista, Roanoke City, VA

  4. Building capacity in VA to provide emergency gynecology services for women.

    PubMed

    Cordasco, Kristina M; Huynh, Alexis K; Zephyrin, Laurie; Hamilton, Alison B; Lau-Herzberg, Amy E; Kessler, Chad S; Yano, Elizabeth M

    2015-04-01

    Visits to Veterans Administration (VA) emergency departments (EDs) are increasingly being made by women. A 2011 national inventory of VA emergency services for women revealed that many EDs have gaps in their resources and processes for gynecologic emergency care. To guide VA in addressing these gaps, we sought to understand factors acting as facilitators and/or barriers to improving VA ED capacity for, and quality of, emergency gynecology care. Semistructured interviews with VA emergency and women's health key informants. ED directors/providers (n=14), ED nurse managers (n=13), and Women Veteran Program Managers (n=13) in 13 VA facilities. Leadership, staff, space, demand, funding, policies, and community were noted as important factors influencing VA EDs building capacity and improving emergency gynecologic care for women Veterans. These factors are intertwined and cross multiple organizational levels so that each ED's capacity is a reflection not only of its own factors, but also those of its local medical center and non-VA community context as well as VA regional and national trends and policies. Policies and quality improvement initiatives aimed at building VA's emergency gynecologic services for women need to be multifactorial and aimed at multiple organizational levels. Policies need to be flexible to account for wide variations across EDs and their medical center and community contexts. Approaches that build and encourage local leadership engagement, such as evidence-based quality improvement methodology, are likely to be most effective.

  5. The NO vA simulation chain

    DOE PAGES

    Aurisano, A.; Backhouse, C.; Hatcher, R.; ...

    2015-12-23

    The NO vA experiment is a two-detector, long-baseline neutrino experiment operating in the recently upgraded NuMI muon neutrino beam. Simulating neutrino interactions and backgrounds requires many steps including: the simulation of the neutrino beam flux using FLUKA and the FLUGG interface, cosmic ray generation using CRY, neutrino interaction modeling using GENIE, and a simulation of the energy deposited in the detector using GEANT4. To shorten generation time, the modeling of detector-specific aspects, such as photon transport, detector and electronics noise, and readout electronics, employs custom, parameterized simulation applications. We will describe the NO vA simulation chain, and present details onmore » the techniques used in modeling photon transport near the ends of cells, and in developing a novel data-driven noise simulation. Due to the high intensity of the NuMI beam, the Near Detector samples a high rate of muons originating in the surrounding rock. In addition, due to its location on the surface at Ash River, MN, the Far Detector collects a large rate ((˜) 140 kHz) of cosmic muons. Furthermore, we will discuss the methods used in NO vA for overlaying rock muons and cosmic ray muons with simulated neutrino interactions and show how realistically the final simulation reproduces the preliminary NO vA data.« less

  6. REACH VA: Moving from Translation to System Implementation.

    PubMed

    Nichols, Linda O; Martindale-Adams, Jennifer; Burns, Robert; Zuber, Jeffrey; Graney, Marshall J

    2016-02-01

    Resources for Enhancing All Caregivers Health in the Department of Veterans Affairs (REACH VA) has been implemented in the VA system as a national program for caregivers. We describe the trajectory of REACH VA from national randomized clinical trial through translation to national implementation. The implementation is examined through the six stages of the Fixsen and Blasé implementation process model: exploration and adoption, program installation, initial implementation, full operation, innovation, and sustainability. Different drivers that move the implementation process forward are important at each stage, including staff selection, staff training, consultation and coaching, staff evaluation, administrative support, program evaluation/fidelity, and systems interventions. Caregivers in the REACH VA 4 session intervention currently implemented in the VA had similar outcomes to longer REACH interventions, including Resources for Enhancing Alzheimer's Caregivers Health (REACH II). Caregivers experienced significant decreases in burden, depression, anxiety, number of troubling patient behaviors reported, caregiving frustrations, stress symptoms (feeling overwhelmed, feeling like crying, being frustrated as a result of caregiving, being lonely), and general stress. Effect sizes (Cohen's d) for these significant variables were between small and medium ranging from .24 to .46. The implementation of REACH VA provides a road map for implementation of other behavioral interventions in health care delivery settings. Lessons learned include the importance of implementing a proven, needed intervention, support from both leadership and clinical staff, willingness to respond to staff and organization needs and modify the intervention while preserving its integrity, and fitting the intervention into ongoing routines and practices. Published by Oxford University Press on behalf of the Gerontological Society of America 2014.

  7. 78 FR 48609 - Safety Zone; James River; Newport News, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-09

    ...-AA00 Safety Zone; James River; Newport News, VA AGENCY: Coast Guard, DHS. ACTION: Temporary final rule...-0670 to read as follows: Sec. 165.T05-0670 Safety Zone, James River, Newport News, VA. (a) Definitions...'11'' N longitude 076[deg]38'40'' W, located near Fort Eustis in Newport News, VA. (c) Regulations. (1...

  8. 33 CFR 80.510 - Chesapeake Bay Entrance, VA.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Chesapeake Bay Entrance, VA. 80.510 Section 80.510 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Fifth District § 80.510 Chesapeake Bay Entrance, VA. A...

  9. 38 CFR 74.27 - How will VA store information?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... (CONTINUED) VETERANS SMALL BUSINESS REGULATIONS Records Management § 74.27 How will VA store information? VA... examination visits will be scanned onto portable media and fully secured in the Center for Veterans Enterprise...

  10. Medical Student Psychiatry Examination Performance at VA and Non-VA Clerkship Sites

    ERIC Educational Resources Information Center

    Tucker, Phebe; von Schlageter, Margo Shultes; Park, EunMi; Rosenberg, Emily; Benjamin, Ashley B.; Nawar, Ola

    2009-01-01

    Objective: The authors examined the effects of medical student assignment to U.S. Department of Veterans Affairs (VA) Medical Center inpatient and outpatient psychiatry clerkship sites versus other university and community sites on the performance outcome measure of National Board of Medical Examiners (NBME) subject examination scores. Methods:…

  11. 78 FR 55777 - Proposed Information Collection (VA, National Veterans Sports Programs and Special Events, Event...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-11

    ... 0928j. o. National Veteran Creative Arts Festival Event Application, VA0929a, b, c, d, e, f, g, h. OMB... Creative Arts Festival, National Veterans TEE Tournament, National Disabled Veterans Winter Sports Clinic...

  12. FACILITIES FOR EDUCATION IN VA HOSPITALS. FINAL REPORT.

    ERIC Educational Resources Information Center

    GREEN, ALAN C.; AND OTHERS

    THIS STUDY WAS AUTHORIZED BY THE VA DEPARTMENT OF MEDICINE AND SURGERY FOR THE PURPOSE OF IDENTIFYING AND DETERMINING THE FACILITIES NEEDED TO PROPERLY HOUSE AND SUPPORT EDUCATION ACTIVITIES IN EXISTING AND FUTURE VA HOSPITALS AND TO PRODUCE ARCHITECTURAL GUIDANCE IN THE DESIGN OF THE FACILITIES. CURRENT PRACTICES AND SIGNIFICANT TRENDS IN MEDICAL…

  13. 48 CFR 852.219-71 - VA mentor-protégé program.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false VA mentor-protégÃ....219-71 VA mentor-protégé program. As prescribed in 819.7115(a), insert the following clause: VA Mentor-Protégé Program (DEC 2009) (a) Large businesses are encouraged to participate in the VA Mentor-Protégé...

  14. Empirical analysis on future-cash arbitrage risk with portfolio VaR

    NASA Astrophysics Data System (ADS)

    Chen, Rongda; Li, Cong; Wang, Weijin; Wang, Ze

    2014-03-01

    This paper constructs the positive arbitrage position by alternating the spot index with Chinese Exchange Traded Fund (ETF) portfolio and estimating the arbitrage-free interval of futures with the latest trade data. Then, an improved Delta-normal method was used, which replaces the simple linear correlation coefficient with tail dependence correlation coefficient, to measure VaR (Value-at-risk) of the arbitrage position. Analysis of VaR implies that the risk of future-cash arbitrage is less than that of investing completely in either futures or spot market. Then according to the compositional VaR and the marginal VaR, we should increase the futures position and decrease the spot position appropriately to minimize the VaR, which can minimize risk subject to certain revenues.

  15. Haemophilia utilization group study - Part Va (HUGS Va): design, methods and baseline data.

    PubMed

    Zhou, Z-Y; Wu, J; Baker, J; Curtis, R; Forsberg, A; Huszti, H; Koerper, M; Lou, M; Miller, R; Parish, K; Riske, B; Shapiro, A; Ullman, M; Johnson, K

    2011-09-01

    To describe the study design, procedures and baseline characteristics of the Haemophilia Utilization Group Study - Part Va (HUGS Va), a US multi-center observational study evaluating the cost of care and burden of illness in persons with factor VIII deficiency. Patients with factor VIII level ≤ 30%, age 2-64 years, receiving treatment at one of six federally supported haemophilia treatment centres (HTCs) were enrolled in the study. Participants completed an initial interview including questions on socio-demographical characteristics, health insurance status, co-morbidities, access to care, haemophilia treatment regimen, factor utilization, self-reported joint pain and motion limitation and health-related quality of life. A periodic follow-up survey collected data regarding time lost from usual activities, disability days, health care utilization and outcomes of care. HTC clinicians documented participants' baseline clinical characteristics and pharmacy dispensing records for 2 years. Between July 2005 and July 2007, 329 participants were enrolled. Average age was 9.7 years for children and 33.5 years for adults; two-thirds had severe haemophilia. The distributions of age, marital status, education level and barriers to haemophilia care were relatively consistent across haemophilic severity categories. Differences were found in participants' employment status, insurance status and income. Overall, children with haemophilia had quality of life scores comparable to healthy counterparts. Adults had significantly lower physical functioning than the general US population. As one of the largest economic studies of haemophilia care, HUGS Va will provide detailed information regarding the burden of illness and health care utilization in the US haemophilia A population. © 2011 Blackwell Publishing Ltd.

  16. Use of VA and Medicare Services By Dually Eligible Veterans with Psychiatric Problems

    PubMed Central

    Carey, Kathleen; Montez-Rath, Maria E; Rosen, Amy K; Christiansen, Cindy L; Loveland, Susan; Ettner, Susan L

    2008-01-01

    Objective To examine how service accessibility measured by geographic distance affects service sector choices for veterans who are dually eligible for veterans affairs (VA) and Medicare services and who are diagnosed with mental health and/or substance abuse (MH/SA) disorders. Data Sources Primary VA data sources were the Patient Treatment (acute care), Extended Care (long-term care), and Outpatient Clinic files. VA cost data were obtained from (1) inpatient and outpatient cost files developed by the VA Health Economics and Resource Center and (2) outpatient VA Decision Support System files. Medicare data sources were the denominator, Medicare Provider Analysis Review (MEDPAR), Provider-of-Service, Outpatient Standard Analytic and Physician/Supplier Standard Analytic files. Additional sources included the Area Resource File and Census Bureau data. Study Design We identified dually eligible veterans who had either an inpatient or outpatient MH/SA diagnosis in the VA system during fiscal year (FY)'99. We then estimated one- and two-part regression models to explain the effects of geographic distance on both VA and Medicare total and MH/SA costs. Principal Findings Results provide evidence for substitution between the VA and Medicare, demonstrating that poorer geographic access to VA inpatient and outpatient clinics decreased VA expenditures but increased Medicare expenditures, while poorer access to Medicare-certified general and psychiatric hospitals decreased Medicare expenditures but increased VA expenditures. Conclusions As geographic distance to VA medical facility increases, Medicare plays an increasingly important role in providing mental health services to veterans. PMID:18355256

  17. Greening America's Capitals - Richmond, VA

    EPA Pesticide Factsheets

    Report from the Greening America's Capitals project in Richmond, VA, to help the city develop design options to protect pedestrians, bicyclists, transit users, and drivers; improve stormwater management; and spur revitalization.

  18. VA Telemedicine: An Analysis of Cost and Time Savings.

    PubMed

    Russo, Jack E; McCool, Ryan R; Davies, Louise

    2016-03-01

    The Veterans Affairs (VA) healthcare system provides beneficiary travel reimbursement ("travel pay") to qualifying patients for traveling to appointments. Travel pay is a large expense for the VA and hence the U.S. Government, projected to cost nearly $1 billion in 2015. Telemedicine in the VA system has the potential to save money by reducing patient travel and thus the amount of travel pay disbursed. In this study, we quantify this savings and also report trends in VA telemedicine volumes over time. All telemedicine visits based at the VA Hospital in White River Junction, VT between 2005 and 2013 were reviewed (5,695 visits). Travel distance and time saved as a result of telemedicine were calculated. Clinical volume in the mental health department, which has had the longest participation in telemedicine, was analyzed. Telemedicine resulted in an average travel savings of 145 miles and 142 min per visit. This led to an average travel payment savings of $18,555 per year. Telemedicine volume grew significantly over the study period such that by the final year the travel pay savings had increased to $63,804, or about 3.5% of the total travel pay disbursement for that year. The number of mental health telemedicine visits rose over the study period but remained small relative to the number of face-to-face visits. A higher proportion of telemedicine visits involved new patients. Telemedicine at the VA saves travel distance and time, although the reduction in travel payments remains modest at current telemedicine volumes.

  19. 77 FR 58773 - Drawbridge Operation Regulations; James River, Newport News, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-24

    ... Operation Regulations; James River, Newport News, VA AGENCY: Coast Guard, DHS. ACTION: Notice of temporary... schedule that governs the US 17/258 Bridge across the James River, mile 5.0, at Newport News, VA. The... 17/258 Bridge over the James River, mile 5.0, at Newport News, VA opens on signal as required by 33...

  20. Community Veterans' Decision to Use VA Services: A Multimethod Veteran Health Partnership Study.

    PubMed

    Franco, Zeno E; Logan, Clinton; Flower, Mark; Curry, Bob; Ruffalo, Leslie; Brazauskas, Ruta; Whittle, Jeff

    2016-01-01

    Ensuring veterans' access to healthcare is a national priority. Prior studies of veterans' use of Veterans Health Administration (VA) healthcare have had limited success in evaluating barriers to access for certain vulnerable veteran subpopulations. Our coalition of researchers and veteran community members sought to understand factors affecting use of VA, particularly for those less likely to participate in traditional survey studies. We recruited 858 veterans to complete a collaboratively designed survey at community events or via social media. We compared our results regarding VA use with the 2010 National Survey of Veterans (NSV) using chi-square tests, multiple logistic regression to identify predictors of VA use, and content analysis for open-ended descriptions of barriers to VA use. Veterans in our study were more likely than NSV respondents to report using VA healthcare ever (76% vs. 28%; p<0.0001). Within this group, more veterans in our sample were current VA users (83% vs. 68%; p<0.0001). In multivariable analysis, VA use was predicted by self-reported physical problems (comparing "a lot" vs. "none" for each variable, adjusted odds ratio [OR], 8.35), thinking problems (OR, 1.14), need for smoking cessation (OR, 1.54), need for pain management (OR, 1.65), and need for other mental health services (OR, 3.04). We identified 15 themes summarizing veterans' perceived barriers to VA use. Persistent actual and perceived barriers prevent some veterans from using VA services. The VA can better understand and address these issues through community-academic partnerships with veterans' organizations.

  1. 38 CFR 74.27 - How will VA store information?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... information? 74.27 Section 74.27 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) VETERANS SMALL BUSINESS REGULATIONS Records Management § 74.27 How will VA store information? VA intends to store records provided to complete the VetBiz Vendor Information Pages registration fully...

  2. 38 CFR 74.27 - How will VA store information?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... information? 74.27 Section 74.27 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) VETERANS SMALL BUSINESS REGULATIONS Records Management § 74.27 How will VA store information? VA intends to store records provided to complete the VetBiz Vendor Information Pages registration fully...

  3. 38 CFR 74.27 - How will VA store information?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... information? 74.27 Section 74.27 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) VETERANS SMALL BUSINESS REGULATIONS Records Management § 74.27 How will VA store information? VA intends to store records provided to complete the VetBiz Vendor Information Pages registration fully...

  4. 38 CFR 74.27 - How will VA store information?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... information? 74.27 Section 74.27 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) VETERANS SMALL BUSINESS REGULATIONS Records Management § 74.27 How will VA store information? VA intends to store records provided to complete the VetBiz Vendor Information Pages registration fully...

  5. Factors related to attrition from VA healthcare use: findings from the National Survey of Women Veterans.

    PubMed

    Hamilton, Alison B; Frayne, Susan M; Cordasco, Kristina M; Washington, Donna L

    2013-07-01

    While prior research characterizes women Veterans' barriers to accessing and using Veterans Health Administration (VA) care, there has been little attention to women who access VA and use services, but then discontinue use. Recent data suggest that among women Veterans, there is a 30 % attrition rate within 3 years of initial VA use. To compare individual characteristics and perceptions about VA care between women Veteran VA attriters (those who discontinue use) and non-attriters (those who continue use), and to compare recent versus remote attriters. Cross-sectional, population-based 2008-2009 national telephone survey. Six hundred twenty-six attriters and 2,065 non-attriters who responded to the National Survey of Women Veterans. Population weighted demographic, military and health characteristics; perceptions about VA healthcare; length of time since last VA use; among attriters, reasons for no longer using VA care. Fifty-four percent of the weighted VA ever user population reported that they no longer use VA. Forty-five percent of attrition was within the past ten years. Attriters had better overall health (p = 0.007), higher income (p < 0.001), and were more likely to have health insurance (p < 0.001) compared with non-attriters. Attriters had less positive perceptions of VA than non-attriters, with attriters having lower ratings of VA quality and of gender-specific features of VA care (p < 0.001). Women Veterans who discontinued VA use since 2001 did not differ from those with more remote VA use on most measures of VA perceptions. Overall, among attriters, distance to VA sites of care and having alternate insurance coverage were the most common reasons for discontinuing VA use. We found high VA attrition despite recent advances in VA care for women Veterans. Women's attrition from VA could reduce the critical mass of women Veterans in VA and affect current system-wide efforts to provide high-quality care for women Veterans. An understanding of reasons for

  6. Impact of the REACH II and REACH VA Dementia Caregiver Interventions on Healthcare Costs.

    PubMed

    Nichols, Linda O; Martindale-Adams, Jennifer; Zhu, Carolyn W; Kaplan, Erin K; Zuber, Jeffrey K; Waters, Teresa M

    2017-05-01

    Examine caregiver and care recipient healthcare costs associated with caregivers' participation in Resources for Enhancing Alzheimer's Caregivers Health (REACH II or REACH VA) behavioral interventions to improve coping skills and care recipient management. RCT (REACH II); propensity-score matched, retrospective cohort study (REACH VA). Five community sites (REACH II); 24 VA facilities (REACH VA). Care recipients with Alzheimer's disease and related dementias (ADRD) and their caregivers who participated in REACH II study (analysis sample of 110 caregivers and 197 care recipients); care recipients whose caregivers participated in REACH VA and a propensity matched control group (analysis sample of 491). Previously collected data plus Medicare expenditures (REACH II) and VA costs plus Medicare expenditures (REACH VA). There was no increase in VA or Medicare expenditures for care recipients or their caregivers who participated in either REACH intervention. For VA care recipients, REACH was associated with significantly lower total VA costs of care (33.6%). VA caregiver cost data was not available. In previous research, both REACH II and REACH VA have been shown to provide benefit for dementia caregivers at a cost of less than $5/day; however, concerns about additional healthcare costs may have hindered REACH's widespread adoption. Neither REACH intervention was associated with additional healthcare costs for caregivers or patients; in fact, for VA patients, there were significantly lower healthcare costs. The VA costs savings may be related to the addition of a structured format for addressing the caregiver's role in managing complex ADRD care to an existing, integrated care system. These findings suggest that behavioral interventions are a viable mechanism to support burdened dementia caregivers without additional healthcare costs. © 2017, Copyright the Authors Journal compilation © 2017, The American Geriatrics Society.

  7. Comparing VA and private sector healthcare costs for end-stage renal disease.

    PubMed

    Hynes, Denise M; Stroupe, Kevin T; Fischer, Michael J; Reda, Domenic J; Manning, Willard; Browning, Margaret M; Huo, Zhiping; Saban, Karen; Kaufman, James S

    2012-02-01

    Healthcare for end-stage renal disease (ESRD) is intensive, expensive, and provided in both the public and private sector. Using a societal perspective, we examined healthcare costs and health outcomes for Department of Veterans Affairs (VA) ESRD patients comparing those who received hemodialysis care at VA versus private sector facilities. Dialysis patients were recruited from 8 VA medical centers from 2001 through 2003 and followed for 12 months in a prospective cohort study. Patient demographics, clinical characteristics, quality of life, healthcare use, and cost data were collected. Healthcare data included utilization (VA), claims (Medicare), and patient self-report. Costs included VA calculated costs, Medicare dialysis facility reports and reimbursement rates, and patient self-report. Multivariable regression was used to compare costs between patients receiving dialysis at VA versus private sector facilities. The cohort comprised 334 patients: 170 patients in the VA dialysis group and 164 patients in the private sector group. The VA dialysis group had more comorbidities at baseline, outpatient and emergency visits, prescriptions, and longer hospital stays; they also had more conservative anemia management and lower baseline urea reduction ratio (67% vs. 72%; P<0.001), although levels were consistent with guidelines (Kt/V≥1.2). In adjusted analysis, the VA dialysis group had $36,431 higher costs than those in the private sector dialysis group (P<0.001). Continued research addressing costs and effectiveness of care across public and private sector settings is critical in informing health policy options for patients with complex chronic illnesses such as ESRD.

  8. 32 CFR 105.10 - SARC and SAPR VA procedures.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... CIVILIAN SEXUAL ASSAULT PREVENTION AND RESPONSE PROGRAM PROCEDURES § 105.10 SARC and SAPR VA procedures. (a) SARC procedures. The SARC shall: (1) Serve as the single point of contact to coordinate sexual assault response when a sexual assault is reported. All SARCs shall be authorized to perform VA duties in...

  9. 32 CFR 105.10 - SARC and SAPR VA procedures.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... CIVILIAN SEXUAL ASSAULT PREVENTION AND RESPONSE PROGRAM PROCEDURES § 105.10 SARC and SAPR VA procedures. (a) SARC procedures. The SARC shall: (1) Serve as the single point of contact to coordinate sexual assault response when a sexual assault is reported. All SARCs shall be authorized to perform VA duties in...

  10. 48 CFR 852.219-9 - VA Small business subcontracting plan minimum requirements.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false VA Small business... Provisions and Clauses 852.219-9 VA Small business subcontracting plan minimum requirements. As prescribed in subpart 819.709, insert the following clause: VA Small Business Subcontracting Plan Minimum Requirements...

  11. 48 CFR 852.219-9 - VA Small business subcontracting plan minimum requirements.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false VA Small business... Provisions and Clauses 852.219-9 VA Small business subcontracting plan minimum requirements. As prescribed in subpart 819.709, insert the following clause: VA Small Business Subcontracting Plan Minimum Requirements...

  12. 48 CFR 852.219-9 - VA Small business subcontracting plan minimum requirements.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 5 2011-10-01 2011-10-01 false VA Small business... Provisions and Clauses 852.219-9 VA Small business subcontracting plan minimum requirements. As prescribed in subpart 819.709, insert the following clause: VA Small Business Subcontracting Plan Minimum Requirements...

  13. 48 CFR 852.219-9 - VA Small business subcontracting plan minimum requirements.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false VA Small business... Provisions and Clauses 852.219-9 VA Small business subcontracting plan minimum requirements. As prescribed in subpart 819.709, insert the following clause: VA Small Business Subcontracting Plan Minimum Requirements...

  14. 48 CFR 852.219-9 - VA Small business subcontracting plan minimum requirements.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false VA Small business... Provisions and Clauses 852.219-9 VA Small business subcontracting plan minimum requirements. As prescribed in subpart 819.709, insert the following clause: VA Small Business Subcontracting Plan Minimum Requirements...

  15. 33 CFR 110.166 - York River, Va., naval anchorage.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.166 York River, Va., naval anchorage. (a) The anchorage grounds. Between Yorktown and the Naval Mine Depot, beginning at latitude 37°15′34″, longitude 76... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false York River, Va., naval anchorage...

  16. 33 CFR 110.166 - York River, Va., naval anchorage.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.166 York River, Va., naval anchorage. (a) The anchorage grounds. Between Yorktown and the Naval Mine Depot, beginning at latitude 37°15′34″, longitude 76... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false York River, Va., naval anchorage...

  17. 33 CFR 110.166 - York River, Va., naval anchorage.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.166 York River, Va., naval anchorage. (a) The anchorage grounds. Between Yorktown and the Naval Mine Depot, beginning at latitude 37°15′34″, longitude 76... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false York River, Va., naval anchorage...

  18. 33 CFR 110.166 - York River, Va., naval anchorage.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.166 York River, Va., naval anchorage. (a) The anchorage grounds. Between Yorktown and the Naval Mine Depot, beginning at latitude 37°15′34″, longitude 76... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false York River, Va., naval anchorage...

  19. 33 CFR 110.166 - York River, Va., naval anchorage.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.166 York River, Va., naval anchorage. (a) The anchorage grounds. Between Yorktown and the Naval Mine Depot, beginning at latitude 37°15′34″, longitude 76... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false York River, Va., naval anchorage...

  20. Identifying Homelessness among Veterans Using VA Administrative Data: Opportunities to Expand Detection Criteria.

    PubMed

    Peterson, Rachel; Gundlapalli, Adi V; Metraux, Stephen; Carter, Marjorie E; Palmer, Miland; Redd, Andrew; Samore, Matthew H; Fargo, Jamison D

    2015-01-01

    Researchers at the U.S. Department of Veterans Affairs (VA) have used administrative criteria to identify homelessness among U.S. Veterans. Our objective was to explore the use of these codes in VA health care facilities. We examined VA health records (2002-2012) of Veterans recently separated from the military and identified as homeless using VA conventional identification criteria (ICD-9-CM code V60.0, VA specific codes for homeless services), plus closely allied V60 codes indicating housing instability. Logistic regression analyses examined differences between Veterans who received these codes. Health care services and co-morbidities were analyzed in the 90 days post-identification of homelessness. VA conventional criteria identified 21,021 homeless Veterans from Operations Enduring Freedom, Iraqi Freedom, and New Dawn (rate 2.5%). Adding allied V60 codes increased that to 31,260 (rate 3.3%). While certain demographic differences were noted, Veterans identified as homeless using conventional or allied codes were similar with regards to utilization of homeless, mental health, and substance abuse services, as well as co-morbidities. Differences were noted in the pattern of usage of homelessness-related diagnostic codes in VA facilities nation-wide. Creating an official VA case definition for homelessness, which would include additional ICD-9-CM and other administrative codes for VA homeless services, would likely allow improved identification of homeless and at-risk Veterans. This also presents an opportunity for encouraging uniformity in applying these codes in VA facilities nationwide as well as in other large health care organizations.

  1. Identifying Homelessness among Veterans Using VA Administrative Data: Opportunities to Expand Detection Criteria

    PubMed Central

    Peterson, Rachel; Gundlapalli, Adi V.; Metraux, Stephen; Carter, Marjorie E.; Palmer, Miland; Redd, Andrew; Samore, Matthew H.; Fargo, Jamison D.

    2015-01-01

    Researchers at the U.S. Department of Veterans Affairs (VA) have used administrative criteria to identify homelessness among U.S. Veterans. Our objective was to explore the use of these codes in VA health care facilities. We examined VA health records (2002-2012) of Veterans recently separated from the military and identified as homeless using VA conventional identification criteria (ICD-9-CM code V60.0, VA specific codes for homeless services), plus closely allied V60 codes indicating housing instability. Logistic regression analyses examined differences between Veterans who received these codes. Health care services and co-morbidities were analyzed in the 90 days post-identification of homelessness. VA conventional criteria identified 21,021 homeless Veterans from Operations Enduring Freedom, Iraqi Freedom, and New Dawn (rate 2.5%). Adding allied V60 codes increased that to 31,260 (rate 3.3%). While certain demographic differences were noted, Veterans identified as homeless using conventional or allied codes were similar with regards to utilization of homeless, mental health, and substance abuse services, as well as co-morbidities. Differences were noted in the pattern of usage of homelessness-related diagnostic codes in VA facilities nation-wide. Creating an official VA case definition for homelessness, which would include additional ICD-9-CM and other administrative codes for VA homeless services, would likely allow improved identification of homeless and at-risk Veterans. This also presents an opportunity for encouraging uniformity in applying these codes in VA facilities nationwide as well as in other large health care organizations. PMID:26172386

  2. A Role for Myosin Va in Human Cytomegalovirus Nuclear Egress.

    PubMed

    Wilkie, Adrian R; Sharma, Mayuri; Pesola, Jean M; Ericsson, Maria; Fernandez, Rosio; Coen, Donald M

    2018-03-15

    Herpesviruses replicate and package their genomes into capsids in replication compartments within the nuclear interior. Capsids then move to the inner nuclear membrane for envelopment and release into the cytoplasm in a process called nuclear egress. We previously found that nuclear F-actin is induced upon infection with the betaherpesvirus human cytomegalovirus (HCMV) and is important for nuclear egress and capsid localization away from replication compartment-like inclusions toward the nuclear rim. Despite these and related findings, it has not been shown that any specific motor protein is involved in herpesvirus nuclear egress. In this study, we have investigated whether the host motor protein, myosin Va, could be fulfilling this role. Using immunofluorescence microscopy and coimmunoprecipitation, we observed associations between a nuclear population of myosin Va and the viral major capsid protein, with both concentrating at the periphery of replication compartments. Immunoelectron microscopy showed that nearly 40% of assembled nuclear capsids associate with myosin Va. We also found that myosin Va and major capsid protein colocalize with nuclear F-actin. Importantly, antagonism of myosin Va with RNA interference or a dominant negative mutant revealed that myosin Va is important for the efficient production of infectious virus, capsid accumulation in the cytoplasm, and capsid localization away from replication compartment-like inclusions toward the nuclear rim. Our results lead us to suggest a working model whereby human cytomegalovirus capsids associate with myosin Va for movement from replication compartments to the nuclear periphery during nuclear egress. IMPORTANCE Little is known regarding how newly assembled and packaged herpesvirus capsids move from the nuclear interior to the periphery during nuclear egress. While it has been proposed that an actomyosin-based mechanism facilitates intranuclear movement of alphaherpesvirus capsids, a functional role for

  3. (4015) 1979 VA: 'Missing Link' Discovered

    NASA Technical Reports Server (NTRS)

    Helin, Eleanor F.

    1993-01-01

    Apollo Asteroid (4015) 1979 VA was discovered in November of 1979 by Helin at Palomar with the 0.46m Schmidt Telescope. It's orbital elements immediately indicated a possible cometary origin. With an extremely eccentric orbit, it approaches the orbit of Jupiter (at the time, the largest 'Q', aphelion, of any known near-Earth asteroid). Physical observations acquired during the discovery apparition suggested that it was carbonaceous in nature. Research into prediscovery observations of Near-Earth Asteroids (Bowell et. al., 1992) has located Palomar Sky Survey photographic plates taken in 1949 observations of (4015) 1979 VA, not as an asteroid, but rather a small cometary image (IAU Circular Nos. 5585 and 5586, August 13, 1992)...

  4. 30 CFR 57.22309 - Methane monitors (V-A mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Methane monitors (V-A mines). 57.22309 Section... Standards for Methane in Metal and Nonmetal Mines Equipment § 57.22309 Methane monitors (V-A mines). (a) Methane monitors shall be installed on continuous mining machines used in or beyond the last open crosscut...

  5. 30 CFR 57.22309 - Methane monitors (V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Methane monitors (V-A mines). 57.22309 Section... Standards for Methane in Metal and Nonmetal Mines Equipment § 57.22309 Methane monitors (V-A mines). (a) Methane monitors shall be installed on continuous mining machines used in or beyond the last open crosscut...

  6. Flexural Stiffness of Myosin Va Subdomains as Measured from Tethered Particle Motion

    PubMed Central

    Michalek, Arthur J.; Kennedy, Guy G.; Warshaw, David M.; Ali, M. Yusuf

    2015-01-01

    Myosin Va (MyoVa) is a processive molecular motor involved in intracellular cargo transport on the actin cytoskeleton. The motor's processivity and ability to navigate actin intersections are believed to be governed by the stiffness of various parts of the motor's structure. Specifically, changes in calcium may regulate motor processivity by altering the motor's lever arm stiffness and thus its interhead communication. In order to measure the flexural stiffness of MyoVa subdomains, we use tethered particle microscopy, which relates the Brownian motion of fluorescent quantum dots, which are attached to various single- and double-headed MyoVa constructs bound to actin in rigor, to the motor's flexural stiffness. Based on these measurements, the MyoVa lever arm and coiled-coil rod domain have comparable flexural stiffness (0.034 pN/nm). Upon addition of calcium, the lever arm stiffness is reduced 40% as a result of calmodulins potentially dissociating from the lever arm. In addition, the flexural stiffness of the full-length MyoVa construct is an order of magnitude less stiff than both a single lever arm and the coiled-coil rod. This suggests that the MyoVa lever arm-rod junction provides a flexible hinge that would allow the motor to maneuver cargo through the complex intracellular actin network. PMID:26770194

  7. Home health care and patterns of subsequent VA and medicare health care utilization for veterans.

    PubMed

    Van Houtven, Courtney Harold; Jeffreys, Amy S; Coffman, Cynthia J

    2008-10-01

    The Veterans Affairs or VA health care system is in the process of significantly expanding home health care (HHC) nationwide. We describe VA HHC use in 2003 for all VA HHC users from 2002; we examine whether VA utilization across a broad spectrum of services differed for a sample of VA HHC users and their propensity-score-matched controls. We also consider crossover between the VA and Medicare. This is a retrospective study using propensity score and stratified analysis to control for selection bias on observable characteristics. We examined the full cohort of 2002 VA HHC users (n = 24,169) and a 2:1 sample of age- and race-based nonusers (n = 53,356). Utilization measures included VA and Medicare outpatient, inpatient, nursing home, and hospice use, as well as VA home-based primary care, respite care, and adult day health care. VA HHC users had a higher absolute probability of outpatient use by around 3%, of inpatient use by 12%, and nursing home use by 6% than their propensity-score-matched controls. Veterans who used HHC services had a higher rate of VA service use in the subsequent year than controls did, even after we adjusted for differences in observed health status, eligibility advantages, and supplemental insurance status. High utilization for VA home health users spilled over into high Medicare utilization.

  8. Home Health Care and Patterns of Subsequent VA and Medicare Health Care Utilization for Veterans

    ERIC Educational Resources Information Center

    Van Houtven, Courtney Harold; Jeffreys, Amy S.; Coffman, Cynthia J.

    2008-01-01

    Purpose: The Veterans Affairs or VA health care system is in the process of significantly expanding home health care (HOC) nationwide. We describe VA HHC use in 2003 for all VA HHC users from 2002; we examine whether VA utilization across a broad spectrum of services differed for a sample of VA HHC users and their propensity-score-matched…

  9. 48 CFR 803.7000 - Display of the VA Hotline poster.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... poster. 803.7000 Section 803.7000 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS... Improper Business Practices 803.7000 Display of the VA Hotline poster. (a) Under the circumstances described in paragraph (b) of this section, a contractor must display prominently a VA Hotline poster...

  10. 48 CFR 803.7000 - Display of the VA Hotline poster.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... poster. 803.7000 Section 803.7000 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS... Improper Business Practices 803.7000 Display of the VA Hotline poster. (a) Under the circumstances described in paragraph (b) of this section, a contractor must display prominently a VA Hotline poster...

  11. 48 CFR 803.7000 - Display of the VA Hotline poster.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... poster. 803.7000 Section 803.7000 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS... Improper Business Practices 803.7000 Display of the VA Hotline poster. (a) Under the circumstances described in paragraph (b) of this section, a contractor must display prominently a VA Hotline poster...

  12. 48 CFR 803.7000 - Display of the VA Hotline poster.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... poster. 803.7000 Section 803.7000 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS... Improper Business Practices 803.7000 Display of the VA Hotline poster. (a) Under the circumstances described in paragraph (b) of this section, a contractor must display prominently a VA Hotline poster...

  13. 48 CFR 803.7000 - Display of the VA Hotline poster.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... poster. 803.7000 Section 803.7000 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS... Improper Business Practices 803.7000 Display of the VA Hotline poster. (a) Under the circumstances described in paragraph (b) of this section, a contractor must display prominently a VA Hotline poster...

  14. 77 FR 38181 - VA Veteran-Owned Small Business Verification Guidelines

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-27

    ... DEPARTMENT OF VETERANS AFFAIRS 38 CFR Part 74 RIN 2900-AO49 VA Veteran-Owned Small Business... small businesses (VOSBs), including service-disabled veteran-owned small businesses (SDVOSBs) in order...- AO49--VA Veteran-Owned Small Business Verification Guidelines.'' All comments received will be...

  15. 78 FR 56271 - FY 2014-2020 Draft VA Strategic Plan

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-12

    ... and access to benefits and services through integration within VA and with our partners; and... integration within VA and with our partners; and developing our workforce with the skills, tools, and... program to coordination and integration across programs and organizations, measuring performance by the...

  16. JPRS Report, Science & Technology, USSR: Science & Technology Policy

    DTIC Science & Technology

    1990-05-31

    SERVICE SPRINGFIELD, VA. 22161 DTTC QUALITY INSPECTED t Science & Technology USSR: Science & Technology Policy JPRS-UST-90-006 CONTENTS 31 May...64 Uzbek Central Committee Examines S& T Cadre Problem [PRAVDA VOSTOKA, 27Feb 90] 65 Miscellaneous Scientists Comment on Compensation, Contract...Expositions POISK Commentary on February S& T Conference [V. Oshchenko, Ye. Ponarina; POISK, 22-28 Feb 90] 77 Conference Sets Policy for Future S& T

  17. 38 CFR 26.7 - VA environmental decision making and documents.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... environmental decision making and documents. (a) Relevant environmental documents shall accompany other decision documents as they proceed through the decision-making process. (b) The major decision points for VA actions... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false VA environmental decision...

  18. 38 CFR 26.9 - Information on and public participation in VA environmental process.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... participation in VA environmental process. 26.9 Section 26.9 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) ENVIRONMENTAL EFFECTS OF THE DEPARTMENT OF VETERANS AFFAIRS (VA) ACTIONS § 26.9 Information on and public participation in VA environmental process. (a) During the...

  19. Case-mix groups for VA hospital-based home care.

    PubMed

    Smith, M E; Baker, C R; Branch, L G; Walls, R C; Grimes, R M; Karklins, J M; Kashner, M; Burrage, R; Parks, A; Rogers, P

    1992-01-01

    The purpose of this study is to group hospital-based home care (HBHC) patients homogeneously by their characteristics with respect to cost of care to develop alternative case mix methods for management and reimbursement (allocation) purposes. Six Veterans Affairs (VA) HBHC programs in Fiscal Year (FY) 1986 that maximized patient, program, and regional variation were selected, all of which agreed to participate. All HBHC patients active in each program on October 1, 1987, in addition to all new admissions through September 30, 1988 (FY88), comprised the sample of 874 unique patients. Statistical methods include the use of classification and regression trees (CART software: Statistical Software; Lafayette, CA), analysis of variance, and multiple linear regression techniques. The resulting algorithm is a three-factor model that explains 20% of the cost variance (R2 = 20%, with a cross validation R2 of 12%). Similar classifications such as the RUG-II, which is utilized for VA nursing home and intermediate care, the VA outpatient resource allocation model, and the RUG-HHC, utilized in some states for reimbursing home health care in the private sector, explained less of the cost variance and, therefore, are less adequate for VA home care resource allocation.

  20. Semi-nonparametric VaR forecasts for hedge funds during the recent crisis

    NASA Astrophysics Data System (ADS)

    Del Brio, Esther B.; Mora-Valencia, Andrés; Perote, Javier

    2014-05-01

    The need to provide accurate value-at-risk (VaR) forecasting measures has triggered an important literature in econophysics. Although these accurate VaR models and methodologies are particularly demanded for hedge fund managers, there exist few articles specifically devoted to implement new techniques in hedge fund returns VaR forecasting. This article advances in these issues by comparing the performance of risk measures based on parametric distributions (the normal, Student’s t and skewed-t), semi-nonparametric (SNP) methodologies based on Gram-Charlier (GC) series and the extreme value theory (EVT) approach. Our results show that normal-, Student’s t- and Skewed t- based methodologies fail to forecast hedge fund VaR, whilst SNP and EVT approaches accurately success on it. We extend these results to the multivariate framework by providing an explicit formula for the GC copula and its density that encompasses the Gaussian copula and accounts for non-linear dependences. We show that the VaR obtained by the meta GC accurately captures portfolio risk and outperforms regulatory VaR estimates obtained through the meta Gaussian and Student’s t distributions.

  1. 78 FR 71041 - VA Compensation and Pension Regulation Rewrite Project

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-27

    ...The Department of Veterans Affairs (VA) proposes to reorganize and rewrite its compensation and pension regulations in a logical, claimant-focused, and user-friendly format. The intended effect of the proposed revisions is to assist claimants, beneficiaries, veterans' representatives, and VA personnel in locating and understanding these regulations.

  2. 38 CFR 17.66 - Notice of noncompliance with VA standards.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... AFFAIRS MEDICAL Community Residential Care § 17.66 Notice of noncompliance with VA standards. If the hearing official determines that an approved community residential care facility does not comply with the... standards must be met in order to avoid revocation of VA approval; (c) The community residential care...

  3. Comparative pharmacokinetics of swertiamarin in rats after oral administration of swertiamarin alone, Qing Ye Dan tablets and co-administration of swertiamarin and oleanolic acid.

    PubMed

    Xu, Gui-li; Li, Hong-liang; He, Jian-chang; Feng, En-fu; Shi, Pan-pan; Liu, Yue-qiong; Liu, Chang-xiao

    2013-08-26

    Qing Ye Dan is a well-known herbal drug that is widely used to treat viral hepatitis in the Yi and Hani minority regions in the Yunnan province of China. An LC-MS/MS method was developed to determine the levels of swertiamarin in rat plasma. Swertiamarin and naringin (internal standard, IS) were extracted from rat plasma using solid-phase extraction (SPE) to purify the samples. The pharmacokinetics of the following different administration methods of swertiamarin in rats were studied: oral administration of swertiamarin alone, a Qing Ye Dan tablet (QYDT) and co-administration of swertiamarin and oleanolic acid, with each method delivering approximately 20mg/kg of swertiamarin. Non-compartmental pharmacokinetic profiles were constructed by using the software DAS (version 2.1.1), and the pharmacokinetic parameters were compared using an unpaired Student's t-test. The results showed that the pharmacokinetic parameters Cmax, AUC0-∞, Vz/F and CLz/F were significantly different (P<0.05) among the three types of swertiamarin administration. The data indicate that oleanolic acid and the other ingredients present in QYDT could affect the pharmacokinetic behaviour of swertiamarin in rats. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  4. 78 FR 26250 - Payment for Home Health Services and Hospice Care to Non-VA Providers

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-06

    ... Hospice Care to Non-VA Providers AGENCY: Department of Veterans Affairs. ACTION: Final rule. SUMMARY: The Department of Veterans Affairs (VA) amends its regulations concerning the billing methodology for non-VA... billing methodology for non-VA providers of home health services and hospice care. The proposed rulemaking...

  5. Identification of VaD and AD prodromes: the Cache County Study.

    PubMed

    Hayden, K M; Warren, L H; Pieper, C F; Østbye, T; Tschanz, J T; Norton, M C; Breitner, J C S; Welsh-Bohmer, K A

    2005-07-01

    It is unclear whether vascular dementia (VaD) has a cognitive prodrome, akin to the mild cognitive impairment (MCI) prodrome to Alzheimer's dementia (AD). To evaluate whether VaD has a cognitive prodrome, and if it can be differentiated from prodromal AD, we examined neuropsychological test performance of participants in a nested case-control study within a population-based cohort aged 65 or older. Participants (n = 485) were identified from the Cache County Study, a large population-based study of aging and dementia. After an average of 3 years of follow-up, a total of 62 incident dementia cases were identified (14 VaD, 48 AD). We identified a number of neuropsychological tests (executive and memory) that discriminated between diagnosed VaD and AD cases. Multivariate analyses sought to differentiate between these same groups 3 years before clinical diagnosis. The Consortium to Establish a Registry for Alzheimer's Disease Word List Recognition Test correct recognition of foils (mean difference, 1.25; 95% confidence interval [CI], 0.42 to 2.07; p < 0.01), Logical Memory I (mean difference, 7.16; 95% CI, 0.78 to 13.55, p < 0.05), Logical Memory II delayed recall (mean difference, 8.67; 95% CI, 1.59 to 15.74, p < 0.05), and percent savings (mean difference, 51.07; 95% CI, 32.58 to 69.56, p < 0.0001) differentiated VaD from AD cases after adjustment for age, sex, education, and dementia severity. Three years before dementia diagnosis, word list recognition ("no" responses mean difference, 1.40; 95% CI, 0.64 to 2.17; p < 0.001, and "yes" responses mean difference, -1.14; 95% CI, -2.14 to -0.13; p < 0.03) discriminated between prodromal VaD and AD. These results suggest that VaD has a prodromal syndrome, the cognitive features of which are distinguishable from the cognitive prodrome of AD.

  6. 76 FR 63357 - VA National Academic Affiliations Council; Notice of Establishment

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-12

    ... DEPARTMENT OF VETERANS AFFAIRS VA National Academic Affiliations Council; Notice of Establishment... Academic Affiliations Council. The Secretary of Veterans Affairs has determined that establishing the... Secretary for Health on matters affecting partnerships between VA and its academic affiliates. The Council...

  7. An overview of patient safety climate in the VA.

    PubMed

    Hartmann, Christine W; Rosen, Amy K; Meterko, Mark; Shokeen, Priti; Zhao, Shibei; Singer, Sara; Falwell, Alyson; Gaba, David M

    2008-08-01

    To assess variation in safety climate across VA hospitals nationally. Data were collected from employees at 30 VA hospitals over a 6-month period using the Patient Safety Climate in Healthcare Organizations survey. We sampled 100 percent of senior managers and physicians and a random 10 percent of other employees. At 10 randomly selected hospitals, we sampled an additional 100 percent of employees working in units with intrinsically higher hazards (high-hazard units [HHUs]). Data were collected using an anonymous survey design. We received 4,547 responses (49 percent response rate). The percent problematic response--lower percent reflecting higher levels of patient safety climate--ranged from 12.0-23.7 percent across hospitals (mean=17.5 percent). Differences in safety climate emerged by management level, clinician status, and workgroup. Supervisors and front-line staff reported lower levels of safety climate than senior managers; clinician responses reflected lower levels of safety climate than those of nonclinicians; and responses of employees in HHUs reflected lower levels of safety climate than those of workers in other areas. This is the first systematic study of patient safety climate in VA hospitals. Findings indicate an overall positive safety climate across the VA, but there is room for improvement.

  8. VA Health Care: VA Spends Millions on Post-Traumatic Stress Disorder Research and Incorporates Research Outcomes into Guidelines and Policy for Post-Traumatic Stress Disorder Services

    DTIC Science & Technology

    2011-01-01

    post - traumatic stress disorder ( PTSD ) and...Veterans Affairs (VA) Intramural Post - Traumatic Stress Disorder ( PTSD ) Research Funding and VA’s Medical and Prosthetic Research Appropriation...Table 6: Department of Veterans Affairs (VA) Research Centers and Programs That Conduct or Support Post - Traumatic Stress Disorder ( PTSD ) Research

  9. Running Head: Evaluation of Contract Versus VA-Staffed CBOCs. Evaluating Contract versus VA-Staffed Community Based Outpatient Clinics (CBOCs) Using Patient Satisfaction and Access Measures in the Veterans Health Administration

    DTIC Science & Technology

    2009-06-01

    Contract versus VA-Staffed Community Based Outpatient Clinics (CBOCS) Using Patient Satisfaction and Access Measures in the Veterans Health ...Administration 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Belote, Janna, M., Civilian - Veterans Health Administration 5d. PROJECT NUMBER 5e...TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) Central Arkansas Veterans Healthcare System 4300 West 7th

  10. Employment status, employment functioning, and barriers to employment among VA primary care patients.

    PubMed

    Zivin, Kara; Yosef, Matheos; Levine, Debra S; Abraham, Kristen M; Miller, Erin M; Henry, Jennifer; Nelson, C Beau; Pfeiffer, Paul N; Sripada, Rebecca K; Harrod, Molly; Valenstein, Marcia

    2016-03-15

    Prior research found lower employment rates among working-aged patients who use the VA than among non-Veterans or Veterans who do not use the VA, with the lowest reported employment rates among VA patients with mental disorders. This study assessed employment status, employment functioning, and barriers to employment among VA patients treated in primary care settings, and examined how depression and anxiety were associated with these outcomes. The sample included 287 VA patients treated in primary care in a large Midwestern VA Medical Center. Bivariate and multivariable analyses were conducted examining associations between socio-demographic and clinical predictors of six employment domains, including: employment status, job search self-efficacy, work performance, concerns about job loss among employed Veterans, and employment barriers and likelihood of job seeking among not employed Veterans. 54% of respondents were employed, 36% were not employed, and 10% were economically inactive. In adjusted analyses, participants with depression or anxiety (43%) were less likely to be employed, had lower job search self-efficacy, had lower levels of work performance, and reported more employment barriers. Depression and anxiety were not associated with perceived likelihood of job loss among employed or likelihood of job seeking among not employed. Single VA primary care clinic; cross-sectional study. Employment rates are low among working-aged VA primary care patients, particularly those with mental health conditions. Offering primary care interventions to patients that address mental health issues, job search self-efficacy, and work performance may be important in improving health, work, and economic outcomes. Published by Elsevier B.V.

  11. Molecular Studies of Alphavirus Immunogenicity

    DTIC Science & Technology

    1992-12-03

    RNAs. These include Ockelbo virus, a virus causing epidemic polyarthritis .n northern Europe , strains of Sindbis virus from Africa, India, Australia...TD TL A VA VAT R YE VDNI T 3421 GGUGUGGUGGIJGGCAUUGAGAACUUUUGCGGAGAGCAAAJAGAGCAUUUGAAGCGAUCAGA 3480 P VL LA L RT F A QS KRA F QA I R 3481...alphaviruses. The Sindbis-like viruses, which are found throughout the Old World from Northern Europe to Africa, India, the Philippines and the Australasian

  12. 77 FR 12697 - VA Homeless Providers Grant and Per Diem Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-01

    ...We propose to revise and reorganize regulations which contain the Department of Veterans Affairs' (VA) Homeless Providers Grant and Per Diem Program. This rulemaking would update our current regulations, implement and authorize new VA policies, and generally improve the clarity of part 61.

  13. Participation of Myosin Va and Pka Type I in the Regeneration of Neuromuscular Junctions

    PubMed Central

    Röder, Ira Verena; Strack, Siegfried; Reischl, Markus; Dahley, Oliver; Khan, Muzamil Majid; Kassel, Olivier; Zaccolo, Manuela; Rudolf, Rüdiger

    2012-01-01

    Background The unconventional motor protein, myosin Va, is crucial for the development of the mouse neuromuscular junction (NMJ) in the early postnatal phase. Furthermore, the cooperative action of protein kinase A (PKA) and myosin Va is essential to maintain the adult NMJ. We here assessed the involvement of myosin Va and PKA in NMJ recovery during muscle regeneration. Methodology/Principal Findings To address a putative role of myosin Va and PKA in the process of muscle regeneration, we used two experimental models the dystrophic mdx mouse and Notexin-induced muscle degeneration/regeneration. We found that in both systems myosin Va and PKA type I accumulate beneath the NMJs in a fiber maturation-dependent manner. Morphologically intact NMJs were found to express stable nicotinic acetylcholine receptors and to accumulate myosin Va and PKA type I in the subsynaptic region. Subsynaptic cAMP signaling was strongly altered in dystrophic muscle, particularly in fibers with severely subverted NMJ morphology. Conclusions/Significance Our data show a correlation between the subsynaptic accumulation of myosin Va and PKA type I on the one hand and NMJ regeneration status and morphology, AChR stability and specificity of subsynaptic cAMP handling on the other hand. This suggests an important role of myosin Va and PKA type I for the maturation of NMJs in regenerating muscle. PMID:22815846

  14. Frequency Comb Spectroscopy - From IR to XUV

    DTIC Science & Technology

    2015-06-09

    time resolution of 25 s. Publications: [1] A. Cingöz, Yost, D. C. , Allison, T. K. , Ruehl, A. , Fermann, M. E. , Hartl , I. , and Ye, J...J. , Eikema, K. S. E. , Fermann, M. E. , Hartl , I. , and Ye, J. , “Full phase stabilization of a Yb:fiber femtosecond frequency comb via high...D. C. , Allison, T. K. , Ruehl, A. , Fermann, M. E. , Hartl , I. , and Ye, J. , “Direct frequency comb spectroscopy in the extreme ultraviolet”, Nature

  15. 78 FR 6849 - Agency Information Collection (Verification of VA Benefits) Activity Under OMB Review

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-31

    ... (Verification of VA Benefits) Activity Under OMB Review AGENCY: Veterans Benefits Administration, Department of... ``OMB Control No. 2900-0406.'' SUPPLEMENTARY INFORMATION: Title: Verification of VA Benefits, VA Form 26... eliminate unlimited versions of lender- designed forms. The form also informs the lender whether or not the...

  16. Teacher factors contributing to dosage of the KiVa anti-bullying program.

    PubMed

    Swift, Lauren E; Hubbard, Julie A; Bookhout, Megan K; Grassetti, Stevie N; Smith, Marissa A; Morrow, Michael T

    2017-12-01

    The KiVa Anti-Bullying Program (KiVa) seeks to meet the growing need for anti-bullying programming through a school-based, teacher-led intervention for elementary school children. The goals of this study were to examine how intervention dosage impacts outcomes of KiVa and how teacher factors influence dosage. Participants included 74 teachers and 1409 4th- and 5th-grade students in nine elementary schools. Teachers and students completed data collection at the beginning and end of the school year, including measures of bullying and victimization, correlates of victimization (depression, anxiety, peer rejection, withdrawal, and school avoidance), intervention cognitions/emotions (anti-bullying attitudes, and empathy toward victims), bystander behaviors, and teacher factors thought to relate to dosage (self-efficacy for teaching, professional burnout, perceived principal support, expected effectiveness of KiVa, perceived feasibility of KiVa). The dosage of KiVa delivered to classrooms was measured throughout the school year. Results highlight dosage as an important predictor of change in bullying, victimization, correlates of victimization, bystander behavior, and intervention cognitions/emotions. Of the teacher factors, professional burnout uniquely predicted intervention dosage. A comprehensive structural equation model linking professional burnout to dosage and then to child-level outcomes demonstrated good fit. Implications for intervention design and implementation are discussed. Copyright © 2017 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  17. CoVaCS: a consensus variant calling system.

    PubMed

    Chiara, Matteo; Gioiosa, Silvia; Chillemi, Giovanni; D'Antonio, Mattia; Flati, Tiziano; Picardi, Ernesto; Zambelli, Federico; Horner, David Stephen; Pesole, Graziano; Castrignanò, Tiziana

    2018-02-05

    The advent and ongoing development of next generation sequencing technologies (NGS) has led to a rapid increase in the rate of human genome re-sequencing data, paving the way for personalized genomics and precision medicine. The body of genome resequencing data is progressively increasing underlining the need for accurate and time-effective bioinformatics systems for genotyping - a crucial prerequisite for identification of candidate causal mutations in diagnostic screens. Here we present CoVaCS, a fully automated, highly accurate system with a web based graphical interface for genotyping and variant annotation. Extensive tests on a gold standard benchmark data-set -the NA12878 Illumina platinum genome- confirm that call-sets based on our consensus strategy are completely in line with those attained by similar command line based approaches, and far more accurate than call-sets from any individual tool. Importantly our system exhibits better sensitivity and higher specificity than equivalent commercial software. CoVaCS offers optimized pipelines integrating state of the art tools for variant calling and annotation for whole genome sequencing (WGS), whole-exome sequencing (WES) and target-gene sequencing (TGS) data. The system is currently hosted at Cineca, and offers the speed of a HPC computing facility, a crucial consideration when large numbers of samples must be analysed. Importantly, all the analyses are performed automatically allowing high reproducibility of the results. As such, we believe that CoVaCS can be a valuable tool for the analysis of human genome resequencing studies. CoVaCS is available at: https://bioinformatics.cineca.it/covacs .

  18. Competition between Chaotic and Nonchaotic Phases in a Quadratically Coupled Sachdev-Ye-Kitaev Model.

    PubMed

    Chen, Xin; Fan, Ruihua; Chen, Yiming; Zhai, Hui; Zhang, Pengfei

    2017-11-17

    The Sachdev-Ye-Kitaev (SYK) model is a concrete solvable model to study non-Fermi liquid properties, holographic duality, and maximally chaotic behavior. In this work, we consider a generalization of the SYK model that contains two SYK models with a different number of Majorana modes coupled by quadratic terms. This model is also solvable, and the solution shows a zero-temperature quantum phase transition between two non-Fermi liquid chaotic phases. This phase transition is driven by tuning the ratio of two mode numbers, and a nonchaotic Fermi liquid sits at the critical point with an equal number of modes. At a finite temperature, the Fermi liquid phase expands to a finite regime. More intriguingly, a different non-Fermi liquid phase emerges at a finite temperature. We characterize the phase diagram in terms of the spectral function, the Lyapunov exponent, and the entropy. Our results illustrate a concrete example of the quantum phase transition and critical behavior between two non-Fermi liquid phases.

  19. Enhancing Cross-Cultural Collaboration between DoD and VA

    DTIC Science & Technology

    2012-04-27

    James A. Lovell Federal Health Care Center ( FHCC ). The NDAA 2010 authorized the DoD and VA to establish a five-year demonstration project...integrating the North Chicago VA Medical Center and the Naval Health Clinic Great Lakes.50 The FHCC is named in 15 honor of retired U.S. Naval officer...and Illinois resident, Captain James A. Lovell , who was an astronaut on Apollo 13. The joint facility serves the medical needs of active duty service

  20. 77 FR 30050 - VA National Academic Affiliations Council, Notice of meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-21

    ... DEPARTMENT OF VETERANS AFFAIRS VA National Academic Affiliations Council, Notice of meeting The...) that the second meeting of the National Academic Affiliations Council will be held on June 5-6, 2012... the Secretary on matters affecting partnerships between VA and its academic affiliates. On June 5, the...

  1. [Textual research on Chen Ye and his Jia cang jing yan fang (Family-preserved Empirical Recipes) of the Song Dynasty].

    PubMed

    Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing

    2014-01-01

    Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).

  2. An Overview of Patient Safety Climate in the VA

    PubMed Central

    Hartmann, Christine W; Rosen, Amy K; Meterko, Mark; Shokeen, Priti; Zhao, Shibei; Singer, Sara; Falwell, Alyson; Gaba, David M

    2008-01-01

    Objective To assess variation in safety climate across VA hospitals nationally. Study Setting Data were collected from employees at 30 VA hospitals over a 6-month period using the Patient Safety Climate in Healthcare Organizations survey. Study Design We sampled 100 percent of senior managers and physicians and a random 10 percent of other employees. At 10 randomly selected hospitals, we sampled an additional 100 percent of employees working in units with intrinsically higher hazards (high-hazard units [HHUs]). Data Collection Data were collected using an anonymous survey design. Principal Findings We received 4,547 responses (49 percent response rate). The percent problematic response—lower percent reflecting higher levels of patient safety climate—ranged from 12.0–23.7 percent across hospitals (mean=17.5 percent). Differences in safety climate emerged by management level, clinician status, and workgroup. Supervisors and front-line staff reported lower levels of safety climate than senior managers; clinician responses reflected lower levels of safety climate than those of nonclinicians; and responses of employees in HHUs reflected lower levels of safety climate than those of workers in other areas. Conclusions This is the first systematic study of patient safety climate in VA hospitals. Findings indicate an overall positive safety climate across the VA, but there is room for improvement. PMID:18355257

  3. Military and VA general dentistry training: a national resource.

    PubMed

    Atchison, Kathryn A; Bachand, William; Buchanan, C Richard; Lefever, Karen H; Lin, Sylvia; Engelhardt, Rita

    2002-06-01

    In 1999, HRSA contracted with the UCLA School of Dentistry to evaluate the postgraduate general dentistry (PDG) training programs. The purpose of this article is to compare the program characteristics of the PGD training programs sponsored by the Armed Services (military) and VA. Surveys mailed to sixty-six VA and forty-two military program directors in fall 2000 sought information regarding the infrastructure of the program, the program emphasis, resident preparation prior to entering the program, and a description of patients served and types of services provided. Of the eighty-one returned surveys (75 percent response rate), thirty were received from military program directors and fifty-one were received from VA program directors. AEGDs reported treating a higher proportion of children patients and GPRs more medically intensive, disadvantaged and HIV/AIDS patients. Over half of the directors reported increases in curriculum emphasis in implantology. The program directors reported a high level of inadequate preparation among incoming dental residents. Having a higher ratio of residents to total number of faculty predicted inadequate preparation (p=.022) although the model was weak. Although HRSA doesn't financially support federally sponsored programs, their goal of improved dental training to care for medically compromised individuals is facilitated through these programs, thus making military and VA general dentistry programs a national resource.

  4. MyHealtheVet (VA's personal health record)

    MedlinePlus

    ... Overview Site Map Help & User Guides FAQ Privacy & Security Terms and Conditions Policies Privacy Policy Web Policies FOIA Accessibility System Use Important Links VA Home White House USA.gov Inspector ...

  5. What the VA can teach us about geriatric care.

    PubMed

    Ratner, Edward R; West, Melissa; Hartwig, Kristopher N; Meyer, Bruce C

    2013-01-01

    The innovation now being demanded by Medicare is creating new opportunities for health care organizations to redesign how they deliver care for elderly people. For many years, the VA Health System has experimented with ways to deliver care more effectively and efficiently. Hospital-based postacute and palliative care and home-based primary care are two examples of successful approaches that non-VA providers should be looking at as they move away from fee-for-service reimbursement and invent new care-delivery models.

  6. 76 FR 27381 - Proposed Information Collection (Notice of Waiver of VA Compensation or Pension To Receive...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-11

    ... of Waiver of VA Compensation or Pension To Receive Military Pay and Allowances) Activity; Comment... Pension to Receive Military Pay and Allowances, VA Form 21-8951 and VA Form 21-8951-2. OMB Control Number... to waive VA disability benefits in order to receive active or inactive duty training pay are required...

  7. Cost-Effectiveness of Treatments for Genotype 1 Hepatitis C Virus Infection in non-VA and VA Populations

    PubMed Central

    Liu, Shan; Barnett, Paul G.; Holodniy, Mark; Lo, Jeanie; Joyce, Vilija R.; Gidwani, Risha; Asch, Steven M.; Owens, Douglas K.; Goldhaber-Fiebert, Jeremy D.

    2018-01-01

    Background Chronic hepatitis C viral (HCV) infection affects millions of Americans. Healthcare systems face complex choices between multiple highly efficacious, costly treatments. This study assessed the cost-effectiveness of HCV treatments for chronic, genotype 1 HCV monoinfected, treatment-naïve individuals in the Department of Veterans Affairs (VA) and general U.S. healthcare systems. Methods We conducted a decision-analytic Markov model-based cost-effectiveness analysis, employing appropriate payer perspectives and time horizons, and discounting benefits and costs at 3% annually. Interventions included: Sofosbuvir/ledipasvir (SOF-LDV); ombitasvir/paritaprevir/ritonavir/dasabuvir (3D); sofosbuvir/simeprevir (SOF-SMV); sofosbuvir/pegylated interferon/ribavirin (SOF-RBV-PEG); boceprevir/pegylated interferon/ribavirin (BOC-RBV-PEG); and pegylated interferon/ribavirin (PEG-RBV). Outcomes were sustained virologic response (SVR), advanced liver disease, costs, quality adjusted life years (QALYs), and incremental cost-effectiveness. Results SOF-LDV and 3D achieve higher SVR rates compared to older regimens and reduce advanced liver disease (>20% relative to no treatment), increasing QALYs by over 2 years per person. For the non-VA population, at current prices ($5,040 per week for SOF-LDV and $4,796 per week for 3D), SOF-LDV’s lifetime cost ($293,370) is $18,000 lower than 3D’s because of its shorter treatment duration in subgroups. SOF-LDV costs $17,100 per QALY gained relative to no treatment. 3D costs $208,000 per QALY gained relative to SOF-LDV. Both dominate other treatments and are even more cost-effective for the VA, though VA aggregate treatment costs still exceed $4 billion at SOF-LDV prices of $3,308 per week. Drug prices strongly determine relative cost-effectiveness for SOF-LDV and 3D; With sufficient price reductions (approximately 20–30% depending on the health system), 3D could be cost-effective relative to SOF-LDV. Limitations include the lack of

  8. VA/Q distribution during heavy exercise and recovery in humans: implications for pulmonary edema

    NASA Technical Reports Server (NTRS)

    Schaffartzik, W.; Poole, D. C.; Derion, T.; Tsukimoto, K.; Hogan, M. C.; Arcos, J. P.; Bebout, D. E.; Wagner, P. D.

    1992-01-01

    Ventilation-perfusion (VA/Q) inequality has been shown to increase with exercise. Potential mechanisms for this increase include nonuniform pulmonary vasoconstriction, ventilatory time constant inequality, reduced large airway gas mixing, and development of interstitial pulmonary edema. We hypothesized that persistence of VA/Q mismatch after ventilation and cardiac output subside during recovery would be consistent with edema; however, rapid resolution would suggest mechanisms related to changes in ventilation and blood flow per se. Thirteen healthy males performed near-maximal cycle ergometry at an inspiratory PO2 of 91 Torr (because hypoxia accentuates VA/Q mismatch on exercise). Cardiorespiratory variables and inert gas elimination patterns were measured at rest, during exercise, and between 2 and 30 min of recovery. Two profiles of VA/Q distribution behavior emerged during heavy exercise: in group 1 an increase in VA/Q mismatch (log SDQ of 0.35 +/- 0.02 at rest and 0.44 +/- 0.02 at exercise; P less than 0.05, n = 7) and in group 2 no change in VA/Q mismatch (n = 6). There were no differences in anthropometric data, work rate, O2 uptake, or ventilation during heavy exercise between groups. Group 1 demonstrated significantly greater VA/Q inequality, lower vital capacity, and higher forced expiratory flow at 25-75% of forced vital capacity for the first 20 min during recovery than group 2. Cardiac index was higher in group 1 both during heavy exercise and 4 and 6 min postexercise. However, both ventilation and cardiac output returned toward baseline values more rapidly than did VA/Q relationships. Arterial pH was lower in group 1 during exercise and recovery. We conclude that greater VA/Q inequality in group 1 and its persistence during recovery are consistent with the hypothesis that edema occurs and contributes to the increase in VA/Q inequality during exercise. This is supported by observation of greater blood flows and acidosis and, presumably therefore

  9. 30 CFR 57.22315 - Self-contained breathing apparatus (V-A mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Self-contained breathing apparatus (V-A mines... NONMETAL MINES Safety Standards for Methane in Metal and Nonmetal Mines Equipment § 57.22315 Self-contained breathing apparatus (V-A mines). Self-contained breathing apparatus of a duration to allow for escape from...

  10. 30 CFR 57.22315 - Self-contained breathing apparatus (V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Self-contained breathing apparatus (V-A mines... NONMETAL MINES Safety Standards for Methane in Metal and Nonmetal Mines Equipment § 57.22315 Self-contained breathing apparatus (V-A mines). Self-contained breathing apparatus of a duration to allow for escape from...

  11. 75 FR 9277 - Proposed Information Collection (VA National Rehabilitation Special Events, Event Registration...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-01

    ... Clinic Application, VA Form 0928--53 hours. f. National Veterans Creative Arts Festival Application, VA... Games, National Veterans Golden Age Games, National Veterans Creative Arts Festival, National Veterans...

  12. 75 FR 25321 - Agency Information Collection (VA National Rehabilitation Special Events, Event Registration...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-07

    ... Clinic Application, VA Form 0928a series. f. National Veterans Creative Arts Festival Application, VA... Veterans Creative Arts Festival, National Veterans TEE Tournament, National Disabled Veterans Winter Sports...

  13. The use of VA Disability Compensation and Social Security Disability Insurance among working-aged veterans.

    PubMed

    Wilmoth, Janet M; London, Andrew S; Heflin, Colleen M

    2015-07-01

    Although there is substantial disability among veterans, relatively little is known about working-aged veterans' uptake of Department of Veterans Affairs (VA) Disability Compensation and Social Security Disability Insurance (DI). This study identifies levels of veteran participation in VA disability and/or DI benefit programs, examines transitions into and out of VA and DI programs among veterans, and estimates the size and composition of the veteran population receiving VA and/or DI benefits over time. Data from the 1992, 1993, 1996, 2001, 2004, and 2008 Survey of Income and Program Participation (SIPP) are used to describe VA and DI program participation among veterans under the age of 65. The majority of working-aged veterans do not receive VA or DI benefits and joint participation is low, but use of these programs has increased over time. A higher percentage of veterans receive VA compensation, which ranges from 4.9% in 1992 to 13.2% in 2008, than DI compensation, which ranges from 2.9% in 1992 to 6.7% in 2008. The rate of joint participation ranges from less than 1% in 1992 to 3.6% in 2008. Veterans experience few transitions between VA and DI programs during the 36-48 months they are observed. The number of veterans receiving benefits from VA and/or DI nearly doubled between 1992 and 2008. There have been substantial shifts in the composition of veterans using these programs, as cohorts who served prior to 1964 are replaced by those who served after 1964. The findings suggest potential gaps in veterans' access to disability programs that might be addressed through improved coordination of VA and DI benefits. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. 46 CFR 7.45 - Cape Henlopen, DE to Cape Charles, VA.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 1 2011-10-01 2011-10-01 false Cape Henlopen, DE to Cape Charles, VA. 7.45 Section 7.45 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY PROCEDURES APPLICABLE TO THE PUBLIC BOUNDARY LINES Atlantic Coast § 7.45 Cape Henlopen, DE to Cape Charles, VA. (a) A line drawn from the easternmost...

  15. 75 FR 41577 - VBA/VHA Musculoskeletal Forum: Improving VA's Disability Evaluation Criteria

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-16

    ... medical science information from presentations made by subject matter experts. VA plans to use this information to update the sections of VA's Schedule for Rating Disabilities (VASRD) that pertain to diseases... FURTHER INFORMATION CONTACT: Mr. Brad Tuttle, VASRD Coordinator, Compensation and Pension Service...

  16. 75 FR 33216 - Payment or Reimbursement for Emergency Treatment Furnished by Non-VA Providers in Non-VA...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-11

    ... treatment of eligible veterans at non-VA facilities and expand the circumstances under which payment for..., potentially eligible veterans would be appropriately afforded ample opportunity to qualify for this expanded...; 64.010, Veterans Nursing Home Care; and 64.011, Veterans Dental Care. Signing Authority The Secretary...

  17. 48 CFR 833.103 - Protests to VA.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... encouraged to use alternative dispute resolution (ADR) procedures to resolve protests at any stage in the protest process. If ADR is used, VA will not furnish any documentation in an ADR proceeding beyond what is...

  18. 78 FR 21817 - Amendment of Restricted Area R-6601; Fort A.P. Hill, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-12

    ...; Airspace Docket No. 12-AEA-7] RIN 2120-AA66 Amendment of Restricted Area R-6601; Fort A.P. Hill, VA AGENCY... limits and time of designation of restricted area R-6601, Fort A.P. Hill, VA. The U.S. Army requested... limits and increase the time of designation of restricted area R-6601, Fort A.P. Hill, VA, (77 FR 35308...

  19. The VA Computerized Patient Record — A First Look

    PubMed Central

    Anderson, Curtis L.; Meldrum, Kevin C.

    1994-01-01

    In support of its in-house DHCP Physician Order Entry/Results Reporting application, the VA is developing the first edition of a Computerized Patient Record. The system will feature a physician-oriented interface with real time, expert system-based order checking, a controlled vocabulary, a longitudinal repository of patient data, HL7 messaging support, a clinical reminder and warning system, and full integration with existing VA applications including lab, pharmacy, A/D/T, radiology, dietetics, surgery, vitals, allergy tracking, discharge summary, problem list, progress notes, consults, and online physician order entry. PMID:7949886

  20. 76 FR 71920 - Payment for Home Health Services and Hospice Care by Non-VA Providers

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-21

    ... concerning the billing methodology for non-VA providers of home health services and hospice care. The proposed rulemaking would include home health services and hospice care under the VA regulation governing payment for other non-VA health care providers. Because the newly applicable methodology cannot supersede...

  1. Effects of inspired CO2, hyperventilation, and time on VA/Q inequality in the dog

    NASA Technical Reports Server (NTRS)

    Tsukimoto, K.; Arcos, J. P.; Schaffartzik, W.; Wagner, P. D.; West, J. B.

    1992-01-01

    In a recent study by Tsukimoto et al. (J. Appl. Physiol. 68: 2488-2493, 1990), CO2 inhalation appeared to reduce the size of the high ventilation-perfusion ratio (VA/Q) mode commonly observed in anesthetized mechanically air-ventilated dogs. In that study, large tidal volumes (VT) were used during CO2 inhalation to preserve normocapnia. To separate the influences of CO2 and high VT on the VA/Q distribution in the present study, we examined the effect of inspired CO2 on the high VA/Q mode using eight mechanically ventilated dogs (4 given CO2, 4 controls). The VA/Q distribution was measured first with normal VT and then with increased VT. In the CO2 group at high VT, data were collected before, during, and after CO2 inhalation. With normal VT, there was no difference in the size of the high VA/Q mode between groups [10.5 +/- 3.5% (SE) of ventilation in the CO2 group, 11.8 +/- 5.2% in the control group]. Unexpectedly, the size of the high VA/Q mode decreased similarly in both groups over time, independently of the inspired PCO2, at a rate similar to the fall in cardiac output over time. The reduction in the high VA/Q mode together with a simultaneous increase in alveolar dead space (estimated by the difference between inert gas dead space and Fowler dead space) suggests that poorly perfused high VA/Q areas became unperfused over time. A possible mechanism is that elevated alveolar pressure and decreased cardiac output eliminate blood flow from corner vessels in nondependent high VA/Q regions.

  2. RadNet Air Data From Richmond, VA

    EPA Pesticide Factsheets

    This page presents radiation air monitoring and air filter analysis data for Richmond, VA from EPA's RadNet system. RadNet is a nationwide network of monitoring stations that measure radiation in air, drinking water and precipitation.

  3. RadNet Air Data From Harrisonburg, VA

    EPA Pesticide Factsheets

    This page presents radiation air monitoring and air filter analysis data for Harrisonburg, VA from EPA's RadNet system. RadNet is a nationwide network of monitoring stations that measure radiation in air, drinking water and precipitation.

  4. VA and DOD Health Care: First Federal Health Care Center Established, but Implementation Concerns Need to Be Addressed

    DTIC Science & Technology

    2011-07-01

    procedures for the reporting of information security incidents. However, VA and DOD did not meet designated deadlines for the three capabilities that were...addition to the contact named above, Marcia A. Mann, Assistant Director; Jill K. Center; Kaycee M. Glavich; E. Jane Whipple ; and Malissa G. Winograd

  5. 78 FR 66265 - Drawbridge Operation Regulation; Elizabeth River, Eastern Branch, Norfolk, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-05

    ... Operation Regulation; Elizabeth River, Eastern Branch, Norfolk, VA AGENCY: Coast Guard, DHS. ACTION: Notice... Elizabeth River Eastern Branch, mile 1.1, at Norfolk, VA. This deviation is necessary to facilitate... maintenance. The Norfolk Southern 5 railroad Bridge, at mile 1.1, across the Elizabeth River (Eastern Branch...

  6. 78 FR 36715 - VA Veteran-Owned Small Business (VOSB) Verification Guidelines; Correction

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-19

    ... DEPARTMENT OF VETERANS AFFAIRS 38 CFR Part 74 RIN 2900-AO63 VA Veteran-Owned Small Business (VOSB... Department of Veterans Affairs (VA) amended its Veteran-Owned Small Business (VOSB) Verification Guidelines... Office of Small and Disadvantaged Business Utilization (00SB), Department of Veterans Affairs, 810...

  7. 46 CFR 7.55 - Cape Henry, VA to Cape Fear, NC.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Cape Henry, VA to Cape Fear, NC. 7.55 Section 7.55 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY PROCEDURES APPLICABLE TO THE PUBLIC BOUNDARY LINES Atlantic Coast § 7.55 Cape Henry, VA to Cape Fear, NC. (a) A line drawn from Rudee Inlet Jetty Light “2” to...

  8. Who pays when VA users are hospitalized in the private sector? Evidence from three data sources.

    PubMed

    West, Alan N; Weeks, William B

    2007-10-01

    Older veterans enrolled in VA healthcare receive much of their medical care in the private sector, through Medicare. Less is known about younger VA enrollees' use of the private sector, or its funding. We compare payers for younger and older enrollees' private sector use in 3 hospitalization datasets. From 1998 to 2000, using private sector discharge data for VA enrollees in New York State, we categorized hospitalizations according to payer (self/family, private insurance, Medicare, Medicaid, other sources). We compared this payer distribution to population-weighted national Medical Expenditure Panel Survey (MEPS) data from 1996-2003 for veterans in VA healthcare. We also compared Medicare utilization in either dataset to hospitalizations for New York veterans from 1998-2000 in the VA-Medicare dataset. Analyses separated patients younger than age 65 from those age 65 or older. VA enrollees under age 65 obtain roughly half their hospitalizations in the private sector; older enrollees use the private sector at least twice as often as the VA. Datasets generally agree on payer distributions. Although older enrollees rely heavily on Medicare, they also use commercial insurance and self/family payments substantially. Half of younger enrollees' non-VA hospitalizations are paid by private insurance, but Medicare, Medicaid, and self/family each pay for one-quarter to one-third of admissions. VA enrollees use the private sector for most of their inpatient care, which is funded by multiple sources. Developing a national UB-92/VA dataset would be critical to understanding veterans' use of the private sector for specific diagnoses and procedures, particularly for the fast growing population of younger veterans.

  9. VA's National PTSD Brain Bank: a National Resource for Research.

    PubMed

    Friedman, Matthew J; Huber, Bertrand R; Brady, Christopher B; Ursano, Robert J; Benedek, David M; Kowall, Neil W; McKee, Ann C

    2017-08-25

    The National PTSD Brain Bank (NPBB) is a brain tissue biorepository established to support research on the causes, progression, and treatment of PTSD. It is a six-part consortium led by VA's National Center for PTSD with participating sites at VA medical centers in Boston, MA; Durham, NC; Miami, FL; West Haven, CT; and White River Junction, VT along with the Uniformed Services University of Health Sciences. It is also well integrated with VA's Boston-based brain banks that focus on Alzheimer's disease, ALS, chronic traumatic encephalopathy, and other neurological disorders. This article describes the organization and operations of NPBB with specific attention to: tissue acquisition, tissue processing, diagnostic assessment, maintenance of a confidential data biorepository, adherence to ethical standards, governance, accomplishments to date, and future challenges. Established in 2014, NPBB has already acquired and distributed brain tissue to support research on how PTSD affects brain structure and function.

  10. VA Construction: Improved Processes Needed to Monitor Contract Modifications, Develop Schedules, and Estimate Costs

    DTIC Science & Technology

    2017-03-01

    address challenges in managing projects to build medical facilities. In response to statutory requirements and additional congressional direction, VA...is outsourcing management of certain such projects to the U.S. Army Corps of Engineers (USACE). As of October 2016, VA had 23 ongoing projects...costing $100 million or more. VA and USACE have entered into interagency agreements for 12 of these 23 projects. The agreements entail USACE’s managing

  11. Feasibility and acceptability of interventions to delay gun access in VA mental health settings.

    PubMed

    Walters, Heather; Kulkarni, Madhur; Forman, Jane; Roeder, Kathryn; Travis, Jamie; Valenstein, Marcia

    2012-01-01

    The majority of VA patient suicides are completed with firearms. Interventions that delay patients' gun access during high-risk periods may reduce suicide, but may not be acceptable to VA stakeholders or may be challenging to implement. Using qualitative methods, stakeholders' perceptions about gun safety and interventions to delay gun access during high-risk periods were explored. Ten focus groups and four individual interviews were conducted with key stakeholders, including VA mental health patients, mental health clinicians, family members and VA facility leaders (N=60). Transcripts were consensus-coded by two independent coders, and structured summaries were developed and reviewed using a consensus process. All stakeholder groups indicated that VA health system providers had a role in increasing patient safety and emphasized the need for providers to address gun access with their at-risk patients. However, VA mental health patients and clinicians reported limited discussion regarding gun access in VA mental health settings during routine care. Most, although not all, patients and clinicians indicated that routine screening for gun access was acceptable, with several noting that it was more acceptable for mental health patients. Most participants suggested that family and friends be involved in reducing gun access, but expressed concerns about potential family member safety. Participants generally found distribution of trigger locks acceptable, but were skeptical about its effectiveness. Involving Veteran Service Organizations or other individuals in temporarily holding guns during high-risk periods was acceptable to many participants but only with numerous caveats. Patients, clinicians and family members consider the VA health system to have a legitimate role in addressing gun safety. Several measures to delay gun access during high-risk periods for suicide were seen as acceptable and feasible if implemented thoughtfully. Published by Elsevier Inc.

  12. 33 CFR 334.290 - Elizabeth River, Southern Branch, Va., naval restricted areas.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ..., Va., naval restricted areas. 334.290 Section 334.290 Navigation and Navigable Waters CORPS OF....290 Elizabeth River, Southern Branch, Va., naval restricted areas. (a) The areas—(1) St. Helena Annex Area. Beginning at a point at St. Helena Annex of the Norfolk Naval Shipyard, on the eastern shore of...

  13. 33 CFR 334.290 - Elizabeth River, Southern Branch, Va., naval restricted areas.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ..., Va., naval restricted areas. 334.290 Section 334.290 Navigation and Navigable Waters CORPS OF....290 Elizabeth River, Southern Branch, Va., naval restricted areas. (a) The areas—(1) St. Helena Annex Area. Beginning at a point at St. Helena Annex of the Norfolk Naval Shipyard, on the eastern shore of...

  14. 77 FR 3844 - Proposed Information Collection (Dependents' Application for VA Educational Benefits) Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-25

    ... use of other forms of information technology. Title: Dependents' Application for VA Educational... (Dependents' Application for VA Educational Benefits) Activity; Comment Request AGENCY: Veterans Benefits...' Educational Assistance and Fry Scholarship benefits. DATES: Written comments and recommendations on the...

  15. 75 FR 24510 - Drug and Drug-Related Supply Promotion by Pharmaceutical Company Sales Representatives at VA...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-05

    ... VA facilities and the business relationships between VA staff and sales representatives promoting..., and provide sales representatives with a consistent standard of permissible business practice at VA... include suspension of a sales representative's access privileges, or, in extreme cases, denying access to...

  16. Myosin Va Bound to Phagosomes Binds to F-Actin and Delays Microtubule-dependent Motility

    PubMed Central

    Al-Haddad, Ahmed; Shonn, Marion A.; Redlich, Bärbel; Blocker, Ariel; Burkhardt, Janis K.; Yu, Hanry; Hammer, John A.; Weiss, Dieter G.; Steffen, Walter; Griffiths, Gareth; Kuznetsov, Sergei A.

    2001-01-01

    We established a light microscopy-based assay that reconstitutes the binding of phagosomes purified from mouse macrophages to preassembled F-actin in vitro. Both endogenous myosin Va from mouse macrophages and exogenous myosin Va from chicken brain stimulated the phagosome–F-actin interaction. Myosin Va association with phagosomes correlated with their ability to bind F-actin in an ATP-regulated manner and antibodies to myosin Va specifically blocked the ATP-sensitive phagosome binding to F-actin. The uptake and retrograde transport of phagosomes from the periphery to the center of cells in bone marrow macrophages was observed in both normal mice and mice homozygous for the dilute-lethal spontaneous mutation (myosin Va null). However, in dilute-lethal macrophages the accumulation of phagosomes in the perinuclear region occurred twofold faster than in normal macrophages. Motion analysis revealed saltatory phagosome movement with temporarily reversed direction in normal macrophages, whereas almost no reversals in direction were observed in dilute-lethal macrophages. These observations demonstrate that myosin Va mediates phagosome binding to F-actin, resulting in a delay in microtubule-dependent retrograde phagosome movement toward the cell center. We propose an “antagonistic/cooperative mechanism” to explain the saltatory phagosome movement toward the cell center in normal macrophages. PMID:11553713

  17. Overlapping buprenorphine, opioid, and benzodiazepine prescriptions among Veterans dually enrolled in VA and Medicare Part D

    PubMed Central

    Gellad, Walid F.; Zhao, Xinhua; Thorpe, Carolyn T.; Thorpe, Joshua M.; Sileanu, Florentina E.; Cashy, John P.; Mor, Maria; Hale, Jennifer A.; Radomski, Thomas; Hausmann, Leslie R. M.; Fine, Michael J.; Good, Chester B.

    2016-01-01

    Background Buprenorphine is a key tool in the management of opioid use disorder, but there are growing concerns about abuse, diversion and safety. These concerns are amplified for the Department of Veterans Affairs (VA), whose patients may receive care concurrently from multiple prescribers within and outside VA. To illustrate the extent of this challenge, we examined overlapping prescriptions for buprenorphine, opioids, and benzodiazepines among Veterans dually enrolled in VA and Medicare Part D. Methods We constructed a cohort of all Veterans dually enrolled in VA and Part D who filled an opioid prescription in 2012. We identified patients who received tablet or film buprenorphine products from either source. We calculated the proportion of buprenorphine recipients with any overlapping prescription (based on days supply) for a non-buprenorphine opioid or benzodiazepine, focusing on Veterans who received overlapping prescriptions from a different system than their buprenorphine prescription (Part D buprenorphine recipients receiving overlapping opioids or benzodiazepines from VA and vice versa). Results We identified 1,790 dually enrolled Veterans with buprenorphine prescriptions, including 760 (43%) from VA and 1,091 (61%) from Part D (61 Veterans with buprenorphine from both systems were included in each group). Among VA buprenorphine recipients, 199 (26%) received an overlapping opioid prescription and 11 (1%) received an overlapping benzodiazepine prescription from Part D. Among Part D buprenorphine recipients, 208 (19%) received an overlapping opioid prescription and 178 (16%) received an overlapping benzodiazepine prescription from VA. Among VA and Part D buprenorphine recipients with cross-system opioid overlap, 25% (49/199) and 35% (72/208), respectively, had >90 days of overlap. Conclusions Many buprenorphine recipients receive overlapping prescriptions for opioids and benzodiazepines from a different health care system than the one in which their

  18. Installation Restoration Program. Phase 1. Records Search Andrews AFB. Maryland

    DTIC Science & Technology

    1985-06-01

    red to silvery-qrey, functions ma a conf ining bed. Formation. ~Va plastics thin lonses of pole gray silt. Ann"a Formation. ye (0-210 sand, qrsenieh...the Nanjemoy Formation (a clayey glauconi- tic sand, two to thirty feet thick) and the Marlboro Clay (a plastic clay with silt partings, two to... plastics , empty 55-gallon drums, waste lumber, tires, pipes, and hospital wastes such as unused needles and chemical reagents. In the past, Site D-4 was

  19. 38 CFR 74.26 - What types of business information will VA collect?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... VETERANS AFFAIRS (CONTINUED) VETERANS SMALL BUSINESS REGULATIONS Records Management § 74.26 What types of business information will VA collect? VA will examine a variety of business records. See § 74.12, “What is... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false What types of business...

  20. Homeless Veterans: Management Improvements Could Help VA Better Identify Supportive Housing Projects

    DTIC Science & Technology

    2016-12-01

    HOMELESS VETERANS Management Improvements Could Help VA Better Identify Supportive-Housing Projects Report to...VETERANS Management Improvements Could Help VA Better Identify Supportive-Housing Projects What GAO Found As of September 2016, for veterans who...disabled veterans. These supportive-housing EULs receive project -based HUD-VASH vouchers, which provide housing subsidies, on-site case management

  1. The Impact of VA and Navy Hospital Collaboration on Medical School Education

    ERIC Educational Resources Information Center

    Atre-Vaidya, Nutan; Ross, Arthur, III; Sandu, Ioana C.; Hassan, Tariq

    2009-01-01

    Objective: The U.S. Department of Veterans Affairs (VA) is the largest single provider of medical education in the United States and is often the preferred training site for medical students and residents. However, changing priorities of patients and the marketplace are forcing medical schools and the VA to consider new ways of practicing medicine…

  2. VA Health Care: Improved Monitoring Needed for Effective Oversight of Care for Women Veterans

    DTIC Science & Technology

    2016-12-01

    November 2014. VHA officials also said that after reviewing information from sources such as veteran surveys and feedback from regional VA business...authorizations for care (of both men and women) from early calendar year 2016. In one case, almost a month and a half elapsed from the time of the...veteran’s initial pregnancy confirmation appointment at VA (when she was 6 weeks pregnant) to when the Choice authorization was sent by the VA facility to

  3. 76 FR 70831 - Proposed Information Collection (Survey of Veteran Enrollees (Quality and Efficiency of VA Health...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-15

    ... of Veteran Enrollees (Quality and Efficiency of VA Health Care)) Activity; Comment Request AGENCY... of Veteran Enrollees (Quality and Efficiency of VA Health Care), VA Form 10-21088. OMB Control Number... will be used to collect data that is necessary to promote quality and efficient delivery of health care...

  4. 76 FR 59765 - Virginia Disaster # VA-00036

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-27

    ... SMALL BUSINESS ADMINISTRATION [Disaster Declaration 12843 and 12844] Virginia Disaster VA-00036 AGENCY: U.S. Small Business Administration. ACTION: Notice SUMMARY: This is a notice of an Administrative declaration of a disaster for the Commonwealth of Virginia dated 09/21/2011. Incident: Hurricane Irene...

  5. 77 FR 3841 - Proposed Information Collection (Survey of Veteran Enrollees (Quality and Efficiency of VA Health...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-25

    ... of Veteran Enrollees (Quality and Efficiency of VA Health Care)) Activities Under OMB Review AGENCY... of Veteran Enrollees (Quality and Efficiency of VA Health Care), VA Form 10-21088. OMB Control Number... will be used to collect data that is necessary to promote quality and efficient delivery of health care...

  6. 78 FR 18425 - Proposed Information Collection VA Police Officer Pre-Employment Screening Checklist); Comment...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-26

    ... enhance the quality, utility, and clarity of the information to be collected; and (4) ways to minimize the... approved collection. Abstract: VA personnel complete VA Form 0120 to document pre- employment history and...

  7. VA health service utilization for homeless and low-income Veterans: a spotlight on the VA Supportive Housing (VASH) program in greater Los Angeles.

    PubMed

    Gabrielian, Sonya; Yuan, Anita H; Andersen, Ronald M; Rubenstein, Lisa V; Gelberg, Lillian

    2014-05-01

    The US Department of Housing and Urban Development (HUD)-VA Supportive Housing (VASH) program-the VA's Housing First effort-is central to efforts to end Veteran homelessness. Yet, little is known about health care utilization patterns associated with achieving HUD-VASH housing. We compare health service utilization at the VA Greater Los Angeles among: (1) formerly homeless Veterans housed through HUD-VASH (HUD-VASH Veterans); (2) currently homeless Veterans; (3) housed, low-income Veterans not in HUD-VASH; and (4) housed, not low-income Veterans. We performed a secondary database analysis of Veterans (n=62,459) who received VA Greater Los Angeles care between October 1, 2010 and September 30, 2011. We described medical/surgical and mental health utilization [inpatient, outpatient, and emergency department (ED)]. We controlled for demographics, need, and primary care use in regression analyses of utilization data by housing and income status. HUD-VASH Veterans had more inpatient, outpatient, and ED use than currently homeless Veterans. Adjusting for demographics and need, HUD-VASH Veterans and the low-income housed Veterans had similar likelihoods of medical/surgical inpatient and outpatient utilization, compared with the housed, not low-income group. Adjusting first for demographics and need (model 1), then also for primary care use (model 2), HUD-VASH Veterans had the greatest decrease in incident rates of specialty medical/surgical, mental health, and ED care from models 1 to 2, becoming similar to the currently homeless, compared with the housed, not low-income group. Our findings suggest that currently homeless Veterans underuse health care relative to housed Veterans. HUD-VASH may address this disparity by providing housing and linkages to primary care.

  8. 78 FR 11094 - Drawbridge Operation Regulation; James River, Between Isle of Wight and Newport News, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-15

    ... Operation Regulation; James River, Between Isle of Wight and Newport News, VA AGENCY: Coast Guard, DHS... River, mile 5.0, between Isle of Wight and Newport News, VA. This deviation is necessary to facilitate... Isle of Isle and Newport News, VA opens on signal. The James River Bridge has vertical clearances in...

  9. 75 FR 8005 - Safety Zone; Wicomico Community Fireworks, Great Wicomico River, Mila, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-23

    ...-AA00 Safety Zone; Wicomico Community Fireworks, Great Wicomico River, Mila, VA AGENCY: Coast Guard, DHS... the Great Wicomico River in the vicinity of Mila, VA in support of the Wicomico Community Fireworks... protect mariners from the hazards associated with fireworks displays. DATES: Comments and related material...

  10. VA Health Professional Scholarship and Visual Impairment and Orientation and Mobility Professional Scholarship Programs. Final rule.

    PubMed

    2013-08-20

    The Department of Veterans Affairs (VA) is amending its VA Health Professional Scholarship Program (HPSP) regulations. VA is also establishing regulations for a new program, the Visual Impairment and Orientation and Mobility Professional Scholarship Program (VIOMPSP). These regulations comply with and implement sections 302 and 603 of the Caregivers and Veterans Omnibus Health Services Act of 2010 (the 2010 Act). Section 302 of the 2010 Act established the VIOMPSP, which authorizes VA to provide financial assistance to certain students seeking a degree in visual impairment or orientation or mobility, in order to increase the supply of qualified blind rehabilitation specialists for VA and the United States. Section 603 of the 2010 Act reauthorized and modified HPSP, a program that provides scholarships for education or training in certain health care occupations.

  11. Potential therapeutic agents for circulatory diseases from Bauhinia glauca Benth.subsp. pernervosa. (Da Ye Guan Men).

    PubMed

    Tang, Yingzhan; Ling, Junhong; Zhang, Peng; Zhang, Xiangrong; Zhang, Na; Wang, Wenli; Li, Jiayuan; Li, Ning

    2015-08-15

    Because of platelets as critical factor in the formation of pathogenic thrombi, anti-platelet activities have been selected as therapeutic target for various circulatory diseases. In order to find potential therapeutic agents, bioassay-directed separation of Bauhinia glauca Benth.subsp. pernervosa. (called Da Ye Guan Men as a traditional Chinese medicine) was performed to get 29 main components (compounds 1-29) from the bioactive part of this herbal. It was the first time to focus on the composition with anti-platelet aggregation activities for this traditional Chinese medicine. The constituents, characterized from the effective extract, were established on the basis of extensive spectral data analysis. Then their anti-platelet aggregation effects were evaluated systematically. On the basis of the chemical profile and biological assay, it was suggested that the flavonoid composition (5 and 18) should be responsible for the anti-platelet aggregation of the herbal because of their significant activities. The primary structure and activity relationship was also discussed briefly. Copyright © 2015. Published by Elsevier Ltd.

  12. 75 FR 29660 - Safety Zone; Wicomico Community Fireworks, Great Wicomico River, Mila, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-27

    ...-AA00 Safety Zone; Wicomico Community Fireworks, Great Wicomico River, Mila, VA AGENCY: Coast Guard, DHS... the Great Wicomico River in the vicinity of Mila, VA in support of the Wicomico Community Fireworks... protect mariners from the hazards associated with fireworks displays. DATES: This rule is effective from 9...

  13. VA and HRS Local Coordination of Florida's Home-Based Services to the Elderly.

    ERIC Educational Resources Information Center

    Bradham, Douglas D.; Chico, Innette Mary

    Florida's District 12 Veterans Administration (VA) wanted to deliver medical case-management services to veterans not receiving home-based services due to the geographic restrictions of the VA's Hospital-Based Home Care Program. The Florida Department of Health and Rehabilitative Services (HRS) desired to demonstrate the effectiveness of nurse…

  14. Black Hole on a Chip: Proposal for a Physical Realization of the Sachdev-Ye-Kitaev model in a Solid-State System

    NASA Astrophysics Data System (ADS)

    Pikulin, D. I.; Franz, M.

    2017-07-01

    A system of Majorana zero modes with random infinite-range interactions—the Sachdev-Ye-Kitaev (SYK) model—is thought to exhibit an intriguing relation to the horizons of extremal black holes in two-dimensional anti-de Sitter space. This connection provides a rare example of holographic duality between a solvable quantum-mechanical model and dilaton gravity. Here, we propose a physical realization of the SYK model in a solid-state system. The proposed setup employs the Fu-Kane superconductor realized at the interface between a three-dimensional topological insulator and an ordinary superconductor. The requisite N Majorana zero modes are bound to a nanoscale hole fabricated in the superconductor that is threaded by N quanta of magnetic flux. We show that when the system is tuned to the surface neutrality point (i.e., chemical potential coincident with the Dirac point of the topological insulator surface state) and the hole has sufficiently irregular shape, the Majorana zero modes are described by the SYK Hamiltonian. We perform extensive numerical simulations to demonstrate that the system indeed exhibits physical properties expected of the SYK model, including thermodynamic quantities and two-point as well as four-point correlators, and discuss ways in which these can be observed experimentally.

  15. PVP VA64 as a novel release-modifier for sustained-release mini-matrices prepared via hot melt extrusion.

    PubMed

    Li, Yongcheng; Lu, Ming; Wu, Chuanbin

    2017-11-10

    The purpose of this study was to explore poly(vinylpyrrolidone-co-vinyl acetate) (PVP VA64) as a novel release-modifier to tailor the drug release from ethylcellulose (EC)-based mini-matrices prepared via hot melt extrusion (HME). Quetiapine fumarate (QF) was selected as model drug. QF/EC/PVP VA64 mini-matrices were extruded with 30% drug loading. The physical state of QF in extruded mini-matrices was characterized using differential scanning calorimetry, X-ray powder diffraction, and confocal Raman microscopy. The release-controlled ability of PVP VA64 was investigated and compared with that of xanthan gum, crospovidone, and low-substituted hydroxypropylcellulose. The influences of PVP VA64 content and processing temperature on QF release behavior and mechanism were also studied. The results indicated QF dispersed as the crystalline state in all mini-matrices. The release of QF from EC was very slow as only 4% QF was released in 24 h. PVP VA64 exhibited the best ability to enhance the drug release as compared with other three release-modifiers. The drug release increased to 50-100% in 24 h with the addition of 20-40% PVP VA64. Increasing processing temperature slightly slowed down the drug release by decreasing free volume and pore size. The release kinetics showed good fit with the Ritger-Peppas model. The values of release exponent (n) increased as PVP VA64 is added (0.14 for pure EC, 0.41 for 20% PVP VA64, and 0.61 for 40% PVP VA64), revealing that the addition of PVP VA64 enhanced the erosion mechanism. This work presented a new polymer blend system of EC with PVP VA64 for sustained-release prepared via HME.

  16. Topiramate Protects Pericytes from Glucotoxicity: Role for Mitochondrial CA VA in Cerebromicrovascular Disease in Diabetes.

    PubMed

    Patrick, Ping; Price, Tulin O; Diogo, Ana L; Sheibani, Nader; Banks, William A; Shah, Gul N

    Hyperglycemia in diabetes mellitus causes oxidative stress and pericyte depletion from the microvasculature of the brain thus leading to the Blood-Brain Barrier (BBB) disruption. The compromised BBB exposes the brain to circulating substances, resulting in neurotoxicity and neuronal cell death. The decline in pericyte numbers in diabetic mouse brain and pericyte apoptosis in high glucose cultures are caused by excess superoxide produced during enhanced respiration (mitochondrial oxidative metabolism of glucose). Superoxide is precursor to all Reactive Oxygen Species (ROS) which, in turn, cause oxidative stress. The rate of respiration and thus the ROS production is regulated by mitochondrial carbonic anhydrases (mCA) VA and VB, the two isoforms expressed in the mitochondria. Inhibition of both mCA: decreases the oxidative stress and restores the pericyte numbers in diabetic brain; and reduces high glucose-induced respiration, ROS, oxidative stress, and apoptosis in cultured brain pericytes. However, the individual role of the two isoforms has not been established. To investigate the contribution of mCA VA in ROS production and apoptosis, a mCA VA overexpressing brain pericyte cell line was engineered. These cells were exposed to high glucose and analyzed for the changes in ROS and apoptosis. Overexpression of mCA VA significantly increased pericyte ROS and apoptosis. Inhibition of mCA VA with topiramate prevented increases both in glucose-induced ROS and pericyte death. These results demonstrate, for the first time, that mCA VA regulates the rate of pericyte respiration. These findings identify mCA VA as a novel and specific therapeutic target to protect the cerebromicrovascular bed in diabetes.

  17. A description of a system of programs for mathematically processing on unified series (YeS) computers photographic images of the Earth taken from spacecraft

    NASA Technical Reports Server (NTRS)

    Zolotukhin, V. G.; Kolosov, B. I.; Usikov, D. A.; Borisenko, V. I.; Mosin, S. T.; Gorokhov, V. N.

    1980-01-01

    A description of a batch of programs for the YeS-1040 computer combined into an automated system for processing photo (and video) images of the Earth's surface, taken from spacecraft, is presented. Individual programs with the detailed discussion of the algorithmic and programmatic facilities needed by the user are presented. The basic principles for assembling the system, and the control programs are included. The exchange format within whose framework the cataloging of any programs recommended for the system of processing will be activated in the future is displayed.

  18. 78 FR 36642 - Proposed Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-18

    ... DEPARTMENT OF VETERANS AFFAIRS [OMB Control No. 2900-0021] Proposed Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity: Comment Request AGENCY: Veterans... techniques or the use of other forms of information technology. Title: VA Loan Electronic Reporting Interface...

  19. RadNet Air Data From Virginia Beach, VA

    EPA Pesticide Factsheets

    This page presents radiation air monitoring and air filter analysis data for Virginia Beach, VA from EPA's RadNet system. RadNet is a nationwide network of monitoring stations that measure radiation in air, drinking water and precipitation.

  20. 48 CFR 853.236-70 - VA Form 10-6298, Architect-Engineer Fee Proposal.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false VA Form 10-6298, Architect-Engineer Fee Proposal. 853.236-70 Section 853.236-70 Federal Acquisition Regulations System DEPARTMENT OF...-Engineer Fee Proposal. VA Form 10-6298, Architect-Engineer Fee Proposal, shall be used as prescribed in 836...

  1. 48 CFR 853.236-70 - VA Form 10-6298, Architect-Engineer Fee Proposal.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false VA Form 10-6298, Architect-Engineer Fee Proposal. 853.236-70 Section 853.236-70 Federal Acquisition Regulations System DEPARTMENT OF...-Engineer Fee Proposal. VA Form 10-6298, Architect-Engineer Fee Proposal, shall be used as prescribed in 836...

  2. 48 CFR 819.602-3 - Resolving differences between VA and the Small Business Administration.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... between VA and the Small Business Administration. 819.602-3 Section 819.602-3 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS Certificates... Small Business Administration. The Director, OSDBU, is the VA liaison with the SBA. Information copies...

  3. 78 FR 59099 - Agency Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-25

    ... Information and Regulatory Affairs, Office of Management and Budget, Attn: VA Desk Officer; 725 17th St. NW....'' SUPPLEMENTARY INFORMATION: Title: VA Loan Electronic Reporting Interface (VALERI) System. OMB Control Number... information submitted through the VALERI system to perform supplemental servicing, determination on...

  4. VA Health Care: Processes to Evaluate, Implement, and Monitor Organizational Structure Changes Needed

    DTIC Science & Technology

    2016-09-01

    VA HEALTH CARE Processes to Evaluate , Implement, and Monitor Organizational Structure Changes Needed Report to...Accountability Office Highlights of GAO-16-803, a report to congressional requesters September 2016 VA HEALTH CARE Processes to Evaluate , Implement, and...recommended organizational structure changes are evaluated to determine appropriate actions and implemented. This is inconsistent with federal standards

  5. Military and VA telemedicine systems for patients with traumatic brain injury.

    PubMed

    Girard, Philip

    2007-01-01

    Telemedicine plays a critical role within the Department of Veterans Affairs (VA) Veterans Health Administration by allowing the surveillance and care of patients who are isolated by geography, poverty, and disability. In military settings, telemedicine is being widely used to identify injury and illness and aid in the treatment, rehabilitation, and recovery of combat-wounded soldiers in theater. Rapid advances in both domains are transforming the way clinicians provide care, education, and support to patients with traumatic brain injury (TBI) and their families. This article discusses the military and VA telemedicine capabilities that are supporting the care of service members and veterans with TBI. These capabilities include new technologies that enhance the identification of TBI, management of symptoms in theater, and application of proven technologies (interactive video, Internet, and World Wide Web) to improve overall care coordination throughout military and VA systems. The impact of distance learning, teleconsultation, telerehabilitation, and home telehealth programs is also described within this context.

  6. 76 FR 44086 - Agency Information Collection (Notice of Waiver of VA Compensation or Pension To Receive Military...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-22

    ... of Waiver of VA Compensation or Pension To Receive Military Pay and Allowances) Activity Under OMB....'' SUPPLEMENTARY INFORMATION: Title: Notice of Waiver of VA Compensation or Pension to Receive Military Pay and... order to receive active or inactive duty training pay are required to complete VA Forms 21-8951 and 21...

  7. MyRIP interaction with MyoVa on secretory granules is controlled by the cAMP-PKA pathway.

    PubMed

    Brozzi, Flora; Lajus, Sophie; Diraison, Frederique; Rajatileka, Shavanthi; Hayward, Katy; Regazzi, Romano; Molnár, Elek; Váradi, Anikó

    2012-11-01

    Myosin- and Rab-interacting protein (MyRIP), which belongs to the protein kinase A (PKA)-anchoring family, is implicated in hormone secretion. However, its mechanism of action is not fully elucidated. Here we investigate the role of MyRIP in myosin Va (MyoVa)-dependent secretory granule (SG) transport and secretion in pancreatic beta cells. These cells solely express the brain isoform of MyoVa (BR-MyoVa), which is a key motor protein in SG transport. In vitro pull-down, coimmunoprecipitation, and colocalization studies revealed that MyRIP does not interact with BR-MyoVa in glucose-stimulated pancreatic beta cells, suggesting that, contrary to previous notions, MyRIP does not link this motor protein to SGs. Glucose-stimulated insulin secretion is augmented by incretin hormones, which increase cAMP levels and leads to MyRIP phosphorylation, its interaction with BR-MyoVa, and phosphorylation of the BR-MyoVa receptor rabphilin-3A (Rph-3A). Rph-3A phosphorylation on Ser-234 was inhibited by small interfering RNA knockdown of MyRIP, which also reduced cAMP-mediated hormone secretion. Demonstrating the importance of this phosphorylation, nonphosphorylatable and phosphomimic Rph-3A mutants significantly altered hormone release when PKA was activated. These data suggest that MyRIP only forms a functional protein complex with BR-MyoVa on SGs when cAMP is elevated and under this condition facilitates phosphorylation of SG-associated proteins, which in turn can enhance secretion.

  8. Intelligent walkers for the elderly: performance and safety testing of VA-PAMAID robotic walker.

    PubMed

    Rentschler, Andrew J; Cooper, Rory A; Blasch, Bruce; Boninger, Michael L

    2003-01-01

    A walker that could help navigate and avoid collisions with obstacles could help reduce health costs and increase the quality of care and independence of thousands of people. This study evaluated the safety and performance of the Veterans Affairs Personal Adaptive Mobility Aid (VA-PAMAID). We performed engineering tests on the VA-PAMAID to determine safety factors, including stability, energy consumption, fatigue life, and sensor and control malfunctions. The VA-PAMAID traveled 10.9 km on a full charge and avoided obstacles while traveling at a speed of up to 1.2 m/s. No failures occurred during static stability, climatic, or fatigue testing. Some problems were encountered during obstacle climbing and sensor and control testing. The VA-PAMAID has good range, has adequate reaction time, and is structurally sound. Clinical trials are planned to compare the device to other low-technical adaptive mobility devices.

  9. Forecasting VaR and ES of stock index portfolio: A Vine copula method

    NASA Astrophysics Data System (ADS)

    Zhang, Bangzheng; Wei, Yu; Yu, Jiang; Lai, Xiaodong; Peng, Zhenfeng

    2014-12-01

    Risk measurement has both theoretical and practical significance in risk management. Using daily sample of 10 international stock indices, firstly this paper models the internal structures among different stock markets with C-Vine, D-Vine and R-Vine copula models. Secondly, the Value-at-Risk (VaR) and Expected Shortfall (ES) of the international stock markets portfolio are forecasted using Monte Carlo method based on the estimated dependence of different Vine copulas. Finally, the accuracy of VaR and ES measurements obtained from different statistical models are evaluated by UC, IND, CC and Posterior analysis. The empirical results show that the VaR forecasts at the quantile levels of 0.9, 0.95, 0.975 and 0.99 with three kinds of Vine copula models are sufficiently accurate. Several traditional methods, such as historical simulation, mean-variance and DCC-GARCH models, fail to pass the CC backtesting. The Vine copula methods can accurately forecast the ES of the portfolio on the base of VaR measurement, and D-Vine copula model is superior to other Vine copulas.

  10. 75 FR 35511 - Virginia Disaster Number VA-00028

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-22

    ... SMALL BUSINESS ADMINISTRATION [Disaster Declaration 12040 and 12041] Virginia Disaster Number VA-00028 AGENCY: Small Business Administration. ACTION: Amendment 3. SUMMARY: This is an amendment of the... declaration remains unchanged. (Catalog of Federal Domestic Assistance Numbers 59002 and 59008) Roger B...

  11. VA/DOD Federal Health Care Center: Costly Information Technology Delays Continue and Evaluation Plan Lacking

    DTIC Science & Technology

    2012-06-01

    Lovell Federal Health Care Center ( FHCC ). Although DOD and VA have shared resources at some level since the 1980s,1 the FHCC is unique in that it is...establish a 5-year demonstration to integrate VA and DOD medical care into a first-of- its-kind FHCC in North Chicago, Illinois. Expectations for the... FHCC are outlined in the Executive Agreement signed by VA and DOD in April 2010. The NDAA for Fiscal Year 2010, as amended by the NDAA for

  12. 38 CFR 3.2130 - Will VA accept a signature by mark or thumbprint?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... signature by mark or thumbprint? 3.2130 Section 3.2130 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF... of This Title General § 3.2130 Will VA accept a signature by mark or thumbprint? VA will accept signatures by mark or thumbprint if: (a) They are witnessed by two people who sign their names and give their...

  13. 30 CFR 57.22240 - Actions at 2.0 percent methane (V-A mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Actions at 2.0 percent methane (V-A mines). 57... MINES Safety Standards for Methane in Metal and Nonmetal Mines Ventilation § 57.22240 Actions at 2.0 percent methane (V-A mines). If methane reaches 2.0 percent in the mine atmosphere, all persons other than...

  14. Making Bullying Prevention a Priority in Finnish Schools: The KiVa Antibullying Program

    ERIC Educational Resources Information Center

    Salmivalli, Christina; Poskiparta, Elisa

    2012-01-01

    The KiVa antibullying program has been widely implemented in Finnish comprehensive schools since 2009. The program is predicated on the idea that a positive change in the behaviors of classmates can reduce the rewards gained by the perpetrators of bullying and consequently their motivation to bully in the first place. KiVa involves both universal…

  15. 30 CFR 57.22240 - Actions at 2.0 percent methane (V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Actions at 2.0 percent methane (V-A mines). 57... MINES Safety Standards for Methane in Metal and Nonmetal Mines Ventilation § 57.22240 Actions at 2.0 percent methane (V-A mines). If methane reaches 2.0 percent in the mine atmosphere, all persons other than...

  16. Using average cost methods to estimate encounter-level costs for medical-surgical stays in the VA.

    PubMed

    Wagner, Todd H; Chen, Shuo; Barnett, Paul G

    2003-09-01

    The U.S. Department of Veterans Affairs (VA) maintains discharge abstracts, but these do not include cost information. This article describes the methods the authors used to estimate the costs of VA medical-surgical hospitalizations in fiscal years 1998 to 2000. They estimated a cost regression with 1996 Medicare data restricted to veterans receiving VA care in an earlier year. The regression accounted for approximately 74 percent of the variance in cost-adjusted charges, and it proved to be robust to outliers and the year of input data. The beta coefficients from the cost regression were used to impute costs of VA medical-surgical hospital discharges. The estimated aggregate costs were reconciled with VA budget allocations. In addition to the direct medical costs, their cost estimates include indirect costs and physician services; both of these were allocated in proportion to direct costs. They discuss the method's limitations and application in other health care systems.

  17. 77 FR 7229 - Virginia Disaster Number VA-00037

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-10

    ... SMALL BUSINESS ADMINISTRATION [Disaster Declaration 12909 and 12910] Virginia Disaster Number VA-00037 AGENCY: U.S. Small Business Administration. ACTION: Amendment 3. SUMMARY: This is an amendment of... remains unchanged. (Catalog of Federal Domestic Assistance Numbers 59002 and 59008.) Jane M. D. Pease...

  18. ViVaMBC: estimating viral sequence variation in complex populations from illumina deep-sequencing data using model-based clustering.

    PubMed

    Verbist, Bie; Clement, Lieven; Reumers, Joke; Thys, Kim; Vapirev, Alexander; Talloen, Willem; Wetzels, Yves; Meys, Joris; Aerssens, Jeroen; Bijnens, Luc; Thas, Olivier

    2015-02-22

    Deep-sequencing allows for an in-depth characterization of sequence variation in complex populations. However, technology associated errors may impede a powerful assessment of low-frequency mutations. Fortunately, base calls are complemented with quality scores which are derived from a quadruplet of intensities, one channel for each nucleotide type for Illumina sequencing. The highest intensity of the four channels determines the base that is called. Mismatch bases can often be corrected by the second best base, i.e. the base with the second highest intensity in the quadruplet. A virus variant model-based clustering method, ViVaMBC, is presented that explores quality scores and second best base calls for identifying and quantifying viral variants. ViVaMBC is optimized to call variants at the codon level (nucleotide triplets) which enables immediate biological interpretation of the variants with respect to their antiviral drug responses. Using mixtures of HCV plasmids we show that our method accurately estimates frequencies down to 0.5%. The estimates are unbiased when average coverages of 25,000 are reached. A comparison with the SNP-callers V-Phaser2, ShoRAH, and LoFreq shows that ViVaMBC has a superb sensitivity and specificity for variants with frequencies above 0.4%. Unlike the competitors, ViVaMBC reports a higher number of false-positive findings with frequencies below 0.4% which might partially originate from picking up artificial variants introduced by errors in the sample and library preparation step. ViVaMBC is the first method to call viral variants directly at the codon level. The strength of the approach lies in modeling the error probabilities based on the quality scores. Although the use of second best base calls appeared very promising in our data exploration phase, their utility was limited. They provided a slight increase in sensitivity, which however does not warrant the additional computational cost of running the offline base caller. Apparently

  19. 77 FR 12647 - Fund Availability Under VA's Homeless Providers Grant and Per Diem Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-01

    ... Affairs (VA) is announcing the availability of funds for applications for assistance under the Per Diem..., application process, and amount of funding available. DATES: Applications must be received in accordance with... Providers Grant and Per Diem Program for eligible entities. VA will award only one application for funding...

  20. VA Library Service--Today's look at Tomorrow's Library.

    ERIC Educational Resources Information Center

    Veterans Administration, Washington, DC.

    The Conference Poceedings are divided into three broad topics: systems planning, audiovisuals in biomedical communication, and automation and networking. Speakers from within the Veterans Administration (VA), from the National Medical Audiovisual Center, and the Lister Hill National Center for Biomedical Communications, National Library of…

  1. Solution behavior of PVP-VA and HPMC-AS-based amorphous solid dispersions and their bioavailability implications.

    PubMed

    Qian, Feng; Wang, Jennifer; Hartley, Ruiling; Tao, Jing; Haddadin, Raja; Mathias, Neil; Hussain, Munir

    2012-10-01

    To identify the mechanism behind the unexpected bio-performance of two amorphous solid dispersions: BMS-A/PVP-VA and BMS-A/HPMC-AS. Solubility of crystalline BMS-A in PVP-VA and HPMC-AS was measured by DSC. Drug-polymer interaction parameters were obtained by Flory-Huggins model fitting. Drug dissolution kinetics of spray-dried dispersions were studied under sink and non-sink conditions. BMS-A supersaturation was studied in the presence of pre-dissolved PVP-VA and HPMC-AS. Potency and crystallinity of undissolved solid dispersions were determined by HPLC and DSC. Polymer dissolution kinetics were obtained by mass balance calculation. Bioavailability of solid dispersions was assessed in dogs. In solid state, both polymers are miscible with BMS-A, while PVP-VA solublizes the drug better. BMS-A dissolves similarly from both solid dispersions in vitro regardless of dissolution method, while the HPMC-AS dispersion performed much better in vivo. At the same concentration, HPMC-AS is more effective in prolonging BMS-A supersaturation; this effect was negated by the slow dissolution rate of HPMC-AS. Further study revealed that fast PVP-VA dissolution resulted in elevated drug loading in undissolved dispersions and facilitated drug recrystallization before complete release. In contrast, the hydrophobicity and slower HPMC-AS dissolution prevented BMS-A recrystallization within the HPMC-AS matrix for >24 h. The lower bioavailability of PVP-VA dispersion was attributed to BMS-A recrystallization within the undissolved dispersion, due to hydrophilicity and fast PVP-VA dissolution rate. Polymer selection for solid dispersion development has significant impact on in vivo performance besides physical stability.

  2. Military Sexual Trauma: Improvements Made, but VA Can Do More to Track and Improve the Consistency of Disability Claim Decisions

    DTIC Science & Technology

    2014-06-01

    traumatic stress disorder (PTSD), depression , and anxiety disorders. Federal law generally entitles veterans with service-connected disabilities (i.e... depression or anxiety disorders. 7 38 C.F.R. § 3.304(f)(5). The regulation also provides that VA will not deny a PTSD claim based on in-service personal...received, completed, and either approved or denied by disability claimed (e.g., PTSD, depression , or anxiety disorders), gender of the veteran, and VBA

  3. The impact of the Department of Veterans Affairs Health Care Personnel Enhancement Act of 2004 on VA physicians' salaries and retention.

    PubMed

    Weeks, William B; Wallace, Tanner A; Wallace, Amy E

    2009-01-01

    To determine whether the Department of Veterans Affairs Health Care Personnel Enhancement Act (the Act), which was designed to achieve VA physician salary parity with American Academy of Medical Colleges (AAMC) Associate Professors and enacted in 2006, had achieved its goal. Using VA human resources datasets and data from the AAMC, we calculated mean VA physician salaries, with 95 percent confidence intervals, for 15 different medical specialties. For each specialty, we compared VA salaries to the median, 25th, and 75th percentile of AAMC Associate Professors' incomes. The Act's passage resulted in a $20,000 annual increase in VA physicians' salaries. VA primary care physicians, medical subspecialists, and psychiatrists had salaries that were comparable to their AAMC counterparts prior to and after enactment of the Act. However, VA surgical specialists', anesthesiologists', and radiologists' salaries lagged their AAMC counterparts both before and after the Act's enactment. Income increases were negatively correlated with full-time workforce changes. VA does not appear to provide comparable salaries for physicians necessary for surgical care. In certain cases, VA should consider outsourcing surgical services.

  4. Racial and Ethnic Disparities in the VA Health Care System: A Systematic Review

    PubMed Central

    Freeman, Michele; Toure, Joahd; Tippens, Kimberly M.; Weeks, Christine; Ibrahim, Said

    2008-01-01

    Objectives To better understand the causes of racial disparities in health care, we reviewed and synthesized existing evidence related to disparities in the “equal access” Veterans Affairs (VA) health care system. Methods We systematically reviewed and synthesized evidence from studies comparing health care utilization and quality by race within the VA. Results Racial disparities in the VA exist across a wide range of clinical areas and service types. Disparities appear most prevalent for medication adherence and surgery and other invasive procedures, processes that are likely to be affected by the quantity and quality of patient–provider communication, shared decision making, and patient participation. Studies indicate a variety of likely root causes of disparities including: racial differences in patients’ medical knowledge and information sources, trust and skepticism, levels of participation in health care interactions and decisions, and social support and resources; clinician judgment/bias; the racial/cultural milieu of health care settings; and differences in the quality of care at facilities attended by different racial groups. Conclusions Existing evidence from the VA indicates several promising targets for interventions to reduce racial disparities in the quality of health care. PMID:18301951

  5. Evaluation of VA Women's Health Fellowships: developing leaders in academic women's health.

    PubMed

    Tilstra, Sarah A; Kraemer, Kevin L; Rubio, Doris M; McNeil, Melissa A

    2013-07-01

    The Department of Veterans Affairs (VA) instituted the VA Women's Health Fellowship (VAWHF) Program in 1994, to accommodate the health needs of increasing numbers of female veterans and to develop academic leaders in women's health. Despite the longevity of the program, it has never been formally evaluated. To describe the training environments of VAWHFs and career outcomes of female graduates. Cross-sectional web-based surveys of current program directors (2010-2011) and VAWHF graduates (1995-2011). Responses were received from six of seven program directors (86 %) and 42 of 74 graduates (57 %). The mean age of graduates was 41.2 years, and mean time since graduation was 8.5 years. Of the graduates, 97 % were female, 74 % trained in internal medicine, and 64 % obtained an advanced degree. Those with an advanced degree were more likely than those without an advanced degree to pursue an academic career (82 % vs. 60 %; P<0.01). Of the female graduates, 76 % practice clinical women's health and spend up to 66 % of their time devoted to women's health issues. Thirty percent have held a VA faculty position. Seventy-nine percent remain in academics, with 39 % in the tenure stream. Overall, 94 % had given national presentations, 88 % had received grant funding, 79 % had published in peer-reviewed journals, 64 % had developed or evaluated curricula, 51 % had received awards for teaching or research, and 49 % had held major leadership positions. At 11 or more years after graduation, 33 % of the female graduates in academics had been promoted to the rank of associate professor and 33 % to the rank of full professor. The VAWHF Program has been successful in training academic leaders in women's health. Finding ways to retain graduates in the VA system would ensure continued clinical, educational, and research success for the VA women veteran's healthcare program.

  6. Integration of Neuropsychological Services in a VA HIV Primary Care Clinic.

    PubMed

    Dux, Moira C; Lee-Wilk, Terry

    2018-05-01

    The Department of Veteran Affairs (VA) is the largest health care provider for individuals with human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS), with >28,000 Veterans with HIV/AIDS enrolled in care. Advances in medical treatment have improved the life-limiting effects of the disease, though many chronic symptoms persist. Comprehensive care is critical to manage the diverse constellation of symptoms. However, many patients face challenges to receiving optimal care due to limited resources, mistrust of health care providers, and/or co-occurring medical, psychiatric, and substance use disorders. The VA is a leader in developing integrated models of care to address these barriers. The inclusion of subspecialty mental health and substance abuse treatment in HIV care has been implemented across many VAs, with evidence of improved patient outcomes. However, neuropsychology has not traditionally been included, despite the fact that cognitive dysfunction represents one of the most ubiquitous complications of HIV/AIDS. Cognitive impairment is associated with myriad negative outcomes including medication non-adherence, reduced quality of life, and increased mortality. We contend that neuropsychologists are uniquely equipped to contribute to the comprehensive care of patients with HIV/AIDS. Neuropsychologists understand the range of factors that can impact cognition and have the requisite knowledge and skills to assess and treat cognitive dysfunction. Although we focus on HIV/AIDS, neuropsychologists often play critical roles in the provision of care for other infectious diseases (e.g., hepatitis C).

  7. Collaboration in health services research: on developing relationships between VA researchers and those in other institutions.

    PubMed Central

    Greenlick, M R; Freeborn, D K

    1986-01-01

    This article explores the potential for collaboration between investigators in institutions outside of the VA and those engaged in research within the VA. The focus is on the potential for collaborative work in health services research; our perspective is that of researchers in a freestanding HMO research center affiliated with the Veterans Administration's Northwest Health Services Research and Development Field Program. The paper begins with a review of the reasons that make collaboration between VA researchers and other health services researchers so appropriate at this time. An example of collaboration is presented, drawing on the experience of the Northwest Field Program and the Kaiser Permanente Center for Health Research. Finally, some difficulties inherent in collaboration between VA and other health services researchers are discussed. PMID:3512485

  8. Quality Of End-Of-Life Care Is Higher In The VA Compared To Care Paid For By Traditional Medicare.

    PubMed

    Gidwani-Marszowski, Risha; Needleman, Jack; Mor, Vincent; Faricy-Anderson, Katherine; Boothroyd, Derek B; Hsin, Gary; Wagner, Todd H; Lorenz, Karl A; Patel, Manali I; Joyce, Vilija R; Murrell, Samantha S; Ramchandran, Kavitha; Asch, Steven M

    2018-01-01

    Congressional and Veterans Affairs (VA) leaders have recommended the VA become more of a purchaser than a provider of health care. Fee-for-service Medicare provides an example of how purchased care differs from the VA's directly provided care. Using established indicators of overly intensive end-of-life care, we compared the quality of care provided through the two systems to veterans dying of cancer in fiscal years 2010-14. The Medicare-reliant veterans were significantly more likely to receive high-intensity care, in the form of chemotherapy, hospital stays, admission to the intensive care unit, more days spent in the hospital, and death in the hospital. However, they were significantly less likely than VA-reliant patients to have multiple emergency department visits. Higher-intensity end-of-life care may be driven by financial incentives present in fee-for-service Medicare but not in the VA's integrated system. To avoid putting VA-reliant veterans at risk of receiving lower-quality care, VA care-purchasing programs should develop coordination and quality monitoring programs to guard against overly intensive end-of-life care.

  9. Geropsychology Training in a VA Nursing Home Setting

    ERIC Educational Resources Information Center

    Karel, Michele J.; Moye, Jennifer

    2005-01-01

    There is a growing need for professional psychology training in nursing home settings, and nursing homes provide a rich environment for teaching geropsychology competencies. We describe the nursing home training component of our Department of Veterans Affairs (VA) Predoctoral Internship and Geropsychology Postdoctoral Fellowship programs. Our…

  10. Access to mental health care among women Veterans: is VA meeting women's needs?

    PubMed

    Kimerling, Rachel; Pavao, Joanne; Greene, Liberty; Karpenko, Julie; Rodriguez, Allison; Saweikis, Meghan; Washington, Donna L

    2015-04-01

    Patient-centered access to mental health describes the fit between patient needs and resources of the system. To date, little data are available to guide implementation of services to women veterans, an underrepresented minority within Department of Veteran Affairs (VA) health care. The current study examines access to mental health care among women veterans, and identifies gender-related indicators of perceived access to mental health care. A population-based sample of 6287 women veterans using VA primary care services participated in a survey of past year perceived need for mental health care, mental health utilization, and gender-related mental health care experiences. Subjective rating of how well mental health care met their needs was used as an indicator of perceived access. Half of all women reported perceived mental health need; 84.3% of those women received care. Nearly all mental health users (90.9%) used VA services, although only about half (48.8%) reported that their mental health care met their needs completely or very well. Gender related experiences (availability of female providers, women-only treatment settings, women-only treatment groups, and gender-related comfort) were each associated with 2-fold increased odds of perceived access, and associations remained after adjusting for ease of getting care. Women VA users demonstrate very good objective access to mental health services. Desire for, and access to specialized mental health services for women varies across the population and are important aspects of shared decision making in referral and treatment planning for women using VA primary care.

  11. 76 FR 27970 - Safety Zone; Cape Charles Fireworks, Cape Charles Harbor, Cape Charles, VA.

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-13

    ... Charles will sponsor a fireworks display on the shoreline of the navigable waters of Cape Charles City...[deg]01'30'' W (NAD 1983). This safety zone will be established in the vicinity of Cape Charles, VA...-AA00 Safety Zone; Cape Charles Fireworks, Cape Charles Harbor, Cape Charles, VA. AGENCY: Coast Guard...

  12. 76 FR 38302 - Safety Zone; Cape Charles Fireworks, Cape Charles Harbor, Cape Charles, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-30

    ... the Town of Cape Charles will sponsor a fireworks display on the shoreline of the navigable waters of...-AA00 Safety Zone; Cape Charles Fireworks, Cape Charles Harbor, Cape Charles, VA AGENCY: Coast Guard... navigable waters of Cape Charles City Harbor in Cape Charles, VA in support of the Fourth of July Fireworks...

  13. 76 FR 67557 - Proposed Information Collection (Survey of Veteran Enrollees' Health and Reliance Upon VA...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-01

    ... of Veteran Enrollees' Health and Reliance Upon VA) Activity: Comment Request AGENCY: Veterans Health... enrollees' health status and reliance on VA's health care services. DATES: Written comments and... of automated collection techniques or the use of other forms of information technology. Title: Survey...

  14. Use of the Decision Support System for VA cost-effectiveness research.

    PubMed

    Barnett, P G; Rodgers, J H

    1999-04-01

    The Department of Veterans Affairs is adopting the Decision Support System (DSS), computer software and databases which include a cost-accounting system which determines the cost of health care products and patient encounters. A system for providing cost data for cost-effectiveness analysis should be provide valid, detailed, and comprehensive data that can be aggregated. The design of DSS is described and compared with those criteria. Utilization data from DSS was compared with other VA utilization data. Aggregate DSS cost data from 35 medical centers was compared with relative resource weights developed for the Medicare program. Data on hospital stays at 3 facilities found that 3.7% of the stays in DSS were not in the VA discharge database, whereas 7.6% of the stays in the discharge data were not in DSS. DSS reported between 68.8% and 97.1% of the outpatient encounters reported by six facilities in the ambulatory care data base. Relative weights for each Diagnosis Related Group based on DSS data from 35 VA facilities correlated with Medicare weights (correlation coefficient of .853). DSS will be useful for research if certain problems are overcome. It is difficult to distinguish long-term from acute hospital care. VA does not have a complete database of all inpatient procedures, so DSS has not assigned them a specific cost. The authority to access encounter-level DSS data needs to be centralized. Researchers can provide the feedback needed to improve DSS cost estimates. A comprehensive encounter-level extract would facilitate use of DSS for research.

  15. Brand-Name Prescription Drug Use Among Diabetes Patients in the VA and Medicare Part D: A National Comparison

    PubMed Central

    Gellad, Walid F.; Donohue, Julie M.; Zhao, Xinhua; Mor, Maria K.; Thorpe, Carolyn T.; Smith, Jeremy; Good, Chester B.; Fine, Michael J.; Morden, Nancy E.

    2013-01-01

    Background Medicare Part D and the Department of Veterans Affairs (VA) use different approaches to manage prescription drug benefits, with implications for spending. Medicare relies on private plans with distinct formularies, whereas VA administers its own benefit using a national formulary. Objective To compare overall and regional rates of brand-name drug use among older adults with diabetes in Medicare and VA. Design Retrospective cohort Setting Medicare and VA Patients National sample in 2008 of 1,061,095 Part D beneficiaries and 510,485 Veterans age 65+ with diabetes. Measurements Percent of patients on oral hypoglycemics, statins, and angiotensin-converting-enzyme inhibitors/angiotensin-receptor-blockers who filled brand-name drugs and percent of patients on long-acting insulin who filled analogues. We compared sociodemographic and health-status adjusted hospital referral region (HRR) brand-name use to examine local practice patterns, and calculated changes in spending if each system’s brand-name use mirrored the other. Results Brand-name use in Medicare was 2–3 times that of VA: 35.3% vs. 12.7% for oral hypoglycemics, 50.7% vs. 18.2% for statins, 42.5% vs. 20.8% for angiotensin-converting-enzyme inhibitors/angiotensin-receptor-blockers, and 75.1% vs. 27.0% for insulin analogues. Adjusted HRR brand-name statin use ranged (5th to 95th percentile) from 41.0%–58.3% in Medicare and 6.2%–38.2% in VA. For each drug group, the HRR at the 95th percentile in VA had lower brand-name use than the 5th percentile HRR in Medicare. Medicare spending in this population would have been $1.4 billion less if brand-name use matched the VA for these medications. Limitation This analysis cannot fully describe the factors underlying differences in brand-name use. Conclusions Medicare beneficiaries with diabetes use 2–3 times more brand-name drugs than a comparable group within VA, at substantial excess cost. Primary Funding Sources VA; NIH; RWJF PMID:23752663

  16. Comparative Analysis of VaR Estimation of Double Long-Memory GARCH Models: Empirical Analysis of China's Stock Market

    NASA Astrophysics Data System (ADS)

    Cao, Guangxi; Guo, Jianping; Xu, Lin

    GARCH models are widely used to model the volatility of financial assets and measure VaR. Based on the characteristics of long-memory and lepkurtosis and fat tail of stock market return series, we compared the ability of double long-memory GARCH models with skewed student-t-distribution to compute VaR, through the empirical analysis of Shanghai Composite Index (SHCI) and Shenzhen Component Index (SZCI). The results show that the ARFIMA-HYGARCH model performance better than others, and at less than or equal to 2.5 percent of the level of VaR, double long-memory GARCH models have stronger ability to evaluate in-sample VaRs in long position than in short position while there is a diametrically opposite conclusion for ability of out-of-sample VaR forecast.

  17. 12 CFR 217.205 - VaR-based measure.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... requirements. The Board-regulated institution must update data sets at least monthly or more frequently as... year. Data used to determine the VaR-based measure must be relevant to the Board-regulated institution.... A Board-regulated institution using this option must update its data more frequently than monthly...

  18. KiVa Anti-Bullying Program in Italy: Evidence of Effectiveness in a Randomized Control Trial.

    PubMed

    Nocentini, Annalaura; Menesini, Ersilia

    2016-11-01

    The present study aims to evaluate the effectiveness of the KiVa anti-bullying program in Italy through a randomized control trial of students in grades 4 and 6. The sample involved 2042 students (51 % female; grade 4, mean age = 8.85; ds = 0.43; grade 6, mean age = 10.93; ds = 0.50); 13 comprehensive schools were randomly assigned into intervention (KiVa) or control (usual school provision) conditions. Different outcomes (bullying, victimization, pro-bullying attitudes, pro-victim attitudes, empathy toward victims), analyses (longitudinal mixed model with multiple-item scales; longitudinal prevalence of bullies and victims using Olweus' single question), and estimates of effectiveness (Cohen's d; odds ratios) were considered in order to compare the Italian results with those from other countries. Multilevel models showed that KiVa reduced bullying and victimization and increased pro-victim attitudes and empathy toward the victim in grade 4, with effect sizes from 0.24 to 0.40. In grade 6, KiVa reduced bullying, victimization, and pro-bullying attitudes; the effects were smaller as compared to grade 4, yet significant (d ≥ 0.20). Finally, using Olweus dichotomous definition of bullies and victims, results showed that the odds of being a victim were 1.93 times higher for a control student than for a KiVa student in grade 4. Overall, the findings provide evidence of the effectiveness of the program in Italy; the discussion will focus on factors that influenced successfully the transportability of the KiVa program in Italy.

  19. Validity testing and neuropsychology practice in the VA healthcare system: results from recent practitioner survey (.).

    PubMed

    Young, J Christopher; Roper, Brad L; Arentsen, Timothy J

    2016-05-01

    A survey of neuropsychologists in the Veterans Health Administration examined symptom/performance validity test (SPVT) practices and estimated base rates for patient response bias. Invitations were emailed to 387 psychologists employed within the Veterans Affairs (VA), identified as likely practicing neuropsychologists, resulting in 172 respondents (44.4% response rate). Practice areas varied, with 72% at least partially practicing in general neuropsychology clinics and 43% conducting VA disability exams. Mean estimated failure rates were 23.0% for clinical outpatient, 12.9% for inpatient, and 39.4% for disability exams. Failure rates were the highest for mTBI and PTSD referrals. Failure rates were positively correlated with the number of cases seen and frequency and number of SPVT use. Respondents disagreed regarding whether one (45%) or two (47%) failures are required to establish patient response bias, with those administering more measures employing the more stringent criterion. Frequency of the use of specific SPVTs is reported. Base rate estimates for SPVT failure in VA disability exams are comparable to those in other medicolegal settings. However, failure in routine clinical exams is much higher in the VA than in other settings, possibly reflecting the hybrid nature of the VA's role in both healthcare and disability determination. Generally speaking, VA neuropsychologists use SPVTs frequently and eschew pejorative terms to describe their failure. Practitioners who require only one SPVT failure to establish response bias may overclassify patients. Those who use few or no SPVTs may fail to identify response bias. Additional clinical and theoretical implications are discussed.

  20. Effects of the KiVa antibullying program on cyberbullying and cybervictimization frequency among Finnish youth.

    PubMed

    Williford, Anne; Elledge, L Christian; Boulton, Aaron J; DePaolis, Kathryn J; Little, Todd D; Salmivalli, Christina

    2013-01-01

    Cyberbullying among school-aged children has received increased attention in recent literature. However, no empirical evidence currently exists on whether existing school-based antibullying programs are effective in targeting the unique aspects of cyberbullying. To address this important gap, the present study investigates the unique effects of the KiVa Antibullying Program on the frequency of cyberbullying and cybervictimization among elementary and middle school youth. Using data from a group randomized controlled trial, multilevel ordinal regression analyses were used to examine differences in the frequencies of cyberbullying and cybervictimization between intervention (N = 9,914) and control students (N = 8,498). The effects of age and gender on frequencies of cyber behaviors were also assessed across conditions. Results revealed a significant intervention effect on the frequency of cybervictimization; KiVa students reported lower frequencies of cybervictimization at posttest than students in a control condition. The effect of condition on the perpetration of cyberbullying was moderated by age. When student age was below the sample mean, KiVa students reported lower frequencies of cyberbullying than students in the control condition. We also found evidence of classroom level variation in cyberbullying and cybervictimization, suggesting cyberbullying is in part a classroom-level phenomenon. KiVa appears to be an efficacious program to address cyber forms of bullying and victimization. We discuss several unique aspects of KiVa that may account for the significant intervention effects. Results suggest that KiVa is an intervention option for schools concerned with reducing cyberbullying behavior and its deleterious effects on children's adjustment.

  1. Using policy to increase prescribing of smoking cessation medications in the VA healthcare system.

    PubMed

    Smith, Mark W; Chen, Shuo; Siroka, Andrew M; Hamlett-Berry, Kim

    2010-12-01

    Since 2002 the US Veterans Affairs (VA) healthcare system has initiated national policies and programmes to reduce smoking among its patients and to increase evidence-based treatment for smoking. To document changes in dispensing rates of cessation-related medications in VA from 2004 to 2008. Retrospective analysis of VA administrative data. Prescription fills for nicotine replacement therapy (NRT), and for bupropion among NRT users, each grew more than 60% in four years. The increase stemmed primarily from treating more people rather than from filling more prescriptions per person. The results provide strong support for the efficacy of these policies and illustrate how healthcare systems can successfully employ multiple strategies to increase evidence-based smoking-cessation treatment.

  2. 30 CFR 57.22218 - Seals and stoppings (III, V-A, and V-B mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Seals and stoppings (III, V-A, and V-B mines... NONMETAL MINES Safety Standards for Methane in Metal and Nonmetal Mines Ventilation § 57.22218 Seals and stoppings (III, V-A, and V-B mines). (a) All seals, and those stoppings that separate main intake from main...

  3. 30 CFR 57.22218 - Seals and stoppings (III, V-A, and V-B mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Seals and stoppings (III, V-A, and V-B mines... NONMETAL MINES Safety Standards for Methane in Metal and Nonmetal Mines Ventilation § 57.22218 Seals and stoppings (III, V-A, and V-B mines). (a) All seals, and those stoppings that separate main intake from main...

  4. 30 CFR 57.22608 - Secondary blasting (I-A, II-A, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Secondary blasting (I-A, II-A, and V-A mines). 57.22608 Section 57.22608 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF... blasting (I-A, II-A, and V-A mines). Prior to secondary blasting, tests for methane shall be made in the...

  5. 30 CFR 57.22608 - Secondary blasting (I-A, II-A, and V-A mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Secondary blasting (I-A, II-A, and V-A mines). 57.22608 Section 57.22608 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF... blasting (I-A, II-A, and V-A mines). Prior to secondary blasting, tests for methane shall be made in the...

  6. 30 CFR 57.22101 - Smoking (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Smoking (I-A, II-A, III, and V-A mines). 57.22101 Section 57.22101 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... Smoking (I-A, II-A, III, and V-A mines). Persons shall not smoke or carry smoking materials, matches, or...

  7. 30 CFR 57.22101 - Smoking (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Smoking (I-A, II-A, III, and V-A mines). 57.22101 Section 57.22101 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... Smoking (I-A, II-A, III, and V-A mines). Persons shall not smoke or carry smoking materials, matches, or...

  8. 30 CFR 57.22101 - Smoking (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Smoking (I-A, II-A, III, and V-A mines). 57.22101 Section 57.22101 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... Smoking (I-A, II-A, III, and V-A mines). Persons shall not smoke or carry smoking materials, matches, or...

  9. 30 CFR 57.22101 - Smoking (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Smoking (I-A, II-A, III, and V-A mines). 57.22101 Section 57.22101 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... Smoking (I-A, II-A, III, and V-A mines). Persons shall not smoke or carry smoking materials, matches, or...

  10. Managing the human side of change in VA's transformation.

    PubMed

    Backer, T E

    1997-01-01

    Transformational change interventions often fail or short fall of their intended impact on organizations and systems. One main reason is that these interventions frequently do not strategically address the complex human dynamics of change. This happens despite awareness of and commitment to intervening at this level by top management and change leaders. The wisdom that "systems don't change; people change" is widely acknowledged but inadequately applied. These are exactly the conditions the U.S. Department of Veterans Affairs (VA) faces in deploying its new Veterans Integrated Services Networks (VISNs). Applying validated behavioral science strategies that address the human side of change will help VA implement VISNs effectively. Six strategies derived from many years of study and practice in the public and private sectors are discussed, along with suggestions for VISN managers about how to implement them.

  11. Initiating an ophthalmic laser program for VA outpatients.

    PubMed

    Newcomb, R D

    1995-08-01

    Administrative and clinical considerations for the establishment of an ophthalmic laser program at a VA Outpatient Clinic are discussed. Outcomes of the first 320 patients treated over a 3-year period of time are presented. The program is evaluated from the perspectives of patient care, safety, maintenance, education, and economics.

  12. 77 FR 39346 - Proposed Information Collection (Statement of Accredited Representative in Appealed Case, VA Form...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-02

    ... in Appealed Case, VA Form 646. OMB Control Number: 2900-0042. Type of Review: Extension of a... (Statement of Accredited Representative in Appealed Case, VA Form 646) Activity: Comment Request AGENCY: The Board of Veterans' Appeals (BVA), Department of Veterans Affairs. ACTION: Notice. SUMMARY: The Board of...

  13. Effectiveness of Expanded Implementation of STAR-VA for Managing Dementia-Related Behaviors Among Veterans.

    PubMed

    Karel, Michele J; Teri, Linda; McConnell, Eleanor; Visnic, Stephanie; Karlin, Bradley E

    2016-02-01

    Nonpharmacological, psychosocial approaches are first-line treatments for managing behavioral symptoms in dementia, but they can be challenging to implement in long-term care settings. The Veterans Health Administration implemented STAR-VA, an interdisciplinary behavioral approach for managing challenging dementia-related behaviors in its Community Living Center (CLCs, nursing home care) settings. This study describes how the program was implemented and provides an evaluation of Veteran clinical outcomes and staff feedback on the intervention. One mental health professional and registered nurse team from 17 CLCs completed STAR-VA training, which entailed an experiential workshop followed by 6 months of expert consultation as they worked with their teams to implement STAR-VA with Veterans identified to have challenging dementia-related behaviors. The frequency and severity of target behaviors and symptoms of depression, anxiety, and agitation were evaluated at baseline and at intervention completion. Staff provided feedback regarding STAR-VA feasibility and impact. Seventy-one Veterans completed the intervention. Behaviors clustered into 6 types: care refusal or resistance, agitation, aggression, vocalization, wandering, and other. Frequency and severity of target behaviors and symptoms of depression, anxiety, and agitation all significantly decreased, with overall effect sizes of 1 or greater. Staff rated both benefits for Veterans and program feasibility favorably. This evaluation supports the feasibility and effectiveness of STAR-VA, an interdisciplinary, behavioral intervention for managing challenging behaviors among residents with dementia in CLCs. Published by Oxford University Press on behalf of the Gerontological Society of America 2015.

  14. Testing V-A in Top Decay at CDF at √s = 1.8 TeV

    NASA Astrophysics Data System (ADS)

    Kilminster, Ben

    2004-02-01

    The structure of the tbW vertex can be probed by measuring the polarization of the W in t → W + b → l + ν + b. The invariant mass of the the lepton and b quark measures the W decay angle which in turn allows a comparison with polarizations expected from a V-A and V+A tbW vertex. We measure the fraction by rate of Ws produced with a V+A coupling in lieu of the Standard Model V-A to be fV+A = -0.21-0.24+0.42 (stat) ± 0.21 (sys). We assign a limit of fV+A < 0.80 @ 95% CL. By combining this result with a complementary observable in the same data, we assign a limit of fV+A < 0.61 @ 95% CL. From this CDF Run I preliminary result, we find no evidence for a non-standard Model tbW vertex.

  15. 77 FR 48127 - Foreign-Trade Zone 20-Suffolk, VA; Notification of Proposed Production Activity, Usui...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-13

    ... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [B-53-2012] Foreign-Trade Zone 20--Suffolk, VA; Notification of Proposed Production Activity, Usui International Corporation, (Diesel Engine Fuel Lines), Chesapeake, VA The Virginia Port Authority, grantee of FTZ 20, submitted a notification of proposed production activity on behalf of Usui...

  16. 76 FR 59153 - Elizabeth Hartwell Mason Neck National Wildlife Refuge, Fairfax County, VA, and Featherstone...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-23

    ... DEPARTMENT OF THE INTERIOR Fish and Wildlife Service [FWS-R5-R-2011-N128; BAC-4311-K9-S3] Elizabeth Hartwell Mason Neck National Wildlife Refuge, Fairfax County, VA, and Featherstone National Wildlife Refuge, Prince William County, VA AGENCY: Fish and Wildlife Service, Interior. ACTION: Notice of...

  17. 48 CFR 852.219-72 - Evaluation factor for participation in the VA mentor-protégé program.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... participation in the VA mentor-protégé program. 852.219-72 Section 852.219-72 Federal Acquisition Regulations... Texts of Provisions and Clauses 852.219-72 Evaluation factor for participation in the VA mentor-protégé... the VA Mentor-Protégé Program (DEC2009) This solicitation contains an evaluation factor or sub-factor...

  18. Federal Health Care Center: VA and DOD Need to Develop Better Information to Monitor Operations and Improve Efficiency

    DTIC Science & Technology

    2017-01-01

    delivery of health care that would be more accessible and less expensive than operating two federal medical centers serving VA and DOD beneficiaries in...departments—including DOD’s operational readiness mission—by integrating services previously provided by the former North Chicago VA Medical Center...1VA beneficiaries include veterans of military service and certain dependents and survivors. DOD beneficiaries include active duty

  19. Correspondence of the Boston Assessment of Traumatic Brain Injury-Lifetime (BAT-L) clinical interview and the VA TBI screen.

    PubMed

    Fortier, Catherine Brawn; Amick, Melissa M; Kenna, Alexandra; Milberg, William P; McGlinchey, Regina E

    2015-01-01

    Mild traumatic brain injury is the signature injury of Operation Enduring Freedom (OEF), Operation Iraqi Freedom (OIF), and Operation New Dawn (OND), yet its identification and diagnosis is controversial and fraught with challenges. In 2007, the Department of Veterans Affairs (VA) implemented a policy requiring traumatic brain injury (TBI) screening on all individuals returning from deployment in the OEF/OIF/OND theaters of operation that lead to the rapid and widespread use of the VA TBI screen. The Boston Assessment of TBI-Lifetime (BAT-L) is the first validated, postcombat semistructured clinical interview to characterize head injuries and diagnose TBIs throughout the life span, including prior to, during, and post-military service. Community-dwelling convenience sample of 179 OEF/OIF/OND veterans. BAT-L, VA TBI screen. Based on BAT-L diagnosis of military TBI, the VA TBI screen demonstrated similar sensitivity (0.85) and specificity (0.82) when administered by research staff. When BAT-L diagnosis was compared with historical clinician-administered VA TBI screen in a subset of participants, sensitivity was reduced. The specificity of the research-administered VA TBI screen was more than adequate. The sensitivity of the VA TBI screen, although relatively high, suggests that it does not oversample or "catch all" possible military TBIs. Traumatic brain injuries identified by the BAT-L, but not identified by the VA TBI screen, were predominantly noncombat military injuries. There is potential concern regarding the validity and reliability of the clinician administered VA TBI screen, as we found poor correspondence between it and the BAT-L, as well as low interrater reliability between the clinician-administered and research-administered screen.

  20. 12 CFR 324.205 - VaR-based measure.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... risk-based capital requirements. The FDIC-supervised institution must update data sets at least monthly... observation period of at least one year. Data used to determine the VaR-based measure must be relevant to the... portfolio over a full business cycle. An FDIC-supervised institution using this option must update its data...

  1. 12 CFR 3.205 - VaR-based measure.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... bank or Federal savings association must update data sets at least monthly or more frequently as... be based on a historical observation period of at least one year. Data used to determine the VaR... using this option must update its data more frequently than monthly and in a manner appropriate for the...

  2. 30 CFR 57.22212 - Air flow (I-C, II-A, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Air flow (I-C, II-A, and V-A mines). 57.22212 Section 57.22212 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND... Standards for Methane in Metal and Nonmetal Mines Ventilation § 57.22212 Air flow (I-C, II-A, and V-A mines...

  3. 77 FR 72816 - Foreign-Trade Zone 20-Suffolk, VA; Authorization of Production Activity; Usui International...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-12-06

    ... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [B-53-2012] Foreign-Trade Zone 20--Suffolk, VA; Authorization of Production Activity; Usui International Corporation (Diesel Engine Fuel Lines); Chesapeake, VA On June 28, 2012, the Virginia Port Authority, grantee of FTZ 20, submitted a notification of proposed production activity to the...

  4. 78 FR 31840 - Safety Zone; USO Patriotic Festival Air Show, Atlantic Ocean; Virginia Beach, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-28

    ...-AA00 Safety Zone; USO Patriotic Festival Air Show, Atlantic Ocean; Virginia Beach, VA AGENCY: Coast... provide for the safety of life on navigable waters during the USO Patriotic Festival Air Show. This action... Patriotic Festival Air Show, Atlantic Ocean; Virginia Beach, VA. (a) Regulated Area. The following area is a...

  5. 77 FR 39404 - Safety Zone; Wicomico Community Fireworks Rain Date, Great Wicomico River, Mila, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-03

    ...-AA00 Safety Zone; Wicomico Community Fireworks Rain Date, Great Wicomico River, Mila, VA AGENCY: Coast... zone on the Great Wicomico River in the vicinity of Mila, VA in support of the Wicomico Community Rain... as follows: Sec. 165.T05-0425 Safety Zone; Wicomico Community Fireworks Rain Date, Great Wicomico...

  6. 38 CFR 17.71 - Revocation of VA approval.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Community Residential Care § 17.71 Revocation of VA approval. (a) If a hearing official determines under § 17.70 of this part that a community residential care facility does not comply with the standards set forth in § 17.63 of this part and determines that the community residential care facility shall not have...

  7. ENTRANCE TO CEMETERY FROM VA MEDICAL CENTER CAMPUS, WITH ADMINISTRATION ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    ENTRANCE TO CEMETERY FROM VA MEDICAL CENTER CAMPUS, WITH ADMINISTRATION BUILDING IN BACKGROUND. VIEW TO NORTH. - Bath National Cemetery, Department of Veterans Affairs Medical Center, San Juan Avenue, Bath, Steuben County, NY

  8. Identification and biochemical analysis of Slac2-c/MyRIP as a Rab27A-, myosin Va/VIIa-, and actin-binding protein.

    PubMed

    Kuroda, Taruho S; Fukuda, Mitsunori

    2005-01-01

    Slac2-c/MyRIP is a specific Rab27A-binding protein that contains an N-terminal synaptotagmin-like protein (Slp) homology domain (SHD, a newly identified GTP-Rab27A-binding motif), but in contrast to the Slp family proteins, it lacks C-terminal tandem C2 domains. In vitro Slac2-c simultaneously directly interacts with both Rab27A and an actin-based motor protein, myosin Va, via its N-terminal SHD and middle region, respectively, consistent with the fact that the overall structure of Slac2-c is similar to that of Slac2-a/melanophilin, a linker protein between Rab27A and myosin Va in the melanosome transport in melanocytes. Unlike Slac2-a, however, the middle region of Slac2-c interacts with two types of myosins, myosin Va and myosin VIIa. In addition, the most C-terminal part of both Slac2-a and Slac2-c functions as an actin-binding domain: it directly interacts with globular and fibrous actin in vitro, and the actin-binding domain of Slac2-a and Slac2-c colocalizes with actin filaments when it is expressed in living cells (i.e., PC12 cells and mouse melanocytes). In this chapter we describe the methods that have been used to analyze the protein-protein interactions of Slac2-c, specifically with Rab27A, myosin Va/VIIa, and actin.

  9. Toward a VA Women's Health Research Agenda: setting evidence-based priorities to improve the health and health care of women veterans.

    PubMed

    Yano, Elizabeth M; Bastian, Lori A; Frayne, Susan M; Howell, Alexandra L; Lipson, Linda R; McGlynn, Geraldine; Schnurr, Paula P; Seaver, Margaret R; Spungen, Ann M; Fihn, Stephan D

    2006-03-01

    The expansion of women in the military is reshaping the veteran population, with women now constituting the fastest growing segment of eligible VA health care users. In recognition of the changing demographics and special health care needs of women, the VA Office of Research & Development recently sponsored the first national VA Women's Health Research Agenda-setting conference to map research priorities to the needs of women veterans and position VA as a national leader in Women's Health Research. This paper summarizes the process and outcomes of this effort, outlining VA's research priorities for biomedical, clinical, rehabilitation, and health services research.

  10. Toward a VA Women's Health Research Agenda: Setting Evidence-based Priorities to Improve the Health and Health Care of Women Veterans

    PubMed Central

    Yano, Elizabeth M; Bastian, Lori A; Frayne, Susan M; Howell, Alexandra L; Lipson, Linda R; McGlynn, Geraldine; Schnurr, Paula P; Seaver, Margaret R; Spungen, Ann M; Fihn, Stephan D

    2006-01-01

    The expansion of women in the military is reshaping the veteran population, with women now constituting the fastest growing segment of eligible VA health care users. In recognition of the changing demographics and special health care needs of women, the VA Office of Research & Development recently sponsored the first national VA Women's Health Research Agenda-setting conference to map research priorities to the needs of women veterans and position VA as a national leader in Women's Health Research. This paper summarizes the process and outcomes of this effort, outlining VA's research priorities for biomedical, clinical, rehabilitation, and health services research. PMID:16637953

  11. Functional evaluation of sublingual microcirculation indicates successful weaning from VA-ECMO in cardiogenic shock.

    PubMed

    Akin, Sakir; Dos Reis Miranda, Dinis; Caliskan, Kadir; Soliman, Osama I; Guven, Goksel; Struijs, Ard; van Thiel, Robert J; Jewbali, Lucia S; Lima, Alexandre; Gommers, Diederik; Zijlstra, Felix; Ince, Can

    2017-10-26

    Veno-arterial extracorporeal membrane oxygenation (VA-ECMO) is increasingly adopted for the treatment of cardiogenic shock (CS). However, a marker of successful weaning remains largely unknown. Our hypothesis was that successful weaning is associated with sustained microcirculatory function during ECMO flow reduction. Therefore, we sought to test the usefulness of microcirculatory imaging in the same sublingual spot, using incident dark field (IDF) imaging in assessing successful weaning from VA-ECMO and compare IDF imaging with echocardiographic parameters. Weaning was performed by decreasing the VA-ECMO flow to 50% (F 50 ) from the baseline. The endpoint of the study was successful VA-ECMO explantation within 48 hours after weaning. The response of sublingual microcirculation to a weaning attempt (WA) was evaluated. Microcirculation was measured in one sublingual area (single spot (ss)) using CytoCam IDF imaging during WA. Total vessel density (TVDss) and perfused vessel density (PVDss) of the sublingual area were evaluated before and during 50% flow reduction (TVDss F50 , PVDss F50 ) after a WA and compared to conventional echocardiographic parameters as indicators of the success or failure of the WA. Patients (n = 13) aged 49 ± 18 years, who received VA-ECMO for the treatment of refractory CS due to pulmonary embolism (n = 5), post cardiotomy (n = 3), acute coronary syndrome (n = 2), myocarditis (n = 2) and drug intoxication (n = 1), were included. TVDss F50 (21.9 vs 12.9 mm/mm 2 , p = 0.001), PVDss F50 (19.7 vs 12.4 mm/mm 2 , p = 0.01) and aortic velocity-time integral (VTI) at 50% flow reduction (VTI F50 ) were higher in patients successfully weaned vs not successfully weaned. The area under the curve (AUC) was 0.99 vs 0.93 vs 0.85 for TVDss F50 (small vessels) >12.2 mm/mm 2 , left ventricular ejection fraction (LVEF) >15% and aortic VTI >11 cm. Likewise, the AUC was 0.91 vs 0.93 vs 0.85 for the PVDss F50 (all vessels) >14

  12. Military and VA General Dentistry Training: A National Resource.

    ERIC Educational Resources Information Center

    Atchison, Kathryn A.; Bachand, William; Buchanan, C. Richard; Lefever, Karen H.; Lin, Sylvia; Engelhardt, Rita

    2002-01-01

    Compared the program characteristics of the postgraduate general dentistry (PGD) training programs sponsored by the military and the Veterans Health Administration (VA). Gathered information on program infrastructure and emphasis, resident preparation prior to entering the program, and patients served and types of services provided. Programs…

  13. 78 FR 76061 - Authorization for Non-VA Medical Services

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-16

    ..., Health professions, Health records, Homeless, Mental health programs, Nursing homes, Reporting and... final rule adopts the proposed rule without changes. We received several comments urging VA to expand....009, Veterans Medical Care Benefits; 64.010, Veterans Nursing Home Care; 64.011, Veterans Dental Care...

  14. Characteristics and service utilization of homeless veterans entering VA substance use treatment.

    PubMed

    Cox, Koriann B; Malte, Carol A; Saxon, Andrew J

    2017-05-01

    This article compares characteristics and health care utilization patterns of homeless veterans entering substance use disorder (SUD) treatment. Baseline self-report and medical record data were collected from 181 homeless veterans participating in a randomized trial of SUD/housing case management. Veterans, categorized as newly (n = 45), episodically (n = 61), or chronically homeless (n = 75), were compared on clinical characteristics and health care utilization in the year prior to baseline. Between-groups differences were seen in stimulant use, bipolar, and depressive disorders. A significant majority accessed VA emergency department services, and nearly half accessed inpatient services, with more utilization among chronically versus newly homeless. A majority in all groups attended VA primary care (73.5%) and mental health (56.9%) visits, and 26.7% newly, 32.8% episodically, and 56.0% chronically homeless veterans initiated multiple SUD treatment episodes (p = .002). A significant proportion of veterans struggling with homelessness and SUDs appear to remain unstable despite high utilization of VA acute and preventative services. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  15. 30 CFR 57.22208 - Auxiliary fans (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Auxiliary fans (I-A, II-A, III, and V-A mines). 57.22208 Section 57.22208 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF... fans (I-A, II-A, III, and V-A mines). (a) Auxiliary fans, except fans used in shops and other areas...

  16. 30 CFR 57.22103 - Open flames (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Open flames (I-A, II-A, III, and V-A mines). 57.22103 Section 57.22103 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... Open flames (I-A, II-A, III, and V-A mines). Open flames shall not be permitted underground except for...

  17. 30 CFR 57.22207 - Booster fans (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Booster fans (I-A, II-A, III, and V-A mines... NONMETAL MINES Safety Standards for Methane in Metal and Nonmetal Mines Ventilation § 57.22207 Booster fans (I-A, II-A, III, and V-A mines). (a) Booster fans shall be approved by MSHA under the applicable...

  18. 30 CFR 57.22207 - Booster fans (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Booster fans (I-A, II-A, III, and V-A mines... NONMETAL MINES Safety Standards for Methane in Metal and Nonmetal Mines Ventilation § 57.22207 Booster fans (I-A, II-A, III, and V-A mines). (a) Booster fans shall be approved by MSHA under the applicable...

  19. 30 CFR 57.22207 - Booster fans (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Booster fans (I-A, II-A, III, and V-A mines... NONMETAL MINES Safety Standards for Methane in Metal and Nonmetal Mines Ventilation § 57.22207 Booster fans (I-A, II-A, III, and V-A mines). (a) Booster fans shall be approved by MSHA under the applicable...

  20. 30 CFR 57.22207 - Booster fans (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Booster fans (I-A, II-A, III, and V-A mines... NONMETAL MINES Safety Standards for Methane in Metal and Nonmetal Mines Ventilation § 57.22207 Booster fans (I-A, II-A, III, and V-A mines). (a) Booster fans shall be approved by MSHA under the applicable...

  1. VA/DoD Joint Executive Council FY 2009: Joint Strategic Plan FY 2010-2012

    DTIC Science & Technology

    2009-01-01

    through the Military Health System (MHS) Population Health Portal . HEC Traumatic Brain Injury and Psychological Health In FY 2009, VA and DoD made...available using the Deployment Occupational and Environmental Health Surveillance Portal . TBI and MH assessment tools were evaluated and monitored through...with increased access, VA maintained the frequency of encounters for treatment of PTSD and other MH conditions in Veterans of prior eras. To forecast

  2. Exact moments of the Sachdev-Ye-Kitaev model up to order 1 /N 2

    NASA Astrophysics Data System (ADS)

    García-García, Antonio M.; Jia, Yiyang; Verbaarschot, Jacobus J. M.

    2018-04-01

    We analytically evaluate the moments of the spectral density of the q-body Sachdev-Ye-Kitaev (SYK) model, and obtain order 1 /N 2 corrections for all moments, where N is the total number of Majorana fermions. To order 1 /N, moments are given by those of the weight function of the Q-Hermite polynomials. Representing Wick contractions by rooted chord diagrams, we show that the 1 /N 2 correction for each chord diagram is proportional to the number of triangular loops of the corresponding intersection graph, with an extra grading factor when q is odd. Therefore the problem of finding 1 /N 2 corrections is mapped to a triangle counting problem. Since the total number of triangles is a purely graph-theoretic property, we can compute them for the q = 1 and q = 2 SYK models, where the exact moments can be obtained analytically using other methods, and therefore we have solved the moment problem for any q to 1 /N 2 accuracy. The moments are then used to obtain the spectral density of the SYK model to order 1 /N 2. We also obtain an exact analytical result for all contraction diagrams contributing to the moments, which can be evaluated up to eighth order. This shows that the Q-Hermite approximation is accurate even for small values of N.

  3. 77 FR 27118 - Safety Zone; Rocketts Red Glare Fireworks, Ancarrows Landing Park, James River, Richmond, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-09

    ... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 [Docket No. USCG-2012-0114] RIN 1625-AA00 Safety Zone; Rocketts Red Glare Fireworks, Ancarrows Landing Park, James River, Richmond, VA... Glare Fireworks, Ancarrows Landing Park, James River, Richmond, VA in the Federal Register (76 FR 13525...

  4. 38 CFR 21.4216 - Review of decision of Director of VA Regional Processing Office of jurisdiction.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Director of VA Regional Processing Office of jurisdiction. 21.4216 Section 21.4216 Pensions, Bonuses, and... Administration of Educational Assistance Programs Schools § 21.4216 Review of decision of Director of VA Regional Processing Office of jurisdiction. (a) Decision is subject to review by the Director, Education Service. At...

  5. 75 FR 34934 - Safety Zone; Fireworks for the Virginia Lake Festival, Buggs Island Lake, Clarksville, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-21

    ...-AA00 Safety Zone; Fireworks for the Virginia Lake Festival, Buggs Island Lake, Clarksville, VA AGENCY... Fireworks for the Virginia Lake Festival event. This action is intended to restrict vessel traffic movement... Virginia Lake Festival, Buggs Island Lake, Clarksville, VA (a) Regulated Area. The following area is a...

  6. VA Education Benefits: VA Should Strengthen Its Efforts to Help Veterans Make Informed Education Choices. Report to Congressional Requesters. GAO-14-324

    ERIC Educational Resources Information Center

    Emrey-Arras, Melissa

    2014-01-01

    In fiscal year 2013, VA provided over $12 billion in benefits for veterans' postsecondary education; however, questions have been raised as to whether some schools are receiving these funds as a result of inappropriate recruiting practices. GAO was asked to examine issues related to schools' recruitment of veterans. This report examines (1) how…

  7. VA/DoD Collaboration Guidebook for Healthcare Research

    DTIC Science & Technology

    2011-01-24

    specific time periods. The VA has academic affiliates that, in some instances, may supplement a researcher’s income and provide tenure and academic ...Clinical care dollars only Career Scientist and Research Scientist Research efforts paid by research funds Academic Researcher Research or...their graduate medical education (GME) program training director. DoD researchers may have scientific academic affiliations with the Uniformed

  8. Automated Tumor Registry for Oncology. A VA-DHCP MUMPS application.

    PubMed

    Richie, S

    1992-01-01

    The VA Automated Tumor Registry for Oncology, Version 2, is a multifaceted, completely automated user-friendly cancer database. Easy to use modules include: Automatic Casefinding; Suspense Files; Abstracting and Printing; Follow-up; Annual Reports; Statistical Reports; Utility Functions.

  9. 77 FR 12997 - Drug and Drug-Related Supply Promotion by Pharmaceutical Company Representatives at VA Facilities

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-05

    ... reduce or eliminate any potential for disruption in the patient care environment, manage activities and... activities that VA staff would otherwise perform during duty hours, including patient care and other... important that VA be able to limit the effects of such promotion on patient care. Again, we make no changes...

  10. Comparison of topical fixed-combination fortified vancomycin-amikacin (VA solution) to conventional separate therapy in the treatment of bacterial corneal ulcer.

    PubMed

    Chiang, C-C; Lin, J-M; Chen, W-L; Chiu, Y-T; Tsai, Y-Y

    2009-02-01

    In an in vitro study, fixed-combination fortified vancomycin and amikacin ophthalmic solutions (VA solution) had the same potency and stable physical properties as the separate components. In this retrospective clinical study, we evaluated the efficacy of the topical VA solution in the treatment of bacterial corneal ulcer and comparison with separate topical fortified vancomycin and amikacin. Separate topical fortified eye drops was used prior to January 2004 and switched to the VA solution afterwards in the treatment of bacterial corneal ulcer. The medical records of 223 patients diagnosed with bacterial corneal ulcers between January 2002 and December 2005 were reviewed retrospectively. There were 122 patients in the VA group and 101 in the separate group. Cure was defined as complete healing of the ulcer accompanied by a nonprogressive stromal infiltrate on two consecutive visits. No significant difference was found between the VA and separate therapy group. The mean treatment duration was 15.4 days in the VA group and 16.1 days in the separate therapy group. The average hospital stay was 5.4 days (VA) and 7.2 days (separate antibiotics). Stromal infiltration regressed significantly without further expansion in both groups. All corneal ulcers completely re-epithelialized without complications related to drugs. VA solution provided similar efficacy to the conventional separate therapy in the treatment of bacterial corneal ulcers; however, it is more convenient and tolerable, promotes patient's compliance, avoids the washout effect, and reduces nurse utilization. Hence, VA solution is a good alternative to separate therapy.

  11. The Integrated Care Team Approach of the Department of Veterans Affairs (VA): Geriatric Primary Care.

    PubMed

    Rasin-Waters, Donna; Abel, Valerie; Kearney, Lisa K; Zeiss, Antonette

    2018-05-01

    Historically, integrated mental and behavioral healthcare in the Department of Veterans Affairs (VA) commenced with initiatives in geriatrics. Innovation and system-wide expansion has occurred over decades and culminated in a unified vision for training and practice in the VA medical home model: Patient Aligned Care Team or PACT approach. In one VA hospital, the integration of neuropsychological services in geriatric primary care is pivotal and increases access for patients, as well as contributing to timely and effective care on an interprofessional team. The development and innovative use of an algorithm to identify problems with cognition, health literacy, and mental and behavioral health has been pragmatic and provides useful information for collaborative treatment planning in GeriPACT, VA geriatric primary care. Use of the algorithm also assists with decision-making regarding brief versus comprehensive neuropsychological assessment in the primary care setting. The model presented here was developed by supervising neuropsychologists as part of a postdoctoral residency program in geropsychology. However, postdoctoral residency programs in neuropsychology, as well as neuropsychological clinics, can also use this model to integrate neuropsychological assessment and interventions in geriatric primary care settings.

  12. Color perception differentiates Alzheimer's Disease (AD) from Vascular Dementia (VaD) patients.

    PubMed

    Arnaoutoglou, N A; Arnaoutoglou, M; Nemtsas, P; Costa, V; Baloyannis, S J; Ebmeier, K P

    2017-08-01

    Alzheimer's Disease (AD) and Vascular Dementia (VaD) are the most common causes of dementia in older people. Both diseases appear to have similar clinical symptoms, such as deficits in attention and executive function, but specific cognitive domains are affected. Current cohort studies have shown a close relationship between αβ deposits and age-related macular degeneration (Johnson et al., 2002; Ratnayaka et al., 2015). Additionally, a close link between the thinning of the retinal nerve fiber (RNFL) and AD patients has been described, while it has been proposed that AD patients suffer from a non-specific type of color blindness (Pache et al., 2003). Our study included 103 individuals divided into three groups: A healthy control group (n = 35), AD (n = 32) according to DSM-IV-TR, NINCDS-ADRDA criteria, and VaD (n = 36) based on ΝΙΝDS-AIREN, as well as Magnetic Resonance Imaging (MRI) results. The severity of patient's cognitive impairment, was measured with the Mini-Mental State Examination (MMSE) and was classified according to the Reisberg global deterioration scale (GDS). Visual perception was examined using the Ishihara plates: "Ishihara Color Vision Test - 38 Plate." The three groups were not statistically different for demographic data (age, gender, and education). The Ishihara color blindness test has a sensitivity of 80.6% and a specificity of 87.5% to discriminate AD and VaD patients when an optimal (32.5) cut-off value of performance is used. Ishihara Color Vision Test - 38 Plate is a promising potential method as an easy and not time-consuming screening test for the differential diagnosis of dementia between AD and VaD.

  13. Automated Tumor Registry for Oncology. A VA-DHCP MUMPS application.

    PubMed Central

    Richie, S.

    1992-01-01

    The VA Automated Tumor Registry for Oncology, Version 2, is a multifaceted, completely automated user-friendly cancer database. Easy to use modules include: Automatic Casefinding; Suspense Files; Abstracting and Printing; Follow-up; Annual Reports; Statistical Reports; Utility Functions. PMID:1482866

  14. Chaplains' Engagement with Suicidality among Their Service Users: Findings from the VA/DoD Integrated Mental Health Strategy.

    PubMed

    Kopacz, Marek S; Nieuwsma, Jason A; Jackson, George L; Rhodes, Jeffrey E; Cantrell, William C; Bates, Mark J; Meador, Keith G

    2016-04-01

    Chaplains play an important role in supporting the mental health of current and former military personnel; in this study, the engagement of Department of Veterans Affairs (VA), Army, Navy, and Air Force chaplains with suicidality among their service users were examined. An online survey was used to collect data from 440 VA and 1,723 Department of Defense (DoD) chaplains as part of the VA/DoD Integrated Mental Health Strategy. Differences were noted for demographics, work setting characteristics, encountering suicidality, and self-perceived preparation for dealing with suicidality. Compared to DoD chaplains, VA chaplains encounter more at-risk service users, yet feel less prepared for dealing with suicidality. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

  15. Waves from the Sun: to the 100th anniversary of V.A. Troitskaya's birth

    NASA Astrophysics Data System (ADS)

    Guglielmi, Anatol; Potapov, Alexander

    2017-09-01

    It has been one hundred years since the birth of the outstanding scientist Professor V.A. Troitskaya. Her remarkable achievements in solar-terrestrial physics are widely known. For many years, Valeria A. Troitskaya was the President of the International Association of Geomagnetism and Aeronomy. This article deals with only one aspect of the multifaceted creative activity of V.A. Troitskaya. It relates to the problem of sources of ultra-low frequency (ULF) electromagnetic oscillations and waves outside Earth’s magnetosphere. We were fortunate to work under the leadership of V.A. Troitskaya on this problem. In this paper, we briefly describe the history from the emergence of the idea of the extramagnetospheric origin of dayside permanent ULF oscillations in the late 1960s to the modern quest made by ground and satellite means for ULF waves excited by solar surface oscillations propagating in the interplanetary medium and reaching Earth.

  16. Contraceptive Provision in the VA Healthcare System to Women Who Report Military Sexual Trauma

    PubMed Central

    Mattocks, Kristin; Schwarz, Eleanor Bimla; Borrero, Sonya; Skanderson, Melissa; Zephyrin, Laurie; Brandt, Cynthia; Haskell, Sally

    2014-01-01

    Abstract Background: Women Veterans who suffered military sexual trauma (MST) may be at high risk for unintended pregnancy and benefit from contraceptive services. The objective of this study is to compare documented provision of contraceptives to women Veterans using the Department of Veterans Affairs (VA) health system who report or deny MST. Methods: This retrospective cohort study included women Veterans aged 18–45 years who served in Operation Enduring or Iraqi Freedom and had at least one visit to a VA medical center between 2002 and 2010. Data were obtained from VA administrative and clinical databases. Chi-squared tests and logistic regression were conducted to evaluate the association between MST, ascertained by routine clinical screening, and first documented receipt of hormonal or long-acting contraception. Results: Of 68,466 women Veterans, 13% reported, 59% denied and 28% had missing data for the MST screen. Among the entire study cohort, 30% of women had documented receipt of a contraceptive method. Women reporting MST were significantly more likely than those denying MST to receive a method of contraception (adjusted odds ratio [aOR] 1.12, 95% confidence interval [CI] 1.07–1.18) including an intrauterine device (odds ratio [OR] 1.29, 95% CI 1.17–1.41) or contraceptive injection (OR 1.17, 95% CI 1.05–1.29). Women who were younger, unmarried, seen at a women's health clinic, or who had more than one visit were more likely to receive contraception. Conclusions: A minority of women Veterans of reproductive age receive contraceptive services from the VA. Women Veterans who report MST, and particularly those who seek care at VA women's health clinics, are more likely to receive contraception. PMID:24787680

  17. Insights into the complex association of bovine factor Va with acidic-lipid-containing synthetic membranes.

    PubMed Central

    Cutsforth, G A; Koppaka, V; Krishnaswamy, S; Wu, J R; Mann, K G; Lentz, B R

    1996-01-01

    The mechanism of binding of blood coagulation cofactor factor Va to acidic-lipid-containing membranes has been addressed. Binding isotherms were generated at room temperature using the change in fluorescence anisotropy of pyrene-labeled bovine factor Va to detect binding to sonicated membrane vesicles containing either bovine brain phosphatidylserine (PS) or 1,2-dioleoyl-3-sn-phosphatidylglycerol (DOPG) in combination with 1-palmitoyl-2-oleoyl-3-sn-phosphatidylcholine (POPC). The composition of the membranes was varied from 0 to 40 mol% for PS/POPC and from 0 to 65 mol % for DOPG/POPC membranes. Fitting the data to a classical Langmuir adsorption model yielded estimates of the dissociation constant (Kd) and the stoichiometry of binding. The values of Kd defined in this way displayed a maximum at low acidic lipid content but were nearly constant at intermediate to high fractions of acidic lipid. Fitting the binding isotherms to a two-process binding model (nonspecific adsorption in addition to binding of acidic lipids to sites on the protein) suggested a significant acidic-lipid-independent binding affinity in addition to occupancy of three protein sites that bind PS in preference to DOPG. Both analyses indicated that interaction of factor Va with an acidic-lipid-containing membrane is much more complex than those of factor Xa or prothrombin. Furthermore, a change in the conformation of bound pyrene-labeled factor Va with surface concentration of acidic lipid was implied by variation of both the saturating fluorescence anisotropy and the binding parameters with the acidic lipid content of the membrane. Finally, the results cannot support the contention that binding occurs through nonspecific adsorption to a patch or domain of acidic lipids in the membrane. Factor Va is suggested to associate with membranes by a complex process that includes both acidic-lipid-specific and acidic-lipid-independent sites and a protein structure change induced by occupancy of acidic

  18. 38 CFR 17.1000 - Payment or reimbursement for emergency services for nonservice-connected conditions in non-VA...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... for emergency services for nonservice-connected conditions in non-VA facilities. 17.1000 Section 17.1000 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS MEDICAL Payment Or Reimbursement for Emergency Services for Nonservice-Connected Conditions in Non-Va Facilities § 17.1000 Payment...

  19. 38 CFR 17.169 - VA Dental Insurance Program for veterans and survivors and dependents of veterans (VADIP).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2013-07-01 2013-07-01 false VA Dental Insurance..., Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS MEDICAL Dental Services § 17.169 VA Dental... Dental Insurance Program (VADIP) provides premium-based dental insurance coverage through which...

  20. 38 CFR 17.169 - VA Dental Insurance Program for veterans and survivors and dependents of veterans (VADIP).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2014-07-01 2014-07-01 false VA Dental Insurance..., Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS MEDICAL Dental Services § 17.169 VA Dental... Dental Insurance Program (VADIP) provides premium-based dental insurance coverage through which...

  1. 38 CFR 17.120 - Payment or reimbursement for emergency treatment furnished by non-VA providers to certain...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... for emergency treatment furnished by non-VA providers to certain veterans with service-connected... Payment or reimbursement for emergency treatment furnished by non-VA providers to certain veterans with... emergency treatment, not previously authorized, in a private or public (or Federal) hospital not operated by...

  2. 38 CFR 17.120 - Payment or reimbursement for emergency treatment furnished by non-VA providers to certain...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... for emergency treatment furnished by non-VA providers to certain veterans with service-connected... Payment or reimbursement for emergency treatment furnished by non-VA providers to certain veterans with... emergency treatment, not previously authorized, in a private or public (or Federal) hospital not operated by...

  3. 38 CFR 17.120 - Payment or reimbursement for emergency treatment furnished by non-VA providers to certain...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... for emergency treatment furnished by non-VA providers to certain veterans with service-connected... Payment or reimbursement for emergency treatment furnished by non-VA providers to certain veterans with... emergency treatment, not previously authorized, in a private or public (or Federal) hospital not operated by...

  4. 30 CFR 57.22206 - Main ventilation failure (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Main ventilation failure (I-A, II-A, III, and V-A mines). 57.22206 Section 57.22206 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... Main ventilation failure (I-A, II-A, III, and V-A mines). (a) When there has been a main ventilation...

  5. 76 FR 27379 - Proposed Information Collection (Supplement to VA Forms 21-526, 21-534, and 21-535 (For...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-11

    ... information technology. Title: Supplement to VA Forms 21-526, 21-534, and 21-535 (For Philippine Claims), VA... residence, proof of service, and whether the applicant was a member of pro-Japanese, pro-German, or anti...

  6. Use of a cost accounting system to evaluate costs of a VA special program.

    PubMed

    Menke, T J; Wray, N P

    1999-04-01

    The Department of Veterans Affairs (VA) established six mobile clinics to provide care for rural veterans. Each was operated by a parent VA Medical Center (VAMC). To describe the use of a cost-accounting system which does not provide costs at the service or patient level to determine the costs of the mobile clinics. Costs per visit were compared among the mobile clinics with the parent VAMCs and with simulated fixed-location clinics. Cost data came from VA's Centralized Accounting for Local Management (CALM) data. Utilization data came from VA's outpatient file. Information was obtained from the VAMCs' fiscal services to reallocate costs among the CALM subaccounts to generate cost data that was comparable among the mobile clinics. Costs per visit for the mobile clinics were twice as high as those of the parent VAMCs. Costs per visit would be lower at fixed-location clinics unless the volume were substantially less than that provided by the mobile clinics. Differences between cost allocations for accounting purposes and research are likely to necessitate adjusting cost accounting data for research purposes. Fortunately, information from the accountants or primary data can lead to a cost database which is appropriate for research evaluations. In the mobile clinics study, the analysis of cost accounting data led to the conclusion that mobile clinics were not a cost-effective way in which to provide care to rural veterans.

  7. Military and Veteran Support: DOD and VA Programs That Address the Effects of Combat and Transition to Civilian Life

    DTIC Science & Technology

    2014-11-01

    servicemembers to civilian life. For its part, VA’s agency priority goals are to (1) ensure access to VA benefits and services, (2) eliminate the disability...transfer their benefits to dependents. VA – Veterans Benefit Administration ( VBA ) Spinal Cord Injury and Disorders Centers Disability; Physical...who are temporarily residing in a home owned by a family member to help adapt the home to meet his or her special needs. VA - VBA Yellow Ribbon

  8. 77 FR 29929 - Safety Zone; Town of Cape Charles Fireworks, Cape Charles Harbor, Cape Charles, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-21

    ... section of this notice. Basis and Purpose On July 4, 2012 the Town of Cape Charles will sponsor a...-AA00 Safety Zone; Town of Cape Charles Fireworks, Cape Charles Harbor, Cape Charles, VA AGENCY: Coast... temporary safety zone on the waters of Cape Charles City Harbor in Cape Charles, VA in support of the Fourth...

  9. 30 CFR 57.22214 - Changes in ventilation (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Changes in ventilation (I-A, II-A, III, and V-A mines). 57.22214 Section 57.22214 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF... ventilation (I-A, II-A, III, and V-A mines). (a) Changes in ventilation which affect the main air current or...

  10. 30 CFR 57.22214 - Changes in ventilation (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Changes in ventilation (I-A, II-A, III, and V-A mines). 57.22214 Section 57.22214 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF... ventilation (I-A, II-A, III, and V-A mines). (a) Changes in ventilation which affect the main air current or...

  11. Tests on a 30 kVA class superconducting transformer

    NASA Astrophysics Data System (ADS)

    Yoneda, E. S.; Tashiro, I.; Morohoshi, M.; Ito, D.

    To demonstrate the applicability of superconductors to electric power machines, the present authors made and tested a 30 kVA class single-phase superconducting transformer. The aim of the study was to determine the superconducting transformer properties. Therefore the superconducting transformer has a simple structure, i.e. the primary to secondary voltage ratio is 1:1 and the iron core is immersed in liquid helium. The core loss, evaluated from no-load tests, was 13 W and leakage impedance, obtained by short circuit tests, was 0.02 Ω in accordance with a calculated value. The superconducting transformer showed the limitation effect of fault currents. The authors succeeded in continuous operation with a 0.5 Ω load resistance. These results suggest that efficiency can be 98.5%, if the iron core is located outside the cryostat and if high Tc superconductors are used as current leads. Superconducting windings exhibit training quenches in general. The authors also developed a superconducting transformer quench detector with a third winding around the iron core. The quench detector revealed that the secondary winding quenches before the primary winding.

  12. 38 CFR 17.101 - Collection or recovery by VA for medical care or services provided or furnished to a veteran for...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... VA for medical care or services provided or furnished to a veteran for a nonservice-connected... MEDICAL Charges, Waivers, and Collections § 17.101 Collection or recovery by VA for medical care or... section covers collection or recovery by VA, under 38 U.S.C. 1729, for medical care or services provided...

  13. Astrovirus VA1/HMO-C: An Increasingly Recognized Neurotropic Pathogen in Immunocompromised Patients

    PubMed Central

    Brown, Julianne R.; Morfopoulou, Sofia; Hubb, Jonathan; Emmett, Warren A.; Ip, Winnie; Shah, Divya; Brooks, Tony; Paine, Simon M. L.; Anderson, Glenn; Virasami, Alex; Tong, C. Y. William; Clark, Duncan A.; Plagnol, Vincent; Jacques, Thomas S.; Qasim, Waseem; Hubank, Mike; Breuer, Judith

    2015-01-01

    Background. An 18-month-old boy developed encephalopathy, for which extensive investigation failed to identify an etiology, 6 weeks after stem cell transplant. To exclude a potential infectious cause, we performed high-throughput RNA sequencing on brain biopsy. Methods. RNA-Seq was performed on an Illumina Miseq, generating 20 million paired-end reads. Nonhost data were checked for similarity to known organisms using BLASTx. The full viral genome was sequenced by primer walking. Results. We identified an astrovirus, HAstV-VA1/HMO-C-UK1(a), which was highly divergent from human astrovirus (HAstV 1–8) genotypes, but closely related to VA1/HMO-C astroviruses, including one recovered from a case of fatal encephalitis in an immunosuppressed child. The virus was detected in stool and serum, with highest levels in brain and cerebrospinal fluid (CSF). Immunohistochemistry of the brain biopsy showed positive neuronal staining. A survey of 680 stool and 349 CSF samples identified a related virus in the stool of another immunosuppressed child. Conclusions. The discovery of HAstV-VA1/HMO-C-UK1(a) as the cause of encephalitis in this case provides further evidence that VA1/HMO-C viruses, unlike HAstV 1–8, are neuropathic, particularly in immunocompromised patients, and should be considered in the differential diagnosis of encephalopathy. With a turnaround from sample receipt to result of <1 week, we confirm that RNA-Seq presents a valuable diagnostic tool in unexplained encephalitis. PMID:25572899

  14. Advanced Imaging Tracker

    DTIC Science & Technology

    1982-06-01

    3oijsteii 14.) v ilson f3 1vj Ar inj~on, VA Ž222JY L. or p AtLnZ: -,iii~iarn Ouriey I d.LU ýu ndoldt i~d txlJlýjLuqucqe, 14,, f. /A i’ Atun : ý...34ivision iY) LiOX d /M ye I v - iv i S i 01-1 I ,/L i r ic u .L Lbr~ J o-r y At~rlt -lex earker 1.i nj .on, A½iI r -I efnLi.) DL-4 NAS’A Aines Atun

  15. VA Health Care: Improvements Needed in Monitoring Antidepressant Use for Major Depressive Disorder and in Increasing Accuracy of Suicide Data

    DTIC Science & Technology

    2014-11-01

    VA HEALTH CARE Improvements Needed in Monitoring Antidepressant Use for Major Depressive Disorder and in Increasing...00-2014 4. TITLE AND SUBTITLE VA Health Care: Improvements Needed in Monitoring Antidepressant Use for Major Depressive Disorder and in Increasing...Use for Major Depressive Disorder and in Increasing Accuracy of Suicide Data Why GAO Did This Study In 2013, VA estimated that about 1.5 million

  16. 78 FR 52085 - VA Veteran-Owned Small Business Verification Guidelines

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-22

    ... DEPARTMENT OF VETERANS AFFAIRS 38 CFR Part 74 RIN 2900-AO49 VA Veteran-Owned Small Business Verification Guidelines AGENCY: Department of Veterans Affairs. ACTION: Final rule. SUMMARY: This document... Domestic Assistance This final rule affects the verification guidelines of veteran- owned small businesses...

  17. 75 FR 54771 - Safety Zone; Thunder on the Bay, Chesapeake Bay, Buckroe Beach Park, Hampton, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-09

    ...-AA00 Safety Zone; Thunder on the Bay, Chesapeake Bay, Buckroe Beach Park, Hampton, VA AGENCY: Coast... safety zone on the navigable waters of Chesapeake Bay in Hampton, VA in support of the Thunder on the Bay.... 0 2. Add Sec. 165.T05-0755 to read as follows: Sec. 165.T05-0755 Safety Zone; Thunder on the Bay...

  18. 33 CFR 334.293 - Elizabeth River, Craney Island Refueling Pier Restricted Area, Portsmouth VA; naval restricted area.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Refueling Pier Restricted Area, Portsmouth VA; naval restricted area. 334.293 Section 334.293 Navigation and... RESTRICTED AREA REGULATIONS § 334.293 Elizabeth River, Craney Island Refueling Pier Restricted Area, Portsmouth VA; naval restricted area. (a) The area. (1) The waters within an area beginning at a point on the...

  19. 33 CFR 334.293 - Elizabeth River, Craney Island Refueling Pier Restricted Area, Portsmouth VA; naval restricted area.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Refueling Pier Restricted Area, Portsmouth VA; naval restricted area. 334.293 Section 334.293 Navigation and... RESTRICTED AREA REGULATIONS § 334.293 Elizabeth River, Craney Island Refueling Pier Restricted Area, Portsmouth VA; naval restricted area. (a) The area. (1) The waters within an area beginning at a point on the...

  20. 33 CFR 334.293 - Elizabeth River, Craney Island Refueling Pier Restricted Area, Portsmouth VA; naval restricted area.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Refueling Pier Restricted Area, Portsmouth VA; naval restricted area. 334.293 Section 334.293 Navigation and... RESTRICTED AREA REGULATIONS § 334.293 Elizabeth River, Craney Island Refueling Pier Restricted Area, Portsmouth VA; naval restricted area. (a) The area. (1) The waters within an area beginning at a point on the...

  1. 33 CFR 334.293 - Elizabeth River, Craney Island Refueling Pier Restricted Area, Portsmouth VA; naval restricted area.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Refueling Pier Restricted Area, Portsmouth VA; naval restricted area. 334.293 Section 334.293 Navigation and... RESTRICTED AREA REGULATIONS § 334.293 Elizabeth River, Craney Island Refueling Pier Restricted Area, Portsmouth VA; naval restricted area. (a) The area. (1) The waters within an area beginning at a point on the...

  2. 33 CFR 334.293 - Elizabeth River, Craney Island Refueling Pier Restricted Area, Portsmouth VA; naval restricted area.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Refueling Pier Restricted Area, Portsmouth VA; naval restricted area. 334.293 Section 334.293 Navigation and... RESTRICTED AREA REGULATIONS § 334.293 Elizabeth River, Craney Island Refueling Pier Restricted Area, Portsmouth VA; naval restricted area. (a) The area. (1) The waters within an area beginning at a point on the...

  3. Sequence stratigraphy and environmental background of the late Pleistocene and Holocene occupation in the Southeast Primor'ye (the Russian Far East)

    NASA Astrophysics Data System (ADS)

    Chlachula, Jiri; Krupyanko, Alexander A.

    2016-06-01

    The paper presents the results of Quaternary palaeoecology and geoarchaeology studies in the Zerkal'naya Basin, with new insights about sequenced natural shifts during the prehistoric occupation of this marginally explored NE Asian maritime territory. The Basin is part of the continental drainage system and the main physiographic and biotic corridor for peopling of the transitive coastal interior SE Primor'ye Region. The Final Pleistocene and Holocene environmental (biotic and abiotic) proxy records from the Upper/Final Palaeolithic to early historical sites document a dynamic climate change with vegetation cover transformations within riverine and mountain valley ecosystems of the Russian Far East. Most of the archaeological sites located on the low terraces and bedrock promontories along the main river channel and its tributary streams suggest traditional hunter gathered lifestyles based on seasonal salmon-fishing supplemented by pastoral economy. Tundra-forests with larch trees, dwarf birch thickets and polypod ferns from the basal stratigraphic units of the late Last Glacial occupation sites associated with the Upper Palaeolithic micro-blade and bifacial stone tool traditions (14C-dated to 19,000-12,000 cal yrs BP) indicate rather pronounced conditions and much lower MAT comparing today. Following a final Pleistocene cooling event, a major climate warming marked the onset of Holocene accompanied by a regional humidity increase promoting the formation of a mixed broadleaved-coniferous oak-dominant taiga, and culminating in the mid-Holocene Climatic Optimum. The appearance of mosaic parklands ca. 5,000-4,000 cal yrs BP. may be partly attributed to the expansion of the Far Eastern Neolithic cultures practicing forest clearance for pastures and dwellings. A progressing landscape opening indicated by the spread of light-demanding thickets and birch-dominated riverine biotopes with Artemisia suggests a further vegetation cover transformation during the late Neolithic

  4. VaProS: a database-integration approach for protein/genome information retrieval.

    PubMed

    Gojobori, Takashi; Ikeo, Kazuho; Katayama, Yukie; Kawabata, Takeshi; Kinjo, Akira R; Kinoshita, Kengo; Kwon, Yeondae; Migita, Ohsuke; Mizutani, Hisashi; Muraoka, Masafumi; Nagata, Koji; Omori, Satoshi; Sugawara, Hideaki; Yamada, Daichi; Yura, Kei

    2016-12-01

    Life science research now heavily relies on all sorts of databases for genome sequences, transcription, protein three-dimensional (3D) structures, protein-protein interactions, phenotypes and so forth. The knowledge accumulated by all the omics research is so vast that a computer-aided search of data is now a prerequisite for starting a new study. In addition, a combinatory search throughout these databases has a chance to extract new ideas and new hypotheses that can be examined by wet-lab experiments. By virtually integrating the related databases on the Internet, we have built a new web application that facilitates life science researchers for retrieving experts' knowledge stored in the databases and for building a new hypothesis of the research target. This web application, named VaProS, puts stress on the interconnection between the functional information of genome sequences and protein 3D structures, such as structural effect of the gene mutation. In this manuscript, we present the notion of VaProS, the databases and tools that can be accessed without any knowledge of database locations and data formats, and the power of search exemplified in quest of the molecular mechanisms of lysosomal storage disease. VaProS can be freely accessed at http://p4d-info.nig.ac.jp/vapros/ .

  5. 77 FR 25592 - Drawbridge Operation Regulations; James River, Hopewell, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-01

    ..., at Hopewell, VA. This deviation is necessary to facilitate mechanical repairs to the vertical lift.... SUPPLEMENTARY INFORMATION: The Virginia Department of Transportation, who owns and operates this vertical-lift... position to facilitate repairs to the skew couplings that keep the vertical lift portion of the bridge...

  6. Headache diagnoses among Iraq and Afghanistan war veterans enrolled in VA: a gender comparison.

    PubMed

    Carlson, Kathleen F; Taylor, Brent C; Hagel, Emily M; Cutting, Andrea; Kerns, Robert; Sayer, Nina A

    2013-01-01

    To examine the prevalence and correlates of headache diagnoses, by gender, among Iraq and Afghanistan War Veterans who use Department of Veterans Affairs (VA) health care. Understanding the health care needs of recent Veterans, and how these needs differ between women and men, is a priority for the VA. The potential for a large burden of headache disorders among Veterans seeking VA services exists but has not been examined in a representative sample. We conducted a historical cohort study using national VA inpatient and outpatient data from fiscal year 2011. Participants were all (n = 470,215) Iraq and Afghanistan War Veteran VA users in 2011; nearly 13% were women. We identified headache diagnoses using International Classification of Diseases (ICD-9) diagnosis codes assigned during one or more VA inpatient or outpatient encounters. Descriptive analyses included frequencies of patient characteristics, prevalence and types of headache diagnoses, and prevalence of comorbid diagnoses. Prevalence ratios (PR) with 95% confidence intervals (CI) were used to estimate associations between gender and headache diagnoses. Multivariate models adjusted for age and race. Additional models also adjusted for comorbid diagnoses. In 2011, 56,300 (11.9%) Veterans received a headache-related diagnosis. While controlling for age and race, headache diagnoses were 1.61 times more prevalent (95% CI = 1.58-1.64) among women (18%) than men (11%). Most of this difference was associated with migraine diagnoses, which were 2.66 times more prevalent (95% CI = 2.59-2.73) among women. Cluster and post-traumatic headache diagnoses were less prevalent in women than in men. These patterns remained the same when also controlling for comorbid diagnoses, which were common among both women and men with headache diagnoses. The most prevalent comorbid diagnoses examined were depression (46% of women with headache diagnoses vs 40% of men), post-traumatic stress disorder (38% vs 58%), and back

  7. Polyoxygenated Cyclohexenoids with Promising α-Glycosidase Inhibitory Activity Produced by Phomopsis sp. YE3250, an Endophytic Fungus Derived from Paeonia delavayi.

    PubMed

    Huang, Rong; Jiang, Bo-Guang; Li, Xiao-Nian; Wang, Ya-Ting; Liu, Si-Si; Zheng, Kai-Xuan; He, Jian; Wu, Shao-Hua

    2018-02-07

    Seven new polyoxygenated cyclohexenoids, namely, phomopoxides A-G (1-7), were isolated from the fermentation broth extract of an endophytic fungal strain Phomopsis sp. YE3250 from the medicinal plant Paeonia delavayi Franch. The structures of these compounds were established by spectroscopic interpretation. The absolute configurations of compounds 1 and 4 were confirmed by X-ray crystallographic analysis and chemical derivative approach. All isolated compounds showed weak cytotoxic activities toward three human tumor cell lines (Hela, MCF-7, and NCI-H460) and weak antifungal activities against five pathogenic fungi (Candida albicans, Aspergillus niger, Pyricularia oryzae, Fusarium avenaceum, and Hormodendrum compactum). In addition, compounds 1-7 showed a promising α-glycosidase inhibitory activity with IC 50 values of 1.47, 1.55, 1.83, 2.76, 2.88, 3.16, and 2.94 mM, respectively, as compared with a positive control of acarbose (IC 50 = 1.22 mM).

  8. A Prospective Study of Racial and Ethnic Variation in VA Psychotherapy Services for PTSD.

    PubMed

    Spoont, Michele R; Sayer, Nina A; Kehle-Forbes, Shannon M; Meis, Laura A; Nelson, David B

    2017-03-01

    To determine whether there are racial or ethnic disparities in receipt of U.S. Department of Veterans Affairs (VA) psychotherapy services for veterans with posttraumatic stress disorder (PTSD), the authors examined the odds of receipt of any psychotherapy and of individual psychotherapy among self-identified racial and ethnic groups for six months after individuals were diagnosed as having PTSD. Data were from a national prospective cohort study of 6,884 veterans with PTSD. Patients with no mental health care in the prior year were surveyed immediately following receipt of a PTSD diagnosis. VA databases were used to determine mental health service use. Analyses controlled for treatment need, access to services, and treatment beliefs. Among veterans with PTSD initially seen in VA mental health treatment settings, Latino veterans were less likely than white veterans to receive any psychotherapy, after the analyses controlled for treatment need, access, and beliefs. Among those initially seen in mental health settings who received some psychotherapy services, Latinos, African Americans, and Asian/Pacific Islanders were less likely than white veterans to receive any individual therapy. These racial-ethnic differences in psychotherapy receipt were due to factors occurring between VA health care networks as well as factors occurring within networks. Drivers of disparities differed across racial and ethnic groups. Inequity in psychotherapy services for some veterans from racial and ethnic minority groups with PTSD were due to factors operating both within and between health care networks.

  9. Myosin Va Plays a Role in Nitrergic Smooth Muscle Relaxation in Gastric Fundus and Corpora Cavernosa of Penis

    PubMed Central

    Carew, Josephine A.; Goyal, Raj K.; Sullivan, Maryrose P.

    2014-01-01

    The intracellular motor protein myosin Va is involved in nitrergic neurotransmission possibly by trafficking of neuronal nitric oxide synthase (nNOS) within the nerve terminals. In this study, we examined the role of myosin Va in the stomach and penis, proto-typical smooth muscle organs in which nitric oxide (NO) mediated relaxation is critical for function. We used confocal microscopy and co-immunoprecipitation of tissue from the gastric fundus (GF) and penile corpus cavernosum (CCP) to localize myosin Va with nNOS and demonstrate their molecular interaction. We utilized in vitro mechanical studies to test whether smooth muscle relaxations during nitrergic neuromuscular neurotransmission is altered in DBA (dilute, brown, non-agouti) mice which lack functional myosin Va. Myosin Va was localized in nNOS-positive nerve terminals and was co-immunoprecipitated with nNOS in both GF and CCP. In comparison to C57BL/6J wild type (WT) mice, electrical field stimulation (EFS) of precontracted smooth muscles of GF and CCP from DBA animals showed significant impairment of nitrergic relaxation. An NO donor, Sodium nitroprusside (SNP), caused comparable levels of relaxation in smooth muscles of WT and DBA mice. These normal postjunctional responses to SNP in DBA tissues suggest that impairment of smooth muscle relaxation resulted from inhibition of NO synthesis in prejunctional nerve terminals. Our results suggest that normal physiological processes of relaxation of gastric and cavernosal smooth muscles that facilitate food accommodation and penile erection, respectively, may be disrupted under conditions of myosin Va deficiency, resulting in complications like gastroparesis and erectile dysfunction. PMID:24516539

  10. 38 CFR 74.29 - When will VA dispose of records?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... (CONTINUED) VETERANS SMALL BUSINESS REGULATIONS Records Management § 74.29 When will VA dispose of records? The records, including those pertaining to businesses not determined to be eligible for the program... of the last Notice of Verified Status Approval letter. Longer retention will not be required unless a...

  11. 30 CFR 57.22221 - Overcast and undercast construction (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Overcast and undercast construction (I-A, II-A, III, and V-A mines). 57.22221 Section 57.22221 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... Overcast and undercast construction (I-A, II-A, III, and V-A mines). Overcasts and undercasts shall be— (a...

  12. 30 CFR 57.22228 - Preshift examination (I-A, I-C, II-A, III, and V-A mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Preshift examination (I-A, I-C, II-A, III, and V-A mines). 57.22228 Section 57.22228 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... Preshift examination (I-A, I-C, II-A, III, and V-A mines). (a) Preshift examinations shall be conducted...

  13. 30 CFR 57.22221 - Overcast and undercast construction (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Overcast and undercast construction (I-A, II-A, III, and V-A mines). 57.22221 Section 57.22221 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... Overcast and undercast construction (I-A, II-A, III, and V-A mines). Overcasts and undercasts shall be— (a...

  14. 30 CFR 57.22228 - Preshift examination (I-A, I-C, II-A, III, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Preshift examination (I-A, I-C, II-A, III, and V-A mines). 57.22228 Section 57.22228 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... Preshift examination (I-A, I-C, II-A, III, and V-A mines). (a) Preshift examinations shall be conducted...

  15. A Survey of Physicians' Attitudes toward Decision-Making Authority for Initiating and Withdrawing VA-ECMO: Results and Ethical Implications for Shared Decision Making.

    PubMed

    Meltzer, Ellen C; Ivascu, Natalia S; Stark, Meredith; Orfanos, Alexander V; Acres, Cathleen A; Christos, Paul J; Mangione, Thomas; Fins, Joseph J

    2016-01-01

    Although patients exercise greater autonomy than in the past, and shared decision making is promoted as the preferred model for doctor-patient engagement, tensions still exist in clinical practice about the primary locus of decision-making authority for complex, scarce, and resource-intensive medical therapies: patients and their surrogates, or physicians. We assessed physicians' attitudes toward decisional authority for adult venoarterial extracorporeal membrane oxygenation (VA-ECMO), hypothesizing they would favor a medical locus. A survey of resident/fellow physicians and internal medicine attendings at an academic medical center, May to August 2013. We used a 24-item, internet-based survey assessing physician-respondents' demographic characteristics, knowledge, and attitudes regarding decisional authority for adult VA-ECMO. Qualitative narratives were also collected. A total of 179 physicians completed the survey (15 percent response rate); 48 percent attendings and 52 percent residents/fellows. Only 32 percent of the respondents indicated that a surrogate's consent should be required to discontinue VA-ECMO; 56 percent felt that physicians should have the right to discontinue VA-ECMO over a surrogate's objection. Those who self-reported as "knowledgeable" about VA-ECMO, compared to those who did not, more frequently replied that there should not be presumed consent for VA-ECMO (47.6 percent versus 33.3 percent, p = 0.007), that physicians should have the right to discontinue VA-ECMO over a surrogate's objection (76.2 percent versus 50 percent, p = 0.02) and that, given its cost, the use of VA-ECMO should be restricted (81.0 percent versus 54.4 percent, p = 0.005). Surveyed physicians, especially those who self-reported as knowledgeable about VA-ECMO and/or were specialists in pulmonary/critical care, favored a medical locus of decisional authority for VA-ECMO. VA-ECMO is complex, and the data may (1) reflect physicians' hesitance to cede authority to presumably

  16. VA Disability Compensation and Money Spent on Substance Use Among Homeless Veterans: A Controversial Association.

    PubMed

    Tsai, Jack; Rosenheck, Robert A

    2015-06-01

    There has long been concern that public support payments are used to support addictive behaviors. This study examined the amount of money homeless veterans spend on alcohol and drugs and the association between public support income, including VA disability compensation, and expenditures on alcohol and drugs. Data were from 1,160 veterans from 19 sites on entry into the Housing and Urban Development-Veterans Affairs Supportive Housing program. Descriptive statistics and nonparametric analyses were conducted. About 33% of veterans reported spending money on alcohol and 22% reported spending money on drugs in the past month. No significant association was found between public support income, VA disability compensation, and money spent on alcohol and drugs. A substantial proportion of homeless veterans spend some income on alcohol and drugs, but disability income, including VA compensation, does not seem to be related to substance use or money spent on addictive substances.

  17. Multimethod evaluation of the VA's peer-to-peer Toolkit for patient-centered medical home implementation.

    PubMed

    Luck, Jeff; Bowman, Candice; York, Laura; Midboe, Amanda; Taylor, Thomas; Gale, Randall; Asch, Steven

    2014-07-01

    Effective implementation of the patient-centered medical home (PCMH) in primary care practices requires training and other resources, such as online toolkits, to share strategies and materials. The Veterans Health Administration (VA) developed an online Toolkit of user-sourced tools to support teams implementing its Patient Aligned Care Team (PACT) medical home model. To present findings from an evaluation of the PACT Toolkit, including use, variation across facilities, effect of social marketing, and factors influencing use. The Toolkit is an online repository of ready-to-use tools created by VA clinic staff that physicians, nurses, and other team members may share, download, and adopt in order to more effectively implement PCMH principles and improve local performance on VA metrics. Multimethod evaluation using: (1) website usage analytics, (2) an online survey of the PACT community of practice's use of the Toolkit, and (3) key informant interviews. Survey respondents were PACT team members and coaches (n = 544) at 136 VA facilities. Interview respondents were Toolkit users and non-users (n = 32). For survey data, multivariable logistic models were used to predict Toolkit awareness and use. Interviews and open-text survey comments were coded using a "common themes" framework. The Consolidated Framework for Implementation Research (CFIR) guided data collection and analyses. The Toolkit was used by 6,745 staff in the first 19 months of availability. Among members of the target audience, 80 % had heard of the Toolkit, and of those, 70 % had visited the website. Tools had been implemented at 65 % of facilities. Qualitative findings revealed a range of user perspectives from enthusiastic support to lack of sufficient time to browse the Toolkit. An online Toolkit to support PCMH implementation was used at VA facilities nationwide. Other complex health care organizations may benefit from adopting similar online peer-to-peer resource libraries.

  18. 76 FR 72046 - Enhanced-Use Lease (EUL) of Department of Veterans Affairs (VA) Real Property for the Development...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-21

    ... Point VA Medical Center--VA Maryland Health Care System in Perryville. As consideration for the lease... their families, and a supportive services program. FOR FURTHER INFORMATION CONTACT: Edward Bradley... consideration under such a lease for the provision of medical care and services would result in a demonstrable...

  19. Strategies from a nationwide health information technology implementation: the VA CART story.

    PubMed

    Box, Tamára L; McDonell, Mary; Helfrich, Christian D; Jesse, Robert L; Fihn, Stephan D; Rumsfeld, John S

    2010-01-01

    The VA Cardiovascular Assessment, Reporting, and Tracking (CART) system is a customized electronic medical record system which provides standardized report generation for cardiac catheterization procedures, serves as a national data repository, and is the centerpiece of a national quality improvement program. Like many health information technology projects, CART implementation did not proceed without some barriers and resistance. We describe the nationwide implementation of CART at the 77 VA hospitals which perform cardiac catheterizations in three phases: (1) strategic collaborations; (2) installation; and (3) adoption. Throughout implementation, success required a careful balance of technical, clinical, and organizational factors. We offer strategies developed through CART implementation which are broadly applicable to technology projects aimed at improving the quality, reliability, and efficiency of health care.

  20. 30 CFR 57.22205 - Doors on main fans (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Doors on main fans (I-A, II-A, III, and V-A mines). 57.22205 Section 57.22205 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF... main fans (I-A, II-A, III, and V-A mines). In mines ventilated by multiple main fans, each main fan...

  1. 30 CFR 57.22220 - Air passing unsealed areas (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Air passing unsealed areas (I-A, II-A, III, and V-A mines). 57.22220 Section 57.22220 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... passing unsealed areas (I-A, II-A, III, and V-A mines). Air that has passed by or through unsealed...

  2. 30 CFR 57.22220 - Air passing unsealed areas (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Air passing unsealed areas (I-A, II-A, III, and V-A mines). 57.22220 Section 57.22220 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... passing unsealed areas (I-A, II-A, III, and V-A mines). Air that has passed by or through unsealed...

  3. 76 FR 77270 - Board Meeting; January 9, 2012, Arlington, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-12

    ... NUCLEAR WASTE TECHNICAL REVIEW BOARD Board Meeting; January 9, 2012, Arlington, VA The U.S. Nuclear Waste Technical Review Board will meet to discuss integration efforts undertaken by DOE-NE and DOE... Amendments Act of 1987, the U.S. Nuclear Waste Technical Review Board will hold a public meeting in Arlington...

  4. Multiclonal methicillin-resistant Staphylococcus aureus (MRSA) outbreak and its control after use of the Veterans Affairs (VA) MRSA bundle in a VA long-term care facility, 2004-2014.

    PubMed

    Webb, Risa M; Denton, Carmelita; Spruill, Emily; Henson, Gay; Bruce, Lisa; Woods, Gail L; Swiatlo, Andrea; Walker, Erica D; Peel, Chere; Sullivan, Donna

    2016-06-01

    A multiclonal methicillin-resistant Staphylococcus aureus (MRSA) outbreak with 91 infections occurred in our Veterans Affairs (VA) community living center over 46 months. Both similar and unique strains were shown by repetitive polymerase chain reaction to contribute to the outbreak, including 1 strain causing infections over a 33-month period. Most infections were soft tissue infections (67%). For 21 months after the initiation of the VA MRSA bundle, no infections were identified, and low rates of infection have been sustained an additional 4 years. The average annual rate of MRSA infection decreased by 62% (P < .001) from 0.6 per 1,000 resident days for 4 years prior to the bundle implementation to 0.09 per 1,000 resident days for 4 years after the bundle implementation. Published by Elsevier Inc.

  5. Statistical Match of the VA 1979-1980 Recipient File against the 1979-1980 Basic Grant Recipient File. Revised.

    ERIC Educational Resources Information Center

    Applied Management Sciences, Inc., Silver Spring, MD.

    The amount of misreporting of Veterans Administration (VA) benefits was assessed, along with the impact of misreporting on the Basic Educational Opportunity Grant (BEOG) program. Accurate financial information is need to determine appropriate awards. The analysis revealed: over 97% of VA beneficiaries misreported benefits; the total net loss to…

  6. 33 CFR 334.330 - Atlantic Ocean and connecting waters in vicinity of Myrtle Island, Va.; Air Force practice...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 33 Navigation and Navigable Waters 3 2014-07-01 2014-07-01 false Atlantic Ocean and connecting waters in vicinity of Myrtle Island, Va.; Air Force practice bombing, rocket firing, and gunnery range... waters in vicinity of Myrtle Island, Va.; Air Force practice bombing, rocket firing, and gunnery range...

  7. 33 CFR 334.330 - Atlantic Ocean and connecting waters in vicinity of Myrtle Island, Va.; Air Force practice...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 33 Navigation and Navigable Waters 3 2012-07-01 2012-07-01 false Atlantic Ocean and connecting waters in vicinity of Myrtle Island, Va.; Air Force practice bombing, rocket firing, and gunnery range... waters in vicinity of Myrtle Island, Va.; Air Force practice bombing, rocket firing, and gunnery range...

  8. 33 CFR 334.330 - Atlantic Ocean and connecting waters in vicinity of Myrtle Island, Va.; Air Force practice...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 3 2013-07-01 2013-07-01 false Atlantic Ocean and connecting waters in vicinity of Myrtle Island, Va.; Air Force practice bombing, rocket firing, and gunnery range... waters in vicinity of Myrtle Island, Va.; Air Force practice bombing, rocket firing, and gunnery range...

  9. 33 CFR 334.330 - Atlantic Ocean and connecting waters in vicinity of Myrtle Island, Va.; Air Force practice...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 33 Navigation and Navigable Waters 3 2011-07-01 2011-07-01 false Atlantic Ocean and connecting waters in vicinity of Myrtle Island, Va.; Air Force practice bombing, rocket firing, and gunnery range... waters in vicinity of Myrtle Island, Va.; Air Force practice bombing, rocket firing, and gunnery range...

  10. 33 CFR 334.330 - Atlantic Ocean and connecting waters in vicinity of Myrtle Island, Va.; Air Force practice...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Atlantic Ocean and connecting waters in vicinity of Myrtle Island, Va.; Air Force practice bombing, rocket firing, and gunnery range... waters in vicinity of Myrtle Island, Va.; Air Force practice bombing, rocket firing, and gunnery range...

  11. Aerosol Vacuum-Assisted Plasma Ionization (Aero-VaPI) Coupled to Ion Mobility-Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Blair, Sandra L.; Ng, Nga L.; Zambrzycki, Stephen C.; Li, Anyin; Fernández, Facundo M.

    2018-02-01

    In this communication, we report on the real-time analysis of organic aerosol particles by Vacuum-assisted Plasma Ionization-Mass Spectrometry (Aero-VaPI-MS) using a home-built VaPI ion source coupled to a Synapt G2-S HDMS ion mobility-mass spectrometry (IM-MS) system. Standards of organic molecules of interest in prebiotic chemistry were used to generate aerosols. Monocaprin and decanoic acid aerosol particles were successfully detected in both the positive and negative ion modes, respectively. A complex aerosol mixture of different sizes of polymers of L-malic acid was also examined through ion mobility (IM) separations, resulting in the detection of polymers of up to eight monomeric units. This noncommercial plasma ion source is proposed as a low cost alternative to other plasma ionization platforms used for aerosol analysis, and a higher-performance alternative to more traditional aerosol mass spectrometers. VaPI provides robust online ionization of organics in aerosols without extensive ion activation, with the coupling to IM-MS providing higher peak capacity and excellent mass accuracy. [Figure not available: see fulltext.

  12. FGM (Functionally Graded Material) Thermal Barrier Coatings for Hypersonic Structures - Design and Thermal Structural Analysis

    DTIC Science & Technology

    2007-06-29

    than others. It was found that TZ-3Y-E, which is a partially stabilised zirconia powder , was particularly suitable. The percentage of ceramic powder...layered coatings The current ceramic powder that was being used was a fully stabilised zirconia powder TZ-0Y. However a readily available powder...TZ-3Y-E, partially stabilised zirconia powder , was available and utilised. These tests consisted of a combination of 3, 4 and 5 layers. In the

  13. Molecular Dissection of the 8 Phase Transcriptional Program Controlled by Cyclin E-P220 NPAT Signaling Pathway

    DTIC Science & Technology

    2005-04-01

    enter S-phase but does not rescue endogenous histone expression (Ye et al. 2003). It is well known that HPV E7 inactivates Rb, the critical regulator...transcription during S-phase (McKnight 2003; Zheng et al. 2003), and with HiNF-P, a transcription factor critical for transactivation of histone H4 genes...CBP/p300 histone acetyltransferase to promote S-phase entry (Wang et al. 2004). Taken together, our work has allowed to demonstrate the critical role of

  14. Measuring Use of Evidence-Based Psychotherapy for PTSD in VA Residential Treatment Settings with Clinician Survey and Electronic Medical Record Templates.

    PubMed

    Shiner, Brian; Leonard Westgate, Christine; Simiola, Vanessa; Thompson, Richard; Schnurr, Paula P; Cook, Joan M

    2018-03-14

    , with polychoric correlation values of 0.77 for PE-I, 0.69 for CPT-I, and 0.82 for CPT-G. Multiple patient factors were positive (e.g., female gender) and negative (e.g., depressive disorders) predictors of receipt of EBPs, even after controlling for site. Among therapist factors, only EBP consultant or trainer status was a positive predictor of EBP provision and only therapist race was a negative predictor of EBT provision after controlling for site. Following a FY15 mandate, EMR templates documenting EBP delivery were widely used by therapists working in VA residential PTSD programs. EBP receipt measured using EMR templates was consistent with therapist self-report of EBT delivery. There were several patient-level predictors of EBP receipt and therapist-level predictors of EBP delivery. However, therapists most likely to deliver EBPs were clustered at a limited number of sites.

  15. Changes in implementation of two evidence-based psychotherapies for PTSD in VA residential treatment programs: a national investigation.

    PubMed

    Cook, Joan M; Dinnen, Stephanie; Thompson, Richard; Simiola, Vanessa; Schnurr, Paula P

    2014-04-01

    There has been little investigation of the natural course of evidence-based treatments (EBTs) over time following the draw-down of initial implementation efforts. Thus, we undertook qualitative interviews with the providers at 38 U.S. Department of Veterans Affairs' residential treatment programs for posttraumatic stress disorder (PTSD) to understand implementation and adaptation of 2 EBTs, prolonged exposure (PE), and cognitive processing therapy (CPT), at 2 time points over a 4-year period. The number of providers trained in the therapies and level of training improved over time. At baseline, of the 179 providers eligible per VA training requirements, 65 (36.4%) had received VA training in PE and 111 (62.0%) in CPT with 17 (9.5%) completing case consultation or becoming national trainers in both PE and CPT. By follow-up, of the increased number of 190 eligible providers, 87 (45.8%) had received VA training in PE and 135 (71.1%) in CPT, with 69 (36.3%) and 81 (42.6%) achieving certification, respectively. Twenty-two programs (57.9%) reported no change in PE use between baseline and follow-up, whereas 16 (42.1%) reported an increase. Twenty-four (63.2%) programs reported no change in their use of CPT between baseline and follow-up, 12 (31.6%) programs experienced an increase, and 2 (5.2%) programs experienced a decrease in use. A significant number of providers indicated that they made modifications to the manuals (e.g., tailoring, lengthening). Reasons for adaptations are discussed. The need to dedicate time and resources toward the implementation of EBTs is noted. Published 2014. This article is a US Government work and is in the public domain in the USA.

  16. Modeling of Mean-VaR portfolio optimization by risk tolerance when the utility function is quadratic

    NASA Astrophysics Data System (ADS)

    Sukono, Sidi, Pramono; Bon, Abdul Talib bin; Supian, Sudradjat

    2017-03-01

    The problems of investing in financial assets are to choose a combination of weighting a portfolio can be maximized return expectations and minimizing the risk. This paper discusses the modeling of Mean-VaR portfolio optimization by risk tolerance, when square-shaped utility functions. It is assumed that the asset return has a certain distribution, and the risk of the portfolio is measured using the Value-at-Risk (VaR). So, the process of optimization of the portfolio is done based on the model of Mean-VaR portfolio optimization model for the Mean-VaR done using matrix algebra approach, and the Lagrange multiplier method, as well as Khun-Tucker. The results of the modeling portfolio optimization is in the form of a weighting vector equations depends on the vector mean return vector assets, identities, and matrix covariance between return of assets, as well as a factor in risk tolerance. As an illustration of numeric, analyzed five shares traded on the stock market in Indonesia. Based on analysis of five stocks return data gained the vector of weight composition and graphics of efficient surface of portfolio. Vector composition weighting weights and efficient surface charts can be used as a guide for investors in decisions to invest.

  17. 30 CFR 57.22205 - Doors on main fans (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Doors on main fans (I-A, II-A, III, and V-A... main fans (I-A, II-A, III, and V-A mines). In mines ventilated by multiple main fans, each main fan... reversal through the fan. The doors shall be located so that they are not in direct line with explosive...

  18. Comparison of rates of potentially inappropriate medication use according to the Zhan criteria for VA versus private sector medicare HMOs.

    PubMed

    Barnett, Mitchell J; Perry, Paul J; Langstaff, Jodi D; Kaboli, Peter J

    2006-06-01

    Inappropriate prescribing in the elderly is common, but rates across different health care systems and the impact of formulary restrictions are not well described. To determine if rates of inappropriate medication use in the elderly differ between the Veterans Affairs (VA) health care system and the private sector Medicare health maintenance organization (HMO) patients. A cross-sectional study design compared administrative pharmacy claims from 10 distinct geographic regions in the United States in the VA health care system and 10 analogous regions for patients enrolled in Medicare HMOs. The cohorts included 123,633 VA and 157,517 Medicare HMO patients aged 65 years and older. Inappropriate medication use was identified using the Zhan modification of the Beers criteria, which categorizes 33 potentially inappropriate drugs into 3 major classifications: "always avoid," "rarely appropriate," and "some indications." Comparisons between the VA health care system and the private sector Medicare HMO were performed for overall differences and stratified by gender and age. The drug formulary status of the Zhan-criteria drugs was known for the VA health system but not for the Medicare HMO patients. Compared with private sector patients, VA patients were less likely to receive any inappropriate medication (21% vs. 29%, P <0.001), and in each classification: always avoid (2% vs. 5%, P <0.001), rarely appropriate (8% vs. 13%, P<0.001), and some indications (15% vs. 17%, P <0.001). The rate of inappropriate drug use was lower in the VA compared with the private sector for males (21% vs. 24%, P <0.001) and females (28% vs. 32%, P <0.001). Differences were consistent when stratified by age. Compared with private sector Medicare HMOs, elderly VA patients were less likely to receive medications defined by the Zhan criteria as potentially inappropriate. A restrictive formulary that excludes 12 of the 33 Zhan criteria drugs may be a factor in the reduction of undesired prescribing

  19. Barriers to Breast Cancer Screening among Latinas in the U.S.-Mexico Border Region

    DTIC Science & Technology

    2011-05-01

    la Salud : A breast and cervical... en in g E ve r ha d a m am m og ra m H ad a M am m og ra m w ith in th e la st 2 ye ar s H ad a m am m og ra m w ith in th e la st ye ar U na dj us...Cancer Society, Atlanta, GA 22. Fernandez ME, Gonzales A, Tortolero-Luna G et al (2009) Effectiveness of Cultivando la Salud : a breast and cervical

  20. 78 FR 6849 - Agency Information Collection (eBenefits Portal) Activity under OMB Review

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-31

    ... for a single sign-on credential that will ultimately be shared by other VA and DoD portals. The e...: Comments must be submitted on or before March 4, 2013. ADDRESSES: Submit written comments on the collection..., a joint project between the VA and DoD, is intended to serve as a single point of entry for benefits...

  1. Racial Differences in Satisfaction with VA Health Care: A Mixed Methods Pilot Study.

    PubMed

    Zickmund, Susan L; Burkitt, Kelly H; Gao, Shasha; Stone, Roslyn A; Rodriguez, Keri L; Switzer, Galen E; Shea, Judy A; Bayliss, Nichole K; Meiksin, Rebecca; Walsh, Mary B; Fine, Michael J

    2015-09-01

    As satisfied patients are more adherent and play a more active role in their own care, a better understanding of factors associated with patient satisfaction is important. In response to a United States Veterans Administration (VA) Hospital Report Card that revealed lower levels of satisfaction with health care for African Americans compared to Whites, we conducted a mixed methods pilot study to obtain preliminary qualitative and quantitative information about possible underlying reasons for these racial differences. We conducted telephone interviews with 30 African American and 31 White veterans with recent inpatient and/or outpatient health care visits at three urban VA Medical Centers. We coded the qualitative interviews in terms of identified themes within defined domains. We summarized racial differences using ordinal logistic regression for Likert scale outcomes and used random effects logistic regression to assess racial differences at the domain level. Compared to Whites, African Americans were younger (p < 0.001) and better educated (p = 0.04). Qualitatively, African Americans reported less satisfaction with trust/confidence in their VA providers and healthcare system and less satisfaction with patient-provider communication. Quantitatively, African Americans reported less satisfaction with outpatient care (odds ratio = 0.28; 95 % confidence interval (CI) 0.10-0.82), but not inpatient care. At the domain level, African Americans were significantly less likely than Whites to express satisfaction themes in the domain of trust/confidence (odds ratio = 0.36; 95 % CI 0.18-0.73). The current pilot study demonstrates racial differences in satisfaction with outpatient care and identifies some specific sources of dissatisfaction. Future research will include a large national cohort, including Hispanic veterans, in order to gain further insight into the sources of racial and ethnic differences in satisfaction with VA care and inform future

  2. Comparison of Friction Characteristics on TN and VA Mode Alignment Films with Friction Force Microscopy

    NASA Astrophysics Data System (ADS)

    Kwak, Musun; Chung, Hanrok; Kwon, Hyukmin; Kim, Jehyun; Han, Daekyung; Yi, Yoonseon; Lee, Sangmun; Lee, Chulgu; Cha, Sooyoul

    Using frictional force microscopy (FFM), the friction surface characteristics were compared between twisted nematic (TN) mode and vertical alignment (VA) mode alignment films (AFs). The friction asymmetry was detected depending on temperature conditions on TN mode AF, but not on VA mode AF. The difference between two modes was explained by leaning intermolecular repulsion caused by the pre-tilt angle uniformity and the density of side chain. No level difference according to temperature conditions appeared when the pre-tilt angle were measured after liquid crystal (LC) injection.

  3. VA Health Service Utilization for Homeless and Low-income Veterans

    PubMed Central

    Gabrielian, Sonya; Yuan, Anita H.; Andersen, Ronald M.; Rubenstein, Lisa V.; Gelberg, Lillian

    2016-01-01

    Background The US Department of Housing and Urban Development (HUD)-VA Supportive Housing (VASH) program—the VA’s Housing First effort—is central to efforts to end Veteran homelessness. Yet, little is known about health care utilization patterns associated with achieving HUD-VASH housing. Objectives We compare health service utilization at the VA Greater Los Angeles among: (1) formerly homeless Veterans housed through HUD-VASH (HUD-VASH Veterans); (2) currently homeless Veterans; (3) housed, low-income Veterans not in HUD-VASH; and (4) housed, not low-income Veterans. Research Design We performed a secondary database analysis of Veterans (n = 62,459) who received VA Greater Los Angeles care between October 1, 2010 and September 30, 2011. We described medical/surgical and mental health utilization [inpatient, outpatient, and emergency department (ED)]. We controlled for demographics, need, and primary care use in regression analyses of utilization data by housing and income status. Results HUD-VASH Veterans had more inpatient, outpatient, and ED use than currently homeless Veterans. Adjusting for demographics and need, HUD-VASH Veterans and the low-income housed Veterans had similar likelihoods of medical/surgical inpatient and outpatient utilization, compared with the housed, not low-income group. Adjusting first for demographics and need (model 1), then also for primary care use (model 2), HUD-VASH Veterans had the greatest decrease in incident rates of specialty medical/surgical, mental health, and ED care from models 1 to 2, becoming similar to the currently homeless, compared with the housed, not low-income group. Conclusions Our findings suggest that currently homeless Veterans underuse health care relative to housed Veterans. HUD-VASH may address this disparity by providing housing and linkages to primary care. PMID:24714583

  4. 33 CFR 334.260 - York River, Va.; naval restricted areas.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ....; naval restricted areas. (a) The areas—(1) Naval mine service-testing area (prohibited). A rectangular... 76°31′50″ W.; and thence along the shore line to the point of beginning. (2) Naval mine service... 33 Navigation and Navigable Waters 3 2012-07-01 2012-07-01 false York River, Va.; naval restricted...

  5. 33 CFR 334.260 - York River, Va.; naval restricted areas.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ....; naval restricted areas. (a) The areas—(1) Naval mine service-testing area (prohibited). A rectangular... 76°31′50″ W.; and thence along the shore line to the point of beginning. (2) Naval mine service... 33 Navigation and Navigable Waters 3 2011-07-01 2011-07-01 false York River, Va.; naval restricted...

  6. 33 CFR 334.260 - York River, Va.; naval restricted areas.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ....; naval restricted areas. (a) The areas—(1) Naval mine service-testing area (prohibited). A rectangular... 76°31′50″ W.; and thence along the shore line to the point of beginning. (2) Naval mine service... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false York River, Va.; naval restricted...

  7. 38 CFR 17.106 - VA collection rules; third-party payers.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... a veteran who is also a beneficiary under the third-party payer's plan. VA's right to recover or... prosecute legal proceedings against a third-party payer to enforce a right of the United States under 38 U.S... the terms and conditions of the third-party payer's plan. Patient care records will not be made...

  8. 38 CFR 17.106 - VA collection rules; third-party payers.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... a veteran who is also a beneficiary under the third-party payer's plan. VA's right to recover or... prosecute legal proceedings against a third-party payer to enforce a right of the United States under 38 U.S... the terms and conditions of the third-party payer's plan. Patient care records will not be made...

  9. Ethanol and Acetic Acid Production from Carbon Monoxide in a Clostridium Strain in Batch and Continuous Gas-Fed Bioreactors

    PubMed Central

    Nalakath Abubackar, Haris; Veiga, María C.; Kennes, Christian

    2015-01-01

    The effect of different sources of nitrogen as well as their concentrations on the bioconversion of carbon monoxide to metabolic products such as acetic acid and ethanol by Clostridium autoethanogenum was studied. In a first set of assays, under batch conditions, either NH4Cl, trypticase soy broth or yeast extract (YE) were used as sources of nitrogen. The use of YE was found statistically significant (p < 0.05) on the product spectrum in such batch assays. In another set of experiments, three bioreactors were operated with continuous CO supply, in order to estimate the effect of running conditions on products and biomass formation. The bioreactors were operated under different conditions, i.e., EXP1 (pH = 5.75, YE 1g/L), EXP2 (pH = 4.75, YE 1 g/L) and EXP3 (pH = 5.75, YE 0.2 g/L). When compared to EXP2 and EXP3, it was found that EXP1 yielded the maximum biomass accumulation (302.4 mg/L) and products concentrations, i.e., acetic acid (2147.1 mg/L) and ethanol (352.6 mg/L). This can be attributed to the fact that the higher pH and higher YE concentration used in EXP1 stimulated cell growth and did, consequently, also enhance metabolite production. However, when ethanol is the desired end-product, as a biofuel, the lower pH used in EXP2 was more favourable for solventogenesis and yielded the highest ethanol/acetic acid ratio, reaching a value of 0.54. PMID:25608591

  10. Ethanol and acetic acid production from carbon monoxide in a Clostridium strain in batch and continuous gas-fed bioreactors.

    PubMed

    Abubackar, Haris Nalakath; Veiga, María C; Kennes, Christian

    2015-01-20

    The effect of different sources of nitrogen as well as their concentrations on the bioconversion of carbon monoxide to metabolic products such as acetic acid and ethanol by Clostridium autoethanogenum was studied. In a first set of assays, under batch conditions, either NH4Cl, trypticase soy broth or yeast extract (YE) were used as sources of nitrogen. The use of YE was found statistically significant (p < 0.05) on the product spectrum in such batch assays. In another set of experiments, three bioreactors were operated with continuous CO supply, in order to estimate the effect of running conditions on products and biomass formation. The bioreactors were operated under different conditions, i.e., EXP1 (pH = 5.75, YE 1g/L), EXP2 (pH = 4.75, YE 1 g/L) and EXP3 (pH = 5.75, YE 0.2 g/L). When compared to EXP2 and EXP3, it was found that EXP1 yielded the maximum biomass accumulation (302.4 mg/L) and products concentrations, i.e., acetic acid (2147.1 mg/L) and ethanol (352.6 mg/L). This can be attributed to the fact that the higher pH and higher YE concentration used in EXP1 stimulated cell growth and did, consequently, also enhance metabolite production. However, when ethanol is the desired end-product, as a biofuel, the lower pH used in EXP2 was more favourable for solventogenesis and yielded the highest ethanol/acetic acid ratio, reaching a value of 0.54.

  11. 78 FR 27882 - VA Veteran-Owned Small Business (VOSB) Verification Guidelines

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-13

    ... Verification Self-Assessment Tool that walks the veteran through the regulation and how it applies to the...) Verification Guidelines AGENCY: Department of Veterans Affairs. ACTION: Advanced notice of proposed rulemaking... regulations governing the Department of Veterans Affairs (VA) Veteran-Owned Small Business (VOSB) Verification...

  12. Comparison of Comet Enflow and VA One Acoustic-to-Structure Power Flow Predictions

    NASA Technical Reports Server (NTRS)

    Grosveld, Ferdinand W.; Schiller, Noah H.; Cabell, Randolph H.

    2010-01-01

    Comet Enflow is a commercially available, high frequency vibroacoustic analysis software based on the Energy Finite Element Analysis (EFEA). In this method the same finite element mesh used for structural and acoustic analysis can be employed for the high frequency solutions. Comet Enflow is being validated for a floor-equipped composite cylinder by comparing the EFEA vibroacoustic response predictions with Statistical Energy Analysis (SEA) results from the commercial software program VA One from ESI Group. Early in this program a number of discrepancies became apparent in the Enflow predicted response for the power flow from an acoustic space to a structural subsystem. The power flow anomalies were studied for a simple cubic, a rectangular and a cylindrical structural model connected to an acoustic cavity. The current investigation focuses on three specific discrepancies between the Comet Enflow and the VA One predictions: the Enflow power transmission coefficient relative to the VA One coupling loss factor; the importance of the accuracy of the acoustic modal density formulation used within Enflow; and the recommended use of fast solvers in Comet Enflow. The frequency region of interest for this study covers the one-third octave bands with center frequencies from 16 Hz to 4000 Hz.

  13. Implementing the KiVa Antibullying Program: Recognition of Stable Victims

    ERIC Educational Resources Information Center

    Haataja, Anne; Sainio, Miia; Turtonen, Mira; Salmivalli, Christina

    2016-01-01

    Teachers do not always recognise students who are victimised by their peers. In this study, we examined the recognition of stable victims in 76 schools beginning to implement the KiVa antibullying programme. We focused on 348 victims (9-15 years) who reported victimisation at the pretest and still at wave 2, after five months of programme…

  14. Identification and classification of genes regulated by phosphatidylinositol 3-kinase- and TRKB-mediated signalling pathways during neuronal differentiation in two subtypes of the human neuroblastoma cell line SH-SY5Y.

    PubMed

    Nishida, Yuichiro; Adati, Naoki; Ozawa, Ritsuko; Maeda, Aasami; Sakaki, Yoshiyuki; Takeda, Tadayuki

    2008-10-28

    SH-SY5Y cells exhibit a neuronal phenotype when treated with all-trans retinoic acid (RA), but the molecular mechanism of activation in the signalling pathway mediated by phosphatidylinositol 3-kinase (PI3K) is unclear. To investigate this mechanism, we compared the gene expression profiles in SK-N-SH cells and two subtypes of SH-SY5Y cells (SH-SY5Y-A and SH-SY5Y-E), each of which show a different phenotype during RA-mediated differentiation. SH-SY5Y-A cells differentiated in the presence of RA, whereas RA-treated SH-SY5Y-E cells required additional treatment with brain-derived neurotrophic factor (BDNF) for full differentiation. After exposing cells to a PI3K inhibitor, LY294002, we identified 386 genes and categorised these genes into two clusters dependent on the PI3K signalling pathway during RA-mediated differentiation in SH-SY5Y-A cells. Transcriptional regulation of the gene cluster, including 158 neural genes, was greatly reduced in SK-N-SH cells and partially impaired in SH-SY5Y-E cells, which is consistent with a defect in the neuronal phenotype of these cells. Additional stimulation with BDNF induced a set of neural genes that were down-regulated in RA-treated SH-SY5Y-E cells but were abundant in differentiated SH-SY5Y-A cells. We identified gene clusters controlled by PI3K- and TRKB-mediated signalling pathways during the differentiation of two subtypes of SH-SY5Y cells. The TRKB-mediated bypass pathway compensates for impaired neural function generated by defects in several signalling pathways, including PI3K in SH-SY5Y-E cells. Our expression profiling data will be useful for further elucidation of the signal transduction-transcriptional network involving PI3K or TRKB.

  15. 38 CFR 17.107 - VA response to disruptive behavior of patients.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2014-07-01 2014-07-01 false VA response to disruptive behavior of patients. 17.107 Section 17.107 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS MEDICAL Disciplinary Control of Beneficiaries Receiving Hospital, Domiciliary Or Nursing Home Care...

  16. 38 CFR 17.107 - VA response to disruptive behavior of patients.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2013-07-01 2013-07-01 false VA response to disruptive behavior of patients. 17.107 Section 17.107 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS MEDICAL Disciplinary Control of Beneficiaries Receiving Hospital, Domiciliary Or Nursing Home Care...

  17. 38 CFR 17.107 - VA response to disruptive behavior of patients.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2012-07-01 2012-07-01 false VA response to disruptive behavior of patients. 17.107 Section 17.107 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS MEDICAL Disciplinary Control of Beneficiaries Receiving Hospital, Domiciliary Or Nursing Home Care...

  18. 38 CFR 58.17 - VA Form 10-0144A-Statement of Assurance of Compliance with Equal Opportunity Laws.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false VA Form 10-0144A-Statement of Assurance of Compliance with Equal Opportunity Laws. 58.17 Section 58.17 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) FORMS § 58.17 VA Form 10-0144A—Statement of Assurance of Compliance with Equal...

  19. 30 CFR 57.22204 - Main fan operation and inspection (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Main fan operation and inspection (I-A, II-A, III, and V-A mines). 57.22204 Section 57.22204 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... Main fan operation and inspection (I-A, II-A, III, and V-A mines). Main fans shall be— (a) Provided...

  20. Computer-Based Patient Records: Better Planning and Oversight by VA, DOD, and IHS Would Enhance Health Data Sharing

    DTIC Science & Technology

    2001-04-01

    IHS), could share information technology (IT) and patient medical information to provide greater continuity of care, accelerate VA eligibility... patient medical information to provide greater continuity of care, accelerate VA eligibility determinations, and save software development costs.1 In...system, which primarily includes information on patient hospital admission and discharge, patient medications , laboratory results, and radiology

  1. 30 CFR 57.22204 - Main fan operation and inspection (I-A, II-A, III, and V-A mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Main fan operation and inspection (I-A, II-A, III, and V-A mines). 57.22204 Section 57.22204 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... Main fan operation and inspection (I-A, II-A, III, and V-A mines). Main fans shall be— (a) Provided...

  2. Characterization of the interaction between the heavy and light chains of bovine factor Va.

    PubMed

    Walker, F J

    1992-10-05

    Bovine factor Va has been previously been shown to consist of heavy (M(r) = 94,000) and light chains (M(r) = 81,000), that interact in a manner dependent upon the presence of either calcium or manganese ions. In an attempt to understand the mechanism of subunit interaction we have studied the effects of temperature and ions on factor Va stability. The rates of formation of factor Va from isolated chains and dissociation were temperature-dependent with an energy of activation of 6.2 and 1.3 kcal mol-1, respectively. The yield of factor Va from isolated chains was inversely related to the amount of time the chains were incubated at 4 degrees C. Incubation of individual chains revealed that the heavy chain is cold-labile, an effect that is reversible. Manganese ion was observed to prevent the conversion to the inactive form. High salt tends to stabilize the two-chain structure of factor Va, but is inhibitory to its formation from isolated chains. High concentrations of either manganese or calcium ions also inhibited reconstitution of activity. The light chain, in particular, was sensitive to the presence of manganese or calcium ion. Heavy chain that had been cleaved by activated protein C had a weakened interaction with the light chain, and the resulting complex had no procoagulant activity. Cooling of the heavy chain to 4 degrees C enhanced its intrinsic fluorescence. Manganese ion prevented some of this enhancement. The heavy chain fluorescence returned to the room temperature value with a half-life of approximately 10 min. In the presence of manganese ion relaxation was accelerated. The intrinsic fluorescence of activated protein C-cleaved heavy chain was not increased when the temperature was decreased. These data suggest that the heavy chain can exist in two forms. Elevated temperature converts it to a form that can bind ions and have a productive interaction with the light chain. However, conditions that prevent the heavy chain from combining with the light

  3. 32 CFR Appendix E to Subpart M of... - References

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 32 National Defense 3 2010-07-01 2010-07-01 true References E Appendix E to Subpart M of Part 552... Training Center, and Camp Bonneville Pt. 552, Subpt. M, App. E Appendix E to Subpart M of Part 552... Services, U.S. Department of Commerce, 5285 Port Royal Road, Springfield, VA 22161. Fort Lewis Regulations...

  4. Evaluating and improving pressure ulcer care: the VA experience with administrative data.

    PubMed

    Berlowitz, D R; Halpern, J

    1997-08-01

    A number of state initiatives are using databases originally developed for nursing home reimbursements to assess the quality of care. Since 1991 the Department of Veterans Affairs (VA; Washington, DC) has been using a long term care administrative database to calculate facility-specific rates of pressure ulcer development. This information is disseminated to all 140 long term care facilities as part of a quality assessment and improvement program. Assessments are performed on all long term care residents on April 1 and October 1, as well as at the time of admission or transfer to a long term care unit. Approximately 18,000 long term care residents are evaluated in each six-month period; the VA rate of pressure ulcer development is approximately 3.5%. Reports of the rates of pressure ulcer development are then disseminated to all facilities, generally within two months of the assessment date. The VA's more than five years' experience in using administrative data to assess outcomes for long term care highlights several important issues that should be considered when using outcome measures based on administrative data. These include the importance of carefully selecting the outcome measure, the need to consider the structure of the database, the role of case-mix adjustment, strategies for reporting rates to small facilities, and methods for information dissemination. Attention to these issues will help ensure that results from administrative databases lead to improvements in the quality of care.

  5. 77 FR 24268 - Agency Information Collection (Dependents' Application for VA Educational Benefits) Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-23

    .../11 GI Bill Marine Gunnery Sergeant John David Fry Scholarship (Fry Scholarship) benefits. VA will use the information collected to determine whether a claimant qualifies for DEA or Fry Scholarship...

  6. VA Student Financial Aid. Opportunity To Reduce Overlap in Approving Education and Training Programs. Report to the Committee on Veterans' Affairs, U.S. Senate.

    ERIC Educational Resources Information Center

    General Accounting Office, Washington, DC. Health, Education, and Human Services Div.

    The Department of Veterans Affairs (VA) contracts with state approving agencies (SAAs) to assess whether schools and training programs offer education of sufficient quality for veterans to receive VA education assistance benefits when attending them. The General Accounting Office examined the gatekeeping activities of the VA and the Department of…

  7. 33 CFR 80.505 - Cape Henlopen, DE to Cape Charles, VA.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Cape Henlopen, DE to Cape Charles, VA. 80.505 Section 80.505 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Fifth District § 80.505 Cape Henlopen, DE...

  8. 33 CFR 334.280 - James River between the entrance to Skiffes Creek and Mulberry Point, Va.; army training and...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... to Skiffes Creek and Mulberry Point, Va.; army training and small craft testing area. 334.280 Section... DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.280 James River between the entrance to Skiffes Creek and Mulberry Point, Va.; army training and small craft testing area. (a) The restricted area...

  9. NPDES Permit for Eastern Colorado Health Care System (VA Hospital) in Colorado

    EPA Pesticide Factsheets

    Under NPDES permit CO-0034991, the U.S. Department of Veterans Affairs (VA) is authorized to discharge from its wastewater treatment facility in Adams County, Colorado, to a storm sewer to Toll Gate Creek, a tributary of Sand Creek.

  10. Prevalence and correlates of cannabis use in an outpatient VA posttraumatic stress disorder clinic.

    PubMed

    Gentes, Emily L; Schry, Amie R; Hicks, Terrell A; Clancy, Carolina P; Collie, Claire F; Kirby, Angela C; Dennis, Michelle F; Hertzberg, Michael A; Beckham, Jean C; Calhoun, Patrick S

    2016-05-01

    Recent research has documented high rates of comorbidity between cannabis use disorders and posttraumatic stress disorder (PTSD) in veterans. However, despite possible links between PTSD and cannabis use, relatively little is known about cannabis use in veterans who present for PTSD treatment, particularly among samples not diagnosed with a substance use disorder. This study examined the prevalence of cannabis use and the psychological and functional correlates of cannabis use among a large sample of veterans seeking treatment at a Veterans Affairs (VA) PTSD specialty clinic. Male veterans (N = 719) who presented at a VA specialty outpatient PTSD clinic completed measures of demographic variables, combat exposure, alcohol, cannabis and other drug use, and PTSD and depressive symptoms. The associations among demographic, psychological, and functional variables were estimated using logistic regressions. Overall, 14.6% of participants reported using cannabis in the past 6 months. After controlling for age, race, service era, and combat exposure, past 6-month cannabis use was associated with unmarried status, use of tobacco products, other drug use, hazardous alcohol use, PTSD severity, depressive symptom severity, and suicidality. The present findings show that cannabis use is quite prevalent among veterans seeking PTSD specialty treatment and is associated with poorer mental health and use of other substances. It may be possible to identify and treat individuals who use cannabis in specialty clinics (e.g., PTSD clinics) where they are likely to present for treatment of associated mental health issues. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  11. Making the connection: the VA-Regenstrief project.

    PubMed

    Martin, D K

    1992-01-01

    The Regenstrief Automated Medical Record System is a well-established clinical information system with powerful facilities for querying and decision support. My colleagues and I introduced this system into the Indianapolis Veterans Affairs (VA) Medical Center by interfacing it to the institution's automated data-processing system, the Decentralized Hospital Computer Program (DHCP), using a recently standardized method for clinical data interchange. This article discusses some of the challenges encountered in that process, including the translation of vocabulary terms and maintenance of the software interface. Efforts such as these demonstrate the importance of standardization in medical informatics and the need for data standards at all levels of information exchange.

  12. Persistence of an intact endometrial matrix and vessels structure in women exposed to VA-2914, a selective progesterone receptor modulator.

    PubMed

    Ravet, S; Munaut, C; Blacher, S; Brichant, G; Labied, S; Beliard, A; Chabbert-Buffet, N; Bouchard, P; Foidart, J-M; Pintiaux, A

    2008-11-01

    VA-2914 is a selective progesterone receptor modulator with potential contraceptive activity that induces amenorrhea, whereas progestins cause endometrial spotting and bleeding. This abnormal bleeding due to progestins is a consequence of focal stromal proteolysis by an increase in naked vessel size and density. Our objective was to quantify the effects of VA-2914 on endometrial vascularization, fibrillar matrix, and vascular endothelial growth factor (VEGF)-A expression in endometrial biopsies from 41 women before and after 12 wk daily treatment with a placebo, or 2.5, 5, or 10 mg VA-2914. Collagen fibrillar network was stained by silver impregnation. Vessel area, density, and structure were quantified with a computer-assisted image analysis system after double immunostaining using an anti-von Willebrand factor (endothelial cells) and an anti-alpha smooth muscle actin (vascular smooth muscle cells) marker antibody. VEGF-A mRNAs were quantified by RT-PCR and localized by immunohistochemistry. The endometrial vessels, collagen network, and mRNA levels of VEGF-A were identical during the luteal phase at baseline and in VA-2914 treated women. VEGF-A distribution was unchanged. VA-2914 does not alter the endometrial matrix and cells, and does not modify the endometrial vessel morphology as compared with baseline biopsies.

  13. Predicting glycerophosphoinositol identities in lipidomic datasets using VaLID (Visualization and Phospholipid Identification)--an online bioinformatic search engine.

    PubMed

    McDowell, Graeme S V; Blanchard, Alexandre P; Taylor, Graeme P; Figeys, Daniel; Fai, Stephen; Bennett, Steffany A L

    2014-01-01

    The capacity to predict and visualize all theoretically possible glycerophospholipid molecular identities present in lipidomic datasets is currently limited. To address this issue, we expanded the search-engine and compositional databases of the online Visualization and Phospholipid Identification (VaLID) bioinformatic tool to include the glycerophosphoinositol superfamily. VaLID v1.0.0 originally allowed exact and average mass libraries of 736,584 individual species from eight phospholipid classes: glycerophosphates, glyceropyrophosphates, glycerophosphocholines, glycerophosphoethanolamines, glycerophosphoglycerols, glycerophosphoglycerophosphates, glycerophosphoserines, and cytidine 5'-diphosphate 1,2-diacyl-sn-glycerols to be searched for any mass to charge value (with adjustable tolerance levels) under a variety of mass spectrometry conditions. Here, we describe an update that now includes all possible glycerophosphoinositols, glycerophosphoinositol monophosphates, glycerophosphoinositol bisphosphates, and glycerophosphoinositol trisphosphates. This update expands the total number of lipid species represented in the VaLID v2.0.0 database to 1,473,168 phospholipids. Each phospholipid can be generated in skeletal representation. A subset of species curated by the Canadian Institutes of Health Research Training Program in Neurodegenerative Lipidomics (CTPNL) team is provided as an array of high-resolution structures. VaLID is freely available and responds to all users through the CTPNL resources web site.

  14. Should tumbling E go out of date in amblyopia screening? Evidence from a population-based sample normative in children aged 3-4 years.

    PubMed

    Guimaraes, Sandra; Fernandes, Tiago; Costa, Patrício; Silva, Eduardo

    2018-06-01

    To determine a normative of tumbling E optotype and its feasibility for visual acuity (VA) assessment in children aged 3-4 years. A cross-sectional study of 1756 children who were invited to participate in a comprehensive non-invasive eye exam. Uncorrected monocular VA with crowded tumbling E with a comprehensive ophthalmological examination were assessed. Testability rates of the whole population and VA of the healthy children for different age subgroups, gender, school type and the order of testing in which the ophthalmological examination was performed were evaluated. The overall testability rate was 95% (92% and 98% for children aged 3 and 4 years, respectively). The mean VA of the first-day assessment (first-VA) and best-VA over 2 days' assessments was 0.14 logMAR (95% CI 0.14 to 0.15) (decimal=0.72, 95% CI 0.71 to 0.73) and 0.13 logMAR (95% CI 0.13 to 0.14) (decimal=0.74, 95% CI 0.73 to 0.74). Analysis with age showed differences between groups in first-VA (F(3,1146)=10.0; p<0.001; η2=0.026) and best-VA (F(3,1155)=8.8; p<0.001; η2=0.022). Our normative was very highly correlated with previous reported HOTV-Amblyopia-Treatment-Study (HOTV-ATS) (first-VA, r=0.97; best-VA, r=0.99), with 0.8 to 0.7 lines consistent overestimation for HOTV-ATS as described in literature. Overall false-positive referral was 1.3%, being specially low regarding anisometropias of ≥2 logMAR lines (0.17%). Interocular difference ≥1 line VA logMAR was not associated with age (p=0.195). This is the first normative for European Caucasian children with single crowded tumbling E in healthy eyes and the largest study comparing 3 and 4 years old testability. Testability rates are higher than found in literature with other optotypes, especially in children aged 3 years, where we found 5%-11% better testability rates. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise

  15. Inter-rater reliability and review of the VA unresolved narratives.

    PubMed Central

    Eagon, J. C.; Hurdle, J. F.; Lincoln, M. J.

    1996-01-01

    To better understand how VA clinicians use medical vocabulary in every day practice, we set out to characterize terms generated in the Problem List module of the VA's DHCP system that were not mapped to terms in the controlled-vocabulary lexicon of DHCP. When entered terms fail to match those in the lexicon, a note is sent to a central repository. When our study started, the volume in that repository had reached 16,783 terms. We wished to characterize the potential reasons why these terms failed to match terms in the lexicon. After examining two small samples of randomly selected terms, we used group consensus to develop a set of rating criteria and a rating form. To be sure that the results of multiple reviewers could be confidently compared, we analyzed the inter-rater agreement of our rating process. Two rates used this form to rate the same 400 terms. We found that modifiers and numeric data were common and consistent reasons for failure to match, while others such as use of synonyms and absence of the concept from the lexicon were common but less consistently selected. PMID:8947642

  16. Inter-rater reliability and review of the VA unresolved narratives.

    PubMed

    Eagon, J C; Hurdle, J F; Lincoln, M J

    1996-01-01

    To better understand how VA clinicians use medical vocabulary in every day practice, we set out to characterize terms generated in the Problem List module of the VA's DHCP system that were not mapped to terms in the controlled-vocabulary lexicon of DHCP. When entered terms fail to match those in the lexicon, a note is sent to a central repository. When our study started, the volume in that repository had reached 16,783 terms. We wished to characterize the potential reasons why these terms failed to match terms in the lexicon. After examining two small samples of randomly selected terms, we used group consensus to develop a set of rating criteria and a rating form. To be sure that the results of multiple reviewers could be confidently compared, we analyzed the inter-rater agreement of our rating process. Two rates used this form to rate the same 400 terms. We found that modifiers and numeric data were common and consistent reasons for failure to match, while others such as use of synonyms and absence of the concept from the lexicon were common but less consistently selected.

  17. A large-scale evaluation of the KiVa antibullying program: grades 4-6.

    PubMed

    Kärnä, Antti; Voeten, Marinus; Little, Todd D; Poskiparta, Elisa; Kaljonen, Anne; Salmivalli, Christina

    2011-01-01

    This study demonstrates the effectiveness of the KiVa antibullying program using a large sample of 8,237 youth from Grades 4-6 (10-12 years). Altogether, 78 schools were randomly assigned to intervention (39 schools, 4,207 students) and control conditions (39 schools, 4,030 students). Multilevel regression analyses revealed that after 9 months of implementation, the intervention had consistent beneficial effects on 7 of the 11 dependent variables, including self- and peer-reported victimization and self-reported bullying. The results indicate that the KiVa program is effective in reducing school bullying and victimization in Grades 4-6. Despite some evidence against school-based interventions, the results suggest that well-conceived school-based programs can reduce victimization. © 2011 The Authors. Child Development © 2011 Society for Research in Child Development, Inc.

  18. Expression of Vitis amurensis VaERF20 in Arabidopsis thaliana Improves Resistance to Botrytis cinerea and Pseudomonas syringae pv. Tomato DC3000.

    PubMed

    Wang, Mengnan; Zhu, Yanxun; Han, Rui; Yin, Wuchen; Guo, Chunlei; Li, Zhi; Wang, Xiping

    2018-03-01

    Ethylene response factor (ERF) transcription factors play important roles in regulating immune responses in plants. In our study, we characterized a member of the ERF transcription factor family, VaERF20 , from the Chinese wild Vitis genotype, V. amurensis Rupr "Shuangyou". Phylogenetic analysis indicated that VaERF20 belongs to group IXc of the ERF family, in which many members are known to contribute to fighting pathogen infection. Consistent with this, expression of VaERF20 was induced by treatment with the necrotrophic fungal pathogen Botrytis cinerea (B. cinerea ) in "Shuangyou" and V. vinifera "Red Globe". Arabidopsis thaliana plants over-expressing VaERF20 displayed enhanced resistance to B. cinerea and the bacterium Pseudomonas syringae pv. tomato ( Pst ) DC3000. Patterns of pathogen-induced reactive oxygen species (ROS) accumulation were entirely distinct in B. cinerea and Pst DC3000 inoculated plants. Examples of both salicylic acid (SA) and jasmonic acid/ethylene (JA/ET) responsive defense genes were up-regulated after B. cinerea and Pst DC3000 inoculation of the VaERF20 -overexpressing transgenic A. thaliana plants. Evidence of pattern-triggered immunity (PTI), callose accumulation and stomatal defense, together with increased expression of PTI genes, was also greater in the transgenic lines. These data indicate that VaERF20 participates in various signal transduction pathways and acts as an inducer of immune responses.

  19. Expression of Vitis amurensis VaERF20 in Arabidopsis thaliana Improves Resistance to Botrytis cinerea and Pseudomonas syringae pv. Tomato DC3000

    PubMed Central

    Wang, Mengnan; Zhu, Yanxun; Han, Rui; Yin, Wuchen; Guo, Chunlei; Li, Zhi; Wang, Xiping

    2018-01-01

    Ethylene response factor (ERF) transcription factors play important roles in regulating immune responses in plants. In our study, we characterized a member of the ERF transcription factor family, VaERF20, from the Chinese wild Vitis genotype, V. amurensis Rupr “Shuangyou”. Phylogenetic analysis indicated that VaERF20 belongs to group IXc of the ERF family, in which many members are known to contribute to fighting pathogen infection. Consistent with this, expression of VaERF20 was induced by treatment with the necrotrophic fungal pathogen Botrytis cinerea (B. cinerea) in “Shuangyou” and V. vinifera “Red Globe”. Arabidopsis thaliana plants over-expressing VaERF20 displayed enhanced resistance to B. cinerea and the bacterium Pseudomonas syringae pv. tomato (Pst) DC3000. Patterns of pathogen-induced reactive oxygen species (ROS) accumulation were entirely distinct in B. cinerea and PstDC3000 inoculated plants. Examples of both salicylic acid (SA) and jasmonic acid/ethylene (JA/ET) responsive defense genes were up-regulated after B. cinerea and PstDC3000 inoculation of the VaERF20-overexpressing transgenic A. thaliana plants. Evidence of pattern-triggered immunity (PTI), callose accumulation and stomatal defense, together with increased expression of PTI genes, was also greater in the transgenic lines. These data indicate that VaERF20 participates in various signal transduction pathways and acts as an inducer of immune responses. PMID:29494485

  20. The business case for the reduction of surgical complications in VA hospitals.

    PubMed

    Vaughan-Sarrazin, Mary; Bayman, Levent; Rosenthal, Gary; Henderson, William; Hendricks, Ann; Cullen, Joseph J

    2011-04-01

    Surgical complications contribute substantially to costs. Most important, surgical complications contribute to morbidity and mortality, and some may be preventable. This study estimates costs of specific surgical complications for patients undergoing general surgery in VA hospitals using merged data from the VA Surgical Quality Improvement Program and VA Decision Support System. Costs associated with 19 potentially preventable complications within 6 broader categories were estimated using generalized, linear mixed regression models to control for patient-level determinants of costs (eg, type of operation, demographics, comorbidity, severity) and hospital-level variation in costs. Costs included costs of the index hospitalization and subsequent 30-day readmissions. In 14,639 patients undergoing general surgical procedures from 10/2005 through 9/2006, 20% of patients developed postoperative surgical complications. The presence of any complication significantly increased unadjusted costs nearly 3-fold ($61,083 vs $22,000), with the largest cost differential attributed to respiratory complications. Patients who developed complications had several markers for greater preoperative severity, including increased age and a lesser presurgery functional health status. After controlling for differences in patient severity, costs for patients with any complication were 1.89 times greater compared to costs for patients with no complications (P < .0001). Within major complication categories, adjusted costs were significantly greater for patients with respiratory, cardiac, central nervous system, urinary, wound, or other complications. Surgical complications contribute markedly to costs of inpatient operations. Investment in quality improvement that decreases the incidence of surgical complications could decrease costs. Copyright © 2011 Mosby, Inc. All rights reserved.

  1. Addressing the Health Concerns of VA Women with Sexual Trauma

    DTIC Science & Technology

    2017-10-01

    AWARD NUMBER: W81XWH-14-1-0368 TITLE: Addressing the Health Concerns of VA Women with Sexual Trauma PRINCIPAL INVESTIGATOR: Caron Zlotnick, PhD...develop and assess a computer-delivered intervention (Safety and Health Experiences Program; SHE) that will provide a screening and brief behavior...intervention for women veterans with any lifetime ST. More specifically, the intervention, SHE, will address interrelated health concerns for women

  2. Interactions between Leishmania braziliensis and Macrophages Are Dependent on the Cytoskeleton and Myosin Va

    PubMed Central

    Azevedo, Elisama; Oliveira, Leandro Teixeira; Castro Lima, Ana Karina; Terra, Rodrigo; Dutra, Patrícia Maria Lourenço; Salerno, Verônica P.

    2012-01-01

    Leishmaniasis is a neglected tropical disease with no effective vaccines. Actin, microtubules and the actin-based molecular motor myosin Va were investigated for their involvement in Leishmania braziliensis macrophage interactions. Results showed a decrease in the association index when macrophages were without F-actin or microtubules regardless of the activation state of the macrophage. In the absence of F-actin, the production of NO in non-activated cells increased, while in activated cells, the production of NO was reduced independent of parasites. The opposite effect of an increased NO production was observed in the absence of microtubules. In activated cells, the loss of cytoskeletal components inhibited the release of IL-10 during parasite interactions. The production of IL-10 also decreased in the absence of actin or microtubules in non-activated macrophages. Only the disruption of actin altered the production of TNF-α in activated macrophages. The expression of myosin Va tail resulted in an acute decrease in the association index between transfected macrophages and L. braziliensis promastigotes. These data reveal the importance of F-actin, microtubules, and myosin-Va suggesting that modulation of the cytoskeleton may be a mechanism used by L. braziliensis to overcome the natural responses of macrophages to establish infections. PMID:22792440

  3. Interactions between Leishmania braziliensis and Macrophages Are Dependent on the Cytoskeleton and Myosin Va.

    PubMed

    Azevedo, Elisama; Oliveira, Leandro Teixeira; Castro Lima, Ana Karina; Terra, Rodrigo; Dutra, Patrícia Maria Lourenço; Salerno, Verônica P

    2012-01-01

    Leishmaniasis is a neglected tropical disease with no effective vaccines. Actin, microtubules and the actin-based molecular motor myosin Va were investigated for their involvement in Leishmania braziliensis macrophage interactions. Results showed a decrease in the association index when macrophages were without F-actin or microtubules regardless of the activation state of the macrophage. In the absence of F-actin, the production of NO in non-activated cells increased, while in activated cells, the production of NO was reduced independent of parasites. The opposite effect of an increased NO production was observed in the absence of microtubules. In activated cells, the loss of cytoskeletal components inhibited the release of IL-10 during parasite interactions. The production of IL-10 also decreased in the absence of actin or microtubules in non-activated macrophages. Only the disruption of actin altered the production of TNF-α in activated macrophages. The expression of myosin Va tail resulted in an acute decrease in the association index between transfected macrophages and L. braziliensis promastigotes. These data reveal the importance of F-actin, microtubules, and myosin-Va suggesting that modulation of the cytoskeleton may be a mechanism used by L. braziliensis to overcome the natural responses of macrophages to establish infections.

  4. Towards a Heterogeneous, Polystore-like Data Architecture for the US Department of Veteran Affairs (VA) Enterprise Analytics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Begoli, Edmon; Bates, Jack; Kistler, Derek E

    The Polystore architecture revisits the federated approach to access and querying of the standalone, independent databases in the uniform and optimized fashion, but this time in the context of heterogeneous data and specialized analyses. In the light of this architectural philosophy, and in the light of the major data architecture development efforts at the US Department of Veterans Administration (VA), we discuss the need for the heterogeneous data store consisting of the large relational data warehouse, an image and text datastore, and a peta-scale genomic repository. The VA's heterogeneous datastore would, to a larger or smaller degree, follow the architecturalmore » blueprint proposed by the polystore architecture. To this end, we discuss the current state of the data architecture at VA, architectural alternatives for development of the heterogeneous datastore, the anticipated challenges, and the drawbacks and benefits of adopting the polystore architecture.« less

  5. The KiVa antibullying program in primary schools in Chile, with and without the digital game component: study protocol for a randomized controlled trial.

    PubMed

    Gaete, Jorge; Valenzuela, Daniela; Rojas-Barahona, Cristian; Valenzuela, Eduardo; Araya, Ricardo; Salmivalli, Christina

    2017-02-20

    Bullying is a major problem worldwide and Chile is no exception. Bullying is defined as a systematic aggressive behavior against a victim who cannot defend him or herself. Victims suffer social isolation and psychological maladjustment, while bullies have a higher risk for conduct problems and substance use disorders. These problems appear to last over time. The KiVa antibullying program has been evaluated in Finland and other European countries, showing preventive effects on victimization and self-reported bullying. The aims of this study are (1) to develop a culturally appropriate version of the KiVa material and (2) to test the effectiveness of the KiVa program, with and without the online game, on reducing experiences of victimization and bullying behavior among vulnerable primary schools in Santiago (Chile), using a cluster randomized controlled trial (RCT) design with three arms: (1) full KiVa program group, (2) partial KiVa (without online game) program group and (3) control group. This is a three-arm, single-blind, cluster randomized controlled trial (RCT) with a target enrolment of 1495 4th and 5th graders attending 13 vulnerable schools per arm. Students in the full and partial KiVa groups will receive universal actions: ten 2-h lessons delivered by trained teachers during 1 year; they will be exposed to posters encouraging them to support victims and behave constructively when witnessing bullying; and a person designated by the school authorities will be present in all school breaks and lunchtimes using a visible KiVa vest to remind everybody that they are in a KiVa school. KiVa schools also will have indicated actions, which consist of a set of discussion groups with the victims and with the bullies, with proper follow-up. Only full KiVa schools will also receive an online game which has the aim to raise awareness of the role of the group in bullying, increase empathy and promote strategies to support victimized peers. Self-reported victimization

  6. The distribution of low and high-risk HPV types in vulvar and vaginal intraepithelial neoplasia (VIN and VaIN).

    PubMed

    Srodon, Monica; Stoler, Mark H; Baber, Gwen B; Kurman, Robert J

    2006-12-01

    It has been proposed that low-grade vulvar and vaginal lesions (VIN 1 and VaIN 1) are flat condylomas and should be designated as such. Moreover, their relationship to high-grade lesions (VIN 3 and VaIN 3) is unclear. Accordingly, this study was undertaken to address these issues by comparing the distribution of human papillomavirus (HPV) types in vulvar and vaginal intraepithelial lesions. We identified 33 cases of VIN 1, 34 cases of VIN 3, 17 cases of VaIN 1, and 16 cases of VaIN 3. In addition, 36 cases of low-grade squamous intraepithelial lesion (LSIL) in the cervix and 116 cases of cervical high-grade squamous intraepithelial lesion were used for comparison. Polymerase chain reaction analysis was performed using both the Roche PGMY and DDL SPF 10 systems. In cases where HPV was detected, the majority of low-grade and high-grade lesions contained a single HPV type. However, a minority of cases were found to have multiple HPV types. Of the VIN 1 cases, a low-risk virus was seen in 22 (67%), with HPV 6 or 11 accounting for 14 (42%). A high-risk virus was detected in 14 (42%) of cases of which 2 (6%) contained HPV 16. Of the VIN 3 cases, all had high-risk HPV of which 31 (91%) were found to have HPV 16. Of the VaIN 1 cases, 6 (35%) were found to have low-risk HPV types. HPV 6 or 11 were not found in these cases. High-risk virus was seen in 13 (76%) VaIN 1 cases, with 1 (6%) containing HPV 16. HPV was detected in 15 of 16 (94%) VaIN 3 lesions, all of which had high-risk types. HPV 16 was found in 8 (50%). In contrast, 2 (6%) of cervical LSIL had low-risk HPV (HPV 6 and 11), whereas 34 (94%) of LSIL cases had high-risk HPVs. Of the cervical high-grade squamous intraepithelial lesion cases, 100% had high-risk HPVs of which 87 (75%) were found to have HPV 16. The findings demonstrate that a significant number of low-grade vulvar and vaginal lesions contain high-risk HPV types, supporting their designation as low-grade intraepithelial lesions rather than flat

  7. 77 FR 33089 - OPSAIL 2012 Virginia, Port of Hampton Roads, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-05

    ... of Hampton Roads. The Coast Guard will establish safety zones as a part of these regulations to... other time deemed necessary for safety and security by the Captain of the Port, Hampton Roads, vessels...] RIN 1625-AA00, AA08, AA11 OPSAIL 2012 Virginia, Port of Hampton Roads, VA AGENCY: Coast Guard, DHS...

  8. Test and Evaluation (T&E)

    DTIC Science & Technology

    2013-03-04

    AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) Air Force Office of...Scientific Research ,AFOSR/RTA,875 N. Randolph,Arlington,VA,22203 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY NAME(S) AND...transitioning revolutionary science to DoD and industry 7 Distribution A: Approved for public release; distribution is unlimited Air Force T&E Organization

  9. 77 FR 74586 - Drawbridge Operation Regulation; Elizabeth River, Eastern Branch, Norfolk, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-12-17

    ... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 117 [Docket No. USCG-2012-1052] Drawbridge Operation Regulation; Elizabeth River, Eastern Branch, Norfolk, VA AGENCY: Coast Guard, DHS. ACTION: Notice...-2012-1052 and are available online at www.regulations.gov , inserting USCG-2012-1052 in the ``Search...

  10. 77 FR 20716 - Drawbridge Operation Regulation; Blackwater River, South Quay, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-06

    ... passage of vessels. There have been no requests for openings in 11 years. DATES: This rule is effective... S189 Bridge across Blackwater River, mile 9.2, at South Quay VA. There has been no request for openings since the year 2000. The only industrial waterway user to request openings left the area in 2000. Since...

  11. 30 CFR 57.22605 - Blasting from the surface (V-A mines).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Standards for Methane in Metal and Nonmetal Mines Explosives § 57.22605 Blasting from the surface (V-A mines). (a) All development and production blasting shall be initiated from the surface after all persons are... methane in the mine is less than 1.0 percent, persons may enter the mine, and all places blasted shall be...

  12. 30 CFR 57.22605 - Blasting from the surface (V-A mines).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Standards for Methane in Metal and Nonmetal Mines Explosives § 57.22605 Blasting from the surface (V-A mines). (a) All development and production blasting shall be initiated from the surface after all persons are... methane in the mine is less than 1.0 percent, persons may enter the mine, and all places blasted shall be...

  13. 30 CFR 57.22605 - Blasting from the surface (V-A mines).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Standards for Methane in Metal and Nonmetal Mines Explosives § 57.22605 Blasting from the surface (V-A mines). (a) All development and production blasting shall be initiated from the surface after all persons are... methane in the mine is less than 1.0 percent, persons may enter the mine, and all places blasted shall be...

  14. 30 CFR 57.22605 - Blasting from the surface (V-A mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Standards for Methane in Metal and Nonmetal Mines Explosives § 57.22605 Blasting from the surface (V-A mines). (a) All development and production blasting shall be initiated from the surface after all persons are... methane in the mine is less than 1.0 percent, persons may enter the mine, and all places blasted shall be...

  15. 30 CFR 57.22605 - Blasting from the surface (V-A mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Standards for Methane in Metal and Nonmetal Mines Explosives § 57.22605 Blasting from the surface (V-A mines). (a) All development and production blasting shall be initiated from the surface after all persons are... methane in the mine is less than 1.0 percent, persons may enter the mine, and all places blasted shall be...

  16. 33 CFR 80.505 - Cape Henlopen, DE to Cape Charles, VA.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... to Cape Charles, VA. (a) A line drawn from the seaward extremity of Indian River Inlet North Jetty to Indian River Inlet South Jetty Light. (b) A line drawn from Ocean City Inlet Light 6, 225° true across Ocean City Inlet to the submerged south breakwater. (c) A line drawn from Assateague Beach Tower Light...

  17. Evaluation of an implementation model: a national investigation of VA residential programs.

    PubMed

    Cook, Joan M; Dinnen, Stephanie; Coyne, James C; Thompson, Richard; Simiola, Vanessa; Ruzek, Josef; Schnurr, Paula P

    2015-03-01

    This national investigation utilizes qualitative data to evaluate an implementation model regarding factors influencing provider use of two evidence-based treatments for posttraumatic stress disorder (PTSD). Semi-structured qualitative interviews with 198 mental health providers from 38 Department of Veterans Affairs' (VA) residential treatment programs were used to explore these issues regarding prolonged exposure (PE) and cognitive processing therapy (CPT) in VA residential PTSD programs. Several unique and some overlapping predictors emerged. Leadership was viewed as an influence on implementation for both CPT and PE, while a lack of dedicated time and resources was viewed as a deterrent for both. Compatibility of CPT with providers' existing practices and beliefs, the ability to observe noticeable patient improvement, a perceived relative advantage of CPT over alternative treatments, and the presence of a supportive peer network emerged as influential on CPT implementation. Leadership was associated with PE implementation. Implications for the design and improvement of training and implementation efforts are discussed.

  18. Do Health Behaviors Explain the Effect of Neuroticism on Mortality? Longitudinal Findings from the VA Normative Aging Study

    PubMed Central

    Mroczek, Daniel K.; Spiro, Avron; Turiano, Nick

    2009-01-01

    Studies have shown that higher levels of neuroticism are associated with greater risk of mortality. Yet what accounts for this association? One major theoretical position holds that persons higher in neuroticism engage in poorer health behaviors, such as smoking and excessive drinking, thus leading to earlier death. We tested this hypothesis using 30-year mortality in 1,788 men from the VA Normative Aging Study. Using proportional hazards (Cox) models we found that one health behavior, smoking, attenuated the effect of neuroticism on mortality by 40%. However, 60% remained unexplained, suggesting that the effects of other pathways (e.g., biological) also influence the relationship between neuroticism and mortality. PMID:20161240

  19. The use of yoga in specialized VA PTSD treatment programs.

    PubMed

    Libby, Daniel J; Reddy, Felice; Pilver, Corey E; Desai, Rani A

    2012-01-01

    Posttraumatic stress disorder (PTSD) is a chronic, debilitating anxiety disorder that is highly prevalent among U.S. military veterans. Yoga, defined to include physical postures (asana) and mindfulness and meditation, is being increasingly used as an adjunctive treatment for PTSD and other psychological disorders. No research or administrative data have detailed the use of these services in Department of Veterans Affairs' (VA) 170 PTSD treatment programs. One hundred twenty-five program coordinators or designated staff completed an 81-item survey of their program's use of complementary and alternative medicine modalities in the past year. This report describes data from a subset of 30 questions used to assess the prevalence, nature, and context of the use of yoga, mindfulness, and meditation other than mindfulness practices. Results revealed that these practices are widely offered in VA specialized PTSD treatment programs and that there is great variability in the context and nature of how they are delivered. Understanding how yoga is used by these programs may inform ongoing efforts to define and distinguish yoga therapy as a respected therapeutic discipline and to create patient-centered care models that mindfully fulfill the unmet needs of individuals with mental health issues, including veterans with PTSD.

  20. Barriers and facilitators to implementation of VA home-based primary care on American Indian reservations: a qualitative multi-case study.

    PubMed

    Kramer, B Josea; Cote, Sarah D; Lee, Diane I; Creekmur, Beth; Saliba, Debra

    2017-09-02

    Veterans Health Affairs (VA) home-based primary care (HBPC) is an evidence-based interdisciplinary approach to non-institutional long-term care that was developed in urban settings to provide longitudinal care for vulnerable older patients. Under the authority of a Memorandum of Understanding between VA and Indian Health Service (IHS) to improve access to healthcare, 14 VA medical centers (VAMC) independently initiated plans to expand HBPC programs to rural American Indian reservations and 12 VAMC successfully implemented programs. The purpose of this study is to describe barriers and facilitators to implementation in rural Native communities with the aim of informing planners and policy-makers for future program expansions. A qualitative comparative case study approach was used, treating each of the 14 VAMC as a case. Using the Consolidated Framework for Implementation Research (CFIR) to inform an open-ended interview guide, telephone interviews (n = 37) were conducted with HBPC staff and clinicians and local/regional managers, who participated or oversaw implementation. The interviews were transcribed, coded, and then analyzed using CFIR domains and constructs to describe and compare experiences and to identify facilitators, barriers, and adaptations that emerged in common across VAMC and HBPC programs. There was considerable variation in local contexts across VAMC. Nevertheless, implementation was typically facilitated by key individuals who were able to build trust and faith in VA healthcare among American Indian communities. Policy promoted clinical collaboration but collaborations generally occurred on an ad hoc basis between VA and IHS clinicians to optimize patient resources. All programs required some adaptations to address barriers in rural areas, such as distances, caseloads, or delays in hiring additional clinicians. VA funding opportunities facilitated expansion and sustainment of these programs. Since program expansion is a responsibility of the

  1. 38 CFR 17.101 - Collection or recovery by VA for medical care or services provided or furnished to a veteran for...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Terminology code, a five-digit identifier defined by the American Medical Association for a specified... VA for medical care or services provided or furnished to a veteran for a nonservice-connected... MEDICAL Charges, Waivers, and Collections § 17.101 Collection or recovery by VA for medical care or...

  2. 38 CFR 17.101 - Collection or recovery by VA for medical care or services provided or furnished to a veteran for...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Terminology code, a five-digit identifier defined by the American Medical Association for a specified... VA for medical care or services provided or furnished to a veteran for a nonservice-connected... MEDICAL Charges, Waivers, and Collections § 17.101 Collection or recovery by VA for medical care or...

  3. 38 CFR 17.101 - Collection or recovery by VA for medical care or services provided or furnished to a veteran for...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Terminology code, a five-digit identifier defined by the American Medical Association for a specified... VA for medical care or services provided or furnished to a veteran for a nonservice-connected... MEDICAL Charges, Waivers, and Collections § 17.101 Collection or recovery by VA for medical care or...

  4. 38 CFR 17.101 - Collection or recovery by VA for medical care or services provided or furnished to a veteran for...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Terminology code, a five-digit identifier defined by the American Medical Association for a specified... VA for medical care or services provided or furnished to a veteran for a nonservice-connected... MEDICAL Charges, Waivers, and Collections § 17.101 Collection or recovery by VA for medical care or...

  5. Implementation of the Geriatric Patient-Aligned Care Team Model in the Veterans Health Administration (VA).

    PubMed

    Sullivan, Jennifer L; Eisenstein, Rina; Price, Thomas; Solimeo, Samantha; Shay, Kenneth

    2018-01-01

    Here, we describe the implementation of a specialty primary care medical home (PCMH) model called Geriatric Patient-Aligned Care Teams (GeriPACT) in the Veterans' Health Administration (VA) that is focused on serving older complex patients. In particular, our aims in this article are to describe how the GeriPACT model was developed and implemented in VA sites, provide a closer look at how GeriPACT functions by presenting a case study, and highlight data showing national variation in the implementation of GeriPACT staffing models and PCMH practices. Stakeholder feedback regarding the GeriPACT model was obtained from a GeriPACT team and the director of GeriPACT in VA. Here, we present national data regarding variations in GeriPACT staffing and PCMH practices. Following the adoption and implementation of the GeriPACT model and release of the GeriPACT handbook, sites were able to adopt the model's principles. The VA's adoption of PCMH reinforced the mission of patient-centered primary care by integrating psychosocial and environmental determinants of health. This was accomplished with enhancements to staff support through new full-time employment equivalents, but also by optimizing staff productivity through improved team function and interpersonal care. The GeriPACT model was implemented in a bottom-up fashion that has led to variation in how GeriPACTs are structured and staffed, as well as how they conform to various PCMH principles. GeriPACT is one approach for bringing an interdisciplinary, patient-centric perspective to primary care in a manner that can likely support the higher staffing costs with economies realized from diminished reliance on institutional placement and highly technologic health care. It is a model which can provide training for the next generation of providers and clinicians. © Copyright 2018 by the American Board of Family Medicine.

  6. VA OpenNotes: exploring the experiences of early patient adopters with access to clinical notes.

    PubMed

    Nazi, Kim M; Turvey, Carolyn L; Klein, Dawn M; Hogan, Timothy P; Woods, Susan S

    2015-03-01

    To explore the experience of early patient adopters who accessed their clinical notes online using the Blue Button feature of the My HealtheVet portal. A web-based survey of VA patient portal users from June 22 to September 15, 2013. 33.5% of respondents knew that clinical notes could be viewed, and nearly one in four (23.5%) said that they had viewed their notes at least once. The majority of VA Notes users agreed that accessing their notes will help them to do a better job of taking medications as prescribed (80.1%) and be better prepared for clinic visits (88.6%). Nine out of 10 users agreed that use of visit notes will help them understand their conditions better (91.8%), and better remember the plan for their care (91.9%). In contrast, 87% disagreed that VA Notes will make them worry more, and 88.4% disagreed that access to VA Notes will be more confusing than helpful. Users who had either contacted their provider or healthcare team (11.9%) or planned to (13.5%) primarily wanted to learn more about a health issue, medication, or test results (53.7%). Initial assessment of the patient experience within the first 9 months of availability provides evidence that patients both value and benefit from online access to clinical notes. These findings are congruent with OpenNotes study findings on a broader scale. Additional outreach and education is needed to enhance patient awareness. Healthcare professionals should author notes keeping in mind the opportunity patient access presents for enhanced communication. © The Author 2014. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. 75 FR 76953 - Foreign-Trade Zone 238-Dublin, VA Site Renumbering Notice

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-10

    ... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Foreign-Trade Zone 238--Dublin, VA Site Renumbering Notice Foreign-Trade Zone 238 was approved by the Foreign-Trade Zones Board on August 5, 1999 (Board Order 1047). FTZ 238 currently consists of 1 ``site'' totaling 50 acres in the Dublin area. The...

  8. Not-so-close collaborators. As the potential for mass military casualties looms, the VA-Defense Department relationship is in the spotlight.

    PubMed

    Gardner, J

    2001-10-15

    Since the U.S. launched strikes against targets in Afghanistan Oct. 7, the relationship between the VA and the Defense Department has been at issue. Some think the VA's backing up the military is an anachronism. Others believe the two departments should stop squabbling and get together in a meaningful way.

  9. 77 FR 64383 - Proposed Information Collection (Verification of VA Benefits) Activity: Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-19

    ... DEPARTMENT OF VETERANS AFFAIRS [OMB Control No. 2900-0406] Proposed Information Collection... any VA-guaranteed loans on an automatic basis. DATES: Written comments and recommendations on the... written comments on the collection of information through the Federal Docket Management System (FDMS) at...

  10. 38 CFR 21.4215 - Decision of Director of VA Regional Processing Office of jurisdiction.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Administration of Educational Assistance Programs Schools § 21.4215 Decision of Director of VA Regional... circumstances. If the matter is referred back to the Committee, the Director will defer a decision until he or...

  11. 38 CFR 21.4215 - Decision of Director of VA Regional Processing Office of jurisdiction.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Administration of Educational Assistance Programs Schools § 21.4215 Decision of Director of VA Regional... circumstances. If the matter is referred back to the Committee, the Director will defer a decision until he or...

  12. 38 CFR 21.4215 - Decision of Director of VA Regional Processing Office of jurisdiction.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Administration of Educational Assistance Programs Schools § 21.4215 Decision of Director of VA Regional... circumstances. If the matter is referred back to the Committee, the Director will defer a decision until he or...

  13. 76 FR 43575 - Amendment of Class E Airspace; Staunton, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-21

    ... airspace extending upward from 700 feet above the surface at Shenandoah Valley Regional Airport, Staunton... airspace extending upward from 700 feet above the surface to support new SIAPs developed at Shenandoah... E airspace areas extending upward from 700 feet or more above the surface of the earth...

  14. 77 FR 60746 - Proposed Information Collection (VA/DOD Joint Disability Evaluation Board Claim) Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-04

    ... War on Terror Heroes, VA and the Department of Defense (DOD) have agreed to develop a joint process in which Global War on Terror (GWOT) service members are evaluated to assign disability ratings, which will...

  15. 76 FR 72838 - Amendment of Class E Airspace; Luray, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-28

    ... Instrument Flight Rules (IFR) operations within the National Airspace System. This action also makes a minor adjustment to the geographic coordinates of the airport. DATES: Effective 0901 UTC, February 9, 2012. The... geographic coordinates of the airport needed to be adjusted. This action makes that adjustment. Class E...

  16. Mariner Jupiter/Saturn LCSSE thruster/valve assembly and injection propulsion unit rocket engine assemblies: 0.2-lbf T/VA development and margin limit test report

    NASA Technical Reports Server (NTRS)

    Clark, E. C.

    1975-01-01

    Thruster valve assemblies (T/VA's) were subjected to the development test program for the combined JPL Low-Cost Standardized Spacecraft Equipment (LCSSE) and Mariner Jupiter/Saturn '77 spacecraft (MJS) programs. The development test program was designed to achieve the following program goals: (1) demonstrate T/VA design compliance with JPL Specifications, (2) to conduct a complete performance Cf map of the T/VA over the full operating range of environment, (3) demonstrate T/VA life capability and characteristics of life margin for steady-state limit cycle and momentum wheel desaturation duty cycles, (4) verification of structural design capability, and (5) generate a computerized performance model capable of predicting T/VA operation over pressures ranging from 420 to 70 psia, propellant temperatures ranging from 140 F to 40 F, pulse widths of 0.008 to steady-state operation with unlimited duty cycle capability, and finally predict the transient performance associated with reactor heatup during any given duty cycle, start temperature, feed pressure, and propellant temperature conditions.

  17. Predicting Glycerophosphoinositol Identities in Lipidomic Datasets Using VaLID (Visualization and Phospholipid Identification)—An Online Bioinformatic Search Engine

    PubMed Central

    McDowell, Graeme S. V.; Taylor, Graeme P.; Fai, Stephen; Bennett, Steffany A. L.

    2014-01-01

    The capacity to predict and visualize all theoretically possible glycerophospholipid molecular identities present in lipidomic datasets is currently limited. To address this issue, we expanded the search-engine and compositional databases of the online Visualization and Phospholipid Identification (VaLID) bioinformatic tool to include the glycerophosphoinositol superfamily. VaLID v1.0.0 originally allowed exact and average mass libraries of 736,584 individual species from eight phospholipid classes: glycerophosphates, glyceropyrophosphates, glycerophosphocholines, glycerophosphoethanolamines, glycerophosphoglycerols, glycerophosphoglycerophosphates, glycerophosphoserines, and cytidine 5′-diphosphate 1,2-diacyl-sn-glycerols to be searched for any mass to charge value (with adjustable tolerance levels) under a variety of mass spectrometry conditions. Here, we describe an update that now includes all possible glycerophosphoinositols, glycerophosphoinositol monophosphates, glycerophosphoinositol bisphosphates, and glycerophosphoinositol trisphosphates. This update expands the total number of lipid species represented in the VaLID v2.0.0 database to 1,473,168 phospholipids. Each phospholipid can be generated in skeletal representation. A subset of species curated by the Canadian Institutes of Health Research Training Program in Neurodegenerative Lipidomics (CTPNL) team is provided as an array of high-resolution structures. VaLID is freely available and responds to all users through the CTPNL resources web site. PMID:24701584

  18. 76 FR 10524 - Restricted Area, Potomac River, Marine Corps Base Quantico, Quantico, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-25

    ... DEPARTMENT OF DEFENSE Department of the Army, Corps of Engineers 33 CFR Part 334 Restricted Area, Potomac River, Marine Corps Base Quantico, Quantico, VA AGENCY: United States Army Corps of Engineers... Facility (MCAF) at Marine Corps Base Quantico (MCB Quantico), located in Quantico, Virginia. DATES...

  19. Radio-Astronomical Instruments Observations (Selected Articles),

    DTIC Science & Technology

    1982-08-02

    NL SIIDAUG 82 L I MATVEYENKO, G S MISEZHNIKOV UNCLASSIFIED FTO_ ID(RS) -0564-82 N FTD-ID(RS) T -0564-82 FOREIGN TECHNOLOGY DIVISION RADIO-ASTRONOMICAL...INSTR1ThMNTS OBSERVATIONS (Selected Articles) 3 71982 Approved for public release; LAJ distribuion~ urJA’nited. • I . FTD- ID(RS) T -0564-82 UNEDITED... T , t * r a yy y y 7, u F, f E # Ye, ye; E, e* X x X x Kh, kh X C Zh, zn .4 u L q Ts, ts - -. Z ,. 4 f 14 Ch ,ch U 7 H u I , i w Sh, sh 2 R ia Y, y

  20. Ferroelectric PLZT thick films grown by poly(1-vinylpyrrolidone-co-vinyl acetate) (PVP/VA)-modified sol-gel process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Zhongqiang; Ma, Beihai; Li, Meiya

    2016-03-01

    We report the growth of ferroelectric Pb0.92La0.08Zr0.52Ti0.48O3 (PLZT) thick films using a poly(1-vinylpyrrolidone-co-vinyl acetate) (PVP/VA)-modified sol–gel process. A per-coating thickness of ≈0.66 μm has been demonstrated using PVP/VA-modified solution, which is more than doubled that of the PLZT films grown by PVP-modified method, and nearly 6 times the per-coating thickness of films prepared by conventional sol–gel process. PLZT thick films grown on LNO/Ni substrates exhibited denser microstructure, higher remanent polarization (11 μC/cm 2) and dielectric tunability (45%), lower leakage current density (≈1.2 × 10 -8 A/cm 2), and higher breakdown strength (≈1.6 MV/cm) than those for the samples grown onmore » PtSi substrates. These results demonstrated great potential of using PVP/VA-modified sol–gel process for high power film capacitor applications.« less

  1. Long-term monitoring of Sgr A* at 7 mm with VERA and KaVA

    NASA Astrophysics Data System (ADS)

    Akiyama, K.; Kino, M.; Sohn, B.; Lee, S.; Trippe, S.; Honma, M.

    2014-05-01

    We present the results of radio monitoring observations of Sgr A* at 7 mm (i.e. 43 GHz) with the VLBI Exploration of Radio Astrometry (VERA), which is a VLBI array in Japan. VERA provides angular resolution on millisecond scales, resolving structures within 100 Schwarzschild radii of Sgr A* , similar to the Very Large Baseline Array (VLBA). We performed multi-epoch observations of Sgr A* in 2005 - 2008, and started monitoring it again with VERA from 2013 January to trace the current G2 encounter event. Our preliminary results in 2013 show that Sgr A* on mas scales has been in an ordinary state as of August 2013, although some fraction of the G2 cloud already passed the pericenter of Sgr A* in April 2013. We will continue monitoring Sgr A* with VERA and the newly developed KaVA (KVN and VERA Array).

  2. Comparing the stress change characteristics and aftershock decay rate of the 2011 Mineral, VA, earthquake with similar earthquakes from a variety of tectonic settings

    NASA Astrophysics Data System (ADS)

    Walsh, L. S.; Montesi, L. G.; Sauber, J. M.; Watters, T. R.; Kim, W.; Martin, A. J.; Anderson, R.

    2011-12-01

    On August 23, 2011, the magnitude 5.8 Mineral, VA, earthquake rocked the U.S. national capital region (Washington, DC) drawing worldwide attention to the occurrence of intraplate earthquakes. Using regional Coulomb stress change, we evaluate to what extent slip on faults during the Mineral, VA, earthquake and its aftershocks may have increased stress on notable Cenozoic fault systems in the DC metropolitan area: the central Virginia seismic zone, the DC fault zone, and the Stafford fault system. Our Coulomb stress maps indicate that the transfer of stress from the Mineral, VA, mainshock was at least 500 times greater than that produced from the magnitude 3.4 Germantown, MD, earthquake that occurred northwest of DC on July 16, 2010. Overall, the Mineral, VA, earthquake appears to have loaded faults of optimum orientation in the DC metropolitan region, bringing them closer to failure. The distribution of aftershocks of the Mineral, VA, earthquake will be compared with Coulomb stress change maps. We further characterize the Mineral, VA, earthquake by comparing its aftershock decay rate with that of blind thrust earthquakes with similar magnitude, focal mechanism, and depth from a variety of tectonic settings. In particular, we compare aftershock decay relations of the Mineral, VA, earthquake with two well studied California reverse faulting events, the August 4, 1985 Kettleman Hills (Mw = 6.1) and October 1, 1987 Whittier Narrow (Mw = 5.9) earthquakes. Through these relations we test the hypothesis that aftershock duration is inversely proportional to fault stressing rate, suggesting that aftershocks in active tectonic margins may last only a few years while aftershocks in intraplate regions could endure for decades to a century.

  3. The VA Ostomy Health-Related Quality of Life Study: objectives, methods, and patient sample.

    PubMed

    Krouse, Robert S; Mohler, M Jane; Wendel, Christopher S; Grant, Marcia; Baldwin, Carol M; Rawl, Susan M; McCorkle, Ruth; Rosenfeld, Kenneth E; Ko, Clifford Y; Schmidt, C Max; Coons, Stephen Joel

    2006-04-01

    To present the design and methods of a multisite study of health-related quality of life (HR-QOL) in veterans living with ostomies. Veterans from Tucson, Indianapolis, and Los Angeles VA Medical Centers were surveyed using the validated City of Hope ostomy-specific tool (mCOH-QOL-Ostomy) and the SF-36V. Cases (ostomates) had a major gastrointestinal procedure that required an intestinal stoma, while controls had similar procedures for which an ostomy was not required. Ostomy subjects were recruited for four focus groups in each of two sites divided by ostomy type (colostomy versus ileostomy) and overall mCOH-QOL-Ostomy HR-QOL score (highest versus lowest quartile). The focus groups further evaluated barriers, concerns, and adaptation methods and skills. This report presents recruitment results, reliability of survey instruments, and demographic characteristics of the sample. The overall response (i.e., recruitment) rate across all sites was 48% and by site was 53%, 57%, and 37%, respectively (p < 0.001). Internal consistency reliability estimates indicated that both instruments remain reliable in this population (Cronbach's alpha for HR-QOL domains/scales: 0.71-0.96). Cases and controls were similar in demographic characteristics. Proportions of minority subjects matched projections from the site patient populations. Subjects with ostomies had significantly longer time since surgery than controls (p < 0.001). Focus groups were comprised of two to six subjects per group and demonstrated racial diversity at the Los Angeles site. The unique design of our study of VA patients with ostomies is an illustration of a successful mixed methods approach to HR-QOL research. We collected meaningful quantitative and qualitative data that will be used in the development of new approaches to care that will lead to improved functioning and well-being in persons living with ostomies. Subsequent reports will provide the results of this research project.

  4. Estimating cause of adult (15+ years) death using InterVA-4 in a rural district of southern Ghana.

    PubMed

    Awini, Elizabeth; Sarpong, Doris; Adjei, Alexander; Manyeh, Alfred Kwesi; Amu, Alberta; Akweongo, Patricia; Adongo, Philip; Kukula, Vida; Odonkor, Gabriel; Narh, Solomon; Gyapong, Margaret

    2014-01-01

    Data needed to estimate causes of death and the pattern of these deaths are scarce in sub-Saharan Africa. Such data are very important for targeting, monitoring, and evaluating health interventions. To estimate the mortality rate and determine causes of death among adults (aged 15 years and older) in a rural district of southern Ghana, using the InterVA-4 model. Data used were generated from verbal autopsies conducted for registered adult members of the Dodowa Health and Demographic Surveillance System who died between 2006 and 2010. The InterVA-4 model was used to assign the cause of death. Overall, the mortality rate for the period under review was 7.5/1,000 person-years (py) for the general population and 10.4/1,000 py for those aged 15 and older. The leading cause of death was communicable diseases (CDs), with a malaria-specific mortality rate of 1.06/1,000 py. Pulmonary tuberculosis (TB)-specific mortality rate was the next highest (1.01/1,000 py). HIV/AIDS attributed deaths were lower among males than females. Non-communicable diseases (NCDs) contributed to 28.3% of the deaths with cause-specific mortality rate of 2.93/1,000 py. Stroke topped the list with cause-specific mortality rate of 0.69/1,000 py. As expected, young males (15-49 years) contributed to more road traffic accident (RTA) deaths; they had a lower RTA cause-specific mortality rate than older males (50-64 years). Data indicate that CDs (e.g. malaria and TB) remain the major cause of death with NCDs (e.g. stroke) following closely behind. Verbal autopsy data can provide the causes of mortality in poorly resourced settings where access to timely and accurate data is scarce.

  5. 38 CFR 74.25 - What types of personally identifiable information will VA collect?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) VETERANS SMALL BUSINESS REGULATIONS Records Management § 74.25 What types of personally identifiable information will VA collect? In order to establish owner... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false What types of personally...

  6. VA's expansion of supportive housing: successes and challenges on the path toward Housing First.

    PubMed

    Austin, Erika Laine; Pollio, David E; Holmes, Sally; Schumacher, Joseph; White, Bert; Lukas, Carol Vandeusen; Kertesz, Stefan

    2014-05-01

    The U.S. Department of Veterans Affairs (VA) is transitioning to a Housing First approach to placement of veterans in permanent supportive housing through the use of rental vouchers, an ambitious organizational transformation. This qualitative study examined the experiences of eight VA facilities undertaking this endeavor in 2012. A multidisciplinary team interviewed facility leadership, midlevel managers, and frontline staff (N=95 individuals) at eight VA facilities representing four U.S. regions. The team used a semistructured interview protocol and the constant comparative method to explore how individuals throughout the organizations experienced and responded to the challenges of transitioning to a Housing First approach. Frontline staff faced challenges in rapidly housing homeless veterans because of difficult rental markets, the need to coordinate with local public housing authorities, and a lack of available funds for move-in costs. Staff sought to balance their time spent on housing activities with intensive case management of highly vulnerable veterans. Finding low-demand sheltering options (that is, no expectations regarding sobriety or treatment participation, as in the Housing First model) for veterans waiting for housing presented a significant challenge to implementation of Housing First. Facility leadership supported Housing First implementation through resource allocation, performance monitoring, and reliance on midlevel managers to understand and meet the challenges of implementation. The findings highlight the considerable practical challenges and innovative solutions arising from a large-scale effort to implement Housing First, with particular attention to the experiences of individuals at all levels within an organization.

  7. 76 FR 44279 - Radio Broadcasting Services; Clinchco, VA, and Coal Run, KY

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-25

    ...] Radio Broadcasting Services; Clinchco, VA, and Coal Run, KY AGENCY: Federal Communications Commission... Station WPKE-FM, Coal Run Kentucky, from Channel 276A to Channel 221C3. DATES: Effective August 1, 2011... 221C3 at Coal Run, Kentucky, are 37-23-57 NL and 82-23-42 WL, and for Channel 276A at Clinchco, Virginia...

  8. 75 FR 28295 - Parkdale Mills (Formerly Hanesbrands, Inc.) Galax, VA; Notice of Affirmative Determination...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-20

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-72,695] Parkdale Mills (Formerly Hanesbrands, Inc.) Galax, VA; Notice of Affirmative Determination Regarding Application for Reconsideration By application dated February 2, 2010, petitioners requested administrative reconsideration of the negative...

  9. 30 CFR 57.22212 - Air flow (I-C, II-A, and V-A mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Standards for Methane in Metal and Nonmetal Mines Ventilation § 57.22212 Air flow (I-C, II-A, and V-A mines). Air flow across each working face shall be sufficient to carry away any accumulation of methane, smoke...

  10. DoD-VA Health Care: A Case Study in Interagency Reform

    DTIC Science & Technology

    2008-03-10

    Panel, and Ad-hoc Commission member testimony, experts and critics are now calling for legislation- much like the military transforming Goldwater...sweeping interagency reform (IAR).2 The timing for such legislation is critical as the Beyond Goldwater-Nichols (BG-N) Phase II Report aptly highlights...medicine is providing an additional incentive for the DoD and VA to collaborate. The BG-N Phase II Report acknowledges the importance of critical

  11. Final Environmental Assessment for Force Structure Changes at Langley Air Force Base, VA

    DTIC Science & Technology

    2011-10-01

    Shepard Blvd, Hampton, VA, 23665, DEQ PC No. 20095002, PC Case Status - Release Confirmed, Case Closed. Langley Air Force Base- Building 333, 90 Oak...NOISEXPO ‘77, Chicago , IL. March. White, R. 1972. Effects of Repetitive Sonic Booms on Glass Breakage. FAA Report FAA-RD-72- 43. April. 6

  12. Development of a 500 kVA-class oxide-superconducting power transformer operated at liquid-nitrogen temperature

    NASA Astrophysics Data System (ADS)

    Funaki, K.; Iwakuma, M.; Kajikawa, K.; Takeo, M.; Suehiro, J.; Hara, M.; Yamafuji, K.; Konno, M.; Kasagawa, Y.; Okubo, K.; Yasukawa, Y.; Nose, S.; Ueyama, M.; Hayashi, K.; Sato, K.

    We have designed and constructed a 500 kVA-class oxide-superconducting power transformer. The windings are cooled by liquid nitrogen or subcooled nitrogen in a G-FRP cryostat of 785 mm in diameter and 1210 mm in height, that has a room-temperature space for an iron core with the diameter of 314 mm. The primary and secondary windings are three-strand and six-strand parallel conductors of a Bi-2223 multifilamentary tape with silver sheath, respectively. The strand 0.22 mm thick and 3.5 mm wide has 61 filaments with no twisting. The ratio of superconductor is 0.284. In the parallel conductors, the strands are transposed five times in each layer for a uniform current distribution among them. It was proved that the transformer has the rated capacity of 500 kVA by means of two-h short-circuit test and half-h no-load test in liquid nitrogen of 77 K. The efficiency is estimated as 99.1% from a core loss of 2.3 kW and a thermal load of 2.2 kW in coolant. The latter is composed of AC losses in windings and heat leakage from the cryostat and current leads, and is multiplied by a refrigeration penalty of liquid nitrogen, 20. Load test was also performed up to 500 kVA. The transformer was furthermore operated in subcooled nitrogen at 66 K with no quenching up to a critical level, that is equivalent to 800 kVA. The efficiency estimated was improved to 99.3% in subcooled nitrogen. Measured a.c. loss in both windings are well explained by a theoretical prediction with the "critical state model". We also discuss prospective applications of the parallel conductors composed of advanced HTS multifilamentary tapes to a.c. windings with large current capacity.

  13. Potential Ameliorative Effects of Qing Ye Dan Against Cadmium Induced Prostatic Deficits via Regulating Nrf-2/HO-1 and TGF-β1/Smad Pathways.

    PubMed

    Du, Lifen; Lei, Yongfang; Chen, Jinglou; Song, Hongping; Wu, Xinying

    2017-01-01

    Cadmium (Cd) is an environmental pollutant with reproductive toxicity. Swertia mileensis is used in Chinese medicine for the treatment of prostatic deficits and named as Qing Ye Dan (QYD). This study was undertaken to investigate the potential protective effects of QYD against Cd-induced prostatic deficits. Rat model of prostatic deficits was induced by 0.2 mg/kg/d CdCl2 subcutaneous injection for 15 days. The prostatic oxidative stress was evaluated by detecting the levels of malondialdehyde, nitric oxide, reduced/ oxidized glutathione, total sulfhydryl groups and enzymatic antioxidant status. The prostatic inflammation was estimated by testing the levels of pro-inflammatory cytokines. The levels of epithelial-mesenchymal transition (EMT) markers E-cadherin, fibronectin, vimentin and α-smooth muscle actin were measured by qPCR analysis. Additionally, the prostatic expressions of transforming growth factor-β1 (TGF-β1), type I TGF-β receptor (TGF-βRI), Smad2, phosphorylation-Smad2 (p-Smad2), Smad3, p-Smad3, Smad7, nuclear related factor-2 (Nrf-2), heme oxygenase-1 (HO-1), B-cell CLL/lymphoma (Bcl)-2 and Bcl-2-associated X protein (Bax) were measured by western blot assay. It was found that QYD ameliorated the Cd-induced prostatic oxidative stress and inflammation, attenuated prostatic EMT, inhibited the TGF-β1/Smad pathway, increased Bcl-2/Bax ratio and enhanced the activity of Nrf-2/HO-1 pathway. These results showed that QYD could ameliorate Cd-induced prostatic deficits via modulating Nrf-2/HO-1 and TGF-β1/Smad pathways. © 2017 The Author(s). Published by S. Karger AG, Basel.

  14. 75 FR 33898 - Agency Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-15

    ... DEPARTMENT OF VETERANS AFFAIRS [OMB Control No. 2900-0021] Agency Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity Under OMB Review AGENCY: Veterans Benefits... Administration (VBA), Department of Veterans Affairs, will submit the collection of information abstracted below...

  15. 30 CFR 57.22222 - Ventilation materials (I-A, I-B, I-C, II-A, III, V-A, and V-B mines).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Ventilation materials (I-A, I-B, I-C, II-A, III, V-A, and V-B mines). 57.22222 Section 57.22222 Mineral Resources MINE SAFETY AND HEALTH....22222 Ventilation materials (I-A, I-B, I-C, II-A, III, V-A, and V-B mines). Brattice cloth and...

  16. 30 CFR 57.22222 - Ventilation materials (I-A, I-B, I-C, II-A, III, V-A, and V-B mines).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Ventilation materials (I-A, I-B, I-C, II-A, III, V-A, and V-B mines). 57.22222 Section 57.22222 Mineral Resources MINE SAFETY AND HEALTH....22222 Ventilation materials (I-A, I-B, I-C, II-A, III, V-A, and V-B mines). Brattice cloth and...

  17. Kollidon VA64, a membrane-resealing agent, reduces histopathology and improves functional outcome after controlled cortical impact in mice.

    PubMed

    Mbye, Lamin H; Keles, Eyup; Tao, Luyang; Zhang, Jimmy; Chung, Joonyong; Larvie, Mykol; Koppula, Rajani; Lo, Eng H; Whalen, Michael J

    2012-03-01

    Loss of plasma membrane integrity is a feature of acute cellular injury/death in vitro and in vivo. Plasmalemma-resealing agents are protective in acute central nervous system injury models, but their ability to reseal cell membranes in vivo has not been reported. Using a mouse controlled cortical impact (CCI) model, we found that propidium iodide-positive (PI+) cells pulse labeled at 6, 24, or 48 hours maintained a degenerative phenotype and disappeared from the injured brain by 7 days, suggesting that plasmalemma permeability is a biomarker of fatal cellular injury after CCI. Intravenous or intracerebroventricular administration of Kollidon VA64, poloxamer P188, or polyethylene glycol 8000 resealed injured cell membranes in vivo (P<0.05 versus vehicle or poloxamer P407). Kollidon VA64 (1 mmol/L, 500 μL) administered intravenously to mice 1  hour after CCI significantly reduced acute cellular degeneration, chronic brain tissue damage, brain edema, blood-brain barrier damage, and postinjury motor deficits (all P<0.05 versus vehicle). However, VA64 did not rescue pulse-labeled PI+ cells from eventual demise. We conclude that PI permeability within 48 hours of CCI is a biomarker of eventual cell death/loss. Kollidon VA64 reduces secondary damage after CCI by mechanisms other than or in addition to resealing permeable cells.

  18. Direct observation of the myosin Va recovery stroke that contributes to unidirectional stepping along actin.

    PubMed

    Shiroguchi, Katsuyuki; Chin, Harvey F; Hannemann, Diane E; Muneyuki, Eiro; De La Cruz, Enrique M; Kinosita, Kazuhiko

    2011-04-01

    Myosins are ATP-driven linear molecular motors that work as cellular force generators, transporters, and force sensors. These functions are driven by large-scale nucleotide-dependent conformational changes, termed "strokes"; the "power stroke" is the force-generating swinging of the myosin light chain-binding "neck" domain relative to the motor domain "head" while bound to actin; the "recovery stroke" is the necessary initial motion that primes, or "cocks," myosin while detached from actin. Myosin Va is a processive dimer that steps unidirectionally along actin following a "hand over hand" mechanism in which the trailing head detaches and steps forward ∼72 nm. Despite large rotational Brownian motion of the detached head about a free joint adjoining the two necks, unidirectional stepping is achieved, in part by the power stroke of the attached head that moves the joint forward. However, the power stroke alone cannot fully account for preferential forward site binding since the orientation and angle stability of the detached head, which is determined by the properties of the recovery stroke, dictate actin binding site accessibility. Here, we directly observe the recovery stroke dynamics and fluctuations of myosin Va using a novel, transient caged ATP-controlling system that maintains constant ATP levels through stepwise UV-pulse sequences of varying intensity. We immobilized the neck of monomeric myosin Va on a surface and observed real time motions of bead(s) attached site-specifically to the head. ATP induces a transient swing of the neck to the post-recovery stroke conformation, where it remains for ∼40 s, until ATP hydrolysis products are released. Angle distributions indicate that the post-recovery stroke conformation is stabilized by ≥ 5 k(B)T of energy. The high kinetic and energetic stability of the post-recovery stroke conformation favors preferential binding of the detached head to a forward site 72 nm away. Thus, the recovery stroke contributes to

  19. 77 FR 74279 - Agency Information Collection (VA/DOD Joint Disability Evaluation Board Claim): Activity under...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-12-13

    ... Global War on Terror Heroes, VA and the Department of Defense (DOD) have agreed to develop a joint process in which Global War on Terror (GWOT) service member's are evaluated to assign disability ratings...

  20. Use of health information technology to advance evidence-based care: lessons from the VA QUERI program.

    PubMed

    Hynes, Denise M; Weddle, Timothy; Smith, Nina; Whittier, Erika; Atkins, David; Francis, Joseph

    2010-01-01

    As the Department of Veterans Affairs (VA) Health Services Research and Development Service's Quality Enhancement Research Initiative (QUERI) has progressed, health information technology (HIT) has occupied a crucial role in implementation research projects. We evaluated the role of HIT in VA QUERI implementation research, including HIT use and development, the contributions implementation research has made to HIT development, and HIT-related barriers and facilitators to implementation research. Key informants from nine disease-specific QUERI Centers. Documentation analysis of 86 implementation project abstracts followed up by semi-structured interviews with key informants from each of the nine QUERI centers. We used qualitative and descriptive analyses. We found: (1) HIT provided data and information to facilitate implementation research, (2) implementation research helped to further HIT development in a variety of uses including the development of clinical decision support systems (23 of 86 implementation research projects), and (3) common HIT barriers to implementation research existed but could be overcome by collaborations with clinical and administrative leadership. Our review of the implementation research progress in the VA revealed interdependency on an HIT infrastructure and research-based development. Collaboration with multiple stakeholders is a key factor in successful use and development of HIT in implementation research efforts and in advancing evidence-based practice.

  1. AVTA Federal Fleet PEV Readiness Data Logging and Characterization Study for Department of Veterans Affairs – VA Manhattan Campus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stephen Schey; Jim Francfort

    2014-10-01

    This report focuses on the Department of Veterans Affairs, VA Manhattan Campus (VA- Manhattan) fleet to identify the daily operational characteristics of select vehicles and report findings on vehicle and mission characterizations to support successful introduction of plug-in electric vehicles (PEVs) into the agency’s fleet. Individual observations of these selected vehicles provide the basis for recommendations related to electric vehicle adoption and whether a battery electric vehicle or plug-in hybrid electric vehicle (collectively called PEVs) can fulfill the mission requirements.

  2. 75 FR 60171 - Proposed Information Collection (Credit Underwriting Standards and Procedures for Processing VA...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-29

    ... DEPARTMENT OF VETERANS AFFAIRS [OMB Control No. 2900-0521] Proposed Information Collection (Credit Underwriting Standards and Procedures for Processing VA Guaranteed Loans) Activity: Comment Request AGENCY... comment on the proposed collection of certain information by the agency. Under the Paperwork Reduction Act...

  3. 78 FR 60379 - Proposed Information Collection (Credit Underwriting Standards and Procedures for Processing VA...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-01

    ... DEPARTMENT OF VETERANS AFFAIRS [OMB Control No. 2900-0521] Proposed Information Collection (Credit Underwriting Standards and Procedures for Processing VA Guaranteed Loans) Activity: Comment Request AGENCY... comment on the proposed collection of certain information by the agency. Under the Paperwork Reduction Act...

  4. Effect of VA and MWNT contents on the rheological and physical properties of EVA

    NASA Astrophysics Data System (ADS)

    Kim, Jong-Ho; Lee, Seungwon; Kim, Byoung Chul; Shin, Bong-Seob; Jeon, Jong-Young; Chae, Dong Wook

    2016-02-01

    Ethylene vinyl acetate (EVA) copolymers with two different VA contents (15 and 33 wt.%, denoted by EVA15 and EVA33, respectively) were melt compounded with multi-walled carbon nanotubes (MWNTs) and the effect of VA and nanotube contents on the rheological, thermal and morphological properties was investigated. The addition of nanotubes into both EVAs increased the onset temperature of crystallization and broadened the peak, but further addition from 3 wt.% slightly decreased the temperature with increasing nanotube contents. In the wide angle X-ray diffraction patterns the peak of EVA15 was little affected by the presence of nanotubes but that of EVA33 slightly shifted to higher degree and became sharper with increasing nanotube contents. Dynamic viscosity (η') increased with nanotube contents giving abrupt increase at 2 wt.% nanotubes. Loss tangent decreased with increasing nanotube contents exhibiting the plateau-like behavior over most of the frequency range from 2 wt.% nanotubes. In the Casson plot, yield stress increased with nanotube content and its increasing extent was more notable for more VA content. In the Cole-Cole plot, the presence of nanotubes from 2 wt.% gave rise to the deviation from the single master curve by decreasing the slope. The deviated extent of EVA33 became more remarkable with increasing nanotube contents than that of EVA15. The stress-strain curve showed that more improved tensile modulus and yield stress were achieved by the introduction of MWNTs for EVA 33 than for EVA15. Tensile strength of EVA33 increased with increasing nanotube contents, while that of EVA15 decreased.

  5. 75 FR 76082 - Agency Information Collection (Credit Underwriting Standards and Procedures for Processing VA...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-07

    ... DEPARTMENT OF VETERANS AFFAIRS [OMB Control No. 2900-0521] Agency Information Collection (Credit Underwriting Standards and Procedures for Processing VA Guaranteed Loans) Activity Under OMB Review AGENCY... information abstracted below to the Office of Management and Budget (OMB) for review and comment. The PRA...

  6. 48 CFR 819.602-3 - Resolving differences between VA and the Small Business Administration.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... of Competency and Determinations of Responsibility 819.602-3 Resolving differences between VA and the... of correspondence sent to the SBA seeking a certificate of competency determination must be concurrently provided to the Director, OSDBU. Before appealing a certificate of competency, the HCA must seek...

  7. 77 FR 21158 - VA Directive 0005 on Scientific Integrity: Availability for Review and Comment

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-09

    ... the Director, Office of Science and Technology Policy's Memorandum of December 17, 2010, on scientific integrity. It addresses how VA ensures quality science in its methods, review, policy application, and...: Background The Presidential Memorandum on Scientific Integrity and the Office of Science and Technology...

  8. Assessing fidelity of cognitive behavioral therapy in rural VA clinics: design of a randomized implementation effectiveness (hybrid type III) trial.

    PubMed

    Cucciare, Michael A; Curran, Geoffrey M; Craske, Michelle G; Abraham, Traci; McCarthur, Michael B; Marchant-Miros, Kathy; Lindsay, Jan A; Kauth, Michael R; Landes, Sara J; Sullivan, Greer

    2016-05-10

    Broadly disseminating and implementing evidence-based psychotherapies with high fidelity, particularly cognitive behavioral therapy (CBT), has proved challenging for many health-care systems, including the Department of Veterans Affairs, especially in primary care settings such as small or remote clinics. A computer-based tool (based on the coordinated anxiety learning and management (CALM) program) was designed to support primary care-based mental health providers in delivering CBT. The objectives of this study are to modify the CALM tool to meet the needs of mental health clinicians in veterans affairs (VA) community-based outpatient clinics (CBOCs) and rural "veterans", use external facilitation to implement CBT and determine the effect of the CALM tool versus a manualized version of CALM to improve fidelity to the CBT treatment model, and conduct a needs assessment to understand how best to support future implementation of the CALM tool in routine care. Focus groups will inform the redesign of the CALM tool. Mental health providers at regional VA CBOCs; CBT experts; VA experts in implementation of evidence-based mental health practices; and veterans with generalized anxiety disorder, panic disorder, social anxiety disorder, posttraumatic stress disorder, "with or without" depression will be recruited. A hybrid type III design will be used to examine the effect of receiving CBT training plus either the CALM tool or a manual version of CALM on treatment fidelity. External facilitation will be used as the overarching strategy to implement both CBT delivery methods. Data will also be collected on symptoms of the targeted disorders. To help prepare for the future implementation of the CALM tool in VA CBOCs, we will perform an implementation need assessment with mental health providers participating in the clinical trial and their CBOC directors. This project will help inform strategies for delivering CBT with high fidelity in VA CBOCs to veterans with anxiety

  9. Huddle up!: The adoption and use of structured team communication for VA medical home implementation.

    PubMed

    Rodriguez, Hector P; Meredith, Lisa S; Hamilton, Alison B; Yano, Elizabeth M; Rubenstein, Lisa V

    2015-01-01

    Daily clinical team meetings (i.e., "huddles") may be helpful in implementing new roles and responsibilities for patient care because they provide a regular opportunity for member learning and feedback. We examined how huddles were implemented in the context of the VA patient-centered medical home (PCMH) transformation, including assessing barriers and facilitators to regular huddling among small teams ("teamlets"). We assessed the extent to which teamlet members that huddled had higher self-efficacy for PCMH changes, reported better teamwork experiences, and perceived more supportive practice environments. We used a convergent mixed-methods approach to analyze 79 teamlet member interviews from six VA primary care practices and 418 clinician and staff PCMH survey responses from the six interviewed practices and 13 additional practices in the same region. Most members reported participating in teamlet huddles when asked in surveys (85%). A minority of interview participants, however, described routine huddling focused on previsit planning that included all members. When members reported routine teamlet huddling, activities included (a) previsit planning, (b) strategizing treatment plans for patients with special or complex needs, (c) addressing daily workflow and communication issues through collective problem solving, and (d) ensuring awareness of what team members do and what actions are happening on the teamlet and in the practice. Primary care providers (PCPs) were least likely to report routine huddling. PCP huddlers reported greater self-efficacy for implementing PCMH changes. All huddlers, irrespective of role, reported better teamwork and more supportive practice climates. The most common barriers to teamlet huddling were limited time and operational constraints. In order to improve the impact of huddles on patient care, practice leaders should clearly communicate the goals, requirements, and benefits of huddling and provide adequate time and resources to

  10. 44. Photocopy of photograph (Pentran file), photographer E. P. Griffith ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    44. Photocopy of photograph (Pentran file), photographer E. P. Griffith (circa 1906). VIEW NORTH ON WASHINGTON AVENUE FROM 27TH STREET, NEWPORT NEWS - Newport News & Old Point Railway & Electric Company, Trolley Barn & Administration Building, 3400 Victoria Boulevard, Hampton, Hampton, VA

  11. 77 FR 67738 - Proposed Information Collection (eBenefits Portal) Activity: Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-13

    ... functionality of the eBenefits portal will register for a single sign-on credential that will ultimately be... Veterans Affairs (VA), is announcing an opportunity for public comment on the proposed collection of... response to the notice. This notice solicits comments on information needed to access the eBenefits portal...

  12. Making housing first happen: organizational leadership in VA's expansion of permanent supportive housing.

    PubMed

    Kertesz, Stefan G; Austin, Erika Laine; Holmes, Sally K; Pollio, David E; Schumacher, Joseph E; White, Bert; Lukas, Carol VanDeusen

    2014-12-01

    While most organizational literature has focused on initiatives that transpire inside the hospital walls, the redesign of American health care increasingly asks that health care institutions address matters outside their walls, targeting the health of populations. The US Department of Veterans Affairs (VA)'s national effort to end Veteran homelessness represents an externally focused organizational endeavor. Our aim was to evaluate the role of organizational practices in the implementation of Housing First (HF), an evidence-based homeless intervention for chronically homeless individuals. This was an interview-based comparative case study conducted across eight VA Medical Centers (VAMCs). Front line staff, mid-level managers, and senior leaders at VA Medical Centers were interviewed between February and December 2012. Using a structured narrative and numeric scoring, we assessed the correlation between successful HF implementation and organizational practices devised according to the organizational transformation model (OTM). Scoring results suggested a strong association between HF implementation and OTM practice. Strong impetus to house Veterans came from national leadership, reinforced by Medical Center directors closely tracking results. More effective Medical Center leaders differentiated themselves by joining front-line staff in the work (at public events and in process improvement exercises), by elevating homeless-knowledgeable persons into senior leadership, and by exerting themselves to resolve logistic challenges. Vertical alignment and horizontal integration advanced at sites that fostered work groups cutting across service lines and hierarchical levels. By contrast, weak alignment from top to bottom typically also hindered cooperation across departments. Staff commitment to ending homelessness was high, though sustainability planning was limited in this baseline year of observation. Key organizational practices correlated with more successful

  13. Restructuring VA ambulatory care and medical education: the PACE model of primary care.

    PubMed

    Cope, D W; Sherman, S; Robbins, A S

    1996-07-01

    The Veterans Health Administration (VHA) Western Region and associated medical schools formulated a set of recommendations for an improved ambulatory health care delivery system during a 1988 strategic planning conference. As a result, the Department of Veterans Affairs (VA) Medical Center in Sepulveda, California, initiated the Pilot (now Primary) Ambulatory Care and Education (PACE) program in 1990 to implement and evaluate a model program. The PACE program represents a significant departure from traditional VA and non-VA academic medical center care, shifting the focus of care from the inpatient to the outpatient setting. From its inception, the PACE program has used an interdisciplinary team approach with three independent global care firms. Each firm is interdisciplinary in composition, with a matrix management structure that expands role function and empowers team members. Emphasis is on managed primary care, stressing a biopsychosocial approach and cost-effective comprehensive care emphasizing prevention and health maintenance. Information management is provided through a network of personal computers that serve as a front end to the VHA Decentralized Hospital Computer Program (DHCP) mainframe. In addition to providing comprehensive and cost-effective care, the PACE program educates trainees in all health care disciplines, conducts research, and disseminates information about important procedures and outcomes. Undergraduate and graduate trainees from 11 health care disciplines rotate through the PACE program to learn an integrated approach to managed ambulatory care delivery. All trainees are involved in a problem-based approach to learning that emphasizes shared training experiences among health care disciplines. This paper describes the transitional phases of the PACE program (strategic planning, reorganization, and quality improvement) that are relevant for other institutions that are shifting to training programs emphasizing primary and ambulatory care.

  14. 75 FR 30782 - Reorganization/Expansion of Foreign-Trade Zone 20; Hampton Roads, VA, Area

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-02

    ... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [Order No. 1683] Reorganization/Expansion of Foreign-Trade Zone 20; Hampton Roads, VA, Area Pursuant to its authority under the Foreign-Trade Zones Act...) in the Hampton Roads, Virginia, area within the Norfolk Customs and Border Protection port of entry...

  15. 76 FR 9636 - Franklin Financial Corporation, Inc., Glen Allen, VA; Approval of Conversion Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-18

    ... DEPARTMENT OF THE TREASURY Office of Thrift Supervision [AC-59: OTS No. H-4761] Franklin Financial Corporation, Inc., Glen Allen, VA; Approval of Conversion Application Notice is hereby given that on February 11, 2011, the Office of Thrift Supervision approved the application of Franklin Financial Corporation...

  16. 78 FR 51067 - VA Health Professional Scholarship and Visual Impairment and Orientation and Mobility...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-20

    ... availability of the program ``to institutions with high numbers of Hispanic students and to historically [[Page... with high numbers of Hispanic students and to Historically Black Colleges and Universities.'' Congress... written request to VA. The requirement for such a written request, however, does not constitute a...

  17. 75 FR 61249 - Proposed Information Collection (VA Request for Determination of Reasonable Value) Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-04

    ... Request for Determination of Reasonable Value) Activity: Comment Request AGENCY: Veterans Benefits... information needed to determine the reasonable value of properties for guaranteed or direct home loans. DATES... Request for Determination of Reasonable Value, VA Form 26-1805 and 26-1805-1. OMB Control Number: 2900...

  18. 75 FR 61858 - Proposed Information Collection (VA Request for Determination of Reasonable Value) Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-06

    ... Request for Determination of Reasonable Value) Activity: Comment Request AGENCY: Veterans Benefits... to determine the reasonable value of properties for guaranteed or direct home loans. DATES: Written... Reasonable Value, VA Form 26-1805 and 26-1805-1. OMB Control Number: 2900-0045. Type of Review: Extension of...

  19. 75 FR 34639 - Safety Zone; Reedville July 4th Celebration, Cockrell's Creek, Reedville, VA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-18

    ...-AA00 Safety Zone; Reedville July 4th Celebration, Cockrell's Creek, Reedville, VA AGENCY: Coast Guard... Cockrell's Creek in the vicinity of Reedville, Virginia in support of the Reedville July 4th Celebration... notice of proposed rulemaking (NPRM) entitled Reedville July 4th Celebration, Cockrell's Creek, Reedville...

  20. Search for V+A current in top-quark decays in pp collisions at sqrts=1.96 TeV.

    PubMed

    Abulencia, A; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Budroni, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carillo, S; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Almenar, C Cuenca; Cuevas, J; Culbertson, R; Cully, J C; Cyr, D; Daronco, S; Datta, M; D'Auria, S; Davies, T; D'Onofrio, M; Dagenhart, D; de Barbaro, P; Cecco, S De; Deisher, A; De Lentdecker, G; Dell'Orso, M; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; Dituro, P; Dörr, C; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garcia, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; da Costa, J Guimaraes; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A C; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Manca, G; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moore, R; Morello, M; Fernandez, P Movilla; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Nachtman, J; Nagano, A; Naganoma, J; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Nurse, E; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Oldeman, R; Orava, R; Osterberg, K; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ranjan, N; Rappoccio, S; Reisert, B; Rekovic, V; Renton, P; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Sabik, S; Safonov, A; Sakumoto, W K; Salamanna, G; Saltó, O; Saltzberg, D; Sánchez, C; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyrla, A; Shapiro, M D; Shears, T; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Sjolin, J; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; Denis, R St; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sun, H; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuchiya, R; Tsuno, S; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Veramendi, G; Veszpremi, V; Vidal, R; Vila, I; Vilar, R; Vine, T; Vollrath, I; Volobouev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, J; Wagner, W; Wallny, R; Wang, S M; Warburton, A; Waschke, S; Waters, D; Weinberger, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zhou, J; Zucchelli, S

    2007-02-16

    We report an upper limit on the fraction of V+A current, fV+A, in top-quark decays, using approximately 700 pb-1 of pp[over ] collisions at sqrts=1.96 TeV acquired by the upgraded Collider Detector at Fermilab. For the decay t-->Wb-->lnub (where l=e or micro), the invariant mass of the charged lepton and the bottom quark jet is sensitive to the polarization of the W boson. We determine fV+A=-0.06+/-0.25 given a top-quark mass of 175 GeV/c2. We set an upper limit on fV+A of 0.29 at the 95% confidence level, an improvement by a factor of 2 on the previous best direct limit.