Replacing Alpha-Fetoprotein With Alpha-Fetoprotein-L3 Increases the Sensitivity of Prenatal Screening for Trisomy 21.

PubMed

Huai, Lei; Leng, Jianhang; Ma, Shenglin; Huang, Fang; Shen, Junya; Ding, Yu

This study aimed to investigate the serum concentration of alpha-fetoprotein (AFP)-L3 in midterm pregnancies and its potential application in prenatal trisomy screening. The serum samples from 27 women with trisomy 21 fetuses and 800 women with normal fetuses were examined to measure the concentrations of AFP, AFP-L3, human chorionic gonadotropin (hCG), unconjugated estriol (uE3), and inhibin-A. The screening results of various tests consisting of these markers were analyzed. In normal pregnancies within 15-20 weeks of gestation, the medians of serum AFP-L3 were 4.63, 5.70, 5.78, 6.58, 7.03, and 7.25 pg/mL. The median of AFP-L3 MoM in the trisomy 21 group was 0.46, which was significantly lower than the value of 1 in the normal group (P < 0.05). When using a cutoff value of 1/270, the sensitivity of the triple marker test (AFP, hCG, uE3) was improved from 74% to 81% by replacing AFP with AFP-L3, with the false-positive rate slightly increased from 5.4% to 6.8%. Similarly, the sensitivity of the quad marker test (AFP, hCG, uE3, inhibin-A) was improved from 81% to 89% by replacing AFP with AFP-L3, with the false-positive rate slightly increased from 4.6% to 5.6%. Serum AFP-L3 concentration increases along with more weeks of gestation in the midterm pregnancies. Trisomy 21 screening tests with AFP replaced by AFP-L3 have higher sensitivities at the expense of slightly increased false-positive rates. This improvement in screening may help to better prepare the parents and caregivers for the special needs of newborns with trisomy 21.

Reducing the H0 and σ8 tensions with dark matter-neutrino interactions

NASA Astrophysics Data System (ADS)

Di Valentino, Eleonora; Bœhm, Céline; Hivon, Eric; Bouchet, François R.

2018-02-01

The introduction of dark matter-neutrino interactions modifies the cosmic microwave background (CMB) angular power spectrum at all scales, thus affecting the reconstruction of the cosmological parameters. Such interactions can lead to a slight increase of the value of H0 and a slight decrease of S8≡σ8√{Ωm/0.3 } , which can help reduce somewhat the tension between the CMB and weak lensing or Cepheids data sets. Here we show that it is impossible to solve both tensions simultaneously. While the 2015 Planck temperature and low multipole polarization data combined with the Cepheids data sets prefer large values of the Hubble rate (up to H0=72.1-1.7+1.5 km /s /Mpc , when Neff is free to vary), the σ8 parameter remains too large to reduce the σ8 tension. Adding high multipole Planck polarization data does not help since this data shows a strong preference for low values of H0, thus worsening current tensions, even though they also prefer smaller value of σ8.

Structural, morphological and optical investigations on electron-beam irradiated PbF2-TeO2-B2O3-Eu2O3 glasses

NASA Astrophysics Data System (ADS)

Wagh, Akshatha; Petwal, Vikash; Dwivedi, Jishnu; Upadhyaya, V.; Raviprakash, Y.; Kamath, Sudha D.

2016-09-01

Combined structural, optical and morphological studies were carried out on Eu2O3 doped PbF2-TeO2-B2O3 glass samples, before and after being subjected to electron beam of energy 7.5 MeV. XRD confirmed the amorphous nature of the glasses even after 150 kGy electron beam irradiation. Densities of the irradiated samples showed slightly greater values when compared to their respective values before irradiation, which proved the increase in the compaction of the network. The intensities of the three prominent bands; B-O-B linkages, BO4 units and BO3 units of FT-IR spectra, of the titled glasses, showed slight decrease after electron beam irradiation. The decrement in the values of energy band gap and shift in cut-off wavelength towards red edge, proved the formation of color centers in the glass network after irradiation. The change in Hunter L values, through color measurement was a proof for the Farbe/color/absorption centers created in the glass sites after irradiation.

Jellyfish Lake, Palau: Regeneration of C, N, Si, and P in anoxic marine lake sediments

USGS Publications Warehouse

Lyons, W.B.; Lent, R.M.; Burnett, W.C.; Chin, P.; Landing, W.M.; Orem, W.H.; McArthur, J.M.

1996-01-01

Sediment cores from Jellyfish Lake were processed under an inert atmosphere and the pore waters extracted and analyzed for the following parameters: pH, titration alkalinity (TA), Cl-, H4SiO4, PO43-, NH4+, Ca2-, Mg2+, SO42-, and H2S. Additionally, in one set of pore-water samples (core 10), the ??13C of the ??CO2 was also determined. The TA, H4SiO4, PO43-, NH4+, and H2S increased with depth in the pore waters above anoxic bottom-water values. H2S values increased to 3.8 ??M. In one case, both H4SiO4 and PO43- concentrations increased to a maximum value and then decreased with depth, suggesting removal into solid phases. The H4SiO4 concentrations are equal to or greater than pore-water values observed in sediments underlying upwelling areas. PO43- concentrations are, in general, lower than pore-water values from terrigenous nearshore areas but higher than nearshore carbonate pore-water values from Florida Bay or Bermuda. The Ca2+, Cl-, and Mg2+: Cl- ratios show slight decreases in the top 15-20 cm, suggesting that authigenic carbonate may be forming. This suggestion is supported by the fact that the pore waters are saturated with respect to CaCO3 due to the very high TAs. The ??13C measurements of the pore-water ??CO2 are from a shorter core. These measurements reach their most negative concentration at 72 cm and then become slightly heavier. This change is accompanied by a decrease in TA, suggesting the onset of methanogenesis at this location in this core.

C-reactive protein reference percentiles among pre-adolescent children in Europe based on the IDEFICS study population.

PubMed

Schlenz, H; Intemann, T; Wolters, M; González-Gil, E M; Nappo, A; Fraterman, A; Veidebaum, T; Molnar, D; Tornaritis, M; Sioen, I; Mårild, S; Iacoviello, L; Ahrens, W

2014-09-01

C-reactive protein (CRP) is involved in a wide range of diseases. It is a powerful marker for inflammatory processes used for diagnostic and monitoring purposes. We aimed to establish reference values as data on the distribution of serum CRP levels in young European children are scarce. Reference values of high-sensitivity CRP concentrations were calculated for 9855 children aged 2.0-10.9 years, stratified by age and sex. The children were recruited during the population-based European IDEFICS study (Identification and prevention of Dietary- and lifestyle-induced health Effects in Children and infantS) with 18 745 participants recruited from 2007 to 2010. In 44.1% of the children, CRP values were below or equal the detection limit of 0.2 mg/l. Median CRP concentrations showed a slight negative age trend in boys and girls, whereas serum CRP values were slightly higher in girls than in boys across all age groups. Our population-based reference values of CRP may guide paediatric practice as elevated values may require further investigation or treatment. Therefore, the presented reference values represent a basis for clinical evaluation and for future research on risk assessment of diseases associated with increased CRP levels among children.

Hyperglycemia may determine fibrinopeptide A plasma level increase in humans.

PubMed

Ceriello, A; Giugliano, D; Quatraro, A; Dello Russo, P; Marchi, E; Torella, R

1989-12-01

The effects of hyperglycemia on plasma fibrinopeptide A (FPA) levels in normal subjects are reported. An increase of FPA concentration parallel to sustained hyperglycemia was observed; when the glycemia returned to basal values, FPA showed values in normal range. Heparin infusion was able to significantly decrease the hyperglycemia-induced augment of FPA levels. Isovolumic-isotonic NaCl solution infusion produced a slight (NS) increase in FPA levels; however, mild hyperglycemia, achieved by glucagon, was also able to produce a significant increase in FPA concentration. These data demonstrate the direct role of hyperglycemia in conditioning FPA level, and suggest that hyperglycemia, by itself, is a sufficient stimulus to produce thrombin activation in humans.

Influence of endurance exercise (triathlon) on circulating transferrin receptors and other indicators of iron status in female athletes.

PubMed

Röcker, Lothar; Hinz, Katrin; Holland, Karsten; Gunga, Hanns-Christian; Vogelgesang, Jens; Kiesewetter, Holger

2002-01-01

Numerous reports have described a poor iron status in female endurance athletes. However, the traditionally applied indicators of iron status (hemoglobin, ferritin, transferrin) may not truly reflect the iron status. Therefore we studied the newly developed soluble transferrin receptor and other indicators of iron status in twelve female endurance athletes before and after a triathlon race. Resting values showed a poor iron status in the participants of the race. Serum TfR concentration increased slightly after the race. However, if the values are corrected for hemoconcentration no change could be found. Hemoglobin, serum ferritin and transferrin values were increased after the race.

To the theory of high-power gyrotrons with uptapered resonators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dumbrajs, O.; Nusinovich, G. S.

In high-power gyrotrons it is desirable to combine an optimal resonator length with the optimal value of the resonator quality factor. In resonators with the constant radius of the central part, the possibilities of this combination are limited because the quality factor of the resonator sharply increases with its length. Therefore the attempts to increase the length for maximizing the efficiency leads to such increase in the quality factor which makes the optimal current too small. Resonators with slightly uptapered profiles offer more flexibility in this regard. In such resonators, one can separate optimization of the interaction length from optimizationmore » of the quality factor because the quality factor determined by diffractive losses can be reduced by increasing the angle of uptapering. In the present paper, these issues are analyzed by studying as a typical high-power 17 GHz gyrotron which is currently under development in Europe for ITER (http://en.wikipedia.org/wiki/ITER). The effect of a slight uptapering of the resonator wall on the efficiency enhancement and the purity of the radiation spectrum in the process of the gyrotron start-up and power modulation are studied. Results show that optimal modification of the shape of a slightly uptapered resonator may result in increasing the gyrotron power from 1052 to 1360 kW.« less

Reference Values for Weight, Height, Head Circumference, and Body Mass Index in Turkish Children.

PubMed

Neyzi, Olcay; Bundak, Rüveyde; Gökçay, Gülbin; Günöz, Hülya; Furman, Andrzej; Darendeliler, Feyza; Baş, Firdevs

2015-12-01

This study aimed to integrate the existing updated reference standards for the growth of Turkish infants and children and to compare these values with World Health Organization (WHO) reference data, data from some European countries, and also with previous local data. Weight, height, and head circumference measurements were obtained on 2,391 boys and 2,102 girls who were regular attenders of a well child clinic and on 1,100 boys and 1,020 girls attending schools in relatively well-off districts in İstanbul. Mean number of measurements per child was 8.2±3.6 in the age group 0-5 years and 5.5±3.3 in the age group 6-18 years. All children were from well-to-do families and all were healthy. All measurements with the exception of measurements at birth, which were based on reported values, were done by trained personnel. The LMS method was used in the analyses and in the construction of the percentile charts. There is an increase in weight for age and body mass index values for age starting in prepubertal ages, indicating an increasing trend for obesity. Compared to WHO reference data, weight and height values in Turkish children were slightly higher in infants and in children younger than 5 years, while they showed similarity to those reported for children from Norway and Belgium. Head circumference values, which were slightly higher than the WHO references in the first 5 years, were comparable to the data on Belgian and Norwegian children in the first 9 years of life. At older ages, Turkish children showed higher values for head circumference. The relatively larger head circumference values were interpreted to reflect a genetic characteristic.

Extension of the energy-to-moment parameter Θ to intermediate and deep earthquakes

NASA Astrophysics Data System (ADS)

Saloor, Nooshin; Okal, Emile A.

2018-01-01

We extend to intermediate and deep earthquakes the slowness parameter Θ originally introduced by Newman and Okal (1998). Because of the increasing time lag with depth between the phases P, pP and sP, and of variations in anelastic attenuation parameters t∗ , we define four depth bins featuring slightly different algorithms for the computation of Θ . We apply this methodology to a global dataset of 598 intermediate and deep earthquakes with moments greater than 1025 dyn∗cm. We find a slight increase with depth in average values of Θ (from -4.81 between 80 and 135 km to -4.48 between 450 and 700 km), which however all have intersecting one- σ bands. With widths ranging from 0.26 to 0.31 logarithmic units, these are narrower than their counterpart for a reference dataset of 146 shallow earthquakes (σ = 0.55). Similarly, we find no correlation between values of Θ and focal geometry. These results point to stress conditions within the seismogenic zones inside the Wadati-Benioff slabs more homogeneous than those prevailing at the shallow contacts between tectonic plates.

Effects of elevated temperature postharvest on color aspect, physiochemical characteristics, and aroma components of pineapple fruits.

PubMed

Liu, Chuanhe; Liu, Yan

2014-12-01

In this work, 2 separate experiments were performed to describe the influence of elevated temperature treatments postharvest on the color, physiochemical characteristics and aroma components of pineapple fruits during low-temperature seasons. The L* (lightness) values of the skin and pulp of pineapple fruits were decreased. The a* (greenness-redness) and b* (blueness-yellowness) values of the skin and pulp were all markedly increased. The elevated temperature significantly increased the contents of total soluble solids (TSS) and slightly affected contents of vitamin C (nonsignificant). Titratable acidity (TA) of pineapple fruits were notably decreased, whereas the values of TSS/TA of pineapple fruits were significantly increased. The firmness of the pineapple fruits decreased and more esters and alkenes were identified. The total relative contents of esters were increased, and the total relative contents of alkenes were decreased. © 2014 Institute of Food Technologists®

Patient-perceived changes in the system of values after cancer diagnosis.

PubMed

Greszta, Elżbieta; Siemińska, Maria J

2011-03-01

A cross-sectional study investigated changes in patients' value systems following a diagnosis of cancer. Fifty patients at 1 to 6 months following cancer diagnosis, were asked to compare their current values with their recollection of past values. Using the Rokeach Value Survey we obtained statistically significant results showing that twenty-seven out of thirty-six values changed their importance from the patients' perspective: 16 values significantly increased, while 11 values significantly decreased in importance. Changes with respect to nine values were insignificant. We indentified clusters of values increasing in importance the most: Religious morality (Salvation, Forgiving, Helpful, Clean), Personal orientation (Self-Respect, True Friendship, Happiness), Self-constriction (Self-Controlled, Obedient, Honest), Family security (Family Security, Responsible), and Delayed gratification (Wisdom, Inner Harmony). We also observed that the following value clusters decreased in importance: Immediate gratification (An Exciting Life, Pleasure, A Comfortable Life); Self-expansion (Capable, Ambitious, Broadminded), Competence (A Sense of Accomplishment, Imaginative, Intellectual). The remaining values belonged to clusters that as a group changed slightly or not at all. Practical implications of the study are discussed.

Thermodynamic Calculations of Hydrogen-Oxygen Detonation Parameters for Various Initial Pressures

NASA Technical Reports Server (NTRS)

Bollinger, Loren E.; Edse, Rudolph

1961-01-01

Composition, temperature, pressure and density behind a stable detonation wave and its propagation rate have been calculated for seven hydrogen-oxygen mixture at 1, 5, 25 and 100 atm initial pressure, and at an initial temperature of 40C. For stoichiometric mixtures that calculations also include an initial temperature of 200C. According to these calculations the detonation velocities of hydrogen-oxygen mixtures increase with increasing initial pressure, but decrease slightly when the initial temperature is raised from 40 to 200 C. The calculated detonation velocities agree satisfactorily with values determined experimentally. These values will be published in the near future.

Ecotoxicity evaluation of a liquid detergent using the automatic biotest ECOTOX.

PubMed

Azizullah, Azizullah; Richter, Peter; Ullah, Waheed; Ali, Imran; Häder, Donat-Peter

2013-08-01

Synthetic detergents are common pollutants reaching aquatic environments in different ways after usage at homes, institutions and industries. In this study a liquid detergent, used for dish washing, was evaluated for its toxicity during long- and short-term tests using the automatic biotest ECOTOX. Different parameters of Euglena gracilis like motility, swimming velocity, gravitactic orientation, cell compactness and cell growth were used as end points. In short-term experiments, the maximum adverse effects on motility, velocity, cell shape and gravitaxis were observed after 1 h of exposure. With further increase in exposure time to the detergent a slight recovery of these parameters was observed. In long-term experiments, the detergent caused severe disturbances to E. gracilis. Motility, cell growth and cell compactness (shape) with EC50 values of 0.064, 0.18 and 2.05 %, respectively, were found as the most sensitive parameters to detergent stress. There was a slight positive effect on gravitactic orientation at the lowest two concentrations; at higher concentrations of the detergent cells orientation was highly impaired giving EC50 values of 1.75 and 2.52 % for upward swimming and r-value, respectively.

Farmer views on calving difficulty consequences on dairy and beef farms.

PubMed

Martin-Collado, D; Hely, F; Byrne, T J; Evans, R; Cromie, A R; Amer, P R

2017-02-01

Calving difficulty (CD) is a key functional trait with significant influence on herd profitability and animal welfare. Breeding plays an important role in managing CD both at farm and industry level. An alternative to the economic value approach to determine the CD penalty is to complement the economic models with the analysis of farmer perceived on-farm impacts of CD. The aim of this study was to explore dairy and beef farmer views and perceptions on the economic and non-economic on-farm consequences of CD, to ultimately inform future genetic selection tools for the beef and dairy industries in Ireland. A standardised quantitative online survey was released to all farmers with e-mail addresses on the Irish Cattle Breeding Federation database. In total, 271 farmers completed the survey (173 beef farmers and 98 dairy farmers). Both dairy and beef farmers considered CD a very important issue with economic and non-economic components. However, CD was seen as more problematic by dairy farmers, who mostly preferred to slightly reduce its incidence, than by beef farmers, who tended to support increases in calf value even though it would imply a slight increase in CD incidence. Farm size was found to be related to dairy farmer views of CD with farmers from larger farms considering CD as more problematic than farmers from smaller farms. CD breeding value was reported to be critical for selecting beef sires to mate with either beef or dairy cows, whereas when selecting dairy sires, CD had lower importance than breeding values for other traits. There was considerable variability in the importance farmers give to CD breeding values that could not be explained by the farm type or the type of sire used, which might be related to the farmer non-economic motives. Farmer perceived economic value associated with incremental increases in CD increases substantially as the CD level considered increases. This non-linear relationship cannot be reflected in a standard linear index weighting. The results of this paper provide key underpinning support to the development of non-linear index weightings for CD in Irish national indexes.

Changes in the level and activation state of the plasma membrane H(+)-ATPase during aging of red beet slices.

PubMed

Papini, R; De Michelis, M I

1997-07-01

The effect of aging on the plasma membrane (PM) H(+)-ATPase of red beet (Beta vulgaris L.) parenchyma discs was analyzed in PM purified by aqueous two-phase partitioning. Aging increased both the activity in the amount of immunodetectable H(+)-ATPase in the PM. The activity assayed at slightly alkaline pH values increased earlier and more strongly than that assayed at acidic pH values, so that the pH curve of the enzyme from aged beet discs was shifted toward more alkaline values. Aging decreased the stimulation of the PM H(+)-ATPase activity by controlled trypsin treatments or by lysophosphatidylcholine. After trypsin treatment the pH dependence of H(+)-ATPase from dormant or aged beet discs became equal. These results indicate that aging not only increases the level of H(+)-ATPase in the PM, but also determines its activation, most likely by modifying the interaction between the autoinhibitory carboxyl-terminal domain and the catalytic site. When the PM H(+)-ATPase activity was assayed at a slightly alkaline pH, the tyrosine modifier N-acetylimidazole inhibited the H(+)-ATPase in the PM from dormant beet discs much less than in the PM from aged discs, suggesting that modification of a tyrosine residue may be involved in the activation of the PM H(+)-ATPase induced by aging. The results are discussed with regard to aging-induced development of transmembrane transport activities.

Enamel remineralization effect of a dentifrice containing calcium sodium phosphosilicate: an optical coherence tomography observation.

PubMed

Matsuyoshi, Saki; Murayama, Ryosuke; Akiba, Shunsuke; Yabuki, Chiaki; Takamizawa, Toshiki; Kurokawa, Hiroyasu; Miyazaki, Masashi

2017-04-01

The purpose of this study was to examine the effects of a dentifrice containing 5% calcium sodium phosphosilicate (CSP) on the remineralization of the enamel using optical coherence tomography (OCT). Bovine incisors were sliced and shaped in a rectangular form. One group of five specimens was treated with undersaturated 0.1 M lactic acid buffer solution (pH 4.75) for 10 min and then placed in artificial saliva (pH 7.0) (De group). Other specimens were stored in solutions of toothpaste containing CSP for 10 min, followed by 10-min immersion in the lactic acid buffer solution twice a day before storage in artificial saliva (CSP group). An additional group was stored in only artificial saliva (control group). OCT imaging on the selected location of the enamel surface was performed. The peak intensity and width at 1/e 2 were recorded in each of the six areas on the sample and averaged, and the sample size of each group was six. The integrated value in units (dB × μm) was calculated in the area of peak intensity. The data for each group was subjected to one-way repeated-measures ANOVA and Tukey HSD tests (α = 0.05). The changes in integrated values of each group were different. A slight but significant increase in the integrated value was observed in the control group, whereas a slight but significant decrease in the value was observed the De group. Integrated values increased in the CSP group. Remineralization occurred upon immersion in the toothpaste containing CSP.

l-Proline and RNA Duplex m-Value Temperature Dependence.

PubMed

Schwinefus, Jeffrey J; Baka, Nadia L; Modi, Kalpit; Billmeyer, Kaylyn N; Lu, Shutian; Haase, Lucas R; Menssen, Ryan J

2017-08-03

The temperature dependence of l-proline interactions with the RNA dodecamer duplex surface exposed after unfolding was quantified using thermal and isothermal titration denaturation monitored by uv-absorbance. The m-value quantifying proline interactions with the RNA duplex surface area exposed after unfolding was measured using RNA duplexes with GC content ranging between 17 and 83%. The m-values from thermal denaturation decreased with increasing GC content signifying increasingly favorable proline interactions with the exposed RNA surface area. However, m-values from isothermal titration denaturation at 25.0 °C were independent of GC content and less negative than those from thermal denaturation. The m-value from isothermal titration denaturation for a 50% GC RNA duplex decreased (became more negative) as the temperature increased and was in nearly exact agreement with the m-value from thermal denaturation. Since RNA duplex transition temperatures increased with GC content, the more favorable proline interactions with the high GC content duplex surface area observed from thermal denaturation resulted from the temperature dependence of proline interactions rather than the RNA surface chemical composition. The enthalpy contribution to the m-value was positive and small (indicating a slight increase in duplex unfolding enthalpy with proline) while the entropic contribution to the m-value was positive and increased with temperature. Our results will facilitate proline's use as a probe of solvent accessible surface area changes during biochemical reactions at different reaction temperatures.

Apparent diffusion coefficient evaluation for secondary changes in the cerebellum of rats after middle cerebral artery occlusion

PubMed Central

Yang, Yunjun; Gao, Lingyun; Fu, Jun; Zhang, Jun; Li, Yuxin; Yin, Bo; Chen, Weijian; Geng, Daoying

2013-01-01

Supratentorial cerebral infarction can cause functional inhibition of remote regions such as the cerebellum, which may be relevant to diaschisis. This phenomenon is often analyzed using positron emission tomography and single photon emission CT. However, these methods are expensive and radioactive. Thus, the present study quantified the changes of infarction core and remote regions after unilateral middle cerebral artery occlusion using apparent diffusion coefficient values. Diffusion-weighted imaging showed that the area of infarction core gradually increased to involve the cerebral cortex with increasing infarction time. Diffusion weighted imaging signals were initially increased and then stabilized by 24 hours. With increasing infarction time, the apparent diffusion coefficient value in the infarction core and remote bilateral cerebellum both gradually decreased, and then slightly increased 3–24 hours after infarction. Apparent diffusion coefficient values at remote regions (cerebellum) varied along with the change of supratentorial infarction core, suggesting that the phenomenon of diaschisis existed at the remote regions. Thus, apparent diffusion coefficient values and diffusion weighted imaging can be used to detect early diaschisis. PMID:25206615

Influence of succinylation on physicochemical property of yak casein micelles.

PubMed

Yang, Min; Yang, Jitao; Zhang, Yuan; Zhang, Weibing

2016-01-01

Succinylation is a chemical-modification method that affects the physicochemical characteristics and functional properties of proteins. This study assessed the influence of succinylation on the physicochemical properties of yak casein micelles. The results revealed that surface hydrophobicity indices decreased with succinylation. Additionally, denaturation temperature and denaturation enthalpy decreased with increasing succinylation level, except at 82%. The buffering properties of yak casein micelles were affected by succinylation. It was found that chemical modification contributed to a slight shift of the buffering peak towards a lower pH value and a markedly increase of the maximum buffering values of yak casein micelles at pH 4.5-6.0 and pH < 3. Succinylation increased yak casein micellar hydration and whiteness values. The findings obtained from this study will provide the basic information on the physicochemical properties of native and succinylated yak casein micelles. Copyright © 2015 Elsevier Ltd. All rights reserved.

Comparing multistate expected damages, option price and cumulative prospect measures for valuing flood protection

NASA Astrophysics Data System (ADS)

Farrow, Scott; Scott, Michael

2013-05-01

Floods are risky events ranging from small to catastrophic. Although expected flood damages are frequently used for economic policy analysis, alternative measures such as option price (OP) and cumulative prospect value exist. The empirical magnitude of these measures whose theoretical preference is ambiguous is investigated using case study data from Baltimore City. The outcome for the base case OP measure increases mean willingness to pay over the expected damage value by about 3%, a value which is increased with greater risk aversion, reduced by increased wealth, and only slightly altered by higher limits of integration. The base measure based on cumulative prospect theory is about 46% less than expected damages with estimates declining when alternative parameters are used. The method of aggregation is shown to be important in the cumulative prospect case which can lead to an estimate up to 41% larger than expected damages. Expected damages remain a plausible and the most easily computed measure for analysts.

Spectral and Spatial UV Sky Radiance Measurements at a Seaside Resort Under Clear Sky and Slightly Overcast Conditions.

PubMed

Sandmann, Henner; Stick, Carsten

2014-01-01

Spatial measurements of the diffusely scattered sky radiance at a seaside resort under clear sky and slightly overcast conditions have been used to calculate the sky radiance distribution across the upper hemisphere. The measurements were done in the summer season when solar UV radiation is highest. The selected wavelengths were 307, 350 and 550 nm representing the UVB, UVA and VIS band. Absolute values of radiance differ considerably between the wavelengths. Normalizing the measured values by use of direct solar radiance made the spatial distributions of unequal sky radiance comparable. The results convey a spatial impression of the different distributions of the radiance at the three wavelengths. Relative scattered radiance intensity is one order of magnitude greater in UVB than in VIS, whereas in UVA lies roughly in between. Under slightly overcast conditions scattered radiance is increased at all three wavelengths by about one order of magnitude. These measurements taken at the seaside underline the importance of diffuse scattered radiance. The effect of shading parts of the sky can be estimated from the distribution of sky radiance. This knowledge might be useful for sun seekers and in the treatment of people staying at the seaside for therapeutic purposes. © 2013 The American Society of Photobiology.

Radiolysis of aqueous solutions of thiamine

NASA Astrophysics Data System (ADS)

Chijate, C.; Albarran, G.; Negron-Mendoza, A.

1998-06-01

The results of the radiolysis of aqueous solutions of thiamine (vitamin B 1) are presented. The yields for decomposition of thiamine and the product of radiolytic products were determined. The G values decrease as the dose increases. Some radiolytic products were identified. Decomposition of thiamine was slightly dependent on the presence of oxygen and on the pH of the solution. At pH 4.4 with a concentration of 2.5 × 10 -4 mol L -1 of thiamine in an oxygen free aqueous solution, the G 0 value for decomposition is 5.0.

Korteweg-deVries-Burgers (KdVB) equation in a five component cometary plasma with kappa described electrons and ions

NASA Astrophysics Data System (ADS)

Michael, Manesh; Willington, Neethu T.; Jayakumar, Neethu; Sebastian, Sijo; Sreekala, G.; Venugopal, Chandu

2016-12-01

We investigate the existence of ion-acoustic shock waves in a five component cometary plasma consisting of positively and negatively charged oxygen ions, kappa described hydrogen ions, hot solar electrons, and slightly colder cometary electrons. The KdVB equation has been derived for the system, and its solution plotted for different kappa values, oxygen ion densities, as well as the temperature ratios for the ions. It is found that the amplitude of the shock wave decreases with increasing kappa values. The strength of the shock profile decreases with increasing temperatures of the positively charged oxygen ions and densities of negatively charged oxygen ions.

Mechanical and optoelectric properties of post-annealed fluorine-doped tin oxide films by ultraviolet laser irradiation

NASA Astrophysics Data System (ADS)

Tseng, Shih-Feng; Hsiao, Wen-Tse; Chiang, Donyau; Huang, Kuo-Cheng; Chou, Chang-Pin

2011-06-01

The fluorine-doped tin oxide (FTO) thin film deposited on a soda-lime glass substrate was annealed by a defocus ultraviolet (UV) laser irradiation at ambient temperature. The mechanical and optoelectric properties of FTO films annealed by using the various laser processing parameters were reported. After the FTO films were subjected to laser post-annealing, the microhardness were slightly less but the reduced modulus values were larger than that of unannealed FTO films, respectively. The average optical transmittance in the visible waveband slightly increased with increasing the laser annealing energy and scan speed. Moreover, all the sheet resistance of laser annealed films was less than that of the unannealed ones. We found that the sheet resistance decrease was obviously influenced by annealing. The suitable annealing conditions could maintain the film thickness and relief the internal stress generated in the film preparation process to improve the electrical conductivity via decreasing laser energy or increasing scan speed.

Chemical composition, oxidative stability and antioxidant capacity of oil extracted from roasted seeds of Sacha-inchi (Plukenetia volubilis L.).

PubMed

Cisneros, Fausto H; Paredes, Daniel; Arana, Adrian; Cisneros-Zevallos, Luis

2014-06-04

The effect of roasting of Sacha-inchi (Plukenetia volubilis L.) seeds on the oxidative stability and composition of its oil was investigated. The seeds were subjected to light, medium and high roasting intensities. Oil samples were subjected to high-temperature storage at 60 °C for 30 days and evaluated for oxidation (peroxide value and p-anisidine), antioxidant activity (total phenols and DPPH assay), and composition (tocopherol content and fatty acid profile). Results showed that roasting partially increased oil oxidation and its antioxidant capacity, slightly decreased tocopherol content, and did not affect the fatty acid profile. During storage, oxidation increased for all oil samples, but at a slower rate for oils from roasted seeds, likely due to its higher antioxidant capacity. Also, tocopherol content decreased significantly, and a slight modification of the fatty acid profile suggested that α-linolenic acid oxidized more readily than other fatty acids present.

Effect of interface deformability on thermocapillary motion of a drop in a tube

NASA Astrophysics Data System (ADS)

Mahesri, S.; Haj-Hariri, H.; Borhan, A.

2014-03-01

The effect of an externally imposed axial temperature gradient on the mobility and deformation of a drop in an otherwise stagnant liquid within an insulated cylindrical tube is investigated. In the absence of bulk transport of momentum and energy, the boundary integral technique is used to obtain the flow and temperature fields inside and outside the deformable drop. The steady drop shapes and the corresponding migration velocities are examined over a wide range of the dimensionless parameters. The steady drop shape is nearly spherical for dimensionless drop sizes <0.5, but becomes slightly elongated in the axial direction for drop sizes comparable to tube diameter. The adverse effect of drop deformation on the effective temperature gradient driving the motion is slightly more pronounced than its favorable effect of reducing drag, thereby leading to a slight reduction in drop mobility with increasing drop deformation. Increasing the viscosity ratio reduces drop deformation and leads to a slight enhancement in the relative mobility (with respect to free thermocapillary motion) of confined drops. When the drop fluid has a lower thermal conductivity than the exterior phase, the presence of the thermally-insulating wall increases the thermal driving force for drop motion (compared to that for the same drop in unbounded domain) by causing more pronounced bending of the isotherms toward the drop. However, the favorable thermal effect of the confining wall is overwhelmed by its retarding hydrodynamic effect, causing the confined drop to always move slower than its unbounded counterpart regardless of the value of the thermal conductivity ratio.

Turbulent convective flows in a cubic cavity at high Prandtl number

NASA Astrophysics Data System (ADS)

Vasiliev, A.; Sukhanovskii, A.; Frick, P.

2016-10-01

Characteristics of turbulent convective flows in a cubic cell is studied experimentally for high values of Prandtl number. The first set was carriied out with propylene glycol (Pr = 64 and the second one with 25% water solution of propylene glycol (Pr = 24). It was found that increasing of Pr from 6.1 to 24 leads only to the slight change of intensity of the flow but during the next increasing of Pr from 24 to 64 the flow changes its structure.

Temporal trends in United States dew point temperatures

NASA Astrophysics Data System (ADS)

Robinson, Peter J.

2000-07-01

In this study, hourly data for the 1951-1990 period for 178 stations in the coterminous United States were used to establish temporal trends in dew point temperature. Although the data had been quality controlled previously (Robinson, 1998. Monthly variations of dew point temperatures in the coterminous United States. International Journal of Climatology 18: 1539-1556), comparisons of values between nearby stations suggested that instrumental changes, combined with locational changes, may have modified the results by as much as 1°C during the 40-year period. Nevertheless, seasonally averaged results indicated an increase over much of the area, of slightly over 1°C/100 years in spring and autumn, slightly less than this in summer. Winter displayed a drying of over 1°C/100 years. When only the 1961-1990 period was considered, the patterns were similar and trends increased by approximately 1-2°C/100 years, except in autumn, which displayed a slight drying. Analyses for specific stations indicated periods of both increasing and decreasing Td, the change between them varying with observation hour. No single change point was common over a wide area, although January commonly indicated maximum values early in the period in the east and west, and much later in the north-central portion. Rates of increase were generally higher in daytime than at night, especially in summer. Investigation of the inter-decadal differences in dew point, as a function of wind conditions, indicated that changes during calm conditions were commonly similar in magnitude to that of the overall average changes, suggesting an important role for the local hydrologic cycle in driving changes. Other inter-decadal changes could be attributed to the changes in the frequency and moisture content of invading air-streams. This was particularly clear for the changes in north-south flow in the interior.

Unsteady Convection Flow and Heat Transfer over a Vertical Stretching Surface

PubMed Central

Cai, Wenli; Su, Ning; Liu, Xiangdong

2014-01-01

This paper investigates the effect of thermal radiation on unsteady convection flow and heat transfer over a vertical permeable stretching surface in porous medium, where the effects of temperature dependent viscosity and thermal conductivity are also considered. By using a similarity transformation, the governing time-dependent boundary layer equations for momentum and thermal energy are first transformed into coupled, non-linear ordinary differential equations with variable coefficients. Numerical solutions to these equations subject to appropriate boundary conditions are obtained by the numerical shooting technique with fourth-fifth order Runge-Kutta scheme. Numerical results show that as viscosity variation parameter increases both the absolute value of the surface friction coefficient and the absolute value of the surface temperature gradient increase whereas the temperature decreases slightly. With the increase of viscosity variation parameter, the velocity decreases near the sheet surface but increases far away from the surface of the sheet in the boundary layer. The increase in permeability parameter leads to the decrease in both the temperature and the absolute value of the surface friction coefficient, and the increase in both the velocity and the absolute value of the surface temperature gradient. PMID:25264737

Unsteady convection flow and heat transfer over a vertical stretching surface.

PubMed

Cai, Wenli; Su, Ning; Liu, Xiangdong

2014-01-01

This paper investigates the effect of thermal radiation on unsteady convection flow and heat transfer over a vertical permeable stretching surface in porous medium, where the effects of temperature dependent viscosity and thermal conductivity are also considered. By using a similarity transformation, the governing time-dependent boundary layer equations for momentum and thermal energy are first transformed into coupled, non-linear ordinary differential equations with variable coefficients. Numerical solutions to these equations subject to appropriate boundary conditions are obtained by the numerical shooting technique with fourth-fifth order Runge-Kutta scheme. Numerical results show that as viscosity variation parameter increases both the absolute value of the surface friction coefficient and the absolute value of the surface temperature gradient increase whereas the temperature decreases slightly. With the increase of viscosity variation parameter, the velocity decreases near the sheet surface but increases far away from the surface of the sheet in the boundary layer. The increase in permeability parameter leads to the decrease in both the temperature and the absolute value of the surface friction coefficient, and the increase in both the velocity and the absolute value of the surface temperature gradient.

[A study of Ververck index in 16 865 singleton neonates with a gestational age of 27-42 weeks in Shenzhen, China].

PubMed

Huang, Xiao-Yun; Liu, Hui-Long; Lei, Min; Lian, Zhao-Hui; Mai, Hui-Fen

2018-01-01

Ververck index (VI) reflects thoracic development, body type, and nutritional status. This study aimed to investigate the VI of singleton neonates with a gestational age (GA) of 27-42 weeks at birth, and to establish percentile curves of VI of the neonates. Cross-sectional cluster sampling was performed between April 2013 and September 2015. Body weight, body length, and chest circumference were measured for 16 865 singleton neonates with a GA of 27-42 weeks in two hospitals in Shenzhen, China. VI was calculated and the percentile curves of VI were plotted for the neonates. Mean VIs were obtained for singleton neonates with a gestational age of 27-42 weeks (in three groups of male, female, and both sexes), and related 3rd-97th percentile curves were plotted. As for the 50th percentile curve, the singleton neonates with a GA of 27 weeks had the lowest 50th percentile value of VI, which gradually increased with the increase in GA. The singleton neonates with a GA of 42 weeks had the highest 50th percentile value of VI. Girls had a slightly higher 50th percentile value of VI than boys in all GA groups. VI of neonates increases with the increase in GA. Female neonates may have a slightly better thoracic development, body type, and nutritional status than male neonates at birth. The percentile curves of VI plotted for singleton neonates with a GA of 27-42 weeks (in three groups of male, female, and both sexes) can provide a basis for evaluating thoracic development, body type, and nutritional status of neonates at birth in Shenzhen, China.

Coagulation processes of kaolinite and montmorillonite in calm, saline water

NASA Astrophysics Data System (ADS)

Zhang, Jin-Feng; Zhang, Qing-He; Maa, Jerome P.-Y.

2018-03-01

A three dimensional numerical model for simulating the coagulation processes of colloids has been performed by monitoring the time evolution of particle number concentration, the size distribution of aggregates, the averaged settling velocity, the collision frequency, and the collision efficiency in quiescent water with selected salinities. This model directly simulates all interaction forces between particles based on the lattice Boltzmann method (LBM) and the extended Derjaguin-Landau-Verwey-Overbeek (XDLVO) theory, and thus, can reveal the collision and coagulation processes of colloidal suspensions. Although using perfect spherical particles in the modeling, the results were compared with those for kaolinite and montmorillonite suspensions to demonstrate the capability of simulating the responses of these particles with highly irregular shape. The averaged settling velocity of kaolinite aggregates in quiescent saline water reached a maximum of 0.16 mm/s when the salinity increasing to about 3, and then, exhibited little dependence on salinity thereafter. Model simulations results (by choosing specific values that represent kaolinite's characteristics) indicate a similar trend: rapid decrease of the particle number concentration (i.e., rapidly flocculated, and thus, settling velocity also increases rapidly) when salinity increases from 0 to 2, and then, only increased slightly when salinity was further increased from 5 to 20. The collision frequency for kaolinite only decreases slightly with increasing salinity because that the fluid density and viscosity increase slightly in sea water. It suggests that the collision efficiency for kaolinite rises rapidly at low salinities and levels off at high salinity. For montmorillonite, the settling velocity of aggregates in quiescent saline water continuedly increases to 0.022 mm/s over the whole salinity range 0-20, and the collision efficiency for montmorillonite rises with increasing salinities.

Relationships of consumer sensory ratings, marbling score, and shear force value to consumer acceptance of beef strip loin steaks.

PubMed

Platter, W J; Tatum, J D; Belk, K E; Chapman, P L; Scanga, J A; Smith, G C

2003-11-01

Logistic regression was used to quantify and characterize the effects of changes in marbling score, Warner-Bratzler shear force (WBSF), and consumer panel sensory ratings for tenderness, juiciness, or flavor on the probability of overall consumer acceptance of strip loin steaks from beef carcasses (n = 550). Consumers (n = 489) evaluated steaks for tenderness, juiciness, and flavor using nine-point hedonic scales (1 = like extremely and 9 = dislike extremely) and for overall steak acceptance (satisfied or not satisfied). Predicted acceptance of steaks by consumers was high (> 85%) when the mean consumer sensory rating for tenderness,juiciness, or flavor for a steak was 3 or lower on the hedonic scale. Conversely, predicted consumer acceptance of steaks was low (< or = 10%) when the mean consumer rating for tenderness, juiciness, or flavor for a steak was 5 or higher on the hedonic scale. As mean consumer sensory ratings for tenderness, juiciness, or flavor decreased from 3 to 5, the probability of acceptance of steaks by consumers diminished rapidly in a linear fashion. These results suggest that small changes in consumer sensory ratings for these sensory traits have dramatic effects on the probability of acceptance of steaks by consumers. Marbling score displayed a weak (adjusted R2 = 0.053), yet significant (P < 0.01), relationship to acceptance of steaks by consumers, and the shape of the predicted probability curve for steak acceptance was approximately linear over the entire range of marbling scores (Traces67 to Slightly Abundant97), suggesting that the likelihood of consumer acceptance of steaks increases approximately 10% for each full marbling score increase between Slight to Slightly Abundant. The predicted probability curve for consumer acceptance of steaks was sigmoidal for the WBSF model, with a steep decline in predicted probability of acceptance as WBSF values increased from 3.0 to 5.5 kg. Changes in WBSF within the high (> 5.5 kg) or low (< 3.0 kg) portions of the range of WBSF values had little effect on the probability of consumer acceptance of steaks.

Magnetic field effects on electron transfer reactions involving sextet-spin ( S = 5/2) intermediates generated on photoexcitation of a Cr(III)-porphyrin complex

NASA Astrophysics Data System (ADS)

Mori, Yukie; Hoshino, Mikio; Hayashi, Hisaharu

The excited trip-sextet ( 6 T 1 ) state of chloro-(3-methylimidazol)-( meso -tetraphenylporphyrinato) chromium(III) (Cr III P) is quenched by 1,1 '-dibenzyl-4,4 '-bipyridinium (BV 2+ ) in acetonitrile through electron transfer to give 5 (Cr III P .+ ) and 2 BV .+ . The intermediate is a geminate ion pair in the sextet (Sx) state 6 [ 5 (Cr III P .+ ) 2 BV .+ ], which decays through either the escape from a solvent cage to give the free ions or the spin conversion to the quartet (Qa) state followed by back electron transfer. The free ion yield ( ΦFI ) increased with increasing magnetic field from 0 to 4 T and then slightly decreased from 4 T to 10 T. These magnetic field effects are explained as follows. Under low fields where the Zeeman splitting of the spin sublevels is lower than or comparable with the electron spin dipole-dipole interaction within 5 (Cr III P .+ ), this interaction effectively induces the Sx ⇔Qa conversion of [ 5 (Cr III P .+ ) 2 BV + ] to result in low ΦFI values. Under high fields where the Zeeman splitting is larger than the dipole-dipole interaction, the Sx Qa conversion is decreased with increasing field to cause higher ΦFI values. The slight decrease in ΦFI above 4 T may be due to the Δg mechanism.

INFLUENCE OF INTRAMUSCULAR FAT LEVEL ON ORGANOLEPTIC, PHYSICAL, AND CHEMICAL CHARACTERISTICS OF IRRADIATED PORK MUSCLE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whitehair, L.A.

1962-01-01

A study was conducted to evaluate the influence of marbling on certain organoleptic, physical, and chemical characteristics of precooked and irradiated pork loin muscle (longissimus dorsi). The study consisted of two separate phases. Loins utilized in Phase I were selected by visual appraisal and categorized into three distinct marbling level scores. A high temperature, short time blanching treatment was used for proteolytic enzyme inactivation. Phase II loins were selected and classified into three marbling levels by both visual appraisal amd ether extraction analysis of total fat. A low temperature, long time heat treatment was used for enzyme inactivation. Samples weremore » packed under vacuum in rigid containers and irradiated at a dosage level of 4.5 megarads gamma radiation. Non-irradiated samples were stored at -65 deg F. Irradiated and control samples were evaluated at periodic intervals by a panel. Physical and chemical analyses were made initially on samples representing each treatment and subsequently at the termination of each storage period. Organoleptic results indicated that degree of marbling did not influence preference ratings of plain radiosterilized longissimus dorsi muscle (pork). However, irradiated longissimus dorsi (pork) sandwich items with lower marbling scores were consistently preferred over highly marbled, irradiated sandwich items. Non-irradiated longissimus dorsi samples were preferred to irradiated longissimus dorsi samples in all tests. The short term-high temperature method of blanching used in Phase I resulted in products of slightly superior quality to those of Phase II, which possessed softer, slightly drier texture characteristics. The practical storage life of irradiated samples under the conditions was approximately 150 days. Hunter color values were increased by radiation treatment. Irradiated longissimus dorsi samples developed a characteristic pink-red color. Mechanical tenderness values in both irradiated and non-irradiated samples were lowered significantly by higher levels of marbling. Expressible moisture values of irradiated samples were lower than those of control samples. The values increased with advancing storage time. Iodine numbers of lower marbling scores (both irradiated and non-irradiated samplcs) exceeded those of highly marbled samples. T.B.A. number values were lower in irradiated samples of Phase I. The values were increased with respect to increased levels of marbling in Phase II. Values increased steadily with advancing storage time in both phases. pH values were elevated by irradiation treatment, marbling level, and storage time in Phase I. The differences were not observed for Phase II samples. Bacteriological assays indicated that irradiated samples were commercially sterile. Extremely low numbers of Micrococci were found. (Dissertation Abstr., 23: No. 4)« less

Plasmaspheric H+, He+, O+, He++, and O++ Densities and Temperatures

NASA Technical Reports Server (NTRS)

Gallagher, D. L.; Craven, P. D.; Comfort H.

2013-01-01

Thermal plasmaspheric densities and temperatures for five ion species have recently become available, even though these quantities were derived some time ago from the Retarding Ion Mass Spectrometer onboard the Dynamics Explorer 1 satellite over the years 1981-1984. The quantitative properties will be presented. Densities are found to have one behavior with lessor statistical variation below about L=2 and another with much greater variability above that Lshell. Temperatures also have a behavior difference between low and higher L-values. The density ratio He++/H+ is the best behaved with values of about 0.2% that slightly increase with increasing L. Unlike the He+/H+ density ratio that on average decreases with increasing Lvalue, the O+/H+ and O++/H+ density ratios have decreasing values below about L=2 and increasing average ratios at higher L-values. Hydrogen ion temperatures range from about 0.2 eV to several 10s of eV for a few measurements, although the bulk of the observations are of temperatures below 3 eV, again increasing with L-value. The temperature ratios of He+/H+ are tightly ordered around 1.0 except for the middle plasmasphere between L=3.5 and 4.5 where He+ temperatures can be significantly higher. The temperatures of He++, O+, and O++ are consistently higher than H+.

Plasmaspheric H+, He+, He++, O+, and O++ Densities and Temperatures

NASA Technical Reports Server (NTRS)

Gallagher, G. L.; Craven, P. D.; Comfort, R. H.

2013-01-01

Thermal plasmaspheric densities and temperatures for five ion species have recently become available, even though these quantities were derived some time ago from the Retarding Ion Mass Spectrometer onboard the Dynamics Explorer 1 satellite over the years 1981-1984. The quantitative properties will be presented. Densities are found to have one behavior with lessor statistical variation below about L=2 and another with much greater variability above that Lshell. Temperatures also have a behavior difference between low and higher L-values. The density ratio He++/H+ is the best behaved with values of about 0.2% that slightly increase with increasing L. Unlike the He+/H+ density ratio that on average decreases with increasing Lvalue, the O+/H+ and O++/H+ density ratios have decreasing values below about L=2 and increasing average ratios at higher L-values. Hydrogen ion temperatures range from about 0.2 eV to several 10s of eV for a few measurements, although the bulk of the observations are of temperatures below 3 eV, again increasing with L-value. The temperature ratios of He+/H+ are tightly ordered around 1.0 except for the middle plasmasphere between L=3.5 and 4.5 where He+ temperatures can be significantly higher. The temperatures of He++, O+, and O++ are consistently higher than H+.

Weak values in collision theory

NASA Astrophysics Data System (ADS)

de Castro, Leonardo Andreta; Brasil, Carlos Alexandre; Napolitano, Reginaldo de Jesus

2018-05-01

Weak measurements have an increasing number of applications in contemporary quantum mechanics. They were originally described as a weak interaction that slightly entangled the translational degrees of freedom of a particle to its spin, yielding surprising results after post-selection. That description often ignores the kinetic energy of the particle and its movement in three dimensions. Here, we include these elements and re-obtain the weak values within the context of collision theory by two different approaches, and prove that the results are compatible with each other and with the results from the traditional approach. To provide a more complete description, we generalize weak values into weak tensors and use them to provide a more realistic description of the Stern-Gerlach apparatus.

Effects of intracellular pH on the mitotic apparatus and mitotic stage in the sand dollar egg.

PubMed

Watanabe, K; Hamaguchi, M S; Hamaguchi, Y

1997-01-01

The effect of change in intracellular pH (pHi) on mitosis was investigated in the sand dollar egg. The pHi in the fertilized egg of Scaphechinus mirabilis and Clypeaster japonicus, which was 7.34 and 7.31, respectively, changed by means of treating the egg at nuclear envelope breakdown with sea water containing acetate and/or ammonia at various values of pH. The mitotic apparatus at pHi 6.70 became larger than that of normal fertilized eggs; that is, the mitotic spindle had the maximal size, especially in length at pHi 6.70. The spindle length linearly decreased when pHi increased from 6.70 to 7.84. By polarization microscopy, the increase in birefringence retardation was detected at slightly acidic pHi, suggesting that the increase in size of the spindle is caused by the increase in the amount of microtubules in the spindle. At pHi 6.30, the organization of the mitotic apparatus was inhibited. Furthermore, slightly acidic pHi caused cleavage retardation or inhibition. By counting the number of the eggs at various mitotic stages with time after treating them with the media, it is found that metaphase was persistent and most of the S. mirabilis eggs were arrested at metaphase under the condition of pHi 6.70. It is concluded that at slightly acidic pH, the microtubules in the spindle are stabilized and more microtubules assembled than those in the normal eggs.

State summaries: Illinois

USGS Publications Warehouse

Lasemi, Z.; Mikulic, Donald G.

2006-01-01

According to the United States Geological Survey (USGS), Illinois ranked third in the amount of crushed stone produced from underground mining operations. In 2004, Illinois produced more than 76.5 Mt of crushed stone and 38.7 Mt of sand-and-gravel. Preliminary data for 2005 showed an increase in the production of crushed stone and a slight decrease in the production of sand-and-gravel. The state remained 16th in total value of nonfuel mineral production. In decreasing order of value, the minerals produced included crushed stone, cement, construction sand and gravel, lime, clay, peat, tripoli, industrial sand, crushed sandstone and gemstone.

Behavior of flavonols and carotenoids of minimally processed kale leaves during storage in passive modified atmosphere packaging.

PubMed

Kobori, C N; Huber, L S; Sarantópoulos, C I G L; Rodriguez-Amaya, D B

2011-03-01

Minimally processed kale leaves were packed in passive modified atmosphere and stored at 3 conditions: 1 °C in the dark and 11 °C with or without light exposure. The products were evaluated during storage in terms of headspace gas composition, sensory attributes, flavonol, and carotenoid contents. The sensory quality decreased slightly during 17 d at 1 °C in the dark. At 11 °C, the vegetable shelf life was predicted to be 6 d in the dark and 3 d with light. Quercetin and kaempferol were stable during storage for 15 d at 1 °C in the absence of light. At 11 °C in the dark, quercetin was stable during 10 d, increasing slightly on the 8th day. Kaempferol decreased up to the 5th day but increased on the 8th day, decreasing again on the 10th day. After 5 d at 11 °C under light, the flavonol levels were significantly higher than those of the initial values. Neoxanthin and violaxanthin did not change significantly after 15 d at 1 °C in the dark. Lutein and β-carotene, however, decreased 7.1% and 11.3%, respectively. At 11 °C in the dark, neoxanthin, violaxanthin, lutein, and β-carotene decreased 16.1%, 13.2%, 24.1%, and 23.7% after 10 d, respectively. At 11 °C under light, neoxanthin and lutein had a slight increase while violaxanthin and β-carotene decreased 23.1% and 16.5% after 5 d. Practical Application:  Passive modified atmosphere packaging together with refrigeration can extend the shelf life of minimally processed kale, retaining the health-promoting compounds, flavonols and carotenoids. Quercetin, kaempferol, neoxanthin, and violaxanthin are stable and lutein and β-carotene slightly reduced.

Thermal Properties of Contemporary and Conventional Gutta Percha Materials Used in Root Canal Treatment

DTIC Science & Technology

2015-01-15

α crystalline form to an amorphous gutta-percha.6,18 It should be noted that these temperatures for commercial endodontic gutta-percha will be...slightly different, as these temperature values are for pure gutta-percha. With the increased number endodontic gutta-percha materials being marketed...clinical technique. Furthermore, some literature has suggested that not all commercially available endodontic gutta-percha materials exist in the same

Intransience of functional components and distinctive properties of amla (Indian gooseberry) ice cream during short-term storage.

PubMed

Goraya, Rajpreet Kaur; Bajwa, Usha

2018-05-01

Inclusion of processed amla have been found to enhance the functional properties and nutritional value of ice cream by augmenting the fiber content, total phenols, tannins, ascorbic acid and antioxidant activity. The present investigation assessed the changes in these constituents, color values (L, a* and b*), melting rate, sensory scores and microbiological quality of ice cream containing amla shreds, pulp, preserve, candy and powder during 60 days' storage at - 18 to - 20 °C. The total solids increased slightly whereas the antioxidant activity, total phenols, ascorbic acid and tannins decreased on storage. The L values declined whereas a* and b* values amplified, the rate of change being highest in candy containing sample followed by preserve. The first drip time of all the samples increased whereas melting rate decreased. The overall acceptability scores declined non significantly. Standard plate count of all the ice cream samples decreased significantly whereas yeast and molds were not detected throughout the storage. The psychrophiles were not spotted up to 30 days, thereafter, a small increase was observed.

Morphological response of coastal dunes to a group of three typhoons on Pingtan Island, China

NASA Astrophysics Data System (ADS)

Yang, Lin; Dong, Yuxiang; Huang, Dequan

2018-06-01

Pingtan Island (Fujian, China) was severely impacted by a group of three typhoons in a sequence of Nepartak, Meranti, and Megi during the summer of 2016. Field investigations were conducted on the island before and after the typhoons using high-precision RTK GPS technology and surveying methods, and we analyzed the morphological responses of three types of coastal dunes (coastal foredunes, climbing dunes, and coastal sand sheets) to the typhoon group. The maximum height decrease among coastal foredunes was 2.89 m after the typhoon group landed; dune volume increased by 0.9%, and the windward side showed a slight height increase, whereas that of the slope crest and leeward slope were slightly lower than the values before the typhoon group landed. The maximum height decrease among climbing dunes was 1.43 m, and dune volume decreased slightly by 0.1%; the height change among climbing dunes differed in magnitude between sites. Among coastal sand sheets, the maximum height increase was 0.75 m, and dune volume increased by 1.5%; the height of frontal coastal sand sheets increased markedly as result of storm surge washover deposits, whereas the heights barely changed at the middle and trailing edges. The above results suggest that the typhoon group imposed significant morphological changes on coastal dunes. However, the features of morphological responses differed between the three types of coastal dunes studied, and also among dunes of the same type based on local characteristics. Furthermore, coastal dunes showed no cumulative effects in their responses to the typhoon group, despite the individual typhoon impacts on coastal dune morphology.

Germination under Moderate Salinity Increases Phenolic Content and Antioxidant Activity in Rapeseed (Brassica napus var oleifera Del.) Sprouts.

PubMed

Falcinelli, Beatrice; Sileoni, Valeria; Marconi, Ombretta; Perretti, Giuseppe; Quinet, Muriel; Lutts, Stanley; Benincasa, Paolo

2017-08-19

The use of sprouts in the human diet is becoming more and more widespread because they are tasty and high in bioactive compounds and antioxidants, with related health benefits. In this work, we sprouted rapeseed under increasing salinity to investigate the effect on free and bound total phenolics (TP), non-flavonoids (NF), tannins (TAN), phenolic acids (PAs), and antioxidant activity. Seeds were incubated at 0, 25, 50, 100, 200 mM NaCl until early or late sprout stage, i.e., before or after cotyledon expansion, respectively. Sprouting and increasing salinity slightly decreased the bound fractions of TP, NF, TAN, PAs, while it increased markedly the free ones and their antioxidant activity. Further increases were observed in late sprouts. Moderate salinity (25-50 mM NaCl) caused the highest relative increase in phenolic concentration while it slightly affected sprout growth. On the contrary, at higher NaCl concentrations, sprouts grew slowly (100 mM NaCl) or even died before reaching the late sprout stage (200 mM). Overall, moderate salinity was the best compromise to increase phenolic content of rapeseed sprouts. The technique may be evaluated for transfer to other species as a cheap and feasible way to increase the nutritional value of sprouts.

Dynamics of entropic uncertainty for atoms immersed in thermal fluctuating massless scalar field

NASA Astrophysics Data System (ADS)

Huang, Zhiming

2018-04-01

In this article, the dynamics of quantum memory-assisted entropic uncertainty relation for two atoms immersed in a thermal bath of fluctuating massless scalar field is investigated. The master equation that governs the system evolution process is derived. It is found that the mixedness is closely associated with entropic uncertainty. For equilibrium state, the tightness of uncertainty vanishes. For the initial maximum entangled state, the tightness of uncertainty undergoes a slight increase and then declines to zero with evolution time. It is found that temperature can increase the uncertainty, but two-atom separation does not always increase the uncertainty. The uncertainty evolves to different relatively stable values for different temperatures and converges to a fixed value for different two-atom distances with evolution time. Furthermore, weak measurement reversal is employed to control the entropic uncertainty.

Effect of Jet-nozzle-expansion Ratio on Drag of Parabolic Afterbodies

NASA Technical Reports Server (NTRS)

Englert, Gerald W; Vargo, Donald J; Cubbison, Robert W

1954-01-01

The interaction of the flow from one convergent and two convergent-divergent nozzles on parabolic afterbodies was studied at free-stream Mach numbers of 2.0, 1.6, and 0.6 over a range of jet pressure ratio. The influence of the jet on boattail and base drag was very pronounced. Study of the total external afterbody drag values at supersonic speeds indicated that, over most of the high-pressure-ratio range, increasing the nozzle design expansion ratio increased the drag even though the boattail area was reduced. Increasing the pressure ratio tended to increase slightly the total-drag increment caused by angle-of-attack operation.

Ambulatory blood pressure and heart rate during shuttle flight, entry and landing

NASA Technical Reports Server (NTRS)

Thornton, W.; Moore, T. P.; Uri, J.

1993-01-01

Ambulatory blood pressures (BP) and heart rates (HR) were recorded on a series of early Shuttle flights during preflight and pre-entry, entry, landing and egress. There were no significant differences between flight and preflight values during routine activity. Systolic blood pressure was slightly elevated in the deorbit period and systolic and diastolic blood pressure and heart rates were all elevated with onset of gravitoinertial loads and remained so through egress. Two of seven subjects had orthostatic problems in egress but their data did not show significant differences from others except in heart rate. Comparison of this data to that from recent studies show even larger increase in HR/BP values during current deorbit and entry phases which is consistent with increased heat and weight loads imposed by added survival gear. Both value and limitations of ambulatory heart rate/blood pressure data in this situation are demonstrated.

An Impact Triggered Runaway Greenhouse on Mars

NASA Technical Reports Server (NTRS)

Segura, T. L.; McKay, C. P.; Toon, O. B.

2004-01-01

When a planet is in radiative equilibrium, the incoming solar flux balances the outgoing longwave flux. If something were to perturb the system slightly, say the incoming solar flux increased, the planet would respond by radiating at a higher surface temperature. Since any radiation that comes in must go out, if the incoming is increased, the outgoing must also increase, and this increase manifests itself as a warmer equilibrium temperature. The increase in solar flux would correspond to an increase in temperature, which would increase the amount of water vapor in the atmosphere due to increased evaporation. Since water vapor is a greenhouse gas, it would absorb more radiation in the atmosphere leading to a yet warmer equilibrium temperature. The planet would reach radiative equilibrium at this new temperature. There exists a point, however, past which this positive feedback leads to a "runaway" situation. In this case, the planet does not simply evaporate a little more water and eventually come to a slightly higher equilibrium temperature. Instead, the planet keeps evaporating more and more water until all of the planet's available liquid and solid water is in the atmosphere. The reason for this is generally understood. If the planet's temperature increases, evaporation of water increases, and the absorption of radiation increases. This increases the temperature and the feedback continues until all water is in the atmosphere. The resulting equilibrium temperature is very high, much higher than the equilibrium temperature of a point with slightly lower solar flux. One can picture that as solar flux increases, planetary temperature also increases until the runaway point where temperature suddenly "jumps" to a higher value, in response to all the available water now residing in the atmosphere. This new equilibrium is called a "runaway greenhouse" and it has been theorized that this is what happened to the planet Venus, where the surface temperature is more than 700 K (427 C).

Cenozoic changes in atmospheric lead recorded in central Pacific ferromanganese crusts

NASA Astrophysics Data System (ADS)

Klemm, Veronika; Reynolds, Ben; Frank, Martin; Pettke, Thomas; Halliday, Alex N.

2007-01-01

The possible sources of pre-anthropogenic Pb contributed to the world's oceans have been the focus of considerable study. The role of eolian dust versus riverine inputs has been of particular interest. With better calibration of isotopic records from central Pacific ferromanganese crusts using Os isotope stratigraphy it now appears that deep water Pb isotopic compositions were effectively homogeneous over a distance of 5000 km for the past 80 Myr. The composition shifted slightly from high 206Pb/ 204Pb ratios in the range of 18.87 ± 0.02 before 65 Ma to lower values of 18.62 ± 0.02 by 45 Ma and then gradually increased again very slightly to the present day ratio of 18.67 ± 0.02. The regional homogeneity provides evidence of a dominant well-mixed atmospheric source the most likely candidate for which is volcanic aerosols contributed either directly or as soluble condensates on eolian dust. The slight shift in Pb isotope composition of deep waters in the central Pacific between 65 and 45 Ma may be the result of a regional- or perhaps global-scale change in the sources of volcanic exhalations and volcanic activity caused by an increase in the importance of melting and assimilation of older continental crustal components over the Cenozoic.

Functional properties of protein isolates extracted from stabilized rice bran by microwave, dry heat, and parboiling.

PubMed

Khan, Saima Hafeez; Butt, Masood Sadiq; Sharif, Mian Kamran; Sameen, Ayesha; Mumtaz, Semee; Sultan, Muhammad Tauseef

2011-03-23

Protein isolates extracted from differently stabilized rice bran were analyzed to work out the food use potential. Bulk density remained higher for isolates obtained from heat stabilized bran, the treatments were found to have positive impact on the oil absorption properties, while the water absorption was slightly impaired owing to some possible configurational changes. Surface hydrophobicity and emulsion properties were improved with bran stabilization. Isolates exhibited better foaming properties owing to the flexible nature of protein molecules, with less intensive disulfide bonding, that were slightly affected by the stabilization treatment. Nitrogen solubility index followed a curved pattern with the least value near isoelectric point that showed an increasing trend toward basic pH, and parboiled protein isolates exhibited better gelling properties among the isolates.

Continous animal exposure to a mixture of dichloromethane and 1,1,1-trichloroethane

NASA Technical Reports Server (NTRS)

1975-01-01

An investigation of the effects of combined exposure of animals to dichloromethane and 1,1,1-trichloroethane was conducted using atmospheric concentrations of each solvent which had individually produced minimal measureable effects on livers. Previously established spacecraft threshold limit values for the individual solvent compounds were studied to determine validity when both were present in an astronaut's breathing environment under continuous exposure conditions. Results show that the combined effect of 90-day continuous exposure of animals to 100 ppm dichloromethane and 1000 ppm 1,1, 1-trichloroethane is no greater than the effect of each alone. While the exposed livers of mice appeared to contain slightly more fat, the degree of increased liver weight and the liver-to-body ratios are slightly lower than those measured for each solvent alone.

Studies on the Effects of Certain Soil Properties on the Biodegradation of Oils Determined by the Manometric Respirometric Method

PubMed Central

Kaakinen, Juhani; Vähäoja, Pekka; Kuokkanen, Toivo; Roppola, Katri

2007-01-01

The biodegradability of certain biofuels was studied in the case of forest soils using the manometric respirometric technique, which was proved to be very suitable for untreated, fertilized as well as pH adjusted soils. Experiments carried out in infertile sandy forest soil gave a BOD/ThOD value of 45.1% for a typical model substance, that is, sodium benzoate after a period of 30 days and mineral addition improved the BOD/ThOD value to a value of 76.2%. Rapeseed oil-based chain oil almost did not biodegrade at all in 30 days in nonprocessed soil, and when pH was adjusted to 8.0, the BOD/ThOD value increased slightly to a value of 7.4%. Mineral addition improved the BOD/ThOD value on average to 43.2% after 30 days. The combined mineral addition and pH adjustment together increased the BOD/ThOD value to 75.8% in 30 days. The observations were similar with a rapeseed oil-based lubricating oil: after 30 days, the BOD/ThOD value increased from 5.9% to an average value of 51.9%, when the pH and mineral concentrations of the soil were optimized. The mineral addition and pH adjustment also improved the precision of the measurements significantly. PMID:18273392

Stressed out or subjective acquisition of competence – how do veterinary students see their curative work placement?

PubMed Central

Dilly, Marc; Tipold, Andrea; Geuenich, Katja

2016-01-01

Veterinary studies in Germany are regulated by the Veterinary Certification Act (TAppV). The practical part of the education consists of 1,170 hours, whereby up to 850 hours can be spent on the curative work placement. A curative work placement can result in physical and psychological stress in the sense of a professional overload. It is the aim of this study to find out in what areas and to what extent competence is acquired and psychological stress exists in students during their work placement. Veterinary students (n=142) from all German education institutes participated in a voluntary online-study based on Burnout Screening Scales (BOSS) as well as a questionnaire regarding the acquisition of competence and excessive stress during the work placement (FKÜP). The distribution of values for work placement related stress show that such work placement related stress is generally slightly increased (T=60) and lies above that of occupational stresses within the normal population. Work placement related physical complaints also show a significant slight increase (T=61). A value (T=42) within the normal range was determined for the resource values. Few of the students questioned considered themselves to be excessively stressed in favour of a high subjective acquisition of competences. The largest increase regarding the acquisition of competence was noted for the areas of animal handling/restraint and application and injection techniques. In the sense of a perceived excessive demand regarding practical capabilities the areas of emergency management, surgery and medication dispensation were mentioned. With regard to the load structure and the acquisition of competence by veterinary students during their work placement, more support of the individual and a balancing of teaching/learning goals would be desirable and represents a promising approach. PMID:26958657

Solvent Hold Tank Sample Results for MCU-15-661-662-663: April 2015 Monthly Sample

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fondeur, F.; Taylor-Pashow, K.

2015-07-08

The Savannah River National Lab (SRNL) received one set of Solvent Hold Tank (SHT) samples (MCU-15-661, MCU-15-662, and MCU-15-663 pulled on April 2, 2015) for analysis. The samples were combined and analyzed for composition. Analysis of the composite sample MCU-15-661-662-663 indicated a low concentration (~ 63% of nominal) of the suppressor (TiDG) and a slightly below the nominal concentration (~ 10% below nominal) of the extractant (MaxCalix). The modifier (CS-7SB) level was also 10% below its nominal value while the Isopar™ L level was slightly above its nominal value. This analysis confirms the addition of Isopar™L to the solvent onmore » March 6, 2015. Despite that the values are below target component levels, the current levels of TiDG, CS-7SB and MaxCalix are sufficient for continuing operation without adding a trim at this time until the next monthly sample. No impurities above the 1000 ppm level were found in this solvent. However, the sample was found to contain approximately 18.4 ug/g solvent mercury. The gamma level increased to 8 E5 dpm/mL solvent and it represents an order of magnitude increase relative to previous solvent samples. The increase means less cesium is being stripped from the solvent. Further analysis is needed to determine if the recent spike in the gamma measurement is due to external factors such as algae or other material that may impede stripping. The laboratory will continue to monitor the quality of the solvent in particular for any new impurity or degradation of the solvent components.« less

Concurrent Timbres in Orchestration: a Perceptual Study of Factors Determining "blend"

NASA Astrophysics Data System (ADS)

Sandell, Gregory John

Orchestration often involves selecting instruments for concurrent presentation, as in melodic doubling or chords. One evaluation of the aural outcome of such choices is along the continuum of "blend": whether the instruments fuse into a single composite timbre, segregate into distinct timbral entities, or fall somewhere in between the two extremes. This study investigates, through perceptual experimentation, the acoustical correlates of blend for 15 natural-sounding orchestral instruments presented in concurrently-sounding pairs (e.g. flute-cello, trumpet -oboe, etc.). Ratings of blend showed primary effects for centroid (the location of the midpoint of the spectral energy distribution) and duration of the onset for the tones. Lower average values of both centroid and onset duration for a pair of tones led to increased blends, as did closeness in value for the two factors. Blend decreased (instruments segregated) with higher average values or increased difference in value for the two factors. The musical interval of presentation slightly affected the relative importance of these two mechanisms, with unison intervals determined more by lower average centroid, and minor thirds determined more by closeness in centroid. The contribution of onset in general was slightly more pronounced in the unison conditions than in the minor third condition. Additional factors contributing to blend were correlation of amplitude and centroid envelopes (blend increased as temporal patterns rose and fell in synchrony) and similarity in the overall amount of fundamental frequency perturbation (decreased blend with increasing jitter from both tones). To confirm the importance of centroid as an independent factor determining blend, pairs of tones including instruments with artificially changed centroids were rated for blend. Judgments for several versions of the same instrument pair showed that blend decreased as the altered instrument increased in centroid, corroborating the earlier experiments. Other factors manipulated were amplitude level and the degree of inharmonicity. A survey of orchestration manuals showed many illustrations of "blending" combinations of instruments that were consistent with the results of these experiments. This study's acoustically-based guidelines for blend augment instance-based methods of traditional orchestration teaching, providing underlying abstractions helpful for evaluating the blend of arbitrary combinations of instruments.

[Effect of Broncho-Vaxom on serum IgE and IgG levels in patients with bronchial asthma and chronic obstructive lung disease. A placebo-controlled double-blind study].

PubMed

Weiss, S; Fux, T

1987-09-26

In a double-blind study of 33 patients with bronchial asthma or chronic obstructive pulmonary disease, of whom 17 had proven atopies, the results showed a distinct diminution of the mean IgE level in the atopic patients at the end of 1-month treatment with Broncho-Vaxom, though not attaining statistical significance (trend with p less than 0.10), compared to a slight increase under placebo. Simultaneously the mean IgG level increased slightly in the atopic patients under Broncho-Vaxom and remained stable in the patients under placebo (p less than 0.10). The IgE and IgG values of the non-atopic patients in both treatment groups remained practically unchanged. Considering the small number of patients in each group, and the clear tendency towards a diminution of the IgE level, it may be concluded that the administration of Broncho-Vaxom to atopic patients does not lead to an increased IgE level but, on the contrary, seems rather to favour a decrease.

Correction of the equilibrium temperature caused by slight evaporation of water in protein crystal growth cells during long-term space experiments at International Space Station.

PubMed

Fujiwara, Takahisa; Suzuki, Yoshihisa; Yoshizaki, Izumi; Tsukamoto, Katsuo; Murayama, Kenta; Fukuyama, Seijiro; Hosokawa, Kouhei; Oshi, Kentaro; Ito, Daisuke; Yamazaki, Tomoya; Tachibana, Masaru; Miura, Hitoshi

2015-08-01

The normal growth rates of the {110} faces of tetragonal hen egg-white lysozyme crystals, R, were measured as a function of the supersaturation σ parameter using a reflection type interferometer under μG at the International Space Station (NanoStep Project). Since water slightly evaporated from in situ observation cells during a long-term space station experiment for several months, equilibrium temperature T(e) changed, and the actual σ, however, significantly increased mainly due to the increase in salt concentration C(s). To correct σ, the actual C(s) and protein concentration C(p), which correctly represent the measured T(e) value in space, were first calculated. Second, a new solubility curve with the corrected C(s) was plotted. Finally, the revised σ was obtained from the new solubility curve. This correction method successfully revealed that the 2.8% water was evaporated from the solution, leading to 2.8% increase in the C(s) and C(p) of the solution.

High serum soluble CD30 does not predict acute rejection in liver transplant patients.

PubMed

Matinlauri, I; Höckerstedt, K; Isoniemi, H

2006-12-01

Increased pre- and posttransplantation values of soluble CD30 (sCD30) have been shown to be associated with acute kidney transplant rejection. We sought to study whether high sCD30 could predict rejection early after liver transplantation. The study population included 54 consecutive liver transplant patients, whose samples were collected before liver transplantation and at discharge, which was at a mean time of 3 weeks after transplantation. During the first 6 months posttransplantation, 22 patients experienced an acute rejection episode. Serum sCD30 concentrations were measured by an enzyme-linked immunoassay; changes in serum sCD30 levels posttransplantation were also expressed as relative values compared with pretransplantation results. Liver patients before transplantation displayed higher serum sCD30 values compared with healthy controls: mean values +/- SD were 93 +/- 58 IU/mL vs 17 +/- 8 IU/mL, respectively. At 3 weeks after transplantation the mean sCD30 concentration in liver transplant patients decreased to 59 +/- 42 IU/mL (P = .005). The mean pretransplantation serum sCD30 value was slightly lower among rejecting vs nonrejecting patients: 78 +/- 43 IU/mL vs 104 +/- 65 IU/mL (P = NS). Posttransplantation values in both groups decreased significantly: 47 +/- 34 IU/mL in patients with rejection (P = .014) vs 69 +/- 45 IU/mL in patients without rejection (P = .012). The relative value at 3 weeks posttransplantation decreased slightly more among patients with vs without rejection (70% vs 88%; NS). No correlation was found between serum sCD30 and anti-HLA class I antibodies or crossmatch positivity. In conclusion, neither pre- nor posttransplantation sCD30 levels were associated with acute rejection in liver transplant patients.

Influence of nitromethane concentration on ignition energy and explosion parameters in gaseous nitromethane/air mixtures.

PubMed

Zhang, Qi; Li, Wei; Lin, Da-Chao; He, Ning; Duan, Yun

2011-01-30

The aim of this paper is to provide new experimental data of the minimum ignition energy (MIE) of gaseous nitromethane/air mixtures to discuss the explosion pressure and the flame temperature as a function of nitromethane concentration. Observations on the influence of nitromethane concentration on combustion pressure and temperature through the pressure and temperature measure system show that peak temperature (the peak of combustion temperature wave) is always behind peak pressure (the peak of the combustion pressure wave) in arrival time, the peak combustion pressure of nitromethane increases in the range of its volume fraction 10-40% as the concentration of nitromethane increases, and it slightly decreases in the range of 40-50%. The maximum peak pressure is equal to 0.94 MPa and the minimum peak pressure 0.58 MPa. Somewhat similar to the peak pressure, the peak combustion temperature increases with the volume fraction of nitromethane in the range of 10-40%, and slightly decreases in 40-50%. The maximum peak temperature is 1340 °C and the minimum 860 °C. The combustion temperature rise rate increases with the concentration of nitromethane in 10-30%, while decreases in 30-50% and its maximum value of combustion temperature rise rate in 10-50% is 4200 °C/s at the volume fraction of 30%. Influence of the concentration of nitromethane on the combustion pressure rise rate is relatively complicated, and the maximum value of rise rate of combustion pressure wave in 10-50% is 11 MPa/s at the concentration 20%. Copyright © 2010 Elsevier B.V. All rights reserved.

On the theory of electric double layer with explicit account of a polarizable co-solvent.

PubMed

Budkov, Yu A; Kolesnikov, A L; Kiselev, M G

2016-05-14

We present a continuation of our theoretical research into the influence of co-solvent polarizability on a differential capacitance of the electric double layer. We formulate a modified Poisson-Boltzmann theory, using the formalism of density functional approach on the level of local density approximation taking into account the electrostatic interactions of ions and co-solvent molecules as well as their excluded volume. We derive the modified Poisson-Boltzmann equation, considering the three-component symmetric lattice gas model as a reference system and minimizing the grand thermodynamic potential with respect to the electrostatic potential. We apply present modified Poisson-Boltzmann equation to the electric double layer theory, showing that accounting for the excluded volume of co-solvent molecules and ions slightly changes the main result of our previous simplified theory. Namely, in the case of small co-solvent polarizability with its increase under the enough small surface potentials of electrode, the differential capacitance undergoes the significant growth. Oppositely, when the surface potential exceeds some threshold value (which is slightly smaller than the saturation potential), the increase in the co-solvent polarizability results in a differential capacitance decrease. However, when the co-solvent polarizability exceeds some threshold value, its increase generates a considerable enhancement of the differential capacitance in a wide range of surface potentials. We demonstrate that two qualitatively different behaviors of the differential capacitance are related to the depletion and adsorption of co-solvent molecules at the charged electrode. We show that an additive of the strongly polarizable co-solvent to an electrolyte solution can shift significantly the saturation potential in two qualitatively different manners. Namely, a small additive of strongly polarizable co-solvent results in a shift of saturation potential to higher surface potentials. On the contrary, a sufficiently large additive of co-solvent shifts the saturation potential to lower surface potentials. We obtain that an increase in the co-solvent polarizability makes the electrostatic potential profile longer-ranged. However, increase in the co-solvent concentration in the bulk leads to non-monotonic behavior of the electrostatic potential profile. An increase in the co-solvent concentration in the bulk at its sufficiently small values makes the electrostatic potential profile longer-ranged. Oppositely, when the co-solvent concentration in the bulk exceeds some threshold value, its further increase leads to decrease in electrostatic potential at all distances from the electrode.

Quantum-memory-assisted entropic uncertainty in spin models with Dzyaloshinskii-Moriya interaction

NASA Astrophysics Data System (ADS)

Huang, Zhiming

2018-02-01

In this article, we investigate the dynamics and correlations of quantum-memory-assisted entropic uncertainty, the tightness of the uncertainty, entanglement, quantum correlation and mixedness for various spin chain models with Dzyaloshinskii-Moriya (DM) interaction, including the XXZ model with DM interaction, the XY model with DM interaction and the Ising model with DM interaction. We find that the uncertainty grows to a stable value with growing temperature but reduces as the coupling coefficient, anisotropy parameter and DM values increase. It is found that the entropic uncertainty is closely correlated with the mixedness of the system. The increasing quantum correlation can result in a decrease in the uncertainty, and the robustness of quantum correlation is better than entanglement since entanglement means sudden birth and death. The tightness of the uncertainty drops to zero, apart from slight volatility as various parameters increase. Furthermore, we propose an effective approach to steering the uncertainty by weak measurement reversal.

Inclusion of extremes of prematurity in ventricular index centile charts.

PubMed

Boyle, M; Shim, R; Gnanasekaran, R; Tarrant, A; Ryan, S; Foran, A; McCallion, N

2015-06-01

To assess the relationship between ventricular index (VI) measurements and postmenstrual age in preterm infants and to generate centile charts and normal ranges for frontal horn ratio (FHR) for a large contemporary cohort of preterm infants. A retrospective cohort study of 253 infants with birth gestation less than 32 weeks admitted between January 2009 and December 2011 to a tertiary NICU in Ireland. A total of 816 cranial ultrasounds were reviewed. Data collected were grouped according to postmenstrual age at the time of scan from 23 weeks to 45 weeks. Median values for VI show a general trend to increase with gestation. FHR did not significantly change with postmenstrual age at scan with a median value of 0.31. There is a slight increase in VI as gestation at the time of scans increases. These results provide the basis for updated centile charts which we propose for current practice.

Modification of cardiometabolic profile in obese diabetic patients after bariatric surgery: changes in cardiovascular risk.

PubMed

Pujante, Pedro; Hellín, María D; Fornovi, Aisa; Martínez Camblor, Pablo; Ferrer, Mercedes; García-Zafra, Victoria; Hernández, Antonio M; Frutos, María D; Luján-Monpeán, Juan; Tébar, Javier

2013-10-01

Bariatric surgery is a valuable tool for metabolic control in obese diabetic patients. The aim of this study was to determine changes in weight and carbohydrate and lipid metabolism in obese diabetic patients during the first 4 years after bariatric surgery. A retrospective study was performed in 104 patients (71 women; mean age, 53.0 [0.9] years; mean body mass index, 46.8 [0.7]) with type 2 diabetes mellitus (median duration, 3 years) who underwent laparoscopic proximal gastric bypass. Blood glucose levels and glycated hemoglobin concentrations decreased during the first 1-3 postoperative months. Values stabilized for the rest of the study period, allowing hypoglycemic treatment to be discontinued in 80% of the patients. No significant differences were observed as a function of the body mass index, diabetes mellitus duration, or previous antidiabetic treatment. Weight decreased during the first 15-24 months and slightly increased afterward. Levels of total cholesterol, triglycerides, and low-density lipoprotein significantly decreased, and target values were reached after 12 months in 80% of the patients. No correlation was found between these reductions and weight loss. Similarly, high-density lipoprotein concentrations decreased until 12 months after surgery. Although concentrations showed a subsequent slight increase, target or lower high-density lipoprotein values were achieved at 24 months postintervention in 85% of the patients. Bariatric surgery is effective for the treatment of obese diabetic patients, contributing to their metabolic control and reducing their cardiovascular risk. Copyright © 2013 Sociedad Española de Cardiología. Published by Elsevier Espana. All rights reserved.

Endocrine effects of adjuvant letrozole compared with tamoxifen in hormone-responsive postmenopausal patients with early breast cancer: the HOBOE trial.

PubMed

Rossi, Emanuela; Morabito, Alessandro; Di Rella, Francesca; Esposito, Giuseppe; Gravina, Adriano; Labonia, Vincenzo; Landi, Gabriella; Nuzzo, Francesco; Pacilio, Carmen; De Maio, Ermelinda; Di Maio, Massimo; Piccirillo, Maria Carmela; De Feo, Gianfranco; D'Aiuto, Giuseppe; Botti, Gerardo; Chiodini, Paolo; Gallo, Ciro; Perrone, Francesco; de Matteis, Andrea

2009-07-01

PURPOSE We compared the endocrine effects of 6 and 12 months of adjuvant letrozole versus tamoxifen in postmenopausal patients with hormone-responsive early breast cancer within an ongoing phase III trial. PATIENTS AND METHODS Patients were randomly assigned to receive tamoxifen, letrozole, or letrozole plus zoledronic acid. Serum values of estradiol, follicle-stimulating hormone (FSH), luteinizing hormone (LH), testosterone, dehydroepiandrosterone-sulphate (DHEA-S), progesterone, and cortisol were measured at baseline and after 6 and 12 months of treatment. For each hormone, changes from baseline at 6 and 12 months were compared between treatment groups, and differences over time for each group were analyzed. Results Hormonal data were available for 139 postmenopausal patients with a median age of 62 years, with 43 patients assigned to tamoxifen and 96 patients assigned to letrozole alone or combined with zoledronic acid. Baseline values were similar between the two groups for all hormones. Many significant changes were observed between drugs and for each drug over time. Namely, three hormones seemed significantly affected by one drug only: estradiol that decreased and progesterone that increased with letrozole and cortisol that increased with tamoxifen. Both drugs affected FSH (decreasing with tamoxifen and slightly increasing with letrozole), LH (decreasing more with tamoxifen than with letrozole), testosterone (slightly increasing with letrozole but not enough to differ from tamoxifen), and DHEA-S (increasing with both drugs but not differently between them). Zoledronic acid did not have significant impact on hormonal levels. CONCLUSION Adjuvant letrozole and tamoxifen result in significantly distinct endocrine effects. Such differences can explain the higher efficacy of letrozole as compared with tamoxifen.

Evaluation of stress distribution of implant-retained mandibular overdenture with different vertical restorative spaces: A finite element analysis

PubMed Central

Ebadian, Behnaz; Farzin, Mahmoud; Talebi, Saeid; Khodaeian, Niloufar

2012-01-01

Background: Available restorative space and bar height is an important factor in stress distribution of implant-supported overdentures. The purpose of this study was to evaluate the effect of different vertical restorative spaces and different bar heights on the stress distribution around implants by 3D finite element analysis. Materials and Methods: 3D finite element models were developed from mandibular overdentures with two implants in the interforaminal region. In these models, four different bar heights from gingival crest (0.5, 1, 1.5, 2 mm) with 15 mm occlusal plane height and three different occlusal plane heights from gingival crest (9, 12, 15 mm) with 2 mm bar height were analyzed. A vertical unilateral and a bilateral load of 150 N were applied to the central occlusal fossa of the first molar and the stress of bone around implant was analyzed by finite element analysis. Results: By increasing vertical restorative space, the maximum stress values around implants were found to be decreased in unilateral loading models but slightly increased in bilateral loading cases. By increasing bar height from gingival crest, the maximum stress values around implants were found to be increased in unilateral loading models but slightly decreased in bilateral loading cases. In unilateral loading models, maximum stress was found in a model with 9 mm occlusal plane height and 1.5 mm bar height (6.254 MPa), but in bilateral loading cases, maximum stress was found in a model with 15 mm occlusal plane height and 0.5 mm bar height (3.482 MPa). Conclusion: The reduction of bar height and increase in the thickness of acrylic resin base in implant-supported overdentures are biomechanically favorable and may result in less stress in periimplant bone. PMID:23559952

Fishmeal replacement with Spirulina Platensis and Chlorella vulgaris in African catfish (Clarias gariepinus) diet: Effect on antioxidant enzyme activities and haematological parameters.

PubMed

Raji, Ameenat Abiodun; Alaba, Peter Adeniyi; Yusuf, Hindatu; Abu Bakar, Noor Hidayati; Mohd Taufek, Norhidayah; Muin, Hasniyati; Alias, Zazali; Milow, Pozi; Abdul Razak, Shaharudin

2018-05-25

This study explored fishmeal replacement with two freshwater microalgae: Spirulina Platensis and Chlorella vulgaris in African catfish (Clarias gariepinus) diet. The effect of inclusion of the two microalgae on biomarkers of oxidative stress, haematological parameters, enzyme activities and growth performance were investigated. The juvenile fish were given 3 distinct treatments with isonitrogenous (35.01-36.57%) and isoenergetic (417.24-422.27 Kcal 100 g - 1) diets containing 50% S. platensis (50SP), 75% S. platensis (75SP), 50% C. vulgaris (50CL), 75% C. vulgaris (75CL) and 100% fishmeal (100% FM) was used as the control diet. The result shows that all the diets substituted with both S. platensis, and C. vulgaris boosted the growth performance based on specific growth rate (SGR) and body weight gain (BDWG) when compared with the control diet. The feed conversion ratio (FCR) and protein efficiency ratio (PER) was significantly influenced by all the supplementations. The haematological analysis of the fish shows a significant increase in the value of red and white blood cells upon supplementation with 50SP and 50CL but decrease slightly when increased to 75SP and 75CL. Furthermore, the value of haematocrit and haemoglobin also increased upon supplementation with 50SP and 50CL but decrease slightly when increased to 75SP and 75CL. The white blood cell (WBC), red blood cell (RBC) increased, while total cholesterol (TCL), and Plasma glucose levels decreased significantly upon supplementation of algae. This is a clear indication that S. platensis and C. vulgaris are a promising replacement for fishmeal, which is a source protein in the C. gariepinus diet. Copyright © 2018 Elsevier Ltd. All rights reserved.

Biological mechanisms of premature ovarian failure caused by psychological stress based on support vector regression

PubMed Central

Wang, Xiu-Feng; Zhang, Lei; Wu, Qing-Hua; Min, Jian-Xin; Ma, Na; Luo, Lai-Cheng

2015-01-01

Psychological stress has become a common and important cause of premature ovarian failure (POF). Therefore, it is very important to explore the mechanisms of POF resulting from psychological stress. Sixty SD rats were randomly divided into control and model groups. Biomolecules associated with POF (β-EP, IL-1, NOS, NO, GnRH, CRH, FSH, LH, E2, P, ACTH, and CORT) were measured in the control and psychologically stressed rats. The regulation relationships of the biomolecules were explored in the psychologically stressed state using support vector regression (SVR). The values of β-EP, IL-1, NOS, and GnRH in the hypothalamus decreased significantly, and the value of NO changed slightly, when the values of 3 biomolecules in the hypothalamic-pituitary-adrenal axis decreased. The values of E2 and P in the hypothalamic-pituitary-ovarian axis decreased significantly, while the values of FSH and LH changed slightly, when the values of the biomolecules in the hypothalamus decreased. The values of FSH and LH in the pituitary layer of the hypothalamic-pituitary-ovarian axis changed slightly when the values of E2 and P in the target gland layer of the hypothalamic-pituitary-ovarian axis decreased. An Imbalance in the neuroendocrine-immune bimolecular network, particularly the failure of the feedback action of the target gland layer to pituitary layer in the pituitary-ovarian axis, is possibly one of the pathogenic mechanisms of POF. PMID:26885082

Changes in soil parameters under continuous plastic mulching in strawberry cultivation

NASA Astrophysics Data System (ADS)

Muñoz, Katherine; Diehl, Dörte; Scopchanova, Sirma; Schaumann, Gabriele E.

2016-04-01

Plastic mulching (PM) is a widely used practice in modern agriculture because they generate conditions for optimal yield rates and quality. However, information about long-term effects of PC on soil quality parameters is scarce. The aim of this study is to compare the effect of three different mulching managements on soil quality parameters. Sampling and methodology: Three different managements were studied: Organic mulching (OM), 2-years PM and 4-years PM. Soil samples were collected from irrigated fields in 0-5, 5-10 and 10-30 cm depths and analyzed for water content (WC), pH, dissolved organic carbon (DOC), total soil carbon (Ctot) and cation exchange capacity (CECeff). Results and discussion: Mulching management has an influence on soil parameters. The magnitude of the effects is influenced by the type (organic agriculture practice vs. plastic mulching practice) and duration of the mulching. PM modified the water distribution through the soil column. WC values at the root zone were in average 10% higher compared to those measured at the topsoil. Under OM, the WC was lower than under PM. The pH was mainly influenced by the duration of the managements with slightly higher values after 4 than after 2-years PM. Under PM, aqueous extracts of the topsoil (0-5 cm depth) contained in average with 8.5±1.8 mg/L higher DOC than in 10-30 cm depth with 5.6±0.5 mg/L, which may indicate a mobilization of organic components in the upper layers. After 4-years PM, Ctot values were slightly higher than after 2-years PM and after OM. Surprisingly, after 4-years PM, CECeff values were with 138 - 157 mmolc/kg almost 2-fold higher than after 2-years PM and OM which had with 74 - 102 mmolc/kg comparable CECeff values. Long-term PM resulted in changes of soil pH and slightly increased Ctot which probably enhanced the CECeff of the soil. However, further investigations of the effect of PM on stability of soil organic matter and microbial community structure are needed.

[Massive transfusion of washed red blood cells: acid-base and electrolyth changes for different wash solutions].

PubMed

Sümpelmann, R; Schürholz, T; Marx, G; Ahrenshop, O; Zander, R

2003-09-01

The composition of normal saline (NaCl), the standard wash solution for cell saver autotransfusion, is considerably different from physiologic plasma values in small infants. Therefore, we investigated acid-base and electrolyte changes during massive cell saver autotransfusion with different wash solutions in young pigs. After approval by the animal protection authorities 15 young pigs (weight 10.6 +/- 1.1 kg, blood volume 848 +/- 88 ml, mean+/-SD) underwent 15 cycles of cell saver autotransfusion (Haemolite 2plus, Haemonetics). For each cycle, 100 ml arterial blood was withdrawn, washed with NaCl, physiologic multielectrolyte solution (PME, V Infusionslösung 296 mval Elektrolyte, Baxter) or physiologic erythrocyte protection solution (PEP, 3.2 % gelatine, pH 7.40, cHCO3 24 mmol/l), and then retransfused. Analyses of acid-base, electrolyte, and hematologic parameters were performed for systemic and washed blood samples. For NaCl there was a progressive decrease in systemic pH, HCO3 and base excess (BE) and an increase in chloride values (Cl) (p < 0.05). Use of PME slightly decreased pH (n. s.), whereas HCO3, BE and Cl remained stable. PEP slightly increased pH, HCO3 and BE, and decreased Cl (n. s.). Free hemoglobin increased in NaCl and PME (p < 0.05) and was below baseline in PEP (n. s.). Lactic acid course was comparable in all groups. The use of NaCl as wash solution for massive autotransfusion resulted in metabolic acidosis caused by dilution of HCO3 and increased Cl values. Fewer systemic acid-base and electrolyte changes were observed, when blood was washed with PME or PEP. The decreased hemoglobin release with PEP is possibly due to a gelatine specific electrostatic surface coating of erythrocyte membranes. For massive transfusion of washed red blood cells, physiologic multielectrolyte solution and physiologic erythrocyte protection solution should be preferred to NaCl, especially for small infants.

Influence of air-drying temperature on drying kinetics, colour, firmness and biochemical characteristics of Atlantic salmon (Salmo salar L.) fillets.

PubMed

Ortiz, Jaime; Lemus-Mondaca, Roberto; Vega-Gálvez, Antonio; Ah-Hen, Kong; Puente-Diaz, Luis; Zura-Bravo, Liliana; Aubourg, Santiago

2013-08-15

In this work the drying kinetics of Atlantic salmon (Salmo salar L.) fillets and the influence of air drying temperature on colour, firmness and biochemical characteristics were studied. Experiments were conducted at 40, 50 and 60°C. Effective moisture diffusivity increased with temperature from 1.08×10(-10) to 1.90×10(-10) m(2) s(-1). The colour difference, determined as ΔE values (from 9.3 to 19.3), as well as firmness (from 25 to 75 N mm(-1)) of dried samples increased with dehydration temperature. The lightness value L(∗) and yellowness value b(∗) indicated formation of browning products at higher drying temperatures, while redness value a(∗) showed dependence on astaxanthin value. Compared with fresh fish samples, palmitic acid and tocopherol content decreased in a 20% and 40%, respectively, with temperature. While eicosapentaenoic acid (EPA) content remained unchanged and docosahexaenoic acid (DHA) content changed slightly. Anisidine and thiobarbituric acid values indicated the formation of secondary lipid oxidation products, which is more relevant for longer drying time than for higher drying temperatures. Copyright © 2013 Elsevier Ltd. All rights reserved.

Just noticeable differences of open quotient and asymmetry coefficient in singing voice.

PubMed

Henrich, Nathalie; Sundin, Gunilla; Ambroise, Daniel; d'Alessandro, Christophe; Castellengo, Michèle; Doval, Boris

2003-12-01

This study aims to explore the perceptual relevance of the variations of glottal flow parameters and to what extent a small variation can be detected. Just Noticeable Differences (JNDs) have been measured for three values of open quotient (0.4, 0.6, and 0.8) and two values of asymmetry coefficient (2/3 and 0.8), and the effect of changes of vowel, pitch, vibrato, and amplitude parameters has been tested. Two main groups of subjects have been analyzed: a group of 20 untrained subjects and a group of 10 trained subjects. The results show that the JND for open quotient is highly dependent on the target value: an increase of the JND is noticed when the open quotient target value is increased. The relative JND is constant: deltaOq/Oq = 14% for the untrained and 10% for the trained. In the same way, the JND for asymmetry coefficient is also slightly dependent on the target value--an increase of the asymmetry coefficient value leads to a decrease of the JND. The results show that there is no effect from the selected vowel or frequency (two values have been tested), but that the addition of a vibrato has a small effect on the JND of open quotient. The choice of an amplitude parameter also has a great effect on the JND of open quotient.

Analysis of benchmark critical experiments with ENDF/B-VI data sets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hardy, J. Jr.; Kahler, A.C.

1991-12-31

Several clean critical experiments were analyzed with ENDF/B-VI data to assess the adequacy of the data for U{sup 235}, U{sup 238} and oxygen. These experiments were (1) a set of homogeneous U{sup 235}-H{sub 2}O assemblies spanning a wide range of hydrogen/uranium ratio, and (2) TRX-1, a simple, H{sub 2}O-moderated Bettis lattice of slightly-enriched uranium metal rods. The analyses used the Monte Carlo program RCP01, with explicit three-dimensional geometry and detailed representation of cross sections. For the homogeneous criticals, calculated k{sub crit} values for large, thermal assemblies show good agreement with experiment. This supports the evaluated thermal criticality parameters for U{supmore » 235}. However, for assemblies with smaller H/U ratios, k{sub crit} values increase significantly with increasing leakage and flux-spectrum hardness. These trends suggest that leakage is underpredicted and that the resonance eta of the ENDF/B-VI U{sup 235} is too large. For TRX-1, reasonably good agreement is found with measured lattice parameters (reaction-rate ratios). Of primary interest is rho28, the ratio of above-thermal to thermal U{sup 238} capture. Calculated rho28 is 2.3 ({+-} 1.7) % above measurement, suggesting that U{sup 238} resonance capture remains slightly overpredicted with ENDF/B-VI. However, agreement is better than observed with earlier versions of ENDF/B.« less

Comparison of the effects of selected chalcones, dihydrochalcones and some cyclic flavonoids on mitochondrial outer membrane determined by fluorescence spectroscopy.

PubMed

Tomecková, Vladimíra; Guzy, Juraj; Kusnír, Jaroslav; Fodor, Krisztina; Mareková, Mária; Chavková, Zenóbia; Perjési, Pál

2006-11-30

The effect on mitochondrial outer membrane of 4-hydroxychalcone (1), the cyclic chalcone analogues E-2-(4'-hydroxybenzylidene)-1-indanone (2a) and E-2-(4'-hydroxybenzylidene)-1-tetralone (2b), the dihydrochalcones phloretin (3a) and phloridzin (3b), the flavanones naringenin (4a) and naringin (4b), and the flavonol quercetin (5) was investigated by fluorescence spectroscopy. Excitation and emission fluorescence spectra of each flavonoid and synthetic analogue were recorded in respiration medium containing 1 mM succinate. Initial interaction of the compounds with the outer mitochondrial membrane was investigated by recording their fluorescence polarization in the presence of rat liver mitochondria. Most of the compounds displayed an elevated fluorescence polarization on mixing with mitochondria at the zero time point. During the investigated 20 min period the initial fluorescence polarization values remained constant (1, 2a), or a gradual depression of the measured polarization values could be observed (2b, 3a, 4b, 5). In the case of naringenin (4a), however, similar to the previously investigated seven-membered cyclic chalcone analogue E-2-(4 -methoxybenzylidene)-1-benzosuberone, a slight, continuous increase of fluorescence polarization could be detected during the 20 min experiment. Phloridzin (3b) showed an increased fluorescence polarization in first 10 min, which was slightly depressed by the 20 min time point.

Simulation of the process kinetics and analysis of physicochemical properties in the freeze drying of kale

NASA Astrophysics Data System (ADS)

Dziki, Dariusz; Polak, Renata; Rudy, Stanisław; Krzykowski, Andrzej; Gawlik-Dziki, Urszula; Różyło, Renata; Miś, Antoni; Combrzyński, Maciej

2018-01-01

Investigations were performed to study the freeze-drying process of kale (Brassica oleracea L. var acephala). The process of freeze-drying was performed at temperatures of 20, 40, and 60°C for whole pieces of leaves and for pulped leaves. The kinetics of the freeze-drying of both kale leaves and kale pulp were best described by the Page model. The increasing freeze-drying temperature from 20 to 60°C induced an approximately two-fold decrease in the drying time. Freeze-drying significantly increased the value of the lightness, delta Chroma, and browning index of kale, and had little influence on the hue angle. The highest increase in the lightness and delta Chroma was observed for whole leaves freeze-dried at 20°C. An increase in the drying temperature brought about a slight decrease in the lightness, delta Chroma and the total colour difference. Pulping decreased the lightness and hue angle, and increased browning index. Freeze-drying engendered a slight decrease in the total phenolics content and antioxidant activity, in comparison to fresh leaves. The temperature of the process and pulping had little influence on the total phenolics content and antioxidant activity of dried kale, but significantly decreased the contents of chlorophyll a and chlorophyll b.

Comparison of platelet function between sedentary individuals and competitive athletes at rest.

PubMed

Lippi, Giuseppe; Montagnana, Martina; Salvagno, Gian Luca; Franchini, Massimo; Guidi, Gian Cesare

2006-08-17

There are controversial evidences on the effect of different types and workloads of physical exercise on primary hemostasis. In particular, little is known on the chronic influence of a strenuous and regular aerobic training regimen on platelet function. The aim of this investigation was to compare platelet function between sedentary controls and trained athletes at rest and to evaluate whether a greater amount of exercise performed in professional cyclists may contribute to increased platelet chronic responsiveness compared to both elite cyclists and sedentary individuals. Platelet's ability to adhere and aggregate was assayed following a 12-24 h resting period in 49 active professional male road cyclists, 40 elite male cyclists and 43 matched sedentary healthy male volunteers, by the platelet function analyzer 100 (PFA-100). Mean values of the collagen-epinephrine test did not differ between controls and athletes (sedentary controls: 111 +/- 33 s; elite athletes: 113 +/- 26 s, p = 0.93; professional athletes: 120 +/- 33 s; p = 0.33), whereas mean values of the collagen-ADP test displayed a slightly but significant trend towards decreased values when comparing sedentary controls (83 +/- 21 s) with either elite (77 +/- 11 s, p < 0.01) or professional (75 +/- 16 s, p < 0.01) athletes. The trend towards slightly lower collagen-ADP values are suggestive for a modest but significant chronic activation of primary hemostasis, highlighting the need to set appropriate reference ranges for the PFA-100 when evaluating primary hemostasis in physically active subjects.

Blood pressure variability in man: its relation to high blood pressure, age and baroreflex sensitivity.

PubMed

Mancia, G; Ferrari, A; Gregorini, L; Parati, G; Pomidossi, G; Bertinieri, G; Grassi, G; Zanchetti, A

1980-12-01

1. Intra-arterial blood pressure and heart rate were recorded for 24 h in ambulant hospitalized patients of variable age who had normal blood pressure or essential hypertension. Mean 24 h values, standard deviations and variation coefficient were obtained as the averages of values separately analysed for 48 consecutive half-hour periods. 2. In older subjects standard deviation and variation coefficient for mean arterial pressure were greater than in younger subjects with similar pressure values, whereas standard deviation and variation coefficient for mean arterial pressure were greater than in younger subjects with similar pressure values, whereas standard deviation aations and variation coefficient were obtained as the averages of values separately analysed for 48 consecurive half-hour periods. 2. In older subjects standard deviation and variation coefficient for mean arterial pressure were greater than in younger subjects with similar pressure values, whereas standard deviation and variation coefficient for heart rate were smaller. 3. In hypertensive subjects standard deviation for mean arterial pressure was greater than in normotensive subjects of similar ages, but this was not the case for variation coefficient, which was slightly smaller in the former than in the latter group. Normotensive and hypertensive subjects showed no difference in standard deviation and variation coefficient for heart rate. 4. In both normotensive and hypertensive subjects standard deviation and even more so variation coefficient were slightly or not related to arterial baroreflex sensitivity as measured by various methods (phenylephrine, neck suction etc.). 5. It is concluded that blood pressure variability increases and heart rate variability decreases with age, but that changes in variability are not so obvious in hypertension. Also, differences in variability among subjects are only marginally explained by differences in baroreflex function.

Quantitative characterization of brazing performance for Sn-plated silver alloy fillers

NASA Astrophysics Data System (ADS)

Wang, Xingxing; Peng, Jin; Cui, Datian

2017-12-01

Two types of AgCuZnSn fillers were prepared based on BAg50CuZn and BAg34CuZnSn alloy through a combinative process of electroplating and thermal diffusion. The models of wetting entropy and joint strength entropy of AgCuZnSn filler metals were established. The wetting entropy of the Sn-plated silver brazing alloys are lower than the traditional fillers, and its joint strength entropy value is slightly higher than the latter. The wetting entropy value of the Sn-plated brazing alloys and traditional filler metal are similar to the change trend of the wetting area. The trend of the joint strength entropy value with those fillers are consisted with the tensile strength of the stainless steel joints with the increase of Sn content.

Methionine sulfone-containing orbitides, good indicators to evaluate oxidation process of flaxseed oil.

PubMed

Zou, Xian-Guo; Hu, Jiang-Ning; Zhu, Xue-Mei; Wang, Yu-Fu; Deng, Ze-Yuan

2018-06-01

This study aimed to explore the possibility of using methionine sulfone (Msn)-containing orbitides as indicators to evaluate the oxidation process of flaxseed oils. Results showed that after 4 days' heating, oxidation values slightly increased (p > .05) with significant decrease in methionine (Met)-containing peptides (p < .05) instead of γ-tocopherol (p > .05). However, as oxidation time continues increasing, oxidation values significantly increased (p < .05) with significant reduction of γ-tocopherol (p < .05). It demonstrated that Met-containing peptides were more readily oxidized compared with γ-tocopherol and showed certain antioxidant activity. Besides, high logarithmic correlations were found between oxidation values and Msn-containing orbitides (0.94-1.00), such as between total carbonyl compounds and orbitide [1-8-NαC],[1-MetO 2 ]-CLE (64.95 lnx - 52.14, R 2  = 0.99, Dingya23 oil). Therefore, in comparison with common oxidation indices, Msn-containing orbitides may be better indicators for evaluating the oxidation process of flaxseed oil with superior separation efficiency, specific information and high stability. Copyright © 2018 Elsevier Ltd. All rights reserved.

Experimental and numerical study of the effect of rolling parameters on shaft deformation during the longitudinal rolling process

NASA Astrophysics Data System (ADS)

Kowalik, Marek; Trzepiecinski, Tomasz

2018-05-01

This paper presents the characteristics of the process of longitudinal rolling of shafts and the geometry of the working section of forming rollers with a secant profile. In addition, the analytical formulae defining the geometry of a roller profile were determined. The experiments were carried out on shafts made of S235JR and C45 structural steels and the MSC.Marc + Mentat program was used for the numerical analysis of the rolling process based on the finite element method. The paper analyses the effect of roller geometry on the changes in value of the widening coefficient and the diameter reduction coefficient for the first forming passage. It was found that the mechanical properties of the shaft material have a slight influence on the widening coefficient. The value of the widening coefficient of the shaft increases with increase in the initial diameter of the shaft. Increasing shaft diameter causes an increase of strain gradient on the cross-section of the shaft.

Physical Properties of Synthetic Resin Materials

NASA Technical Reports Server (NTRS)

Fishbein, Meyer

1939-01-01

A study was made to determine the physical properties of synthetic resins having paper, canvas, and linen reinforcements, and of laminated wood impregnated with a resin varnish. The results show that commercial resins have moduli of elasticity that are too low for structural considerations. Nevertheless, there do exist plastics that have favorable mechanical properties and, with further development, it should be possible to produce resin products that compare favorably with the light-metal alloys. The results obtained from tests on Compound 1840, resin-impregnated wood, show that this material can stand on its own merit by virtue of a compressive strength four times that of the natural wood. This increase in compressive strength was accomplished with an increase of density to a value slightly below three times the normal value and corrected one of the most serious defects of the natural product.

Acute Oral Toxicity of Trimethylolethane Trinitrate (TMETN) in Sprague- Dawley Rats

DTIC Science & Technology

1989-07-01

classification scheme of Hodge and Steiner, these results indicate that TMETN is a slightly toxic compound.1 20. ON-RIBUTION /AVAILABILITY OF ABSTRACT 21. ABSTRACT...the classification scheme of Hodge and Sterner, these results indcate that TMETN is a slightly toxic compound. KEY WORDS: Acute Oral Toxicit-y...Dawley rats and 1027.4 63.7 mg/kg in female Sprague-Dawley rats. These MLD values place TMETN in the "slightly toxic" range by the system of Hodge and

Transition from one revolving cluster to two revolving clusters in the ground-state rotational bands of nuclei in the lanthanon region.

PubMed

Pauling, L

1991-02-01

Whereas 234(92)U142 and other actinon nuclei have ground-state bands that indicate that each nucleus consists of a sphere and a single revolving cluster with constant composition and with only a steady increase in the moment of inertia with increase in J, the angular-momentum quantum number, many of the lanthanon ground-state bands show discontinuities, usually with an initial slightly or strongly curved segment followed by one or two nearly straight segments. The transition to nearly straight segments is interpreted as a change in structure from one revolving cluster to two revolving clusters. The proton-neutron compositions of the clusters and the central sphere are assigned, leading to values of the radius of revolution. The approximation of the two-cluster sequences to linearity is attributed to the very small values of the quadrupole polarizability of the central sphere. Values of the nucleon numbers of clusters and spheres, of the radius of revolution, and of promotion energy are discussed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gavriliuk, A.G.; Struzhkin, V.V.; Lyubutin, I.S.

The magnetic behavior of a Bi{sup 57}FeO{sub 3} powdered sample was studied at high pressures by the method of nuclear forward scattering (NFS) of synchrotron radiation. The NFS spectra from {sup 57}Fe nuclei were recorded at room temperature under high pressures up to 61.4 GPa, which were created in a diamond anvil cell. In the pressure interval 0 < P < 47 GPa, the magnetic hyperfine field H{sup Fe} at the {sup 57}Fe nuclei increased reaching a value of {approx}52.5 T at 30 GPa, and then it slightly decreased to {approx}49.6 T at P = 47 GPa. As the pressuremore » was increased further, the field H{sup Fe} abruptly dropped to zero testifying a transition from the antiferromagnetic to a nonmagnetic state (magnetic collapse). In the pressure interval 47 < P < 61.4 GPa, the value of H{sup Fe} remained zero. The field H{sup Fe} recovered to the low-pressure values during decompression.« less

Structure and optical properties of ZnO produced from microwave hydrothermal hydrolysis of tris(ethylenediamine)zinc nitrate complex

NASA Astrophysics Data System (ADS)

Mostafa, Nasser Y.; Heiba, Zein K.; Ibrahim, Mohamed M.

2015-01-01

ZnO powders were synthesized using a solution microwave hydrothermal hydrolysis process and tris(ethylenediamine)zinc nitrate {[Zn(en)3](NO3)2} (en = ethylenediamine) as a precursor. Hydrolysis of the precursor complex at different pH produced zinc oxide with a diversity of well-defined morphologies. The effect of hydrolysis pH values on the structural and optical properties has been explored using XRD, SEM, and UV-visible diffuse reflectance spectroscopy (DRS). At pH = 7.0, randomly dispersed rods were formed. Whereas flower-like morphologies were obtained by treating the complex precursor in water at pH = 10.0 and 12.0. The ZnO4 tetrahedrons are greatly affected by the pH value. The band gap decreased sharply with increasing the pH value from 7.0 to 10.0, then slightly decreased with further increasing the pH to 12.0. The relationship between band gap and both structure and surface defects of the samples is also discussed.

[Lung dysfunction in patients with mild chronic obstructive bronchitis].

PubMed

Nefedov, V B; Popova, L A; Shergina, E A

2004-01-01

VC, FVC, FEV1, FEV1/VC%, PEF, MEF25, MEF50, MEF75, TCL, TGV, RV, Ravt, Riin, Rex, DLCO-SS, PaO2, and PaO2 were determined in 33 patients with mild chronic obstructive lung disease (FEV1 > 70% of the normal value). All the patients were found to have impaired bronchial patency; most (63.6%) patients had lung volume and capacity changes, almost half (45.5%) the patients had pulmonary gas exchange dysfunction. Impaired bronchial patency mainly appeared as decreased MEF50, MEF15, and FEV1/VC%; altered lung volumes and capacities manifested chiefly by increased RV and decreased VC; pulmonary gas exchange dysfunction showed up primarily as lowered PaO2. The magnitude of the observed functional changes was generally slight. MEF50, MEF75, FEV1/VC%, and VC dropped to 59-20 and 79-70% of the normal value, respectively. RV increased up to 142-196% of the normal value; PaO2 reduced up to 79-60% mm Hg.

Using geochemical and isotopic techniques for exploration of geothermal energy in Southern Sabalan geothermal field, NW Iran

NASA Astrophysics Data System (ADS)

Masoumi, Rahim

2017-04-01

From a hydrogeochemical point of view the geothermal fluids in the study area can be divided into two categories, (1) Na-Cl and (2) Na-Ca-HCO3. In the study area, the hot water samples depict temperature and pH ranges of 22 °C to 77 °C and 6.4 to 7.3, respectively. The total dissolved solids vary from 456 mg/L to 7006 mg/L. The concentration of rare metallic and non-metallic elements such as Li, Rb, B, Ba, Sr, CS, Se, Al, As, Hg in cold and hot spring waters in the Bushdi area were also analyzed. The utmost concentration belongs to Se which ranges from 135 mg/L to 273 mg/L. Boron also shows notable concentration values, in most samples it exceeds 20 mg/L, and in certain samples it ranges from 28 mg/L to 33.5 mg/L. The concentration value of arsenic ranges from 3 mg/L to 4 mg/L. The maximum concentration value of mercury is 0.01 mg/L. The δ18O values of these samples vary from -12.4 ‰ to -7.5 ‰ and the δD values range from -78.6 ‰ to -70.6 ‰. Plotting δ18O versus δD demonstrates that the data points are clustered close to both, the global meteoric water line (GMWL) with the equation δD = 8 δ18O + 10 and, the national meteoric water line (NMWL) with the equation δD = 6.89 δ18O + 6.57. As can be observed, the geothermal fluids in the Bushdi area show relatively slight increase in δ18O values that may be caused by interaction of hot fluids with host volcanic rocks. In fact, this relatively slight increment in δ18O values may indicate the low to moderate temperature of the geothermal system. The δD values, in general, do not show notable variation because of very low hydrogen content of the host rocks. The slight increase in δD, however, may be in conjunction with vaporization and isotopic interaction with the host rocks. The 3H content of the cold and hot waters in the Bushdi area is relatively high and varies from 0.65 TU to 41.4 TU. This may be caused either by mixing with meteoric sources or rapid fluid flow within the system in a shorter time than the β- disintegration of the isotope 3H. The δ18O versus δD diagram demonstrates that the data for the Bushdi area is plotted in three distinct domains, a, b, c. In a, the 3H content is > 10 TU indicating these waters being modern waters. Domain b belongs to samples whose 3H values are within the range of 1 TU to 10 TU being temporally categorized as sub-modern waters. The water samples in c possess 3H values < 1 TU indicating the oldest waters within the geothermal system in the study area. Key words: Geothermal fluids, Stable isotopes, Tracemetals, Sabalan volcano.

Erythrocyte fluorescence and lead intoxication.

PubMed Central

Clark, K G

1976-01-01

Blood samples from people exposed to inorganic lead were examined by fluorescence microscopy for excess erythrocyte porphyrin. With continued lead absorption, fluorescent erythrocytes appeared in the circulation of workers handling this metal or its compounds, and they progressively increased in number and brilliance. These changes ensued if the blood lead concentration was maintained above 2-42 mumol/l (50 mug/100 ml), and preceded any material fall in the haemoglobin value. At one factory, 62-5% of 81 symptomless workers showed erythrocyte fluorescence attributable to the toxic effects of lead. Excess fluorocytes were found in blood samples from a child with pica and three of her eight siblings. These four were subsequently shown to have slightly increased blood lead concentrations (2-03 to 2-32 mumol/l). Fluorescence microscopy for excess erythrocyte porphyrin is a sensitive method for the detection of chronic lead intoxication. A relatively slight increase in the blood lead is associated with demonstrabel changes in erythrocyte porphyrin content. The procedure requires little blood, and may be performed upon stored samples collected for lead estimation. The results are not readily influenced by contamination, and provide good confirmatory evidence for the absorption of biochemically active lead. PMID:963005

Protein C

MedlinePlus

... Normal Results Normal values are 60% to 150% inhibition. Normal value ranges may vary slightly among different ... Health Solutions. About MedlinePlus Site Map FAQs Customer Support Get email updates Subscribe to RSS Follow us ...

Protein S

MedlinePlus

... Normal Results Normal values are 60% to 150% inhibition. Normal value ranges may vary slightly among different ... Health Solutions. About MedlinePlus Site Map FAQs Customer Support Get email updates Subscribe to RSS Follow us ...

Properties of nanocomposite PP fibres

NASA Astrophysics Data System (ADS)

Smole, Majda S.; Stakne, Kristina; Svetec, Diana G.; Kleinschek, Karin S.; Ribitsch, Volker

2005-06-01

PP-based nanocomposite fibres were prepared by direct polymer melt intercalation. With the intention to determine the size and dispersion of nanoparticles in the polymer matrix, fibres were plasma etched and SEM observations were performed. The influence of nanofiller content and coupling agent on electrokinetic properties was studied. PP monofilament fibres exhibit hydrophobe character with negative zeta potential value. The zeta potential value of co-polymer PP fibre decreases with increasing PPAA content and the isoelectric point IEP of co-polymer samples shifts towards acid region. Addition of modified montmorillonite due to the particles electropositive character, affects the reduction of zeta potential value and a slight shift of IEP towards neutral region is observed. Nano-particles content influences electrokinetic fibres properties, i.e. ZP value is changed, however IE point is not significantly changed by different concentrations of nanofiller. In addition to, mechanical properties of nanocomposite fibres were determined.

Effect of hemodialysis on factors influencing oxygen transport.

PubMed

Hirszel, P; Maher, J F; Tempel, G E; Mengel, C E

1975-06-01

Ten patients underwent 4 study hemodialyses, one with standard dialysis conditions, one with an isophosphate dialysate, one with simultaneous ammonium chloride loading, and other, after pretreatment, with sodium bicarbonate. Measurement of hemoglobin oxygen affinity (P-50), erythrocyte 2,3-DPG, blood-gasses, and serum chemistries revealed biochemically effective hemodialyses and slight changes in oxygen transport parameters. The P-50 (in vivo) values decreased slightly but significantly (p greater than 0.05) with dialysis. When corrected to pH 7.4, eliminating the Bohr effect, P-50 increased (p greater than 0.05). With unmodified dialysis elevated values of 2,3-DPG (in comparison to normal) decreased, a change that did not correlate with delta-p-50, delta-serum phosphate, or delta-serum creatinine. With standard and isophosphate dialyses Po-2 decreased significantly. The decrease correlated with delta-hydrogen ion concentration and did not occur with dialyses designed to maintain pH constant. Thus, hemodialysis influences many factors that affect oxygen transport in different and counterbalancing directions. These changes are not totally explained by alterations in 2,3-DPG, pH or serum phosphate. Maintenance of acidosis or hyperphosphatemia during dialysis is not recommended.

Plasma vasopressin and renin activity in women exposed to bed rest and +G/z/ acceleration

NASA Technical Reports Server (NTRS)

Keil, L. C.; Ellis, S.

1976-01-01

To study the effect of prolonged recumbency on plasma vasopressin and renin activity, eight women were subjected to 17 days of absolute bed rest. The tolerance to +3G vertical acceleration of the subjects was tested before and after 14 days of bed rest. From day 2 and through day 17 of bed rest, plasma arginine vasopressin (AVP) levels were reduced 33%. Plasma renin activity (PRA) increased 91% above ambulatory control values from days 10 through 15 of bed rest. When compared to precentrifuge values, exposure to vertical acceleration prior to bed rest provoked a 20-fold rise in mean plasma AVP but resulted in only a slight increase in PRA. After bed rest, acceleration increased plasma AVP 7-fold; however, the magnitude of this increase was less than the post +3G acceleration value obtained prior to bed rest. After bed rest, no significant rise was noted in PRA following +3G acceleration. This study demonstrates that prolonged bed rest leads to a significant rise in the PRA of female subjects, while exposure to positive vertical acceleration provokes a marked rise in plasma AVP.

Contamination levels of mercury in the muscle of female and male spiny dogfishes (Squalus acanthias) caught off the coast of Japan.

PubMed

Endo, Tetsuya; Hisamichi, Yohsuke; Kimura, Osamu; Kotaki, Yuichi; Kato, Yoshihisa; Ohta, Chiho; Koga, Nobuyuki; Haraguchi, Koichi

2009-11-01

We analyzed the total mercury (T-Hg) and stable isotopes of (13)C and (15)N in the muscle of spiny dogfish (Squalus acanthias) caught off the coast of Japan. The average body length of the female spiny dogfish sampled (94.9+/-20.2 cm, 50.5-131.0 cm, n=40) was significantly larger than that of the males sampled (77.8+/-10.8 cm, 55.5-94.0 cm, n=35), although the ages of the samples were unknown. The T-Hg concentration in the muscle samples rapidly increased after maturity in the females (larger than about 120 cm) and males (larger than about 90 cm), followed by a continued gradual increase. Contamination level of T-Hg in female muscle samples (0.387+/-0.378 microg(wet g)(-1), n=40) was slightly higher than that in male muscle samples (0.316+/-0.202 microg(wet g)(-1), n=35), probably due to the greater longevity of females. In contrast, the contamination level of T-Hg in females smaller than 94.0 cm in length (0.204+/-0.098 microg(wet g)(-1), n=20) was slightly lower than that in the males, probably due to the faster growth rate of females. Although the partial differential(13)C and partial differential(15)N values in the muscle samples increased with an increase in body length, there were no significant differences between the females (-17.2+/-0.4 per thousand and 12.4+/-0.9 per thousand, respectively) and males (-17.3+/-0.4 per thousand and 12.4+/-0.8 per thousand, respectively). A positive correlation was found between partial differential(13)C and partial differential(15)N values, suggesting trophic enrichment due to the growth.

Effect of 400 ml blood loss on adaptation of certain functions of the organism to exercise.

PubMed

Markiewicz, K; Cholewa, M; Górski, L; Jaszczuk, J; Chmura, J; Bartniczak, Z

1981-01-01

Eighteen men aged 19-23 years, volunteer blood donors, donated 400 ml of blood. Twenty-four hours before donation, one hour and 24 hours after it they performed a 10-minute exercise on Monark cycle ergometer at workloads raising the heart rate to 170/min. During the exercise the oxygen uptake (VO2), carbon dioxide elimination (VCO2), respiratory quotient (RQ), oxygen uptake to maximal oxygen uptake ratio (VO2/VO2 max), heart rate (HR) and systolic and diastolic arterial blood pressure (Ps and Pd) were determined. The obtained results were compared with the values of haemoglobin concentration and erythrocyte count. One hour after blood donation raised values of HR and Pd were obtained (p less than 0.05) with decreased Ps (p less than 0.05) and VO2 (p less than 0.05). Twenty-four hours after blood loss these parameters were not different from the initial ones (p less than 0.05). Submaximal exercise performed 1 hour after blood loss produced a significantly greater increase of the heart rate than this exercise performed before blood loss. The values of VO2, VCO2, and VO2/VO2 max were slightly lower and those of RQ and HRXPs slightly higher than during control exercise (p less than 0.05). Exercise performed 24 hours after blood loss caused identical changes in these parameters as during control tests.

The influence of natural short photoperiodic and temperature conditions on plasma thyroid hormones and cholesterol in male Syrian hamsters

NASA Astrophysics Data System (ADS)

Vaughan, M. K.; Brainard, G. C.; Reiter, R. J.

1984-09-01

Adult male Syrian hamsters were subjected to 1, 3, 5, 7 or 11 weeks of either natural winter conditions or rigorously controlled laboratory conditions (LD 10∶14; 22 ± 2‡C). Although both groups of hamsters gained weight over the course of the experiment, hamsters housed indoors were significantly heavier after 5 weeks of treatment compared to their outdoors counterparts. Animals housed under natural conditions exhibited a significant decrease in circulating levels of thyroxine (T4) and a rapid rise in triiodothyronine (T3) levels; the free T4 and free T3 index (FT4I and FT3I) mirrored the changes in circulating levels of the respective hormones. Laboratory-housed animals had a slight rise in T4 and FT4I at 3 weeks followed by a slow steady decline in these values; T3 and FT3I values did not change remarkably in these animals. Plasma cholesterol declined steadily over the course of the experiment in laboratory-maintained animals but increased slightly during the first 5 weeks in animals under natural conditions. Since the photoperiodic conditions were approximately of the same duration in these 2 groups, it is concluded that the major differences in body weight, thyroid hormone values and plasma cholesterol are due to some component (possibly temperature) in the natural environment.

Measurement of thermal neutrons reflection coefficients for two-layer reflectors.

PubMed

Azimkhani, S; Zolfagharpour, F; Ziaie, F

2018-05-01

In this research, thermal neutrons albedo coefficients and relative number of excess counts have been measured experimentally for different thicknesses of two-layer reflectors by using 241 Am-Be neutron source (5.2Ci) and BF 3 detector. Our used reflectors consist of two-layer which are combinations of water, graphite, polyethylene, and lead materials. Experimental results reveal that thermal neutron reflection coefficients slightly increased by addition of the second layer. The maximum value of growth for thermal neutrons albedo is obtained for lead-polyethylene compound (0.72 ± 0.01). Also, there is suitable agreement between the experimental values and simulation results by using MCNPX code. Copyright © 2018 Elsevier Ltd. All rights reserved.

An Archeological Survey at Fort Devens, Massachusetts and Its Off-Base Facilities.

DTIC Science & Technology

1983-08-01

tundra regions, pine pollen blown on to the tundra from distant forests could provide as much as 20% of the pollen deposited. As woodland and forest...vegetation moved into the area more pine pollen was produced, but since ’ "" 11 there also were greater numbers of other pollen types, the percentage...value of pine only increased slightly (Davis 1969:326). API techniques have, in later profiles, clarified this confusion in the pollen record. The use of

Influence of deformation behavior, oxydation, and temperature on the long time cyclic stress behavior of high temperature steels

NASA Technical Reports Server (NTRS)

Maile, K.

1982-01-01

The influence of different parameters on the creep-fatigue behavior of several steel alloys was investigated. The higher the temperature the lower the crack initiation value. Pauses during the cycle reduce the damage. Oxidation reduces and protective gas increases the lifetime. Prior loading and prior deformation reduce the lifetime. Short annealing slightly affects the cycle stress behavior. The test results do not satisfactorily agree with methods of extrapolation and damage accumulation.

Detritus utilization by Mytilus edulis

NASA Astrophysics Data System (ADS)

Williams, Phil

1981-06-01

Feeding expriments showed that salt marsh vascular plant detritus is a poor food for Mytilus edulis. In laboratory experiment tissue weight of mussels increased slightly when Spartina foliosa and Salicornia virginica detritus was added to background seawater rich in organic matter. However, mussels lost weight when detritus was added to background seawater with a lower organic matter content. Aged and unaged plant material were equally poor in food value for M. edulis. Mussels in the Tijuana Estuary grew substantially during the period of the laboratory experiments.

Japanese and Taiwanese pelagic longline fleet dynamics and the impacts of climate change in the southern Indian Ocean

NASA Astrophysics Data System (ADS)

Michael, P. E.; Wilcox, C.; Tuck, G. N.; Hobday, A. J.; Strutton, P. G.

2017-06-01

Climate change is projected to continue shifting the distribution of marine species, leading to changes in local assemblages and different interactions with human activities. With regard to fisheries, understanding the relationship between fishing fleets, target species catch per unit effort (CPUE), and the environment enhances our ability to anticipate fisher response and is an essential step towards proactive management. Here, we explore the potential impact of climate change in the southern Indian Ocean by modelling Japanese and Taiwanese pelagic longline fleet dynamics. We quantify the mean and variability of target species CPUE and the relative value and cost of fishing in different areas. Using linear mixed models, we identify fleet-specific effort allocation strategies most related to observed effort and predict the future distribution of effort and tuna catch under climate change for 2063-2068. The Japanese fleet's strategy targets high-value species and minimizes the variability in CPUE of the primary target species. Conversely, the Taiwanese strategy indicated flexible targeting of a broad range of species, fishing in areas of high and low variability in catch, and minimizing costs. The projected future mean and variability in CPUE across species suggest a slight increase in CPUE in currently high CPUE areas for most species. The corresponding effort projections suggest a slight increase in Japanese effort in the western and eastern study area, and Taiwanese effort increasing east of Madagascar. This approach provides a useful method for managers to explore the impacts of different fishing and fleet management strategies for the future.

Aging stability of complete blood count and white blood cell differential parameters analyzed by Abbott CELL-DYN Sapphire hematology analyzer.

PubMed

Hedberg, P; Lehto, T

2009-02-01

This study presents the results of an aging stability study of complete blood count (CBC) and leukocyte differential parameters using the Abbott CELL-DYN Sapphire hematology analyzer. Stability studies showed no substantial change in CBC parameters up to 24-48 h at +23 +/- 2 degrees C (room temperature), except for optical platelet count (PLTo). For specimens aged over 24, the value of impedance platelet count yielded more reliable results than the routine PLTo. White blood cell (WBC) differential parameters, except eosinophils, were stable for up to 48 h at +23 +/- 2 degrees C. CBC parameters were stable for 72 h, except mean platelet volume, which slightly increased between 48 and 72 h, at +4 degrees C. WBC differentials were stable 48-72 h, with a slight decrease observed in absolute neutrophils and lymphocytes at +4 degrees C.

Influence of slight to moderate risk for birth hypoxia on acquisition of cognitive and language function in the preterm infant: a cross-sectional comparison with preterm-birth controls.

PubMed

Hopkins-Golightly, Tracy; Raz, Sarah; Sander, Craig J

2003-01-01

The cognitive and language performance of a group of 26 preterm-birth preschool and early school-age children with slight to moderate risk for perinatal hypoxia was compared with the performance of a preterm-birth comparison group of 26 children. Despite the relatively small discrepancy in degree of risk, the cognitive performance of the 2 groups diverged significantly. When data for children with known perinatal arterial pH were combined, a curvilinear (quadratic) regression model provided the best fit. Increasing acidosis was linearly related to decreases in cognitive skills, with the bend in the curve occurring well within the normal range of pH values. Hence, in the preterm infant, even minor risk for birth hypoxia may result in discernible deviation from the expected developmental trajectory.

Motivations of female Black Hills deer hunters

USGS Publications Warehouse

Gigliotti, Larry M.; Covelli Metcalf, Elizabeth

2016-01-01

State fish and wildlife agencies are particularly interested in attracting female participation because of the potential to offset declining participation in hunting. Understanding female hunters’ motivations will be critical for designing effective recruitment and retention programs for women hunters. Although female participation in hunting is increasing, males still outnumber females by about tenfold. Gender differences in deer hunters were explored by comparing ratings of eight motivations (social, nature, excitement, meat, challenge, trophy, extra hunting opportunity, and solitude). Hunter types were defined by hunters’ selection of the most important motivation for why they like Black Hills deer hunting. Overall, females and males were relatively similar in their ratings of the eight motivations, and we found 85% gender similarity in the selection of the most important motivation. Women were slightly more motivated by the food aspect of the hunt while men placed slightly more value on the hunt as a sporting activity.

Panic disorder: a review of DSM-IV panic disorder and proposals for DSM-V.

PubMed

Craske, Michelle G; Kircanski, Katharina; Epstein, Alyssa; Wittchen, Hans-Ulrich; Pine, Danny S; Lewis-Fernández, Roberto; Hinton, Devon

2010-02-01

This review covers the literature since the publication of DSM-IV on the diagnostic criteria for panic attacks (PAs) and panic disorder (PD). Specific recommendations are made based on the evidence available. In particular, slight changes are proposed for the wording of the diagnostic criteria for PAs to ease the differentiation between panic and surrounding anxiety; simplification and clarification of the operationalization of types of PAs (expected vs. unexpected) is proposed; and consideration is given to the value of PAs as a specifier for all DSM diagnoses and to the cultural validity of certain symptom profiles. In addition, slight changes are proposed for the wording of the diagnostic criteria to increase clarity and parsimony of the criteria. Finally, based on the available evidence, no changes are proposed with regard to the developmental expression of PAs or PD. This review presents a number of options and preliminary recommendations to be considered for DSM-V.

Experience with single photon emission computerized tomography (SPECT) in follow-up of sternotomy healing.

PubMed

Harjula, A; Järvinen, A; Mattila, S; Porkka, L

1985-01-01

Single photon emission computerized tomography (SPECT) was performed thrice in ten patients undergoing open-heart surgery--preoperatively and 2 and 12 weeks postoperatively. The operations were done for ischemic heart disease (5), aortic valvular stenosis (2), aortic valvular insufficiency (1), leaking mitral prosthetic valve (1) and combined aortic and mitral valvular stenosis and insufficiency (1). The healing process in the longitudinally divided sternum was evaluated from the SPECT study. Four conventional static images in two dimensions were registered in anteroposterior, posteroanterior and left and right lateral projections. A tomographic study was done. Quantitative analyses were performed. The ratio of the sternal counts to the counts from a thoracic vertebra was calculated for use as a reference. The activity ratios showed a similar pattern in six cases, with initial increases and at 12 weeks slight decrease compared with the preoperative values. In two cases the activity was still increasing after 12 postoperative weeks. One patient, with sternotomy also one year previously, showed only slightly increased activity. The activity at the areas of the sternal wires was increased in six cases. The study thus revealed differing patterns of isotope uptake, although recovery was uneventful in all patients. The differences may reflect the possibility that the operative course and the preoperative clinical status can influence the healing mechanisms.

Lactate dehydrogenase test

MedlinePlus

Normal value range is 105 to 333 international units per liter (IU/L). Normal value ranges may vary slightly among different laboratories. Some labs use different measurements or test different samples. Talk to your provider about ...

A database for propagation models

NASA Technical Reports Server (NTRS)

Kantak, Anil V.; Suwitra, Krisjani; Le, Choung

1993-01-01

The NASA Propagation Program supports academic research that models various propagation phenomena in the space research frequency bands. NASA supports such research via school and institutions prominent in the field. The products of such efforts are particularly useful for researchers in the field of propagation phenomena and telecommunications systems engineers. The systems engineer usually needs a few propagation parameter values for a system design. Published literature on the subject, such as the Cunsultative Committee for International Radio (CCIR) publications, may help somewhat, but often times, the parameter values given in such publications use a particular set of conditions which may not quite include the requirements of the system design. The systems engineer must resort to programming the propagation phenomena model of interest and to obtain the parameter values to be used in the project. Furthermore, the researcher in the propagation field must then program the propagation models either to substantiate the model or to generate a new model. The researcher or the systems engineer must either be a skillful computer programmer or hire a programmer, which of course increases the cost of the effort. An increase in cost due to the inevitable programming effort may seem particularly inappropriate if the data generated by the experiment is to be used to substantiate the already well-established models, or a slight variation thereof. To help researchers and the systems engineers, it was recommended by the participants of NASA Propagation Experimenters (NAPEX) 15 held in London, Ontario, Canada on 28-29 June 1991, that propagation software should be constructed which will contain models and prediction methods of most propagation phenomenon. Moreover, the software should be flexible enough for the user to make slight changes to the models without expending a substantial effort in programming.

Cigarette smoking and associated factors among in-school adolescents in Jamaica: comparison of the Global Youth Tobacco Surveys 2000 and 2006.

PubMed

Muula, Adamson S; Siziya, Seter; Rudatsikira, Emmanuel

2008-07-28

We conducted this study to estimate the correlates of current cigarette smoking among in-school adolescents in Jamaica 2006 and compare prevalence of smoking and associated factors between 2000 and 2006. In 2006, 1854 participated of whom 49.5 were males and 50.5% females. 1752 adolescents, 48.8% male and 51.2% females participated in the 2000 survey. Between 2000 and 2006, the prevalence of smoking among Jamaican school-going adolescents went up slightly from 15.2% to 16.7% but this was not statistically significant (p = 0.22). The perception that smoking is not harmful increased from 10.9% to 15.9% while parental smoking decreased from 39.4% to 35.5%. There was a decrease in the rates of adolescents exposed to tobacco adverts on billboards (p-value = 0.037) and in newspapers/magazine (p-value < 0.001). The percentage of adolescents who reported having an item with a tobacco brand logo on it increased from 13.9% to 16.4%. The perception that boys and girls who smoked had more friends increased between 2000 and 2006 (p-values = 0.016 and 0.004 respectively). Current smoking was associated with male gender (OR = 1.55; 95% CI [1.09-2.19]), having smoking parents (OR = 1.75; 95% CI [1.23-2.50]), and smoking friends (OR = 14.94; 95% CI [8.61-25.92] for most or all friends smokers and OR = 4.38; 95% CI [2.93-6.56] for some friends smokers)). Results from this study indicate smoking was positively associated with male gender, having smoking friends or parents. We observed a slightly non significant increase in the prevalence of smoking between 2000 and 2006 among adolescents in Jamaica. Although there was a decrease in the rates of adolescents exposed to advertisement, the percentage of those who had an item with a tobacco brand logo had increased. The possible impact of the Jamaica's ratification of the Framework Convention on Tobacco control remains to be observed.

Physical and chemical characteristics of products from the torrefaction of yellow poplar (Liriodendron tulipifera).

PubMed

Kim, Young-Hun; Lee, Soo-Min; Lee, Hyoung-Woo; Lee, Jae-Won

2012-07-01

We investigated the characteristics of torrefied yellow poplar (Liriodendron tulipifera) depending on reaction time (30 min) and temperature (240-280 °C). The thermogravimetric, grindability and calorific value of torrefied biomass were analyzed. As the torrefaction temperature increased, the carbon content of torrefied biomass increased from 49.50% to 54.42%, while the hydrogen and oxygen contents decreased from 6.09% to 5.65% and 28.71% to 26.61%, respectively. The highest calorific value was 1233 kJ/kg when torrefaction was performed at 280 °C for 30 min. An overall increase in energy density and decrease in mass and energy yield was observed with the increase in torrefaction temperature. The analysis of thermal decomposition demonstrated that the hemicelluloses contained in torrefied biomass decreased with increasing torrefaction temperature, whereas cellulose and lignin were only slightly affected. The grindability of torrefied biomass was significantly improved when torrefaction was performed at high temperature. Torrefaction of yellow poplar improved the chemical and physical fuel properties of the biomass. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

Subcategorization of Suspicious Breast Lesions (BI-RADS Category 4) According to MRI Criteria: Role of Dynamic Contrast-Enhanced and Diffusion-Weighted Imaging.

PubMed

Maltez de Almeida, João Ricardo; Gomes, André Boechat; Barros, Thomas Pitangueira; Fahel, Paulo Eduardo; de Seixas Rocha, Mário

2015-07-01

The purposes of this study were to investigate whether dynamic contrast-enhanced MRI is adequate for subcategorization of suspicious lesions (BI-RADS category 4) and to evaluate whether use of DWI improves diagnostic performance. The study group was composed of 103 suspicious lesions found in 83 subjects. Patient ages and lesion sizes were compiled, and two radiologists reanalyzed the images; subcategorized the findings as BI-RADS 4A, 4B, or 4C; and calculated apparent diffusion coefficient (ADC) values. The stratified variables were tested by univariate analysis and inserted in two multivariate predictive models, which were used to generate ROC curves and compare AUCs. Positive predictive values (PPVs) for each subcategory and ADC level were calculated, and interobserver agreement was tested. Forty-four (42.7%) suspicious findings proved malignant. Except for age (p = 0.08), all stratified predictor variables were significant in univariate analyses (p < 0.01). Logistic regression models did not differ substantially after comparison of the ROC curves (p = 0.09), but the one including ADC values was slightly better: AUC of 0.89 (95% CI, 0.82-0.95) against AUC of 0.85 (95% CI, 0.78-0.93). PPV increased progressively in each BI-RADS 4 subcategory (4A, 0.15; 4B, 0.37; 4C, 0.84). ADC values of 1.10 × 10(-3) mm(2)/s or less had the second highest PPV (0.77). Interobserver agreement was substantial at a kappa value of 0.80 (95% CI, 0.70-0.90; p < 0.01). Risk stratification of suspicious lesions (BI-RADS category 4) can be satisfactorily performed with DCE-MRI and slightly improved when DWI is introduced.

Putrescine N-Methyltransferase in Cultured Roots of Hyoscyamus albus1

PubMed Central

Hibi, Naruhiro; Fujita, Toshihiro; Hatano, Mika; Hashimoto, Takashi; Yamada, Yasuyuki

1992-01-01

Biosynthesis of tropane alkaloids is thought to proceed by way of the diamine putrescine, followed by its methylation by putrescine N-methyltransferase (PMT; EC 2.1.1.53). High PMT activities were found in branch roots and/or cultured roots of several solanaceous plants. PMT was partially purified and characterized from cultured roots of Hyoscyamus albus that contain hyoscyamine as the main alkaloid. Initial velocity studies and product inhibition patterns of PMT are consistent with an ordered bi-bi mechanism, in which the Km values for putrescine and S-adenosyl-l-methionine are 277 and 203 μm, respectively, and the Ki value for S-adenosyl-l-homocysteine is 110 μm. PMT efficiently N-methylated amines that have at least two amino groups separated by three or four methylene groups. Monoamines were good competitive inhibitors of PMT, among which n-butylamine, cyclohexylamine, and exo-2-aminonorbornane were most inhibitory, with respective Ki values of 11.0, 9.1, and 10.0 μm. When n-butylamine was fed to root cultures of H. albus, the alkamine intermediates (tropinone, tropine, and pseudotropine) drastically decreased at 1 mm of the exogenous monoamine, and the hyoscyamine content decreased by 52% at 6 mm, whereas the contents of 6β-hydroxyhyoscyamine and scopolamine did not change. Free and conjugated forms of polyamines were also measured. The n-butylamine treatment caused a large increase in the putrescine content (especially in the conjugated pool), and the spermine content also increased slightly, whereas the spermidine content decreased slightly. The increase in the putrescine pool size (approximately 40 nmol/mg dry weight) was large enough to account for the decrease in the total alkaloid pool size. Similar results were also obtained in root cultures of Datura stramonium. These studies further support the role of PMT as the first committed enzyme specific to alkaloid biosynthesis. Images Figure 8 PMID:16653064

Relationship between regional myocardial blood flow and thallium-201 distribution in the presence of coronary artery stenosis and dipyridamole-induced vasodilation.

PubMed Central

Mays, A E; Cobb, F R

1984-01-01

This study assesses the relationship between the distribution of thallium-201 and myocardial blood flow during coronary vasodilation induced by intravenous dipyridamole in canine models of partial and complete coronary artery stenosis. 10 dogs were chronically instrumented with catheters in the left atrium and aorta and with a balloon occluder and electromagnetic flow probe on the proximal left circumflex coronary artery. Regional myocardial blood flow was measured during control conditions with radioisotope-labeled microspheres, and the phasic reactive hyperemic response to a 20-s transient occlusion was then recorded. Dipyridamole was then infused intravenously until phasic coronary blood flow increased to match peak hyperemic values. The left circumflex coronary artery was either partially occluded to reduce phasic blood flow to control values (group 1) or it was completely occluded (group 2), and thallium-201 and a second microsphere label were injected. 5 min later, the animals were sacrificed, the left ventricle was sectioned into 1-2-g samples, and thallium-201 activity and regional myocardial blood flow were measured. Curvilinear regression analyses between thallium-201 localization and myocardial blood flow during dipyridamole infusion demonstrated a slightly better fit to a second- as compared with a first-order model, indicating a slight roll-off of thallium activity as myocardial blood flow increases. During the dipyridamole infusion, the increases in phasic blood flow, the distributions of regional myocardial blood flow, and the relationships between thallium-201 localization and regional blood flow were comparable to values previously observed in exercising dogs with similar occlusions. These data provide basic validation that supports the use of intravenous dipyridamole and thallium-201 as an alternative to exercise stress and thallium-201 for evaluating the effects of coronary occlusive lesions on the distribution of regional myocardial blood flow. PMID:6715540

Effect of pressure on the metamagnetic transition of DyB 6 single crystal

NASA Astrophysics Data System (ADS)

Sakai, T.; Oomi, G.; Uwatoko, Y.; Kunii, S.

2007-03-01

The effects of pressure on the magnetization ( M) and the magnetostriction (MS) for DyB 6 single crystal have been measured at 4.2 K. It is found that the M loops are insensitive to pressure, whereas the large MS with magnitude of 0.5% at 5 T at ambient pressure is rapidly suppressed by applying pressure. The metamagnetic transition field HM in the M curve increases slightly by applying pressure with the rate of increase, ∂ ln HM/∂ P, of 0.03 GPa -1, which is almost the same value as that for TN, 0.04 GPa -1.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grzetic, S; Weldon, M; Noa, K

Purpose: This study compares the newly released MaxFOV Revision 1 EFOV reconstruction algorithm for GE RT590 to the older WideView EFOV algorithm. Two radiotherapy overlays from Q-fix and Diacor, are included in our analysis. Hounsfield Units (HU) generated with the WideView algorithm varied in the extended field (beyond 50cm) and the scanned object’s border varied from slice to slice. A validation of HU consistency between the two reconstruction algorithms is performed. Methods: A CatPhan 504 and CIRS062 Electron Density Phantom were scanned on a GE RT590 CT-Simulator. The phantoms were positioned in multiple locations within the scan field of viewmore » so some of the density plugs were outside the 50cm reconstruction circle. Images were reconstructed using both the WideView and MaxFOV algorithms. The HU for each scan were characterized both in average over a volume and in profile. Results: HU values are consistent between the two algorithms. Low-density material will have a slight increase in HU value and high-density material will have a slight decrease in HU value as the distance from the sweet spot increases. Border inconsistencies and shading artifacts are still present with the MaxFOV reconstruction on the Q-fix overlay but not the Diacor overlay (It should be noted that the Q-fix overlay is not currently GE-certified). HU values for water outside the 50cm FOV are within 40HU of reconstructions at the sweet spot of the scanner. CatPhan HU profiles show improvement with the MaxFOV algorithm as it approaches the scanner edge. Conclusion: The new MaxFOV algorithm improves the contour border for objects outside of the standard FOV when using a GE-approved tabletop. Air cavities outside of the standard FOV create inconsistent object borders. HU consistency is within GE specifications and the accuracy of the phantom edge improves. Further adjustments to the algorithm are being investigated by GE.« less

The effects of ILLLI on peripheral blood T lymphocytes subpopulation & NK cells in psoriasis treatment

NASA Astrophysics Data System (ADS)

Zhu, Jing; Nie, Fan

2005-07-01

Objective: To research the effects of Intravascular low level laser irradiation (ILLLI) on the immulogic function of cells in treatment of psoriasis. Method: 49 patients suffered from psoriasis were treated by Intravascular low level laser irradiation (laser output power: 4-5mw, 1 hour per day, a course of treatment is 10 days). We checked the function of T lymphocyte subgroup and NK cell in peripheral blood between pre and post treatment. Results: 1.The mean value of CD3+ in post treatment is higher. P<0.05. Significant difference is showed between pre and post treatment 2. The mean value of CD4+ in post treatment dropped slightly while the mean value of CD4/CD8, NK cell in post treatment increased little, nearly approach the mean value of natural person. 3.The mean value of CD4+,CD8+,NK cell which is under 30% increased the percent obviously after the treatment; The mean value of CD4+,CD8+ u higher than 30% obviously drop the percent, P#0.05 and <0.01. Related statistical analysis showed significant and much significant difference between pre and post treatment. Conclusions: The low level laser irradiation (ILLLI) in treatment of psoriasis has bidirectional ajustive effect which can balance the immulogic function of cell.

Tribological Properties of PVD Ti/C-N Nanocoatnigs

NASA Astrophysics Data System (ADS)

Leitans, A.; Lungevics, J.; Rudzitis, J.; Filipovs, A.

2017-04-01

The present paper discusses and analyses tribological properties of various coatings that increase surface wear resistance. Four Ti/C-N nanocoatings with different coating deposition settings are analysed. Tribological and metrological tests on the samples are performed: 2D and 3D parameters of the surface roughness are measured with modern profilometer, and friction coefficient is measured with CSM Instruments equipment. Roughness parameters Ra, Sa, Sz, Str, Sds, Vmp, Vmc and friction coefficient at 6N load are determined during the experiment. The examined samples have many pores, which is the main reason for relatively large values of roughness parameter. A slight wear is identified in all four samples as well; its friction coefficient values range from 0,.21 to 0.29. Wear rate values are not calculated for the investigated coatings, as no expressed tribotracks are detected on the coating surface.

Effects of bending on the superconducting critical current density of monofilamentary Nb3Sn wires

NASA Astrophysics Data System (ADS)

Kaiho, K.; Luhman, T. S.; Suenaga, M.; Sampson, W. B.

1980-02-01

Variations in the superconducting current density Jc of the Nb3Sn wires upon bending were measured for a series of monofilamentary wires in which the ratio Rv of the matrix (Cu+Sn) to the core (Nb3Sn,Nb) was changed from 0 to 58. In most cases Jc was found to increase slightly until the bending strain exceeded a value of ɛirrB , beyond which it severely and irreversibly degraded. For wires with intermediate values of Rv (˜2 to 10), ɛirrB , calculated by geometrical considerations, was substantially lower than the measured value of the tensile strain ɛirrT which was required to irreversibly degrade the critical current. The influence of bending strains on Jc can qualitatively be described by considering residual prestrains in the matrix and the core.

The Steep Ramp Test in Dutch white children and adolescents: age- and sex-related normative values.

PubMed

Bongers, Bart C; de Vries, Sanne I; Obeid, Joyce; van Buuren, Stef; Helders, Paul J M; Takken, Tim

2013-11-01

The Steep Ramp Test (SRT), a feasible, reliable, and valid exercise test on a cycle ergometer, may be more appealing for use in children in daily clinical practice than the traditional cardiopulmonary exercise test because of its short duration, its resemblance to children's daily activity patterns, and the fact that it does not require respiratory gas analysis. The aim of the present study was to provide sex- and age-related normative values for SRT performance in Dutch white children and adolescents who were healthy and 8 to 19 years old. This was a cross-sectional, observational study. A total of 252 Dutch white children and adolescents, 118 boys (mean age=13.4 years, SD=3.0) and 134 girls (mean age=13.4 years, SD=2.9), performed the SRT (work rate increment of 10, 15, or 20 W·10 s(-1), depending on body height) to voluntary exhaustion to assess peak work rate (WRpeak). Normative values are presented as reference centiles developed by use of generalized additive models for location, scale, and shape. Peak work rate correlated highly with age (r=.915 and r=.811), body mass (r=.870 and r=.850), body height (r=.922 and r=.896), body surface area (r=.906 and r=.885), and fat free mass (r=.930 and r=.902) in boys and girls, respectively. The reference curves demonstrated an almost linear increase in WRpeak with age in boys, even when WRpeak was normalized for body mass. In contrast, absolute WRpeak in girls increased constantly until the age of approximately 13 years, when it started to level off. Peak work rate normalized for body mass in girls showed only a slight increase with age until 14 years of age, when a slight decrease in relative WRpeak was observed. The sample may not have been entirely representative of the Dutch population. The present study provides sex- and age-related normative values for SRT performance in terms of both absolute WRpeak and relative WRpeak, thereby facilitating the interpretation of SRT results by clinicians and researchers.

Mesospheric circulation at the cloud top level of Venus according to Venus Monitoring Camera images

NASA Astrophysics Data System (ADS)

Khatuntsev, Igor; Patsaeva, Marina; Ignatiev, Nikolay; Titov, Dmitri; Markiewicz, Wojciech; Turin, Alexander

We present results of wind speed measurements at the cloud top level of Venus derived from manual cloud tracking in the UV (365 nm) and IR (965 nm) channels of the Venus Monitoring Camera Experiment (VMC) [1] on board the Venus Express mission. Cloud details have a maximal contrast in the UV range. More then 90 orbits have been processed. 30000 manual vectors were obtained. The period of the observations covers more than 4 venusian year. Zonal wind speed demonstrates the local solar time dependence. Possible diurnal and semidiurnal components are observed [2]. According to averaged latitude profile of winds at level of the upper clouds: -The zonal speed is slightly increasing by absolute values from 90 on the equator to 105 m/s at latitudes —47 degrees; -The period of zonal rotation has the maximum at the equator (5 earth days). It has the minimum (3 days) at altitudes —50 degrees. After minimum periods are slightly increasing toward the South pole; -The meridional speed has a value 0 on the equator, and then it is linear increasing up to 10 m/s (by absolute value) at 50 degrees latitude. "-" denotes movement from the equator to the pole. -From 50 to 80 degrees the meridional speed is again decreasing by absolute value up to 0. IR (965+10 nm) day side images can be used for wind tracking. The obtained speed of the zonal wind in the low and middle latitudes are systematically less than the wind speed derived from the UV images. The average zonal speed obtained from IR day side images in the low and average latitudes is about 65-70 m/s. The given fact can be interpreted as observation of deeper layers of mesosphere in the IR range in comparison with UV. References [1] Markiewicz W. J. et al. (2007) Planet. Space Set V55(12). P.1701-1711. [2] Moissl R., et al. (2008) J. Geophys. Res. 2008. doi:10.1029/2008JE003117. V.113.

Analysis of composite/difference field scattering properties between a slightly rough optical surface and multi-body defects.

PubMed

Gong, Lei; Wu, Zhensen; Gao, Ming; Qu, Tan

2018-03-20

The effective extraction of optical surface roughness and defect characteristic provide important realistic values to improve optical system efficiency. Based on finite difference time domain/multi-resolution time domain (FDTD/MRTD) mixed approach, composite scattering between a slightly rough optical surface and multi-body defect particles with different positions is investigated. The scattering contribution of defect particles or the slightly rough optical surface is presented. Our study provides a theoretical and technological basis for the nondestructive examination and optical performance design of nanometer structures.

Bayesian lead time estimation for the Johns Hopkins Lung Project data.

PubMed

Jang, Hyejeong; Kim, Seongho; Wu, Dongfeng

2013-09-01

Lung cancer screening using X-rays has been controversial for many years. A major concern is whether lung cancer screening really brings any survival benefits, which depends on effective treatment after early detection. The problem was analyzed from a different point of view and estimates were presented of the projected lead time for participants in a lung cancer screening program using the Johns Hopkins Lung Project (JHLP) data. The newly developed method of lead time estimation was applied where the lifetime T was treated as a random variable rather than a fixed value, resulting in the number of future screenings for a given individual is a random variable. Using the actuarial life table available from the United States Social Security Administration, the lifetime distribution was first obtained, then the lead time distribution was projected using the JHLP data. The data analysis with the JHLP data shows that, for a male heavy smoker with initial screening ages at 50, 60, and 70, the probability of no-early-detection with semiannual screens will be 32.16%, 32.45%, and 33.17%, respectively; while the mean lead time is 1.36, 1.33 and 1.23 years. The probability of no-early-detection increases monotonically when the screening interval increases, and it increases slightly as the initial age increases for the same screening interval. The mean lead time and its standard error decrease when the screening interval increases for all age groups, and both decrease when initial age increases with the same screening interval. The overall mean lead time estimated with a random lifetime T is slightly less than that with a fixed value of T. This result is hoped to be of benefit to improve current screening programs. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

Evaluation of Temperature-Dependent Effective Material Properties and Performance of a Thermoelectric Module

NASA Astrophysics Data System (ADS)

Chien, Heng-Chieh; Chu, En-Ting; Hsieh, Huey-Lin; Huang, Jing-Yi; Wu, Sheng-Tsai; Dai, Ming-Ji; Liu, Chun-Kai; Yao, Da-Jeng

2013-07-01

We devised a novel method to evaluate the temperature-dependent effective properties of a thermoelectric module (TEM): Seebeck coefficient ( S m), internal electrical resistance ( R m), and thermal conductance ( K m). After calculation, the effective properties of the module are converted to the average material properties of a p- n thermoelectric pillar pair inside the module: Seebeck coefficient ( S TE), electrical resistivity ( ρ TE), and thermal conductivity ( k TE). For a commercial thermoelectric module (Altec 1091) chosen to verify the novel method, the measured S TE has a maximum value at bath temperature of 110°C; ρ TE shows a positive linear trend dependent on the bath temperature, and k TE increases slightly with increasing bath temperature. The results show the method to have satisfactory measurement performance in terms of practicability and reliability; the data for tests near 23°C agree with published values.

Project environmental microbiology as related to planetary quarantine

NASA Technical Reports Server (NTRS)

Pflug, I. J.

1974-01-01

Microbiological analyses of soil particles allow for the following conclusions: (1) there is a considerable range in the values of aerobic, mesophilic microbial counts associated with different size soil fractions; (2) as soil particle size increases, there is an increase in the mean microbial concentration per particle; (3) plate counts of aerobic, mesophilic organisms in unheated soils yielded a mean concentration of about six organisms per particle for the smallest soil fraction; (4) aerobic, mesophilic counts for sonicated particles heated at 80 C for 20 minutes yielded mean values of about two organisms per particle for the smallest particles; (5) some actinomycetes associated with the soil fractions could survive dry heat treatment at 110 C for one hour; and (6) soil particles stored under ambient laboratory conditions for 2.5 years aerobic, mesophilic plate counts which were comparable or slightly greater than the counts for more recently collected soil.

Comparison of platelet function between sedentary individuals and competitive athletes at rest

PubMed Central

Lippi, Giuseppe; Montagnana, Martina; Salvagno, Gian Luca; Franchini, Massimo; Guidi, Gian Cesare

2006-01-01

Background There are controversial evidences on the effect of different types and workloads of physical exercise on primary hemostasis. In particular, little is known on the chronic influence of a strenuous and regular aerobic training regimen on platelet function. Methods The aim of this investigation was to compare platelet function between sedentary controls and trained athletes at rest and to evaluate whether a greater amount of exercise performed in professional cyclists may contribute to increased platelet chronic responsiveness compared to both elite cyclists and sedentary individuals. Platelet's ability to adhere and aggregate was assayed following a 12–24 h resting period in 49 active professional male road cyclists, 40 elite male cyclists and 43 matched sedentary healthy male volunteers, by the platelet function analyzer 100 (PFA-100). Results and discussion Mean values of the collagen-epinephrine test did not differ between controls and athletes (sedentary controls: 111 ± 33 s; elite athletes: 113 ± 26 s, p = 0.93; professional athletes: 120 ± 33 s; p = 0.33), whereas mean values of the collagen-ADP test displayed a slightly but significant trend towards decreased values when comparing sedentary controls (83 ± 21 s) with either elite (77 ± 11 s, p < 0.01) or professional (75 ± 16 s, p < 0.01) athletes. Conclusion The trend towards slightly lower collagen-ADP values are suggestive for a modest but significant chronic activation of primary hemostasis, highlighting the need to set appropriate reference ranges for the PFA-100 when evaluating primary hemostasis in physically active subjects. PMID:16916446

Possibility of using waste tire rubber and fly ash with Portland cement as construction materials.

PubMed

Yilmaz, Arin; Degirmenci, Nurhayat

2009-05-01

The growing amount of waste rubber produced from used tires has resulted in an environmental problem. Recycling waste tires has been widely studied for the last 20 years in applications such as asphalt pavement, waterproofing systems and membrane liners. The aim of this study is to evaluate the feasibility of utilizing fly ash and rubber waste with Portland cement as a composite material for masonry applications. Class C fly ash and waste automobile tires in three different sizes were used with Portland cement. Compressive and flexural strength, dry unit weight and water absorption tests were performed on the composite specimens containing waste tire rubber. The compressive strength decreased by increasing the rubber content while increased by increasing the fly ash content for all curing periods. This trend is slightly influenced by particle size. For flexural strength, the specimens with waste tire rubber showed higher values than the control mix probably due to the effect of rubber fibers. The dry unit weight of all specimens decreased with increasing rubber content, which can be explained by the low specific gravity of rubber particles. Water absorption decreased slightly with the increase in rubber particles size. These composite materials containing 10% Portland cement, 70% and 60% fly ash and 20% and 30% tire rubber particles have sufficient strength for masonry applications.

Effects of inulin with different degree of polymerization on gelatinization and retrogradation of wheat starch.

PubMed

Luo, Denglin; Li, Yun; Xu, Baocheng; Ren, Guangyue; Li, Peiyan; Li, Xuan; Han, Sihai; Liu, Jianxue

2017-08-15

The effects of three types of inulin, including FS (DP≤10), FI (DP of 2-60) and FXL (DP≥23), on the gelatinization and retrogradation characteristics of wheat starch were investigated. As the concentration of inulin added into starch increased, the gelatinization temperature increased whereas the breakdown value decreased, and the value of setback first decreased and then increased slightly. The three types of inulin with lower concentrations (<15%) all showed obvious suppression effects on the short-term retrogradation of wheat starch. After 7days of storage, the three types of inulin showed a significant suppression of starch retrogradation in the addition range of 5-7.5%. They can all inhibit amylose retrogradation, but accelerate amylopectin retrogradation. Inulin with lower DP has stronger effects on the starch retrogradation. Generally, the three types of inulin can all retard the retrogradation performance of wheat starch to some extent in the long-term storage. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dynamics of acoustically levitated disk samples.

PubMed

Xie, W J; Wei, B

2004-10-01

The acoustic levitation force on disk samples and the dynamics of large water drops in a planar standing wave are studied by solving the acoustic scattering problem through incorporating the boundary element method. The dependence of levitation force amplitude on the equivalent radius R of disks deviates seriously from the R3 law predicted by King's theory, and a larger force can be obtained for thin disks. When the disk aspect ratio gamma is larger than a critical value gamma(*) ( approximately 1.9 ) and the disk radius a is smaller than the critical value a(*) (gamma) , the levitation force per unit volume of the sample will increase with the enlargement of the disk. The acoustic levitation force on thin-disk samples ( gamma

Study on the interaction of graphene oxide‑silver nanocomposites with bovine serum albumin and the formation of nanoparticle-protein corona.

PubMed

Xu, Xiangyu; Mao, Xuyan; Wang, Yunfei; Li, Dandan; Du, Zhongyu; Wu, Weihua; Jiang, Liang; Yang, Jie; Li, Jianjun

2018-05-09

The interaction between graphene oxide-sliver nanocomposites (GO-AgNCPs) and bovine serum albumin (BSA) in aqueous buffer solution was investigated by using several spectroscopic and imaging techniques. The visible absorbance intensity of GO-AgNCPs increased with increasing concentrations of BSA, and a slight redshift of the surface plasmon resonance band (SPR) occurred due to the absorption of BSA on the surface of GO-AgNCPs. Fluorescence data revealed a static quenching process of BSA caused by GO-AgNCPs. Thermodynamic parameters of the absorption process, including adsorption equilibrium constants, changes in Gibbs free energy (ΔG), enthalpy (ΔH) and entropy (ΔS), were evaluated at different temperatures. Negative values of ΔG showed that this process was spontaneous and the BSA-GO-AgNCPs complex might form in aqueous solution. Negative values of ΔH and ΔS suggested that the binding was mainly an enthalpy-driven process, and van der Waals forces and hydrogen bonding were the major force in the formation of the nanoparticle-protein corona. Analysis of synchronous, three dimensional (3D) fluorescence and circular dichroism (CD) spectra demonstrated that the conformation of BSA was slightly altered in the presence of GO-AgNCPs. The protein corona formed on the surface of GO-AgNCPs was directly observed by scanning probe microscopy (SPM). Copyright © 2018 Elsevier B.V. All rights reserved.

Dynamics of acoustically levitated disk samples

NASA Astrophysics Data System (ADS)

Xie, W. J.; Wei, B.

2004-10-01

The acoustic levitation force on disk samples and the dynamics of large water drops in a planar standing wave are studied by solving the acoustic scattering problem through incorporating the boundary element method. The dependence of levitation force amplitude on the equivalent radius R of disks deviates seriously from the R3 law predicted by King’s theory, and a larger force can be obtained for thin disks. When the disk aspect ratio γ is larger than a critical value γ*(≈1.9) and the disk radius a is smaller than the critical value a*(γ) , the levitation force per unit volume of the sample will increase with the enlargement of the disk. The acoustic levitation force on thin-disk samples (γ⩽γ*) can be formulated by the shape factor f(γ,a) when a⩽a*(γ) . It is found experimentally that a necessary condition of the acoustic field for stable levitation of a large water drop is to adjust the reflector-emitter interval H slightly above the resonant interval Hn . The simulation shows that the drop is flattened and the central parts of its top and bottom surface become concave with the increase of sound pressure level, which agrees with the experimental observation. The main frequencies of the shape oscillation under different sound pressures are slightly larger than the Rayleigh frequency because of the large shape deformation. The simulated translational frequencies of the vertical vibration under normal gravity condition agree with the theoretical analysis.

Observations of instability, hysteresis, and oscillation in low-Reynolds-number flow past polymer gels.

PubMed

Eggert, Matthew D; Kumar, Satish

2004-10-01

We perform a set of experiments to study the nonlinear nature of an instability that arises in low-Reynolds-number flow past polymer gels. A layer of a viscous liquid is placed on a polydimethylsiloxane (PDMS) gel in a parallel-plate rheometer which is operated in stress-controlled mode. As the shear stress on the top plate increases, the apparent viscosity stays relatively constant until a transition stress where it sharply increases. If the stress is held at a level slightly above the transition stress, the apparent viscosity oscillates with time. If the stress is increased to a value above the transition stress and then decreased back to zero, the apparent viscosity shows hysteretic behavior. If the stress is instead decreased to a constant value and held there, the apparent viscosity is different from its pretransition value and exhibits sustained oscillations. This can happen even if the stress is held at values below the transition stress. Our observations suggest that the instability studied here is subcritical and leads to a flow that is oscillatory and far from viscometric. The phenomena reported here may be useful in applications such as microfluidics, membrane separations, and polymer processing. They may also provide insight into the rheological behavior of complex fluids that undergo flow-induced gelation.

[Effects of artificial reef construction to marine ecosystem services value: a case of Yang-Meikeng artificial reef region in Shenzhen].

PubMed

Qin, Chuan-xin; Chem, Pi-mao; Jia, Xiao-ping

2011-08-01

Based on the researches and statistic data of Yangmeikeng artificial reef region in Shenzhen in 2008 and by the method of ecosystem services value, this paper analyzed the effects of artificial reef construction in the region on the marine ecosystem services. After the artificial reef construction, the tourism service value in the region decreased from 87% to 42%, food supply service value increased from 7% to 27%, and the services value of raw material supply, climatic regulation, air quality regulation, water quality regulation, harmful organism and disease regulation, and knowledge expansion had a slight increase, as compared to the surrounding coastal areas. The total services value per unit area of Yangmeikeng artificial reef region in 2008 was 1714.7 x 10(4) yuan x km(-2), far higher than the mean services value of coastal marine ecosystem in the surrounding areas of Shenzhen and in the world. Artificial reef construction affected and altered the structure of regional marine ecosystem services value, and improved the regional ecosystem services value, being of significance for the rational exploitation and utilization of marine resources and the successful recovery of damaged marine eco-environment and fish resources. Utilizing the method of ecosystem services value to evaluate artificial reef construction region could better elucidate the benefits of artificial reef construction, effectively promote the development of our artificial reef construction, and improve the management of marine ecosystem.

16 CFR 1500.41 - Method of testing primary irritant substances.

Code of Federal Regulations, 2012 CFR

2012-01-01

... example: Skin reaction Exposure time (hours) Evaluation value Erythema and eschar formation: Intact skin... patches are removed and the resulting reactions are evaluated on the basis of the designated values in the following table: Skin reaction Value 1 Erythema and eschar formation: No erythema 0 Very slight erythema...

Ball clay

USGS Publications Warehouse

Virta, R.L.

2013-01-01

Four companies — H.C. Spinks Clay Co., Inc., Imerys, Old Hickory Clay Co. and Unimin Corp. — mined ball clay in five U.S. states in 2012. Production, on the basis of preliminary data, was 900 kt (992,000 st), with an estimated value of $42.3 million. This was a slight increase in tonnage from 886 kt (977,000 st), with a value of $40.9 million in 2011. Tennessee was the leading ball clay producing state, with 63 percent of domestic production, followed by Texas, Mississippi, Kentucky and Indiana. Reported ball clay production from Indiana probably was fire clay rather than ball clay. About 69 percent of total ball clay production was airfloat, 20 percent was crude and 11 percent was water-slurried.

Productivity, pesticides, and management of the Peregrine Falcon in Arizona

USGS Publications Warehouse

Ellis, D.H.

1985-01-01

In the decade since research commenced with the Peregrine in Arizona, over 60 sites have been identified which historically or presently are occupied by breeding pairs. Productivity was determined for about 120 breeding attempts from 1975-85. Almost all sites, for which productivity information is available for two or more years, have hatched young. Average values for fledging success were ca. 1.4 young/attempt for all active sites and ca. 2.3 young/attempt for successful sites. Eggshell thickness values were highly varied, but few samples reflect thinning sufficient to cause reproductive failure, and the population appears to be increasing slightly. Management practices which can further benefit the falcon include: controlling pesticide use, habitat protection, and information management.

The red tide event in El Salvador, August 2001-January 2002.

PubMed

Enrique Barraza, José; Armero-Guardado, Julio; Valencia de Toledo, Zobeyda Marisol

2004-09-01

A red tide event occurred in El Salvador from August 2001 to January 2002. National health authorities usually measured toxin levels in Ostrea iridescens, however other species were analyzed during this microalgae bloom: Anadara similis, Anadara tuberculosa and Modiolus sp. El Salvador authorities consider 400 mouse units/100 g the highest value that is safe for human health. During this period toxin levels in 0. iridescens and Modiolus sp. increased from values under 400 to 3977 and 15,468 mouse units/100 g, respectively. Persistent and higher levels were recorded in oyster and mussel banks on the west part of the country. The Ministry of Health and Social Assistance treated 41 slight to moderate intoxications associated to bivalve mollusks consumption.

The Quality Characteristics of Salted Ground Pork Patties Containing Various Fat Levels by Microwave Cooking

PubMed Central

Jeong, Jong Youn; Lim, Seung Taek; Kim, Cheon Jei

2016-01-01

This study was carried out to evaluate the effects of fat level on the microwave cooking properties of ground pork patties with NaCl (1.5%). Ground pork patties were processed from pork hams to achieve fat levels of 10%, 15%, 20%, and 25%, respectively. Each patty was cooked from a thawed state to 75℃ in a microwave oven at full power (700 W). After microwave cooking, protein content, moisture content, fat retention, and shear force values in patties decreased as fat level increased from 10 to 25%. As fat level increased, cooking time decreased but total cooking loss and drip loss were increased, whereas slight differences in diameter reduction and thickness of patties were observed. In raw patties, 10% fat patties had lower L* values and higher a* values compared to patties with more fat, but these differences were reduced when patties were cooked. Patties with 10% fat showed a more pink color on the surface and interior than patties with a higher fat content but more air pockets were noted in higher-fat patties. Higher-fat patties were more tender, juicy, and oily than lower-fat patties. PMID:27621696

Effects of gamma irradiation on physicochemical properties of Korean red ginseng powder

NASA Astrophysics Data System (ADS)

Byun, Myung-Woo; Yook, Hong-Sun; Kwon, Oh-Jin; Kang, Il-Jun

1997-04-01

Gamma irradiation was applied to Korean red ginseng powder to improve its quality. Major physicochemical properties (approximate composition, pH, acidity, browning pigment, hydrogen donating activity, fatty acids, minerals and saponin) were not significantly changed by gamma irradiation up to 10 kGy. The TBA value was increased depending on the increment of irradiation dose level. In free amino acids, threonine was increased while, serine and glutamic acid were decreased by gamma irradiation. In total amino acids, total contents were not significantly changed by gamma irradiation though tyrosine was slightly decreased P ⩽ 0.05. In free sugar, glucose, sucrose and maltose were significantly increased by 7.5 and 10 kGy gamma irradiation P ⩽ 0.05

Acute toxic effects of nerve agent VX on respiratory dynamics and functions following microinsillation inhalation exposure in guinea pigs.

PubMed

Rezk, Peter E; Graham, Jacob R; Moran, Theodore S; Gordon, Richard K; Sciuto, Alfred M; Doctor, Bhupendra P; Nambiar, Madhusoodana P

2007-03-01

Exposure to a chemical warfare nerve agent (CWNA) leads to severe respiratory distress, respiratory failure, or death if not treated. We investigated the toxic effects of nerve agent VX on the respiratory dynamics of guinea pigs following exposure to 90.4 mug/m3 of VX or saline by microinstillation inhalation technology for 10 min. Respiratory parameters were monitored by whole-body barometric plethysmography at 4, 24, and 48 h, 7 d, 18 d, and 4 wk after VX exposure. VX-exposed animals showed a significant decrease in the respiratory frequency (RF) at 24 and 48 h of recovery (p value .0329 and .0142, respectively) compared to the saline control. The tidal volume (TV) slightly increased in VX exposed animals at 24 and significantly at 48 h (p = .02) postexposure. Minute ventilation (MV) increased slightly at 4 h but was reduced at 24 h and remained unchanged at 48 h. Animals exposed to VX also showed an increase in expiratory (Te) and relaxation time (RT) at 24 and 48 h and a small reduction in inspiratory time (Ti) at 24 h. A significant increase in end expiratory pause (EEP) was observed at 48 h after VX exposure (p = .049). The pseudo lung resistance (Penh) was significantly increased at 4 h after VX exposure and remained slightly high even at 48 h. Time-course studies reveal that most of the altered respiratory dynamics returned to normal at 7 d after VX exposure except for EEP, which was high at 7 d and returned to normal at 18 d postexposure. After 1 mo, all the monitored respiratory parameters were within normal ranges. Bronchoalveolar lavage (BAL) 1 mo after exposure showed virtually no difference in protein levels, cholinesterase levels, cell number, and cell death in the exposed and control animals. These results indicate that sublethal concentrations of VX induce changes in respiratory dynamics and functions that over time return to normal levels.

Influence of CoO Nanoparticles on Properties of Barium Zirconium Titanate Ceramics

NASA Astrophysics Data System (ADS)

Jarupoom, Parkpoom; Jaita, Pharatree; Boothrawong, Narongdetch; Phatungthane, Thanatep; Sanjoom, Ratabongkot; Rujijanagul, Gobwute; Cann, David P.

2017-07-01

Composites of Ba(Zr0.07Ti0.93)O3 ceramic and CoO nanoparticles (at 1.0 vol.% to 3.0 vol.%) have been fabricated to investigate the effects of the CoO nanoparticles on the properties of the composites. X-ray diffraction data revealed that the modified samples contained Ba(Zr0.07Ti0.93)O3 and CoO phases. Addition of CoO nanoparticles improved the magnetic behavior and resulted in slight changes in ferroelectric properties. The composites showed a magnetoelectric effect in which the negative value of the magnetocapacitance increased with increasing CoO concentration. Examination of the dielectric spectra showed that the two phase-transition temperatures as observed for unmodified Ba(Zr0.07Ti0.93)O3 merged into a single phase-transition temperature for the composite samples. The composite samples also showed broad relative permittivity versus temperature ( ɛ r - T) curves with frequency dispersion. This dielectric behavior can be explained in terms of the Maxwell-Wagner mechanism. In addition, the Vickers hardness ( H v) value of the samples increased with increasing CoO content.

[Studies on sintering of dental porcelain. (Part 1) Binary system sintering of alumina and low fusing frit (author's transl)].

PubMed

Kuwayama, N; Kon, M

1981-04-01

Dental porcelains were made from frit and glass powder with electro fused alumina powder addition in the range from 20 to 60 wt% using sintering method at the temperature from 500 degree C to 1 000 degree C, and the effects of alumina content and firing temperature on firing processes of sintered composite were investigated. Shrinkage curves of the powder compacts varied with kind of frit and content of alumina. Particulary, powder compact with alumina addition in the range from 50 to 55% was found to have a remarkable influence for extention of firing temperature range. The densification of the powder compacts was considered to be accelerated by the dissolution of a small a mount of alumina particle into the frit and glass above 900 degree C. Expansion coefficient value of sintered composite of alumina and Pyrex glass powder gradually increased with increase of alumina content. Inversely, expansion coefficient of soda-lime-silica glass showed the minimum value at 40 wt% alumina content and then had a tendency of slight increases with increase of alumina content.

Evaluation of the Nutritional and Storage Quality of Meatballs Formulated with Bee Pollen.

PubMed

Turhan, Sadettin; Yazici, Fehmi; Saricaoglu, Furkan Turker; Mortas, Mustafa; Genccelep, Huseyin

2014-01-01

In this study, the nutritional and storage quality of meatballs formulated with different levels (0, 1.5, 3.0, 4.5 and 6.0%) of bee pollen were investigated during storage at 41℃ for 9 d. Protein content of meatballs increased, while moisture content decreased with increased pollen. The addition of pollen improved cooking loss but decreased the redness (Hunter a value) and sensory scores. Textural parameters (hardness, springsness, gumminess, and chewiness) were affected by pollen addition and the hardness and gumminess values of meatballs decreased as the pollen content increased. While C18:0 content of meatballs slightly decreased with pollen addition, C18:2n-6c, C18:3n-3, C20:5n-3, and PUFA contents increased. The PUFA/saturated fatty acids (P/S) ratio increased from 0.05 in the control to 0.09 in meatballs with 6.0% pollen. The n-6/n-3 ratio decreased from 11.84 in the control to 3.65 in the meatballs with 6.0% pollen. The addition of pollen retarded the lipid oxidation and inhibited the bacterial growth in meatballs. The pH, redness, TBA value and total aerobic mesophilic bacteria, coliform bacteria and S. aureus counts values changed significantly during storage. The results suggest that bee pollen could be added to enhance the nutritional and storage quality of meatballs with minimal changes in composition and/or sensory properties.

Evaluation of the Nutritional and Storage Quality of Meatballs Formulated with Bee Pollen

PubMed Central

2014-01-01

In this study, the nutritional and storage quality of meatballs formulated with different levels (0, 1.5, 3.0, 4.5 and 6.0%) of bee pollen were investigated during storage at 41℃ for 9 d. Protein content of meatballs increased, while moisture content decreased with increased pollen. The addition of pollen improved cooking loss but decreased the redness (Hunter a value) and sensory scores. Textural parameters (hardness, springsness, gumminess, and chewiness) were affected by pollen addition and the hardness and gumminess values of meatballs decreased as the pollen content increased. While C18:0 content of meatballs slightly decreased with pollen addition, C18:2n-6c, C18:3n-3, C20:5n-3, and PUFA contents increased. The PUFA/saturated fatty acids (P/S) ratio increased from 0.05 in the control to 0.09 in meatballs with 6.0% pollen. The n-6/n-3 ratio decreased from 11.84 in the control to 3.65 in the meatballs with 6.0% pollen. The addition of pollen retarded the lipid oxidation and inhibited the bacterial growth in meatballs. The pH, redness, TBA value and total aerobic mesophilic bacteria, coliform bacteria and S. aureus counts values changed significantly during storage. The results suggest that bee pollen could be added to enhance the nutritional and storage quality of meatballs with minimal changes in composition and/or sensory properties. PMID:26761280

Effect of tidal fluctuations on transient dispersion of simulated contaminant concentrations in coastal aquifers

USGS Publications Warehouse

La Licata, Ivana; Langevin, Christian D.; Dausman, Alyssa M.; Alberti, Luca

2011-01-01

Variable-density groundwater models require extensive computational resources, particularly for simulations representing short-term hydrologic variability such as tidal fluctuations. Saltwater-intrusion models usually neglect tidal fluctuations and this may introduce errors in simulated concentrations. The effects of tides on simulated concentrations in a coastal aquifer were assessed. Three analyses are reported: in the first, simulations with and without tides were compared for three different dispersivity values. Tides do not significantly affect the transfer of a hypothetical contaminant into the ocean; however, the concentration difference between tidal and non-tidal simulations could be as much as 15%. In the second analysis, the dispersivity value for the model without tides was increased in a zone near the ocean boundary. By slightly increasing dispersivity in this zone, the maximum concentration difference between the simulations with and without tides was reduced to as low as 7%. In the last analysis, an apparent dispersivity value was calculated for each model cell using the simulated velocity variations from the model with tides. Use of apparent dispersivity values in models with a constant ocean boundary seems to provide a reasonable approach for approximating tidal effects in simulations where explicit representation of tidal fluctuations is not feasible.

Influence of pH, benzoic acid, glutathione, EDTA, 4-hexylresorcinol, and sodium chloride on the pressure inactivation kinetics of mushroom polyphenol oxidase.

PubMed

Weemaes, C A; Ludikhuyze, L R; Van den Broeck, I; Hendrickx, M E

1999-09-01

Pressure inactivation of mushroom PPO was studied for pH values ranging from 4 to 8, and the effect of some antibrowning agents on the pressure stability of mushroom PPO at pH 6.5 was evaluated. pH reduction below 6.5 resulted in a lowered inactivation threshold pressure and an increase of the absolute value of the activation volume (or a decrease of the z(p) value), the latter two parameters reflecting the pressure dependency of the inactivation rate constant. An increase in pH from 6.5 to 8, on the other hand, did only marginally affect the pressure stability of the enzyme. Mushroom PPO at pH 6.5 was markedly sensitized toward pressure by the presence of 2.5 mM 4-hexylresorcinol and slightly stabilized by the presence of 5 mM EDTA. The presence of 5 mM glutathione, sodium chloride, or benzoic acid caused no significant alteration of the enzyme pressure stability. Only in the presence of 4-hexylresorcinol, significant changes of the activation volume and z(p) value were noticed.

Effect of tidal fluctuations on transient dispersion of simulated contaminant concentrations in coastal aquifers

USGS Publications Warehouse

La Licata, Ivana; Langevin, Christian D.; Dausman, Alyssa M.; Alberti, Luca

2013-01-01

Variable-density groundwater models require extensive computational resources, particularly for simulations representing short-term hydrologic variability such as tidal fluctuations. Saltwater-intrusion models usually neglect tidal fluctuations and this may introduce errors in simulated concentrations. The effects of tides on simulated concentrations in a coastal aquifer were assessed. Three analyses are reported: in the first, simulations with and without tides were compared for three different dispersivity values. Tides do not significantly affect the transfer of a hypothetical contaminant into the ocean; however, the concentration difference between tidal and non-tidal simulations could be as much as 15%. In the second analysis, the dispersivity value for the model without tides was increased in a zone near the ocean boundary. By slightly increasing dispersivity in this zone, the maximum concentration difference between the simulations with and without tides was reduced to as low as 7%. In the last analysis, an apparent dispersivity value was calculated for each model cell using the simulated velocity variations from the model with tides. Use of apparent dispersivity values in models with a constant ocean boundary seems to provide a reasonable approach for approximating tidal effects in simulations where explicit representation of tidal fluctuations is not feasible.

A thermal model for evaluation of the Malay Basin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Waples, D.W.; Warren, L.; Mahadir, R.

1994-07-01

Detailed reconstruction of the present-day thermal structure of Malay Basin using downhole temperature, and paleoheat flow using an R[sub 0] database, leads to important conclusions and observations about the thermal history of the basin: (1) a major heating event occurred within the last 100,000 yr; (2) low R[sub 0] value throughout the basin indicates heat flow prior to the heating event only slightly higher than that of stable cratons, (3) present-day heat flow is lowest in the eastern Malay Basin, where most of the erosion due to the late Miocene regional unconformity, and highest in the northwestern, where Pliocene-Pleistocene subsidencemore » have been greatest. The data are consistent with the following general models for the basin evolution: (1) slight extension of the stable craton during late Eocene resulting from the collision of India with Asia, without the high heat flow, thermal doming, or rift development; (2) maintenance of slight extension and continued downwarping until the end of the middle Miocene, when local compression uplifted the basement in the eastern portion of the basin, leading to 15 km of erosion in some areas; and (3) establishment of a much stronger extensional regime throughout the basin during the Pliocene, causing submergence and greatest subsidence in the west, accompanied by an increase in heat flow to levels never seen before in the basin. Although strong subsidence (and presumably the increase in basal heat flow) began about 5.5 Ma, the thermal effects were not noted in the upper sedimentary section until recently because of the time required for the increased basal heat flow to reach the surface.« less

Identification of sources and behavior of agricultural contaminants in groundwater using nitorgen and sulfur isootope in Haean basin, Korea

NASA Astrophysics Data System (ADS)

Kaown, Dugin; Kim, Heejung; Mayer, Bernard; Hyun, Yunjung; Lee, Jin-Yong; Lee, Kang-Kun

2013-04-01

The Haean basin shows a bowl-shaped topographic feature and the drainage system shows a dendritic pattern. The study area is consisted of forests (58.0%), vegetable fields (27.6%), rice paddy fields (11.4%) and fruit fields (0.5%). Most of residents in the study area practice agriculture and paddy rice and vegetables (Chinese radish) are the typical crops grown. The concentration of nitrate in groundwater showed 0.8 ~ 67.3 mg/L in June, 2012 and 2.0 ~ 65.7 mg/L in September, 2012. Hydrogeochemical values and stable isotope ratios of dissolved nitrate and sulfate in groundwater were used to identify contamination sources and transformation processes in shallow groundwater. The δ15N-NO3- values in the study area ranged between +5.2 and +16.9‰ in June and between +4.4 and +13.0‰ in September. The sulfate concentration in groundwater samples obtained from the study area varied from 0.8 to 16.5 mg/L in June and 0 to 19.7 mg/L in September. δ34S-SO42- values ranged from +2.9 to +11.7‰ in June and +1.6 to +8.2‰ in September. The values of δ15N-NO3- and δ34S-SO42- in September were slightly decreased than those of values in June. The chemical composition of groundwater in vegetable and fruit fields showed slightly lower values of δ34S-SO42- and δ15N-NO3- indicated that a mixture of synthetic and organic fertilizers is responsible for groundwater contamination with agro-chemicals. Most groundwater from forests and paddy fields showed slightly higher values of δ15N-NO3- suggested that organic fertilizer is introduced into subsurface.

Esterified propoxylated glycerol soyate, a fat substitute model compound, and soy oil after heating.

PubMed

Artz, W E; Soheili, K C; Arjona, I M

1999-09-01

The changes occurring in two oil samples [EPG-00 soyate (transesterified soybean oil) and soy oil esterified propoxylated glycerol (EPG-08 soyate, a model, fat substitute compound)] were compared after heating at approximately 190 degrees C for 12 h/day. The EPG-00 soyate sample required 48 h of heating to attain a polymer content >20%, while the EPG-08 soyate required only 36 h. After 48 h of heating the EPG-00 soyate sample, the free fatty acid value (FFA) increased from 0.19 to 0.79, the acid value (AV) increased from 0.10 to 1.59, and the p-anisidine value (p-AV) increased from 1.6 to 195.4. In comparison, after only 36 h of heating, the EPG-08 soyate sample had FFA, AV, and p-AV increases from 0.19 to 0.71, from 0.26 to 1.36, and from 1.1 to 191.7, respectively. The triacylglycerol substrate degradation rate for EPG-00 soyate was k = 0.0126 +/- 0.0003 h(-)(1), while the rate for EPG-08 soyate was k = 0.0166 +/- 0.0017 h(-)(1). The results suggest that the EPG-00 soyate or transesterified soybean oil is slightly more stable than EPG-08 soyate.

Changes in Postfermentation Quality during the Distribution Process of Anchovy ( Engraulis japonicus) Fish Sauce.

PubMed

Joung, Byung Chun; Min, Jin Gi

2018-06-01

In the present study, we evaluated the changes in quality that can occur during the distribution of nonheated anchovy ( Engraulis japonicus) fish sauce after packaging. The pH values of all samples ranged from 5.5 to 5.8, and there were no significant differences ( P > 0.05) in pH among the samples during storage regardless of storage temperature or salt concentration. The initial total volatile base nitrogen concentration in all samples after bottling was 115 to 121 mg/100 mL, but this concentration increased gradually with storage time. After 1 year of storage, total volatile base nitrogen concentration had increased to approximately 170% of the initial concentration (166 to 194 mg/100 mL). Amino nitrogen increased slightly during storage but was significantly lower than the increase in amino nitrogen during general anchovy fish sauce fermentation with anchovy flesh. Most of the free amino acids increased slightly during the storage period regardless of storage temperature or salt concentration, but tyrosine and histidine increased and then decreased during the storage period. The histamine concentration of the anchovy fish sauce at a salt concentration of 20% was 43.3 mg/100 mL initially, but after 1 year the histamine concentration was 89.7 mg/100 mL in samples stored at 10°C, 102.6 mg/100 mL in samples stored at 25°C, and 116.8 mg/100 mL in samples stored at 35°C . Changes in putrescine and cadaverine concentrations were similar to those in histamine; concentrations increased about twofold from the initial concentrations after 1 year of storage. However, the rate of increase in putrescine from 4 months after storage was very high, and cadaverine slightly decreased by 12 months of storage. High scores for umami and aroma sensory characteristics were given to samples stored at 10°C, but samples stored 35°C were given high scores for rancid. Despite the overall low scores for aroma and umami for samples stored at 35°C, the quality of the anchovy fish sauce as a fermented food was considered acceptable.

Complex coacervation for the development of composite edible films based on LM pectin and sodium caseinate.

PubMed

Eghbal, Noushin; Yarmand, Mohammad Saeid; Mousavi, Mohammad; Degraeve, Pascal; Oulahal, Nadia; Gharsallaoui, Adem

2016-10-20

Coacervation between sodium caseinate (CAS) and low methoxyl pectin (LMP) at pH 3 was investigated as a function of protein/polysaccharide ratio. The highest amount of complex coacervates was formed at a CAS/LMP ratio of 2 at which the ζ-potential value was zero and the turbidity reached its highest value. Then, the properties of films based on these complex coacervates were studied. Coacervation resulted in decreasing water content and water sorption of films as the protein concentration increased. The mechanical properties of films were highly influenced by the formation of electrostatic complexes. The highest values of Young's modulus (182.97± 6.48MPa) and tensile strength (15.64±1.74MPa) with a slight increase of elongation at break (9.35±0.10%) were obtained for films prepared at a CAS/LMP ratio equal to 0.05. These findings show that interactions between LMP and CAS can be used to develop innovative packaging containing active molecules. Copyright © 2016 Elsevier Ltd. All rights reserved.

[Quantification of the gnostic sensitivity via measurement of the vibration threshold and of finger tip sensation].

PubMed

Oosterhuis, H J; Bouwsma, C; van Halsema, B; Hollander, R A; Kros, C J; Tombroek, I

1992-10-03

Quantification of vibration perception and fingertip sensation in routine neurological examination. Neurological Clinic, University Hospital, Groningen, the Netherlands. Prospective, controlled investigation. Vibration perception and fingertip sensation were quantified in a large group of normal control persons of various ages and in neurological patients and compared with the usual sensory tests at routine neurological examination. The vibration perception limit was measured with a biothesiometer without accelerometer, the fingertip sensation with a device for two-point discrimination slightly modified according to Renfrew ('Renfrew meter'). Concordance of the tests was studied by calculating kappa values. The normal values of both sensory qualities had a log-normal distribution and increased with age. The values obtained with the Renfrew meter correlated well with those of the two-point discrimination and stereognosis but were systematically higher than those indicated by Renfrew. Both methods appear useful at routine neurological examination if certain measuring precautions are taken.

Influence on grip of knife handle surface characteristics and wearing protective gloves.

PubMed

Claudon, Laurent

2006-11-01

Ten subjects were asked to apply maximum torques on knife handles with either their bare hand or their hand wearing a Kevlar fibre protective glove. Four knife handles (2 roughnesses, 2 hardnesses) were tested. Surface electromyograms of 6 upper limb and shoulder muscles were recorded and subject opinions on both knife handle hardness and friction in the hand were also assessed. The results revealed the significant influence of wearing gloves (p<0.0001), knife type (p<0.0005) and handle hardness (p<0.005) on the applied torque. Wearing Kevlar fibre gloves greatly increased the torque independently of the other two parameters. Under the bare hand condition, a 90 degrees ShA slightly rough handle provided the greatest torque. Subject opinion agreed with the observed effects on recorded torque values except for the hardness factor, for which a preference for the 70 degrees ShA value over the 90 degrees ShA value emerged.

Brain perfusion alterations in tick-borne encephalitis-preliminary report.

PubMed

Tyrakowska-Dadełło, Zuzanna; Tarasów, Eugeniusz; Janusek, Dariusz; Moniuszko-Malinowska, Anna; Zajkowska, Joanna; Pancewicz, Sławomir

2018-03-01

Magnetic resonance imaging (MRI) changes in tick-borne encephalitis (TBE) are non-specific and the pathophysiological mechanisms leading to their formation remain unclear. This study investigated brain perfusion in TBE patients using dynamic susceptibility-weighted contrast-enhanced magnetic resonance perfusion imaging (DSC-MRI perfusion). MRI scans were performed for 12 patients in the acute phase, 3-5days after the diagnosis of TBE. Conventional MRI and DSC-MRI perfusion studies were performed. Cerebral blood flow (CBF), cerebral blood volume (CBV), mean transit time (MTT), and time to peak (TTP) parametric maps were created. The bilateral frontal, parietal, and temporal subcortical regions and thalamus were selected as regions of interest. Perfusion parameters of TBE patients were compared to those of a control group. There was a slight increase in CBF and CBV, with significant prolongation of TTP in subcortical areas in the study subjects, while MTT values were comparable to those of the control group. A significant increase in thalamic CBF (p<0.001) and increased CBV (p<0.05) were observed. Increased TTP and a slight reduction in MTT were also observed within this area. The DSC-MRI perfusion study showed that TBE patients had brain perfusion disturbances, expressed mainly in the thalami. These results suggest that DSC-MRI perfusion may provide important information regarding the areas affected in TBE patients. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Tensile Properties of Friction Stir Welded Joints of AA 2024-T6 Alloy at Different Welding Speeds

NASA Astrophysics Data System (ADS)

Avula, Dhananjayulu; Devuri, Venkateswarlu; Cheepu, Muralimohan; Dwivedi, Dheerendra Kumar

2018-03-01

The influence of welding speed on the friction stir welded joint properties of hardness, tensile properties, defects and microstructure characterization are studied in the present study. The friction stir welding was conducted on AA2014-T6 heat treated alloy with 5 mm thickness plate in butt joint configuration. The welding speed was varied from 8 mm/min to 120 mm/min at the fixed travel speed and load conditions. It is observed that the welding speeds at higher rate with wide range can be possible to weld this alloy at higher rates of tool revolution suggesting that the inherent capability of friction stir welding technique for aluminum 2014 alloys. The strength of the joints gradually increases with enhancing of welding speed. The micro structural observations exhibited the formation of equiaxed grains in the stir zone and slightly in the thermo-mechanically affected zone. In addition, the size of the grains decreases with increase in welding speed owing to the presence of low heat input. Hence the hardness of the joints slightly increased in the stir zones over the other zones of the weld nugget. The joint strength initially increases with the welding speed and starts to decreases after reaching to the maximum value. The relationship between the welding conditions and friction stir welded joint properties has been discussed.

Towards closing the gap between hygroscopic growth and activation for secondary organic aerosol: Part 1 - Evidence from measurements

NASA Astrophysics Data System (ADS)

Wex, H.; Petters, M. D.; Carrico, C. M.; Hallbauer, E.; Massling, A.; McMeeking, G. R.; Poulain, L.; Wu, Z.; Kreidenweis, S. M.; Stratmann, F.

2009-01-01

Secondary Organic Aerosols (SOA) studied in laboratory experiments generally was found to show only slight hygroscopic growth, but a much better activity as a CCN (Cloud Condensation Nucleus) than indicated by the hygroscopic growth. This discrepancy was examined at LACIS (Leipzig Aerosol Cloud Interaction Simulator), using a portable generator that produced SOA particles from the ozonolysis of α-pinene, and adding butanol or butanol and water vapor during some of the experiments. The light scattering signal of dry SOA-particles was measured by the LACIS optical particle spectrometer and was used to derive a refractive index for SOA of 1.45. LACIS also measured the hygroscopic growth of SOA particles up to 99.6% relative humidity (RH), and a CCN counter was used to measure the particle activation. SOA-particles were CCN active with critical diameters of e.g. 100 and 55 nm at supersaturations of 0.4 and 1.1%, respectively. But only slight hygroscopic growth with hygroscopic growth factors ≤1.05 was observed at RH<98% RH. The hygroscopic growth increased slightly with the OH concentration present during the SOA-generation. At RH>98%, the hygroscopic growth increased stronger than would be expected if a constant hygroscopicity parameter for the particle/droplet solution was assumed. An increase of the hygroscopicity parameter by a factor of 4-6 was observed in the RH-range from below 90 to 99.6%, and this increase continued for increasingly diluted particle solutions for activating particles. This explains an observation already made in the past: that the relation between critical supersaturation and dry diameter for activation is steeper than what would be expected for a constant value of the hygroscopicity. The increase in the hygroscopicity parameter could be explained by either an increase in the number of ions/molecules in solution (e.g. due to the presence of slightly soluble particles with deliquescence RHs above 98%), or a change in the non-ideal behaviour (see companion paper Petters et al., 2008). Combining measurements of hygroscopic growth and activation, it was found that the surface tension that has to be assumed to interpret the measurements consistently is greater than 55 mN/m, possibly close to that of pure water, depending on the different SOA-types produced, and therefore only in part accounts for the discrepancy between hygroscopic growth and CCN activity observed for SOA particles in the past.

Effect of antimony-oxide on the shielding properties of some sodium-boro-silicate glasses.

PubMed

Zoulfakar, A M; Abdel-Ghany, A M; Abou-Elnasr, T Z; Mostafa, A G; Salem, S M; El-Bahnaswy, H H

2017-09-01

Some sodium-silicate-boro-antimonate glasses having the molecular composition [(20) Na 2 O - (20) SiO 2 - (60-x) B 2 O 3 - (x) Sb 2 O 3 (where x takes the values 0, 5 … or 20)] have been prepared by the melt quenching method. The melting and annealing temperatures were 1500 and 650K respectively. The amorphous nature of the prepared samples was confirmed by using X-ray diffraction analysis. Both the experimental and empirical density and molar volume values showed gradual increase with increasing Sb 2 O 3 content. The empirical densities showed higher values than those obtained experimentally, while the empirical molar volume values appeared lower than those obtained experimentally, which confirm the amorphous nature and randomness character of the studied samples. The experimentally obtained shielding parameters were approximately coincident with those obtained theoretically by applying WinXCom program. At low gamma-ray energies (0.356 and 0.662MeV) Sb 2 O 3 has approximately no effect on the total Mass Attenuation Coefficient, while at high energies it acts to increase the total Mass Attenuation Coefficient gradually. The obtained Half Value Layer and Mean Free Path values showed gradual decrease as Sb 2 O 3 was gradually increased. Also, the Total Mass Attenuation Coefficient values obtained between about 0.8 and 3.0MeV gamma-ray energy showed a slight decrease, as gamma-ray photon energy increased. This may be due to the differences between the Attenuation Coefficients of both antimony and boron oxides at various gamma-ray photon energies. However, it can be stated that the addition of Sb 2 O 3 into sodium-boro-silicate glasses increases the gamma-ray Attenuation Coefficient and the best sample is that contains 20 mol% of Sb 2 O 3 , which is operating well at 0.356 and 0.662MeV gamma-ray. Copyright © 2017 Elsevier Ltd. All rights reserved.

A Reference Database of Cartilage 3 Tesla MRI T2 Values in Knees without Diagnostic Evidence of Cartilage Degeneration: Data from the Osteoarthritis Initiative

PubMed Central

Joseph, Gabby B.; McCulloch, Charles E.; Nevitt, Michael C.; Heilmeier, Ursula; Nardo, Lorenzo; Lynch, John A.; Liu, Felix; Baum, Thomas; Link, Thomas M.

2015-01-01

Objective The purpose of this study was 1) to establish a gender- and BMI-specific reference database of cartilage T2 values, and 2) to assess the associations between cartilage T2 values and gender, age, and BMI in knees without radiographic osteoarthritis or MRI-based (WORMS 0/1) evidence of cartilage degeneration. Design 481 subjects between the ages of 45-65 years with Kellgren-Lawrence Scores 0/1 in the study knee were selected from the Osteoarthritis Initiative database. Baseline morphologic cartilage 3T MRI readings (WORMS scoring) and T2 measurements (resolution=0.313mmx0.446mm) were performed in the medial femur, lateral femur, medial tibia, lateral tibia, and patella compartments. In order to create a reference database, a logarithmic transformation was applied to the data to obtain the 5th-95th percentile values for T2. Results Significant differences in mean cartilage T2 values were observed between joint compartments. Although females had slightly higher T2 values than males in a majority of compartments, the differences were only significant in the medial femur (p<0.0001). A weak positive association was seen between age and T2 in all compartments, and was most pronounced in the patella (3.27% increase in median T2/10 years, p=0.009). Significant associations between BMI and T2 were observed, and were most pronounced in the lateral tibia (5.33% increase in median T2/5 kg/m2 increase in BMI, p<0.0001), and medial tibia (4.81% increase in median T2 /5 kg/m2 increase in BMI, p<0.0001). Conclusions This study established the first reference database of T2 values in a large sample of morphologically normal cartilage plates in knees without radiographic knee osteoarthritis. While cartilage T2 values were weakly associated with age and gender, they had the highest correlations with BMI. PMID:25680652

Porous PZT ceramics for receiving transducers.

PubMed

Kara, Hudai; Ramesh, Rajamani; Stevens, Ron; Bowen, Chris R

2003-03-01

PZT-air (porous PZT) and PZT-polymer (polymer impregnated porous PZT) piezocomposites with varying porosity/polymer volume fractions have been manufactured. The composites were characterized in terms of hydrostatic charge (dh) and voltage (gh) coefficients, permittivity, hydrostatic figure of merit (dh.gh), and absolute sensitivity (M). With decreasing PZT ceramic volume, gh increased, and dh.gh had a broad maximum around 80 to 90% porosity/polymer content. The absolute sensitivity was also increased. In each case, PZT-air piezocomposites performed better than PZT-polymer piezocomposites. Hydrophones constructed from piezocomposites showed slightly lower measured receiving sensitivities than calculated values for piezocomposite materials, which was due to the loading effect of the cable and the low permittivity associated with the piezocomposites.

Performance of special radiation-hardened optical fibers intended for use in the telecom spectral windows at a megagray level

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomashuk, A.L.; Dianov, E.M.; Golant, K.M.

Gamma-radiation-induced absorption spectra (2.15 MGy(Si)) are compared in N-doped and pure silica fibers fabricated by surface plasma CVD-process under different regimes with the aim to reveal the chief absorption mechanisms in the telecom spectral windows and to work out an optimum fiber design. The long wavelength absorption edge is shown to be the main absorption mechanism at megagray doses. Its value increases with increasing bonded hydrogen concentration in the fiber glass network and is slightly greater in N-doped fibers. No nitrogen-related color centers have been revealed in the short wavelength loss edge, which is determined by chlorine impurity in silica.

Operational trends in the temperature of a high-pressure microwave powered sulfur lamp

NASA Astrophysics Data System (ADS)

Johnston, C. W.; Jonkers, J.; van der Mullen, J. J. A. M.

2002-10-01

Temperatures have been measured in a high-pressure microwave sulfur lamp using sulfur atomic lines found in the spectrum at 867, 921 and 1045 nm. The absolute intensities were determined for 3, 5 and 7 bar lamps at several input powers, ranging from 400 to 600 W. On average, temperatures are found to be 4.1+/-0.15 kK and increase slightly with increasing pressure and input power. These values and trends agree well with our simulations. However, the power trend is reversed to that demonstrated by the model, which might be an indication that the skin-depth model for the electric field may be incomplete.

Effects of formaldehyde-enriched mists on Pseudotsuga menziesii (Mirbel) Franco and Lobaria pulmonaria (L.) Hoffm.

PubMed

Muir, P S; Shirazi, A M

1996-01-01

The atmosphere in some areas is polluted with formaldehyde (HCHO); however, little is known about effects of HCHO on plants at concentrations resembling those in polluted areas. The effects of simulated fogwater enriched with HCHO on seedlings of Pseudotsuga menziesii (Mirbel) Franco (Douglas fir) and pendants of Lobaria pulmonaria (L.) Hoffm. were assessed. Plants were treated with HCHO-enriched fog (target concentrations of 100, 500, and 1000 microm) during five 4-night mist sessions. Growth and nitrogenase activity (acetylene reduction rate) for lichens and growth and timing of bud-break for Douglas fir were monitored. Nitrogenase activity was lowest in lichens treated at the highest HCHO concentration after all but the first mist session, and it declined significantly with increasing HCHO concentration after the final mist session (R(2) = 0.60, p = 0.02). However, differences in nitrogenase activity among treatments were generally not statistically significant (most p values from ANOVAs were >/= 0.20). Formaldehyde did not affect growth of the lichens. Budbreak of Douglas firs was slightly delayed and height growth was slightly depressed with increasing HCHO concentration, although effects were not statistically significant.

The effect of physical activity on bone turnover in young adults.

PubMed

Franck, H; Beuker, F; Gurk, S

1991-01-01

Physical activity has been suggested as one of the determinants of bone turnover and to prevent the involutional age related bone loss. However, the degree to which physical exercise is necessary to induce changes in bone turnover and calciotropic hormones have been widely discussed (Williams et al., 1984; Cook et al., 1987; Smith et al., 1985). The aim of this study was to examine the rate of bone formation measured by osteocalcin in 56 healthy volunteers before and after 4 and 8 weeks of physical exercise (PE) and its dependence on various parameters of calcium and phosphate metabolism. The studied group consisting of 44 men and 12 women, mean age 24.8 and 24.3 years, respectively, performed a standardized physical training of 8 weeks. Mean serum osteocalcin levels were significantly (p less than 0.01) reduced after 4 weeks (men: 2.26 +/- 1.8 ng/ml; women: 0.94 +/- 1.6 ng/ml) compared to the values before PE (men: 4.01 +/- 2.18 ng/ml; women: 1.69 +/- 1.7 ng/ml) and returned to normal values after 8 weeks. Similarly, magnesium levels (0.82 mmol/l) decreased significantly (p less than 0.01) after 4 weeks of PE (0.79 mmol/l), returning to normal values after 8 weeks. Concomitantly, there was only a slight, but significant fall of serum calcium from 2.48 +/- 0.07 to 2.45 +/- 0.07 returning to initial values again. Furthermore, serum phosphate increased slightly in men from 1.01 mmol/l to 1.13 and 1.15 mmol/l after 4 and 8 weeks, respectively. In contrast, alkaline phosphatase and serum creatinine remained in the normal range.(ABSTRACT TRUNCATED AT 250 WORDS)

[Influence of below-cloud secondary evaporation on stable isotope composition in precipitation in Northwest China.

PubMed

Liu, Jie Yao; Zhang, Fu Ping; Feng, Qi; Li, Zong Xing; Zhu, Yi Wen; Nie, Shuo; Li, Ling

2018-05-01

The precipitation isotope data and meteorological data of eight stations provided by GNIP (Global Network for Isotopes in Precipitation) and two stations from the present study, combined with HYSPLIT model and water droplet evaporation model were used to examine the spatial and temporal distribution of precipitation δ 18 O and d values in Northwest China. The secondary evaporative effect of existence was evaluated and then quantitatively discussed, with the sensitive factors of secondary evaporative effect being considered. The results showed that during the summer monsoon, the δ 18 O and d values decreased from south to north in Xinjiang, while the δ 18 O value increased but d values decreased from south to north and from east to west of Shaanxi-Gansu-Ningxia region. During the winter monsoon, the δ 18 O value decreased from east to west in whole Northwest region, while the d value increased from south to north in Xinjiang, decreased from south to north and increased slightly from east to west in Shanxi-Gansu-Ningxia. The slope and intercept (6.80, -0.07) of the atmospheric precipitation line in the summer monsoon period was significantly lower than that of annual mean (7.27, 3.37) and winter monsoon period (7.46, 6.07), indicating that the secondary evaporation was stronger during the summer monsoon. The evaporation ratio in the summer monsoon was 4.49%, which was higher than 3.65% in the winter monsoon. However, the evaporation ratio of the winter monsoon was higher than the summer monsoon around of Loess Plateau, which might closely relate to the increasing drought of the Loess Plateau in recent years. Finally, the intensity of secondary evaporation decreased with increasing relative humidity, precipitation and vapor pressure but increased with increasing temperature (greater than 0 ℃). The influences of those factors (humidity, precipitation, temperature and vapor pressure) on the secondary evaporation were dependent on the differences of ranges.

Microstructure and Texture Evolutions of Biomedical Ti-13Nb-13Zr Alloy Processed by Hydrostatic Extrusion

NASA Astrophysics Data System (ADS)

Ozaltin, K.; Panigrahi, A.; Chrominski, W.; Bulutsuz, A. G.; Kulczyk, M.; Zehetbauer, M. J.; Lewandowska, M.

2017-11-01

A biomedical β-type Ti-13Nb-13Zr (TNZ) (wt pct) ternary alloy was subjected to severe plastic deformation by means of hydrostatic extrusion (HE) at room temperature without intermediate annealing. Its effect on microstructure, mechanical properties, phase transformations, and texture was investigated by light and electron microscopy, mechanical tests (Vickers microhardness and tensile tests), and XRD analysis. Microstructural investigations by light microscope and transmission electron microscope showed that, after HE, significant grain refinement took place, also reaching high dislocation densities. Increases in strength up to 50 pct occurred, although the elongation to fracture left after HE was almost 9 pct. Furthermore, Young's modulus of HE-processed samples showed slightly lower values than the initial state due to texture. Such mechanical properties combined with lower Young's modulus are favorable for medical applications. Phase transformation analyses demonstrated that both initial and extruded samples consist of α' and β phases but that the phase fraction of α' was slightly higher after two stages of HE.

Utilization of Bagasse Fly Ash to Remove the Unpleasant Odor of Stevia Extract and Soy Milk

NASA Astrophysics Data System (ADS)

Ashadi; Masykuri, M.; Haryono

2017-04-01

Stevia is a safe natural sweetener that, but has a slightly unpleasant odor. Soy milk is undoubtedly high nutritional value, soy milk slightly unpleasant odor. Bagasse Fly Ash (BFA) is a sugar factory waste which is abundant, not widely used yet, and allowed to accumulate around the sugar factory. BFA can be activated with a solution of NaOH become adsorbent. Utilization of activated BFA to remove the odor of stevia extract and soy milk means the utilization of a waste to reduce other waste. Deodorizing done by batch system. Before being used as adsorbent, BFA characterized using SEM, XRD, FTIR, and AAS. Odor and color analysis conducted by organoleptic. The results shown activation increases the cavity, BFA containing SiO2 and Al2O3, does not contain Pb, Cr, Cd. The results shown that the BFA can reduce odor of stevia from a scale of 4 to 2, the color becomes more clear, unpleasant odor of soy milk is also reduced.

Antioxidant capacity, fatty acids profile, and descriptive sensory analysis of table olives as affected by deficit irrigation.

PubMed

Cano-Lamadrid, Marina; Hernández, Francisca; Corell, Mireia; Burló, Francisco; Legua, Pilar; Moriana, Alfonso; Carbonell-Barrachina, Ángel A

2017-01-01

The influence of three irrigation treatments (T0, no stress; T1, soft stress; and, T2, moderate stress) on the key functional properties [fatty acids, sugar alcohols, organic acids, minerals, total polyphenols content (TPC), and antioxidant activity (AA)], sensory quality, and consumers' acceptance of table olives, cv. 'Manzanilla', was evaluated. A soft water stress, T1, led to table olives with the highest oil and dry matter contents, with the highest intensities of key sensory attributes and slightly, although not significant, higher values of consumer satisfaction degree. Besides, RDI in general (T1 and T2) slightly increased green colour, the content of linoleic acid, but decreased the content of phytic acid and some minerals. The soft RDI conditions are a good option for the cultivation of olive trees because they are environmentally friendly and simultaneously maintain or even improve the functionality, sensory quality, and consumer acceptance of table olives. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Ensemble Statistical Post-Processing of the National Air Quality Forecast Capability: Enhancing Ozone Forecasts in Baltimore, Maryland

NASA Technical Reports Server (NTRS)

Garner, Gregory G.; Thompson, Anne M.

2013-01-01

An ensemble statistical post-processor (ESP) is developed for the National Air Quality Forecast Capability (NAQFC) to address the unique challenges of forecasting surface ozone in Baltimore, MD. Air quality and meteorological data were collected from the eight monitors that constitute the Baltimore forecast region. These data were used to build the ESP using a moving-block bootstrap, regression tree models, and extreme-value theory. The ESP was evaluated using a 10-fold cross-validation to avoid evaluation with the same data used in the development process. Results indicate that the ESP is conditionally biased, likely due to slight overfitting while training the regression tree models. When viewed from the perspective of a decision-maker, the ESP provides a wealth of additional information previously not available through the NAQFC alone. The user is provided the freedom to tailor the forecast to the decision at hand by using decision-specific probability thresholds that define a forecast for an ozone exceedance. Taking advantage of the ESP, the user not only receives an increase in value over the NAQFC, but also receives value for An ensemble statistical post-processor (ESP) is developed for the National Air Quality Forecast Capability (NAQFC) to address the unique challenges of forecasting surface ozone in Baltimore, MD. Air quality and meteorological data were collected from the eight monitors that constitute the Baltimore forecast region. These data were used to build the ESP using a moving-block bootstrap, regression tree models, and extreme-value theory. The ESP was evaluated using a 10-fold cross-validation to avoid evaluation with the same data used in the development process. Results indicate that the ESP is conditionally biased, likely due to slight overfitting while training the regression tree models. When viewed from the perspective of a decision-maker, the ESP provides a wealth of additional information previously not available through the NAQFC alone. The user is provided the freedom to tailor the forecast to the decision at hand by using decision-specific probability thresholds that define a forecast for an ozone exceedance. Taking advantage of the ESP, the user not only receives an increase in value over the NAQFC, but also receives value for

Sources and Transport of Nutrients, Organic Carbon, and Chlorophyll-a in the San Joaquin River Upstream of Vernalis, California, during Summer and Fall, 2000 and 2001

USGS Publications Warehouse

Kratzer, Charles R.; Dileanis, Peter D.; Zamora, Celia; Silva, Steven R.; Kendall, Carol; Bergamaschi, Brian A.; Dahlgren, Randy A.

2004-01-01

Oxidizable materials from the San Joaquin River upstream of Vernalis can contribute to low dissolved oxygen episodes in the Stockton Deep Water Ship Channel that can inhibit salmon migration in the fall. The U.S. Geological Survey collected and analyzed samples at four San Joaquin River sites in July through October 2000 and June through November 2001, and at eight tributary sites in 2001. The data from these sites were supplemented with data from samples collected and analyzed by the University of California at Davis at three San Joaquin River sites and eight tributary sites as part of a separate study. Streamflows in the San Joaquin River were slightly above the long-term average in 2000 and slightly below average in 2001. Nitrate loads at Vernalis in 2000 were above the long-term average, whereas loads in 2001 were close to average. Total nitrogen loads in 2000 were slightly above average, whereas loads in 2001 were slightly below average. Total phosphorus loads in 2000 and 2001 were well below average. These nutrient loads correspond with the flow-adjusted concentration trends--nitrate concentrations significantly increased since 1972 (p 0.05). Loading rates of nutrients and dissolved organic carbon increased in the San Joaquin River in the fall with the release of wetland drainage into Mud Slough and with increased reservoir releases on the Merced River. During August 2000 and September 2001, the chlorophyll-a loading rates and concentrations in the San Joaquin River declined and remained low during the rest of the sampling period. The most significant tributary sources of nutrients were the Tuolumne River, Harding Drain, and Mud Slough. The most significant tributary sources of dissolved organic carbon were Salt Slough, Mud Slough, and the Tuolumne and Stanislaus Rivers. Compared with nutrients and dissolved organic carbon, the tributaries were minor sources of chlorophyll-a, suggesting that most of the chlorophyll-a was produced in the San Joaquin River rather than its tributaries. On the basis of the carbon-to-nitrogen ratios and the d13C of particulate organic matter in the San Joaquin River and tributaries, the particulate organic matter in the river was mostly phytoplankton. On the basis of the d15N values of the particulate organic matter, and of total dissolved nitrogen and nitrate, the nitrate in the San Joaquin River probably was a significant nutrient source for the phytoplankton. The range of d15N and d18O values of nitrate in the San Joaquin River and tributaries suggest that animal waste or sewage was a significant source of nitrate in the river at the time the samples were collected.

Mass distribution in galaxy clusters: the role of Active Galactic Nuclei feedback

NASA Astrophysics Data System (ADS)

Teyssier, Romain; Moore, Ben; Martizzi, Davide; Dubois, Yohan; Mayer, Lucio

2011-06-01

We use 1-kpc resolution cosmological Adaptive Mesh Refinement (AMR) simulations of a Virgo-like galaxy cluster to investigate the effect of feedback from supermassive black holes on the mass distribution of dark matter, gas and stars. We compared three different models: (i) a standard galaxy formation model featuring gas cooling, star formation and supernovae feedback, (ii) a 'quenching' model for which star formation is artificially suppressed in massive haloes and finally (iii) the recently proposed active galactic nucleus (AGN) feedback model of Booth and Schaye. Without AGN feedback (even in the quenching case), our simulated cluster suffers from a strong overcooling problem, with a stellar mass fraction significantly above observed values in M87. The baryon distribution is highly concentrated, resulting in a strong adiabatic contraction (AC) of dark matter. With AGN feedback, on the contrary, the stellar mass in the brightest cluster galaxy (BCG) lies below observational estimates and the overcooling problem disappears. The stellar mass of the BCG is seen to increase with increasing mass resolution, suggesting that our stellar masses converge to the correct value from below. The gas and total mass distributions are in better agreement with observations. We also find a slight deficit (˜10 per cent) of baryons at the virial radius, due to the combined effect of AGN-driven convective motions in the inner parts and shock waves in the outer regions, pushing gas to Mpc scales and beyond. This baryon deficit results in a slight adiabatic expansion of the dark matter distribution that can be explained quantitatively by AC theory.

PET/CT detectability and classification of simulated pulmonary lesions using an SUV correction scheme

NASA Astrophysics Data System (ADS)

Morrow, Andrew N.; Matthews, Kenneth L., II; Bujenovic, Steven

2008-03-01

Positron emission tomography (PET) and computed tomography (CT) together are a powerful diagnostic tool, but imperfect image quality allows false positive and false negative diagnoses to be made by any observer despite experience and training. This work investigates PET acquisition mode, reconstruction method and a standard uptake value (SUV) correction scheme on the classification of lesions as benign or malignant in PET/CT images, in an anthropomorphic phantom. The scheme accounts for partial volume effect (PVE) and PET resolution. The observer draws a region of interest (ROI) around the lesion using the CT dataset. A simulated homogenous PET lesion of the same shape as the drawn ROI is blurred with the point spread function (PSF) of the PET scanner to estimate the PVE, providing a scaling factor to produce a corrected SUV. Computer simulations showed that the accuracy of the corrected PET values depends on variations in the CT-drawn boundary and the position of the lesion with respect to the PET image matrix, especially for smaller lesions. Correction accuracy was affected slightly by mismatch of the simulation PSF and the actual scanner PSF. The receiver operating characteristic (ROC) study resulted in several observations. Using observer drawn ROIs, scaled tumor-background ratios (TBRs) more accurately represented actual TBRs than unscaled TBRs. For the PET images, 3D OSEM outperformed 2D OSEM, 3D OSEM outperformed 3D FBP, and 2D OSEM outperformed 2D FBP. The correction scheme significantly increased sensitivity and slightly increased accuracy for all acquisition and reconstruction modes at the cost of a small decrease in specificity.

Cytotoxicity of four categories of dental cements.

PubMed

Schmid-Schwap, Martina; Franz, Alexander; König, Franz; Bristela, Margit; Lucas, Trevor; Piehslinger, Eva; Watts, David C; Schedle, Andreas

2009-03-01

Assessment of dental material biocompatibility is gaining increasing importance for both patients and dentists. Dental cements may be in contact with oral soft tissues for prolonged periods of time and play an important role in prosthetic rehabilitation. The aim of the present study was to evaluate eight dental cements using a standardized L929-fibroblast cell culture test. For each material, fresh specimens (added to the cultures immediately after preparation) and specimens preincubated for 7 days in cell culture medium were prepared according to the manufacturers' recommendations. After exposure to test specimens, cell numbers were compared to glass controls. The main outcome was a two-sided 95% confidence interval for the mean value of the standardized cell number for each substance investigated. Fresh specimens of all tested cements showed significant cytotoxicity, which diminished after 7 days preincubation. Cytotoxicity of fresh adhesive and self-adhesive resin cements was lower when specimens were dual-cured compared to self-cured. A rank order of cytotoxicity was established based on mean values: Nexus 2 (dual-cured) showed least cytotoxicity, followed by Variolink II (dual-cured), Nexus 2 (self-cured), Harvard, RelyxUnicem (dual-cured), Panavia 21, Fujicem, Durelon, Variolink II (self-cured), RelyxUnicem (self-cured), Maxcem (dual-cured) and Maxcem (self-cured). When bondings were added to Nexus 2 or Variolink II specimens, a slight increase in cytotoxicity was observed. Adhesive resin cements showed less cytotoxicity than self-adhesive and chemically setting cements. Bonding only slightly influenced cytotoxicity of the adhesive resin cements. Dual-cured specimens of adhesive and self-adhesive resin cements showed significantly less toxicity than self-cured specimens.

Underwater study of arterial blood pressure in breath-hold divers.

PubMed

Sieber, Arne; L'abbate, Antonio; Passera, Mirko; Garbella, Erika; Benassi, Antonio; Bedini, Remo

2009-11-01

Knowledge regarding arterial blood pressure (ABP) values during breath-hold diving is scanty. It derives from a few reports of measurements performed at the water's surface, showing slight or no increase in ABP, and from a single study of two simulated deep breath-hold dives in a hyperbaric chamber. Simulated dives showed an increase in ABP to values considered life threatening by standard clinical criteria. For the first time, using a novel noninvasive subaquatic sphygmomanometer, we successfully measured ABP in 10 healthy elite breath-hold divers at a depth of 10 m of freshwater (mfw). ABP was measured in dry conditions, at the surface (head-out immersion), and twice at a depth of 10 mfw. Underwater measurements of ABP were obtained in all subjects. Each measurement lasted 50-60 s and was accomplished without any complications or diver discomfort. In the 10 subjects as a whole, mean ABP values were 124/93 mmHg at the surface and 123/94 mmHg at a depth of 10 mfw. No significant statistical differences were found when blood pressure measurements at the water surface were compared with breath-hold diving conditions at a depth of 10 mfw. No systolic blood pressure values >140 mmHg or diastolic blood pressure values >115 mmHg were recorded. In conclusion, direct measurements of ABP during apnea diving showed no or only mild increases in ABP. However, our results cannot be extended over environmental conditions different from those of the present study.

Call to Adopt a Nominal Set of Astrophysical Parameters and Constants to Improve the Accuracy of Fundamental Physical Properties of Stars

NASA Astrophysics Data System (ADS)

Harmanec, Petr; Prša, Andrej

2011-08-01

The increasing precision of astronomical observations of stars and stellar systems is gradually getting to a level where the use of slightly different values of the solar mass, radius, and luminosity, as well as different values of fundamental physical constants, can lead to measurable systematic differences in the determination of basic physical properties. An equivalent issue with an inconsistent value of the speed of light was resolved by adopting a nominal value that is constant and has no error associated with it. Analogously, we suggest that the systematic error in stellar parameters may be eliminated by (1) replacing the solar radius R⊙ and luminosity L⊙ by the nominal values that are by definition exact and expressed in SI units: and ; (2) computing stellar masses in terms of M⊙ by noting that the measurement error of the product GM⊙ is 5 orders of magnitude smaller than the error in G; (3) computing stellar masses and temperatures in SI units by using the derived values and ; and (4) clearly stating the reference for the values of the fundamental physical constants used. We discuss the need and demonstrate the advantages of such a paradigm shift.

The clinical value of 201Tl per rectum scintigraphy in the work-up of patients with alcoholic liver disease.

PubMed

Urbain, D; Reding, P; Georges, B; Thys, O; Ham, H R

1986-01-01

The clinical value of thallium 201 per rectum scintigraphy in the work-up of patients with alcoholic liver disease was evaluated using data obtained in 104 patients. The 25th min ratio of heart to liver activities was used as an index of portal systemic shunting. This ratio was found to be normal in alcoholic patients with normal liver biopsy and also in those presenting only steatosis. It was slightly higher in patients with liver fibrosis and significantly higher values were observed in patients with liver cirrhosis. High values of the ratio were associated with a higher risk of portal systemic encephalopathy and/or gastrointestinal bleeding. The prognostic value of the test was supported by the fact that good correlations were observed between the ratio and widely accepted prognostic scores such as the Child score or the Orrego index. Moreover, high ratios were associated with an increased mortality risk at one year. We conclude that this simple test is interesting in the screening of cirrhotics at risk of encephalopathy, gastrointestinal hemorrhage, or early death.

Diatomite

USGS Publications Warehouse

Crangle, R.D.

2013-01-01

The United States continues to be the world’s leading producer and consumer of diatomite. Production of diatomite in the United States during 2012 was estimated to be 820 kt (903,000 st), a slight increase compared with 2011 production. The unit value of diatomite varied widely by end use in 2012. Diatomite used as a lightweight aggregate was priced at $11/t ($9.98/st), while specialty-grade diatomite, used in art supplies, cosmetics, or biomedical applications, could be priced as high as $10,000/t ($9,000/st). Filter-grade diatomite had an average unit value of $330/t ($299/st). Seven companies operated 10 mines and nine processing facilities in California, Nevada, Oregon and Washington. U.S. diatomite exports totaled about 96 kt (106,000 st). Imports were much lower at approximately 3.07 kt (3,380 st).

Diatomite

USGS Publications Warehouse

Crangle, R.D.

2012-01-01

The United States continues to be the world's leading producer and consumer of diatomite. Production of diatomite in the United States during 2011 was estimated to be 600 kt (661,000 st), a slight increase compared with 2010 production. The unit value of diatomite varied widely by end use in 2011. Diatomite used as a lightweight aggregate was priced at $8.82/t ($8/st), while specialty-grade diatomite, used in art supplies, cosmetics, or biomedical applications, was priced as high as $10,000/t ($9,070/st) on a spot basis. Filter-grade diatomite had an average unit value of $394/t ($357/st). Seven companies operated 10 mines an nine processing facilities in California, Nevada, Oregon and Washington. U.S. diatomite exports totaled about 120 kt (132,000 st). Imports were much lower, at approximately 1 kt (1,100 st).

Trends in the Prevalence of Overweight and Obesity among Chinese Preschool Children from 2006 to 2014.

PubMed

Xiao, Yanyu; Qiao, Yijuan; Pan, Lei; Liu, Jin; Zhang, Tao; Li, Nan; Liu, Enqing; Wang, Yue; Liu, Hongyan; Liu, Gongshu; Huang, Guowei; Hu, Gang

2015-01-01

To examine the trends in the prevalence of overweight and obesity among preschool children from 2006 to 2014. A total of 145,078 children aged 3-6 years from 46 kindergartens finished the annual health examination in Tianjin, China. Height, weight and other information were obtained using standardized methods. Z-scores for weight, height, and BMI were calculated based on the standards for the World Health Organization (WHO) child growth standards. From 2006 to 2014, mean values of height z-scores significantly increased from 0.34 to 0.54, mean values of weight z-scores kept constant, and mean values of BMI z-scores significantly decreased from 0.40 to 0.23. Mean values of height z-scores, weight z-scores, and BMI z-scores slightly decreased among children from 3 to 4 years old, and then increased among children from 4 to 6 years old. Between 2006 and 2014, there were no significant changes in prevalence of overweight (BMI z-scores >2 SD) and obesity (BMI z-scores >3 SD) among 3-4 years children. However, prevalence of obesity (BMI z-scores >2 SD) increased from 8.8% in 2006 to 10.1% in 2010, and then kept stable until 2014 among 5-6 years children. Boys had higher prevalence of obesity than girls. Mean values of BMI z-scores decreased from 2006 to 2014 among Chinese children aged 3-6 years old due to the significant increase of height z-scores. Prevalence of obesity increased from 2006 to 2010, and then kept stable until 2014 among children aged 5-6 years. The prevalence of obesity was higher in boys than in girls.

What Makes Annuitization More Appealing?

PubMed Central

Beshears, John; Choi, James J.; Laibson, David; Madrian, Brigitte C.; Zeldes, Stephen P.

2013-01-01

We conduct and analyze two large surveys of hypothetical annuitization choices. We find that allowing individuals to annuitize a fraction of their wealth increases annuitization relative to a situation where annuitization is an “all or nothing” decision. Very few respondents choose declining real payout streams over flat or increasing real payout streams of equivalent expected present value. Highlighting the effects of inflation increases demand for cost of living adjustments. Frames that highlight flexibility, control, and investment significantly reduce annuitization. A majority of respondents prefer to receive an extra “bonus” payment during one month of the year that is funded by slightly lower payments in the remaining months. Concerns about later-life income, spending flexibility, and counterparty risk are the most important self-reported motives that influence the annuitization decision. PMID:24954961

ESB Clinical Biomechanics Award 2008: Complete data of total knee replacement loading for level walking and stair climbing measured in vivo with a follow-up of 6-10 months.

PubMed

Heinlein, Bernd; Kutzner, Ines; Graichen, Friedmar; Bender, Alwina; Rohlmann, Antonius; Halder, Andreas M; Beier, Alexander; Bergmann, Georg

2009-05-01

Detailed information about the loading of the knee joint is required for various investigations in total knee replacement. Up to now, gait analysis plus analytical musculo-skeletal models were used to calculate the forces and moments acting in the knee joint. Currently, all experimental and numerical pre-clinical tests rely on these indirect measurements which have limitations. The validation of these methods requires in vivo data; therefore, the purpose of this study was to provide in vivo loading data of the knee joint. A custom-made telemetric tibial tray was used to measure the three forces and three moments acting in the implant. This prosthesis was implanted into two subjects and measurements were obtained for a follow-up of 6 and 10 months, respectively. Subjects performed level walking and going up and down stairs using a self-selected comfortable speed. The subjects' activities were captured simultaneously with the load data on a digital video tape. Customized software enabled the display of all information in one video sequence. The highest mean values of the peak load components from the two subjects were as follows: during level walking the forces were 276%BW (percent body weight) in axial direction, 21%BW (medio-lateral), and 29%BW (antero-posterior). The moments were 1.8%BW*m in the sagittal plane, 4.3%BW*m (frontal plane) and 1.0%BW*m (transversal plane). During stair climbing the axial force increased to 306%BW, while the shear forces changed only slightly. The sagittal plane moment increased to 2.4%BW*m, while the frontal and transversal plane moments decreased slightly. Stair descending produced the highest forces of 352%BW (axial), 35%BW (medio-lateral), and 36%BW (antero-posterior). The sagittal and frontal plane moments increased to 2.8%BW*m and 4.6%BW*m, respectively, while the transversal plane moment changed only slightly. Using the data obtained, mechanical simulators can be programmed according to realistic load profiles. Furthermore, musculo-skeletal models can be validated, which until now often lacked the ability to predict properly the non-sagittal load values, e.g. varus-valgus and internal-external moments.

Performance of the American Urological Association Symptom Index with and without an additional urge incontinence item.

PubMed

Barry, Michael J; Avins, Andrew L; Meleth, Sreelatha

2011-09-01

To examine the value of adding an urge incontinence question to the American Urological Association Symptom Index (AUASI) among men in the Complementary and Alternative Medicine for Urological Symptoms (CAMUS) trial. The CAMUS study was a randomized trial of Saw palmetto fruit extract versus placebo among men aged ≥45 years with an AUASI score of ≥8 and ≤24. The baseline measurements included the AUASI, a question about urge incontinence (UI), the International Prostate Symptom Score quality of life question, and the Benign Prostatic Hyperplasia Impact Index. We correlated the items and scales and examined whether adding the UI question resulted in better prediction of disease-specific health status. The mean age of the 369 men in the CAMUS trial was 61 years, and mean baseline AUASI score was 14.6. UI was reported infrequently; about 82% of the respondents answered the question "not at all" or "<1 time in 5." UI correlated significantly with all other AUASI items, except for weak stream; the strongest correlation was to urgency (R=0.51, P<.0001). The correlation between the AUASI score and the AUASI+UI score was 0.98 (P<.0001). In a logistic regression analysis predicting the International Prostate Symptom Score quality of life score, adding UI to the AUASI slightly increased the discriminating ability (c statistic increased from 0.77 to 0.78, P<.0001). Similarly, in a linear regression analysis predicting the Benign Prostatic Hyperplasia Impact Index score, adding UI to the AUASI slightly increased the predictive ability (R2 statistic increased from 0.22 to 0.26, P<.0001). According to our analysis in the CAMUS trial population, the value of adding a UI question to the AUASI in terms of predicting bother seemed small at best. Copyright © 2011 Elsevier Inc. All rights reserved.

Early Spring in Europe: A Result of More Dominant North-Atlantic Southwesterlies?

NASA Technical Reports Server (NTRS)

Otterman, J.; Atlas, R.; Chase, T. N.; Chou, S.-H.; Jusem, J. C.; Pielke, R. A., Sr.; Rogers, J.; Russell, G. L.; Schubert, S. D.; Sud, Y. C.;

Invited paper: Dielectric properties of CaCu3Ti4O12 polycrystalline ceramics

NASA Astrophysics Data System (ADS)

Lee, Sung Yun; Hong, Youn Woo; Yoo, Sang Im

2011-12-01

We investigated the relationship between the microstructures and dielectric properties of various CaCu3Ti4O12 (CCTO) polycrystalline ceramics sintered in air. An abrupt increase in the dielectric constant ( ɛ r) from ˜3,000 to ˜170,000 at 1 kHz occurred with increasing the sintering temperature from 980 to 1000°C for 12 h, respectively, which was accompanied by a very large increase in the average grain size from 5 to 300 µm, respectively, due to an abnormal grain growth. With further increasing the sintering temperature, the ɛ r value at 1 kHz was slightly decreased to ˜150,000 at 1020°C with no variation in the average grain size, significantly decreased to ˜77,000 at 1040°C with a large decrease in the average grain size (˜150 µm), and then maintained the values of ˜76,000 and ˜69,000 at 1060 and 1080°C, respectively, without noticeable variation in the average grain size. While no abnormal grain growth occurred in the CCTO samples sintered at 980°C for the holding time to 24 h and thus their ɛ r values showed relatively lower ɛ r values (< ˜4,000 at 1 kHz), the abnormal grain growth occurred in the samples after a certain holding time at a given sintering temperature of higher than 1000°C and thus their ɛ r values abruptly increased. Analyses by the complex impedance ( Z*) and modulus ( M*) spectroscopy revealed that the ɛ r values of the CCTO samples were dominantly affected by the electrical properties of grain boundary so that high ɛ r values over 10,000 at 1 kHz were attributable to the high capacitance ( C) of grain boundary, which is in good agreement with grain boundary internal barrier layer capacitor (IBLC) model.

Skin temperature evaluation by infrared thermography: Comparison of two image analysis methods during the nonsteady state induced by physical exercise

NASA Astrophysics Data System (ADS)

Formenti, Damiano; Ludwig, Nicola; Rossi, Alessio; Trecroci, Athos; Alberti, Giampietro; Gargano, Marco; Merla, Arcangelo; Ammer, Kurt; Caumo, Andrea

2017-03-01

The most common method to derive a temperature value from a thermal image in humans is the calculation of the average of the temperature values of all the pixels confined within a demarcated boundary defined region of interest (ROI). Such summary measure of skin temperature is denoted as Troi in this study. Recently, an alternative method for the derivation of skin temperature from the thermal image has been developed. Such novel method (denoted as Tmax) is based on an automated (software-driven) selection of the warmest pixels within the ROI. Troi and Tmax have been compared under basal, steady-state conditions, resulting very well correlated and characterized by a bias of approximately 1 °C (Tmax > Troi). Aim of this study was to investigate the relationship between Tmax and Troi under the nonsteady-state conditions induced by physical exercise. Thermal images of quadriceps of 13 subjects performing a squat exercise were recorded for 120 s before (basal steady state) and for 480 s after the initiation of the exercise (nonsteady state). The thermal images were then analysed to extract Troi and Tmax. Troi and Tmax changed almost in parallel during the nonstead -state. At a closer inspection, it was found that during the nonsteady state the bias between the two methods slightly increased (from 0.7 to 1.1 °C) and the degree of association between them slightly decreased (from Pearson's r = 0.96 to 0.83). Troi and Tmax had different relationships with the skin temperature histogram. Whereas Tmax was the mean, which could be interpreted as the centre of gravity of the histogram, Tmax was related with the extreme upper tail of the histogram. During the nonsteady state, the histogram increased its spread and became slightly more asymmetric. As a result, Troi deviated a little from the 50th percentile, while Tmax remained constantly higher than the 95th percentile. Despite their differences, Troi and Tmax showed a substantial agreement in assessing the changes in skin temperature following physical exercise. Further studies are needed to clarify the relationship existing among Tmax, Troi and cutaneous blood flow during physical exercise.

Intramyocardial pressure gradients in working and nonworking isolated cat hearts.

PubMed

Mihailescu, L S; Abel, F L

1994-03-01

This study presents an improved method for the measurement of intramyocardial pressure (IMP) using the servo-nulling mechanism. Glass micropipettes (20-24 microns OD) were used as transducers, coated to increase their mechanical resistance to breakage, and placed inside the left ventricular wall with a micropipette holder and manipulator. IMP was measured at the base of the left ventricle in working and nonworking isolated cat hearts that were perfused with Krebs-Henseleit buffer. In working hearts a transmural gradient of systolic IMP oriented from endocardium toward the epicardium was found; the endocardial values for systolic IMP were slightly higher than systolic left ventricular pressure (LVP), by 11-18%. Increases in afterload induced increases in IMP, without changing the systolic IMP-to-LVP ratio. In nonworking hearts with drained left ventricles, the systolic transmural gradient for IMP described for working hearts persisted, but at lower values, and was directly dependent on coronary perfusion pressure. Systolic IMP-to-LVP ratios were always > 1. The diastolic IMP of both working and nonworking hearts exhibited irregular transmural gradients. Our results support the view that generated systolic IMP is largely independent of LVP development.

Seven years of aerosol scattering hygroscopic growth measurements from SGP: Factors influencing water uptake: Aerosol Scattering Hygroscopic Growth

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jefferson, A.; Hageman, D.; Morrow, H.

Long-term measurements of changes in the aerosol scattering coefficient hygroscopic growth at the U.S. Department of Energy Southern Great Plains site provide information on the seasonal as well as size and chemical dependence of aerosol hygroscopic growth. Annual average sub 10 um fRH values (the ratio of aerosol scattering at 85%/40% RH) were 1.75 and 1.87 for the gamma and kappa fit algorithms, respectively. The study found higher growth rates in the winter and spring seasons that correlated with high aerosol nitrate mass fraction. FRH, exhibited strong, but differing correlations with the scattering Ångström exponent and backscatter fraction, two opticalmore » size-dependent parameters. The aerosol organic fraction had a strong influence, with fRH decreasing with increases in the organic mass fraction and absorption Ångström exponent and increasing with the aerosol single scatter albedo. Uncertainty analysis if the fit algorithms revealed high uncertainty at low scattering coefficients and slight increases in uncertainty at high RH and fit parameters values.« less

Self-assembling N-(9-Fluorenylmethoxycarbonyl)-l-Phenylalanine hydrogel as novel drug carrier.

PubMed

Snigdha, Kirti; Singh, Brijesh K; Mehta, Abijeet Singh; Tewari, R P; Dutta, P K

2016-12-01

Supramolecular hydrogel as a novel drug carrier was prepared from N-(9-Fluorenylmethoxycarbonyl) (Fmoc) modified l-phenylalanine. Its different properties like stability at different pH, temperature and rheology were evaluated in reference to salicylic acid (SA) as a model drug, entrapped in the supramolecular hydrogel network. The release behaviour of SA drug in supramolecular hydrogel was investigated by UV-vis spectroscopy. The influence of hydrogelator, pH values of the accepting media, temperature and concentration of SA drug on the release behaviour was investigated under static conditions. The results indicated that the release rate of SA in the supramolecular hydrogels was slightly retarded with an increase of the hydrogelator concentration. Also, the release rates of SA increased with an increase of temperature and its concentration. Furthermore, the release behaviour of SA was found to be different at various pH values in buffers. The study of the release kinetics indicated that the release behaviour of SA from the carrier was in accord with the Peppas model and the diffusion controlled mechanism involved in the Fickian model. Copyright © 2016 Elsevier B.V. All rights reserved.

Corrosion Mechanism of Low-Carbon Steel in Industrial Water and Adsorption Thermodynamics in the Presence of Some Plant Extracts

NASA Astrophysics Data System (ADS)

Badiea, A. M.; Mohana, K. N.

2009-12-01

The effects of radish leaves and black cumin as plant extracts on the corrosion behavior of low-carbon steel in industrial water in the temperature range of 30 to 80 °C and velocity range of 1.44 to 2.02 m s-1 using potentiodynamic polarization, electrochemical impedance spectroscopy, and mass loss measurements have been investigated. The inhibition efficiency increased with increasing concentration of the plant extracts up to a critical value but it slightly decreased with increasing temperature. Inhibition efficiency values obtained from mass loss and potentiodynamic data were in reasonable agreement. Potentiodynamic polarization clearly indicated that radish leaves and black cumin extracts acted as anodic inhibitors. The adsorption behavior was found to obey the Flory-Huggins isotherm model. The associated activation parameters and thermodynamic data of adsorption were evaluated and discussed. The results show that radish leaves and black cumin could serve as effective inhibitors for low-carbon steel in industrial water media, with black cumin providing better protection than radish leaves.

The influenced of reaction time on the degradation of palm oil empty fruit bunch (EFB) in hydrothermal carbonization

NASA Astrophysics Data System (ADS)

Sarwono, Rakhman; Kurniawan, Hendris Hendarsyah

2017-11-01

Hydrothermal carbonization (HTC) of empty fruit bunch (EFB) of palm oil in different reaction times were investigated. Experiments were carried out in an autoclave at different reaction time of 3,6,9, 15, 20, 25 and 40 hours. With a fixed solid/liquid ratio of 5 gram of EFB in 50 ml water as a solvent, and temperature reaction of 250 °C. Increase the reaction time the soluble products are also increased. The liquid products were analyzed using GCMS to determine the chemical composition. The chemical composition were greatly affected by the reaction time. The main component was glycolic acid, by increasing the reaction time made the varieties of chemical compositions in liquid products, especially for the glycolic acid component, it was decreased slightly. The higher heating value (HHV) also increase slighly by increasing the reaction time both solid and liquid products.

1969 Washington timber harvest.

Treesearch

Brian R. Wall

1970-01-01

Washington's timber harvest increased slightly in 1969 to a 40-year high of 7 billion board feet. This is slightly below the record timber harvest of 7.38 billion board feet established in 1829. Private timberland owners in western Washington increased their production 10.9 percent, accounting for most of the increase in the 1969 total harvest. In eastern...

Nutrient recovery from apple pomace waste by vermicomposting technology.

PubMed

Hanc, Ales; Chadimova, Zuzana

2014-09-01

The present work was focused on vermicomposting apple pomace waste and its mixtures with straw in volume proportions of 25%, 50%, and 75%. The feasibility was evaluated on the basis of agrochemical properties and earthworm biomass. Vermicomposting was able to reduce the weight and volume of the feedstock by 65% and 85%, respectively. The resulting vermicomposts were characterized by slightly acidic to neutral pH (5.9-6.9), and optimal EC (1.6-4.4mS/cm) and C:N ratios (13-14). The total content of nutrients increased during vermicomposting for all of the treatments with the following average final values: N=2.8%, P=0.85%, K=2.3%, and Mg=0.38%. The addition of straw to apple pomace did not enhance earthworm biomass, but did increase the available content of nutrients during vermicomposting. The data reveals that vermicomposting is a suitable technology for the decomposition of apple pomace waste into a value added product. Copyright © 2014 Elsevier Ltd. All rights reserved.

Modeling power flow in the induction cavity with a two dimensional circuit simulation

NASA Astrophysics Data System (ADS)

Guo, Fan; Zou, Wenkang; Gong, Boyi; Jiang, Jihao; Chen, Lin; Wang, Meng; Xie, Weiping

2017-02-01

We have proposed a two dimensional (2D) circuit model of induction cavity. The oil elbow and azimuthal transmission line are modeled with one dimensional transmission line elements, while 2D transmission line elements are employed to represent the regions inward the azimuthal transmission line. The voltage waveforms obtained by 2D circuit simulation and transient electromagnetic simulation are compared, which shows satisfactory agreement. The influence of impedance mismatch on the power flow condition in the induction cavity is investigated with this 2D circuit model. The simulation results indicate that the peak value of load voltage approaches the maximum if the azimuthal transmission line roughly matches the pulse forming section. The amplitude of output transmission line voltage is strongly influenced by its impedance, but the peak value of load voltage is insensitive to the actual output transmission line impedance. When the load impedance raises, the voltage across the dummy load increases, and the pulse duration at the oil elbow inlet and insulator stack regions also slightly increase.

Dynamic Yielding and Spall Behavior of Commercially Pure Grade 4 Titanium

NASA Astrophysics Data System (ADS)

Thadhani, Naresh; Whelchel, R. L.; Sanders, Tom; Mehkote, D. S.; Iyer, K. A.; Georgia Instiutute of Technology Collaboration; Johns Hopkins University, Applied Physics Labortaory Collaboration

2015-06-01

The dynamic yielding and fracture (spalling) of commercially pure (grade 4) titanium are investigated using symmetric plate impact experiments over a peak stress range of 5.6 GPa to 12.5 GPa, using the 80-mm single-stage gas-gun. VISAR rear free surface velocity profiles display both a Hugoniot elastic limit (HEL) and a velocity pullback, which are indicative of dynamic compressive yielding and tensile fracture (spalling), respectively. The HEL values appear to show a slight decrease with peak stress from 2.2 GPa to 2.0 GPa along with a corresponding increase in twinning observed in recovered impacted samples. The spall strength on the other hand increases with peak stress from a value of 3.3 GPa to 3.8 GPa and shows a good power law fit with the decompression strain rate. The differing responses in dynamic yield and fracture behavior suggest that void nucleation may be the dominant mechanism affecting the spall strength of grade 4 titanium.

Performance characteristics of rubber seed oil biodiesel

NASA Astrophysics Data System (ADS)

Liu, P.; Qin, M.; Wu, J.; Chen, B. S.

2018-01-01

The lubricity, ignition quality, oxidative stability, low temperature flow property and elastomeric compatibility of rubber seed oil biodiesel(RSM) were evaluated and compared with conventional petro-diesel. The results indicated that RSM and its blends with petro-diesel possessed outstanding lubricity manifested by sharp decrease in wear scar diameters in the high-frequency reciprocating rig(HFRR) testing. They also provided acceptable flammability and cold flow property,although the cetane numbers (CN) and cold filter plugging points(CFPP) of biodiesel blends slightly decreased with increasing contents of petro-diesel. However, RSM proved to be very susceptible to oxidation at elevated temperatures during prolonged oxidation durations, characterized by increased peroxide values, viscosity, acid values and isooctane insolubles. The oxidation stability of RSM could be significantly improved by antioxidants such as BD100, a phenol antioxidant produced by Ciba corporation. Furthermore, RSM provided poor compatibility with some elastomeric rubbers such as polyacrylate, nitrile-butadiene and chloroprene, but was well compatible with the hydrogenated nitrile-butadiene elastomer.

Impact of blanching, sweating and drying operations on pungency, aroma and color of Piper borbonense.

PubMed

Weil, M; Shum Cheong Sing, A; Méot, J M; Boulanger, R; Bohuon, P

2017-03-15

Low pungency, high aromatic potential and red color, give to Piper borbonense its originality when compared to Piper nigrum. Effects of blanching, sweating and drying on these characteristics were assessed. The three operations had no impact on the concentration of piperine and essential oil but affected the composition of essential oil slightly and considerably affected the color of the pepper. The "wet process", including blanching, sweating and drying, had the largest impact on the composition of aroma, increasing para-cymene content by 89% and reducing safrole content by 33% in dried pepper compared to fresh. Blanching increased the drying rate thus reducing drying time. Drying had a major impact on color, which changed from red to brown. The biggest differences observed led to reductions of 2.2, 7.9 and 8.4units in L ∗ , a ∗ and b ∗ values, when chromatic values measured in fresh pepper were compared to those of dried pepper. Copyright © 2016 Elsevier Ltd. All rights reserved.

Storage stability and composition changes of three cold-pressed nut oils under refrigeration and room temperature conditions.

PubMed

Rabadán, Adrián; Álvarez-Ortí, Manuel; Pardo, José Emilio; Alvarruiz, Andrés

2018-09-01

Chemical composition and stability parameters of three cold-pressed nut oils (almond, walnut and pistachio) were monitored for up to 16 months of storage at 5 °C, 10 °C, 20 °C and room temperature. Freshly pressed pistachio oil had lower peroxide value than almond oil and higher induction period than almond and walnut oils, indicating a higher stability. The peroxide values increased faster at room temperature than at lower temperatures during the storage time, and the highest increase was for pistachio oil stored at room temperature exposed to daylight. The induction period decreased for all three nut oils during the storage time, regardless of the storage conditions. Pistachio oil remained the most stable oil at the end of the storage time, followed by almond oil. The percentage of polyunsaturated fatty acids decreased slightly throughout the storage. Copyright © 2018 Elsevier Ltd. All rights reserved.

Simulation of hydrodynamics, temperature, and dissolved oxygen in Table Rock Lake, Missouri, 1996-1997

USGS Publications Warehouse

Green, W. Reed; Galloway, Joel M.; Richards, Joseph M.; Wesolowski, Edwin A.

2003-01-01

Outflow from Table Rock Lake and other White River reservoirs support a cold-water trout fishery of substantial economic yield in south-central Missouri and north-central Arkansas. The Missouri Department of Conservation has requested an increase in existing minimum flows through the Table Rock Lake Dam from the U.S. Army Corps of Engineers to increase the quality of fishable waters downstream in Lake Taneycomo. Information is needed to assess the effect of increased minimum flows on temperature and dissolved- oxygen concentrations of reservoir water and the outflow. A two-dimensional, laterally averaged, hydrodynamic, temperature, and dissolved-oxygen model, CE-QUAL-W2, was developed and calibrated for Table Rock Lake, located in Missouri, north of the Arkansas-Missouri State line. The model simulates water-surface elevation, heat transport, and dissolved-oxygen dynamics. The model was developed to assess the effects of proposed increases in minimum flow from about 4.4 cubic meters per second (the existing minimum flow) to 11.3 cubic meters per second (the increased minimum flow). Simulations included assessing the effect of (1) increased minimum flows and (2) increased minimum flows with increased water-surface elevations in Table Rock Lake, on outflow temperatures and dissolved-oxygen concentrations. In both minimum flow scenarios, water temperature appeared to stay the same or increase slightly (less than 0.37 ?C) and dissolved oxygen appeared to decrease slightly (less than 0.78 mg/L) in the outflow during the thermal stratification season. However, differences between the minimum flow scenarios for water temperature and dissolved- oxygen concentration and the calibrated model were similar to the differences between measured and simulated water-column profile values.

Detection of Dental Secondary Caries Using Frequency-Domain Infrared Photothermal Radiometry (PTR) and Modulated Luminescence (LUM)

NASA Astrophysics Data System (ADS)

Kim, J.; Mandelis, A.; Matvienko, A.; Abrams, S.; Amaechi, B. T.

2012-11-01

The ability of frequency-domain photothermal radiometry (PTR) and modulated luminescence (LUM) to detect secondary caries is presented. Signal behavior upon sequential demineralization and remineralization of a spot (diameter ~1 mm) on a vertical wall of sectioned tooth samples was investigated experimentally. From these studies, it was found that PTR-LUM signals change, showing a certain pattern upon progressive demineralization and remineralization. PTR amplitudes slightly decreased upon progressive demineralization and slightly increased upon subsequent remineralization. The PTR phase increased during both demineralization and remineralization. LUM amplitudes exhibit a decreasing trend at excitation/probe distances larger than 200 μm away from the edge for both demineralization and remineralization; however, at locations close to the edge (up to ~200 μm), LUM signals slightly decrease upon demineralization and slightly increase during subsequent remineralization.

Vocal tract resonances in singing: The soprano voice

NASA Astrophysics Data System (ADS)

Joliveau, Elodie; Smith, John; Wolfe, Joe

2004-10-01

The vocal tract resonances of trained soprano singers were measured while they sang a range of vowels softly at different pitches. The measurements were made by broad band acoustic excitation at the mouth, which allowed the resonances of the tract to be measured simultaneously with and independently from the harmonics of the voice. At low pitch, when the lowest resonance frequency R1 exceeded f0, the values of the first two resonances R1 and R2 varied little with frequency and had values consistent with normal speech. At higher pitches, however, when f0 exceeded the value of R1 observed at low pitch, R1 increased with f0 so that R1 was approximately equal to f0. R2 also increased over this high pitch range, probably as an incidental consequence of the tuning of R1. R3 increased slightly but systematically, across the whole pitch range measured. There was no evidence that any resonances are tuned close to harmonics of the pitch frequency except for R1 at high pitch. The variations in R1 and R2 at high pitch mean that vowels move, converge, and overlap their positions on the vocal plane (R2,R1) to an extent that implies loss of intelligibility. .

The bile acid turnover rate assessed with the (75)SeHCAT test is stable in chronic diarrhoea but slightly decreased in healthy subjects after a long period of time.

PubMed

Bajor, Antal; Kilander, Anders; Sjövall, Henrik; Rudling, Mats; Ung, Kjell-Arne

2008-11-01

The stability of bile acid turnover rate was evaluated retrospectively using repeat SeHCAT tests in patients with chronic diarrhoea and prospectively for 16 years in healthy subjects. The SeHCAT values were stable in 39 patients with chronic diarrhoea, as shown by a comparison of the test results [data presented as median and (25th-75th percentile)]: 18% (8-23) in the first test versus 14% (9-21) in the second test [n = 39, P = 0.37, time interval 44 months (16-68), repeatability index >95%]. In contrast, they were reduced after 16 years in healthy subjects: 38% (30-49.5) in the first test versus 31% (21-49.5) in the second test (P < 0.03). In healthy subjects, the body mass index increased by 13% from 23.2 kg/m(2) (21-24.6) to 26.2 kg/m(2) (22.5-27.8) (P < 0.01) during the 16 years. There was a negative correlation between hepatic bile acid synthesis and the SeHCAT values (r = -0.615, P = 0.02, n = 14). In conclusion, the turnover rate of bile acids is stable over a long period of time in patients with chronic diarrhoea irrespective of bile acid malabsorption, suggesting that a repeat SeHCAT test is dispensable. There is a significant negative correlation between bile acid synthesis and SeHCAT test results in healthy subjects. The SeHCAT test values are slightly reduced in healthy subjects after 16 years.

Reuse of imputed data in microarray analysis increases imputation efficiency

PubMed Central

Kim, Ki-Yeol; Kim, Byoung-Jin; Yi, Gwan-Su

2004-01-01

Background The imputation of missing values is necessary for the efficient use of DNA microarray data, because many clustering algorithms and some statistical analysis require a complete data set. A few imputation methods for DNA microarray data have been introduced, but the efficiency of the methods was low and the validity of imputed values in these methods had not been fully checked. Results We developed a new cluster-based imputation method called sequential K-nearest neighbor (SKNN) method. This imputes the missing values sequentially from the gene having least missing values, and uses the imputed values for the later imputation. Although it uses the imputed values, the efficiency of this new method is greatly improved in its accuracy and computational complexity over the conventional KNN-based method and other methods based on maximum likelihood estimation. The performance of SKNN was in particular higher than other imputation methods for the data with high missing rates and large number of experiments. Application of Expectation Maximization (EM) to the SKNN method improved the accuracy, but increased computational time proportional to the number of iterations. The Multiple Imputation (MI) method, which is well known but not applied previously to microarray data, showed a similarly high accuracy as the SKNN method, with slightly higher dependency on the types of data sets. Conclusions Sequential reuse of imputed data in KNN-based imputation greatly increases the efficiency of imputation. The SKNN method should be practically useful to save the data of some microarray experiments which have high amounts of missing entries. The SKNN method generates reliable imputed values which can be used for further cluster-based analysis of microarray data. PMID:15504240

Mechanical Properties of Cu-Cr-Nb Alloys

NASA Technical Reports Server (NTRS)

Ellis, David L.

1997-01-01

The chemical compositions of the alloys are listed. The alloying levels were near the values for stochiometric Cr2Nb. A slight excess of Cr was chosen for increased hydrogen embrittlement resistance. The microstructures of all Cu-Cr-Nb alloys were very similar. Two typical transmission electron microscope (TEM) micrographs are presented. The images show the presence of large mount of Cr2Nb precipitates in a nearly pure Cu matrix. The interactions between dislocations and precipitates are currently under investigations, but as the images demonstrates, the extremely fine (less then 15 nm) Cr2Nb are the primary strengtheners for the alloy.

Simulation study of entropy production in the one-dimensional Vlasov system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dai, Zongliang, E-mail: liangliang1223@gmail.com; Wang, Shaojie

2016-07-15

The coarse-grain averaged distribution function of the one-dimensional Vlasov system is obtained by numerical simulation. The entropy productions in cases of the random field, the linear Landau damping, and the bump-on-tail instability are computed with the coarse-grain averaged distribution function. The computed entropy production is converged with increasing length of coarse-grain average. When the distribution function differs slightly from a Maxwellian distribution, the converged value agrees with the result computed by using the definition of thermodynamic entropy. The length of the coarse-grain average to compute the coarse-grain averaged distribution function is discussed.

A descriptive analysis of the 2008 credit crisis on multistate healthcare systems: what impact did it have on their financial performance?

PubMed

McCue, Michael J

2010-01-01

Due to the recent credit crisis and recession of 2008, hospitals experienced substantial losses in their investment portfolios. The author analyzed key financial accounts of 15 large, multistate healthcare systems that measured their changes in value of their investments, changes in net assets, liquidity ratios, and other performance ratios. Overall, he found that the majority of these systems did incur financial losses in their investment portfolios; however, for the majority of these systems, their liquidity and cash flow margin ratios declined slightly whereas their capital expenditure and community benefits increased.

Oxygen isotope constraints on the sulfur cycle over the past 10 million years.

PubMed

Turchyn, Alexandra V; Schrag, Daniel P

2004-03-26

Oxygen isotopes in marine sulfate (delta18O(SO4)) measured in marine barite show variability over the past 10 million years, including a 5 per mil decrease during the Plio-Pleistocene, with near-constant values during the Miocene that are slightly enriched over the modern ocean. A numerical model suggests that sea level fluctuations during Plio-Pleistocene glacial cycles affected the sulfur cycle by reducing the area of continental shelves and increasing the oxidative weathering of pyrite. The data also require that sulfate concentrations were 10 to 20% lower in the late Miocene than today.

Studies on the compressibility of wax matrix granules of acetaminophen and their admixtures with various tableting bases.

PubMed

Uhumwangho, M U; Okor, R S

2006-04-01

Matrix granules of acetaminophen have been formed by a melt granulation process whereby the acetaminophen powder was triturated with the melted wax--goat wax, glyceryl monostearate or carnuba wax. The compressibility of the matrix granules and their admixture, with diluent granules (lactose, alpha-cellulose or microcrystalline cellulose) was investigated. The granules were compressed to tablets at a constant load (30 arbitrary units on the load scale) of a manesty single punch machine. Resulting tablets were evaluated for tensile strength (T) and disintegration times (DT). Granule flow was determined by measuring their angle of repose when allowed to fall freely on a level surface. Matrix granules prepared by melt granulation with goat wax or glyceryl monostearate were too sticky and therefore did not flow at all. They were also poorly compressible (T values = 0.20MN/m2). Inclusion of the diluent remarkably improved granule flow property and compressibility. The T values of the tablets (measure of compressibility) increased from about 0.24 to 0.65 MN/m2 during increase in diluent (lactose) content from 20 to 80 %w/w. Microcrystalline cellulose and alpha-cellulose were more effective than lactose in promoting compressibility of the granules. By contrast the matrix granules formed with carnuba wax were free flowing (angle of repose, 18.60). Addition of the diluent further improved flowability slightly. The matrix granules (without a diluent) were readily compressible (T value, 1.79MN/m2). Addition of the diluent (80%w/w) reduced T values (MN/m2) slightly to 1.32 (lactose), 1.48 (alpha-cellulose) and 1.74 (microcrystalline cellulose). Tablets of the matrix granules only, disintegrated rapidly within 3 minutes. DT was further reduced to <30 s by addition of any of the diluents. The indication is that the inclusion of the diluents studied can be used to improve the compressibility of the otherwise poorly compressible matrix granules. Based on the flowability, compressibility, and disintegration data, carnuba wax proved most promising in the melt granulation of the test drug for sustained release applications.

Ground-water movement and effects of coal strip mining on water quality of high-wall lakes and aquifers in the Macon-Huntsville area, north- central Missouri

USGS Publications Warehouse

Hall, D.C.; Davis, R.E.

1986-01-01

Glacial drift and Pennsylvanian bedrock were mixed together forming spoil during pre-reclamation strip mining for coal in north-central Missouri. This restructuring of the land increases the porosity of the material, and increases aqueous concentrations of many dissolved constituents. Median sodium and bicarbonate concentrations were slightly greater, calcium 5 times greater, magnesium 6 times greater, manganese 15 times greater, iron 19 times greater, and sulfate 24 times greater in water from spoil than in water from glacial drift. Median potassium concentrations were slightly greater, and chloride concentrations were two times greater in water from glacial drift than in water from spoil. Water types in glacial drift and bedrock were mostly sodium bicarbonate and calcium bicarbonate; in spoil and lakes in the spoil, the water types were mostly calcium sulfate. Median pH values in water from spoil were 6.6, as compared to 7.4 in water from glacial drift and 9.0 in water from bedrock. Neutralization of acid by carbonate rocks causes the moderate pH values in water from spoil; a carbonate system closed to the atmosphere may result in alkaline pH values in bedrock. Transmissivities generally are greatest for spoil, and decrease in the following order: alluvium, glacial drift, and bedrock. Recharge to spoil is from precipitation, lateral flow from glacial drift, and lateral and vertical flow from bedrock. The rate of recharge to the aquifers is unknown, but probably is small. Groundwater discharge from the glacial drift, bedrock, and spoil is to alluvium. The direction of flow generally was from high-wall lakes in the spoil toward East Fork Little Chariton River or South Fork Claybank Creek. Significant differences (95% confidence level) in values and concentrations of aqueous constituents between spoil areas mined at different times (1940, 1952, and 1968) were obtained for pH, calcium, magnesium, manganese, sulfate, chloride, and dissolved solids, but not for iron. These differences are attributed to local variations in the geohydrologic system rather than spoil age. (Lantz-PTT)

New p-methylsulfonamido phenylethylamine analogues as class III antiarrhythmic agents: design, synthesis, biological assay, and 3D-QSAR analysis.

PubMed

Liu, Hong; Ji, Ming; Luo, Xiaomin; Shen, Jianhua; Huang, Xiaoqin; Hua, Weiyi; Jiang, Hualiang; Chen, Kaixian

2002-07-04

Class III antiarrhythmic agents selectively delay the effective refractory period (ERP) and increase the transmembrane action potential duration (APD). Using dofetilide (2) as a template of class III antiarrhythmic agents, we designed and synthesized 16 methylsulfonamido phenylethylamine analogues (4a-d and 5a-l). Pharmacological assay indicated that all of these compounds showed activity for increasing the ERP in isolated animal atrium; among them, the effective concentration of compound 4a is 1.6 x 10(-8) mol/L in increasing ERP by 10 ms, slightly less potent than that of 2, 1.1 x 10(-8) mol/L. Compound 4a also produced a slightly lower change in ERP at 10(-5) M, DeltaERP% = 17.5% (DeltaERP% = 24.0% for dofetilide). On the basis of this bioassay result, these 16 compounds together with dofetilide were investigated by the three-dimensional quantitative structure-activity relationship (3D-QSAR) techniques of comparative molecular field analysis (CoMFA), comparative molecular similarity index analysis (CoMSIA), and the hologram QSAR (HQSAR). The 3D-QSAR models were tested with another 11 compounds (4e-h and 5m-s) that we synthesized later. Results revealed that the CoMFA, CoMSIA, and HQSAR predicted activities for the 11 newly synthesized compounds that have a good correlation with their experimental value, r(2) = 0.943, 0.891, and 0.809 for the three QSAR models, respectively. This indicates that the 3D-QSAR models proved a good predictive ability and could describe the steric, electrostatic, and hydrophobic requirements for recognition forces of the receptor site. On the basis of these results, we designed and synthesized another eight new analogues of methanesulfonamido phenylethyamine (6a-h) according to the clues provided by the 3D-QSAR analyses. Pharmacological assay indicated that the effective concentrations of delaying the ERP by 10 ms of these newly designed compounds correlated well with the 3D-QSAR predicted values. It is remarkable that the percent change of delaying ERP at 10(-5) M compound 6c is much higher than that of dofetilide; the effective concentration of compound 6c is 5.0 x 10(-8)mol/L in increasing the ERP by 10 ms, which is slightly lower than that of 2. The results showed that the 3D-QSAR models are reliable and can be extended to design new antiarrhythmic agents.

Effects of complete water fasting and regeneration diet on kidney function, oxidative stress and antioxidants.

PubMed

Mojto, V; Gvozdjakova, A; Kucharska, J; Rausova, Z; Vancova, O; Valuch, J

2018-01-01

The aim of the study was to observe the influence of 11-days complete water fasting (WF) and regeneration diet (RD) on renal function, body weight, blood pressure and oxidative stress. Therapeutic WF is considered a healing method. Ten volunteers drank only water for 11 days, followed by RD for the next 11 days. Data on body weight, blood pressure, kidney functions, antioxidants, lipid peroxidation, cholesterols, triacylglycerols and selected biochemical parameters were obtained. WF increased uric acid and creatinine and decreased glomerular filtration rate. After RD, the parameters were comparable to baseline values. Urea was not affected. Lipid peroxidation (TBARS) decreased and maintained stable after RD. Fasting decreased α-tocopherol and increased γ-tocopherol, no significant changes were found after RD. Coenzyme Q10 decreased after RD. HDL-cholesterol decreased in WF. Total- and LDL-cholesterol decreased after RD. Other biochemical parameters were within the range of reference values. The effect of the complete fasting on kidney function was manifested by hyperuricemia. Renal function was slightly decreased, however maintained within the reference values. After RD, it returned to baseline values. The positive effect of the complete water fasting was in the reduction of oxidative stress, body weight and blood pressure (Tab. 3, Ref. 25).

Detector evaluation of a prototype amorphous selenium-based full field digital mammography system

NASA Astrophysics Data System (ADS)

Jesneck, Jonathan L.; Saunders, Robert S.; Samei, Ehsan; Xia, Jessie Q.; Lo, Joseph Y.

2005-04-01

This study evaluated the physical performance of a selenium-based direct full-field digital mammography prototype detector (Siemens Mammomat NovationDR), including the pixel value vs. exposure linearity, the modulation transfer function (MTF), the normalized noise power spectrum (NNPS), and the detective quantum efficiency (DQE). The current detector is the same model which received an approvable letter from FDA for release to the US market. The results of the current prototype are compared to those of an earlier prototype. Two IEC standard beam qualities (RQA-M2: Mo/Mo, 28 kVp, 2 mm Al; RQA-M4: Mo/Mo, 35 kVp, 2 mm Al) and two additional beam qualities (MW2: W/Rh, 28 kVp, 2 mm Al; MW4: W/Rh, 35 kVp, 2 mm Al) were investigated. To calculate the modulation transfer function (MTF), a 0.1 mm Pt-Ir edge was imaged at each beam quality. Detector pixel values responded linearly against exposure values (R2 0.999). As before, above 6 cycles/mm Mo/Mo MTF was slightly higher along the chest-nipple axis compared to the left-right axis. MTF was comparable to the previously reported prototype, with slightly reduced resolution. The DQE peaks ranged from 0.71 for 3.31 μC/kg (12.83 mR) to 0.4 for 0.48 μC/kg (1.86 mR) at 1.75 cycles/mm for Mo/Mo at 28 kVp. The DQE range for W/Rh at 28 kVP was 0.81 at 2.03 μC/kg (7.87 mR) to 0.50 at 0.50 μC/kg (1.94 mR) at 1 cycle/mm. NNPS tended to increase with greater exposures, while all exposures had a significant low-frequency component. Bloom and detector edge artifacts observed previously were no longer present in this prototype. The new detector shows marked noise improvement, with slightly reduced resolution. There remain artifacts due to imperfect gain calibration, but at a reduced magnitude compared to a prototype detector.

Preparation and characterization of bio-nanocomposite films of agar and silver nanoparticles: laser ablation method.

PubMed

Rhim, Jong-Whan; Wang, Long-Feng; Lee, Yonghoon; Hong, Seok-In

2014-03-15

Silver nanoparticles (AgNPs) were prepared by a laser ablation method and composite films with the AgNPs and agar were prepared by solvent casting method. UV-vis absorbance test and transmission electron microscopy (TEM) analysis results revealed that non-agglomerated spherical AgNPs were formed by the laser ablation method. The surface color of the resulting agar/AgNPs films exhibited the characteristic plasmonic effect of the AgNPs with the maximum absorption peaks of 400-407 nm. X-ray diffraction (XRD) test results also exhibited characteristic AgNPs crystals with diffraction peaks observed at 2θ values of 38.39°, 44.49°, and 64.45°, which were corresponding to (111), (200), and (220) crystallographic planes of face-centered cubic (fcc) silver crystals, respectively. Thermogravimetric analysis (TGA) results showed that thermal stability of the agar/AgNPs composite films was increased by the inclusion of metallic silver. Water vapor barrier properties and surface hydrophobicity of the agar/AgNPs films increased slightly with the increase in AgNPs content but they were not statistically significant (p>0.05), while mechanical strength and stiffness of the composite films decreased slightly (p<0.05). The agar/AgNPs films exhibited distinctive antimicrobial activity against both Gram-positive (Listeria monocytogenes) and Gram-negative (Escherichia coli O157:H7) bacterial pathogens. Copyright © 2014 Elsevier Ltd. All rights reserved.

Annealing effect on thermal conductivity and microhardness of carbon nanotube containing Se80Te16Cu4 glassy composites

NASA Astrophysics Data System (ADS)

Upadhyay, A. N.; Tiwari, R. S.; Singh, Kedar

2018-02-01

This study deals with the effect of thermal annealing on structural/microstructural, thermal and mechanical behavior of pristine Se80Te16Cu4 and carbon nanotubes (CNTs) containing Se80Te16Cu4 glassy composites. Pristine Se80Te16Cu4, 3 and 5 wt%CNTs-Se80Te16Cu4 glassy composites are annealed in the vicinity of glass transition temperature to onset crystallization temperature (340-380 K). X-ray diffraction (XRD) pattern revealed formation of polycrystalline phases of hexagonal CuSe and trigonal selenium. The indexed d-values in XRD patterns are in well conformity with the d-values obtained after the indexing of the ring pattern of selected area electron diffraction pattern of TEM images. The SEM investigation exhibited that the grain size of the CNTs containing Se80Te16Cu4 glassy composites increased with increasing annealing temperature and decreased at further higher annealing temperature. Thermal conductivity, microhardness exhibited a substantial increase with increasing annealing temperature of 340-360 K and slightly decreases for 380 K. The variation of thermal conductivity and microhardness can be explained by cross-linking formation and voids reduction.

RBC count

MedlinePlus

... common measurements for results of these tests. Normal value ranges may vary slightly among different laboratories. Some labs use different measurements or test different samples. Talk to your health ...

Changes of Bone-Related Minerals during Denosumab Administration in Post-Menopausal Osteoporotic Patients.

PubMed

Suzuki, Takako; Nakamura, Yukio; Kato, Hiroyuki

2017-08-13

This retrospective study included 21 patients with primary osteoporosis who were treated with the anti-resorption drug, denosumab. To date, there has been no detailed report on the changes of bone-related minerals after anti-resorption drug therapy. Twenty-one post-menopausal females were retrospectively enrolled. Serum zinc (Zn), magnesium (Mg), iron (Fe), copper (Cu), grip strength, and estimated glomerular filtration rate (eGFR) were examined at one week and 1, 2, 4, 6, 8, 10, and 12 months. Lumbar spine (L1-4) bone mineral density (L-BMD) and bilateral total hip BMD (H-BMD) were examined before and at 4, 8, and 12 months after treatment commencement. Serum Zn tended to decrease at one week and one month, and tended to increase during 10 to 12 months. Serum Cu maintained during zero to eight months, then decreased at 10 and 12 months. Serum Fe gradually increased after four months. Serum Mg sharply increased at one week, then decreased further. Grip strength increased for two months, then slightly decreased and maintained 4 to 12 months. eGFR almost maintained for zero to eight months, then slightly decreased thereafter. L-BMD values significantly increased at eight (5.8%) ( p < 0.01) and 12 months (9.8%) ( p < 0.01). H-BMD increased during the period (at 12 months: 3.7%). These results suggest that at later phases of denosumab therapy, Zn and Fe tended to increase while Mg tended to decrease, all of which are important for bone metabolism. Thus, denosumab might improve Zn and Fe metabolism, and thereby likely increase BMD. Since denosumab may not improve Mg, it is better to obtain Mg supplementation during the therapy.

Midlevel Administrators' Pay Increases Slightly but Doesn't Match Inflation

ERIC Educational Resources Information Center

Fuller, Andrea

2012-01-01

Salaries for midlevel administrators rose by a median of 2 percent this year over last year, matching the median pay increase for senior administrators and coming in slightly higher than the 1.9-percent median increase for faculty members, says an annual report released by the College and University Professional Association for Human Resources.…

[Not Available].

PubMed

Ackerman, E

1977-01-01

Acceptance of birth control increased greatly among the inhabitants of Bonnieres, a French community situated on the left bank of the Seine, immediately following the 1789-1799 French Revolution. Increased acceptance of birth control was attributed to the general questioning of traditional values and beliefs which occurred during and immediately following the revolution. The revolutionary spirit allowed individuals to feel a greater sense of control over their own destiny. Prior to the revolution, Catholic teaching concerning sexual matters were followed by almost all of the inhabitants of Bonnieres. During the period 1736-1785 there was some increase in birth control acceptance, but the changes were slight compared to those which occurred following the revolution. During 1736-1785, average completed family size decreased slight from 5.8-5.6; however during 1786-1815, average completed family size was 3.9 and during the period 1816-1845, it was 2.9. An examination of changes in birth intervals suggested that during the period 1756-1785, 9.2-18.0% of the population practiced some form of birth control while 37.8-42.8% of the population practiced birth control during the period 1786-1815. An examination of age specific fertility rates further demonstrated that the major increase in birth control practice occurred immediately following the revolution. Birth control acceptance occurred despite a continuing infant mortality rate of 123-195/1000 throughout the 1700s and 1800s. Tables provided data on age specific fertility rates and on birth intervals for females in Bonnieres for 1736-1845.

Serological levels of apoptotic bodies, sFAS and TNF in lupus erythematosus.

PubMed

Alecu, M; Coman, G; Alecu, S

In our study we have investigated the presence of apoptotic bodies, soluble FAS receptor and TNF (tumor necrosis factor) in three clinical forms of lupus erythematosus. Determinations were performed in attack period of: systemic lupus erythematosus (SLE) for 20 patients, 20 patients with subacute cutaneous lupus erythematosus (SCLE), 20 patients with chronic discoid lupus erythematosus (DLE). Determinations were performed by ELISA (for apoptotic bodies, kit Boehringer, normal values 400-800 mU), (for sFAS, kit R&D Systems, normal values 4500-17000 pg/ml) (for TNF, ELISA kit R&D Systems, normal values 0.4-3.6 pg/ml). Results in SLE: apoptotic bodies were increased in 16 cases (980-1030); sFAS in 18 cases (17000-24000 pg/ml) TNF was increased in all 20 cases (40-140 pg/ml). In SCLE with multiple cutaneous lesions and without internal organs disturbance the apoptotic bodies were increased in 10 cases (960-1030 pg/ml), sFAS in 9 cases (17000-22000 pg/ml), and TNF alpha in 9 cases. In DLE, apoptotic bodies were increased in 2 patients (980-1010 pg/ml), sFAS in 3 patients (17000-20000 pg/ml) and TNF in 2 patients (20-40 pg/mil). Investigated values were slightly correlated with immune parameters (anti dsDNA antibodies), but they were correlated with the presence of renal disturbances or extension of cutaneous lesions. We consider that the presence of increased apoptotic bodies as a result of peripheral mononuclear cells apoptosis appear as a nauto-limiting mechanism in a pathological immune response. The increase of sFAS in lupus patients serum might be interpreted as an alteration of apoptosis respectively a deficit in apoptosis which has as a first consequence the persistence of B and T lymphocytes, activated, in the pathogen immune response.

Stable C and N isotopic composition of cold-water corals from the Newfoundland and Labrador continental slope: Examination of trophic, depth and spatial effects

NASA Astrophysics Data System (ADS)

Sherwood, Owen A.; Jamieson, Robyn E.; Edinger, Evan N.; Wareham, Vonda E.

2008-10-01

With the aim of understanding of the trophic ecology of cold-water corals, this paper explores the tissue δ13C and δ15N values of 11 'coral' species (8 alcyonacean, 1 antipatharian, 1 pennatulacean, 1 scleractinian) collected along the Newfoundland and Labrador continental slope. Isotopic results delimit species along continua of trophic level and food lability. With an isotopic signature similar to macrozooplankton, Paragorgia arborea occupies the lowest trophic level and most likely feeds on fresh phytodetritus. Primnoa resedaeformis occupies a slightly higher trophic level, likely supplementing its diet with microzooplankton. Bathypathes arctica, Pennatulacea and other alcyonaceans ( Acanella arbuscula, Acanthogorgia armata, Anthomastus grandiflorus, Duva florida, Keratoisis ornata, Paramuricea sp.) had higher δ13C and δ15N values, suggesting these species feed at higher trophic levels and on a greater proportion of more degraded POM. Flabellum alabastrum had an isotopic signature similar to that of snow crab, indicating a primarily carnivorous diet. Isotopic composition did not vary significantly over a depth gradient of 50-1400 m. Coral δ13C increased slightly (<1‰) from the Hudson Strait to the southern Grand Banks, but δ15N did not. By modulating the availability and quality of suspended foods, substrate likely exerts a primary influence on the feeding habits of cold-water corals.

Studies on mould growth and biomass production using waste banana peel.

PubMed

Essien, J P; Akpan, E J; Essien, E P

2005-09-01

Hyphomycetous (Aspergillus fumigatus) and Phycomycetous (Mucor hiemalis) moulds were cultivated in vitro at room temperature (28 + 20 degrees C) to examined their growth and biomass production on waste banana peel agar (BPA) and broth (BPB) using commercial malt extract agar (MEA) and broth (MEB) as control. The moulds grew comparatively well on banana peel substrates. No significant difference (p > 0.05) in radial growth rates was observed between moulds cultivated on PBA and MEA, although growth rates on MEA were slightly better. Slight variations in sizes of asexual spores and reproductive hyphae were also observed between moulds grown on MEA and BPA. Smaller conidia and sporangiospores, and shorter aerial hyphae (conidiophores and sporangiophores) were noticed in moulds grown on BPA than on MEA. The biomass weight of the test moulds obtained after one month of incubation with BPB were only about 1.8 mg and 1.4 mg less than values recorded for A. fumigatus and M. hiemalis respectively, grown on MEB. The impressive performance of the moulds on banana peel substrate may be attributed to the rich nutrient (particularly the crude protein 7.8% and crude fat 11.6% contents) composition of banana peels. The value of this agricultural waste can therefore be increased by its use not only in the manufacture of mycological medium but also in the production of valuable microfungal biomass which is rich in protein and fatty acids.

The brominated flame retardants, PBDEs and HBCD, in Canadian human milk samples collected from 1992 to 2005; concentrations and trends.

PubMed

Ryan, John Jake; Rawn, Dorothea F K

2014-09-01

Human milk samples were collected from individuals residing in various regions across Canada mostly in the years 1992 to 2005. These included five large cities in southern Canada as well as samples from Nunavik in northern Quebec. Comparative samples were also collected from residents of Austin, Texas, USA in 2002 and 2004. More than 300 milk samples were analysed for the brominated flame retardants (BFRs), PBDEs and HBCD, by extraction, purification and quantification using either isotope dilution gas chromatography-mass spectrometry (GC-MS) or liquid chromatography-MS. The Canadian total PBDE values in the years 2002-2005 show median levels of about 20μg/kg on a lipid basis; a value significantly higher than in the 1980s and 1990s. Milk samples from Inuit donors in the northern region of Nunavik were slightly lower in PBDE concentrations than those from populated regions in the south of Quebec. Milk samples from Ontario contained slightly lower amounts of PBDEs in two time periods than those from Texas. HBCD levels in most milk samples were usually less than 1ppb milk lipid and dominated by the α-isomer. This large data set of BFRs in Canadian human milk demonstrates an increase in the last few decades in human exposure to BFRs which now appears to have stabilized. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

Biomechanical behaviour - Anisotropy of eye cornea through experimental strip tests

NASA Astrophysics Data System (ADS)

Arsalan Khan, Mohammad; Elsheikh, Ahmed; Khan, Iqtedar Ahmad

2018-02-01

With the advent of research it was identified that material properties are responsible for errors in tonometry pressure (referred to as Goldmann IOP or IOPG) with the stiffening of a composite structure of corneal tissue in particular. Strip tensile tests are conducted to determine their stress-strain relationship for the purpose to study the behaviour of material properties of cornea. Specimens are taken from the superior-inferior (vertical) and temporal- nasal (horizontal) directions. Testing is performed on an Instron machine, under different rate of loading conditions. First set of experiment, with single strain rate, is executed on eyes having random population. While the second set of experiment is executed on eyes of the same animal in both directions, and different strain rates are applied each specimen. Relatively, the first set of experiment is found to be slightly different and less accurate. In general, it is found that the vertical specimen is 34% on an average stiffer than the horizontal specimen compared to Kampmeier et al. of 20% (studied in 2000) and Defu Wang of 15% (studied in 2007). Curve fitting coefficients are also evaluated for 4-degree polynomial. The anisotropy is evident by plotting the ratio of E-tangent value of vertical Ev and horizontal Eh against stresses with individual strain rates. The value of Ev/Eh increases with slightly slow rate with stresses as compared to achieved through slow strain rates.

Improving the quantity, quality and transparency of data used to derive radionuclide transfer parameters for animal products. 2. Cow milk.

PubMed

Howard, B J; Wells, C; Barnett, C L; Howard, D C

2017-02-01

Under the International Atomic Energy Agency (IAEA) MODARIA (Modelling and Data for Radiological Impact Assessments) Programme, there has been an initiative to improve the derivation, provenance and transparency of transfer parameter values for radionuclides from feed to animal products that are for human consumption. A description of the revised MODARIA 2016 cow milk dataset is described in this paper. As previously reported for the MODARIA goat milk dataset, quality control has led to the discounting of some references used in IAEA's Technical Report Series (TRS) report 472 (IAEA, 2010). The number of Concentration Ratio (CR) values has been considerably increased by (i) the inclusion of more literature from agricultural studies which particularly enhanced the stable isotope data of both CR and F m and (ii) by estimating dry matter intake from assumed liveweight. In TRS 472, the data for cow milk were 714 transfer coefficient (F m ) values and 254 CR values describing 31 elements and 26 elements respectively. In the MODARIA 2016 cow milk dataset, F m and CR values are now reported for 43 elements based upon 825 data values for F m and 824 for CR. The MODARIA 2016 cow milk dataset F m values are within an order of magnitude of those reported in TRS 472. Slightly bigger changes are seen in the CR values, but the increase in size of the dataset creates greater confidence in them. Data gaps that still remain are identified for elements with isotopes relevant to radiation protection. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

RBC urine test

MedlinePlus

... measurement for a result of this test. Normal value ranges may vary slightly among different laboratories. Some labs use different measurements or test different samples. Talk to your provider ...

Reference values of coplanar and non-coplanar PCBs in serum samples from two Italian population groups.

PubMed

Turci, Roberta; Finozzi, Enrico; Catenacci, Giovanni; Marinaccio, Alessandro; Balducci, Claudio; Minoia, Claudio

2006-04-10

The main goal of this study is to establish the reference values of individual Polychlorinated biphenyl (PCB) congeners in non-occupationally exposed subjects. Since the PCB pattern in human serum is related to the living area, two different population groups from North and Central Italy, were compared. Serum concentrations of both coplanar and non-coplanar PCB congeners were measured by using gas chromatography coupled with low-resolution mass spectrometry (HRGC-LRMS). A fast and reliable method for the determination of 60 congeners had been previously validated. Its reliability was further verified by using high-resolution mass spectrometry. Thirty-one congeners out of 60 were found at detectable concentrations in at least one sample. The mean value for total PCBs was found to be 2.48 and 3.93 microg/L for the two population groups. Eight dioxin-like PCBs were detected. In accordance with the findings from the literature, the most abundant congeners were found to be 153, 138, 180, and 170. Both univariate and multivariate analysis showed that age is a significant determinant of PCB concentrations. The correlation increased with increasing chlorination. Slight differences in the PCB pattern were observed in the two population groups.

[Food value of the spiruline algae to man].

PubMed

Sautier, C; Tremolieres, J

1975-01-01

The acceptability of various culinary products based on the algae spirulina was tested by questionaire: formulas rich in proteins, soups, omelets, desserts. Spirulina are little appreciated in France due to offensive color, smell and taste. Tomato and chocolate are the most acceptable flavors. Lyophilisation is preferable to atomisation, and discoloration using alcohol is preferable to the acetone method. The hydrolysate obtained, having neither the smell nor the taste of algae, is excellent. Nitrogen, sodium and potassium balances were recorded in 5 undernourished subjects fed via a gastric tube. The spirulina provided respectively 15 p. 100 (1 subject), 30 p. 100 (2 subjects), and 50 p. 100 (2 subjects) of the protein ration. There were no intestinal problems. The spirulina did not modify the investigated balances. However, faecal nitrogen increased to 2.08 g (compared to control period values, 1.33 g and 1.51 g). The various coefficients: digestibility, nitrogen retention and protein utilization did not vary. In man as in animals, nitrogen retention is satisfactory, but digestibility is diminished. Uric acid did not vary in the urine, but serum values increased slightly. Ingestion of spirulina in small doses even over a long period should be tolerable in the normal subject.

Thermal Inactivation Characteristics of Bacillus subtilis Spores at Ultrahigh Temperatures1

PubMed Central

Edwards, J. L.; Busta, F. F.; Speck, M. L.

1965-01-01

The thermal inactivation characteristics of Bacillus subtilis A spores suspended in skim milk with the use of large-scale ultrahigh temperature (UHT) processing equipment were investigated in terms of survival as measured with two plating media. Data on survival immediately after UHT treatments were recorded in temperature-survivor curves, time-survivor curves, and decimal reduction time (DRT) curves. The temperature-survivor curves emphasized that inactivation is accelerated more by increases in the treatment temperature than by increases in the exposure time. Time-survivor curves and DRT curves were not linear. Generally, exceedingly concave time-survivor curves were observed with the standard plating medium; however, only slightly concave curves were observed when CaCl2 and sodium dipicolinate were added to the medium. For a given UHT sample, larger D values were obtained by use of the medium with the added CaCl2 and sodium dipicolinate. The DRT curves of all data were concave and appeared to have two discrete slopes (zD values). The zD values observed in the upper UHT range (above 260 F; 127 C) were twice those observed at lower test temperatures. PMID:4956036

Diurnal and long-term variation of instability indices over a tropical region in India

NASA Astrophysics Data System (ADS)

Chakraborty, Rohit; Basha, Ghouse; Venkat Ratnam, M.

2018-07-01

Climatology of atmospheric instability is studied over Gadanki using high-resolution radiosonde launched daily during April 2006 to April 2017. The diurnal and seasonal variation of instability parameters is discussed in relation with surface meteorological parameters. Seasonal variations depict strong variability in instability which is masked by stronger diurnal variation with descending Lifting Condensation Level (LCL) and Level of Free Convection (LFC) between 11 and 18 IST resulting in high Convective Available Potential Energy (CAPE) values and heavy rainfall. On a seasonal basis, parcel parameters are high during the late monsoon and post-monsoon while the instability parameters like Total Totals index (TT) and Vertical Totals index (VT) show highest values in the pre-monsoon associated with strong convection. LFC and LCL start descending with ascent in Equilibrium Level (EL) before the monsoon onset. However after the onset, atmospheric instability falls sharply as supported by decreasing TT, VT and CAPE with increasing LI. The 11-year long-term variation depicts slightly elevated LFC and LCL and declining EL values indicating a decrease in the instability with a decrease in CAPE and K Index (KI) and increase in Lifted Index (LI) and Convective Inhibition (CIN).

Provisional hourly values of equatorial Dst for 1971

NASA Technical Reports Server (NTRS)

Sugiura, M.; Poros, D. J.

1972-01-01

Tables and plots of provisional hourly values of the equatorial Dst index for 1971 are given, a table of daily mean Dst values for 1971 is also provided. The base line values for the four observatories, Hermanus, Kakioka, Honolulu, and San Juan, were obtained from extrapolations using the coefficients for the secular variations determined for the previous years. Examining the Dst values for quiet days, the base lines so determined appear to be slightly low, so that the Dst index for quiet periods tends to be high.

Assessment of forest fragmentation in southern New England using remote sensing and geographic information systems technology

USGS Publications Warehouse

Vogelmann, James E.

1995-01-01

Spatial patterns and rates of forest fragmentation were assessed using digital remote sensing data for a region in southern New England that included 157 townships in southern New Hampshire and northeastern Massachusetts. The study area has undergone marked population increases over the last several decades. Following classification of 1973 and 1988 Landsat Multispectral Scanner data into forest and nonforest classes, data were incorporated into a geographic information system. The natural logarithms of forest area to perimeter ratios, referred to as the forest continuity index, were used to assess patterns and trends of forest fragmentation across the region Forest continuity index values were extracted from each township for both data sets and compared with population data. Forest continuity index values were found to decrease with increasing population density until about 200 persons per square kilometer, after which the relationship stabilized. With slight population increases at low densities forest continuity index values declined sharply, implying abrupt increases in forest fragmentation. Results from the study indicated good negative correlations (r2 values of 0.81 and 0.77) between the Multispectral Scanner-derived forest continuity index and natural logs of township population density. Socioeconomic indicators such as affluence and commuting patterns did not appear to correlate well with forest fragmentation estimates. Decreases in forest continuity index values occurred throughout much of the study region between 1973 and 1988, suggesting that forest fragmentation is occurring over large regions within the eastern United States. It is technologically feasible to assess patterns and rates of forest fragmentation across much larger areas than analyzed in this study; such analyses would provide useful overviews enabling objective assessment of the magnitude of forest fragmentation.

Sensory, Physico-Chemical and Water Sorption Properties of Corn Extrudates Enriched with Spirulina.

PubMed

Tańska, Małgorzata; Konopka, Iwona; Ruszkowska, Millena

2017-09-01

This study compares the quality of extrudates made from corn grits with the addition of up to 8% of spirulina powder. The sensory properties (shape, color, aroma, taste and crispness), chemicals (content of water, protein, fat, ash, fiber, carbohydrates, carotenoids, chlorophyll and phycocyanin) and physical properties (color, water absorption index, expansion indices, texture and water sorption properties) were determined. It has been found that spirulina-enriched extrudates had slightly lower sensory scores, but the addition of spirulina improved their nutritional value. The contents of protein, ash, fiber and β-carotene increased in extrudates with 8% of spirulina by 34, 36, 140 and 1,260%, respectively. The increasing addition of spirulina caused a decrease in extrudates lightness, an increase in their greenness and yellowness accompanied by a decrease of expansion indices and an increase of softness. Only small differences were found in water sorption properties, suggesting a similar behavior of spirulina-enriched extrudates during storage.

A Facile Pathway to Modify Cellulose Composite Film by Reducing Wettability and Improving Barrier towards Moisture.

PubMed

Hu, Xiaorong; Chen, Lin; Tao, Dandan; Ma, Zhaocheng; Liu, Shilin

2017-01-05

The hydrophilic property of cellulose is a key limiting factor for its wide application. Here, a novel solution impregnation pathway was developed to increase the hydrophobic properties of cellulose. When compared with the regenerated cellulose (RC), the composite films showed a decrease in water uptake ability towards water vapor, and an increase of the water contact angle from 29° to 65° with increasing resin content in the composites, with only a slight change in the transmittance. Furthermore, the Young's modulus value increased from 3.2 GPa (RC film) to 5.1 GPa (RCBEA50 film). The results indicated that the composites had combined the advantages of cellulose and biphenyl A epoxy acrylate prepolymer (BEA) resin. The presented method has great potential for the preparation of biocomposites with improved properties. The overall results suggest that composite films can be used as high-performance packaging materials.

A Facile Pathway to Modify Cellulose Composite Film by Reducing Wettability and Improving Barrier towards Moisture

PubMed Central

Hu, Xiaorong; Chen, Lin; Tao, Dandan; Ma, Zhaocheng; Liu, Shilin

2017-01-01

The hydrophilic property of cellulose is a key limiting factor for its wide application. Here, a novel solution impregnation pathway was developed to increase the hydrophobic properties of cellulose. When compared with the regenerated cellulose (RC), the composite films showed a decrease in water uptake ability towards water vapor, and an increase of the water contact angle from 29° to 65° with increasing resin content in the composites, with only a slight change in the transmittance. Furthermore, the Young’s modulus value increased from 3.2 GPa (RC film) to 5.1 GPa (RCBEA50 film). The results indicated that the composites had combined the advantages of cellulose and biphenyl A epoxy acrylate prepolymer (BEA) resin. The presented method has great potential for the preparation of biocomposites with improved properties. The overall results suggest that composite films can be used as high-performance packaging materials. PMID:28772399

Studies of heat source driven natural convection

NASA Technical Reports Server (NTRS)

Kulacki, F. A.; Nagle, M. E.; Cassen, P.

1974-01-01

Natural convection energy transport in a horizontal layer of internally heated fluid with a zero heat flux lower boundary, and an isothermal upper boundary, has been studied. Quantitative information on the time-mean temperature distribution and the fluctuating component of temperature about the mean temperature in steady turbulent convection are obtained from a small thermocouple inserted into the layer through the upper bounding plate. Data are also presented on the development of temperature at several vertical positions when the layer is subject to both a sudden increase and to a sudden decrease in power input. For changes of power input from zero to a value corresponding to a Rayleigh number much greater than the critical linear stability theory value, a slight hysteresis in temperature profiles near the upper boundary is observed between the heat-up and cool-down modes.

Dark stars in Starobinsky's model

NASA Astrophysics Data System (ADS)

Panotopoulos, Grigoris; Lopes, Ilídio

2018-01-01

In the present work we study non-rotating dark stars in f (R ) modified theory of gravity. In particular, we have considered bosonic self-interacting dark matter modeled inside the star as a Bose-Einstein condensate, while as far as the modified theory of gravity is concerned we have assumed Starobinsky's model R +a R2. We solve the generalized structure equations numerically, and we obtain the mass-to-ratio relation for several different values of the parameter a , and for two different dark matter equation-of-states. Our results show that the dark matter stars become more compact in the R-squared gravity compared to general relativity, while at the same time the highest star mass is slightly increased in the modified gravitational theory. The numerical value of the highest star mass for each case has been reported.

Slots in dielectric image line as mode launchers and circuit elements

NASA Astrophysics Data System (ADS)

Solbach, K.

1981-01-01

A planar resonator model is used to investigate slots in the ground plane of dielectric image lines. An equivalent circuit representation of the slot discontinuity is obtained, and the launching efficiency of the slot as a mode launcher is analyzed. Slots are also shown to be useful in the realization of dielectric image line array antennas. It is found that the slot discontinuity can be shown as a T-junction of the dielectric image line and a metal waveguide. The launching efficiency is found to increase with the dielectric constant of the dielectric image line, exhibiting a maximum value for guides whose height is slightly less than half a wavelength in the dielectric medium. The measured launching efficiencies of low permittivity dielectric image lines are found to be in good agreement with calculated values

Partially suppressed shot noise in hopping conduction: observation in SiGe quantum wells

PubMed

Kuznetsov; Mendez; Zuo; Snider; Croke

2000-07-10

We have observed shot noise in the hopping conduction of two-dimensional carriers confined in a p-type SiGe quantum well at a temperature of 4 K. Moreover, shot noise is suppressed relative to its "classical" value 2eI by an amount that depends on the length of the sample and the carrier density. We have found a suppression factor to the classical value of about one-half for a 2 &mgr;m long sample, and of one-fifth for a 5 &mgr;m sample. In each case, the factor decreased slightly as the density increased toward the insulator-metal transition. We explain these results in terms of the characteristic length ( approximately 1 &mgr;m in our case) of the inherent inhomogeneity of hopping transport, obtained from percolation theory.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Minority-carrier lifetime in InP as a function of light bias

NASA Technical Reports Server (NTRS)

Yater, Jane A.; Weinberg, I.; Jenkins, Phillip P.; Landis, Geoffrey A.

1995-01-01

Minority-carrier lifetime in InP is studied as a function of doping level and laser intensity using time-resolved photoluminescence. A continuous wave diode laser illuminates bulk InP and acts as a light bias, injecting a steady-state concentration of carriers. A 200 ps laser pulse produces a small transient signal on top of the steady-state luminescence, allowing lifetime to be measured directly as a function of incident intensity. For p-InP, lifetime increases with light bias up to a maximum value. Bulk recombination centers are presumably filled to saturation, allowing minority carriers to live longer. The saturation bias scales with dopant concentration for a particular dopant species. As light bias is increased for n-InP, minority-carrier lifetime increases slightly but then decreases, suggesting radiative recombination as a dominant decay mechanism.

Drought until death do us part: a case study of the desiccation-tolerance of a tropical moist forest seedling-tree, Licania platypus (Hemsl.) Fritsch.

PubMed

Tyree, Melvin T; Vargas, Gustavo; Engelbrecht, Bettina M J; Kursar, Thomas A

2002-11-01

Studies of the desiccation tolerance of 15-month-old Licania platypus (Hemsl.) Fritsch seedlings were performed on potted plants. Pots were watered to field capacity and then dehydrated for 23-46 d to reach various visible wilting stages from slightly-wilted to dead. Root hydraulic conductance, k(r), was measured with a high-pressure flow meter and whole-stem hydraulic conductance, k(ws), was measured by a vacuum chamber method. Leaf punches were harvested for measurement of leaf water potential by a thermocouple psychrometer and for measurement of fresh- and dry-weight. L. platypus was surprisingly desiccation-tolerant, suggesting that most species of central Panama may be well adapted to the seasonality of rainfall in the region. The slightly-wilted stage corresponded to leaf water potentials and relative water contents of -2.7 MPa and 0.85, respectively, but plants did not die until these values fell to -7.5 MPa and 0.14, respectively. As desiccation proceeded k(r) and k(ws) declined relative to irrigated controls, but k(ws) was more sensitive to desiccation than k(r). Values of k(ws) declined by 70-85% in slightly-wilted to dead plants, respectively. By comparison, k(r) showed no significant change in slightly-wilted plants and fell by about 50% in plants having severely-wilted to dead shoots.

[Dosimetric comparison of non-small cell lung cancer treatment with multi fields dynamic-MLC IMRT].

PubMed

Hao, Longying; Wang, Delin; Cao, Yujuan; Du, Fang; Cao, Feng; Liu, Chengwei

2015-05-19

We compared the dosimetric differences between the target and surrounding tissues/organs of the 5-field and 7,9-field (Hereinafter referred to as F5, F7, F9) treatment plan in non-small cell lung cancer (NSCLC) by the dynamic intensity-modulated radiotherapy (dIMRT), to provide reference for clinical application. Using Varian planning system (Eclipse 7.3), we randomly selected 30 cases of patients who received dIMRT to study, all patients were 5, 7, 9 fixed field dynamics intensity-modulated radiotherapy plans to meet the target prescription requirements (95% dose curve enveloping 100% of the PTV), by comparing dose-volume histogram DVH evaluation, and the maximum dose D(max), the minimum dose D(min), and the mean dose D(mean), and conformal index CI of PTV,organs at risk of spinal cord the maximum dose D(max), lung V(5), V(10), V(20), V(30), heart V(30) and esophageal V(50), V(60) of F5,F7 and F9 dIMRT plans,and compare the mu of the three treatment programs. The D(max), D(min) and D(mean) values of F5's PTV are (7 203 ± 128), (5 493 ± 331), (6 900 ± 138) cGy respectively; the D(max), D(min) and D(mean) values of F7's PTV are (7 304 ± 96), (5 526 ± 296), (6 976 ± 130) cGy respectively; and the D(max), D(min) and D(mean) values of F9's PTV are (7 356 ± 54), (5 578 ± 287), (7 019 ± 56) cGy respectively. The data shows that while we increased the numbers of fields, the isodose line surrounding the target area would also promote slightly. The conformity index CI of target became better with the increase of radiation fields. The whole lung V(5) and V(10) slightly became larger with increase of fields and the V(20) showed no significant difference in three models, V(30) of double lungs slightly decreased with the increase of fields. The above date was statistically meaningless (P > 0.05). With the increase of fields esophagus V(50) were reduced by 3% and 5% respectively, V(60) of the esophagus were reduced by 6% and 11%, the average dose reduced by 5% and 10% and spinal cord D(max) decreased by 9% and 13%. In the F7 and F9, heart V5 were lower than F5 plan by 11%, 19%. The mu of them were increased with the increase of radiation fields, Treatment time of F7 and F9 plan were longer by 15% and 25%. Through comparing the three fixed dIMRT plans, we could draw a conclusion that the three multi-field intensity-modulated radiotherapy in non-small cell lung cancer can meet the clinical target volume dose requirements. If the treatment is required to protect the patient's spinal cord, esophagus and heart, we can choose 7 or 9 fields. While other ordinary patients should be treated with 5 fields plan, to shorten the treatment time and improve the biological effects of lesions, and lower mu of plans to avoid unnecessary irradiation of normal tissues.

Modeling Air Temperature/Water Temperature Relations Along a Small Mountain Stream Under Increasing Urban Influence

NASA Astrophysics Data System (ADS)

Fedders, E. R.; Anderson, W. P., Jr.; Hengst, A. M.; Gu, C.

2017-12-01

Boone Creek is a headwater stream of low to moderate gradient located in Boone, North Carolina, USA. Total impervious surface coverage in the 5.2 km2 catchment drained by the 1.9 km study reach increases from 13.4% in the upstream half of the reach to 24.3% in the downstream half. Other markers of urbanization, including culverting, lack of riparian shade vegetation, and bank armoring also increase downstream. Previous studies have shown the stream to be prone to temperature surges on short timescales (minutes to hours) caused by summer runoff from the urban hardscaping. This study investigates the effects of urbanization on the stream's thermal regime at daily to yearly timescales. To do this, we developed an analytical model of daily average stream temperatures based on daily average air temperatures. We utilized a two-part model comprising annual and biannual components and a daily component consisting of a 3rd-order Markov process in order to fit the thermal dynamics of our small, gaining stream. Optimizing this model at each of our study sites in each studied year (78 total site-years of data) yielded annual thermal exchange coefficients (K) for each site. These K values quantify the strength of the relationship between stream and air temperature, or inverse thermal stability. In a uniform, pristine catchment environment, K values are expected to decrease downstream as the stream gains discharge volume and, therefore, thermal inertia. Interannual average K values for our study reach, however, show an overall increase from 0.112 furthest upstream to 0.149 furthest downstream, despite a near doubling of stream discharge between these monitoring points. K values increase only slightly in the upstream, less urban, half of the reach. A line of best fit through these points on a plot of reach distance versus K value has a slope of 2E-6. But the K values of downstream, more urbanized sites increase at a rate of 2E-5 per meter of reach distance, an order of magnitude greater. This indicates a possible tipping point in the stream temperature-water temperature relationship at which increased urbanization overpowers increasing stream thermal inertia.

Effect of gamma irradiation on some physicochemical properties and bioactive compounds of jujube (Ziziphus jujuba var vulgaris) fruit

NASA Astrophysics Data System (ADS)

Najafabadi, Najmeh Shams; Sahari, Mohammad Ali; Barzegar, Mohsen; Esfahani, Zohreh Hamidi

2017-01-01

Interest in the protection of bioactive compounds and a safe alternative method for preservation of processed fruits and fruit juices has recently increased significantly throughout the world. There is a distinct lack of information on the profile of bioactive compounds in jujube fruit (e.g. organic acids, anthocyanins, and water-soluble vitamins) and their changes during processing (e.g. gamma irradiation). Therefore, in this study, the effect of gamma irradiation at different doses (0.0, 0.5, 1.0, 2.5 and 5.0 kGy) on some physicochemical properties and the bioactive compounds of jujube fruit was investigated. The total soluble solids (TSSs) values remained unaffected at various doses, while the level of total acidity (TA) showed a slight increase at doses ≥ 2.5 kGy (p ≤ 0.05). Irradiation up to 2.5 kGy caused a significant increase in the total monomeric anthocyanin and the total phenolic content (about 12% and 6%, respectively), but a significant decrease was observed in both parameters immediately after irradiation at 5 kGy. Moreover, irradiation treatment caused a significant decrease in L* value and a significant increase in a* and b* values (P ≤ 0.05); however, changes of color were slight until the dose of 5 kGy. Gamma irradiation up to 2.5 kGy had no significant effect on the concentration of malic, citric and succinic acids, while the level of ascorbic acid decreased significantly at all irradiation doses (0-5 kGy). Cyanidin-3, 5-diglucoside was determined as the major anthocyanin in the jujube fruit studied (about 68%), which was reduced significantly when 5 kGy of irradiation was applied (degradation percentage: 27%). The results demonstrated that vitamins C, B2 and B1 are the most water-soluble vitamins in jujube fruit, respectively. Vitamins C and B1 content significantly decreased at all applied doses (0-5 kGy), whereas B2 content at doses ≤ 2.5 kGy was not significantly affected. The results of this study indicate that gamma irradiation at doses below 2.5 kGy can be successfully used for improving the quality the jujube fruit.

Cadmium removal from wastewater by sponge iron sphere prepared by charcoal direct reduction.

PubMed

Li, Junguo; Li, Jun; Li, Yungang

2009-01-01

Sponge iron sphere (SIS), made of concentrated iron powder and possessed high activity and intension, was prepared through the process of palletizing, roasting and direct reduction by charcoal. The sponge iron sphere could remove most of Cd(2+) from wastewater. The results showed the Cd(2+) removal followed the first order reaction. Initial pH value played an important role in Cd(2+) removal. With original initial pH, Cd(2+) removal decreased to the minimum and then increased slightly with the rising of original concentration. The removal rate constant was -0.1263 and -0.0711 h(-1), respectively, under the Cd(2+) concentration of 50 and 200 mg/L. When the initial pH was adjusted to 3.0, the removal rate constant could increase to -9.896 and -4.351 h(-1), respectively. The removal percentage almost reached to 100% when Cd(2+) concentration was below 100 mg/L. While Cd(2+) concentration was above 100 mg/L, Cd(2+) removal percentage decreased slightly. In dynamic experiments, the column filled with sponge iron sphere exhibited favorable permeability. There was no sphere pulverization and conglutination between spheres. In contrast to the static state experiments, the Cd(2+) removal percentage in dynamic state experiment was lower, and the removal Cd(2+) quantity was 1.749 mg/g.

Influence of addition order and contact time on thorium(IV) retention by hematite in the presence of humic acids.

PubMed

Reiller, Pascal; Casanova, Florence; Moulin, Valérie

2005-03-15

The influence of addition order and contact time in the system hematite (alpha-Fe2O3)-humic acid (HA)-thorium(IV) (Th(IV)) was studied in batch experiments. Th(IV) is considered here as a chemical analogue of other actinides (IV). The sorption isotherms were acquired varying pH in the range 2-10 and HA concentration in the range 1-100 mg/L. As already observed by numerous authors, Th(IV) retention was hindered when HA and hematite were equilibrated beforehand during 24 h. As it has been observed in a previous study, this effect was drastic when the ratio between humic and surface (iron oxide) sites exceeds a critical value. However, when HA was added after a 24-h equilibration of the hematite-Th(IV) system, Th(IV) was barely desorbed from the iron oxide surface. Furthermore, no drastic effect of the ratio between humic and surface sites could be evidenced, as the increase of HA concentration only results in a slight monotonic decrease in Th(IV) retention. Increasing contact time between components of the systems only indicated slight Th(IV) retention variation. This was interpreted as a consequence of slow kinetic controls of both the Th(IV)-HA complexation and HA-hematite sorption.

Thermal comfort assessment of a surgical room through computational fluid dynamics using local PMV index.

PubMed

Rodrigues, Nelson J O; Oliveira, Ricardo F; Teixeira, Senhorinha F C F; Miguel, Alberto Sérgio; Teixeira, José Carlos; Baptista, João S

2015-01-01

Studies concerning indoor thermal conditions are very important in defining the satisfactory comfort range in health care facilities. This study focuses on the evaluation of the thermal comfort sensation felt by surgeons and nurses, in an orthopaedic surgical room of a Portuguese hospital. Two cases are assessed, with and without the presence of a person. Computational fluid dynamic (CFD) tools were applied for evaluating the predicted mean vote (PMV) index locally. Using average ventilation values to calculate the PMV index does not provide a correct and enough descriptive evaluation of the surgical room thermal environment. As studied for both cases, surgeons feel the environment slightly hotter than nurses. The nurses feel a slightly cold sensation under the air supply diffuser and their neutral comfort zone is located in the air stagnation zones close to the walls, while the surgeons feel the opposite. It was observed that the presence of a person in the room leads to an increase of the PMV index for surgeons and nurses. That goes in line with the empirical knowledge that more persons in a room lead to an increased heat sensation. The clothing used by both classes, as well as the ventilation conditions, should be revised accordingly to the amount of persons in the room and the type of activity performed.

Non-destructive tests for railway evaluation: Detection of fouling and joint interpretation of GPR and track geometric parameters - COST Action TU1208

NASA Astrophysics Data System (ADS)

Solla, Mercedes; Fontul, Simona; Marecos, Vânia; Loizos, Andreas

2016-04-01

During the last years high-performance railway lines have increased both their number and capabilities. As all types of infrastructures, railways have to maintain a proper behaviour during the entire life cycle. This work is focused on the analysis of the GPR method and its capabilities to detect defects in both infra and superstructure in railways. Different GPR systems and frequency antennas (air-coupled with antennas of 1.0 and 1.8 GHz, and ground-coupled with antennas of 1.0 and 2.3 GHz) were compared to establish the best procedures. For the assessment of the ground conditions, both GPR systems were used in combination with Falling Weight Deflectometer (FWD) load tests, in order to evaluate the bearing capacity of the subgrade. Moreover, Light Falling Weight Deflectometer (LFWD) measures were performed for the validation of the interpretation of the damaged areas identified from GPR and FWD tests. Finally, to corroborate the joint interpretation of GPR and FWD-LFWD, drill cores were extracted in the damaged areas identified based on the field data. Comparing all the data, a good agreement was obtained between the methods, when identifying both anomalous deflections and reflections. It was also demonstrated that ground-coupled systems have clear advantages compared to air-coupled systems since these antennas provide both better signal penetration and vertical resolution to detect fine details like cracking. Regarding the assessment of the thickness, three different high-speed track infrastructure solutions were constructed in a physical model, using asphalt as subballast layer. Four different antennas were used, two ground- and two air-coupled systems. Two different methodologies were assumed to calibrate the velocity of wave propagation: coring and metal plate. Comparing the results obtained, it was observed that the ground-coupled system provided higher values of wave velocity than the air-coupled system. The velocity values were also obtained by the amplitude or metal plate method with the air-coupled system. These velocities values were similar to those values obtained with the ground-coupled system, when using the coring method. Some laboratory tests were also developed in this work aiming to evaluate the dielectric constants for different levels of ballast fouling (0, 7.5 and 15%). The effect of the water presence on the dielectric constant was also evaluated by simulating different water contents: 5.5, 10 and 14%. Different GPR systems and configuration were used. The results have demonstrated that dielectric values increase with the increasing of fouling conditions. The dielectric constants also increase with the increasing of water content. However, the analysis of all the results obtained has revealed that values are more sensitive to the fouling level rather than to the water content variation. The dielectric constants obtained with a frequency of 1.0 GHz were slightly lower than those obtained with higher frequencies of 1.8 and 2.3 GHz. Additionally, the dielectric constants obtained for all the measurements, increasing fouling conditions and water contents, with a frequency of 1.0 GHz, were also different. Thus, the dielectric constant values obtained with the ground-coupled antenna were slightly lower than those obtained with the air-coupled antenna.

Impact of hydrostatic pressure on an intrinsically disordered protein: a high-pressure NMR study of α-synuclein.

PubMed

Roche, Julien; Ying, Jinfa; Maltsev, Alexander S; Bax, Ad

2013-09-23

The impact of pressure on the backbone (15) N, (1) H and (13) C chemical shifts in N-terminally acetylated α-synuclein has been evaluated over a pressure range 1-2500 bar. Even while the chemical shifts fall very close to random coil values, as expected for an intrinsically disordered protein, substantial deviations in the pressure dependence of the chemical shifts are seen relative to those in short model peptides. In particular, the nonlinear pressure response of the (1) H(N) chemical shifts, which commonly is associated with the presence of low-lying "excited states", is much larger in α-synuclein than in model peptides. The linear pressure response of (1) H(N) chemical shift, commonly linked to H-bond length change, correlates well with those in short model peptides, and is found to be anticorrelated with its temperature dependence. The pressure dependence of (13) C chemical shifts shows remarkably large variations, even when accounting for residue type, and do not point to a clear shift in population between different regions of the Ramachandran map. However, a nearly universal decrease in (3) JHN-Hα by 0.22 ± 0.05 Hz suggests a slight increase in population of the polyproline II region at 2500 bar. The first six residues of N-terminally acetylated synuclein show a transient of approximately 15% population of α-helix, which slightly diminishes at 2500 bar. The backbone dynamics of the protein is not visibly affected beyond the effect of slight increase in water viscosity at 2500 bar. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The thermal comfort and its changes in the 31 provincial capital cities of mainland China in the past 30 years

NASA Astrophysics Data System (ADS)

Chi, Xiaoli; Li, Rui; Cubasch, Ulrich; Cao, Wenting

2018-04-01

The thermal comfort and its changes in the 31 provincial capital cities of mainland China in the past 30 years were comprehensively evaluated using the Physiologically Equivalent Temperature (PET) and Universal Thermal Climate Index (UTCI) indicators. The PET and UTCI values were highly correlated with each other and presented similar thermal comfort pattern, although their sensitivities might differ slightly. The results showed that these cities covered, respectively, 4-8 and 6-8 thermal comfort classes of the PET and UTCI scale. On the whole, the annual cumulative number of pleasant days was more than 160 days/year. In terms of seasonal variations in thermal comfort conditions, the 31 provincial capital cities in mainland China can be classified into 5 types, which are, respectively, characterized by pleasant summer and severe cold winter (type-I); pleasant spring, autumn, winter, and severe hot summer (type-II); pleasant spring and autumn, slightly pleasant summer, and cold winter (type-III); pleasant spring and autumn, hot stress summer, and slightly cold winter (type-IV); and pleasant spring, summer, autumn, and cool winter (type-V). Type-II cities are rare winter resorts, while type-I cities are natural summer resorts. Type-V cities are the year round pleasant resorts. In the past three decades, the cities in mainland China had experienced increasing pleasant duration in late winter and early spring and intensifying heat stress in summer. The reduction in annual cumulative number of cold stress days in higher latitude/altitude cities outweighed the increase in duration of heat stress in subtropical cities. These may provide some references for urban planning and administration in mainland China.

The Effect of Single-Level Disc Degeneration on Dynamic Response of the Whole Lumbar Spine to Vertical Vibration.

PubMed

Guo, Li-Xin; Fan, Wei

2017-09-01

The objective of this study was to investigate the effect of single-level disc degeneration on dynamic response of the whole lumbar spine to vertical whole body vibration that is typically present when driving vehicles. Ligamentous finite element models of the lumbar L1-S1 motion segment in different grades of degeneration (healthy, mild, and moderate) at the L4-L5 level were developed with consideration of changing disc height and material properties of the nucleus pulpous. All models were loaded with a compressive follower preload of 400 N and a sinusoidal vertical vibration load of ±40 N. After transient dynamic analyses, computational results for the 3 models in terms of disc bulge, von-Mises stress in annulus ground substance, and nucleus pressure were plotted as a function of time and compared. All the predicted results showed a cyclic response with time. At the degenerated L4-L5 disc level, as degeneration progressed, maximum value of the predicted response showed a decrease in disc bulge and von-Mises stress in annulus ground substance but a slight increase in nucleus pressure, and their vibration amplitudes were all decreased. At the adjacent levels of the degenerated disc, there was a slight decrease in maximum value and vibration amplitude of these predicted responses with the degeneration. The results indicated that single-level disc degeneration can alter vibration characteristics of the whole lumbar spine especially for the degenerated disc level, and increasing the degeneration did not deteriorate the effect of vertical vibration on the spine. Copyright © 2017 Elsevier Inc. All rights reserved.

Experimental investigation of turbulent diffusion of slightly buoyant droplets in locally isotropic turbulence

NASA Astrophysics Data System (ADS)

Gopalan, Balaji; Malkiel, Edwin; Katz, Joseph

2008-09-01

High-speed inline digital holographic cinematography is used for studying turbulent diffusion of slightly buoyant 0.5-1.2 mm diameter diesel droplets and 50 μm diameter neutral density particles. Experiments are performed in a 50×50×70 mm3 sample volume in a controlled, nearly isotropic turbulence facility, which is characterized by two dimensional particle image velocimetry. An automated tracking program has been used for measuring velocity time history of more than 17 000 droplets and 15 000 particles. For most of the present conditions, rms values of horizontal droplet velocity exceed those of the fluid. The rms values of droplet vertical velocity are higher than those of the fluid only for the highest turbulence level. The turbulent diffusion coefficient is calculated by integration of the ensemble-averaged Lagrangian velocity autocovariance. Trends of the asymptotic droplet diffusion coefficient are examined by noting that it can be viewed as a product of a mean square velocity and a diffusion time scale. To compare the effects of turbulence and buoyancy, the turbulence intensity (ui') is scaled by the droplet quiescent rise velocity (Uq). The droplet diffusion coefficients in horizontal and vertical directions are lower than those of the fluid at low normalized turbulence intensity, but exceed it with increasing normalized turbulence intensity. For most of the present conditions the droplet horizontal diffusion coefficient is higher than the vertical diffusion coefficient, consistent with trends of the droplet velocity fluctuations and in contrast to the trends of the diffusion timescales. The droplet diffusion coefficients scaled by the product of turbulence intensity and an integral length scale are a monotonically increasing function of ui'/Uq.

Internal Kinematics of Groups of Galaxies in the Sloan Digital Sky Survey Data Release 7

NASA Astrophysics Data System (ADS)

Li, Cheng; Jing, Y. P.; Mao, Shude; Han, Jiaxin; Peng, Qiuying; Yang, Xiaohu; Mo, H. J.; van den Bosch, Frank

2012-10-01

We present measurements of the velocity dispersion profile (VDP) for galaxy groups in the final data release of the Sloan Digital Sky Survey (SDSS). For groups of given mass, we estimate the redshift-space cross-correlation function (CCF) with respect to a reference galaxy sample, ξ(s)(rp , π), the projected CCF, wp (rp ), and the real-space CCF, ξcg(r). The VDP is then extracted from the redshift distortion in ξ(s)(rp , π), by comparing ξ(s)(rp , π) with ξcg(r). We find that the velocity dispersion (VD) within virial radius (R 200) shows a roughly flat profile, with a slight increase at radii below ~0.3R 200 for high-mass systems. The average VD within the virial radius, σ v , is a strongly increasing function of central galaxy mass. We apply the same methodology to N-body simulations with the concordance Λ cold dark matter cosmology but different values of the density fluctuation parameter σ8, and we compare the results to the SDSS results. We show that the σ v - M * relation from the data provides stringent constraints on both σ8 and σ ms , the dispersion in log M * of central galaxies at fixed halo mass. Our best-fitting model suggests σ8 = 0.86 ± 0.03 and σ ms = 0.16 ± 0.03. The slightly higher value of σ8 compared to the WMAP7 result might be due to a smaller matter density parameter assumed in our simulations. Our VD measurements also provide a direct measure of the dark matter halo mass for central galaxies of different luminosities and masses, in good agreement with the results obtained by Mandelbaum et al. from stacking the gravitational lensing signals of the SDSS galaxies.

Soil or Dust for Health Risk Assessment Studies in Urban Environment.

PubMed

Gabarrón, M; Faz, A; Acosta, J A

2017-10-01

To identify the best material (soil or dust) to be selected for health-risk assessment studies, road dust and urban soil from three cities with different population densities were collected, and size fractions were analysed for metal content (Pb, Zn, Cu, Cd, Cr, Co, and Ni). Results showed similar distribution of the size particles among cities, predominating fractions between 75 and 2000 μm in road dust and particles below 75 μm in soil. Metals were mainly bound to PM10 in both soil and road dust increasing the risk of adverse health effects, overall through inhalation exposure. The risk assessment showed that the most hazardous exposure pathway was the ingestion via, followed by dermal absorption and inhalation route. Values of hazard quotient showed that the risk for children due to the ingestion and dermal absorption was higher than adults, and slightly larger at PM10 comparing to <75-μm fraction for the inhalation route. Higher risk values were found for road dust, although any hazard index or cancer risk index value did not overreach the safe value of 10 -6 .

Radiocarbon concentration in modern tree rings from Fukushima, Japan.

PubMed

Xu, Sheng; Cook, Gordon T; Cresswell, Alan J; Dunbar, Elaine; Freeman, Stewart P H T; Hastie, Helen; Hou, Xiaolin; Jacobsson, Piotr; Naysmith, Philip; Sanderson, David C W

2015-08-01

A 30-year-old Japanese cedar (Cryptomeria japonica), collected from Iwaki, Fukushima in 2014, was analyzed for the long-lived radionuclide (14)C. Values of Δ(14)C varied from 211.7‰ in 1984 to 16.9‰ in 2013. The temporal Δ(14)C variation can be described as an exponential decline, indistinguishable from the general Northern Hemisphere Zone 2 (NH Zone 2) values in the atmosphere, until at least 1994. Values of Δ(14)C for 1999 and 2004 are slightly depleted compared with NH Zone 2 values, while from 1999 to 2013 the data suggest a clear depletion with a 2-8 ppmV additional CO2 contribution from a (14)C-free (i.e. fossil carbon) source. This change coincides with local traffic increases since two nearby expressways were opened in the 1990's. In addition, the small but visible (14)C pulse observed in the 2011 tree-ring might be caused by release from the damaged reactors during the Fukushima nuclear accident. Copyright © 2015 Elsevier Ltd. All rights reserved.

Effect of salting and ripening on the physicochemical and sensory quality of goat and sheep cured legs.

PubMed

Teixeira, Alfredo; Fernandes, Aline; Pereira, Etelvina; Manuel, Aristides; Rodrigues, Sandra

2017-12-01

Physicochemical and sensory characteristics of sheep and goat cured legs were evaluated. The pH values (5.7-5.8) and aw (0.87 and 0.83) found to be adequate to control meat deterioration, promoting safety and stability to shelf life of products with respect to microbial growth. The high protein (46.2 and 38.4%) and low fat (5.3 and 8.7%) percentages of the goat and sheep cured legs were the main evidence of the effect of salting and ripening processes. A low cholesterol content of 4.5% is particularly evident in sheep cured legs. Curing process produced a slight increase in the P/S ratio 0.23 and 0.17 for goat and sheep cured legs, respectively. TBARS values are much lower than the value of 2mg of MDA/Kg which is the upper limit of rancidity. Physico-chemical and sensory characteristics indicate that producing cured goat and sheep legs from cull animals can be an interesting way of adding value to animals with very low commercial prices. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effects of preoperative administration of butorphanol or meloxicam on physiologic responses to surgery in ball pythons.

PubMed

Olesen, Mette G; Bertelsen, Mads F; Perry, Steve F; Wang, Tobias

2008-12-15

To characterize physiologic responses of ball pythons (Python regius) following a minor surgical procedure and investigate the effects of 2 commonly used analgesics on this response. 15 healthy ball pythons. Snakes were randomly assigned to receive 1 of 3 treatments: meloxicam (0.3 mg/kg [0.14 mg/lb]; n = 5), butorphanol (5 mg/kg [2.3 mg/lb]; 5), or saline (0.9% NaCl) solution (5) before catheterization of the vertebral artery. Plasma concentrations of catecholamines and cortisol, blood pressure, heart rate, and blood gas values were measured at various times for 72.5 hours after catheterization. The 72.5-hour point was defined as baseline. Heart rate of ball pythons increased significantly during the first hour following surgery. Mean plasma epinephrine concentration increased slightly at 2.5 hours after surgery, whereas mean plasma cortisol concentration increased beginning at 1.5 hours, reaching a maximum at 6.5 hours. Mean blood pressure increased within the first hour but returned to the baseline value at 2.5 hours after surgery. After 24.5 hours, blood pressure, heart rate, and plasma hormone concentrations remained stable at baseline values. There were no significant differences in values for physiologic variables between snakes that received saline solution and those that received meloxicam or butorphanol. Measurement of physiologic variables provides a means of assessing postoperative pain in snakes. Meloxicam and butorphanol at the dosages used did not decrease the physiologic stress response and did not appear to provide analgesic effects in ball pythons.

Morphology-Property relationship of high density Polyethylene/Hevea Brasiliensis Leaves/Imperata cylindrica hybrid composite: Impact strength

NASA Astrophysics Data System (ADS)

Rashidi, A. R.; Muhammad, A.; Roslan, A.

2017-09-01

This research studies about the Hevea Brasiliensis Leaves and Imperata Cylindrica that was used as filler in High Density Polyethylene (HDPE). The fillers content were varied in the composite by 5 wt%, 15 wt% and 25 wt% respectively. This polymer composite are being studied by using Impact Test and Scanning Electron Microscopy (SEM). The analysis show that the impact strength value increased when the percent of bio filler used is low. The result between pure HDPE and the composites shows an outcome of significant changes in impact energy values, while the values between different composite change slightly. A composite that contained 5 wt% of fillers is the better energy absorber than 15 wt% and 25 wt% according to impact testing. In addition, the morphology studies on the composite sample show that the bio-filler was successfully embedded. Overall, these finding suggest that HBL and IC can be an alternative filler to be incorporated in polymer matrix.

Ag-graphene hybrid conductive ink for writing electronics.

PubMed

Xu, L Y; Yang, G Y; Jing, H Y; Wei, J; Han, Y D

2014-02-07

With the aim of preparing a method for the writing of electronics on paper by the use of common commercial rollerball pens loaded with conductive ink, hybrid conductive ink composed of Ag nanoparticles (15 wt%) and graphene-Ag composite nanosheets (0.15 wt%) formed by depositing Ag nanoparticles (∼10 nm) onto graphene sheets was prepared for the first time. Owing to the electrical pathway effect of graphene and the decreased contact resistance of graphene junctions by depositing Ag nanoparticles (NPs) onto graphene sheets, the concentration of Ag NPs was significantly reduced while maintaining high conductivity at a curing temperature of 100 ° C. A typical resistivity value measured was 1.9 × 10(-7) Ω m, which is 12 times the value for bulk silver. Even over thousands of bending cycles or rolling, the resistance values of writing tracks only increase slightly. The stability and flexibility of the writing circuits are good, demonstrating the promising future of this hybrid ink and direct writing method.

Direct measurement of methane hydrate composition along the hydrate equilibrium boundary

USGS Publications Warehouse

Circone, S.; Kirby, S.H.; Stern, L.A.

2005-01-01

The composition of methane hydrate, namely nW for CH 4??nWH2O, was directly measured along the hydrate equilibrium boundary under conditions of excess methane gas. Pressure and temperature conditions ranged from 1.9 to 9.7 MPa and 263 to 285 K. Within experimental error, there is no change in hydrate composition with increasing pressure along the equilibrium boundary, but nW may show a slight systematic decrease away from this boundary. A hydrate stoichiometry of n W = 5.81-6.10 H2O describes the entire range of measured values, with an average composition of CH4??5.99(??0.07) H2O along the equilibrium boundary. These results, consistent with previously measured values, are discussed with respect to the widely ranging values obtained by thermodynamic analysis. The relatively constant composition of methane hydrate over the geologically relevant pressure and temperature range investigated suggests that in situ methane hydrate compositions may be estimated with some confidence. ?? 2005 American Chemical Society.

Effect of postural changes on aldosterone to plasma renin ratio in patients with suspected secondary hypertension.

PubMed

Barigou, M; Ah-Kang, F; Orloff, E; Amar, J; Chamontin, B; Bouhanick, B

2015-06-01

To study the influence of postural changes on aldosterone to renin ratio (ARR) in patients with suspected secondary hypertension and to evaluate the sensitivity and specificity of the recommended seated ARR compared to supine and upright ARR for primary aldosteronism screening. Fifty-three hypertensive patients were prospectively hospitalized for secondary hypertension exploration (age: 51 ± 12, 66% males). After withdrawal of drugs interfering with renin angiotensin system, plasma aldosterone and direct renin concentration were measured in the morning, at bed after an overnight supine position, then out of bed after 1 hour of upright position and finally 2 hours later after 15 minutes of seating. Minimal renin value was set at 5 μUI/mL. Referring to ARR cut-off of 23 pg/μUI, the sensitivity of seated ARR was 57.1% and specificity was 92.3%. The negative and positive predictive values were 95.1% and 45.2% respectively. Compared to these results, a cut-off of 19 improved sensitivity to 85.7% with a specificity of 89.7%. Negative and positive predictive values were 98.3% and 41.1% respectively. Seated ARR mean value was lower than supine and upright ARR mean values, due to an overall increase in renin at seating compared to the supine position by factor 1.9 while aldosterone just slightly increased by factor 1.2. Seated ARR correlated to supine and upright ARR: correlation coefficients (r) 0.90 and 0.93 respectively (P<0.001). Current recommended measurement of ARR in the seating position is fairly correlated to supine and upright ARR. A suggested cut-off value of 19 instead of 23 pg/μUI increased the discriminating power of this test. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Effect of co-milled wheat, green gram and barley on the rheological and quality characteristics of cookies.

PubMed

Tulse, Siddharth B; V, Reshma; Rajiv, Jyotsna; Sakhare, Suresh D

2015-10-01

Studies were carried out on the co-milling of wheat (W), green gram (GG) and barley (BR) grains using a roller milling system. The co-milled straight run flours obtained by varying proportions of wheat, barley and green gram WGGBR-1 (90:5:5), WGGBR-2 (80:10:10) and WGGBR-3 (70:15:15) were used in the cookie baking experiments. As the amount of GG and BR increased in blend, water absorption increased (56.5-58.4%) and dough stability and extensibility values decreased (104-92 mm). Hardness of cookie doughs and spread ratio (7.70-6.00) of cookies decreased and breaking strength values increased from 2900 to 3700 g in cookies made using co-milled blends WGGBR-1, WGGBR-2 and WGGBR-3. The highest breaking strength value (3700 g), large islands, gummy mouth feel and lowest overall quality score of 51.5 were recorded for cookies made with blend WGGBR-3 indicating that the cookies had unacceptable hard texture. The optimum blend for cookies was WGGBR-2 (80:10:10) and the cookies possessed slightly small islands, crisp, light texture and a pleasant taste. These cookies had 12.30 and 8.00% protein and dietary fibre as against the control cookie values of 8 and 4%, respectively. The in vitro protein digestibility of the control cookies was 61% and it was 51% for cookies made with WGGBR-2 blend. © The Author(s) 2014.

Solar Cycle and Anthropogenic Forcing of Surface-Air Temperature at Armagh Observatory, Northern Ireland

NASA Technical Reports Server (NTRS)

Wilson, Robert M.

2010-01-01

A comparison of 10-yr moving average (yma) values of Armagh Observatory (Northern Ireland) surface-air temperatures with selected solar cycle indices (sunspot number (SSN) and the Aa geomagnetic index (Aa)), sea-surface temperatures in the Nino 3.4 region, and Mauna Loa carbon dioxide (CO2) (MLCO2) atmospheric concentration measurements reveals a strong correlation (r = 0.686) between the Armagh temperatures and Aa, especially, prior to about 1980 (r = 0.762 over the interval of 1873-1980). For the more recent interval 1963-2003, the strongest correlation (r = 0.877) is between Armagh temperatures and MLCO2 measurements. A bivariate fit using both Aa and Mauna Loa values results in a very strong fit (r = 0.948) for the interval 1963-2003, and a trivariate fit using Aa, SSN, and Mauna Loa values results in a slightly stronger fit (r = 0.952). Atmospheric CO2 concentration now appears to be the stronger driver of Armagh surface-air temperatures. An increase of 2 C above the long-term mean (9.2 C) at Armagh seems inevitable unless unabated increases in anthropogenic atmospheric gases can be curtailed. The present growth in 10-yma Armagh temperatures is about 0.05 C per yr since 1982. The present growth in MLCO2 is about 0.002 ppmv, based on an exponential fit using 10-yma values, although the growth appears to be steepening, thus, increasing the likelihood of deleterious effects attributed to global warming.

Changes in plasma chemistry after drug-induced liver disease or muscle necrosis in racing pigeons (Columba livia domestica).

PubMed

Lumeij, J T; Meidam, M; Wolfswinkel, J; Van der Hage, M H; Dorrestein, G M

1988-01-01

Changes in plasma variables as a result of liver damage induced by ethylene glycol (group A) or D-galactosamine (group B) and of muscle damage induced by doxycycline were compared. Plasma bile acid concentration was both a specific and a sensitive indicator of liver disease. Another specific, but less sensitive indicator of liver disease was 7-GT. Plasma AS AT activity was the most sensitive indicator of disease of the liver, but was not specific, since increased ASAT activities were also seen during muscle disease. ALAT activity was slightly more sensitive to liver damage than 7-GT, but was also not specific, being increased also after muscle damage. Plasma GLDH activity was increased only as a result of extensive liver necrosis. AP activity was of no value for detecting liver disease in the pigeon. CK activity was specific for muscle injury, though the activities of ALAT, ASAT and LD were also increased. Because of its long elimination half-life, increased ALAT activity persisted for 9 days after muscle damage, whereas CK activity returned to reference values within 3 days. LDH was a poor indicator of damage to liver and muscle, despite its relatively high tissue concentrations in both tissues. The rapid disappearance rate of LDH from plasma probably explains this observation.

A 1-year randomized study to evaluate the effects of a dose reduction in oral contraceptives on lipids and carbohydrate metabolism: 20 microg ethinyl estradiol combined with 100 microg levonorgestrel.

PubMed

Skouby, Sven O; Endrikat, Jan; Düsterberg, Bernd; Schmidt, Werner; Gerlinger, Christoph; Wessel, Jens; Goldstein, Henri; Jespersen, Joergen

2005-02-01

To evaluate the impact on lipid and carbohydrate variables of a combined one-third ethinyl estradiol (EE)/levonorgestrel (LNG) dose reduction in oral contraceptives. In an open-label, randomized study, a dose-reduced oral contraceptive containing 20 microg EE and 100 microg LNG (20 EE/100 LNG) was compared with a reference preparation containing 30 microg EE and 150 microg LNG (30 EE/150 LNG). One-year data from 48 volunteers were obtained. We found a decrease of HDL2 cholesterol and increases of low-density lipoprotein cholesterol, very low-density lipoprotein cholesterol and total triglycerides in both treatment groups from baseline to the 13th treatment cycle. Although for four of six variables, the changes in the 20 EE group were lower compared with the 30 EE group, none of the differences between the two treatments were statistically significant. The median values for the fasting levels of insulin, C-peptide and free fatty acids slightly increased or remained unchanged while the fasting glucose levels slightly decreased after 13 treatment cycles. While the glucose area under the curve (AUC) (0-3 h) was similar in both groups during the OGTT, the insulin AUC(0-3 h) was less increased in the 20 EE/100 LNG group compared with the 30 EE/150 LNG group. None of the differences between the treatment groups for any of the carbohydrate metabolism variables were statistically significant at any time point. Both study treatments were safe and well tolerated by the volunteers. Similar effects on the lipid and carbohydrate profiles were found for both preparations. The balanced one-third EE dose reduction in this new oral contraceptive caused slightly lower, but insignificant, changes in the lipid and carbohydrate variables compared with the reference treatment.

Improving Indonesian cinnamon (c. burmannii (Nees & t. nees) Blume) value chains for Greater Farmers Incomes

NASA Astrophysics Data System (ADS)

Menggala, S. R.; Damme, P. V.

2018-03-01

Genus Cinnamomum (Lauraceae) regroups some species whose stem bark are harvested, conditioned and traded as cinnamon in an international market. Over the centuries, the species have been domesticated so that now at least six different ones are grown in Southeast Asia countries. One of the species is Cinnamomum burmannii, also known as Korintje Cinnamon, which generates income for most smallholder farmers in Kerinci district, Jambi, Indonesia. Most cinnamon consumed in the world originates from this Korintje Cinnamon products. It is recognized for its unparalleled quality that comes with its sharp and sweet flavor, with a slightly bitter edge. However, international market requirements for product certification and quality standards make it difficult for a farmer to comply. Our research will address issues related to (improvement of) productivity, sustainability and value chains faced by cinnamon producers in Kerinci, to strengthen their product’s value chains. Smallholder farmers are very vulnerable to climate change impacts, and thus empowering the value chains of agricultural products will increase farmers resilience to climate change. The research will analyze the development of agricultural value chains, certification & standards on trade mechanism to help farmers earn a better income and future prospects.

Influence of applied electric field annealing on the microwave properties of (Ba0.5Sr0.5)TiO3 thin films

NASA Astrophysics Data System (ADS)

Cho, Kwang-Hwan; Lee, Chil-Hyoung; Kang, Chong-Yun; Yoon, Seok-Jin; Lee, Young-Pak

2007-04-01

The effect of heat treatment in electric field on the structure and dielectric properties at microwave range of rf magnetron sputtering derived (Ba0.5Sr0.5)TiO3 thin films have been studied. It has been demonstrated that postannealing in the proper electric field can increase the dielectric constant and the tunability. The increased out-of-plane lattice constant in the electric-annealed films indicated the formation of small polar regions with tetragonal structure, which are responsible for the increased dielectric constant and tunability. It was proposed that the segregation of Ti3+ ions caused by electric annealing could induce the formation of BaTiO3-like regions, which are ferroelectric at room temperature. And in dielectric loss, as the Ti-O bonding lengths increase, the energy scattering on the ferroelectric mode also increases. So, the value of dielectric loss is slightly increased.

Effect of organo clay on curing, mechanical and dielectric properties of NR/SBR blends

NASA Astrophysics Data System (ADS)

Ravikumar, K.; Joseph, Reji; Ravichandran, K.

2018-04-01

Natural rubber (NR) and styrene butadiene rubber (SBR) based elastomeric blends reinforced with organically modified Sodium bentonite clay were prepared by two roll mills. Vulcanization parameters such as minimum and maximum torque values scorch and cure times are measured by Oscillating Disc Rheometer. Mechanical properties such as Tensile strength, modulus at 100%, 200% and 300% elongation and elongation at break and Hardness were measured by Universal testing machine and Durometer Shore A hardness meter respectively. Dielectric properties such as dielectric constant (ε’), dissipation factor (tanδ) and volume resistivity (ρv) were measured at room temperature. The curing studies show that torque values are increasing in NR/SBR blends by increase NR content. The scorch and optimum cure time in NR/SBR blends reinforced organo modified clay was found through increase in the SBR content. This may be due to better processing safety of the NR/SBR blends reinforced with organo modified clay. Mechanical properties show that addition of SBR in blends, tensile strength, elongation modulus increases, but 100% modulus slightly increases and no change was observed in Hardness. Dielectric studies show that dielectric constant of NR and SBR rubbers are almost same, it may due to their non-polar nature. But addition of SBR in NR/SBR blend, dielectric constant gradually increases and maximum value observed at 50/50 ratio. But no considerable change was observed in dissipation factor. Frequency dependant resistivity shows that volume resistivity was not changed with respect to frequency up to 3.5 kHz and beyond that the frequency dependence resistivity was found.

Parameter optimization of the QUAL2K model for a multiple-reach river using an influence coefficient algorithm.

PubMed

Cho, Jae Heon; Ha, Sung Ryong

2010-03-15

An influence coefficient algorithm and a genetic algorithm (GA) were introduced to develop an automatic calibration model for QUAL2K, the latest version of the QUAL2E river and stream water-quality model. The influence coefficient algorithm was used for the parameter optimization in unsteady state, open channel flow. The GA, used in solving the optimization problem, is very simple and comprehensible yet still applicable to any complicated mathematical problem, where it can find the global-optimum solution quickly and effectively. The previously established model QUAL2Kw was used for the automatic calibration of the QUAL2K. The parameter-optimization method using the influence coefficient and genetic algorithm (POMIG) developed in this study and QUAL2Kw were each applied to the Gangneung Namdaecheon River, which has multiple reaches, and the results of the two models were compared. In the modeling, the river reach was divided into two parts based on considerations of the water quality and hydraulic characteristics. The calibration results by POMIG showed a good correspondence between the calculated and observed values for most of water-quality variables. In the application of POMIG and QUAL2Kw, relatively large errors were generated between the observed and predicted values in the case of the dissolved oxygen (DO) and chlorophyll-a (Chl-a) in the lowest part of the river; therefore, two weighting factors (1 and 5) were applied for DO and Chl-a in the lower river. The sums of the errors for DO and Chl-a with a weighting factor of 5 were slightly lower compared with the application of a factor of 1. However, with a weighting factor of 5 the sums of errors for other water-quality variables were slightly increased in comparison to the case with a factor of 1. Generally, the results of the POMIG were slightly better than those of the QUAL2Kw.

Nanoscale Zero-Valent Iron Decorated on Bentonite/Graphene Oxide for Removal of Copper Ions from Aqueous Solution.

PubMed

Shao, Jicheng; Yu, Xiaoniu; Zhou, Min; Cai, Xiaoqing; Yu, Chuang

2018-06-04

The removal efficiency of Cu(II) in aqueous solution by bentonite, graphene oxide (GO), and nanoscale iron decorated on bentonite (B-nZVI) and nanoscale iron decorated on bentonite/graphene oxide (GO-B-nZVI) was investigated. The results indicated that GO-B-nZVI had the best removal efficiency in different experimental environments (with time, pH, concentration of copper ions, and temperature). For 16 hours, the removal efficiency of copper ions was 82% in GO-B-nZVI, however, it was 71% in B-nZVI, 26% in bentonite, and 18% in GO. Bentonite, GO, B-nZVI, and GO-B-nZVI showed an increased removal efficiency of copper ions with the increase of pH under a certain pH range. The removal efficiency of copper ions by GO-B-nZVI first increased and then fluctuated slightly with the increase of temperature, while B-nZVI and bentonite increased and GO decreased slightly with the increase of temperature. Lorentz-Transmission Electron Microscope (TEM) images showed the nZVI particles of GO-B-nZVI dispersed evenly with diameters ranging from 10 to 86.93 nm. Scanning electron microscope (SEM) images indicated that the nanoscale iron particles were dispersed evenly on bentonite and GO with no obvious agglomeration. The q e,cal (73.37 mg·g -1 and 83.89 mg·g -1 ) was closer to the experimental value q e,exp according to the pseudo-second-order kinetic model. The q m of B-nZVI and GO-B-nZVI were 130.7 mg·g -1 and 184.5 mg·g -1 according to the Langmuir model.

Impacts of human activity and extreme weather events on sedimentary organic matter in the Andong salt marsh, Hangzhou Bay, China

NASA Astrophysics Data System (ADS)

Loh, Pei Sun; Cheng, Long-Xiu; Yuan, Hong-Wei; Yang, Lin; Lou, Zhang-Hua; Jin, Ai-Min; Chen, Xue-Gang; Lin, Yu-Shih; Chen, Chen-Tung Arthur

2018-02-01

In this study, lignin-derived phenols, stable carbon isotopes and bulk elemental compositions were determined along the length of two sediment cores (C1 and C2) from the Andong salt marsh, which is located southwest of Hangzhou Bay, China. The purpose of this study was to determine the short-term changes and their implications along sediment profiles. The 1997 high tide had caused an increase in the terrestrial organic matter (OM) signal from 1996/1997 to 2000 in both cores, which was indicated by a high Λ (total lignin in mg/100 mg OC), TOC, C/N and more negative δ13C values. The slight increases in terrestrial OM along the length of the cores between 2003 and 2006 were most likely attributable to the construction of the Hangzhou Bay Bridge. Both events have likely caused an increase in erosion, and thus, these events have increased the input of terrestrial OM to nearby areas. The effects of the distinctively dry year of 2006 can be observed along C2 between 2006 and 2008 in the steadily declining terrestrial OM signal. The overall slight decrease in terrestrial OM and the distinct increase in TOC along the length of both cores toward the present were most likely because of the overall reduced sediment caused by the trapping of materials within reservoirs. These results show that the reduction in terrestrial OM in the Andong salt marsh for the past 30 years was due to reservoirs and the 2006 drought, but this was counterbalanced by the 1997 high tide event and construction of the Hangzhou Bay Bridge, which resulted in increased erosion and terrestrial OM input.

Partial resistance of low density lipoprotein to oxidation in vivo after increased intake of berries.

PubMed

Marniemi, J; Hakala, P; Mäki, J; Ahotupa, M

2000-12-01

The health-promoting effects of fruit- and vegetable-based diets are known to be associated with their antioxidative components. We found in our preliminary in vitro laboratory tests that extracts of many common Finnish edible berries are potent scavengers of peroxyl radicals and inhibitors of lipid peroxidation. We therefore designed the current study to evaluate both the long-term (8 weeks) and short-term (5 hours) effects of increased intake of three berries on antioxidant potential and lipid peroxidation. Healthy 60-year-old men were randomized to berry, supplement and control groups (20 men in each group). The berry group ate, in addition to their normal diet, a 100 g portion of deep-frozen berries (bilberries, lingonberries, or black currants) daily for 8 weeks. The other groups ingested daily 100 mg of alpha-tocopherol and 500 mg of ascorbic acid (supplement group) or 500 mg of calcium gluconate (control group). In the short-term experiment 6 men ate 80 g of each of the three berries in one go. Serum ascorbate concentrations increased significantly in both the berry and the supplement group. Serum alpha-tocopherol levels and the antioxidant potential (TRAP) in low density lipoprotein (LDL) increased in the supplement group only. In the berry group, slightly lowered LDL diene conjugation (p = 0.074) and slightly increased total serum TRAP (p = 0.084) values were observed. No changes were found in these measures in the supplement or the control group. In the short-term experiment, LDL TRAP showed a small increase (about 10%, p = 0.039) during five hours after the intake of 240 g berries. The effects of consumption of berries on antioxidant potential and diene conjugation in LDL particles in vivo appear to be small.

Phosphate fertilizer impacts on glyphosate sorption by soil.

PubMed

Munira, Sirajum; Farenhorst, Annemieke; Flaten, Don; Grant, Cynthia

2016-06-01

This research examined the impact of field-aged phosphate and cadmium (Cd) concentrations, and fresh phosphate co-applications, on glyphosate sorption by soil. Soil samples were collected in 2013 from research plots that had received, from 2002 to 2009, annual applications of mono ammonium phosphate (MAP) at 20, 40 and 80 kg P ha(-1) and from products containing 0.4, 70 or 210 mg Cd kg(-1) as an impurity. A series of batch equilibrium experiments were carried out to quantify the glyphosate sorption distribution constant, Kd. Extractable Cd concentrations in soil had no significant effect on glyphosate sorption. Glyphosate Kd values significantly decreased with increasing Olsen-P concentrations in soil, regardless of the pH conditions studied. Experiments repeated with a commercially available glyphosate formulation showed statistically similar results as the experiments performed with analytical-grade glyphosate. Co-applications of MAP with glyphosate also reduced the available sorption sites to retain glyphosate, but less so when soils already contain large amounts of phosphate. Glyphosate Kd values in soils ranged from 173 to 939 L kg(-1) under very strong to strongly acidic condition but the Kd was always <100 L kg(-1) under moderately acidic to slightly alkaline conditions. The highest Olsen-P concentrations in soil reduced Kd values by 25-44% relative to control soils suggesting that, under moderately acidic to slightly alkaline conditions, glyphosate may become mobile by water in soils with high phosphate levels. Otherwise, glyphosate residues in agricultural soils are more likely to be transported off-site by wind and water-eroded sediments than by leaching or runoff. Copyright © 2016 Elsevier Ltd. All rights reserved.

High-Fiber Orange Juice as a Nutrition Supplement in Women: A Randomized, Double-Blind, Placebo-Controlled Study of Tolerance and Effectiveness.

PubMed

Bergamasco, Christiane; Horie, Lilian Mika; Torrinhas, Raquel Susana; Waitzberg, Dan L

2015-11-01

The daily consumption of dietary fiber is frequently below suggested recommendations. Using a double-blind, controlled, randomized study, we assessed the efficiency and tolerance of a fiber-enriched orange juice to supplement fiber intake in women. After 1 week of noninterventional observation, 192 healthy adult women ingested 400 mL of orange juice for 21 days, which either was not (placebo group) or was enriched with fiber (fiber group). Orange juice ingestion was registered daily and controlled for each week during the study period. Macronutrient, fiber, and energy intake were determined using a 3-day food record, validated food chemical composition databases, and the "Pro Diet" software. Gastrointestinal symptoms were self-evaluated daily by scoring 4 grades of symptom intensity and using a visual analog scale to grade pain severity. No changes were observed for macronutrient and energy ingestion. For the placebo group (n = 97), the total fiber intake record was under the daily recommended value. In contrast, the fiber group (n = 95) displayed higher comparative values of total and soluble fiber consumption (P ≤ .001), achieving the daily recommended values of fiber intake. Both groups reported an increased frequency of slight bloating and rumbles over time (P ≤ .05). The fiber group also experienced a higher frequency of slight flatulence over time (P = .002). Consumption of fiber-enriched orange juice was efficient to achieve the daily fiber intake recommendation for women, was not accompanied by intense adverse events, and may represent a suitable method to supplement fiber intake in woman. © 2014 American Society for Parenteral and Enteral Nutrition.

Investigation on the gaseous and particulate emissions of a compression ignition engine fueled with diesel-dimethyl carbonate blends.

PubMed

Cheung, C S; Zhu, Ruijun; Huang, Zuohua

2011-01-01

The effect of dimethyl carbonate (DMC) on the gaseous and particulate emissions of a diesel engine was investigated using Euro V diesel fuel blended with different proportions of DMC. Combustion analysis shows that, with the blended fuel, the ignition delay and the heat release rate in the premixed combustion phase increase, while the total combustion duration and the fuel consumed in the diffusion combustion phase decrease. Compared with diesel fuel, with an increase of DMC in the blended fuel, the brake thermal efficiency is slightly improved but the brake specific fuel consumption increases. On the emission side, CO increases significantly at low engine load but decreases at high engine load while HC decreases slightly. NO(x) reduces slightly but the reduction is not statistically significant, while NO(2) increases slightly. Particulate mass and number concentrations decrease upon using the blended fuel while the geometric mean diameter of the particles shifts towards smaller size. Overall speaking, diesel-DMC blends lead to significant improvement in particulate emissions while the impact on CO, HC and NO(x) emissions is small. Copyright © 2010 Elsevier B.V. All rights reserved.

Structural, vibrational and dielectric studies of (0.95)Pb(Zr{sub x}Ti{sub 1−x})O{sub 3}-(0.05)BiFeO{sub 3} nanoceramics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Subhash, E-mail: rk.dwivedi@jiit.ac.in; Singh, Vikash, E-mail: rk.dwivedi@jiit.ac.in; Dwivedi, R. K., E-mail: rk.dwivedi@jiit.ac.in

2014-04-24

(0.95)Pb(Zr{sub x}Ti{sub 1−x})O{sub 3}-(0.05)BiFeO{sub 3} nanoceramics with x=0.51, 0.53 and 0.55 were synthesized by sol-gel route. Rietveld refined X-ray powder diffraction pattern of the samples confirm the single phase formation of compounds with tetragonal structure (P4mm). FT-IR studies revealed that slight shift of phonon modes towards the lower wave number and increase in the bond length with increasing Zr{sup 4+} concentration. Room temperature dielectric properties of system revealed that relaxor characteristics of these samples. Ferroelectric hysteresis curve shows the decrease in polarization values with Zr concentration.

Electrodeposited Fe-Co films prepared from a citric-acid-based plating bath

NASA Astrophysics Data System (ADS)

Yanai, T.; Uto, H.; Shimokawa, T.; Nakano, M.; Fukunaga, H.; Suzuki, K.

2013-06-01

Electrodeposited Fe-Co films are commonly prepared in a boric-acid-based bath. In this research, we applied citric acid instead of boric acid for the plating of Fe-Co films because boron in the waste bath is restricted by environmental-protection regulations in Japan. We evaluated the effect of citric acid on the magnetic and structural properties of the films. The saturation magnetization of the Fe-Co films slightly increased while the Fe content in the Fe-Co films decreased with increasing citric acid concentration. The lowest coercivity value of 240 A/m was obtained at a citric acid concentration of 100 g/L. The plating bath with this citric acid concentration enabled us to obtain Fe-Co films with high saturation magnetizations and smooth surface morphologies.

Chemistry of Aviation Fuels

NASA Technical Reports Server (NTRS)

Knepper, Bryan; Hwang, Soon Muk; DeWitt, Kenneth J.

2004-01-01

Minimum ignition energies of various methanol/air mixtures were measured in a temperature controlled constant volume combustion vessel using a spark ignition method with a spark gap distance of 2 mm. The minimum ignition energies decrease rapidly as the mixture composition (equivalence ratio, Phi) changes from lean to stoichiometric, reach a minimum value, and then increase rather slowly with Phi. The minimum of the minimum ignition energy (MIE) and the corresponding mixture composition were determined to be 0.137 mJ and Phi = 1.16, a slightly rich mixture. The variation of minimum ignition energy with respect to the mixture composition is explained in terms of changes in reaction chemistry.

Experimental Research on Air Propellers III

NASA Technical Reports Server (NTRS)

Durand, W F; Lesley, E P

1920-01-01

Report presents the results of wind tunnel tests of propellers that examined the influence of the following characteristics: (1) nominal pitch ratio 1.3 combined with a certain number of the more common or standard forms and proportions; (2) driving face slightly rounded or convex; (3) change in the location of the maximum thickness ordinate of the blade section; (4) pushing forward the leading edge of the blade, thus giving a rounded convex surface on the leading side of the driving face. (5) a series of values for the constant "angle of attack" in forming propellers with radially increasing pitch. In accordance with these purposes tests were carried out on 28 propellers.

Analysis of Arterial Mechanics During Head-Down-Tilt Bed Rest

NASA Technical Reports Server (NTRS)

Elliott, Morgan B.; Martin, David S.; Westby, Christian M.; Stenger, Michael B.; Platts, Steven H.

2014-01-01

Carotid, brachial, and tibial arteries reacted differently to HDTBR. Previous studies have not analyzed the mechanical properties of the human brachial or anterior tibial arteries. After slight variations during bed-rest, arterial mechanical properties and IMT returned to pre-bed rest values, with the exception of tibial stiffness and PSE, which continued to be reduced post-bed rest while the DC remained elevated. The tibial artery remodeling was probably due to decreased pressure and volume. Resulting implications for longer duration spaceflight are unclear. Arterial health may be affected by microgravity, as shown by increased thoracic aorta stiffness in other ground based simulations (Aubert).

Connecticut's Value-Based Insurance Plan Increased The Use Of Targeted Services And Medication Adherence.

PubMed

Hirth, Richard A; Cliff, Elizabeth Q; Gibson, Teresa B; McKellar, M Richard; Fendrick, A Mark

2016-04-01

In 2011 Connecticut implemented the Health Enhancement Program for state employees. This voluntary program followed the principles of value-based insurance design (VBID) by lowering patient costs for certain high-value primary and chronic disease preventive services, coupled with requirements that enrollees receive these services. Nonparticipants in the program, including those removed for noncompliance with its requirements, were assessed a premium surcharge. The program was intended to curb cost growth and improve health through adherence to evidence-based preventive care. To evaluate its efficacy in doing so, we compared changes in service use and spending after implementation of the program to trends among employees of six other states. Compared to employees of other states, Connecticut employees were similar in age and sex but had a slightly higher percentage of enrollees with chronic conditions and substantially higher spending at baseline. During the program's first two years, the use of targeted services and adherence to medications for chronic conditions increased, while emergency department use decreased, relative to the situation in the comparison states. The program's impact on costs was inconclusive and requires a longer follow-up period. This novel combination of VBID principles and participation requirements may be a tool that can help plan sponsors increase the use of evidence-based preventive services. Project HOPE—The People-to-People Health Foundation, Inc.

The influence of changes in blood flow on the accuracy of pulse oximetry in humans.

PubMed

Vegfors, M; Lindberg, L G; Lennmarken, C

1992-05-01

Oxygen saturation (SpO2) was measured with a pulse oximeter in ten healthy, young men breathing air. A pulse oximeter probe was attached to the second toe and a laser Doppler probe to the first toe of the same foot for measurement of changes in peripheral blood flow. The pulse oximeter and laser Doppler readings were simultaneously compared when the foot was positioned 40 cm (position 1) above heart level, elevated 10 cm (position 2) above heart level and horizontally at heart level (position 3). Using this experimental human model, we achieved various blood flows. The AC and DC optical signals used for determination of oxygen saturation were recorded from the pulse oximeter and analysed. There was a significant increase (P less than 0.05) between position 1 and 3 in blood flow as measured by the laser Doppler flow meter. The corresponding pulse oximeter readings of haemoglobin saturation also increased significantly (P less than 0.05) comparing these two leg positions. Analysing the AC- and DC optical signals, the AC value of infrared light increased considerably, while the AC value of the red light decreased slightly. The DC values of red and infrared light did not change significantly. In summary, when blood flow was decreased, the ratio of red to infrared transmitted light was changed, resulting in a low SpO2 reading.

Age and diagnostic performance of Alzheimer disease CSF biomarkers.

PubMed

Mattsson, N; Rosén, E; Hansson, O; Andreasen, N; Parnetti, L; Jonsson, M; Herukka, S-K; van der Flier, W M; Blankenstein, M A; Ewers, M; Rich, K; Kaiser, E; Verbeek, M M; Olde Rikkert, M; Tsolaki, M; Mulugeta, E; Aarsland, D; Visser, P J; Schröder, J; Marcusson, J; de Leon, M; Hampel, H; Scheltens, P; Wallin, A; Eriksdotter-Jönhagen, M; Minthon, L; Winblad, B; Blennow, K; Zetterberg, H

2012-02-14

Core CSF changes in Alzheimer disease (AD) are decreased amyloid β(1-42), increased total tau, and increased phospho-tau, probably indicating amyloid plaque accumulation, axonal degeneration, and tangle pathology, respectively. These biomarkers identify AD already at the predementia stage, but their diagnostic performance might be affected by age-dependent increase of AD-type brain pathology in cognitively unaffected elderly. We investigated effects of age on the diagnostic performance of CSF biomarkers in a uniquely large multicenter study population, including a cross-sectional cohort of 529 patients with AD dementia (median age 71, range 43-89 years) and 304 controls (67, 44-91 years), and a longitudinal cohort of 750 subjects without dementia with mild cognitive impairment (69, 43-89 years) followed for at least 2 years, or until dementia diagnosis. The specificities for subjects without AD and the areas under the receiver operating characteristics curves decreased with age. However, the positive predictive value for a combination of biomarkers remained stable, while the negative predictive value decreased only slightly in old subjects, as an effect of the high AD prevalence in older ages. Although the diagnostic accuracies for AD decreased with age, the predictive values for a combination of biomarkers remained essentially stable. The findings highlight biomarker variability across ages, but support the use of CSF biomarkers for AD even in older populations.

Age and diagnostic performance of Alzheimer disease CSF biomarkers

PubMed Central

Rosén, E.; Hansson, O.; Andreasen, N.; Parnetti, L.; Jonsson, M.; Herukka, S.-K.; van der Flier, W.M.; Blankenstein, M.A.; Ewers, M.; Rich, K.; Kaiser, E.; Verbeek, M.M.; Olde Rikkert, M.; Tsolaki, M.; Mulugeta, E.; Aarsland, D.; Visser, P.J.; Schröder, J.; Marcusson, J.; de Leon, M.; Hampel, H.; Scheltens, P.; Wallin, A.; Eriksdotter-Jönhagen, M.; Minthon, L.; Winblad, B.; Blennow, K.; Zetterberg, H.

2012-01-01

Objectives: Core CSF changes in Alzheimer disease (AD) are decreased amyloid β1–42, increased total tau, and increased phospho-tau, probably indicating amyloid plaque accumulation, axonal degeneration, and tangle pathology, respectively. These biomarkers identify AD already at the predementia stage, but their diagnostic performance might be affected by age-dependent increase of AD-type brain pathology in cognitively unaffected elderly. Methods: We investigated effects of age on the diagnostic performance of CSF biomarkers in a uniquely large multicenter study population, including a cross-sectional cohort of 529 patients with AD dementia (median age 71, range 43–89 years) and 304 controls (67, 44–91 years), and a longitudinal cohort of 750 subjects without dementia with mild cognitive impairment (69, 43–89 years) followed for at least 2 years, or until dementia diagnosis. Results: The specificities for subjects without AD and the areas under the receiver operating characteristics curves decreased with age. However, the positive predictive value for a combination of biomarkers remained stable, while the negative predictive value decreased only slightly in old subjects, as an effect of the high AD prevalence in older ages. Conclusion: Although the diagnostic accuracies for AD decreased with age, the predictive values for a combination of biomarkers remained essentially stable. The findings highlight biomarker variability across ages, but support the use of CSF biomarkers for AD even in older populations. PMID:22302554

Historical carbon footprinting and implications for sustainability planning: a case study of the Pittsburgh region.

PubMed

Hoesly, Rachel; Blackhurst, Mike; Matthews, H Scott; Miller, Jeffrey F; Maples, Amy; Pettit, Matthew; Izard, Catherine; Fischbeck, Paul

2012-04-17

This study estimates fossil-based CO(2) emissions and energy use from 1900-2000 for Allegheny County, PA. Total energy use and emissions increased from 1900 to 1970, reflecting the significant industrial, economic, and population growth that occurred in Allegheny County. From 1970 to 2000, Allegheny County experienced a 30% decrease in total emissions and energy use from peak values, primarily because of a decline in industrial activity (40% decrease in value added) and the loss of a quarter of its population. Despite these dramatic economic and demographic transitions, per capita emissions remained stable from 1970 to 2000, buoyed by relatively stable or slightly increasing emissions in the commercial and transportation sectors. Allegheny County's history suggests the scale of change needed to achieve local emissions reductions may be significant; given years of major technological, economic, and demographic changes, per capita emissions in 1940 were nearly the same in 2000. Most local governments are planning emissions reductions rates that exceed 1% per year, which deviate significantly from historical trends. Our results suggest additional resources and improved planning paradigms are likely necessary to achieve significant emissions reductions, especially for areas where emissions are still increasing.

Time course of fractional gluconeogenesis after meat ingestion in healthy adults: a D2O study.

PubMed

Gaudichon, Claire; Ta, Hai-Yen; Khodorova, Nadezda V; Oberli, Marion; Breton, Isabelle; Benamouzig, Robert; Tomé, Daniel; Godin, Jean-Philippe

2018-06-19

In the postprandial state, glucose homeostasis is challenged by macronutrient intake, including proteins that trigger insulin secretion and provide glucose precursors. However, little is known about the postprandial response of gluconeogenesis to a protein meal. We aimed to quantify the evolution of fractional gluconeogenesis after a meat meal. Thirteen healthy subjects received oral doses of D 2 O. After fasting overnight, they ingested a steak (120 g). Glycemia, insulinemia and 2 H enrichments in glucose and plasma water were measured for 8 h after the meal. Fractional gluconeogenesis was assessed using the average method. Glucose was stable for 5 h and then decreased. There was a slight increase of insulin 1 h after the meal. 2 H enrichment in C5 increased after 2 h, whereas it decreased in plasma water. Consequently, fractional gluconeogenesis increased from 68.2 {plus minus} 7.2% before the meal to 75.5 {plus minus} 5.8% 8 h after the meal, the latter corresponding to 22 h without a glucose supply. These values are consistent with the exhaustion of glycogen stores after 24 h, but represents the highest among values in the literature. The impact of methodological conditions is discussed.

Guar gum as efficient non-toxic inhibitor of carbon steel corrosion in phosphoric acid medium: Electrochemical, surface, DFT and MD simulations studies

NASA Astrophysics Data System (ADS)

Messali, M.; Lgaz, H.; Dassanayake, R.; Salghi, R.; Jodeh, S.; Abidi, N.; Hamed, O.

2017-10-01

Guar gum is a water-soluble, nonionic, nontoxic, biodegradable and biocompatible hetero polysaccharide with unlimited number of industrial applications. In this study, guar gum was evaluated as a natural inhibitor of carbon steel (CS) corrosion in 2 M H3PO4 solution. The characteristic effect of guar gum on the steel corrosion was studied at concentration ranges from 0.1 to 1.0 g/L at 298-328 K by weight loss and electrochemical methods. Obtained results showed that, the inhibition efficiency (η%) of guar gum decreased slightly when the temperature increased and increased by increasing the inhibitor concentration reaching the maximum value at 1.0 g/L. The adsorption of guar gum on steel surface was studied by the Temkin adsorption model. EIS measurements indicate that the values of the polarization resistance (Rp) of CS in presence of guar gum are significantly higher than that of the untreated surface. Steel surface coated with guar gum was analyzed by SEM, FTIR and XRD. The quantum calculations using DFT method and Molecular Dynamic (MD) simulations were performed to define the relationship between inhibition performance of investigated compound and their molecular structure.

Relation between the adsorbed quantity and the immersion enthalpy in catechol aqueous solutions on activated carbons.

PubMed

Moreno-Piraján, Juan Carlos; Blanco, Diego; Giraldo, Liliana

2012-01-01

An activated carbon, Carbochem(TM)-PS230, was modified by chemical and thermal treatment in flow of H(2), in order to evaluate the influence of the activated carbon chemical characteristics in the adsorption of the catechol. The catechol adsorption in aqueous solution was studied along with the effect of the pH solution in the adsorption process of modified activated carbons and the variation of immersion enthalpy of activated carbons in the aqueous solutions of catechol. The interaction solid-solution is characterized by adsorption isotherms analysis, at 298 K and pH 7, 9 and 11 in order to evaluate the adsorption value above and below that of the catechol pK(a). The adsorption capacity of carbons increases when the solution pH decreases. The retained amount increases slightly in the reduced carbon to maximum adsorption pH and diminishes in the oxidized carbon. Similar conclusions are obtained from the immersion enthalpies, whose values increase with the solute quantity retained. In granular activated carbon (CAG), the immersion enthalpies obtained are between 21.5 and 45.7 J·g(-1) for catechol aqueous solutions in a range of 20 at 1500 mg·L(-1).

Relation Between the Adsorbed Quantity and the Immersion Enthalpy in Catechol Aqueous Solutions on Activated Carbons

PubMed Central

Moreno-Piraján, Juan Carlos; Blanco, Diego; Giraldo, Liliana

2012-01-01

An activated carbon, CarbochemTM—PS230, was modified by chemical and thermal treatment in flow of H2, in order to evaluate the influence of the activated carbon chemical characteristics in the adsorption of the catechol. The catechol adsorption in aqueous solution was studied along with the effect of the pH solution in the adsorption process of modified activated carbons and the variation of immersion enthalpy of activated carbons in the aqueous solutions of catechol. The interaction solid-solution is characterized by adsorption isotherms analysis, at 298 K and pH 7, 9 and 11 in order to evaluate the adsorption value above and below that of the catechol pKa. The adsorption capacity of carbons increases when the solution pH decreases. The retained amount increases slightly in the reduced carbon to maximum adsorption pH and diminishes in the oxidized carbon. Similar conclusions are obtained from the immersion enthalpies, whose values increase with the solute quantity retained. In granular activated carbon (CAG), the immersion enthalpies obtained are between 21.5 and 45.7 J·g−1 for catechol aqueous solutions in a range of 20 at 1500 mg·L−1. PMID:22312237

A Method to Assess the Human Factors Characteristics of Army Aviation Helicopter Crewstations

DTIC Science & Technology

2013-03-01

are Oculomotor (e.g., eyestrain, difficulty focusing, blurred vision), Disorientation (e.g., dizziness, vertigo ), and Nausea (e.g., nausea, increased... Vertigo * None Slight Moderate Severe o. Stomach awareness ** None Slight Moderate Severe p. Burping None Slight...Moderate Severe * Vertigo is a loss of orientation with respect to vertical upright. ** Stomach awareness is a feeling of discomfort just short

Biomarkers in diverticular diseases of the colon.

PubMed

Tursi, Antonio

2012-01-01

Recent data found that diverticular disease (DD) of the colon shows similarities with inflammatory bowel diseases (IBD). In particular, the detection of microscopic inflammation and the clinical response to mesalazine seem to confirm the hypothesis that inflammation may be a key point for the appearance of symptoms and development of complications. In light of this hypothesis, several studies have recently focused their attention on the role of biomarkers in predicting and monitoring the course of the disease. C-reactive protein (CRP), white blood cell count, erythrocyte sedimentation rate, and fecal calprotectin (FC) have therefore been investigated. As in IBD, CRP seems to be the most effective marker of histological and clinical severity of the disease. In particular, CRP below 50 mg/l suggests an acute uncomplicated diverticulitis (AUD), whereas CRP higher than 200 mg/l is a strong indicator of DD complicated by perforation. As in IBD, FC seems to be a noninvasive sensitive marker of DD severity. In particular, FC may show slight increased valued already in symptomatic uncomplicated DD (SUDD) (FC value ≥15 μg/ml seems to be predictive of SUDD). As expected, FC shows higher values in AUD (FC value ≥60 μg/ml seems to be predictive of AUD). Finally, FC seems to be useful also in monitoring the therapeutic response in DD. In fact, FC values decreased significantly in patients responding to therapy, whereas they persisted to increase in patients who failed to obtain remission. Copyright © 2012 S. Karger AG, Basel.

Anthropometric and metabolic indices in assessment of type and severity of dyslipidemia.

PubMed

Zaid, Muhammad; Ameer, Fatima; Munir, Rimsha; Rashid, Rida; Farooq, Nimrah; Hasnain, Shahida; Zaidi, Nousheen

2017-02-28

It has been shown that obesity is associated with increased rates of dyslipidemia. The present work revisits the association between plasma lipid levels and classical indicators of obesity including body mass index (BMI). The significance of various anthropometric/metabolic variables in clinical assessment of type and severity of dyslipidemia was also determined. Recently described body indices, a body shape index (ABSI) and body roundness index (BRI), were also assessed in this context. For the present cross-sectional analytical study, the participants (n = 275) were recruited from the patients visiting different health camps. Participants were anthropometrically measured and interviewed, and their fasting intravenous blood was collected. Plasma lipid levels were accordingly determined. The values for different anthropometric parameters are significantly different between dyslipidemic and non-dyslipidemic participants. Receiver operating characteristics curve analyses revealed that all the tested variables gave the highest area under the curve (AUC) values for predicting hypertriglyceridemia in comparison to other plasma lipid abnormalities. BRI gave slightly higher AUC values in predicting different forms of dyslipidemia in comparison to BMI, whereas ABSI gave very low values. Several anthropometric/metabolic indices display increased predictive capabilities for detecting hypertriglyceridemia in comparison to any other form of plasma lipid disorders. The capacity of BRI to predict dyslipidemia was comparable but not superior to the classical indicators of obesity, whereas ABSI could not detect dyslipidemia.

Gene Expression Profiling of Nonhuman Primates Exposed to Aerosolized Venezuelan Equine Encephalitis Virus

DTIC Science & Technology

2007-12-01

endogenous pyrogens occur slightly earlier in s.c. infections, but are more pro- longed by aerosol. Lymphopenia also seems to be more aggressive in...brain) Brain P-value (lung) Lung P-value (spleen) Spleen Antigen processing, endogenous antigen via MHC class I (BP) HLA-A 213932_x_at 8.58E-05 2.40

Estimated glomerular filtration rate is associated with both arterial stiffness and N-terminal pro-brain natriuretic peptide in newly diagnosed hypertensive patients.

PubMed

Gür, Mustafa; Uçar, Hakan; Kuloğlu, Osman; Kıvrak, Ali; Şeker, Taner; Türkoğlu, Caner; Özaltun, Betül; Kaypaklı, Onur; Şahin, Durmuş Yıldıray; Elbasan, Zafer; Tanboğa, Halil İbrahim; Çaylı, Murat

2014-01-01

Even a slight decrease in the glomerular filtration rate (GFR) is an independent risk factor for cardiovascular disease. Arterial stiffness, left ventricular hypertrophy and N-terminal pro-brain natriuretic peptide (NT-proBNP) are independent risk factors for cardiovascular disease, which are particularly common in end-stage renal disease. We aimed to evaluate the association between GFR with arterial stiffness, left ventricle mass (LVM) and NT-proBNP in hypertensive subjects with normal to mildly impaired renal function. The study population consisted of 285 newly diagnosed hypertensive patients (mean age; 49.9 ± 11.8 years). GFR was estimated (eGFR) by the Modification of Diet in Renal Disease formula. Pulse wave velocity (PWV) and augmentation index (AIx), which reflects arterial stiffness, were calculated using the single-point method via the Mobil-O-Graph® ARCsolver algorithm. LVM was obtained by echocardiography. Plasma NT-proBNP was measured by electrochemiluminescence. The patients were divided into two groups according to the median eGFR value (eGFRlow group <101 ml/min/1.73 m(2) and eGFRhigh group ≥ 101 ml/min/1.73 m(2)). LVM and NT-proBNP values were higher in eGFRlow group compared with eGFRhigh group (p<0.05). Pulse wave velocity and augmentation index values were higher in eGFRlow group compared with eGFRhigh group (p<0.05, for all). Multiple linear regression analysis showed that eGFR was independently associated with PWV (β=-0.422, p<0.001) and NT-proBNP (β=-0.404, p<0.001). Present study showed that eGFR was independently associated with PWV and NT-proBNP values. Importantly, these findings may explain, in part, the increase in cardiovascular risk in with slightly impaired renal function.

Estimating total body water content in suckling and lactating llamas (Lama glama) by isotope dilution.

PubMed

Riek, Alexander; Gerken, Martina

2010-08-01

Total body water (TBW) in 17 suckling and six lactating llamas was estimated from isotope dilution at three different post natum and lactation stages using both (18)O and deuterium oxide (D(2)O). In total, 69 TBW measurements were undertaken. While TBW in lactating dams, expressed in kilogram, remained stable during the three measurement periods (91.8 +/- 15.0 kg), the body water fraction (TBW expressed in percent of body mass) increased slightly (P = 0.042) from 62.9% to 65.8%. In contrast, TBW (kilogram) in suckling llamas increased significantly (P < 0.001) with age and decreased slightly when expressed as a percentage of body mass (P = 0.016). Relating TBW to body mass across all animals yielded a highly significant regression equation (TBW in kilogram = 2.633 + 0.623 body mass in kilogram, P < 0.001, n = 69) explaining 99.5% of the variation. The water fraction instead decreased in a curve linear fashion with increasing body mass (TBW in percent of body mass = 88.23 body mass in kilogram(-0.064), P < 0.001, R (2) = 0.460). The present results on TBW can serve as reference values for suckling and lactating llamas, e.g., for the evaluation of fluid losses during disease. Additionally, the established regression equations can be used to predict TBW from body mass, providing that the body masses fall inside the range of masses used to derive the equations.

Lotus (Nelumbo nucifera) Rhizome as an Antioxidant Dietary Fiber in Cooked Sausage: Effects on Physicochemical and Sensory Characteristics.

PubMed

Ham, Youn-Kyung; Hwang, Ko-Eun; Song, Dong-Heon; Kim, Yong-Jae; Shin, Dong-Jin; Kim, Kyung-Il; Lee, Hye-Jin; Kim, Na-Rae; Kim, Cheon-Jei

2017-01-01

The objective of this study was to determine the physicochemical and sensory properties of cooked emulsion sausages containing different levels of lotus rhizome powder (0, 1, 2, and 3%, based on total weight). Lotus rhizome powder had no significant ( p >0.05) impact on pH, moisture, protein, or ash content of sausage. However, fat content was slightly but significantly ( p <0.05) decreased when the level of lotus rhizome powder was increased in the sausages. The addition of lotus rhizome powder to sausages at over 1% resulted in significantly ( p <0.05) darker and less red color of cooked sausage compared to control. Increase in lotus rhizome level slightly improved the emulsion stability and apparent viscosity. Significant ( p <0.05) reduction in cooking loss was observed when more than 1% of lotus rhizome powder was added to sausages. The textural properties of sausages were unaffected by the inclusion of lotus rhizome except for springiness and chewiness. On the manufacture day, control sausage had significantly ( p <0.05) higher TBARS value than treatments. Regarding sensory characteristics, increased levels of lotus rhizome powder decreased ( p <0.05) color and juiciness scores. However, cooked sausages exhibited similar overall acceptability regardless of the level of lotus rhizome powder added to sausages. Therefore, lotus rhizome powder, an antioxidant dietary fiber, could be used as an effective natural ingredient in meat products for the development of healthier and functional food.

Lotus (Nelumbo nucifera) Rhizome as an Antioxidant Dietary Fiber in Cooked Sausage: Effects on Physicochemical and Sensory Characteristics

PubMed Central

2017-01-01

The objective of this study was to determine the physicochemical and sensory properties of cooked emulsion sausages containing different levels of lotus rhizome powder (0, 1, 2, and 3%, based on total weight). Lotus rhizome powder had no significant (p>0.05) impact on pH, moisture, protein, or ash content of sausage. However, fat content was slightly but significantly (p<0.05) decreased when the level of lotus rhizome powder was increased in the sausages. The addition of lotus rhizome powder to sausages at over 1% resulted in significantly (p<0.05) darker and less red color of cooked sausage compared to control. Increase in lotus rhizome level slightly improved the emulsion stability and apparent viscosity. Significant (p<0.05) reduction in cooking loss was observed when more than 1% of lotus rhizome powder was added to sausages. The textural properties of sausages were unaffected by the inclusion of lotus rhizome except for springiness and chewiness. On the manufacture day, control sausage had significantly (p<0.05) higher TBARS value than treatments. Regarding sensory characteristics, increased levels of lotus rhizome powder decreased (p<0.05) color and juiciness scores. However, cooked sausages exhibited similar overall acceptability regardless of the level of lotus rhizome powder added to sausages. Therefore, lotus rhizome powder, an antioxidant dietary fiber, could be used as an effective natural ingredient in meat products for the development of healthier and functional food. PMID:28515646

Electromyographic and neuromuscular fatigue thresholds as concepts of fatigue.

PubMed

Mäestu, Jarek; Cicchella, Antonio; Purge, Priit; Ruosi, Sergio; Jürimäe, Jaak; Jürimäe, Toivo

2006-11-01

The aim of this study was to investigate the concepts of electromyographic (EMG) threshold (EMGT) by integrated EMG (iEMG) signals and neuromuscular fatigue threshold (NMFT) concepts in trained male athletes. Nine competitive national-level male rowers (21.8 +/- 4.4 years; 186.2 +/- 4.6 cm; 79.6 +/- 8.4 kg) took part in this investigation. Subjects were asked to participate in the graded exercise test to volitional exhaustion and 500-, 1,000-, and 2,000-m all-out rowing ergometer tests on a rowing ergometer. During all tests, oxygen consumption parameters, average power, and iEMG of the musculus vastus lateralis were recorded. The second ventilatory threshold (248.9 +/- 26.67 W) and EMGT (258.89 +/- 27.13 W) were not significantly different but were significantly lower than the NMFT (302.25 +/- 45.10 W). During 1,000- and 2,000-m all-out distances, VO(2) increased during the first minute and then leveled on a plateau with a slight decrease at the end of the exercise. Vastus lateralis activity showed a slight increase during all distances that was accompanied by a remarkable increase towards the end of the distance. All measured threshold values were significantly correlated (r > 0.70; p < 0.05) to the rowing ergometer performance characteristics. It was concluded that EMGT is closely related to the aerobic-anaerobic transition phase, because NMFT represents the local fatigue accumulation in the muscle. NMFT indicates the performance capacity of the muscles; therefore, it helps coaches to better predict top athletes' performance.

Effects of sandblasting and silica-coating procedures on pure titanium.

PubMed

Kern, M; Thompson, V P

1994-10-01

Silica coating titanium improves chemomechanical bonding. Sandblasting is recommended as a pretreatment to thermal silica coating (Silicoater MD) or as part of a tribochemical silica coating process (Rocatec). This study evaluated the effects of sandblasting and coating techniques on volume loss, surface morphology and composition changes in pure titanium. Volume loss of titanium was similar to values reported for base alloys and does not seem to be critical for the clinical fit of restorations. Embedded alumina particles were found in the titanium after sandblasting and the alumina content increased to a range of 27.5-39.3 wt% as measured by EDS. Following tribochemical silica coating, a layer of small silica particles remained on the surface, increasing the silica content to a range of 17.9-19.5 wt%. Ultrasonic cleaning removed loose alumina or silica particles from the surface, resulting in only slight decreases in alumina or silica contents, suggesting firm attachment of most of the alumina and silica to the titanium surface. Silica content following thermal silica coating treatment increased only slightly from the sandblasted specimen to 1.4 wt%. The silica layer employed by these silica coating methods differs widely in both morphology and thickness. These results provide a basis for explanation of adhesive failure modes in bond strength tests and for developing methods to optimize resin bonding. Clinically, ultrasonic cleaning of sandblasted and tribochemically silica coated titanium should improve resin bonding as loose surface particles are removed without relevant changes in composition.

[The effect of a new antiparkinson agent, Selegilin, on psychomotor performance in humans].

PubMed

Müller-Limmroth, W

1985-01-01

A combination of tests consisting of a compensation task with differential value indication, a tachystoscopic arrangement with verbal identification of characteristic features and an arrangement for a visually induced motor reaction was carried out on 12 healthy volunteers aged from 20-30 to determine psychomotor efficiency under the influence of the new antiparkinson drug selegiline (Eldepryl). The results were compared with the effects of the psychostimulant fenetylline and the depressant-antihistamine chlorphenoxamine, and with a placebo. While fenetylline and chlorphenoxamine produced the anticipated effects with regard to an improvement or deterioration in performance in all parameters, selegiline resulted in a slightly longer motor reaction time and an increase in control errors, and in a significantly longer mental processing time. In comparison with the placebo, selegiline increased the motor reaction time by 0.8 +/- 1.95% and mental processing time by 4.1 +/- 1.7%. This depressant effect of selegiline, however, only attained 1/8 and 2/3, resp., of the sedative effect of the normal dose of the antihistamine chlorophenoxamine. Under the influence of chlorphenoxamine, performance becomes less regular and under fenetylline more regular. Selegiline does not differ significantly from the placebo. In spite of selegiline metabolites 1-metamphetamine and 1-amphetamine, which act as mild stimulants, the slightly depressant effect of selegiline detected can be explained by the increased effect of dopamine inhibitory neurons, particularly in the inhibitory system of the formatio reticularis and the cortex frontalis as a result of a concentration of dopamine.

Ultrafiltration technology with a ceramic membrane for reactive dye removal: optimization of membrane performance.

PubMed

Alventosa-deLara, E; Barredo-Damas, S; Alcaina-Miranda, M I; Iborra-Clar, M I

2012-03-30

An ultrafiltration (UF) ceramic membrane was used to decolorize Reactive Black 5 (RB5) solutions at different dye concentrations (50 and 500 mg/L). Transmembrane pressure (TMP) and cross-flow velocity (CFV) were modified to study their influence on initial and steady-state permeate flux (J(p)) and dye rejection (R). Generally, J(p) increased with higher TMP and CFV and lower feed concentration, up to a maximum steady-state J(p) of 266.81 L/(m(2)h), obtained at 3 bar, 3m/s and 50mg/L. However, there was a TMP value (which changed depending on operating CFV and concentration) beyond which slight or no further increase in steady-state J(p) was observed. Similarly, the higher the CFV was, the more slightly the steady-state J(p) increased. Furthermore, the effectiveness of ultrafiltration treatment was evaluated through dye rejection coefficient. The results showed significant dye removals, regardless of the tested conditions, with steady-state R higher than 79.8% for the 50mg/L runs and around 73.2% for the 500 mg/L runs. Finally response surface methodology (RSM) was used to optimize membrane performance. At 50mg/L, a TMP of 4 bar and a CFV of 2.53 m/s were found to be the conditions giving the highest steady-state J(p), 255.86 L/(m(2)h), and the highest R, 95.2% simultaneously. Copyright © 2012 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gavva, S.R.; Harris, B.G.; Cook, P.F.

A thiol group at the malate-binding site of the NAD-malic enzyme from Ascaris suum has been modified to thiocyanate. The modified enzyme generally exhibits slight increases in K{sub NAD} and K{sub i metal} and decreases in V{sub max} as the metal size increases from Mg{sup 2+} to Mn{sup 2+} to Cd{sup 2+}, indicative of crowding in the site. The K{sub malate} value increases 10- to 30-fold, suggesting that malate does not bind optimally to the modified enzyme. Deuterium isotope effects on V and V/K{sub malate} increase with all three metal ions compared to the native enzyme concomitant with a decreasemore » in the {sup 13}C isotope effect, suggesting a switch in the rate limitation of the hydride transfer and decarboxylation steps with hydride transfer becoming more rate limiting. The {sup 13}C effect decreases only slightly when obtained with deuterated malate, suggestive of the presence of a secondary {sup 13}C effect in the hydride transfer step, similar to data obtained with non-nicotinamide-containing dinucleotide substrates for the native enzyme (see the preceding paper in this issue). The native enzyme is inactivated in a time-dependent manner by Cd{sup 2+}. This inactivation occurs whether the enzyme alone is present or whether the enzyme is turning over with Cd{sup 2+} as the divalent metal activator. Upon inactivation, only Cd{sup 2+} ions are bound at high stoichiometry to the enzyme, which eventually becomes denatured. Conversion of the active-site thiol to thiocyanate makes it more difficult to inactivate the enzyme by treatment with Cd{sup 2+}.« less

Hematological variations at rest and during maximal and submaximal exercise in a cold (0°C) environment

NASA Astrophysics Data System (ADS)

Vogelaere, P.; Brasseur, M.; Quirion, A.; Leclercq, R.; Laurencelle, L.; Bekaert, S.

1990-03-01

The affect of negative thermal stress on hematological variables at rest, and during submaximal (sub ex) and maximal exercise (max ex) were observed for young males who volunteered in two experimental sessions, performed in cold (0°C) and in normal room temperature (20°C). At rest, hematological variables such as RBC and derivates Hb and Hct were significantly increased ( P<0.05) during cold stress exposure, while plasma volume decreased. The findings of this study suggest that the major factor inducing hypovolemia during low thermal stress can be imputed to local plasma water-shift mechanisms and especially to a transient shift of plasma water from intrato extravascular compartments. Rest values for WBC and platelets (Pla) were also slightly increased during cold stress exposure. However this increase can partly be related to hemoconcentration but also to the cold induced hyperventilation activating the lung circulation. Maximal exhaustive exercise induced, in both experimental temperatures, significant ( P<0.05) increments of RBC, Hb, Hct, and WBC while plasma volume decreased. However, Pla increase was less marked. On the other hand, cold stress raised slightly the observed variations of the different hematological variables. Submaximal exercise induced a similar, though non-significant, pattern for the different hematological variables in both experimental conditions. Observed plasma volume (Δ PV%) reduction appears during exercise. However cold stress induced resting plasma volume variations that are transferred at every exercise level. Neither exercise nor cold inducement significantly modified the hematological indices (MCH, MCV, MCHC). In conclusion hematological variables are affected by cold stress exposure, even when subjects perform a physical activity.

Lymph node culture

MedlinePlus

A normal result means there was no growth of microorganisms on the lab dish. Normal value ranges may vary slightly among different laboratories. Talk to your doctor about the meaning of your specific test results.

Antithrombin III blood test

MedlinePlus

... thinning medicine does not work. Normal Results Normal value ranges may vary slightly among different laboratories. Talk ... to the principles of the Health on the Net Foundation (www.hon.ch). The information provided herein ...

Trypsinogen test

MedlinePlus

... is also used to screen newborn babies for cystic fibrosis. Normal Results Normal value ranges may vary slightly ... to: Abnormal production of pancreatic enzymes Acute pancreatitis Cystic fibrosis Pancreatic cancer Low or normal levels may be ...

Hermetic Seal Leak Detection Apparatus

NASA Technical Reports Server (NTRS)

Kelley, Anthony R. (Inventor)

2013-01-01

The present invention is a hermetic seal leak detection apparatus, which can be used to test for hermetic seal leaks in instruments and containers. A vacuum tight chamber is created around the unit being tested to minimize gas space outside of the hermetic seal. A vacuum inducing device is then used to increase the gas chamber volume inside the device, so that a slight vacuum is pulled on the unit being tested. The pressure in the unit being tested will stabilize. If the stabilized pressure reads close to a known good seal calibration, there is not a leak in the seal. If the stabilized pressure reads closer to a known bad seal calibration value, there is a leak in the seal. The speed of the plunger can be varied and by evaluating the resulting pressure change rates and final values, the leak rate/size can be accurately calculated.

Dissociative charge transfer of H/+/ ions with H2 and D2 molecules from 78 to 330 K

NASA Technical Reports Server (NTRS)

Johnsen, R.; Chen, A.; Biondi, M. A.

1980-01-01

The dissociative charge transfer of He(+) ions with H2 and D2 molecules has been studied using a temperature-variable drift-tube mass-spectrometer apparatus over the temperature range 78 to 330 K. The binary rate coefficients are small at 300 K, approximately 10 to the -13th to 10 to the -14th cu cm/sec, and only slightly larger at 78 K. Termolecular contributions to the binary rate coefficients are found to be small at 330 K but increase substantially with decreasing temperature. Two-body charge transfer with D2 is found to be slower than with H2 by a factor of 10, in good agreement with recent theoretical predictions, although the measured values of the rate coefficients are larger by a factor of about 4 than the predicted values.

Structural characterization of polysaccharides from bamboo

NASA Astrophysics Data System (ADS)

Kamil, Ruzaimah Nik Mohamad; Yusuf, Nur'aini Raman; Yunus, Normawati M.; Yusup, Suzana

2014-10-01

The alkaline and water soluble polysaccharides were isolate by sequential extractions with distilled water, 60% ethanol containing 1%, 5% and 8% NaOH. The samples were prepared at 60 °C for 3 h from local bamboo. The functional group of the sample were examined using FTIR analysis. The most precipitate obtained is from using 60% ethanol containing 8% NaOH with yield of 2.6%. The former 3 residues isolated by sequential extractions with distilled water, 60% ethanol containing 1% and 5% NaOH are barely visible after filtering with cellulose filter paper. The FTIR result showed that the water-soluble polysaccharides consisted mainly of OH group, CH group, CO indicates the carbohydrate and sugar chain. The sample weight loss was slightly decreased with increasing of temperature.

Comparative lethality kinetic curves and predictive models of F-value for Listeria monocytogenes using different sanitizers

PubMed Central

Beltrame, Cezar A; Kubiak, Gabriela B; Rottava, Ieda; Toniazzo, Geciane; Cansian, Rogério L; Lerin, Lindomar A; de Oliveira, Débora; Treichel, Helen

2013-01-01

The objective of this work was to evaluate the kinetic of inactivation of Listeria monocytogenes using peracetic acid, chlorhexidine, and organic acids as active agent, determining the respective D-, Z-, and F-values. From our knowledge, these important results from an industrial view point are not available in the current literature, mainly for organic acids, pointing out the main contribution of the present work. Lower D-values were obtained for peracetic acid and chlorhexidine, compared with the organic acids. For the reduction of 6 log10 of L. monocytogenes using peracetic acid, at 0.2, 0.1, and 0.05% are necessary 7.08, 31.08, and 130.44 min of contact, respectively. The mathematical models of F-values showed that at concentrations lower than 0.15% one can verify an exponential increase in F-values, for both de chlorhexidine and peracetic acid. The organic acids presented a linear behavior, showing slight variation in F-values, is even more effective in under dosage. The results obtained are of fundamental importance in terms of industrial strategy for sanitization procedure, permitting to choose the best relation product concentration/exposure time, aiming at reducing costs without compromising the disinfectant efficiency. PMID:24804011

Correlated lateral phase separations in stacks of lipid membranes

NASA Astrophysics Data System (ADS)

Hoshino, Takuma; Komura, Shigeyuki; Andelman, David

2015-12-01

Motivated by the experimental study of Tayebi et al. [Nat. Mater. 11, 1074 (2012)] on phase separation of stacked multi-component lipid bilayers, we propose a model composed of stacked two-dimensional Ising spins. We study both its static and dynamical features using Monte Carlo simulations with Kawasaki spin exchange dynamics that conserves the order parameter. We show that at thermodynamical equilibrium, due to strong inter-layer correlations, the system forms a continuous columnar structure for any finite interaction across adjacent layers. Furthermore, the phase separation shows a faster dynamics as the inter-layer interaction is increased. This temporal behavior is mainly due to an effective deeper temperature quench because of the larger value of the critical temperature, Tc, for larger inter-layer interaction. When the temperature ratio, T/Tc, is kept fixed, the temporal growth exponent does not increase and even slightly decreases as a function of the increased inter-layer interaction.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Waldemar, G.; Vorstrup, S.; Andersen, A.R.

The effect of the angiotensin-converting enzyme (ACE) inhibitor captopril on regional cerebral blood flow (rCBF) was studied in 12 patients within 5 days after their first acute stroke. rCBF was studied by xenon-133 inhalation and single-photon emission computed tomography (SPECT) scan before and 1 h after oral administration of 25 mg captopril. No increase in rCBF was observed in any of the 12 patients included in the study. In only one patient was there a slight redistribution of blood flow in favor of the low-flow area, but the absolute flow value did not increase. Captopril did not cause any significantmore » change in mean hemispheric blood flow, mean arterial blood pressure (MAP), or end-expiratory CO2 fraction (FECO2). The assumption that ACE inhibition might increase cerebral blood flow in the periinfarct zone and preserve some still viable brain tissue could not be verified in the present study.« less

Cancer incidence in the workers cohort of textile manufacturing factory in Alytus, Lithuania.

PubMed

Kuzmickiene, Irena; Didziapetris, Remigijus; Stukonis, Mecys

2004-02-01

Altogether 14,650 workers employed at least for 1 year a the textile factory in Alytus, Lithuania, were included in the cohort and followed during the period from 1978 to 1997. The standardized incidence ratio (SIR) for men was 1.28. The incidence of esophagus cancer was significant higher (SIR 3.42). It increased only slightly for lung (SIR 1.35). In the women cohort, SIR was 1.05. However, there was a significant increase of the incidence of gallbladder cancer (SIR 3.19). Among textile-processing (spinning and weaving departments) women workers, we found elevated total cancer incidence (SIR 1.35), incidence of breast cancer (SIR 1.49), and cervical cancer (SIR 1.82). In this cohort increased SIR values were observed for more than 10 years since first exposure for all cancer (SIR 1.70) and cervical cancer (SIR 2.44).

High performance ZnO:Al films deposited on PET substrates using facing target sputtering

NASA Astrophysics Data System (ADS)

Guo, Tingting; Dong, Guobo; Gao, Fangyuan; Xiao, Yu; Chen, Qiang; Diao, Xungang

2013-10-01

ZnO:Al (ZAO) thin films have been deposited on flexible PET substrates using a plasma damage-free facing target sputtering system at room temperature. The structure, surface morphology, electrical and optical properties were investigated as a function of working power. All the samples have a highly preferred orientation of the c-axis perpendicular to the PET substrate and have a high quality surface. With increased working power, the carrier concentration changes slightly, the mobility increases at the beginning and decreases after it reaches a maximum value, in line with electrical conductivity. The figure of merit has been significantly improved with increasing of the working power. Under the optimized condition, the lowest resistivity of 1.3 × 10-3 Ω cm with a sheet resistance of 29 Ω/□ and the relative visible transmittance above 93% in the visible region were obtained.

Crack healing behavior of hot pressed silicon nitride due to oxidation

NASA Technical Reports Server (NTRS)

Choi, S. R.; Tikare, V.

1992-01-01

It is shown that limited oxidation of an MgO-containing, hot-pressed silicon nitride ceramic at 800 deg C and above results in increased strength due to crack healing. Slight oxidation of the surface produces enstatite and cristobalite which fills in cracks. More extensive oxidation leads to strength degradation due to the formation of new flaws by the evolution of N2 gas at the surface. The apparent fracture toughness also increased at 800 deg C and above due to oxidation. Bonds formed between the two surfaces of the crack during oxidation leads to a reduction in stress intensity at the crack tip, suggesting that valid high-temperature toughness values cannot be obtained in an air environment. The increase in strength due to crack healing by oxidation can be achieved without compromising the fatigue properties of the silicon nitride ceramic.

Dealing with uncertainty in water scarcity footprints

NASA Astrophysics Data System (ADS)

Scherer, Laura; Pfister, Stephan

2016-05-01

Water scarcity adversely affects ecosystems, human well-being and the economy. It can be described by water scarcity indices (WSIs) which we calculated globally for the decades 1981-1990 and 2001-2010. Based on a model ensemble, we calculated the WSI for both decades including uncertainties. While there is a slight tendency of increased water scarcity in 2001-2010, the likelihood of the increase is rather low (53%). Climate change played only a minor role, but increased water consumption is more decisive. In the last decade, a large share of the global population already lived under highly water scarce conditions with a global average monthly WSI of 0.51 (on a scale from 0 to 1). Considering that globally there are enough water resources to satisfy all our needs, this highlights the need for regional optimization of water consumption. In addition, crop choices within a food group can help reduce humanity’s water scarcity footprint without reducing its nutritional value.

Internal friction and velocity measurements. [vacuum effects on lunar basalt resonance

NASA Technical Reports Server (NTRS)

Tittmann, B. R.; Ahlberg, L.; Curnow, J.

1976-01-01

The Q of a lunar basalt sample was measured under varying vacuum conditions, and it was found that even at pressures as low as 10 to the -7th to 10 to the -10th torr, substantial increases in Q with decreasing pressure are observed, while the resonant frequency increases only slightly. This suggests that only small amounts of volatiles are sufficient to increase the internal friction (lower the Q) dramatically. The technique of vibrating encapsulated samples in the torsional mode was used to measure Q of terrestrial rocks as a function of hydrostatic pressure under lunar vacuum conditions. Young's modulus measurements in the temperature range 25-600 C under a variety of conditions including high vacuum show no evidence of any irreversibility upon temperature cycling and no indication that the high Q-values obtained are associated with any permanent structure changes such as the formation of lossless 'welded' contacts.

Mechanical properties of kinked silicon nanowires

NASA Astrophysics Data System (ADS)

Jing, Yuhang; Zhang, Chuan; Liu, Yingzhi; Guo, Licheng; Meng, Qingyuan

2015-04-01

Molecular dynamics simulations are used to investigate the mechanical properties of KSiNWs. Our results show that KSiNWs have a much larger fracture strain compared to straight SiNWs. The effects of the periodic length of KSiNWs with symmetric arms and the arm length of the KSiNW with asymmetric arms on the mechanical properties of KSiNWs are studied. The fracture stress of KSiNWs decrease as the periodic length increases. However, the fracture strain of KSiNWs is not dependent on the short periodic length and the fracture strain of KSiNWs will abruptly increase to very large value and then vary slightly as the periodic length increases. In addition, the fracture stress is not dependent on arm length while the fracture strain monotonically increases as the arm length increases. We also investigate the fracture process of KSiNWs. The results in this paper suggest that the KSiNWs with larger fracture strain can be a promising anode materials in high performance Li-ion batteries.

Structure and properties of sintered MM-Fe-B magnets

NASA Astrophysics Data System (ADS)

Shang, R. X.; Xiong, J. F.; Li, R.; Zuo, W. L.; Zhang, J.; Zhao, T. Y.; Chen, R. J.; Sun, J. R.; Shen, B. G.

2017-05-01

MM14Fe79.9B6.1 magnets were prepared by conventional sintering method. The Curie temperature of the sintered MM2Fe14B magnet was about 210 °C. When the sintering temperature increased from 1010 °C to 1030 °C, the density of the magnet increased from 6.85 g/cm3 to 7.52 g/cm3. After the first stage tempering at 900 °C, the (BH)max and Hcj had a slight increase. The maximum value of (BH)max = 7.6 MGOe and Hcj = 1080 Oe was obtained when sintered at 1010 °C and tempering at 900 °C, respectively. The grain size grew very large when the sintering temperature increased to 1050 °C, and the magnetic properties deteriorated rapidly. La reduced by ˜ 7.5 at. % in grains, which is almost equal to the increased percentage of Nd. That is mainly because La-Fe-B is very difficult to form the 2: 14: 1 phase.

Certificated Personnel and Related Information--Fall 1990.

ERIC Educational Resources Information Center

Keith, Jo Ann; MacKenzie, Stella

Twelve tables present data concerning the salaries and characteristics of school certified personnel in Colorado as of fall 1990. The average salary for Colorado's 32,342 public school teachers was $31,819 in 1990, which represents a slight increase over the 1989 figure ($30,758). The number of classroom teachers had increased slightly to 32,342;…

Minnesota's tax-forfeited land: some trends in timber harvested and stumpage prices.

Treesearch

David C. Lothner; Edwin Kallio; David T. Davis

1979-01-01

The volume of timber harvested from Minnesota tax-forfeited land increased from about 145,000 cord equivalents in 1960 to 235,000 cord equivalents in 1975. Actual prices paid for stumpage decreased slightly in the 1960's and increased in the 1970's. However, in deflated dollars, stumpage prices decreased slightly throughout the period.

Repetitive transcranial magnetic stimulation improves consciousness disturbance in stroke patients: A quantitative electroencephalography spectral power analysis.

PubMed

Xie, Ying; Zhang, Tong

2012-11-05

Repetitive transcranial magnetic stimulation is a noninvasive treatment technique that can directly alter cortical excitability and improve cerebral functional activity in unconscious patients. To investigate the effects and the electrophysiological changes of repetitive transcranial magnetic stimulation cortical treatment, 10 stroke patients with non-severe brainstem lesions and with disturbance of consciousness were treated with repetitive transcranial magnetic stimulation. A quantitative electroencephalography spectral power analysis was also performed. The absolute power in the alpha band was increased immediately after the first repetitive transcranial magnetic stimulation treatment, and the energy was reduced in the delta band. The alpha band relative power values slightly decreased at 1 day post-treatment, then increased and reached a stable level at 2 weeks post-treatment. Glasgow Coma Score and JFK Coma Recovery Scale-Revised score were improved. Relative power value in the alpha band was positively related to Glasgow Coma Score and JFK Coma Recovery Scale-Revised score. These data suggest that repetitive transcranial magnetic stimulation is a noninvasive, safe, and effective treatment technology for improving brain functional activity and promoting awakening in unconscious stroke patients.

Effect of Oscillating Tabs on a Jet-in-Cross-Flow

NASA Technical Reports Server (NTRS)

Zaman, K. B. M. Q.

2003-01-01

A novel technique for active control of a jet-in-cross-flow is explored in this study. Two triangular tabs are placed at the 90 degree and 270 degree edges of the jet orifice, relative to the direction of the cross-flow. A slight asymmetry in the placement of the two tabs is reversed periodically. This causes a profound oscillation of the flow field that persists as far downstream as the measurements were permitted by the facility (100 orifice diameters). Parametric dependence of the unsteadiness and its impact on the flowfield has been investigated preliminarily. It is found that the effect becomes increasingly pronounced with increasing value of the momentum flux ratio (J). However, there is little or no effect at low values of J in the range, J less than 15. The effective frequencies of oscillation are low - more than an order of magnitude lower than that found with oscillatory blowing technique in previous studies. The flow mechanism apparently involves a direct perturbation of the counter-rotating streamwise vortex pair of the flow.

Scratch Testing of Hot-Pressed Monolithic Chromium Diboride (CrB2) and CrB2 + MoSi2 Composite

NASA Astrophysics Data System (ADS)

Bhatt, B.; Murthy, T. S. R. Ch.; Singh, K.; Sashanka, A.; Vishwanadh, B.; Sonber, J. K.; Sairam, K.; Nageswara Rao, G. V. S.; Srinivasa Rao, T.; Kain, Vivekanand

2017-10-01

The tribological performance of hot-pressed monolithic CrB2 and a newly developed CrB2 + 20 vol.% MoSi2 composite was investigated by using scratch test. The test was carried out under progressive loading ranging from 0.9 to 30 N over a scratch distance of 3 mm. In situ values of coefficient of friction (COF), depth of penetration and acoustic emission were recorded. The wear volume and fracture toughness were also calculated. COF of both materials is increased with increasing the scratch length and progressive load. COF of the composite was observed to be slightly higher compared to the monolithic CrB2. The wear volume of the composite is 60% higher compared to monolithic CrB2. Fracture toughness values of 2.48 and 2.81 MPa m1/2 were calculated for monolithic CrB2 and CrB2 + 20 vol.% MoSi2 composite, respectively. Microstructural characterization indicates that the abrasive wear is the dominant wear mechanism in both the materials.

Simulations of dissociation constants in low pressure supercritical water

NASA Astrophysics Data System (ADS)

Halstead, S. J.; An, P.; Zhang, S.

2014-09-01

This article reports molecular dynamics simulations of the dissociation of hydrochloric acid and sodium hydroxide in water from ambient to supercritical temperatures at a fixed pressure of 250 atm. Corrosion of reaction vessels is known to be a serious problem of supercritical water, and acid/base dissociation can be a significant contributing factor to this. The SPC/e model was used in conjunction with solute models determined from density functional calculations and OPLSAA Lennard-Jones parameters. Radial distribution functions were calculated, and these show a significant increase in solute-solvent ordering upon forming the product ions at all temperatures. For both dissociations, rapidly decreasing entropy of reaction was found to be the controlling thermodynamic factor, and this is thought to arise due to the ions produced from dissociation maintaining a relatively high density and ordered solvation shell compared to the reactants. The change in entropy of reaction reaches a minimum at the critical temperature. The values of pKa and pKb were calculated and both increased with temperature, in qualitative agreement with other work, until a maximum value at 748 K, after which there was a slight decrease.

[Pulmonary function in patients with focal pulmonary tuberculosis].

PubMed

Nefedov, V B; Popova, L A; Shergina, E A

2008-01-01

Vital capacity (VC), forced vital capacity (FVC), forced expiratory volume in 1 second (FEV1), FEV1/VC%, PEF, MEF25, MEF50, MEF75, TLC, TGV, pulmonary residual volume (PRV), Raw, Rin, Rcx, DLCO-SB, DLCO-SS/VA, PaO2, and PaCO2 were determined in 40 patients with focal pulmonary tuberculosis. Changes were found in lung volumes and capacities in 75%, impaired bronchial patency and pulmonary gas exchange dysfunction were in 57.5 and 25%, respectively. The lung volume and capacity changes appeared mainly as increased TGV and PRV; impaired bronchial patency presented as decreased MEF50, MEF75, and FEV1/VC%; pulmonary gas exchange dysfunction manifested itself as reduced DLCO-SB, PaO2, and PaCO2. The magnitude of the observed functional changes was generally slight. TGV and PRL increased up to 148-187 and 142-223% of the normal values, respectively; MEF50, MEF75, FEV1/VC%, and DLCO decreased to 59-24, 58-26, 78-57, and 78-67% of the normal values and PaO2 and PaCO2 did to 79-69 and 34-30 cm Hg.

Effect of continuous annealing temperature on microstructure and properties of ferritic rolled interstitial-free steel

NASA Astrophysics Data System (ADS)

Qiu, Chen-yang; Li, Lang; Hao, Lei-lei; Wang, Jian-gong; Zhou, Xun; Kang, Yong-lin

2018-05-01

In this report, the microstructure, mechanical properties, and textures of warm rolled interstitial-free steel annealed at four different temperatures (730, 760, 790, and 820°C) were studied. The overall structural features of specimens were investigated by optical microscopy, and the textures were measured by X-ray diffraction (XRD). Nano-sized precipitates were then observed by a transmission electron microscope (TEM) on carbon extraction replicas. According to the results, with increased annealing temperatures, the ferrite grains grew; in addition, the sizes of Ti4C2S2 and TiC precipitates also increased. Additionally, the sizes of TiN and TiS precipitates slightly changed. When the annealing temperature increased from 730 to 820°C, the yield strength (YS) and the ultimate tensile strength (UTS) showed a decreasing trend. Meanwhile, elongation and the strain harden exponent (n value) increased to 49.6% and 0.34, respectively. By comparing textures annealed at different temperatures, the intensity of {111} texture annealed at 820°C was the largest, while the difference between the intensity of {111}<110> and {111}<112> was the smallest when the annealing temperature was 820°C. Therefore, the plastic strain ratio (r value) annealed at 820°C was the highest.

Wheelchair cushion effect on skin temperature, heat flux, and relative humidity.

PubMed

Stewart, S F; Palmieri, V; Cochran, G V

1980-05-01

For patients subject to decubitus ulcers, wheelchair cushions should be prescribed with knowledge of the cushion's effect on the thermal as well as mechanical environment of the skin. To define thermal effects that may be encountered during routine use, tests werr made on 24 commercially available cushions. Skin temperature, heat flux and relative humidity were measured under the ischial tuberosities of a normal 24-year-old man during a 1-hour period of sitting on each cushion. After 1 hour, skin temperatures increased by means of 3.4 C and 2.8 C on foams and viscoelastic foams and there were slight decreases in heat flux as compared with control values in air. On gels, skin temperatures remained constant and heat flux increased, while water "floatation" pads caused a mean skin temperature decreased of 2.7 C along with a marked increase in heat flux. Relative humidity at the skin cushion interface increased by 10.4%, 22.8% and 19.8% on foams, gels and water floatation pads, as compared with room air values. Representative cushions from each of the general types (foam, viscoelastic foam, gel and water floatation) also were subjected to 2-hour tests which indicated the measured parameters continued to change asymptotically.

Abdominal auscultation does not provide clear clinical diagnoses.

PubMed

Durup-Dickenson, Maja; Christensen, Marie Kirk; Gade, John

2013-05-01

Abdominal auscultation is a part of the clinical examination of patients, but the determining factors in bowel sound evaluation are poorly described. The aim of this study was to assess inter- and intra-observer agreement in physicians' evaluation of pitch, intensity and quantity in abdominal auscultation. A total of 100 physicians were presented with 20 bowel sound recordings in a blinded set-up. Recordings had been made in a mix of healthy volunteers and emergency patients. They evaluated pitch, intensity and quantity of bowel sounds in a questionnaire with three, three and four categories of answers, respectively. Fleiss' multi-rater kappa (κ) coefficients were calculated for inter-observer agreement; for intra-observer agreement, calculation of probability was performed. Inter-observer agreement regarding pitch, intensity and quantity yielded κ-values of 0.19 (p < 0.0001), 0.30 (p < 0.0001) and 0.24 (p < 0.0001), respectively, corresponding to slight, fair and fair agreement. Regarding intra-observer agreement, the probability of agreement was 0.55 (95% confidence interval (CI): 0.51-0.59), 0.45 (95% CI: 0.42-0.49) and 0.41 (95% CI: 0.38-0.45) for pitch, intensity and quantity, respectively. Although relatively poor, observer agreement was slight to fair and thus better than expected by chance. Since the diagnostic value of auscultation increases with addition of history and clinics, and may be further improved by systematic training, it should still be used in the examination of patients with acute abdominal pain. not relevant. not relevant.

Higher-order aberrations after wavefront-optimized photorefractive keratectomy and laser in situ keratomileusis

PubMed Central

Randleman, J. Bradley; Perez-Straziota, Claudia E.; Hu, Michelle H.; White, Alfred J.; Loft, Evan S.; Stulting, R. Doyle

2013-01-01

PURPOSE To analyze the changes in higher-order aberrations (HOAs) that occur after wavefront-optimized photorefractive keratectomy (PRK) and laser in situ keratomileusis (LASIK). SETTING Private practice, Atlanta, Georgia, USA. METHODS This retrospective analysis comprised eyes that had PRK or LASIK from June 2004 through October 2005. Postoperative outcome measures included 3-month uncorrected visual acuity (UCVA), best spectacle-corrected visual acuity (BSCVA), manifest refraction spherical equivalent (MRSE), changes in the root mean square (RMS) and grouped coefficient HOAs (microns) measured with a corneal analyzer, and subjective assessment of visual aberrations. RESULTS One hundred consecutive eyes of 54 patients had PRK, and 100 contemporaneous consecutive eyes of 71 patients had LASIK. The PRK and LASIK populations were similar in general demographics, preoperative HOAs, and postoperative UCVA and BSCVA. The mean MRSE was slightly hyperopic after PRK (mean +0.11 diopters [D]) and slightly myopic after LASIK (mean −0.19 D) (P<.0001). There were no statistically significant changes in RMS or grouped coefficient HOA values after PRK or LASIK, nor were there significant differences in postoperative RMS or grouped coefficient HOA values between PRK and LASIK. One percent of PRK and LASIK patients reported a subjective increase in postoperative visual aberrations; 5% reported a subjective improvement postoperatively. CONCLUSIONS Wavefront-optimized excimer laser surgery did not induce significant HOAs after PRK or LASIK. The 2 techniques were equally efficacious and had equivalent postoperative HOA profiles. PMID:19185240

Seasonal Equability in Late Cretaceous Central-Eastern Iberia? Inferences from Isotopic Data on Vertebrates

NASA Astrophysics Data System (ADS)

Domingo, L.; Barroso-Barcenilla, F.; Cambra-Moo, O.

2013-12-01

After the mid-Cretaceous thermal maximum, the latest Cretaceous witnessed a long-term cooling trend (Santonian-Maastrichtian). It has been proposed that seasonal equability (low mean annual range of temperatures) accompanied the mid-Cretaceous greenhouse period, but was it also a climatic feature of the colder latest Cretaceous? Terrestrial proxies have proven useful in understanding past seasonality and in this vein, we performed oxygen isotope analyses of the phosphate (δ18OPO4) on the rich and exceptionally well preserved late Campanian-early Maastrichtian vertebrate assemblage of 'Lo Hueco' fossil site (Cuenca, Spain). We analysed theropod and crocodilian tooth enamel, turtle shell, and gar ganoine with the aim of evaluating paleoclimatic conditions existing in the western area of the Tethys realm. The 'Lo Hueco' locality was situated at a paleo-latitude of 31°N and sedimentological and paleontological studies point to a coastal environment with distributary channels and sporadic sabkhas. Samples were collected from two different levels: G1 (proximal muddy floodplain) and G2 (distal muddy floodplain), with G1 being older. δ18OH2O values were calculated from theropod, crocodilian and turtle δ18OPO4 values using established equations and in all cases they are in good agreement with precipitation water from subtropical latest Cretaceous and modern settings. Theropods recorded consistently slightly lower δ18OH2O values (G1: -4.1×1.4‰, G2: -3.5×0.5‰) than crocodilians (G1: -3.6×0.6‰, G2: -2.7×0.6‰) and turtles (G1: -3.8×0.6‰, G2: -2.9×0.5‰). This may be due to terrestrial endothermic taxa, such as theropods, recording ingested water year round, meanwhile semiaquatic ectothermic taxa, such as crocodilians and turtles, would record δ18OH2O values representing local meteoric waters over the warm season, when conditions are favorable for apatite synthesis. With these δ18OH2O values, we used gar ganoine δ18OPO4 values as an independent proxy to calculate temperature values. As expected, temperature values estimated from theropods are lower (G1: 17.5×4.4°C, G2: 21.0×3.8°C), representing mean annual temperature (MAT), whereas temperature values yielded by crocodilians (G1: 19.6×4.4°C, G2: 24.4×3.8°C) and turtles (G1: 18.8×4.4°C, G2: 23.5×3.8°C) are slightly higher, reflecting the temperature of the warmest months (TWMs). Our record shows an increase in temperature values between G1 and G2, but they remain within expected temperature estimates based on other independent proxies (palynomorphs, vertebrates) and paleoclimatic models for the Late Cretaceous and the 'Lo Hueco' paleo-latitude. Maximum differences between TWMs and MAT are 2.1°C and 3.4°C for G1 and G2, respectively. These differences are in the low end-member of those observed in modern subtropical settings (~2.8-8.1°C) pointing to a slightly lower seasonal thermal varibility in central-eastern Iberia during the late Campanian-early Maastrichtian.

CA-125 blood test

MedlinePlus

... above 35 U/mL is considered abnormal. Normal value ranges may vary slightly among different laboratories. Some ... 125 usually does not mean ovarian cancer is present. Most healthy women with an elevated CA-125 ...

77 FR 217 - Medicare and Medicaid Programs: Hospital Outpatient Prospective Payment; Ambulatory Surgical...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-01-04

... Donald Howard, (410) 786-6764, Hospital Value-Based Purchasing (VBP) Program Issues. SUPPLEMENTARY... analyses performed by Brandeis University and Mathematica Policy Research together despite their slightly...

Trends in cooling degree-days for five locations in Croatia

NASA Astrophysics Data System (ADS)

Cvitan, L.

2010-09-01

The cooling degree-days (CDD) and number of cooling days (CD) over the period 1901-2008 are analyzed at five stations that represent different climatic regions in Croatia. The stations under consideration are: Osijek in the southern lowland of Pannonian Plain, Zagreb - Grič at the furthest south-eastern edge of the Julian Alps, Gospić in highland - hinterland of the Dinaric Alps, Crikvenica on the north-eastern Adriatic coast and Hvar on the mid - Adriatic island with the same name. Calculation of CDDs and counting of CDs are performed for the 18° C, 21° C and 23° C temperature thresholds that represent daily mean air temperature. Daily mean temperature (M) is calculated by using daily temperatures measured at 7 a.m. (t7), 2 p.m. (t14) and 9 p.m. (t21), in the following way: M=(t7+t14+2t21)/4. Linear trends over the period 1901-2008 are determined for each month as well as for the whole year (annual trend). Statistical significances of the trends are tested using the non-parametric Mann - Kendal test. For the months with the greatest potential cooling demands - June, July and August, the increasing trend is detected for almost all analyzed values at five locations. Namely, only for the August CD (threshold 18° C) for Hvar area and for the June and August CDDs (threshold 23° C) for Gospić area are detected slightly decreasing trends. Most slightly decreasing trends are discovered for September for both parameters at Osijek, Zagreb and Gospić area. Annual trends in both parameters for all locations are increasing, except the annual Gospić CDD (threshold 23° C) trend that is slightly decreasing. According to the Mann - Kendal test neither of the annual trends in CDD and CD for three temperature thresholds are statistically significant at 0.05 significance level in Gospić and Osijek. On the contrary, all of the mentioned annual trends are significant in Zagreb and Crikvenica, and almost all in Hvar (except trends in CD for the 21° C and 23° C thresholds). Months with the significant trends in most of analyzed values are: May and June in Osijek, May, June and July in Zagreb, June in Gospić, June, July and August in Crikvenica and July in Hvar.

Long-term studies on the effects of nonvolatile organic compounds on porous media surface areas.

PubMed

Khachikian, Crist S; Harmon, Thomas C

2002-01-01

This paper investigates the long-term behavior of porous media contaminated by nonvolatile organic compounds (NVOC) in terms of specific interfacial surface area. Specifically, a natural sand, Moffett sand (MS), was contaminated with naphthalene and the surface area was measured repeatedly over time using nitrogen adsorption-desorption techniques. A field-contaminated sand affected by lamp-black material (LB) from former manufactured gas plant operations was also studied. Lampblack is a carbonaceous skeleton containing polycyclic aromatic hydrocarbons (PAHs) and other hydrocarbons. It is hypothesized that soils contaminated by these types of chemicals will exhibit significantly less surface area than their clean counterparts. The surface areas for the contaminated MS samples increased toward their clean-MS values during the 700-h aging period, but achieved the clean values only after pentane extraction or heating at 60 degrees C. Heating at 50 degrees C failed to achieve a similar recovery of the clean-MS surface area value. Nonspecific mass loss tracked the increase in surface area as indirect evidence that naphthalene loss was the cause of the surface area increase. For the LB samples, aging at 100 degrees C produced a slight decrease in surface area and mass while aging at 250 degrees C caused the surface area to increase roughly threefold while the mass decreased by approximately 1%. These results suggest that, under moderate heating and over the time scale of this investigation, there is a redistribution of the complex contaminant mixture on the solid matrix. Greater temperatures remove mass more efficiently and therefore exhibited the surface area increase expected in this experiment.

The effect of changing seawater Ca and Mg concentrations upon the distribution coefficients of Mg and Sr in the skeletons of the scleractinian coral Pocillopora damicornis

NASA Astrophysics Data System (ADS)

Giri, Sharmila J.; Swart, Peter K.; Devlin, Quinn B.

2018-02-01

The skeletal composition of calcifying organisms, in particular Mg/Ca and Sr/Ca ratios, have been widely used to understand fluctuations in seawater chemistry throughout the Phanerozoic. While the success of applying these data to the geologic record depends on a knowledge of the distribution coefficients for these elements (DMg and DSr), there are scarcely any studies which have described how these values vary as a result of changing seawater Mg/Ca ratios. To address this, we have cultured the scleractinian coral, Pocillopora damicornis, in seawater with ranges of Mg and Ca concentrations. Here, we demonstrate that Mg/Ca and Sr/Ca ratios of coral skeletons correlate with total seawater Mg/Ca and Sr/Ca molar ratios, but that apparent DMg and DSr values do not remain constant across the range of experimental seawater treatments, with DMg values significantly increasing with seawater Mg/Ca ratios and DSr values significantly increasing with seawater Ca concentrations. These trends are not rate dependent and may be best explained by a Rayleigh distillation model, in which the calcifying space is semi-isolated from seawater during skeletogenesis (i.e. leaky). As there is a slight increase in DMg and decrease in DSr values between our "Jurassic" and "Modern" seawater treatments, the application of a constant distribution coefficient to estimate changes in ancient seawater chemistry may underestimate seawater Mg/Ca ratios and overestimate Sr/Ca throughout the Mesozoic and Cenozoic. We suggest that interpretations of seawater chemistry from fossil corals may be improved by using the relationships derived for skeletal and seawater Mg/Ca and Sr/Ca ratios established by our experiments, as they incorporate the effect of seawater Mg/Ca ratios on skeletal Mg/Ca and Sr/Ca ratios.

Application of lean manufacturing techniques in the Emergency Department.

PubMed

Dickson, Eric W; Singh, Sabi; Cheung, Dickson S; Wyatt, Christopher C; Nugent, Andrew S

2009-08-01

"Lean" is a set of principles and techniques that drive organizations to continually add value to the product they deliver by enhancing process steps that are necessary, relevant, and valuable while eliminating those that fail to add value. Lean has been used in manufacturing for decades and has been associated with enhanced product quality and overall corporate success. To evaluate whether the adoption of Lean principles by an Emergency Department (ED) improves the value of emergency care delivered. Beginning in December 2005, we implemented a variety of Lean techniques in an effort to enhance patient and staff satisfaction. The implementation followed a six-step process of Lean education, ED observation, patient flow analysis, process redesign, new process testing, and full implementation. Process redesign focused on generating improvement ideas from frontline workers across all departmental units. Value-based and operational outcome measures, including patient satisfaction, expense per patient, ED length of stay (LOS), and patient volume were compared for calendar year 2005 (pre-Lean) and periodically after 2006 (post-Lean). Patient visits increased by 9.23% in 2006. Despite this increase, LOS decreased slightly and patient satisfaction increased significantly without raising the inflation adjusted cost per patient. Lean improved the value of the care we delivered to our patients. Generating and instituting ideas from our frontline providers have been the key to the success of our Lean program. Although Lean represents a fundamental change in the way we think of delivering care, the specific process changes we employed tended to be simple, small procedure modifications specific to our unique people, process, and place. We, therefore, believe that institutions or departments aspiring to adopt Lean should focus on the core principles of Lean rather than on emulating specific process changes made at other institutions.

Examining the effect of gardening on vegetable consumption among youth in kindergarten through fifth grade.

PubMed

Wright, William; Rowell, Laura

2010-06-01

Funded by a grant from the makers of Hidden Valley Salad Dressings the objective of this study was to determine if the introduction of a school-wide gardening program would affect overall vegetable consumption among elementary school youth. The study's setting was Elmore Elementary, Green Bay, Wisconsin, 1 of 27 elementary schools in the Green Bay Area Public School District. The school's salad bar was used to measure changes in vegetable consumption during school lunch. School food service staff recorded the weight of vegetables selected from the salad bar. The daily total weight of vegetables selected from the salad bar was divided by the number of students purchasing lunch that day. The resulting factor (average grams per child) was charted to monitor changes in consumption. After approximately 10 weeks of data collection, a gardening program was introduced. Food service staff continued to record weights, allowing for a quantitative analysis of the group's consumption prior to, during, and postintervention. Selection of vegetables from the salad bar decreased (r = -.403) during the first 2 1/2 months of the study. During the intervention period, selection increased (r = .3940) and continued to show a slight rise postintervention (r = .2037). The negative trend in daily salad bar selection before intervention was reversed, and a steady increase per day was seen during the intervention period. This suggests that intervention helped increase consumption rates per student. Consumption continued to increase postintervention, although at a lesser rate than during intervention. The average daily value also showed a slight increase between intervention and postintervention. This suggests that gardening intervention lessons and activities were retained by the students after the lessons and activities were completed.

Incidence and mortality trends of aspiration pneumonia in Parkinson's disease in the United States, 1979-2010.

PubMed

Akbar, Umer; Dham, Bhavpreet; He, Ying; Hack, Nawaz; Wu, Samuel; Troche, Michelle; Tighe, Patrick; Nelson, Eugene; Friedman, Joseph H; Okun, Michael S

2015-09-01

Careful examination of long-term analyses and trends is essential in understanding the medico-economic burden of this common complication. We sought to describe the long-term (32-year) trends of incidence and mortality in PD patients hospitalized with aspiration pneumonia (AsPNA). Incidence and mortality of AsPNA in hospitalized PD versus non-PD patients was assessed by logistic regression analysis applied to a national database between the years 1979 and 2010. Covariates such as age-decennium, gender, year AsPNA occurred, and the interactions with PD diagnosis were investigated. Rate of AsPNA and mortality over the 32-years was trended and compared. AsPNA occurred in 3.6% of PD patients and 1.0% of non-PD patients. The average mortality for PD patients was less (17% vs. 22%). Long-term (32-year) trends revealed a nearly 10-fold increase in incidence of AsPNA in PD (0.4% in 1979, 4.9% in 2010), decreasing mortality overtime, higher likelihood in males, and increasing average age of AsPNA patients (steeper increase in PD). All p-values<0.05. In regression analysis, each successive year had a slight increase in odds of AsPNA (OR 1.03 in PD, OR1.06 in non-PD). Trends over 32 years revealed a 10-fold increase in AsPNA among PD and non-PD patients, and an associated decrease in mortality. Our data suggest that PD patients are living longer, have slightly more AsPNA, but a lower mortality than was seen in past decades. Further research should investigate the causes of AsPNA in PD, and also potential interventions to decrease its occurrence. Copyright © 2015 Elsevier Ltd. All rights reserved.

Changes in UCP expression in tissues of Zucker rats fed diets with different protein content.

PubMed

Masanés, R M; Yubero, P; Rafecas, I; Remesar, X

2002-09-01

The effect of dietary protein content on the uncoupling proteins (UCP) 1, 2 and 3 expression in a number of tissues of Zucker lean and obese rats was studied. Thirty-day-old male Zucker lean (Fa/?) and obese (fa/fa) rats were fed on hyperproteic (HP, 30% protein), standard (RD, 17% protein) or hypoproteic (LP, 9% protein) diets ad libitum for 30 days. Although dietary protein intake affected the weights of individual muscles in lean and obese animals, these weights were similar. In contrast, huge differences were observed in brown adipose tissue (BAT) and liver weights. Lean rats fed on the LP diet generally increased UCP expression, whereas the HP group had lower values. Obese animals, HP and LP groups showed higher UCP expression in muscles, with slight differences in BAT and lower values for UCP3 in subcutaneous adipose tissue. The mean values of UCP expression in BAT of obese rats were lower than in their lean counterpart, whereas the expression in skeletal muscle was increased. Thus, expression of UCPs can be modified by dietary protein content, in lean and obese rats. A possible thermogenic function of UCP3 in muscle and WAT in obese rats must be taken into account.

Comparison of lipids in organs of the starfish Asterias amurensis associated with different treatments

NASA Astrophysics Data System (ADS)

Wang, Qi; Ikegame, Keita; Takahashi, Koretaro; Xue, Changhu; Zhang, Weinong; Wang, Hongxun; Hou, Wenfu; Wang, Yuming

2013-09-01

Lipids were extracted from organs of the starfish Asterias amurensis associated with different treatments (raw-control, boiling and heating), and then analyzed for lipid content, lipid oxidation index, lipid classes and fatty acid composition. Results showed that boiling softened the hard starfish shells, thus facilitating the collection of starfish organs. As compared with raw organs, the boiled organs had lower water content and higher lipid content, possibly due to the loss of water-holding capacity caused by protein denaturation. Both boiling and heating increased the peroxide value (PV), thiobarbituric acid (TBA) value and carbon value (CV) of lipids. Despite slight increases in the content of complex lipids, associated lipid composition had no substantial variations upon boiling and heating. For simple lipids, the content of 1, 2-diglyceride decreased in boiled and heated organs, with free fatty acids observed on thin layer chromatography (TLC). However, neither boiling nor heating significantly changed the fatty acid compositions of simple or complex lipids in starfish organs, suggesting that these two treatments had no significant effects on complex lipids in starfish organs. Together, our results indicated that boiling of starfish soon after capture facilitated the handling and extraction of useful complex lipids consisting of abundant glucosylceramide and eicosapentaenoic acid (EPA)-bounded phospholipids.

Nitroblue tetrazolium test

MedlinePlus

... infections. Normal value ranges may vary slightly from one lab to another. Talk to your doctor about the meaning of your test results. What Abnormal Results Mean If the sample does not change color when NBT is added, ...

Predicting moisture and economic value of solid forest fuel piles for improving the profitability of bioenergy use

NASA Astrophysics Data System (ADS)

Lauren, Ari; Kinnunen, Jyrki-Pekko; Sikanen, Lauri

2016-04-01

Bioenergy contributes 26 % of the total energy use in Finland, and 60 % of this is provided by solid forest fuel consisting of small stems and logging residues such as tops, branches, roots and stumps. Typically the logging residues are stored as piles on site before transporting to regional combined heat and power plants for combustion. Profitability of forest fuel use depends on smart control of the feedstock. Fuel moisture, dry matter loss, and the rate of interest during the storing are the key variables affecting the economic value of the fuel. The value increases with drying, but decreases with wetting, dry matter loss and positive rate of interest. We compiled a simple simulation model computing the moisture change, dry matter loss, transportation costs and present value of feedstock piles. The model was used to predict the time of the maximum value of the stock, and to compose feedstock allocation strategies under the question: how should we choose the piles and the combustion time so that total energy yield and the economic value of the energy production is maximized? The question was assessed concerning the demand of the energy plant. The model parameterization was based on field scale studies. The initial moisture, and the rates of daily moisture change and dry matter loss in the feedstock piles depended on the day of the year according to empirical field measurements. Time step of the computation was one day. Effects of pile use timing on the total energy yield and profitability was studied using combinatorial optimization. Results show that the storing increases the pile maximum value if the natural drying onsets soon after the harvesting; otherwise dry matter loss and the capital cost of the storing overcome the benefits gained by drying. Optimized timing of the pile use can improve slightly the profitability, based on the increased total energy yield and because the energy unit based transportation costs decrease when water content in the biomass is decreased.

Critical Elements in Fly Ash from the Combustion of Bituminous Coal in Major Polish Power Plants

NASA Astrophysics Data System (ADS)

Bielowicz, Barbara; Botor, Dariusz; Misiak, Jacek; Wagner, Marian

2018-03-01

The concentration of critical elements, including such REE as Fe, Co, W, Zn, Cr, Ni, V, Mn, Ti, Ag, Ga, Ta, Sr, Li, and Cu, in the so-called fly ash obtained from the 9 Polish power plants and 1 thermal power station has been determined. The obtained values, compared with the global average concentration in bituminous coal ash and sedimentary rocks (Clarke values), have shown that the enrichment of fly ash in the specified elements takes place in only a few bituminous coal processing sites in Poland. The enrichment factor (EF) is only slightly higher (the same order of magnitude) than the Clarke values. The enrichment factor in relation to the Clarke value in the Earth's crust reached values above 10 in all of the examined ashes for the following elements: Cr, Ni, V, W, and, in some ash samples, also Cu and Zn. The obtained values are low, only slightly higher than the global average concentrations in sedimentary rocks and bituminous coal ashes. The ferromagnetic grains (microspheres) found in bituminous coal fly ashes seem to be the most economically prospective in recovery of selected critical elements. The microanalysis has shown that iron cenospheres and plerospheres in fly ash contain, in addition to enamel and iron oxides (magnetite and hematite), iron spinels enriched in Co, Cr, Cu, Mn, Ni, W, and Zn.

Lung function parameters of healthy Sri Lankan Tamil young adults.

PubMed

Balasubramaniam, M; Sivapalan, K; Thuvarathipan, R

2014-06-01

To establish reference norms of lung function parameters for healthy Sri Lankan Tamil young adults. Cross sectional study of Tamil students at the Faculty of Medicine, Jaffna. Healthy non smoking students of Sri Lankan Tamil ethnic group were enrolled. Age, height, weight, BMI and spirometric measurements (Micro Quark) were recorded in 267 participants (137 females and 130 males). Height was significantly correlated with (p<0.05) all the lung function parameters except FEV1%, PEFR and MEF75 in males. Prediction equations were derived by regression analysis based on the height as an independent variable. Predicted lung function values for a particular age and height were lower than values predicted for Pakistanis, Kelatanese Malaysians and eastern Indians. The values were comparable to south Indians in Madras. Our FVC values of males and VC of females were closer to Sri Lankan Sinhalese. FEV1 and FEF25-75 in males were slightly higher and FVC, FEV1 and FEF25-75 in females were slightly lower in Tamils. When mean values were compared, these parameters were significantly higher in Tamil males (p<0.001) and significantly lower in Tamil females (p<0.001). These values will be useful in interpreting lung function parameters of the particular age group as there are no published norms for Sri Lankan Tamils. However, our study sample was confined to medical students of 20-28 years which may explain the differences with Sinhalese.

Diagnostic performance of dual-staining cytology for cervical cancer screening: A systematic literature review.

PubMed

Tjalma, Wiebren A A

2017-03-01

Cervical cancer screening saves lives. Secondary prevention in cervical cancer screening relies on the results of primary cytology and/or HPV testing. However, primary screening with cytology has a low sensitivity, and HPV screening has a low specificity. This means that either cancers are missed, or women are over-treated. To improve performance outcomes, the concept of dual-stain cytology (CINtec ® PLUS Cytology test) has been introduced. In this approach, additional staining with p16/Ki-67 is performed in cases where cytology results are abnormal (LSIL or ASCUS) and/or HPV-positive. Another way to describe this approach might be "diagnostic" cytology. In order to assess the value of this "diagnostic cytology", a systematic literature review was conducted of dual-stain cytology performance across multiple studies until May 2016. In a Belgian screening population (women age 25-65 years), dual-stain cytology was significantly more sensitive (66%) and slightly less specific (-1.0%) than cytology. In the population referred to colposcopy or with abnormal cytology (ASCUS, LSIL), dual-staining showed a significantly higher increase in specificity, and a slightly lower sensitivity than HPV testing. Specificity gains resulted in fewer false positives and an increase in the number of correct referrals to colposcopy. Dual-staining with p16/Ki-67 cytology is an attractive biomarker approach for triage in cervical cancer screening. Copyright © 2017 Elsevier B.V. All rights reserved.

[Chemical composition and daily variation of melt water during ablation season in monsoonal temperate Glacier region: a case study of Baishui Glacier No. 1].

PubMed

Zhu, Guo-Feng; Pu, Tao; He, Yuan-Qing; Wang, Pei-Zhen; Kong, Jian-Long; Zhang, Ning-Ning; Xin, Hui-Juan

2012-12-01

Melt water samples collected continuously from 29 August to 3 September 2009 in the Baishui Glacier No. 1 at elevation of 4750 m were analyzed for pH, conductivity, delta18O and inorganic ions. The results showed that the pH had obvious diurnal variations and was increased slightly by the influence of precipitation. The dissolution of alkaline soluble salts in the dust was the main reason for the increase of melt water conductivity; the value of delta18O was relatively low in strong ablation period and high in slight ablation period. Different from other research areas, the concentrations of Na+, K+, which were influenced by lithological and marine water vapor, were higher than that of Mg2+ in the study area; HCO3- and Ca2+ accounted for more than 80% of total ions in snow and ice melt water, indicating that the ions mainly came from limestone and the melt water was a typical carbonate solution; The content of melt water had an obvious daily change with temperature change, but the response amplitudes were different; Monsoon transport, local rock lithology, human industrial and agricultural activities were the main sources of inorganic ions and the deciding factors of the ion composition in the Baishui Glacier No. 1.

Synthesis and characterization of LPCVD SiC films using novel precursors

NASA Astrophysics Data System (ADS)

Bhaskaran, Mahalingam

A unique low pressure chemical vapor deposition (LPCVD) process has been developed to synthesize amorphous and crystalline SiC films using environmentally benign chemicals. The interrelationships governing the process variables, compositions and select properties of the resulting films were established. Such films can be used to produce high quality mask membrane for x-ray lithography. These films can also be used in fabricating high power electrical devices, and hetrojunction devices in conjunction with silicon. Amorphous SiC films were synthesized using a single precursor, ditertiarybutylsilane, at temperatures below 850sp°C. Compositional analysis performed on these deposits revealed that, in the deposition temperature range of 625 to 750sp°C, the composition of the deposits changed progressively from slightly silicon rich (55% Si) to slightly carbon rich (51%C). Above 750sp°C, there was a rapid increase in the carbon content from the near stoichiometric value to about 75%-C at 850sp°C. The stoichiometric films exhibited high stress values of 700 ± 50 MPa. Attempts to reduce the stress values resulted in films with excess carbon content of about 60%-C. From the high frequency C-V characterization, the dielectric constant for these films was estimated to be 10.1 ± 0.5. Temperature bias stressing studies revealed a trapped charge density of 0.869× 10sp7 cIsp{-2} within the bulk. Crystalline silicon carbide films were grown on silicon substrates using dichlorosilane and acetylene as precursors, in the temperature range of 950sp°C to 1050sp°C. The carbon content in the film was found to be increasing with the deposition temperature, when the flow ratio of precursors was one. The carbon composition was also found to be sharply dependent on acetylene flow, for constant deposition temperature and pressure. Stoichiometric films were achieved for dichlorosilane to acetylene flow ratio of 4:1. X-ray diffraction studies confirmed the growth of beta-SiC with $$ orientation in all the cases. The voltage-current relationship for Si-film-metal structure showed a diode behavior with an ideality factor of 4.03 in the diffusion current dominating regime.

Wear resistance of machine tools' bionic linear rolling guides by laser cladding

NASA Astrophysics Data System (ADS)

Wang, Yiqiang; Liu, Botao; Guo, Zhengcai

2017-06-01

In order to improve the rolling wear resistance (RWR) of linear rolling guides (LRG) as well as prolong the life of machine tools, various shape samples with different units spaces ranged from 1 to 5 mm are designed through the observation of animals in the desert and manufactured by laser cladding. Wear resistance tests reproducing closely the real operational condition are conducted by using a homemade linear reciprocating wear test machine, and wear resistance is evaluated by means of weight loss measurement. Results indicate that the samples with bionic units have better RWR than the untreated one, of which the reticulate treated sample with unit space 3 mm present the best RWR. More specifically, among the punctuate treated samples, the mass loss increases with the increase of unit space; among the striate treated samples, the mass loss changes slightly with the increase of unit space, attaining a minimum at the unit space of 4 mm; among the reticulate treated samples, with the increase of unit space, the mass loss initially decreases, but turns to increase after reaching a minimum at the unit space of 3 mm. Additionally, the samples with striate shape perform better wear resistance than the other shape groups on the whole. From the ratio value of laser treated area to contacted area perspective, that the samples with ratio value between 0.15 and 0.3 possess better wear resistance is concluded.

Effect of Lime, Humic Acid and Moisture Regime on the Availability of Zinc in Alfisol

PubMed Central

Naik, Sushanta Kumar; Das, Dilip Kumar

2007-01-01

Lime and humic acid application can play an important role in the availability of zinc in paddy soils. We conducted laboratory incubation experiments on a rice growing soil (Alfisol) to determine the effect of lime, humic acid and different moisture regimes on the availability of Zn. Addition of half doses of liming material (powdered lime stone) recorded highest values of DTPA-Zn followed by no lime and 100% of lime requirement throughout the incubation period. With the progress of incubation, DTPA-Zn increased slightly during the first week and then decreased thereafter. The highest DTPA-extractable Zn content of 2.85 mg/kg was found in the treatment Zn10 L1/2 at 7 days of incubation, showing 17.3 % increase in DTPA-Zn content over its corresponding treatment of Zn alone (Zn10L0). The DTPA-Zn concentration increased with the application of humic acid compared with no humic acid throughout 35 days of the incubation period and the peak value obtained was 3.12 mg/kg in the treatment Zn10 HA2 at 14 days after incubation, showing 50 % increase in Zn content over its corresponding treatment of Zn alone (Zn10HA0). The application of 0.2% humic acid compared with 0.1% resulted in greater increase in DTPA-Zn concentration in soil application. During the 35 days of incubation, highest values of DTPA-Zn were recorded in soil maintained at saturated compared to water logged conditions. However, under alternate wetting and drying condition the DTPA-Zn content gradually decreased up to 21 days and thereafter increased slowly. PMID:17704853

Biogeochemical patterns of intermittent streams over space and time as surface flows decrease

NASA Astrophysics Data System (ADS)

MacNeille, R. B.; Lohse, K. A.; Godsey, S.; McCorkle, E. P.; Parsons, S.; Baxter, C.

2016-12-01

Climate change in the western United States is projected to lead to earlier snowmelt, increasing fire risk and potentially transitioning perennial streams to intermittent ones. Differences between perennial and intermittent streams, especially the temporal and spatial patterns of carbon and nutrient dynamics during periods of drying, are understudied. We examined spatial and temporal patterns in surface water biogeochemistry in southwest Idaho and hypothesized that as streams dry, carbon concentrations would increase due to evapoconcentration and/or increased in-stream production. Furthermore, we expected that biogeochemical patterns of streams would become increasingly spatially heterogeneous with drying. Finally, we expected that these patterns would vary in response to fire. To test these hypotheses, we collected water samples every 50 meters from two intermittent streams, one burned and one unburned, in April, May and June, 2016 to determine surface water biogeochemistry. Results showed average concentrations of dissolved inorganic carbon (DIC) and dissolved organic carbon (DOC) increased 3-fold from April to June in the burned site compared to the unburned site where concentrations remained relatively constant. Interestingly, average concentrations of total nitrogen (TN) dropped substantially for the burned site over these three months, but only decreased slightly for the unburned site over the same time period. We also assessed changes in spatial correlation between the burned and unburned site: carbon concentrations were less spatially correlated at the unburned site than at the burned site. Scatterplot matrices of DIC values indicated that at a lag distance of 300 m in April and June, the unburned site had r-values of 0.7416 and 0.5975, respectively, while the burned site had r-values of 0.9468 and 0.8783, respectively. These initial findings support our hypotheses that carbon concentrations and spatial heterogeneity increased over time.

Sensitivity of some nitrogen fixers and the target pest Fusarium oxysporum to fungicide thiram.

PubMed

Osman, Awad G; Sherif, Ashraf M; Elhussein, Adil A; Mohamed, Afrah T

2012-03-01

This study was carried out to investigate the toxic effects of the fungicide thiram (TMTD) against five nitrogen fixers and the thiram target pest Fusarium oxysporum under laboratory conditions. Nitrogen fixing bacteria Falvobacterium showed the highest values of LD(50) and proved to be the most resistant to the fungicide followed by Fusarium oxysporum, while Pseudomonas aurentiaca was the most affected microorganism. LD(50) values for these microorganisms were in 2-5 orders of magnitude lower in comparison with LD(50) value for Fusarium oxysporum. Thiram was most toxic to Pseudomonas aurentiaca followed by Azospirillum. The lowest toxicity index was recorded for Fusarium oxysporum and Flavobacterium. The slope of the curve for Azomonas, Fusarium oxysporum and Flavobacterium is more steep than that of the other curves, suggesting that even a slight increase of the dose of the fungicide can cause a very strong negative effect. Thiram was more selective to Pseudomonas aurentiaca followed by Azospirillum, Rhizobium meliloti and Azomonas. The lowest selectivity index of the fungicide was recorded for Falvobacterium followed by Fusarium oxysporum. The highest safety coefficient of the fungicide was assigned for Flavobacterium, while Pseudomonas aurentiaca showed the lowest value.

High Reynolds Number Investigation of a Flush-Mounted, S-Duct Inlet With Large Amounts of Boundary Layer Ingestion

NASA Technical Reports Server (NTRS)

Berrier, Bobby L.; Carter, Melissa B.; Allan, Brian G.

2005-01-01

An experimental investigation of a flush-mounted, S-duct inlet with large amounts of boundary layer ingestion has been conducted at Reynolds numbers up to full scale. The study was conducted in the NASA Langley Research Center 0.3-Meter Transonic Cryogenic Tunnel. In addition, a supplemental computational study on one of the inlet configurations was conducted using the Navier-Stokes flow solver, OVERFLOW. Tests were conducted at Mach numbers from 0.25 to 0.83, Reynolds numbers (based on aerodynamic interface plane diameter) from 5.1 million to 13.9 million (full-scale value), and inlet mass-flow ratios from 0.29 to 1.22, depending on Mach number. Results of the study indicated that increasing Mach number, increasing boundary layer thickness (relative to inlet height) or ingesting a boundary layer with a distorted profile decreased inlet performance. At Mach numbers above 0.4, increasing inlet airflow increased inlet pressure recovery but also increased distortion. Finally, inlet distortion was found to be relatively insensitive to Reynolds number, but pressure recovery increased slightly with increasing Reynolds number.

Coccidioides complement fixation

MedlinePlus

... antibodies are detected in the blood sample. Normal value ranges may vary slightly among different laboratories. Some labs use different measurements or test different samples. Talk to your health care provider about the meaning of your specific test results.

Albumin - blood (serum)

MedlinePlus

The normal range is 3.4 to 5.4 g/dL (34 to 54 g/L). Normal value ranges may vary slightly among different laboratories. Some labs use different measurements or test different samples. Talk to your provider about ...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lave, Matthew Samuel; Stein, Joshua; Burnham, Laurie

This report provides performance data and analysis for two Stion copper indium gallium selenide (CIGS) module types, one framed, the other frameless, and installed at the New Mexico, Florida and Vermont RTCs. Sandia looked at data from both module types and compared the latter with data from an adjacent monocrystalline baseline array at each RTC. The results indicate that the Stion modules are slightly outperforming their rated power, with efficiency values above 100% of rated power, at 25degC cell temperatures. In addition, Sandia sees no significant performance differences between module types, which is expected because the modules differ only inmore » their framing. In contrast to the baseline systems, the Stion strings showed increasing efficiency with increasing irradiance, with the greatest increase between zero and 400 Wm -2 but still noticeable increases at 1000 Wm -2 . Although baseline data availability in Vermont was spotty and therefore comparative trends are difficult to discern, the Stion modules there may offer snow- shedding advantages over monocrystalline-silicon modules but these findings are preliminary.« less

Unsteady density and velocity measurements in the 6 foot x 6 foot wind tunnel

NASA Technical Reports Server (NTRS)

Rose, W. C.; Johnson, D. A.

1980-01-01

The methods used and the results obtained in four aero-optic tests are summarized. It is concluded that the rather large values of density fluctuation appear to be the result of much higher Mach number than freestream and the violent turbulence in the flow as it separates from the turret. A representative comparison of fairing on-fairing off rms density fluctuation indicates essentially no effect at M = 0.62 and a small effect at M = 0.95. These data indicate that some slight improvement in optical quality can be expected with the addition of a fairing, although at M = 0.62 its effect would be nil. Fairings are very useful in controlling pressure loads on turrets, but will not have first order effects on optical quality. Scale sizes increase dramatically with increasing azimuth angle for a reprensentative condition. Since both scale sizes and fluctuation levels increase (total turbulence path length also increases) with azimuth angle, substantial optical degradation might be expected. For shorter wave lengths, large degradations occur.

Electrofluid hydrolysis enhances the production of fermentable sugars from corncob via in/reverse-phase induced voltage.

PubMed

Wu, Fengfeng; Jin, Yamei; Li, Dandan; Zhou, Yuyi; Guo, Lunan; Zhang, Mengyue; Xu, Xueming; Yang, Na

2017-06-01

To improve the economic value of lignocellulosic biomasses, an innovative electrofluidic technology has been applied to the efficient hydrolysis of corncob. The system combines fluidic reactors and induced voltages via magnetoelectric coupling effect. The excitation voltage had a positive impact on reducing sugar content (RSC). But, the increase of voltage frequency at 400-700Hz caused a slight decline of the RSC. Higher temperature limits the electrical effect on the hydrolysis at 70-80°C. The energy efficiency increased under the addition of metallic ions and series of in-phase induced voltage to promote hydrolysis. In addition, the 4-series system with in-phase and reverse-phase induced voltages under the synchronous magnetic flux, exhibited a significant influence on the RSC with a maximum increase of 56%. High throughput could be achieved by increasing series in a compact system. Electrofluid hydrolysis avoids electrochemical reaction, electrode corrosion, and sample contamination. Copyright © 2017 Elsevier Ltd. All rights reserved.

Detailed microearthquake studies at the Cerro Prieto geothermal field

DOE Office of Scientific and Technical Information (OSTI.GOV)

Majer, E.L.; McEvilly, T.V.

There appears to be an increase in seismic activity within the Cerro Prieto production zone since early 1978. The microearthquake activity is now more or less constant at a rate of 2 to 3 events per day. The b-values within the field are significantly higher inside the production zone than are those for events on faults outside of the production region. The earthquakes seem to be controlled by the Hidalgo fault, although slight clustering was observed in the center of the main production region. The earthquakes within the production zone may reflect the reservoir dynamics associated with heat and massmore » withdrawal. Mechanisms such as volume change, thermal stresses and weakening of materials associated with boiling (i.e., phase changes, dissolution) may all be responsible for the increased seismic activity. Although a small reinjection program has started, the pressure drawdown conditions existing within the field would imply that increased pore pressure resulting from the injection activities is not responsible for the increased seismic activity.« less

Employee-Organization Pro-environmental Values Fit and Pro-environmental Behavior: The Role of Supervisors' Personal Values.

PubMed

Lu, Hui; Liu, Xia; Chen, Hong; Long, Ruyin

2017-12-18

This study examines the relationship among the employees-organization pro-environmental values fit (E-O PEVs fit), supervisors' PEVs and employees' pro-environmental behaviors (PEB). Informed by the PEB, organizational values and employee-organization fit literature, we propose and test hypotheses that under egoistic, altruistic and biosphere-value orientations, E-O PEVs fit versus non-fit have significant effects on employees' private-sphere PEB and public-sphere PEB, identifying supervisors' PEVs as a moderator. An empirical investigation indicates that the effect of E-O PEVs fit on employees' private-sphere PEB and public-sphere PEB varies as the value orientation differs. More specifically, under the context of altruistic and biosphere-value orientations, if the organizational PEVs do not match the employees' PEVs, especially when the former exceeds the latter, employees' PEB will rise as the organizational PEVs increase. As for egoistic value orientation, when organizational PEVs exceed employees' PEVs, not only will public-sphere PEB stop decreasing and tend to stabilize, but also private-sphere PEB will rise to a slight degree. Furthermore, compared with altruistic and biospheric values dimensions, supervisors who promote egoistic PEVs will have a more significant effect on the relationship between global E-O PEVs fit and employees' PEB. Finally, we suggest that the goals of an organization and its supervisors need to be combined within the actual situation of Chinese corporations to truly implement corporate green practices by balancing the profit goal and the environmental goal.

Age and Employee Green Behaviors: A Meta-Analysis

PubMed Central

Wiernik, Brenton M.; Dilchert, Stephan; Ones, Deniz S.

2016-01-01

Recent economic and societal developments have led to an increasing emphasis on organizational environmental performance. At the same time, demographic trends are resulting in increasingly aging labor forces in many industrialized nations. Commonly held stereotypes suggest that older workers are less likely to be environmentally responsible than younger workers. To evaluate the degree to which such age differences are present, we meta-analyzed 132 independent correlations and 336 d-values based on 4676 professional workers from 22 samples in 11 countries. Contrary to popular stereotypes, age showed small positive relationships with pro-environmental behaviors, suggesting that older adults engaged in these workplace behaviors slightly more frequently. Relationships with age appeared to be linear for overall, Conserving, Avoiding Harm, and Taking Initiative pro-environmental behaviors, but non-linear trends were observed for Transforming and Influencing Others behaviors. PMID:26973550

Effects of Mn substitution on the thermoelectric properties of the electron-doped perovskite Sr1-xLaxTiO3

NASA Astrophysics Data System (ADS)

Okuda, T.; Hata, H.; Eto, T.; Nishina, K.; Kuwahara, H.; Nakamura, M.; Kajimoto, R.

2014-12-01

We have tried to improve the n-type thermoelectric properties of the electron- doped Perovskite Sr1-xLaxTiO3 by a Mn substitution. The 1 ~ 2 % Mn substitution enhances the Seebeck coefficient (S) and reduces the thermal conductivity (κ) by about 50 % at room temperature (RT) without largely increasing the resistivity for the 5 % electron-doped SrTiO3. Consequently, the power factor at RT keeps a large value comparable to that of Bi2Te3 and the dimensionless figure-of-merits at RT increases twofold by the slight Mn substitution. Such a large reduction of κ at RT is perhaps due to the effect of Jahn-Teller active Mn3+ ions, around which dynamical local lattice distortion may occur.

Modification by protons of frog skeletal muscle KATP channels: effects on ion conduction and nucleotide inhibition.

PubMed Central

Vivaudou, M; Forestier, C

1995-01-01

1. The molecular mechanisms underlying pH regulation of skeletal muscle ATP-sensitive K+ (KATP) channels were studied using the patch clamp technique in the inside-out configuration. Two effects of intracellular protons were studied in detail: the decrease in magnitude of single-channel currents and the increase in open probability (Po) of nucleotide-inhibited channels. 2. The pH dependence of inward unit currents under different ionic conditions was in poor agreement with either a direct block of the pore by protons or an indirect proton-induced conformational change, but was compatible with the protonation of surface charges located near the cytoplasmic entrance of the pore. This latter electrostatic mechanism was modelled using Gouy-Chapman-Stern theory, which predicted the data accurately with a surface charge density of about 0.1 negative elementary charges per square nanometre and a pK (pH value for 50% effect) value for protonation of these charges of 6.25. The same mechanism, i.e. neutralization of negative surface charges by cation binding, could also account for the previously reported reduction of inward unit currents by Mg2+. 3. Intracellular alkalization did not affect Po of the KATP channels. Acidification increased Po. In the presence of 0.1 mM ATP (no Mg2+), the channel activation vs. pH relationship could be fitted with a sigmoid curve with a Hill coefficient slightly above 2 and a pK value of 6. This latter value was dependent on the ATP concentration, decreasing from 6.3 in 30 microM ATP to 5.3 in 1 microM ATP. 4. Conversely, the channel inhibition vs. ATP concentration curve was shifted to the right when the pH was lowered. At pH 7.1, the ATP concentration causing half-maximal inhibition was about 10 microM. At pH 5.4, it was about 400 microM. The Hill coefficient values remained slightly below 2. Similar effects were observed when ADP was used as the inhibitory nucleotide. 5. These results confirm that a reciprocal competitive link exists between proton and nucleotide binding sites. Quantitatively, they are in full agreement with a steady-state model of a KATP channel possessing four identical protonation sites (microscopic pK, 6) allosterically connected to the channel open state and two identical nucleotide sites (microscopic ATP dissociation constant, approximately 30 microM) connected to the closed state. Images Figure 13 PMID:7473225

Aquatic passive sampling of perfluorinated chemicals with polar organic chemical integrative sampler and environmental factors affecting sampling rate.

PubMed

Li, Ying; Yang, Cunman; Bao, Yijun; Ma, Xueru; Lu, Guanghua; Li, Yi

2016-08-01

A modified polar organic chemical integrative sampler (POCIS) could provide a convenient way of monitoring perfluorinated chemicals (PFCs) in water. In the present study, the modified POCIS was calibrated to monitor PFCs. The effects of water temperature, pH, and dissolved organic matter (DOM) on the sampling rate (R s) of PFCs were evaluated with a static renewal system. During laboratory validation over a 14-day period, the uptake kinetics of PFCs was linear with the POCIS. DOM and water temperature slightly influenced POCIS uptake rates, which is in consistent with the theory for uptake into POCIS. Therefore, within a narrow span of DOM and water temperatures, it was unnecessary to adjust the R s value for POCIS. Laboratory experiments were conducted with water over pH ranges of 3, 7, and 9. The R s values declined significantly with pH increase for PFCs. Although pH affected the uptake of PFCs, the effect was less than twofold. Application of the R s value to analyze PFCs with POCIS deployed in the field provided similar concentrations obtained from grab samples.

Childhood obesity, gender, actual-ideal body image discrepancies, and physical self-concept in Hong Kong children: cultural differences in the value of moderation.

PubMed

Marsh, Herbert W; Hau, K T; Sung, R Y T; Yu, C W

2007-05-01

Childhood obesity is increasingly prevalent in Western and non-Western societies. The authors related multiple dimensions of physical self-concept to body composition for 763 Chinese children aged 8 to 15 and compared the results with Western research. Compared with Western research, gender differences favoring boys were generally much smaller for physical self-concept and body image. Objective and subjective indexes of body fat were negatively related to many components of physical self-concept, but--in contrast to Western research--were unrelated to global self-esteem and slightly positively related to health self-concept. In support of discrepancy theory, actual-ideal discrepancies in body image were related to physical self-concept. However, consistent with the Chinese cultural value of moderation, and in contrast to Western results, being too thin relative to personal ideals was almost as detrimental as being too fat. The results reflect stronger Chinese cultural values of moderation and acceptance of obesity than in Western culture and have implications for social and educational policy in China. Copyright (c) 2007 APA, all rights reserved.

Composition and quality of coals in the Huaibei Coalfield, Anhui, China

USGS Publications Warehouse

Zheng, Lingyun; Liu, Gaisheng; Wang, L.; Chou, C.-L.

2008-01-01

The Huaibei Coalfield, Anhui Province, China, is one of the largest coalfields in China. The coals of Permian age are used mainly for power generation. Coal compositions and 47 trace elements of the No. 10 Coal of the Shanxi Formation, the No. 7, 5, and 4 Coals of the Lower Shihezi Formation, and the No. 3 Coal of the Upper Shihezi Formation from the Huaibei Coalfield were studied. The results indicate that the Huaibei coals have low ash, moisture, and sulfur contents, but high volatile matter and calorific value. The ash yield increases stratigraphically upwards, but the volatile matter and total sulfur contents show a slight decrease from the lower to upper seams. Magmatic intrusion into the No. 5 Coal resulted in high ash, volatile matter, and calorific value, but low moisture value in the coal. Among the studied 47 trace elements, Ba, Co, Cr, Cu, Hg, Mo, Ni, Pb, Sb, Th, U, V, and Zn are of environmental concerns. Four elements Hg, Mo, Zn, and Sb are clearly enriched in the coals as compared with the upper continental crust. ?? 2007 Elsevier B.V. All rights reserved.

[Malignant tumor incidence in employees of the Alytus textile factory (1978-1997)].

PubMed

Kuzmickiene, Irena; Stukonis, Mecys; Didziapetris, Remigijus

2002-01-01

The purpose of this study was to evaluate cancer incidence in the large cotton-manufacturing factory in Lithuania. Altogether 10,198 workers employed at least 1 year in 1969-1997 were included in the cohort and followed during the period 1978/01/01-1997/12/31. National cancer rates were used to calculate the expected number of cancer cases. The overall cancer risk for men was slightly higher than that in the general population (standardized incidence rate (SIR) 1.15, 95% confidence interval (95% CI) 0.98-1.34). A significant increase in the incidence of esophagus (11 observed cases, SIR 3.76, 95% CI 1.88-6.67) and slightly increased of lung (42 observed cases, SIR 1.26, 95% CI 0.91-1.70) cancer became evident. None of the cancer risk showed statistically significant excess cancer incidence in the textile-processing (spinning and weaving) departments (SIR 0.98). In the women cohort the level of the general incidence was very close to expected, standardized incidence rates (SIR) being 0.99 (95% CI 0.88-1.13). However, there was a significant increase in the number of cases of gall bladder (6 observed, SIR 3.19, 95% CI 1.17-6.95). The analysis of the results among textile-processing (spinning and weaving departments) workers indicated the elevated risk of breast cancer (44 observed cases, SIR 1.49, 95% CI 1.08-2.0) and cervical cancer (24 observed cases, SIR 1.68, 95% CI 1.08-2.50). The number of lung cancer cases in this group was a higher, but statistically not significant (5 observed cases, SIR 1.53, 95% CI 0.5-3.58). Increased SIR values were observed for > or = 10 years since the first exposure for all cancers, cervix uteri, ovary and kidney. The overall cancer risk for men cohort was slightly higher than that in the general population. There was a significant increase in the number of cancer of the esophagus. The overall excess risk in women cohort was only for gall bladder, but for spinners and weavers the elevated risk was for cervix uteri and breast cancer. After 10 years of employment the excess risk was already for all cancers, cervix uteri, ovary and kidney malignant tumors.

Estimating sugarcane yield potential using an in-season determination of normalized difference vegetative index.

PubMed

Lofton, Josh; Tubana, Brenda S; Kanke, Yumiko; Teboh, Jasper; Viator, Howard; Dalen, Marilyn

2012-01-01

Estimating crop yield using remote sensing techniques has proven to be successful. However, sugarcane possesses unique characteristics; such as, a multi-year cropping cycle and plant height-limiting for midseason fertilizer application timing. Our study objective was to determine if sugarcane yield potential could be estimated using an in-season estimation of normalized difference vegetative index (NDVI). Sensor readings were taken using the GreenSeeker® handheld sensor from 2008 to 2011 in St. Gabriel and Jeanerette, LA, USA. In-season estimates of yield (INSEY) values were calculated by dividing NDVI by thermal variables. Optimum timing for estimating sugarcane yield was between 601-750 GDD. In-season estimated yield values improved the yield potential (YP) model compared to using NDVI. Generally, INSEY value showed a positive exponential relationship with yield (r(2) values 0.48 and 0.42 for cane tonnage and sugar yield, respectively). When models were separated based on canopy structure there was an increase the strength of the relationship for the erectophile varieties (r(2) 0.53 and 0.47 for cane tonnage and sugar yield, respectively); however, the model for planophile varieties weakened slightly. Results of this study indicate using an INSEY value for predicting sugarcane yield shows potential of being a valuable management tool for sugarcane producers in Louisiana.

Cephalometric Evaluation of the Effect of Complete Dentures on Retropharyngeal Space and Its Effect on Spirometric Values in Altered Vertical Dimension

PubMed Central

Gupta, Prachi; Thombare, Ram; Pakhan, A. J.; Singhal, Sameer

2011-01-01

Role of complete dentures in reducing apnea-hypoapnea index in edentulous obstructive sleep apnea patient has shown promising results in previous studies. This study was undertaken to ascertain the role of complete denture and complete denture with slight increase in vertical dimension using custom made occlussal jig, on retropharyngeal space, posterior airway space, pharyngeal depth, and spirometric readings in comparison with those in edentulous group. Significant changes were observed in both intervention groups and thus, paving the way for doing further research for the consideration of using complete denture with modifications as an oral appliance in edentulous obstructive sleep apnea patient. PMID:21991477

[Sputum viscosity and pulmonary function measurements during a one-week parenteral treatment with a standardized oxidation product of oil of turpentine and terpin hydrate].

PubMed

Löllgen-Horres, I; Löllgen, H

1976-01-01

In 23 patients with chronic obstructive lung diseases, viscosity, airway resistance, arterial blood gases and acid-base balance, and sputum aspect were measured before and after one-week treatment with Ozothin, a substance from oxidation products of ol. terebinth. and terpinum hydratum. Within this time, viscosity of the sputum was reduced, airway resistance decreased, and arterial oxygen pressure slightly increased, whereas arterial carbon dioxide tension obvious change of sputum aspect could be observed. Correlation calculations revealed no significant relations between viscosity and the above cited lung function values. The results indicate that administration of Ozothin may liquefy viscous secretion and reduce sputum viscosity.

Enhanced pid vs model predictive control applied to bldc motor

NASA Astrophysics Data System (ADS)

Gaya, M. S.; Muhammad, Auwal; Aliyu Abdulkadir, Rabiu; Salim, S. N. S.; Madugu, I. S.; Tijjani, Aminu; Aminu Yusuf, Lukman; Dauda Umar, Ibrahim; Khairi, M. T. M.

2018-01-01

BrushLess Direct Current (BLDC) motor is a multivariable and highly complex nonlinear system. Variation of internal parameter values with environment or reference signal increases the difficulty in controlling the BLDC effectively. Advanced control strategies (like model predictive control) often have to be integrated to satisfy the control desires. Enhancing or proper tuning of a conventional algorithm results in achieving the desired performance. This paper presents a performance comparison of Enhanced PID and Model Predictive Control (MPC) applied to brushless direct current motor. The simulation results demonstrated that the PSO-PID is slightly better than the PID and MPC in tracking the trajectory of the reference signal. The proposed scheme could be useful algorithms for the system.

Proximate Nutritional Evaluation of Gamma Irradiated Black Rice (Oryza sativa L. cv. Cempo ireng)

NASA Astrophysics Data System (ADS)

Riyatun; Suharyana; Ramelan, A. H.; Sutarno; Saputra, O. A.; Suryanti, V.

2018-03-01

Black rice is a type of pigmented rice with black bran covering the endosperm of the rice kernel. The main objective of the present study was to provide details information on the proximate composition of third generation of gamma irradiated black rice (Oryza sativa L. cv. Cempo ireng). In respect to the control, generally speaking, there were no significant changes of moisture, lipids, proteins, carbohydrates and fibers contents have been observed for the both gamma irradiated black rice. However, the 200-BR has slightly better nutritional value than that of 300-BR and the control. The mineral contents of 200-BR increased significantly of about 35% than the non-gamma irradiated black rice.

Radar stage uncertainty

USGS Publications Warehouse

Fulford, J.M.; Davies, W.J.

2005-01-01

The U.S. Geological Survey is investigating the performance of radars used for stage (or water-level) measurement. This paper presents a comparison of estimated uncertainties and data for radar water-level measurements with float, bubbler, and wire weight water-level measurements. The radar sensor was also temperature-tested in a laboratory. The uncertainty estimates indicate that radar measurements are more accurate than uncorrected pressure sensors at higher water stages, but are less accurate than pressure sensors at low stages. Field data at two sites indicate that radar sensors may have a small negative bias. Comparison of field radar measurements with wire weight measurements found that the radar tends to measure slightly lower values as stage increases. Copyright ASCE 2005.

Digital ranges of motion: normal values in young adults.

PubMed

Mallon, W J; Brown, H R; Nunley, J A

1991-09-01

Analysis of the range of motion of fingers was done in young (eighteen to thirty-five year old) adult volunteers with no history of previous injury to their hands. The data show that there are slight differences between the individual digits. Notably, metacarpophalangeal flexion and total active motion increase linearly in proceeding from the index to the small finger. There were also minor differences in comparing sexes. Women have greater extension at the metacarpophalangeal joint in both active and passive motion and have a greater total active motion at all digits as a result. A significant tenodesis effect was found at the distal interphalangeal joint in normal subjects. No differences were found that could be attributable to handedness.

Maternal blood total oxypurines and erythrocyte 2,3-diphosphoglycerate levels during normal pregnancy.

PubMed

Mizutani, S; Akiyama, H; Kurauchi, O; Taira, H; Yamada, R; Narita, O; Tomoda, Y

1985-01-01

The effects of pregnancy on the levels of maternal plasma total oxypurines (hypoxanthine, xanthine and uric acid) and erythrocyte 2,3-diphosphoglycerate (2,3-DPG) was investigated. With advancing gestation there was a slight increasing tendency in plasma total oxypurines as well as erythrocyte 2,3-DPG in pregnant women. When the ratio of 2,3-DPG to total oxypurines was calculated, the ratio was almost unchanged until week 34. After week 35, the ratio decreased to week 37; the ratios between week 37 and 40 had similar values to cord blood. The above data suggest that the changes of these metabolites in maternal peripheral blood may be indicative for hypoxia with fetoplacental tissue.

Isotopically exchangeable organic hydrogen in coal relates to thermal maturity and maceral composition

USGS Publications Warehouse

Mastalerz, Maria; Schimmelmann, A.

2002-01-01

Hydrogen isotopic exchangeability (Hex) and ??Dn values of non-exchangeable organic hydrogen were investigated in coal kerogens ranging in rank from lignite to graphite. The relative abundance of Hex is highest in lignite with about 18% of total hydrogen being exchangeable, and decreases to around 2.5% in coals with Ro of 1.7 to ca. 5.7%. At Still higher rank (Ro > 6%), Hex increases slightly, although the abundance of total hydrogen decreases. ??Dn is influenced by original biochemical D/H ratios and by thermal maturation in contact with water. Therefore, ??Dn does not show an overall consistent trend with maturity. ?? 2002 Elsevier Science Ltd. All rights reserved.

Photoacclimation in a tropical population of Cladophora glomerata (L.) Kützing 1843 (Chlorophyta) from southeastern Brazil.

PubMed

Bautista, A I N; Necchi-Júnior, O

2008-02-01

Photoacclimation of photosynthesis was investigated in a tropical population of C. glomerata (São Paulo State, southeastern Brazil, 20 degrees 48' 24" S and 49 degrees 22' 24" W) by chlorophyll fluorescence parameters and chlorophyll a content. Plants were acclimated to two levels of irradiance: low (65 +/- 5 micromol.m(-2).s(-1)) and high (300 +/- 10 micromol.m(-2).s(-1)) and exposed short-term (4 days) and long-term (28 days) under a light-dark cycle of 12:12 hours. Photosynthesis-irradiance (PI) curves revealed distinct strategies of photoacclimation. In long-term exposure, plants acclimated by altering the photosynthetic units (PSU) number and keeping fixed the PSU size, revealed by increased rates of maximum photosynthesis (Pmax), lower photosynthetic efficiency (alpha) and higher values of the saturation parameter (Ik) under high irradiance. The short-term acclimation strategy consisted of changing the PSU size, with a fixed number of PSUs, as revealed by similar Pmax but higher alpha and lower Ik under low irradiance. Chlorophyll a contents followed the general pattern reported in green algae of higher concentrations under lower irradiance. Dark/light induction curves revealed consistently higher values of potential quantum yield under low irradiance. Initial and final values showed a higher recovery capacity in the short (84.4-90.6%) term exposure than in the long-term case (81.4-81.5%). ETR (electron transport rate) and NPQ (non-photochemical quenching) values were consistently higher under low irradiance. ETR showed a continuous and steady increase along the light exposure period in the short and long-term experiments, whereas NPQ values revealed a rapid increase after 15 seconds of light exposure, kept a slightly increasing trend and stabilized in most treatments. Lower photosynthetic performance (ETR) and recovery capacity of potential quantum yield were observed, particularly in long-term exposure, suggesting that this population is constrained by the typical high light environment of tropical regions.

Exact quantum scattering calculation of transport properties for free radicals: OH(X2Π)-helium.

PubMed

Dagdigian, Paul J; Alexander, Millard H

2012-09-07

Transport properties for OH-He are computed through quantum scattering calculations using the ab initio potential energy surfaces determined by Lee et al. [J. Chem. Phys. 113, 5736 (2000)]. To gauge the importance of the open-shell character of OH and the anisotropy of the potential on the transport properties, including the collision integrals Ω((1,1)) and Ω((2,2)), as well as the diffusion coefficient, calculations were performed with the full potential, with the difference potential V(dif) set to zero, and with only the spherical average of the potential. Slight differences (3%-5%) in the computed diffusion coefficient were found between the values obtained using the full potential and the truncated potentials. The computed diffusion coefficients were compared to recent experimental measurements and those computed with a Lennard-Jones (LJ) 12-6 potential. The values obtained with the full potential were slightly higher than the experimental values. The LJ 12-6 potential was found to underestimate the variation in temperature as compared to that obtained using the full OH-He ab initio potential.

Value Conflicts between Civil Society and Military Institutions.

DTIC Science & Technology

1972-02-01

to inaividuality and personal freedom in the military service (30 percent of the sample indi- cated they were unemployed ). Potential for Reenlistment...percent were unemployed as contrasted with 15 percent of "would not have entered" they have a lower socioeconomic background and include a larger...they .ere unemployed .) With respect to importance attached to value ouestions, some slight, statistically significant, differences appear (.3

Modeling and Performance Estimation for Airborne Minefield Detection System

DTIC Science & Technology

2008-05-01

Difference Vegetation Index ( NDVI ) NDVI is defined as: NDVI = (NIR – RED)/ (NIR + RED...to minimize the effect of variable irradiance levels. NDVI is always bounded between -1 and 1. A higher positive value of NDVI indicates the...lakes, and rivers) which has low reflectance in both NIR as well as visible bands, results in very low positive or slightly negative NDVI values

Numerical simulation for the influence of laser-induced plasmas addition on air mass capture of hypersonic inlet

NASA Astrophysics Data System (ADS)

Zhao, Wei; Dou, Zhiguo; Li, Qian

2012-03-01

The theory of laser-induced plasmas addition to hypersonic airflow off a vehicle to increase air mass capture and improve the performance of hypersonic inlets at Mach numbers below the design value is explored. For hypersonic vehicles, when flying at mach numbers lower than the design one, we can increase the mass capture ratio of inlet through laser-induced plasmas injection to the hypersonic flow upstream of cowl lip to form a virtual cowl. Based on the theory, the model of interaction between laser-induced plasmas and hypersonic flow was established. The influence on the effect of increasing mass capture ratio was studied at different positions of laser-induced plasmas region for the external compression hypersonic inlet at Mach 5 while the design value is 6, the power of plasmas was in the range of 1-8mJ. The main results are as follows: 1. the best location of the plasma addition region is near the intersection of the nose shock of the vehicle with the continuation of the cowl line, and slightly below that line. In that case, the shock generated by the heating is close to the shock that is a reflection of the vehicle nose shock off the imaginary solid surface-extension of the cowl. 2. Plasma addition does increase mass capture, and the effect becomes stronger as more energy is added, the peak value appeared when the power of plasma was about 4mJ, when the plasma energy continues to get stronger, the mass capture will decline slowly.

Numerical simulation for the influence of laser-induced plasmas addition on air mass capture of hypersonic inlet

NASA Astrophysics Data System (ADS)

Zhao, Wei; Dou, Zhiguo; Li, Qian

2011-11-01

The theory of laser-induced plasmas addition to hypersonic airflow off a vehicle to increase air mass capture and improve the performance of hypersonic inlets at Mach numbers below the design value is explored. For hypersonic vehicles, when flying at mach numbers lower than the design one, we can increase the mass capture ratio of inlet through laser-induced plasmas injection to the hypersonic flow upstream of cowl lip to form a virtual cowl. Based on the theory, the model of interaction between laser-induced plasmas and hypersonic flow was established. The influence on the effect of increasing mass capture ratio was studied at different positions of laser-induced plasmas region for the external compression hypersonic inlet at Mach 5 while the design value is 6, the power of plasmas was in the range of 1-8mJ. The main results are as follows: 1. the best location of the plasma addition region is near the intersection of the nose shock of the vehicle with the continuation of the cowl line, and slightly below that line. In that case, the shock generated by the heating is close to the shock that is a reflection of the vehicle nose shock off the imaginary solid surface-extension of the cowl. 2. Plasma addition does increase mass capture, and the effect becomes stronger as more energy is added, the peak value appeared when the power of plasma was about 4mJ, when the plasma energy continues to get stronger, the mass capture will decline slowly.

The effects of a whole-watershed calcium addition on the chemistry of stream storm events at the Hubbard Brook Experimental Forest in NH, USA.

PubMed

Cho, Youngil; Driscoll, Charles T; Blum, Joel D

2009-10-01

Patterns of storm runoff chemistry from a wollastonite (calcium-silicate mineral, CaSiO(3)) treated watershed (W1) were compared with a reference watershed (W6) at the Hubbard Brook Experimental Forest (HBEF) in New Hampshire (NH), USA to investigate the role of Ca(2+) supply in the acid-base status of stream chemistry. In the summer of 2003, six storm events were studied in W1 and W6 to evaluate the effects of the wollastonite treatment on the episodic acidification of stream waters. Although mean values of Ca(2+) concentrations decreased slightly from 33.8 to 31.7 mumol/L with increasing stream discharge in W1 during the events, the mean value of acid neutralizing capacity (ANC) was positive (1.2 mueq/L) during storm events, compared to negative values (-0.2 mueq/L) in W6. This pattern is presumably due to enhanced Ca(2+) supply in W1 (20.7 to 29.0% of dissolved Ca(2+) derived from the added wollastonite) to stream water as a result of interflow along shallow flowpaths. In addition, the application of wollastonite increased pH and dissolved silica (H(4)SiO(4)) concentrations, and decreased the concentration of inorganic monomeric Al (Al(i)) in W1 in comparison with W6 during storm events. Despite an increase in SO(4)(2-) concentration, likely due to desorption of sulfate from soil after the treatment, the watershed showed an increase in ANC compared to the reference watershed, serving to mitigate episodic acidification.

Effects of nitrogen gas ratio on the structural and corrosion properties of ZrN thin films grown on biodegradable magnesium alloy by ion-beam sputtering

NASA Astrophysics Data System (ADS)

Kiahosseini, Seyed Rahim; Mojtahedzadeh Larijani, Majid

2017-12-01

Studies on the corrosion resistance of magnesium alloys, which are widely applied as biomaterials, have increased in recent years. In this work, zirconium nitride (ZrN) coatings were deposited on AZ91 magnesium alloy through ion-beam sputtering at 473 K with 0.3, 0.4, 0.5, and 0.6 nitrogen proportions [F(N2)] in ionized gas. X-ray diffraction, profilometry, hardness tests, scanning electron microscopy, and potentiodynamic polarization techniques were used to analyze the structure, thickness, adhesion, microstructure, and corrosion resistance of coated samples, respectively. Results showed that the (111) crystalline orientation dominated in all coatings. Williamson-Hall technique revealed that the crystallite size of ZrN films decreased from 73 to 20 nm with increasing F(N2), and compressive microstrain increased from 0.004 to 0.030. Film thicknesses were inversely correlated with N2 amount and significantly decreased from 1.7 to 0.8 µm. The maximum d P/d r ratio, a dependent factor of adhesion, was 0.04 kg/cm for the film deposited under the F(N2) value of 0.5. The corrosion potential of coated samples was not significantly different from that of uncoated AZ91. Under the F(N2) value of 0.6, corrosion current density slightly decreased from 14 to 9.7 µA/cm2 and significantly increased to 13.5 µA/cm2. Results indicated that ZrN film deposited under the F(N2) value of 0.5 showed high adhesion and corrosion resistance.

Preparation of poly(lactic acid)/sintered hydroxyapatite composite biomaterial by supercritical CO2.

PubMed

Zhang, Yumin; Wang, Jianru; Ma, Yanmiao; Han, Bo; Niu, Xiaojun; Liu, Jianchun; Gao, Lan; Wang, Jue; Zhai, Xiaoyan; Chu, Kaibo; Yang, Liwang

2018-01-01

Based on a kind of sintered hydroxyapatite (HA) with a good cytocompatibility, a series of polylactic acid (PLA) and PLA/HA with the various PLA:HA weight ratio (5:5, 4:6, 3:7, 2:8, 1:9) were fabricated by supercritical CO2. The physical and chemical properties were evaluated by pH, degradation, water absorption, porosity, density, mechanical property, and cytotoxicity respectively. With the increase of HA content, the pH value and porosity increased gradually, while weight loss rate and the density showed a gradual downward trend. Existence of HA can drastically improve the hydroscopicity of PLA scaffolds. The compression strength values slightly increased (p>0.05) from 39.96 MPa of PLA to 45.00 MPa of PLA/HA with the ratio of 7:3, subsequently, the values decreased (p<0.05) from 43.29 MPa (8:2) to 19.00 MPa (9:1). While the modulus of elasticity decreased (p<0.05) from 5.89 to 1.84 GPa with increasing HA content. The PLA/HA (8:2) promoted cell proliferation more significantly than any of other groups (p<0.05). Based on the results, the overall properties of porous scaffolds are the optimal when the weight ratio of PLA/HA is 8:2. Its pH, porosity, density, compression strength, and elasticity modulus are 7.39, 83.0%, 0.60g/cm-3, 34.1 MPa and 2.63 GPa, respectively. SEM observation presented a homogeneous distribution of HA in PLA matrix and a foam-like structure comprising interconnected pores.

Tryptase increase on the first day of hymenoptera venom immunotherapy might be a predictor of future systemic reactions during treatment.

PubMed

Vega-Castro, A; Alonso-Llamazares, A; Cárdenas, R; Beitia, J M; Mateo, B; Alvarez-Twose, I; Blanco, C

2018-03-28

Serum tryptase (ST) decreases in long-term venom immunotherapy (VIT). A circadian tryptase variation with a small decrease has been found after sting challenge. Both findings have been related to successful VIT. Objective: To assess whether variation (increase or decrease) in ST on the first day of VIT is associated with the likehood of future systemic adverse reactions (SAR) during treatment. We prospectively studied patients who underwent cluster VIT and continued it for at least 6 months. ST was measured on the first day of VIT, before the first dose (pre-IT tryptase) and after the last dose (post-IT tryptase). Differences between patients' groups (with and without SAR) were analysed. One hundred and sixty VIT were administered to 150 patients. The median baseline ST value was 4.3 μg/L. A total of 25 VIT (15.6%) were associated with SAR. In 64% of the 25 patients with SAR, post-IT tryptase value was higher than pre-IT tryptase level; the median increment was 19% in these patients. We found a significant relation between this increase in tryptase level on the first day of VIT and future SAR (risk ratio 7.6). This elevation was independent of the VIT scheduled day and severity of the SAR, as well as of the basal ST value. A slight increase in tryptase on the first day of VIT is an independent variable strongly related to a high risk of future SAR. This simple biomarker could be helpful to improve patients´ safety.

Fearing Colleges Slight "Traditional Values," Conservatives Back "Free Enterprise" Chairs.

ERIC Educational Resources Information Center

Evangelauf, Jean

1987-01-01

In the last 25 years, 80 to 100 chairs or institutes focusing on the study of capitalism have been established on college campuses, sometimes facing criticism because of potential conflict with the institution's mission. (MSE)

CMV blood test

MedlinePlus

CMV antibody tests ... never been infected with CMV have no detectable antibodies to CMV. Normal value ranges may vary slightly ... The presence of antibodies to CMV indicates a current or past ... CMV. If the number of antibodies (called the antibody titer) ...

Aspartate aminotransferase (AST) blood test

MedlinePlus

The normal range is 10 to 34 U/L (0.17 to 0.57 µkat/L). Normal value ranges may vary slightly among different laboratories. Some labs use different measurements or may test different samples. Talk to your health ...

[The study of the colorimetric characteristics of the cobalt-chrome alloys abutments covered by four different all-ceramic crowns by using dental spectrophotometer].

PubMed

Chen, Yifan; Liu, Hongchun; Meng, Yukun; Chao, Yonglie; Liu, Changhong

2015-06-01

This study aims to evaluate the optical data of the different sites of the cobalt-chrome (Co-Cr) alloy abutments covered by four different all-ceramic crowns and the color difference between the crowns and target tab using a digital dental spectrophotometer. Ten Co-Cr alloy abutments were made and tried in four different groups of all-ceramic crowns, namely, Procera aluminia, Procera zirconia, Lava zirconia (Lava-Zir), and IPS E.max glass-ceramic lithium disilicate-reinforced monolithic. The color data of the cervical, body, and incisal sites of the samples were recorded and analyzed by dental spectrophotometer. The CIE L*, a*, b* values were again measured after veneering. The color difference between the abutments covered by all-ceramic crowns and A2 dentine shade tab was evaluated. The L* and b* values of the abutments can be increased by all of the four groups of all-ceramic copings, but a* values were decreased in most groups. A statistical difference was observed among four groups. After being veneered, the L* values of all the copings declined slightly, and the values of a*, b* increased significantly. When compared with A2 dentine shade tab, the ΔE of the crowns was below 4. Four ceramic copings were demonstrated to promote the lightness and hue of the alloy abutments effecttively. Though the colorimetric baseline of these copings was uneven, veneer porcelain can efficiently decrease the color difference between the samples and thee target.

Peak insertion torque values of five mini-implant systems under different insertion loads.

PubMed

Quraishi, Erma; Sherriff, Martyn; Bister, Dirk

2014-06-01

To assess the effect of 1 and 3 kg insertion load on five makes of self-drilling mini-implants on peak insertion torque values to establish risk factors involved in the fracture of mini-implants. Two different loads were applied during insertion of 40 mini-implants from five different manufacturers (Dual Top(™) (1·6×8 mm), Infinitas(™) (1·5×9 mm), Ortho Easy(™) (1·7×8 mm), Spider Screw(™) (1·5×8 mm) and Vector TAS(™) (1·4×8 mm)) into acrylic blocks at 8 rev/min utilizing a Motorized Torque Measurement Stand. Peak insertion torque values for both loads were highest for Vector TAS followed by Ortho Easy and Dual Top and were nearly three times higher than Infinitas (original version) and Spider Screws(TM). The log-rank test showed statistically significant differences for both loads for Vector TAS, Ortho Easy and Spider Screws. Unlike other designs tested, both tapered mini-implant designs (Spider Screw and Infinitas) showed a tendency to buckle in the middle of the body but fractured at the tip. Non-tapered mini-implants fractured at significantly higher torque values compared to tapered designs under both loads. Increased pressure resulted in slightly higher maximum torque values at fracture for some of the mini-implant designs, although this is unlikely to be of clinical relevance. Tripling insertion pressure from 1 to 3 kg increased the risk of bending tapered mini-implants before fracture. © 2014 British Orthodontic Society.

Slight Fermentation with Lactobacillus fermentium Improves the Taste (Sugar:Acid Ratio) of Citrus (Citrus reticulata cv. chachiensis) Juice.

PubMed

Yu, Yuanshan; Xiao, Gengsheng; Xu, Yujuan; Wu, Jijun; Fu, Manqin; Wen, Jing

2015-11-01

The aim of this study was to evaluate the hypothesis that fermentation with Lactobacillus fermentium, which can metabolize citric acid, could be applied in improving the taste (sugar:acid ratio) of citrus juice. During fermentation, the strain of L. fermentium can preferentially utilize citric acid of citrus (Citrus reticulata cv. Chachiensis) juice to support the growth without the consumption of sugar. After 6 h of fermentation with L. fermentium at 30 °C, the sugar:acid ratio of citrus juice increased to 22:1 from 12:1, which resulted in that the hedonic scores of sweetness, acidity and overall acceptability of fermented-pasteurized citrus juice were higher than the unfermented-pasteurized citrus juice. Compared with unfermented-pasteurized citrus juice, the ORAC value and total amino acid showed a reduction, and no significant change (P > 0.05) in the L*, a*, b*, total soluble phenolics and ascorbic acid (Vc) content in the fermented-pasteurized citrus juice was observed as compared with unfermented-pasteurized citrus juice. Hence, slight fermentation with L. fermentium can be used for improving the taste (sugar:acid ratio) of citrus juice with the well retaining of quality. © 2015 Institute of Food Technologists®

Local Lunar Gravity Field Analysis over the South Pole-aitken Basin from SELENE Farside Tracking Data

NASA Technical Reports Server (NTRS)

Goossens, Sander Johannes; Ishihara, Yoshiaki; Matsumoto, Koji; Sasaki, Sho

2012-01-01

We present a method with which we determined the local lunar gravity field model over the South Pole-Aitken (SPA) basin on the farside of the Moon by estimating adjustments to a global lunar gravity field model using SELENE tracking data. Our adjustments are expressed in localized functions concentrated over the SPA region in a spherical cap with a radius of 45deg centered at (191.1 deg E, 53.2 deg S), and the resolution is equivalent to a 150th degree and order spherical harmonics expansion. The new solution over SPA was used in several applications of geophysical analysis. It shows an increased correlation with high-resolution lunar topography in the frequency band l = 40-70, and admittance values are slightly different and more leveled when compared to other, global gravity field models using the same data. The adjustments expressed in free-air anomalies and differences in Bouguer anomalies between the local solution and the a priori global solution correlate with topographic surface features. The Moho structure beneath the SPA basin is slightly modified in our solution, most notably at the southern rim of the Apollo basin and around the Zeeman crater

Historical Records and Source Apportionment of Polycyclic Aromatic Hydrocarbons Over the Past 100 Years in Dianchi Lake, a Plateau Lake in Southwest China.

PubMed

Ma, Xiaohua; Han, Xiuxiu; Jiang, Quanliang; Huang, Changchun; Huang, Tao; Yang, Hao; Yao, Ling

2018-04-12

Two sediment cores were collected from Dianchi Lake, a plateau lake in Southwest China, to study the temporal trends and to investigate the sources of sedimentary deposited polycyclic aromatic hydrocarbon. The ΣPAH16 concentration in the two sediment cores ranged from 172.5 to 2244.8 ng/g and from 211.4 to 1777.8 ng/g, with mean values of 1106.2 and 865.1 ng/g, respectively. Three temporal trends for the ΣPAH16 concentration and the composition of PAHs in Dianchi Lake all showed three typical changing stages: (1) slight changes in deeper segments before the 1950s; (2) a rapid increase in PAH concentrations between the 1960s and 1990s; and (3) a slight reduction from the 1990s onward. These trends differ from those observed in developed countries due to differences in the timing of industrialization and urbanization processes. According to the results of the molecular ratios and principal component analysis, the PAH deposition was dominated by coal combustion, wood combustion, and vehicle emissions before and after the 1960s, respectively.

Undergraduate Research Program in Atmospheric Science: Houston Ozone Studies

NASA Astrophysics Data System (ADS)

Morris, P. A.; Balimuttajjo, M.; Damon, D.; Herridge, A.; Hromis, A. G.; Litwin, D.; Wright, J. M.

2011-12-01

The Minority University Consortium for Earth and Space Sciences (MUCESS) composed of the University of Houston-Downtown (UHD), Medgar Evers College (City University of New York), South Carolina State University, is an undergraduate atmospheric science program funded by NSF. The program's goal is to increase the participation of minority universities in STEM activities and careers by providing students with the knowledge and skills needed to perform weather balloon launches, interpret ozone and temperature variations in the troposphere and stratosphere. Ozone profiles up to 30 km altitude are obtained via an instrument payload attached to a weather balloon. The payload instrumentation consists of an EN-SCI ECC ozonesonde and an iMET radiosonde. The data is transmitted to a base station in real time and includes pressure, temperature, humidity, and GPS coordinates This presentation is directed towards comparing our 2011 Houston data to data that either UHD or the University of Houston (UH) has collected. Our launches are primarily on Sunday, and UH's on Friday. Our primary objective is to identify ground level ozone variations on Sunday and compare with weekday levels as tropospheric ozone is largely controlled by anthropogenic activities. Ozone levels vary depending on the time of year, temperature, rain, wind direction, chemical plant activities, private and commercial traffic patterns.etc. Our limited Friday launches, supported by UH data, indicate that ground level ozone is generally elevated in contrast to Sunday data, For example, our Friday July 2011 launch detected elevated low-altitude ozone levels with ground level ozone levels of 42 nb that increased to 46 nb from 500 m to 1 km. Other peaks are at 2.7 km (44 nb) and 6km (41 nb), decreasing to 17 nb at the tropopause (12 km). Overall, Sunday low altitude ozone levels are generally lower. Our Sunday ground level ozone data ranges from a low of 25 nb on July 11 to a high of 50 nb on August 1. A combination of wind direction and industrial output variations are likely responsible for the these differences. On July 11, ozone levels decrease slightly from the ground-level values up to 2 km. Above this altitude, significant fluctuations in ozone values ranging from 20 to 40nb occur from 2 to 7 km. These fluctuations inversely correlate with humidity. Relative humidity of 20% corresponding to high ozone and 60% humidity values for low ozone. This probably reflects dilution of ozone with water vapor. In contrast, on August 1 ozone values decrease abruptly at 800 meters to 35 nb with only minor fluctuations with increasing altitude to the tropopause. For both days, the change from ground-level ozone values to the higher altitude patterns correlates with a slight temperature inversion. The Stratospheric ozone also shows a significant contrast on the two days. At 22 km altitude an ozone value of 150 nb is seen on August 1 cf the more typical 110 nb on July 11. The high value seen on August 1 is coincident with a major solar flare. These variations are typical of the range of stratospheric ozone levels seen throughout the year and may be attributable to short-term fluctuations in solar activity.

The effect of increase in dielectric values on specific absorption rate (SAR) in eye and head tissues following 900, 1800 and 2450 MHz radio frequency (RF) exposure

NASA Astrophysics Data System (ADS)

Keshvari, Jafar; Keshvari, Rahim; Lang, Sakari

2006-03-01

Numerous studies have attempted to address the question of the RF energy absorption difference between children and adults using computational methods. They have assumed the same dielectric parameters for child and adult head models in SAR calculations. This has been criticized by many researchers who have stated that child organs are not fully developed, their anatomy is different and also their tissue composition is slightly different with higher water content. Higher water content would affect dielectric values, which in turn would have an effect on RF energy absorption. The objective of this study was to investigate possible variation in specific absorption rate (SAR) in the head region of children and adults by applying the finite-difference time-domain (FDTD) method and using anatomically correct child and adult head models. In the calculations, the conductivity and permittivity of all tissues were increased from 5 to 20% but using otherwise the same exposure conditions. A half-wave dipole antenna was used as an exposure source to minimize the uncertainties of the positioning of a real mobile device and making the simulations easily replicable. Common mobile telephony frequencies of 900, 1800 and 2450 MHz were used in this study. The exposures of ear and eye regions were investigated. The SARs of models with increased dielectric values were compared to the SARs of the models where dielectric values were unchanged. The analyses suggest that increasing the value of dielectric parameters does not necessarily mean that volume-averaged SAR would increase. Under many exposure conditions, specifically at higher frequencies in eye exposure, volume-averaged SAR decreases. An increase of up to 20% in dielectric conductivity or both conductivity and permittivity always caused a SAR variation of less than 20%, usually about 5%, when it was averaged over 1, 5 or 10 g of cubic mass for all models. The thickness and composition of different tissue layers in the exposed regions within the human head play a more significant role in SAR variation compared to the variations (5-20%) of the tissue dielectric parameters.

Variation of b and p values from aftershocks sequences along the Mexican subduction zone and their relation to plate characteristics

NASA Astrophysics Data System (ADS)

Ávila-Barrientos, L.; Zúñiga, F. R.; Rodríguez-Pérez, Q.; Guzmán-Speziale, M.

2015-11-01

Aftershock sequences along the Mexican subduction margin (between coordinates 110ºW and 91ºW) were analyzed by means of the p value from the Omori-Utsu relation and the b value from the Gutenberg-Richter relation. We focused on recent medium to large (Mw > 5.6) events considered susceptible of generating aftershock sequences suitable for analysis. The main goal was to try to find a possible correlation between aftershock parameters and plate characteristics, such as displacement rate, age and segmentation. The subduction regime of Mexico is one of the most active regions of the world with a high frequency of occurrence of medium to large events and plate characteristics change along the subduction margin. Previous studies have observed differences in seismic source characteristics at the subduction regime, which may indicate a difference in rheology and possible segmentation. The results of the analysis of the aftershock sequences indicate a slight tendency for p values to decrease from west to east with increasing of plate age although a statistical significance is undermined by the small number of aftershocks in the sequences, a particular feature distinctive of the region as compared to other world subduction regimes. The b values show an opposite, increasing trend towards the east even though the statistical significance is not enough to warrant the validation of such a trend. A linear regression between both parameters provides additional support for the inverse relation. Moreover, we calculated the seismic coupling coefficient, showing a direct relation with the p and b values. While we cannot undoubtedly confirm the hypothesis that aftershock generation depends on certain tectonic characteristics (age, thickness, temperature), our results do not reject it thus encouraging further study into this question.

Survey of radiation belt energetic electron pitch angle distributions based on the Van Allen Probes MagEIS measurements: Electron Pitch Angle Distributions

DOE PAGES

Shi, Run; Summers, Danny; Ni, Binbin; ...

2016-12-30

A statistical survey of electron pitch angle distributions (PADs) is performed based on the pitch angle-resolved flux observations from the Magnetic Electron Ion Spectrometer (MagEIS) instrument on board the Van Allen Probes during the period from 1 October 2012 to 1 May 2015. By fitting the measured PADs to a sin nα form, where α is the local pitch angle and n is the power law index, we investigate the dependence of PADs on electron kinetic energy, magnetic local time (MLT), the geomagnetic Kp index, and L shell. The difference in electron PADs between the inner and outer belt ismore » distinct. In the outer belt, the common averaged n values are less than 1.5, except for large values of the Kp index and high electron energies. The averaged n values vary considerably with MLT, with a peak in the afternoon sector and an increase with increasing L shell. In the inner belt, the averaged n values are much larger, with a common value greater than 2. The PADs show a slight dependence on MLT, with a weak maximum at noon. A distinct region with steep PADs lies in the outer edge of the inner belt where the electron flux is relatively low. The distance between the inner and outer belt and the intensity of the geomagnetic activity together determine the variation of PADs in the inner belt. Finally, besides being dependent on electron energy, magnetic activity, and L shell, the results show a clear dependence on MLT, with higher n values on the dayside.« less

Effect of heat treatment on mechanical properties of age-hardenable gold alloy at intraoral temperature.

PubMed

Watanabe, I; Watanabe, E; Cai, Z; Okabe, T; Atsuta, M

2001-09-01

The aim of this study was to investigate the effect of various heat treatments on the mechanical properties of gold alloys capable of age-hardening at intraoral temperature. Dumbbell-shaped patterns (ISO 6871) were cast with three gold alloys (Sofard; NC Type-IV; Aurum Cast, NihombashiTokuriki Co.). The Sofard alloy is age-hardenable at intraoral temperature. The castings underwent various heat treatments [as-cast (AC); solution treatment (ST); high-temperature aging (HA); intraoral aging (IA)]. After these heat treatments, ultimate tensile strength (UTS), 0.2% offset yield strength (YS), and elongation (EL) were measured at a strain rate of 1.7x10(-4)/s. Fracture surfaces of the specimens after tensile testing were observed using SEM. Vickers hardness was also measured after heat treating. After IA, the hardness values of the Sofard alloy increased and reached values similar to the hardness of the Sofard specimens aged at high temperature (HA). The hardness values of the NC Type-IV and Aurum Cast specimens slightly increased after IA, but did not reach the values of the specimens after HA. All the Sofard, NC Type-IV and Aurum Cast specimens showed significantly (P<0.05) greater hardness values after HA, compared with the values after any other heat treatments (AC, ST and IA). The UTS and YS of the specimens indicated a tendency similar to the results obtained for hardness. The Sofard specimens with ST showed the greatest elongation compared to the corresponding NC Type-IV and Aurum Cast specimens. However, the elongation of the Sofard specimens was abruptly reduced after intraoral aging. Intraoral aging significantly improved the mechanical properties and hardness of the Sofard alloy.

Survey of radiation belt energetic electron pitch angle distributions based on the Van Allen Probes MagEIS measurements: Electron Pitch Angle Distributions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Run; Summers, Danny; Ni, Binbin

A statistical survey of electron pitch angle distributions (PADs) is performed based on the pitch angle-resolved flux observations from the Magnetic Electron Ion Spectrometer (MagEIS) instrument on board the Van Allen Probes during the period from 1 October 2012 to 1 May 2015. By fitting the measured PADs to a sin nα form, where α is the local pitch angle and n is the power law index, we investigate the dependence of PADs on electron kinetic energy, magnetic local time (MLT), the geomagnetic Kp index, and L shell. The difference in electron PADs between the inner and outer belt ismore » distinct. In the outer belt, the common averaged n values are less than 1.5, except for large values of the Kp index and high electron energies. The averaged n values vary considerably with MLT, with a peak in the afternoon sector and an increase with increasing L shell. In the inner belt, the averaged n values are much larger, with a common value greater than 2. The PADs show a slight dependence on MLT, with a weak maximum at noon. A distinct region with steep PADs lies in the outer edge of the inner belt where the electron flux is relatively low. The distance between the inner and outer belt and the intensity of the geomagnetic activity together determine the variation of PADs in the inner belt. Finally, besides being dependent on electron energy, magnetic activity, and L shell, the results show a clear dependence on MLT, with higher n values on the dayside.« less

Status of alewife and rainbow smelt in U.S. waters of Lake Ontario, 2015

USGS Publications Warehouse

Walsh, Maureen; Weidel, Brian C.; Connerton, Michael J.; Holden, Jeremy P.

2016-01-01

In 2015 the joint USGS and NYSDEC surveys for Alewife and Rainbow Smelt were combined for the first time into a comprehensive spring pelagic prey fish survey. The adult Alewife abundance and weight indices in 2015 increased slightly from 2014 levels, and adult Alewife abundance has remained relatively stable for the past five years. Adult Alewife condition in both spring and fall increased from 2014 values and was above long-term means. Yearling Alewife abundance was the lowest observed in the 38-year time series. Alewife year class strength at age 1 is related to the number of spawning adults and summer temperatures and winter duration in the first year after hatching. Moderate year classes were produced during 2009-2011, and 2012 was the largest year class in the time series. However, severe winters in 2013-2014 and 2014-2015 contributed to two successive very small year classes for the first time in the time series. We expect adult Alewife abundance and biomass to decline in 2016 as older and larger fish decline in the population. The number of spawning adults increased in 2015, summer temperatures were slightly below average, and the anticipated winter duration is below average (i.e., milder winter) for 2015-2016, so these conditions will likely produce a low to moderate year class. A third successive weak year class could be problematic for the Lake Ontario Alewife population and may be of concern to binational lake managers. Rainbow Smelt were also assessed and the population continues to persist at a low and stable level.

Sperm DNA fragmentation induced by cryopreservation: new insights and effect of a natural extract from Opuntia ficus-indica.

PubMed

Meamar, Mehrdad; Zribi, Nassira; Cambi, Marta; Tamburrino, Lara; Marchiani, Sara; Filimberti, Erminio; Fino, Maria Grazia; Biggeri, Annibale; Menezo, Yves; Forti, Gianni; Baldi, Elisabetta; Muratori, Monica

2012-08-01

To analyze the effect of cryopreservation on sperm DNA fragmentation (SDF) in two cytometric sperm populations, PI(brighter) and PI(dimmer), and to test the effects of Opuntia ficus-indica (OFI) extracts, which contain antioxidants and flavanoids, and of resveratrol on cryopreservation of human semen. In vitro prospective study. Institutional study. Twenty-one normozoospermic men undergoing semen analysis for couple infertility. Cryopreservation using the routine method in the presence of OFI extracts or resveratrol. Measurement of SDF by TUNEL/PI flow cytometric method to evaluate sperm motility (by automated motion analysis, CASA system) and viability (by eosin/nigrosin staining) in the two populations of sperm PI(br) and PI(dim). Cryopreservation induced an increase of SDF only in the PI(br) sperm population. The increase was negatively dependent on the basal values of SDF in the same population. Addition of OFI extracts and resveratrol to the cryopreservation medium slightly but statistically significantly reduced SDF in the PI(br) population without affecting the deleterious effect of cryopreservation on sperm motion parameters or viability. The increase of SDF in the PI(br) population, which is unrelated to semen quality, suggests that caution must be taken in using cryopreserved semen, as morphologically normal and motile sperm may be damaged. The addition of substances with multifunctional properties such as OFI extracts to cryopreservation medium is only slightly effective in preventing the dramatic effects on SDF. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Changes to anti-JCV antibody levels in a Swedish national MS cohort

PubMed Central

Warnke, Clemens; Ramanujam, Ryan; Plavina, Tatiana; Bergström, Tomas; Goelz, Susan; Subramanyam, Meena; Kockum, Ingrid; Rahbar, Afsar; Kieseier, Bernd C; Holmén, Carolina; Olsson, Tomas; Hillert, Jan; Fogdell-Hahn, Anna

2013-01-01

Background The anti-JC virus (JCV) antibody status has been introduced to stratify patients with multiple sclerosis (MS) for higher or lower risk of progressive multifocal leukoencephalopathy (PML). Objective To assess the potential utility of anti-JCV antibody levels for earlier diagnosis or prediction of PML. Methods An analytically validated antibody assay was used to determine serological status, normalised optical density values, and dilution titres for anti-JCV antibodies. The method was applied to stored sera of 1157 patients with MS including five cases of PML, all enrolled in the Swedish pharmacovigilance study for natalizumab (NAT). Anticytomegalovirus (CMV) and antivaricella-zoster (VZV) antibody levels served as controls. Results Prior to treatment with NAT, anti-JCV antibody levels were stable in the anti-JCV positive patients. During therapy, a slight decrease in anti-JCV and anti-VZV antibody levels, but not anti-CMV antibody levels, was observed. All five patients who developed PML showed a mild to moderate increase in anti-JCV antibody levels at time of PML diagnosis; pre-PML samples suggested that this increase might start already prior to diagnosis of PML. Conclusions Treatment initiation with NAT may lead to a slight decrease in anti-JCV and anti-VZV antibody levels, suggestive of a mild suppressive effect of NAT on antibody levels. Our findings in five cases of PML demonstrate that the onset of PML can be accompanied by increasing anti-JCV antibodies in serum. Monitoring of anti-JCV antibody levels could potentially be used as a tool for prediction or earlier diagnosis of PML during NAT treatment for MS. Further studies are warranted. PMID:23463870

Changes to anti-JCV antibody levels in a Swedish national MS cohort.

PubMed

Warnke, Clemens; Ramanujam, Ryan; Plavina, Tatiana; Bergström, Tomas; Goelz, Susan; Subramanyam, Meena; Kockum, Ingrid; Rahbar, Afsar; Kieseier, Bernd C; Holmén, Carolina; Olsson, Tomas; Hillert, Jan; Fogdell-Hahn, Anna

2013-11-01

The anti-JC virus (JCV) antibody status has been introduced to stratify patients with multiple sclerosis (MS) for higher or lower risk of progressive multifocal leukoencephalopathy (PML). To assess the potential utility of anti-JCV antibody levels for earlier diagnosis or prediction of PML. An analytically validated antibody assay was used to determine serological status, normalised optical density values, and dilution titres for anti-JCV antibodies. The method was applied to stored sera of 1157 patients with MS including five cases of PML, all enrolled in the Swedish pharmacovigilance study for natalizumab (NAT). Anticytomegalovirus (CMV) and antivaricella-zoster (VZV) antibody levels served as controls. Prior to treatment with NAT, anti-JCV antibody levels were stable in the anti-JCV positive patients. During therapy, a slight decrease in anti-JCV and anti-VZV antibody levels, but not anti-CMV antibody levels, was observed. All five patients who developed PML showed a mild to moderate increase in anti-JCV antibody levels at time of PML diagnosis; pre-PML samples suggested that this increase might start already prior to diagnosis of PML. Treatment initiation with NAT may lead to a slight decrease in anti-JCV and anti-VZV antibody levels, suggestive of a mild suppressive effect of NAT on antibody levels. Our findings in five cases of PML demonstrate that the onset of PML can be accompanied by increasing anti-JCV antibodies in serum. Monitoring of anti-JCV antibody levels could potentially be used as a tool for prediction or earlier diagnosis of PML during NAT treatment for MS. Further studies are warranted.

[Effect of ambulatory supervised cardiac training on arterial hypertension in patients with coronary artery disease and arterial hypertension].

PubMed

Kałka, Dariusz; Sobieszczańska, Małgorzata; Marciniak, Wojciech; Popielewicz-Kautz, Aleksandra; Markuszewski, Leszek; Chorebała, Arkadiusz; Korzeniowska, Joanna; Janczak, Jacek; Adamus, Jerzy

2007-01-01

Arterial hypertension is one of the most common health problems occurring in highly developed countries. It was proved that long-term and regular physical activity results in hypotensive effect. A goal of the present study was to assess an influence of six-month ambulatory cardiac rehabilitation on arterial pressure level in patients with coronary artery disease and hypertension as well as analysis of correlation between pressure values alterations and intensity of cardiac training. A study group comprised 103 patients (mean age: 61.2 +/- 0.8 years) manifesting coronary artery disease accompanied by arterial hypertension. A control group constituted 39 normotensive patients with coronary artery disease (mean age: 59.4 +/- 1.3 years). The both observed groups differ from each other only with values of left ventricle mass index and drug regimen established at least three months prior to the follow-up onset. During the rehabilitation cycle, no treatment corrections were made and no new preparations were added. The all patients were enrolled to the six-month cardiac rehabilitation program. The program comprised 45-minute training with cycle ergometer, three times a week, and generally improving gym exercises, two times a week. The analyses concerned systolic and diastolic pressure values, measured just before each training (resting pressure) and just after peak exercise interval (peak pressure), at the beginning and at the end of the rehabilitation cycle. At the initial stage, the patient group with hypertension demonstrated the higher pressure values (resting and peak), as compared with the control group. Cardiac rehabilitation performed in the examined patients caused a statistically significant reduction of the mean resting pressure, both systolic (p < 0.01) and diastolic (p < 0.01). As to the mean peak pressure in this group, systolic diminished slightly (NS), but diastolic was reduced significantly (p < 0.01). In the control group, after six-month rehabilitation the values appeared to be lowered insignificantly in relation to systolic and diastolic resting pressure, likewise diastolic peak pressure, and contrarily systolic peak pressure increased slightly. Assessing an interrelation between the final outcome of the rehabilitation program, expressed as delta of arterial pressure, and terminal training workload and delta of training workload, only for delta of systolic pressure and final training workload, a positive correlation of statistical significance was found out, which is considered an implication of physiological reaction against an increase of training workload. Long-term and regular cardiac training induced the larger alterations of pressure values in the patients with hypertension, as compared with the normotensive patients. A positive effect of cardiac rehabilitation on arterial pressure level in the hypertensive patients was found to be independent of the training intensity.

Gram staining of protected pulmonary specimens in the early diagnosis of ventilator-associated pneumonia.

PubMed

Mimoz, O; Karim, A; Mazoit, J X; Edouard, A; Leprince, S; Nordmann, P

2000-11-01

We evaluated prospectively the use of Gram staining of protected pulmonary specimens to allow the early diagnosis of ventilator-associated pneumonia (VAP), compared with the use of 60 bronchoscopic protected specimen brushes (PSB) and 126 blinded plugged telescopic catheters (PTC) obtained from 134 patients. Gram stains were from Cytospin slides; they were studied for the presence of microorganisms in 10 and 50 fields by two independent observers and classified according to their Gram stain morphology. Quantitative cultures were performed after serial dilution and plating on appropriate culture medium. A final diagnosis of VAP, based on a culture of > or = 10(3) c.f.u. ml-1, was established after 81 (44%) samplings. When 10 fields were analysed, a strong relationship was found between the presence of bacteria on Gram staining and the final diagnosis of VAP (for PSB and PTC respectively: sensitivity 74 and 81%, specificity 94 and 100%, positive predictive value 91 and 100%, negative predictive value 82 and 88%). The correlation was less when we compared the morphology of microorganisms observed on Gram staining with those of bacteria obtained from quantitative cultures (for PSB and PTC respectively: sensitivity 54 and 69%, specificity 86 and 89%, positive predictive value 72 and 78%, negative predictive value 74 and 84%). Increasing the number of fields read to 50 was associated with a slight decrease in specificity and positive predictive value of Gram staining, but with a small increase in its sensitivity and negative predictive value. The results obtained by the two observers were similar to each other for both numbers of fields analysed. Gram staining of protected pulmonary specimens performed on 10 fields predicted the presence of VAP and partially identified (using Gram stain morphology) the microorganisms growing at significant concentrations, and could help in the early choice of the treatment of VAP. Increasing the number of fields read or having the Gram stain analysed by two independent individuals did not improve the results.

Sustainable energy development of bio briquettes based on rice husk blended materials: an alternative energy source

NASA Astrophysics Data System (ADS)

Suryaningsih, S.; Nurhilal, O.

2018-05-01

Rice husk as an abundant waste of biomass up to 21 million tons/year, it is unfortunate if it is not utilized. By converting it into bio briquettes, the value of rice husk bio briquettes in some studies before obtaining a relatively low value of 3,221-3,350 cal/g. The purpose of this research is to increase the calorific value of rice husk bio briquettes by mixing with coconut shell charcoal or corncob charcoal at various composition ratios of 50:50 and 80:20, to reach the optimal value that the industrial sector needed. Carbonization process was carried out at a temperature of 250-350 °C for 1.5 hours. From the results of the proximate analysis test using selected carbonization temperature at 300 °C, it can be seen that the best briquette value is made by mixing rice husk and coconut shell charcoal at composition ratio of 50:50, resulting 47.92% fixed carbon, 8.52% moisture content, 23.40% volatile matter and 20.16% ash content. The highest calorific value of 4,886 cal/g at ratio composition of 50:50, is slightly higher than the East Kalimantan coal standard of 4,828 cal/g. Hence, this bio briquettes are suitable for small scale industry application and household community use.

Stable isotopes composition of precipitation fallen over Cluj-Napoca, Romania, between 2009-2012

DOE Office of Scientific and Technical Information (OSTI.GOV)

Puscas, R.; Feurdean, V.; Simon, V.

2013-11-13

The paper presents the deuterium and oxygen 18 content from All precipitations events, which have occured over Cluj-Napoca, Romania from 2009 until 2012. Time series for δ{sup 2}H and δ{sup 18}O values point out both the seasonal variation that has increased amplitude reflecting the continental character of the local climate as well as dramatic variations of isotopic content of successive precipitation events, emphasizing the anomalous values. These fluctuations are the footprint of the variations and trends in climate events. Local Meteoric Water Line (LMWL), reflecting the δ{sup 2}H - δ{sup 18}O correlation, has the slop and the intercept slightly deviatedmore » from the GMWL, indicating that the dominant process affecting local precipitations are close to the equilibrium condition. LMWL has a slope smaller then that of the GMWL in the warm season due to lower humidity and a slope closest to the slop of GMWL in cold season with high humidity. The δ{sup 2}H and δ{sup 18}O values both for the precipitation events and monthly mean values are positively correlated with the temperature values with a very good correlation factor. The values of δ{sup 2}H and δ{sup 18}O are not correlated with amount of precipitation, the 'amount effect' of isotopic composition of precipitation is not observed for this site.« less

Hardness of the subchondral bone of the patella in the normal state, in chondromalacia, and in osteoarthrosis.

PubMed

Björkström, S; Goldie, I F

1982-06-01

The hardness of bone is its property of withstanding the impact of a penetrating agent. It has been found that articular degenerative changes in, for example, the tibia (knee) are combined with a decrease in the hardness of the subchondral bone. In this investigation the hardness of subchondral bone in chondromalacia and osteoarthrosis of the patella has been analysed and compared with normal subchondral bone. Using an indentation method originally described by Brinell the hardness of the subchondral bone was evaluated in 7 normal patellae, in 20 with chondromalacia and in 33 with osteoarthrosis. A microscopic and microradiographic study of the subchondral bone was carried out simultaneously. Hardness was lowest in the normal material. The mean hardness value beneath the degenerated cartilage differed only slightly from that of the normal material, but the variation of values was increased. The hardness in bone in the chondromalacia area was lower than the hardness in bone covered by surrounding normal cartilage. The mean hardness value in bone beneath normal parts of cartilage in specimens with chondromalacia was higher than the mean hardness value of the normal material. In the microscopic and microradiographic examination it became evident that there was a relationship between trabecular structure and subchondral bone hardness; high values: coarse and solid structure; low values: slender and less regular structure.

Hematological parameters in relation to age, sex and biochemical values for mute swans (Cygnus olor).

PubMed

Dolka, B; Włodarczyk, R; Zbikowski, A; Dolka, I; Szeleszczuk, P; Kluciński, W

2014-06-01

The knowledge of the correct morphological and biochemical parameters in mute swans is an important indicator of their health status, body condition, adaptation to habitat and useful diagnostic tools in veterinary practice and ecological research. The aim of the study was to obtain hematological parameters in relation to age, sex and serum biochemistry values in wild-living mute swans. We found the significant differences in the erythrocyte count, hematocrit, hemoglobin concentration and erythrocyte sedimentation rate in relation to age of mute swans. There were no differences in hematological values between males and females. The leukogram and H/L ratio did not vary by age and sex in swans. Among of biochemical parameters the slightly increased AST, ALP, CK, K, urea, decreased CHOL and TG values were recorded. As far as we know, this is the first study in which the morphometric parameters of blood cells in mute swans were presented. We found extremely low concentration of lead in blood (at subthreshold level). No blood parasites were found in blood smears. The analysis of body mass and biometric parameters revealed a significant differences dependent on age and sex. No differences in the scaled mass index were found. Our results represent a normal hematologic and blood chemistry values and age-sex related changes, as reference values for the mute swan.

Preliminary study of gill NA+,K+-ATPase activity in juvenile spring chinook salmon following electroshock or handling stress

USGS Publications Warehouse

VanderKooi, S.P.; Gale, William L.; Maule, A.G.

2000-01-01

We compared gill Na+,K+-ATPase in subyearling and yearling spring chinook salmon Oncorhynchus tshawytscha 3 h, 24 h, and 7 d after exposure to either a short pulsed DC electroshock (300 V, 50 Hz, 8-ms pulse duration) or an acute handling stress. Mean gill Na+,K+-ATPase values ranged from 7.5 to 11.8 ??mol inorganic phosphate (Pi) ?? (mg protein)-1 ?? h-1. No significant differences were detected, with the exception of electroshocked subyearlings 7 d after treatment. Increased activity was attributed to the presence of two influential values. No significant differences were detected after removal of these observations, so the increase was not considered biologically significant. Inclusion of the outliers did not alter our interpretation of the results given that the observed increase was slight compared with the magnitude of changes reported under experimental conditions and in migrating juvenile salmonids. The treatment groups underwent a typical stress response and had significantly elevated cortisol and glucose levels 3 h after treatment. Recovery to control levels occurred within 24 h for cortisol and from 24 h to 7 d for glucose. Our results lead to the conclusion that neither acute electroshock nor acute handling stress alters Na+,K+-ATPase activity in juvenile spring chinook salmon.

[Spatiotemporal changes of potential evapotranspiration in Songnen Plain of Northeast China].

PubMed

Zhang, Yong-fang; Deng, Jun-li; Guan, De-xin; Jin, Chang-jie; Wang, An-zhi; Wu, Jia-bing; Yuan, Feng-hui

2011-07-01

Based on the daily meteorological data from 72 weather stations from 1961-2003, a quantitative analysis was conducted on the spatiotemporal changes of the potential evapotranspiration in the Plain. The Penman-Monteith model was applied to calculate the potential evapotranspiration; the Mann-Kendall test, accumulative departure curve, and climatic change rate were adopted to analyze the change trend of the evapotranspiration; and the spatial analysis function of ArcGIS was used to detect the spatial distribution of the evapotranspiration. In 1961-2003, the mean annual potential evapotranspiration in the Plain was 330 - 860 mm, and presented an overall decreasing trend, with the high value appeared in southwest region, low value in surrounding areas of southwest region, and a ring-belt increasing southwestward. The climatic change rate of the annual potential evapotranspiration was -0.21 mm x a(-1). The annual potential evapotranspiration was the highest in 1982, the lowest in 1995, and increased thereafter. Seasonally, the climatic change rate of the potential evapotranspiration in spring, summer, autumn, and winter was -0.19, 0.01, -0.05, and 0.03 mm x a(-1), respectively, suggesting that the potential evapotranspiration had a weak increase in winter and summer and a slight decrease in spring and autumn.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iwamoto, Y.; Shin, S.G.; Matsubara, H.

The grain growth behavior of ceramic materials under the existence of a liquid phase was investigated for Si{sub 3}N{sub 4}-Y{sub 2}O{sub 3}-SiO{sub 2}, TiC-Ni, and WC-Co systems. The kinetics of grain growth behavior of these systems closely fitted to the cubic relation of d{sup 3} - d{sub 0}{sup 3} = Kt. The growth rate of {beta}-Si{sub 3}N{sub 4} grain was approximately one order of magnitude larger in length direction than that in width direction. The growth rate slightly increased with increasing liquid phase content in both these directions of the {beta}-Si{sub 3}N{sub 4} grain. TiC-Ni and WC-Co cermets had amore » peak in growth rate at a certain liquid phase content. The rate constant values of these systems were much smaller by a factor of 10{sup 3}{approximately}10{sup 5} compared to the theoretical values expected from the diffusion-controlled growth model. The experimental growth rates tended to decrease with increasing contiguity of the solid phase. The grain growth behavior of these systems could be explained by the mechanism resulting from the existence of contiguous boundaries of solid phase, which suppressed the movement of solid/liquid interfaces during liquid phase sintering.« less

Maximizing the Wildlife Conservation Value of Road Right-of-Ways in an Agriculturally Dominated Landscape

PubMed Central

McCleery, Robert A.; Holdorf, Allison R.; Hubbard, Laura L.; Peer, Brian D.

2015-01-01

There has been a growing recognition that the narrow linear strips of uncultivated vegetation that lie between roads and agricultural crops, referred to as roadside right-of-ways or verges, can serve as areas for the conservation of wildlife. The features of right-of-ways that should influence the composition of wildlife communities vary considerably. Our goal was to determine what features of right-of-ways increased the conservation potential of right-of-ways for wildlife in a grassland system dominated by agricultural production. We sampled 100 right-of-ways for birds and 92 right-of-ways for small mammals in McDonough and Warren Counties in west-central Illinois. We found that the sizes of right-of-ways and the amount of traffic on the adjacent roads synergistically worked to influence wildlife communities. On roads with low traffic, avian species richness increased rapidly with increased right-of-way width, while on roads with high traffic, avian richness increased only slightly with increasing right-of-way widths. We found that wider roadside right-of-ways (preferably across the road from equally wide right-of-ways) with thicker and taller vegetation had the greatest conservation value for birds and small mammals. The features that enhanced the conservation value of right-of-ways in our study area were uncommon. Efforts to create or enhance these features for the benefit of wildlife would likely face numerous obstacles. Nonetheless, from a grassland conservation perspective, working with stakeholders to implement specific strategies to enhance these often neglected areas may be an effective complement to purchasing and restoring conservation lands away from roads. PMID:25794180

[Value of 3T magnetic resonance dynamic contrast-enhanced and diffusion-weighted imaging in differential diagnosis of musculoskeletal tumors].

PubMed

Qi, Zi-hua; Li, Chuan-fu; Ma, Xiang-xing; Yang, Hui; Jiang, Bao-dong; Zhang, Kai; Yu, De-xin

2012-04-01

To evaluate the value of magnetic resonance dynamic contrast-enhanced (MR-DCE) and magnetic resonance diffusion-weighted imaging (MR-DWI) in the differentiation of benign and malignant musculoskeletal tumors. Sixty-three patients with pathologically confirmed musculoskeletal tumors were examined with MR-DCE and MR-DWI. Using single shot spin echo planar imaging sequence and different b values of 400, 600, 800 and 1000 s/mm(2), we obtained the apparent diffusion coefficient (ADC) of the lesions. ADC values were measured before and after MR-DCE, with a b value of 600 s/mm(2). The 3D fast acquired multiple phase enhanced fast spoiled gradient recalled echo sequence was obtained for multi-slice of the entire lesion. The time-signal intensity curve (TIC), dynamic contrast-enhanced parameters, maximum slope of increase (MSI), positive enhancement integral, signal enhancement ratio, and time to peak (T(peak)) were also recorded. ADC showed no significant difference between benign and malignant tumors when the b value was 400, 600, 800, or 1000 s/mm(2), and it was not significantly different between benign and malignant tumors in both pre-MR-DCE and post-MR-DCE with b value of 600 s/mm(2). TIC were classified into four types type1 showed rapid progression and gradual drainage; type2 showed rapid progression but had no or slight progression; type 3 showed gradual progression; and type 4 had no or slight progression. Most lesions of type1 or type2 were malignant, whereas most lesions of type 3 or type 4 were benign. When using type1 and type 2 as the standards of malignancy, the diagnostic sensitivity and specificity was 87.23% and 50.00%, respectively. The types of TIC showed significant difference between benign and malignant musculoskeletal tumors(χ(2)=17.009,P=0.001). When using MSI 366.62 ± 174.84 as the standard of malignancy, the diagnostic sensitivity and specificity was 86.78% and 78.67%, respectively. When using T(peak)≤70s as the standard of malignancy, the diagnostic sensitivity and specificity was 82.89%and 85.78%, respectively. Positive enhancement integral and signal enhancement ratio showed no significant difference between benign and malignant musculoskeletal tumors. TIC, MSI and T(peak) of MR-DCE are valuable in differentiating benign from malignant musculoskeletal tumors. T(peak) has the highest diagnostic specificity, and TIC has the highest diagnostic sensitivity. The mean ADC value are no significant difference between benign and malignant tumors.

Comparing salt tolerance of beet cultivars and their halophytic ancestor: consequences of domestication and breeding programmes

PubMed Central

Rozema, Jelte; Cornelisse, Danny; Zhang, Yuancheng; Li, Hongxiu; Bruning, Bas; Katschnig, Diana; Broekman, Rob; Ji, Bin; van Bodegom, Peter

2015-01-01

Salt tolerance of higher plants is determined by a complex set of traits, the timing and rate of evolution of which are largely unknown. We compared the salt tolerance of cultivars of sugar beet and their ancestor, sea beet, in hydroponic studies and evaluated whether traditional domestication and more recent breeding have changed salt tolerance of the cultivars relative to their ancestor. Our comparison of salt tolerance of crop cultivars is based on values of the relative growth rate (RGR) of the entire plant at various salinity levels. We found considerable salt tolerance of the sea beet and slightly, but significantly, reduced salt tolerance of the sugar beet cultivars. This indicates that traditional domestication by selection for morphological traits such as leaf size, beet shape and size, enhanced productivity, sugar content and palatability slightly affected salt tolerance of sugar beet cultivars. Salt tolerance among four sugar beet cultivars, three of which have been claimed to be salt tolerant, did not differ. We analysed the components of RGR to understand the mechanism of salt tolerance at the whole-plant level. The growth rate reduction at higher salinity was linked with reduced leaf area at the whole-plant level (leaf area ratio) and at the individual leaf level (specific leaf area). The leaf weight fraction was not affected by increased salinity. On the other hand, succulence and leaf thickness and the net assimilation per unit of leaf area (unit leaf rate) increased in response to salt treatment, thus partially counteracting reduced capture of light by lower leaf area. This compensatory mechanism may form part of the salt tolerance mechanism of sea beet and the four studied sugar beet cultivars. Together, our results indicate that domestication of the halophytic ancestor sea beet slightly reduced salt tolerance and that breeding for improved salt tolerance of sugar beet cultivars has not been effective. PMID:25492122

A five year review of paediatric burns and social deprivation: Is there a link?

PubMed

Richards, Helen; Kokocinska, Maria; Lewis, Darren

2017-09-01

To establish if there is a correlation between burn incidence and social deprivation in order to formulate a more effective burns prevention strategy. A quantitative retrospective review of International Burn Injury Database (IBID) was carried out over a period from 2006 to 2011 to obtain data for children referred to our burns centre in West Midlands. Social deprivation scores for geographical areas were obtained from Office of National Statistics (ONS). Statistical analysis was carried out using Graphpad Prism. 1688 children were reviewed at our burns centre. Statistical analysis using Pearson correlation coefficient showed a slight association between social deprivation and increasing burn incidence r 2 =0.1268, 95% confidence interval 0.018-0.219, p value<0.0001. There was a slight male preponderance (58%). The most common mechanism of injury was scalding (61%). The most commonly affected age group were 1-2 year olds (38%). There were statistically significant differences in the ethnicity of children with significantly more children from Asian and African backgrounds being referred compared to Caucasian children. We found that appropriate first aid was administered in 67% of cases overall. We did not find a statistically significant link between first aid provision and social deprivation score. There was only a slight positive correlation between social deprivation and burn incidence. However, there did not seem to be any change in mechanism of burn in the most deprived groups compared to overall pattern, nor was there a significant difference in appropriate first aid provision. It would seem that dissemination of burn prevention strategies and first aid advice need to be improved across all geographical areas as this was uniformly lacking and the increased burn incidence in more socially deprived groups, although present, was not statistically significant. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

Effect of simulated climate warming on the morphological and physiological traits of Elsholtzia haichowensis in copper contaminated soil.

PubMed

Guan, Ming; Jin, Zexin; Li, Junmin; Pan, Xiaocui; Wang, Suizi; Li, Yuelin

2016-01-01

The aim of this study was to investigate the effects of temperature and Cu on the morphological and physiological traits of Elsholtzia haichowensis grown in soils amended with four Cu concentrations (0, 50, 500, and 1000 mg kg(-1)) under ambient temperature and slight warming. At the same Cu concentration, the height, shoot dry weight, total plant dry weight, and root morphological parameters such as length, surface area and tip number of E. haichowensis increased due to the slight warming. The net photosynthetic rate, stomatal conductance, transpiration, light use efficiency were also higher under the slight warming than under ambient temperature. The increased Cu concentrations, total Cu uptake, bioaccumulation factors and tolerance indexes of shoots and roots were also observed at the slight warming. The shoot dry weight, root dry weight, total plant dry weight and the bioaccumulation factors of shoots and roots at 50 mg Cu kg(-1) were significantly higher than those at 500 and 1000 mg Cu kg(-1) under the slight warming. Therefore, the climate warming may improve the ability of E. haichowensis to phytoremediate Cu-contaminated soil, and the ability improvement greatly depended on the Cu concentrations in soils.

Algorithm 699 - A new representation of Patterson's quadrature formulae

NASA Technical Reports Server (NTRS)

Krogh, Fred T.; Van Snyder, W.

1991-01-01

A method is presented to reduce the number of coefficients necessary to represent Patterson's quadrature formulae. It also reduces the amount of storage necessary for storing function values, and produces slightly smaller error in evaluating the formulae.

Calibration of sea ice dynamic parameters in an ocean-sea ice model using an ensemble Kalman filter

NASA Astrophysics Data System (ADS)

Massonnet, F.; Goosse, H.; Fichefet, T.; Counillon, F.

2014-07-01

The choice of parameter values is crucial in the course of sea ice model development, since parameters largely affect the modeled mean sea ice state. Manual tuning of parameters will soon become impractical, as sea ice models will likely include more parameters to calibrate, leading to an exponential increase of the number of possible combinations to test. Objective and automatic methods for parameter calibration are thus progressively called on to replace the traditional heuristic, "trial-and-error" recipes. Here a method for calibration of parameters based on the ensemble Kalman filter is implemented, tested and validated in the ocean-sea ice model NEMO-LIM3. Three dynamic parameters are calibrated: the ice strength parameter P*, the ocean-sea ice drag parameter Cw, and the atmosphere-sea ice drag parameter Ca. In twin, perfect-model experiments, the default parameter values are retrieved within 1 year of simulation. Using 2007-2012 real sea ice drift data, the calibration of the ice strength parameter P* and the oceanic drag parameter Cw improves clearly the Arctic sea ice drift properties. It is found that the estimation of the atmospheric drag Ca is not necessary if P* and Cw are already estimated. The large reduction in the sea ice speed bias with calibrated parameters comes with a slight overestimation of the winter sea ice areal export through Fram Strait and a slight improvement in the sea ice thickness distribution. Overall, the estimation of parameters with the ensemble Kalman filter represents an encouraging alternative to manual tuning for ocean-sea ice models.

Large Decadal Decline of the Arctic Multiyear Ice Cover

NASA Technical Reports Server (NTRS)

Comiso, Josefino C.

2012-01-01

The perennial ice area was drastically reduced to 38% of its climatological average in 2007 but recovered slightly in 2008, 2009, and 2010 with the areas being 10%, 24%, and 11% higher than in 2007, respectively. However, trends in extent and area remained strongly negative at -12.2% and -13.5% decade (sup -1), respectively. The thick component of the perennial ice, called multiyear ice, as detected by satellite data during the winters of 1979-2011 was studied, and results reveal that the multiyear ice extent and area are declining at an even more rapid rate of -15.1% and -17.2% decade(sup -1), respectively, with a record low value in 2008 followed by higher values in 2009, 2010, and 2011. Such a high rate in the decline of the thick component of the Arctic ice cover means a reduction in the average ice thickness and an even more vulnerable perennial ice cover. The decline of the multiyear ice area from 2007 to 2008 was not as strong as that of the perennial ice area from 2006 to 2007, suggesting a strong role of second-year ice melt in the latter. The sea ice cover is shown to be strongly correlated with surface temperature, which is increasing at about 3 times the global average in the Arctic but appears weakly correlated with the Arctic Oscillation (AO), which controls the atmospheric circulation in the region. An 8-9-yr cycle is apparent in the multiyear ice record, which could explain, in part, the slight recovery in the last 3 yr.

Effect of the coefficient of friction and tightening speed on the preload induced at the dental implant complex with the finite element method.

PubMed

Bulaqi, Haddad Arabi; Mousavi Mashhadi, Mahmoud; Geramipanah, Farideh; Safari, Hamed; Paknejad, Mojgan

2015-05-01

To prevent screw loosening, a clear understanding of the factors influencing secure preload is necessary. The purpose of this study was to investigate the effect of coefficient of friction and tightening speed on screw tightening based on energy distribution method with exact geometric modeling and finite element analysis. To simulate the proper boundary conditions of the screw tightening process, the supporting bone of an implant was considered. The exact geometry of the implant complex, including the Straumann dental implant, direct crown attachment, and abutment screw were modeled with Solidworks software. Abutment screw/implant and implant/bone interfaces were designed as spiral thread helixes. The screw-tightening process was simulated with Abaqus software, and to achieve the target torque, an angular displacement was applied to the abutment screw head at different coefficients of friction and tightening speeds. The values of torque, preload, energy distribution, elastic energy, and efficiency were obtained at the target torque of 35 Ncm. Additionally, the torque distribution ratio and preload simulated values were compared to theoretically predicted values. Upon reducing the coefficient of friction and enhancing the tightening speed, the angle of turn increased at the target torque. As the angle of turn increased, the elastic energy and preload also increased. Additionally, by increasing the coefficient of friction, the frictional dissipation energy increased but the efficiency decreased, whereas the increase in tightening speed insignificantly affected efficiency. The results of this study indicate that the coefficient of friction is the most influential factor on efficiency. Increasing the tightening speed lowered the response rate to the frictional resistance, thus diminishing the coefficient of friction and slightly increasing the preload. Increasing the tightening speed has the same result as reducing the coefficient of friction. Copyright © 2015 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

Fragmentation, Cost and Environmental Effects of Plaster Stemming Method for Blasting at A Basalt Quarry

NASA Astrophysics Data System (ADS)

Cevizci, Halim

2014-10-01

In this study, the plaster stemming application for blasting at a basalt quarry is studied. Drill cuttings are generally used in open pits and quarries as the most common stemming material since these are most readily available at blast sites. However, dry drill cuttings eject very easily from blastholes without offering much resistance to blast energy. The plaster stemming method has been found to be better than the drill cuttings stemming method due to increased confinement inside the hole and better utilization of blast explosive energy in the rock. The main advantage of the new stemming method is the reduction in the cost of blasting. At a basalt quarry, blasting costs per unit volume of rock were reduced to 15% by increasing burden and spacing distances. In addition, better fragmentation was obtained by using the plaster stemming method. Blast trials showed that plaster stemming produced finer material. In the same blast tests, +30 cm size fragments were reduced to 47.3% of the total, compared to 32.6% in the conventional method of drill cuttings stemming. With this method of stemming, vibration and air shock values increased slightly due to more blast energy being available for rock breakage but generally these increased values were small and stayed under the permitted limit for blast damage criteria unless measuring distance is too close.

[Nutrient contents and microbial populations of aeolian sandy soil in Sanjiangyuan region of Qinghai Province].

PubMed

Lin, Chao-feng; Chen, Zhan-quan; Xue, Quan-hong; Lai, Hang-xian; Chen, Lai-sheng; Zhang, Deng-shan

2007-01-01

Sanjiangyuan region (the headstream of three rivers) in Qinghai Province of China is the highest and largest inland alpine wetland in the world. The study on the nutrient contents and microbial populations of aeolian sandy soils in this region showed that soil organic matter content increased with the evolution of aeolian sand dunes from un-stabilized to stabilized state, being 5.9 and 3.8 times higher in stabilized sand dune than in mobile and semi-stabilized sand dunes, respectively. Soil nitrogen and phosphorus contents increased in line with the amount of organic matter, while potassium content and pH value varied slightly. The microbial populations changed markedly with the development of vegetation, fixing of mobile sand, and increase of soil nutrients. The quantities of soil bacteria, fungi and actinomycetes were 4.0 and 2.8 times, 19.6 and 6.3 times, and 12.4 and 2.6 times higher in stabilized and semi-stabilized sand dunes than in mobile sand dune, respectively, indicating that soil microbial bio-diversity was increased with the evolution of aeolian sand dunes from mobile to stabilized state. In addition, the quantities of soil microbes were closely correlated with the contents of soil organic matter, total nitrogen, and available nitrogen and phosphorus, but not correlated with soil total phosphorus, total and available potassium, or pH value.

Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

NASA Astrophysics Data System (ADS)

Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

2017-11-01

A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

Characterization of color fade during frozen storage of red grapefruit juice concentrates.

PubMed

Lee, Hyoung S; Coates, Gary A

2002-07-03

Color changes in red grapefruit juice concentrates during storage at -23 degrees C for 12 months were studied. Concentrate (38 degrees Brix) was packed in both plastic (16 oz) and metal (6 oz) cans. Decrease in red intensity (CIE a) in juice color and slight increases in CIE L*, b*, and hue values from analysis of reconstituted juices were the characteristic color changes in concentrate during frozen storage. With respect to fresh concentrate, juice color in stored concentrate shifted toward the direction between negative DeltaC* and positive DeltaL*, indicating the color became slightly paler. A color difference seems to exist between the two containers, especially for the magnitude of DeltaE*; color changes were more pronounced in concentrates packed in plastic. There are significant changes (P < 0.05) in major carotenoid pigments (beta-carotene and lycopene) in the concentrates. More than 20% loss of lycopene and about 7% loss of beta-carotene occurred with plastic containers after a 12-month period. Regression analysis showed that the rate of decline was about 0.291 ppm per month (r = 0.990) for lycopene compared to 0.045 ppm (r = 0.817) for beta-carotene in concentrate stored in plastic. In the metal can, the same trends were observed but pigment losses were slightly smaller than those with plastic. An estimated shelf life for lycopene was 26.1 months in the metal can compared to 18 months in plastic. Shelf life for beta-carotene was more than 39 months, more than twice that of lycopene in plastic container.

Histological features of bone marrow in paediatric patients during the asymptomatic phase of early-stage Black African sickle cell anaemia.

PubMed

Mauriello, Alessandro; Giacobbi, Erica; Saggini, Andrea; Isgrò, Antonella; Facchetti, Simone; Anemona, Lucia

2017-04-01

Bone marrow histological features of sickle cell anaemia (SCA) patients during early stages and in the asymptomatic phase of the disease appear an interesting area of study, representing early-stage consequences of SCA with a close relation to its pathophysiology. Unfortunately, this field of research has never been specifically addressed before. Bone marrow biopsies from 26 consecutive Black African SCA patients (M:F=1.6:1; age 2-17 years), free of clinical signs of chronic bone marrow damage, with no recent history of symptomatic vaso-occlusive episodes, and waiting for haematopoietic stem cell transplantation (HSCT), underwent morphological, immunohistochemical and electron microscopy evaluation. Additional comparison with three bone marrow specimens from post-HSCT SCA patients and 10 bone marrow specimens from AS healthy carriers was performed. Bone marrow of SCA patients was normocellular or slighly hypercellular in all cases. Erythroid hyperplasia was a common feature. Myeloid lineage was slightly decreased with normal to slightly diminished neutrophilic granulocytes; CD68 positive monocytic-macrophagic cells appeared slightly increased, with a predominant CD163 positive M2/M(Hb) phenotype. A positive correlation was found between haemoglobin values and number of bone marrow erythroid cells (R 2 =0.15, p=0.05). Intravascular and interstitial clusters of erythroid sickle cells were found in bone marrow of pre-HSCT homozygous SS SCA patients, as well as heterozygous AS healthy carriers, and the single post-HSCT patient matched to an AS health carrier donor. Copyright © 2017 Royal College of Pathologists of Australasia. Published by Elsevier B.V. All rights reserved.

Validation and optimisation of an ICD-10-coded case definition for sepsis using administrative health data

PubMed Central

Jolley, Rachel J; Jetté, Nathalie; Sawka, Keri Jo; Diep, Lucy; Goliath, Jade; Roberts, Derek J; Yipp, Bryan G; Doig, Christopher J

2015-01-01

Objective Administrative health data are important for health services and outcomes research. We optimised and validated in intensive care unit (ICU) patients an International Classification of Disease (ICD)-coded case definition for sepsis, and compared this with an existing definition. We also assessed the definition's performance in non-ICU (ward) patients. Setting and participants All adults (aged ≥18 years) admitted to a multisystem ICU with general medicosurgical ICU care from one of three tertiary care centres in the Calgary region in Alberta, Canada, between 1 January 2009 and 31 December 2012 were included. Research design Patient medical records were randomly selected and linked to the discharge abstract database. In ICU patients, we validated the Canadian Institute for Health Information (CIHI) ICD-10-CA (Canadian Revision)-coded definition for sepsis and severe sepsis against a reference standard medical chart review, and optimised this algorithm through examination of other conditions apparent in sepsis. Measures Sensitivity (Sn), specificity (Sp), positive predictive value (PPV) and negative predictive value (NPV) were calculated. Results Sepsis was present in 604 of 1001 ICU patients (60.4%). The CIHI ICD-10-CA-coded definition for sepsis had Sn (46.4%), Sp (98.7%), PPV (98.2%) and NPV (54.7%); and for severe sepsis had Sn (47.2%), Sp (97.5%), PPV (95.3%) and NPV (63.2%). The optimised ICD-coded algorithm for sepsis increased Sn by 25.5% and NPV by 11.9% with slightly lowered Sp (85.4%) and PPV (88.2%). For severe sepsis both Sn (65.1%) and NPV (70.1%) increased, while Sp (88.2%) and PPV (85.6%) decreased slightly. Conclusions This study demonstrates that sepsis is highly undercoded in administrative data, thus under-ascertaining the true incidence of sepsis. The optimised ICD-coded definition has a higher validity with higher Sn and should be preferentially considered if used for surveillance purposes. PMID:26700284

The velocity, refractive index, and equation of state of liquid ammonia at high temperatures and high pressures.

PubMed

Li, Fangfei; Li, Min; Cui, Qiliang; Cui, Tian; He, Zhi; Zhou, Qiang; Zou, Guangtian

2009-10-07

The high temperature and high pressure Brillouin scattering studies of liquid ammonia have been performed in a diamond anvil cell. Acoustic velocity, refractive index, adiabatic bulk modulus, and the equation of state of liquid ammonia were determined at temperatures up to 410 K and at pressures up to the solidification point. Velocity and refractive index increase smoothly with increasing pressure along isothermals but decrease slightly with the temperature increase. The bulk modulus increases linearly with pressure and its slope dB/dP decreases slightly with increasing temperature from 6.67 at 297 K to 5.94 at 410 K.

The effect of star-spots on the ages of low-mass stars determined from the lithium depletion boundary

NASA Astrophysics Data System (ADS)

Jackson, R. J.; Jeffries, R. D.

2014-12-01

In a coeval group of low-mass stars, the luminosity of the sharp transition between stars that retain their initial lithium and those at slightly higher masses in which Li has been depleted by nuclear reactions, the lithium depletion boundary (LDB), has been advanced as an almost model-independent means of establishing an age scale for young stars. Here, we construct polytropic models of contracting pre-main sequence stars (PMS) that have cool, magnetic star-spots blocking a fraction β of their photospheric flux. Star-spots slow the descent along Hayashi tracks, leading to lower core temperatures and less Li destruction at a given mass and age. The age, τLDB, determined from the luminosity of the LDB, LLDB, is increased by a factor of (1 - β)-E compared to that inferred from unspotted models, where E ≃ 1 + dlog τLDB/dlog LLDB and has a value ˜0.5 at ages <80 Myr, decreasing to ˜0.3 for older stars. Spotted stars have virtually the same relationship between K-band bolometric correction and colour as unspotted stars, so this relationship applies equally to ages inferred from the absolute K magnitude of the LDB. Low-mass PMS stars do have star-spots, but the appropriate value of β is highly uncertain with a probable range of 0.1 < β < 0.4. For the smaller β values, our result suggests a modest systematic increase in LDB ages that is comparable with the maximum levels of theoretical uncertainty previously claimed for the technique. The largest β values would however increase LDB ages by 20-30 per cent and demand a re-evaluation of other age estimation techniques calibrated using LDB ages.

Thermoelectric properties of heavily GaP- and P-doped Si0.95Ge0.05

NASA Astrophysics Data System (ADS)

Yamashita, Osamu

2001-06-01

The Seebeck coefficient S, the electrical resistivity ρ and the thermal conductivity κ of Si0.95Ge0.05 samples doped with 0.4 at. % P and/or 0.5-2.0 mol % GaP, which were prepared by a conventional arc melting method, were measured as functions of GaP content and temperature T in the range from 323 to 1208 K. When multidoped with P and GaP, Ga tends to segregate more strongly with Ge to the grain boundaries than P, while when doped with GaP alone, both P and Ga segregate equally strongly with Ge. For multidoped samples, the S values at 323 K have a minimum at 1.0 mol % GaP and then increase with additional GaP, while the values of ρ and κ decrease monotonically with increasing GaP content. The optimum additional content of GaP that gives the largest thermoelectric figures of merit (ZT=S2T/κρ) for multidoped n-type Si0.95Ge0.05 samples was 1.5 mol %, which is slightly less than the 2.0 mol % of GaP added to Si0.8Ge0.2 alloy by hot pressing. The ZT value for multidoped Si0.95Ge0.05 with an optimum content of GaP increases linearly with temperature, and at 1073 K is 18% higher than that obtained previously for Si0.95Ge0.05 doped with only 0.4 at. % P. At 1173 K the ZT value is 1.16, which corresponds to 95% of that obtained previously at the corresponding temperature for Si0.8Ge0.2 alloy doped with 2.0 mol % GaP.

Biochemical Profiles of Submariners: A Longitudinal Health Study

DTIC Science & Technology

1975-05-15

probability curves . A slight skewing was demonstrated for total calcium, lactic dehydrogenase, alkaline phosphatase, and total protein. Blood urea...values for fasting blood sugar reported by Cutler and as- sociates4 and Craig and Bartholomew2 are essentially identical to our average values of...Longitudinal Health Study examina- tion. Upon reporting for study at 0700, a 7.5-ml vacuum tube without anticoagu- lant was used to obtain blood without

Paleohydrology and paleochemistry of Lake Manitoba, Canada: the isotope and ostracode records

USGS Publications Warehouse

Last, W.M.; Teller, J.T.; Forester, R.M.

1994-01-01

Lake Manitoba, the largest lake in the Prairie region of North America, contains a fine-grained sequence of late Pleistocene and Holocene sediment that documents a complex postglacial history. This record indicates that differential isostatic rebound and changing climate have interacted with varying drainage basin size and hydrologic budget to create significant variations in lake level and limnological conditions. During the initial depositional period in the basin, the Lake Agassiz phase (???12-9 ka), ??18O of ostracodes ranged from -16??? to -5??? (PDB), implying the lake was variously dominated by cold, dilute glacial meltwater and warm to cold, slightly saline water. Candona subtriangulata, which prefers cold, dilute water, dominates the most negative ??18O intervals, when the basin was part of proglacial Lake Agassiz. At times during this early phase, the ??18O of the lake abruptly shifted to higher values; euryhaline taxa such as C. rawsoni or Limnocythere ceriotuberosa, and halobiont taxa such as L. staplini or L. sappaensis are dominant in these intervals. This positive covariance of isotope and ostracode records implies that the lake level episodically fell, isolating the Lake Manitoba basin from the main glacial lake. ??18O values from inorganic endogenic Mg-calcite in the post-Agassiz phase of Lake Manitoba trend from -4??? at 8 ka to -11??? at 4.5 ka. We interpret that this trend indicates a gradually increasing influence of isotopically low (-20??? SMOW) Paleozoic groundwater inflow, although periods of increased evaporation during this time may account for zones of less negative isotopic values. The ??18O of this inorganic calcite abruptly shifts to higher values (-6???) after ???4.5 ka due to the combined effects of increased evaporative enrichment in a closed basin lake and the increased contribution of isotopically high surface water inflow on the hydrologic budget. After ???2 ka, the ??18O of the Mg-calcite fluctuates between -13??? and -7???, implying short-term variability in the lake's hydrologic budget, with values indicating the lake varied from outflow-dominated to evaporation-dominated. The ??13C values of Mg-calcite remain nearly constant from 8 to 4.5 ka and then trend to higher values upward in the section. This pattern suggests primary productivity in the lake was initially constant but gradually increased after 4.5 ka. ?? 1994 Kluwer Academic Publishers.

Influence of ethanol vapor addition on the surface modification of polyethylene in a dielectric barrier discharge

NASA Astrophysics Data System (ADS)

Van Deynse, Annick; Morent, Rino; Leys, Christophe; De Geyter, Nathalie

2017-10-01

In this paper, ethanol vapor up to 50% is added to an argon, air or nitrogen dielectric barrier discharge at medium pressure to profoundly investigate the effect of ethanol addition on the surface modification of low density polyethylene (LDPE). Water contact angle (WCA) and X-ray photoelectron spectroscopy (XPS) measurements show that the ethanol vapor addition effect on the LDPE surface depends on the used carrier gas. Adding ethanol to an argon plasma has no significant effect on the wettability nor on the chemical composition of LDPE compared to a pure argon plasma treatment. Ethanol addition does however slightly increase the LDPE surface roughness. Addition of small amounts of ethanol vapor to an air plasma makes it possible to incorporate additional nitrogen and oxygen groups on the LDPE surface, resulting in an extra decrease of 11% in WCA value. Moreover, the LDPE surface roughness is slightly increased due to the ethanol vapor addition. The most significant effect of ethanol addition is however observed when nitrogen is used as carrier gas. After an N2/2% ethanol plasma treatment, an 85% reduction in WCA value to 8.5° is found compared to a pure N2 plasma treatment. This very hydrophilic LDPE surface is obtained due to a significantly high incorporation of oxygen and nitrogen groups on the surface with an O/C and N/C ratio reaching 32% and 53% respectively. FTIR measurements also reveal that the observed extremely high wettability of LDPE is not the result of plasma activation but is due to plasma polymerization effects occurring on the surface resulting into the deposition of a plasma polymer containing ketones, amides as well as Cdbnd N groups. In addition, ageing studies have also been conducted and these studies reveal that for all carrier gases, ethanol addition to the discharge gas significantly suppresses the ageing effect. All the above mentioned conclusions therefore indicate that ethanol vapor based plasmas can be an excellent tool to increase the surface energy of polymers.

Comparison of Water Vapor Measurements from Ground-based and Space-based GPS Atmospheric Remote Sensing Techniques

NASA Astrophysics Data System (ADS)

Colon-Pagan, Ian; Kuo, Ying-Hwa

2008-10-01

In this study, we compare precipitable water vapor (PWV) values from ground-based GPS water vapor sensing and COSMIC radio occultation (RO) measurements over the Caribbean Sea, Gulf of Mexico, and United States regions as well as global analyses from NCEP and ECMWF models. The results show good overall agreement; however, the PWV values estimated by ground-based GPS receivers tend to have a slight dry bias for low PWV values and a slight wet bias for higher PWV values, when compared with GPS RO measurements and global analyses. An application of a student T-test indicates that there is a significant difference between both ground- and space-based GPS measured datasets. The dry bias associated with space-based GPS is attributed to the missing low altitude data, where the concentration of water vapor is large. The close agreements between space-based and global analyses are due to the fact that these global analyses assimilate space-based GPS RO data from COSMIC, and the retrieval of water vapor profiles from space-based technique requires the use of global analyses as the first guess. This work is supported by UCAR SOARS and a grant from the National Oceanic and Atmospheric Administration, Educational Partnership Program under the cooperative agreement NA06OAR4810187.

Bioindication of human-induced soil degradation in enclosed karst depressions (dolines) using Ellenberg indicator values (Classical Karst, Slovenia).

PubMed

Breg Valjavec, Mateja; Zorn, Matija; Čarni, Andraž

2018-05-29

One of the frequently used bioindication methods is Ellenberg indicator values (EIVs), which are commonly applied in Central Europe as bioindicators of ecological characteristics. However, very few studies have tested EIVs as a bioindication of human-induced soil degradation. We tested the ability of EIVs to distinguish between localities of degraded karst depressions (dolines) and localities of semi-natural (agricultural) soils in preserved dolines on the Kras Plateau (Classical Karst, SW Slovenia). We compared the results of bioindications of soil nutrient content (N), soil reaction (R) and soil moisture (M) with measured soil parameters. Low values of organic carbon, a slightly alkaline soil reaction and low organic sulphur content are chemical indicators of soil degradation in dolines, in comparison with preserved reference dolines (high organic carbon, slightly acid reaction, higher S). EIV reaction is the most reliable plant indicator value that can distinguish between degraded and non-degraded soil plots. According to a regression tree, sulphur (S) and C/N are the most important factors for division on the basis of EIV reaction. By applying the EIV reaction of diagnostic plant species, we significantly improved bioindication of soil degradation, although in the case of EIV nutrients, bioindication was not improved. Copyright © 2018. Published by Elsevier B.V.

Effect of air flow, panel curvature, and internal pressurization on field-incidence transmission loss

NASA Technical Reports Server (NTRS)

Koval, L. R.

1976-01-01

In the context of sound transmission through aircraft fuselage panels, equations for the field-incidence transmission loss (TL) of a single-walled panel are derived that include the effects of external air flow, panel curvature, and internal fuselage pressurization. Flow is shown to provide a modest increase in TL that is uniform with frequency up to the critical frequency. The increase is about 2 dB at Mach number M = 0.5, and about 3.5 dB at M = 1. Above the critical frequency where TL is damping controlled, the increase can be slightly larger at certain frequencies. Curvature is found to stiffen the panel, thereby increasing the TL at low frequencies, but also to introduce a dip at the 'ring frequency' of a full cylinder having the same radius as the panel. Pressurization appears to produce a slight decrease in TL throughout the frequency range, and also slightly shifts the dips at the critical frequency and at the ring frequency.

A research program to reduce interior noise in general aviation airplanes. Influence of depressurization and damping material on the noise reduction characteristics of flat and curved stiffened panels

NASA Technical Reports Server (NTRS)

Navaneethan, R.; Streeter, B.; Koontz, S.; Roskam, J.

1981-01-01

Some 20 x 20 aluminum panels were studied in a frequency range from 20 Hz to 5000 Hz. The noise sources used were a swept sine wave generator and a random noise generator. The effect of noise source was found to be negligible. Increasing the pressure differential across the panel gave better noise reduction below the fundamental resonance frequency due to an increase in stiffness. The largest increase occurred in the first 1 psi pressure differential. The curved, stiffened panel exhibited similar behavior, but with a lower increase of low frequency noise reduction. Depressurization on these panels resulted in decreased noise reduction at higher frequencies. The effect of damping tapes on the overall noise reduction values of the test specimens was small away from the resonance frequency. In the mass-law region, a slight and proportional improvement in noise reduction was observed by adding damping material. Adding sound absorbtion material to a panel with damping material beneficially increased noise reduction at high frequencies.

[Effects of slope gradient on slope runoff and sediment yield under different single rainfall conditions].

PubMed

He, Ji-Jun; Cai, Qiang-Guo; Liu, Song-Bo

2012-05-01

Based on the field observation data of runoff and sediment yield produced by single rainfall events in runoff plots, this paper analyzed the variation patterns of runoff and sediment yield on the slopes with different gradients under different single rainfall conditions. The differences in the rainfall conditions had little effects on the variation patterns of slope runoff with the gradient. Under the conditions of six different rainfall events in the study area, the variation patterns of slope runoff with the gradient were basically the same, i. e., the runoff increased with increasing gradient, but the increment of the runoff decreased slightly with increasing gradient, which was mainly determined by the infiltration flux of atmospheric precipitation. Rainfall condition played an important role on the slope sediment yield. Generally, there existed a critical slope gradient for slope erosion, but the critical gradient was not a fixed value, which varied with rainfall condition. The critical slope gradient for slope erosion increased with increasing slope gradient. When the critical slope gradient was greater, the variation of slope sediment yield with slope gradient always became larger.

The effect of trench width on the behavior of buried rigid pipes

NASA Astrophysics Data System (ADS)

Balkaya, Müge; Saǧlamer, Ahmet

2014-12-01

In this study, in order to determine the effect of trench width (Bd) on the behavior of buried rigid pipes, a concrete pipe having an outside diameter of 150 cm and wall thickness (t) of 15 cm was analyzed using 2D PLAXIS finite element program. In the analyses, three different trench widths (Bd = 2.20 m, 3.40 m, and 4.40 m) were modeled. The results of the analyses indicated that, as the width of the trench increases, the axial force, shear force, bending moment, effective normal stress, and the earth load acting on the pipe increased. The variations of the loads acting on the pipe due to the increasing trench widths were also evaluated using the Marston load theory. When the loads calculated by the Marston Load Theory and the finite element analysis were compared with each other, it was seen that the Marston Load Theory resulted in slightly higher load values than the finite element analysis. On the other hand, for the two methods, the loads acting on the pipe increased with increasing trench width.

Wind-tunnel tests on model wing with Fowler flap and specially developed leading-edge slot

NASA Technical Reports Server (NTRS)

Weick, Fred E; Platt, Robert C

1933-01-01

An investigation was made in the NACA 7 by 10 foot wind tunnel to find the increase in maximum lift coefficient which could be obtained by providing a model wing with both a Fowler trailing-edge extension flap and a Handley Page type leading-edge slot. A conventional Handley page slot proportioned to operate on the plain wing without a flap gave but a slight increase with the flap; so a special form of slot was developed to work more effectively with the flap. With the best combined arrangement the maximum lift coefficient based on the original area was increased from 3.17, for the Fowler wing, to 3.62. The minimum drag coefficient with both devices retracted was increased in approximately the same proportion. Tests were also made with the special-type slot on the plain wing without the flap. The special slot, used either with or without the Fowler flap, gave definitely higher values of the maximum lift coefficient than the slots of conventional form, with an increase of the same order in the minimum drag coefficient.

Fixation of slightly beneficial mutations: effects of life history.

PubMed

Vindenes, Yngvild; Lee, Aline Magdalena; Engen, Steinar; Saether, Bernt-Erik

2010-04-01

Recent studies of rates of evolution have revealed large systematic differences among organisms with different life histories, both within and among taxa. Here, we consider how life history may affect the rate of evolution via its influence on the fixation probability of slightly beneficial mutations. Our approach is based on diffusion modeling for a finite, stage-structured population with stochastic population dynamics. The results, which are verified by computer simulations, demonstrate that even with complex population structure just two demographic parameters are sufficient to give an accurate approximation of the fixation probability of a slightly beneficial mutation. These are the reproductive value of the stage in which the mutation first occurs and the demographic variance of the population. The demographic variance also determines what influence population size has on the fixation probability. This model represents a substantial generalization of earlier models, covering a large range of life histories.

[Application of continuous intra-arterial blood gas monitoring system "Paratrend 7" for pulmonary lavage of a patient with alveolar proteinosis].

PubMed

Harigae, M; Hirose, Y; Gamo, M; Hirose, M; Fujiwara, C; Matsuo, K

1999-03-01

We applied a continuous intra-arterial blood gas monitoring system (Paratrend 7) to a patient with pulmonary alveolar proteinosis during pulmonary lavage. Lavage was performed under general anesthesia with one lung ventilation. We inserted the sensor of Patatrend 7 through a 20 G catheter into the radial artery, and monitored pH, PaCO2 and PaO2 continuously throughout the procedure. SpO2 and EtCO2 were also monitored. Saline 1000-1500 ml was instilled and drained repeatedly by volume limited methods. PaO2 values by Paratrend 7 increased during instillation and decreased during drainage of the irrigating fluid. In contrast, PaCO2 value by Paratrend 7 decreased slightly during instillation and increased during drainage. The change of SpO2 was almost the same as that by Paratrend 7, but the response time of pulse oxymetry was a little quicker than Paratrend 7. During the lavage procedure, respiratory and circulatory condition changed very rapidly, and it is necessary to monitor blood gas change intensively. Paratrend 7 is useful as a perioperative monitoring system, but pulse oxymetry might be sufficient during pulmonary lavage considering its cost.

Simulation of value stream mapping and discrete optimization of energy consumption in modular construction

NASA Astrophysics Data System (ADS)

Chowdhury, Md Mukul

With the increased practice of modularization and prefabrication, the construction industry gained the benefits of quality management, improved completion time, reduced site disruption and vehicular traffic, and improved overall safety and security. Whereas industrialized construction methods, such as modular and manufactured buildings, have evolved over decades, core techniques used in prefabrication plants vary only slightly from those employed in traditional site-built construction. With a focus on energy and cost efficient modular construction, this research presents the development of a simulation, measurement and optimization system for energy consumption in the manufacturing process of modular construction. The system is based on Lean Six Sigma principles and loosely coupled system operation to identify the non-value adding tasks and possible causes of low energy efficiency. The proposed system will also include visualization functions for demonstration of energy consumption in modular construction. The benefits of implementing this system include a reduction in the energy consumption in production cost, decrease of energy cost in the production of lean-modular construction, and increase profit. In addition, the visualization functions will provide detailed information about energy efficiency and operation flexibility in modular construction. A case study is presented to validate the reliability of the system.

The role of pH control on biohydrogen production by single stage hybrid dark- and photo-fermentation.

PubMed

Zagrodnik, R; Laniecki, M

2015-10-01

The role of pH control on biohydrogen production by co-culture of dark-fermentative Clostridium acetobutylicum and photofermentative Rhodobacter sphaeroides was studied. Single stage dark fermentation, photofermentation and hybrid co-culture systems were studied at different values of controlled and uncontrolled pH. Increasing pH during dark fermentation resulted in lower hydrogen production rate (HPR) and longer lag time for both controlled and uncontrolled conditions. However, it only slightly affected cumulative H2 volume. Results have shown that pH control at pH 7.5 increased photofermentative hydrogen production from 0.966 to 2.502 L H2/L(medium) when compared to uncontrolled process. Fixed pH value has proven to be an important control strategy also for the hybrid process and resulted in obtaining balanced co-culture of dark and photofermentative bacteria. Control of pH at 7.0 was found optimum for bacteria cooperation in the co-culture what resulted in obtaining 2.533 L H2/L(medium) and H2 yield of 6.22 mol H2/mol glucose. Copyright © 2015 Elsevier Ltd. All rights reserved.

Rapid and High-Efficiency Laser-Alloying Formation of ZnMgO Nanocrystals

PubMed Central

Liu, Peisheng; Wang, Hao; Chen, Jun; Li, Xiaoming; Zeng, Haibo

2016-01-01

Applications of ZnMgO nanocrystals (NCs), especially in photoelectric detectors, have significant limitations because of the unresolved phase separation in the synthesis process. Here, we propose a rapid and highly efficient ZnMgO NC alloying method based on pulsed laser ablation in liquid. The limit value of homogeneous magnesium (Mg) is pushed from 37% to 62%, and the optical band gap is increased to 3.7 eV with high doping efficiency (>100%). Further investigations on the lattice geometry of ZnMgO NCs indicate that all ZnMgO NCs are hexagonal wurtzite structures, and the (002) and (100) peaks shift to higher diffraction angles with the increase in Mg doping content. The calculated results of the lattice constants a and c slightly decrease based on Bragg’s law and lattice geometry equations. Furthermore, the relationship between annealing temperature and the limit value of homogeneous Mg is examined, and the results reveal that the latter decreases with the former because of the phase separation of MgO. A probable mechanism of zinc magnesium alloy is introduced to expound on the details of the laser-alloying process. PMID:27324296

New insights in morphological analysis for managing activated sludge systems.

PubMed

Oliveira, Pedro; Alliet, Marion; Coufort-Saudejaud, Carole; Frances, Christine

2018-06-01

In activated sludge (AS) process, the impact of the operational parameters on process efficiency is assumed to be correlated with the sludge properties. This study provides a better insight into these interactions by subjecting a laboratory-scale AS system to a sequence of operating condition modifications enabling typical situations of a wastewater treatment plant to be represented. Process performance was assessed and AS floc morphology (size, circularity, convexity, solidity and aspect ratio) was quantified by measuring 100,000 flocs per sample with an automated image analysis technique. Introducing 3D distributions, which combine morphological properties, allowed the identification of a filamentous bulking characterized by a floc population shift towards larger sizes and lower solidity and circularity values. Moreover, a washout phenomenon was characterized by smaller AS flocs and an increase in their solidity. Recycle ratio increase and COD:N ratio decrease both promoted a slight reduction of floc sizes and a constant evolution of circularity and convexity values. The analysis of the volume-based 3D distributions turned out to be a smart tool to combine size and shape data, allowing a deeper understanding of the dynamics of floc structure under process disturbances.

Effect of Ionizing Radiation on the Mechanical and Structural Properties of Graphite Fiber Reinforced Composites. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Wolf, Kay Woodroof

1982-01-01

Graphite/epoxy (T300/5208) and graphite/polyimide composites (C6000/PMR 15) were exposed to various levels of 0.5 MeV electron radiation with the maximum dose being 10,000 Mrad. A three point bending test was used to evaluate the ultimate stress and modulus of the composites. In all composites except transverse samples of C6000/PMR 15 ultimate stress values remained approximately constant or increased slightly. The modulus values remained approximately constant for all composite types regardless of the radiation level. Interfacial aspects of composites were studied. Interlaminar shear tests were performed on T300/5208 and C6000/PMR 15 composites irradiated to 10,000 Mrad. There was an initial increase in interlaminar shear strength (up to 1,000 Mrad) followed by a sharp decrease with further radiation exposure. Using scanning electron microscopy no visual differences in the mode of fracture could be detected between ruptured control samples and those exposed to various levels of radiation. Electron spectroscopy for chemical analysis (ESCA) revealed little change in the surface elements present in control and highly irradiated T300/5208 composite samples.

Re-use of winery wastewaters for biological nutrient removal.

PubMed

Rodríguez, L; Villaseñor, J; Buendía, I M; Fernández, F J

2007-01-01

The aim of this study was to evaluate the feasibility of the re-use of the winery wastewater to enhance the biological nutrient removal (BNR) process. In batch experiments it was observed that the addition of winery wastewater mainly enhanced the nitrogen removal process because of the high denitrification potential (DNP), of about 130 mg N/g COD, of the contained substrates. This value is very similar to that obtained by using pure organic substrates such as acetate. The addition of winery wastewater did not significantly affect either phosphorus or COD removal processes. Based on the experimental results obtained, the optimum dosage to remove each mg of N-NO3 was determined, being a value of 6.7 mg COD/mg N-NO3. Because of the good properties of the winery wastewater to enhance the nitrogen removal, the viability of its continuous addition in an activated sludge pilot-scale plant for BNR was studied. Dosing the winery wastewater to the pilot plant a significant increase in the nitrogen removal was detected, from 58 to 75%. The COD removal was slightly increased, from 89 to 95%, and the phosphorus removal remained constant.

Comparison of CyTOF assays across sites: Results of a six-center pilot study.

PubMed

Leipold, Michael D; Obermoser, Gerlinde; Fenwick, Craig; Kleinstuber, Katja; Rashidi, Narges; McNevin, John P; Nau, Allison N; Wagar, Lisa E; Rozot, Virginie; Davis, Mark M; DeRosa, Stephen; Pantaleo, Giuseppe; Scriba, Thomas J; Walker, Bruce D; Olsen, Lars R; Maecker, Holden T

2018-02-01

For more than five years, high-dimensional mass cytometry has been employed to study immunology. However, these studies have typically been performed in one laboratory on one or few instruments. We present the results of a six-center study using healthy control human peripheral blood mononuclear cells (PBMCs) and commercially available reagents to test the intra-site and inter-site variation of mass cytometers and operators. We used prestained controls generated by the primary center as a reference to compare against samples stained at each individual center. Data were analyzed at the primary center, including investigating the effects of two normalization methods. All six sites performed similarly, with CVs for both Frequency of Parent and median signal intensity (MSI) values<30%. Increased background was seen when using the premixed antibody cocktail aliquots at each site, suggesting that cocktails are best made fresh. Both normalization methods tested performed adequately for normalizing MSI values between centers. Clustering algorithms revealed slight differences between the prestained and the sites-stained samples, due mostly to the increased background of a few antibodies. Therefore, we believe that multicenter mass cytometry assays are feasible. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

Integrated optoelectronic oscillator.

PubMed

Tang, Jian; Hao, Tengfei; Li, Wei; Domenech, David; Baños, Rocio; Muñoz, Pascual; Zhu, Ninghua; Capmany, José; Li, Ming

2018-04-30

With the rapid development of the modern communication systems, radar and wireless services, microwave signal with high-frequency, high-spectral-purity and frequency tunability as well as microwave generator with light weight, compact size, power-efficient and low cost are increasingly demanded. Integrated microwave photonics (IMWP) is regarded as a prospective way to meet these demands by hybridizing the microwave circuits and the photonics circuits on chip. In this article, we propose and experimentally demonstrate an integrated optoelectronic oscillator (IOEO). All of the devices needed in the optoelectronic oscillation loop circuit are monolithically integrated on chip within size of 5×6cm 2 . By tuning the injection current to 44 mA, the output frequency of the proposed IOEO is located at 7.30 GHz with phase noise value of -91 dBc/Hz@1MHz. When the injection current is increased to 65 mA, the output frequency can be changed to 8.87 GHz with phase noise value of -92 dBc/Hz@1MHz. Both of the oscillation frequency can be slightly tuned within 20 MHz around the center oscillation frequency by tuning the injection current. The method about improving the performance of IOEO is carefully discussed at the end of in this article.

Effect of the economic recession on pharmaceutical policy and medicine sales in eight European countries.

PubMed

Leopold, Christine; Mantel-Teeuwisse, Aukje K; Vogler, Sabine; Valkova, Silvia; de Joncheere, Kees; Leufkens, Hubert G M; Wagner, Anita K; Ross-Degnan, Dennis; Laing, Richard

2014-09-01

To identify pharmaceutical policy changes during the economic recession in eight European countries and to determine whether policy measures resulted in lower sales of, and less expenditure on, pharmaceuticals. Information on pharmaceutical policy changes between 2008 and 2011 in eight European countries was obtained from publications and pharmaceutical policy databases. Data on the volume and value of the quarterly sales of products between 2006 and 2011 in the 10 highest-selling therapeutic classes in each country were obtained from a pharmaceutical market research database. We compared these indicators in economically stable countries; Austria, Estonia and Finland, to those in economically less stable countries, Greece, Ireland, Portugal, Slovakia and Spain. Economically stable countries implemented two to seven policy changes each, whereas less stable countries implemented 10 to 22 each. Of the 88 policy changes identified, 33 occurred in 2010 and 40 in 2011. They involved changing out-of-pocket payments for patients in 16 cases, price mark-up schemes in 13 and price cuts in 11. Sales volumes increased moderately in all countries except Greece and Portugal, which experienced slight declines after 2009. Sales values decreased in both groups of countries, but fell more in less stable countries. Less economically stable countries implemented more pharmaceutical policy changes during the recession than economically stable countries. Unexpectedly, pharmaceutical sales volumes increased in almost all countries, whereas sales values declined, especially in less stable countries.

Three-dimensional CTOA and constraint effects during stable tearing in a thin-sheet material

NASA Technical Reports Server (NTRS)

Dawicke, D. S.; Newman, J. C., Jr.; Bigelow, C. A.

1995-01-01

A small strain theory, three-dimensional elastic-plastic finite element analysis was used to simulate fracture in thin sheet 2024-T3 aluminum alloy in the T-L orientation. Both straight and tunneled cracks were modeled. The tunneled crack front shapes as a function of applied stress were obtained from the fracture surface of tested specimens. The stable crack growth behavior was measured at the specimen surface as a function of applied stress. The fracture simulation modeled the crack tunneling and extension as a function of applied stress. The results indicated that the global constraint factor, alpha(sub g), initially dropped during stable crack growth. After peak applied stress was achieved, alpha(sub g) began to increase slightly. The effect of crack front shape on alpha(sub g) was small, but the crack front shape did greatly influence the local constraint and through-thickness crack-tip opening angle (CTOA) behavior. The surface values of CTOA for the tunneled crack front model agreed well with experimental measurements, showing the same initial decrease from high values during the initial 3mm of crack growth at the specimen's surface. At the same time, the interior CTOA values increased from low angles. After the initial stable tearing region, the CTOA was constant through the thickness. The three-dimensional analysis appears to confirm the potential of CTOA as a two-dimensional fracture criterion.

Combined Effect of Surface Roughness and Wake Splitter Plate on the Aerodynamic Characteristics of a Circular Cylinder

NASA Astrophysics Data System (ADS)

Saisanthosh, Iyer; Arunkumar, K.; Ajithkumar, R.; Srikrishnan, A. R.

2017-09-01

This paper is focussed on numerical investigation of flow around a stationary circular cylinder (diameter, D) with selectively applied surface roughness (roughness strips with thickness ‘k’) in the presence of a wake splitter plate (length, L). The plate leading edge is at a distance of ‘G’ from the cylinder base. For this study, the commercial software ANSYS Fluent is used. Fluid considered is water. Study was conducted the following cases (a) plain cylinder (b) cylinder with surface roughness (without splitter plate) (c) Cylinder with splitter plate (without surface roughness) and (d) cylinder with both roughness and splitter plate employed. The study Reynolds number (based on D) is 17,000 and k/δ = 1.25 (in all cases). Results indicate that, for cylinder with splitter plate (no roughness), lift coefficient gradually drops till G/D=1.5 further to which it sharply increases. Whereas, drag coefficient and Strouhal number undergoes slight reduction till G/D=1.0 and thereafter, gradually increase. Circumferential location of strip (α) does not influence the aerodynamic parameters significantly. With roughness alone, drag is magnified by about 1.5 times and lift, by about 2.7 times that of the respective values of the smooth cylinder. With splitter plate, for roughness applied at all ‘α’ values, drag and lift undergoes substantial reduction with the lowest value attained at G/D=1.0.

[Analysis of the 4th generation outer space bred Angelica dahurica by FTIR spectroscopy].

PubMed

Zhu, Yan-ying; Wu, Peng-le; Liu, Mei-yi; Wang, Zhi-zhou; Guo, Xi-hua; Guan, Ying

2012-03-01

The major components of the 4th generation outer space bred angelica and the ground group were determined and analyzed by Fourier transform infrared spectroscopy (FTIR) and second derivative spectrum, considering the large mutation of the plants with space mutagenesis. The results show that the content of the coumarin (1741 cm(-1)), which is the main active components of the space angelica dahurica increased, and the content of the protein (1 459, 1 419 cm(-1)) and the fat (930 cm(-1)) increased slightly, whereas the content of the starch and the dietary fiber reduced drastically. There are obvious differences between the peak values of the second derivative spectra of the plants, revealing that the outer space angelica dahurica contained amine component at 1 279 cm(-1). Space mutation breeding is favor of breeding angelica with better idiosyncrasy.

Low-Cost CdTe/Silicon Tandem Solar Cells

DOE PAGES

Tamboli, Adele C.; Bobela, David C.; Kanevce, Ana; ...

2017-09-06

Achieving higher photovoltaic efficiency in single-junction devices is becoming increasingly difficult, but tandem modules offer the possibility of significant efficiency improvements. By device modeling we show that four-terminal CdTe/Si tandem solar modules offer the prospect of 25%-30% module efficiency, and technoeconomic analysis predicts that these efficiency gains can be realized at costs per Watt that are competitive with CdTe and Si single junction alternatives. The cost per Watt of the modeled tandems is lower than crystalline silicon, but slightly higher than CdTe alone. But, these higher power modules reduce area-related balance of system costs, providing increased value especially in area-constrainedmore » applications. This avenue for high-efficiency photovoltaics enables improved performance on a near-term timeframe, as well as a path to further reduced levelized cost of electricity as module and cell processes continue to advance.« less

The Thermoelectric Properties and Flexural Strength of Nano-TiN/Co4Sb11.3Te0.58Se0.12 Composites Affected by Annealing Treatment

NASA Astrophysics Data System (ADS)

Pengfei, Wen; Pengcheng, Zhai; Shijie, Ding; Bo, Duan; Yao, Li

2017-05-01

This paper is devoted to investigating the thermoelectric properties and flexural strength of the nano-TiN (1 vol.%) dispersed Co4Sb11.3Te0.58Se0.12 composites affected by different thermal annealing treatments at 773 K in a vacuum. After 200 h of annealing treatment, the density of the sample decreases by 4% compared with that before annealing. Moreover, the electrical conductivity and thermal conductivity decline because of the higher porosity in the annealed sample. However, the Seebeck coefficient changes little after annealing. As a result, the ZT value varies slightly after 200 h of annealing. In addition, it is noteworthy that the flexural strength decreases by 16% after 200 h of annealing treatment. Furthermore, the discrete degree of the flexural strength increases with increasing annealing time.

Low-Cost CdTe/Silicon Tandem Solar Cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tamboli, Adele C.; Bobela, David C.; Kanevce, Ana

Achieving higher photovoltaic efficiency in single-junction devices is becoming increasingly difficult, but tandem modules offer the possibility of significant efficiency improvements. By device modeling we show that four-terminal CdTe/Si tandem solar modules offer the prospect of 25%-30% module efficiency, and technoeconomic analysis predicts that these efficiency gains can be realized at costs per Watt that are competitive with CdTe and Si single junction alternatives. The cost per Watt of the modeled tandems is lower than crystalline silicon, but slightly higher than CdTe alone. But, these higher power modules reduce area-related balance of system costs, providing increased value especially in area-constrainedmore » applications. This avenue for high-efficiency photovoltaics enables improved performance on a near-term timeframe, as well as a path to further reduced levelized cost of electricity as module and cell processes continue to advance.« less

Evaporation for Lithium Bromide Aqueous Solution in a Falling Film Heater under Reduced Pressures

NASA Astrophysics Data System (ADS)

Matsuda, Akira; Ide, Tetsuo; Yukino, Keiji

Experiments on evaporation for water and lithium bromide (LiBr) aqueous solution were made in a externally heated wetted-wall column under reduced pressures. For water, evaporation rate increased slightly as feed rate decreased. The heat transfer coefficients of falling film agreed with those for filmwise condensation. For LiBr solution, evaporation rate decreased and outlet temperature of LiBr solution increased as feed rate decreased. The equations of continuity, diffusion and energy which assume that only water moves to the surface and LiBr doesn't move through falling film of LiBr solution were solved numerically. Calculated values of evaporation rate and outlet temperature of solution agreed with experimental results. The results of this work were compared with pool boiling data reported previously, and it was shown that falling film heater is superior to pool boiling heater concerning heat transfer.

Comprehensive evaluation and analysis of ecological environment quality ofLaoshan Natural Reservebased on Remote Sensing

NASA Astrophysics Data System (ADS)

Cui, Wenlian; Liu, Shanwei; Liu, Yan; Wang, Yanling; Zhang, Naixin

2016-11-01

We used the remote sensing images of 2001, 2005 and 2010, statistics of reservoir water quality, air quality data, precipitation data and population data to evaluate and analyze the ecological environment quality of Laoshan Natural Reserve. In this decade, the ecological environment of tourism scenic area in Laoshan Natural Reserve becomes significantly better than that of the surrounding area, and it is the urban sprawl and increase of cultivated land area that resulted in the reduction of the scenic plants; Reservoir water quality was stable, but PH value and total nitrogen content still did not meet the standards because of the use of the sewage and pesticide fertilizer in the neighborhood; Air quality decreased slightly, however, the situation of acid rain had improved; Residential population continued to grow in Laoshan district and scenic tourists have increased, so human activity has become the main impacting factor of ecological environment of Laoshan Natural Reserve.

Defect structure in electrodeposited nanocrystalline Ni layers with different Mo concentrations

NASA Astrophysics Data System (ADS)

Kapoor, Garima; Péter, László; Fekete, Éva; Gubicza, Jenő

2018-05-01

The effect of molybdenum (Mo) alloying on the lattice defect structure in electrodeposited nanocrystalline nickel (Ni) films was studied. The electrodeposited layers were prepared on copper substrate at room temperature, with a constant current density and pH value. The chemical composition of these layers was determined by EDS. In addition, X-ray diffraction line profile analysis was carried out to study the microstructural parameters such as the crystallite size, the dislocation density and the stacking fault probability. It was found that the higher Mo content yielded more than one order of magnitude larger dislocation density while the crystallite size was only slightly smaller. In addition, the twin boundary formation activity during deposition increased with increasing Mo concentration. The results obtained on electrodeposited layers were compared with previous research carried out on bulk nanocrystalline Ni-Mo materials with similar compositions but processed by severe plastic deformation.

The Soft Magnetic Properties, and Temperature Stability, of Co-Fe-Zr-B Metallic Glasses

NASA Astrophysics Data System (ADS)

Bednarčík, J.; Kováč, J.; Roth, S.; Fűzer, J.; Kollár, P.; Varga, L.; Franz, H.

2008-01-01

In the present work multicomponent Co-based alloys with nominal composition Co72-x FexZr8B20 (x=10, 15, and 20 at. %) were synthesized by single-roller melt-spinning. The measurement of coercivity, Hc, reveals the soft magnetic behavior of investigated alloys. The value of Hc increases from 23 A/m for alloy with x=10 at. % up to 32 A/m for alloy with x=20 at. %. Further it was found that crystallization temperature of as-quenched alloys slightly varies with iron content and lays between 605 and 625°C. From the temperature dependence of magnetization it follows that partial substitution of cobalt by iron has positive influence on the Curie temperature of amorphous phase, Tam c, which increases from 300°C up to 462°C for alloy with x=10 at. % and x=2 0 at. %, respectively.

Chromium - blood test

MedlinePlus

Serum chromium level normally is less than or equal to 1.4 micrograms/milliliter (µg/mL) or 26924.80 nanomoles/L (nmol/L). Normal value ranges may vary slightly among different laboratories. Talk to your provider about the meaning of your specific test result.

Amylase - blood

MedlinePlus

The normal range is 40 to 140 units per liter (U/L) or 0.38 to 1.42 microkat/L (µkat/L). Note: Normal value ranges may vary slightly among different laboratories. Talk to your provider about the meaning of your specific test results. The examples ...

More about the moment of inertia of Mars

NASA Technical Reports Server (NTRS)

Kaula, William M.; Sleep, Norman H.; Phillips, Roger J.

1989-01-01

Differences between Mars and other terrestrial planets are discussed. Unlike other terrestrial planets, Mars has two nonhydrostatic components of moments of inertia that are nearly equal. The most probable value of I/MR-squared is slightly less than 0.3650.

Aerosol optical properties and radiative effects: Assessment of urban aerosols in central China using 10-year observations

NASA Astrophysics Data System (ADS)

Zhang, Ming; Ma, Yingying; Gong, Wei; Liu, Boming; Shi, Yifan; Chen, ZhongYong

2018-06-01

Poor air quality episodes are common in central China. Here, based on 10 years of ground-based sun-photometric observations, aerosol optical and radiative forcing characteristics were analyzed in Wuhan, the biggest metropolis in central China. Aerosol optical depth (AOD) in the last decade declined significantly, while the Ångström exponent (AE) showed slight growth. Single scattering albedo (SSA) at 440 nm reached the lowest value (0.87) in winter and highest value (0.93) in summer. Aerosol parameters derived from sun-photometric observations were used as input in a radiative transfer model to calculate aerosol radiative forcing (ARF) on the surface in ultraviolet (UV), visible (VIS), near-infrared (NIR), and shortwave (SW) spectra. ARFSW sustained decreases (the absolute values) over the last 10 years. In terms of seasonal variability, due to the increases in multiple scattering effects and attenuation of the transmitted radiation as AOD increased, ARF in summer displayed the largest value (-73.94 W/m2). After eliminating the influence of aerosol loading, the maximum aerosol radiative forcing efficiency in SW range (ARFESW) achieved a value of -64.5 W/m2/AOD in April. The ARFE change in each sub-interval spectrum was related to the change in SSA and effective radius of fine mode particles (Refff), that is, ARFE increased with the decreases in SSA and Refff. The smallest contribution of ARFENIR to ARFESW was 34.11% under strong absorbing and fine particle conditions, and opposite results were found for the VIS range, whose values were always over 51.82%. Finally, due to the serious air pollution and frequency of haze day, aerosol characteristics in haze and clear days were analyzed. The percentage of ARFENIR increased from 35.71% on clear-air days to 37.63% during haze periods, while both the percentage of ARFEUV and ARFENIR in ARFESW kept decreasing. The results of this paper should help us to better understand the effect of aerosols on solar spectral radiation and to develop improved the aerosol models over central China.

Leukocyte subsets and neutrophil function after short-term spaceflight

NASA Technical Reports Server (NTRS)

Stowe, R. P.; Sams, C. F.; Mehta, S. K.; Kaur, I.; Jones, M. L.; Feeback, D. L.; Pierson, D. L.

1999-01-01

Changes in leukocyte subpopulations and function after spaceflight have been observed but the mechanisms underlying these changes are not well defined. This study investigated the effects of short-term spaceflight (8-15 days) on circulating leukocyte subsets, stress hormones, immunoglobulin levels, and neutrophil function. At landing, a 1.5-fold increase in neutrophils was observed compared with preflight values; lymphocytes were slightly decreased, whereas the results were variable for monocytes. No significant changes were observed in plasma levels of immunoglobulins, cortisol, or adrenocorticotropic hormone. In contrast, urinary epinephrine, norepinephrine, and cortisol were significantly elevated at landing. Band neutrophils were observed in 9 of 16 astronauts. Neutrophil chemotactic assays showed a 10-fold decrease in the optimal dose response after landing. Neutrophil adhesion to endothelial cells was increased both before and after spaceflight. At landing, the expression of MAC-1 was significantly decreased while L-selectin was significantly increased. These functional alterations may be of clinical significance on long-duration space missions.

One-group fission cross sections for plutonium and minor actinides inserted in calculated neutron spectra of fast reactor cooled with lead-208 or lead-bismuth eutectic

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khorasanov, G. L.; Blokhin, A. I.

The paper is dedicated to one-group fission cross sections of Pu and MA in LFRs spectra with the aim to increase these values by choosing a coolant which hardens neutron spectra. It is shown that replacement of coolant from Pb-Bi with Pb-208 in the fast reactor RBEC-M, designed in Russia, leads to increasing the core mean neutron energy. As concerns fuel Pu isotopes, their one-group fission cross sections become slightly changed, while more dramatically Am-241 one-group fission cross section is changed. Another situation occurs in the lateral blanket containing small quantities of minor actinides. It is shown that as amore » result of lateral blanket mean neutron energy hardening the one-group fission cross sections of Np-237, Am-241 and Am-243 increases up to 8-11%. This result allows reducing the time of minor actinides burning in FRs. (authors)« less

Starch and protein analysis of wheat bread enriched with phenolics-rich sprouted wheat flour.

PubMed

Świeca, Michał; Dziki, Dariusz; Gawlik-Dziki, Urszula

2017-08-01

Wheat flour in the bread formula was replaced with sprouted wheat flour (SF) characterized by enhanced nutraceutical properties, at 5%, 10%, 15% and 20% levels. The addition of SF slightly increased the total protein content; however, it decreased their digestibility. Some qualitative and quantitative changes in the electrophoretic pattern of proteins were also observed; especially, in the bands corresponding with 27kDa and 15-17kDa proteins. These results were also confirmed by SE-HPLC technique, where a significant increase in the content of proteins and peptides (molecular masses <20kDa) was determined for breads with 20% of SF. Bread enriched with sprouted wheat flour had more resistant starch, but less total starch, compared to control bread. The highest in vitro starch digestibility was determined for the control bread. The studied bread with lowered nutritional value but increased nutritional quality can be used for special groups of consumers (obese, diabetic). Copyright © 2017 Elsevier Ltd. All rights reserved.

Molecular dynamics simulations of AP/HMX composite with a modified force field.

PubMed

Zhu, Wei; Wang, Xijun; Xiao, Jijun; Zhu, Weihua; Sun, Huai; Xiao, Heming

2009-08-15

An all-atom force field for ammonium perchlorate (AP) is developed with the framework of pcff force field. The structural parameters of AP obtained with the modified force field are in good agreement with experimental values. Molecular dynamics (MD) simulations have been performed to investigate AP/HMX (1,3,5,7-tetranitro-1,3,5,7-tetrazocane) composite at different temperatures. The binding energies, thermal expansion coefficient, and the trigger bond lengths of HMX in the AP/HMX composite have been obtained. The binding energies of the system increase slightly with temperature increasing, peak at 245K, and then gradually decrease. The volume thermal expansion coefficient of the AP/HMX composite has been derived from the volume variation with temperature. As the temperature rises, the maximal lengths of the trigger bond N-NO(2) of HMX increase gradually. The simulated results indicate that the maximal length of trigger bond can be used as a criterion for judging the sensitivity of energetic composite.

Effect of Detergent on Electrical Properties of Squid Axon Membrane

PubMed Central

Kishimoto, Uichiro; Adelman, William J.

1964-01-01

The effects of detergents on squid giant axon action and resting potentials as well as membrane conductances in the voltage clamp have been studied. Anionic detergents (sodium lauryl sulfate, 0.1 to 1.0 mM; dimethyl benzene sulfonate, 1 to 20 mM, pH 7.6) cause a temporary increase and a later decrease of action potential height and the value of the resting potential. Cationic detergent (cetyl trimethyl ammonium chloride, 6 x 10-5 M or more, pH 7.6) generally brings about immediate and irreversible decreases in the action and resting potentials. Non-ionic detergent (tween 80, 0.1 M, pH 7.6) causes a slight reversible reduction of action potential height without affecting the value of the resting potential. Both anionic and cationic detergents generally decrease the sodium and potassium conductances irreversibly. The effect of non-ionic detergent is to decrease the sodium conductance reversibly, leaving the potassium conductance almost unchanged. PMID:14158665

Rapid neodymium release to marine waters from lithogenic sediments in the Amazon estuary

PubMed Central

Rousseau, Tristan C. C.; Sonke, Jeroen E.; Chmeleff, Jérôme; van Beek, Pieter; Souhaut, Marc; Boaventura, Geraldo; Seyler, Patrick; Jeandel, Catherine

2015-01-01

Rare earth element (REE) concentrations and neodymium isotopic composition (ɛNd) are tracers for ocean circulation and biogeochemistry. Although models suggest that REE release from lithogenic sediment in river discharge may dominate all other REE inputs to the oceans, the occurrence, mechanisms and magnitude of such a source are still debated. Here we present the first simultaneous observations of dissolved (<0.45 μm), colloidal and particulate REE and ɛNd in the Amazon estuary. A sharp drop in dissolved REE in the low-salinity zone is driven by coagulation of colloidal matter. At mid-salinities, total dissolved REE levels slightly increase, while ɛNd values are shifted from the dissolved Nd river endmember (−8.9) to values typical of river suspended matter (−10.6). Combining a Nd isotope mass balance with apparent radium isotope ages of estuarine waters suggests a rapid (3 weeks) and globally significant Nd release by dissolution of lithogenic suspended sediments. PMID:26158849

Universal behaviour of interoccurrence times between losses in financial markets: An analytical description

NASA Astrophysics Data System (ADS)

Ludescher, J.; Tsallis, C.; Bunde, A.

2011-09-01

We consider 16 representative financial records (stocks, indices, commodities, and exchange rates) and study the distribution PQ(r) of the interoccurrence times r between daily losses below negative thresholds -Q, for fixed mean interoccurrence time RQ. We find that in all cases, PQ(r) follows the form PQ(r)~1/[(1+(q- 1)βr]1/(q-1), where β and q are universal constants that depend only on RQ, but not on a specific asset. While β depends only slightly on RQ, the q-value increases logarithmically with RQ, q=1+q0 ln(RQ/2), such that for RQ→2, PQ(r) approaches a simple exponential, PQ(r)cong2-r. The fact that PQ does not scale with RQ is due to the multifractality of the financial markets. The analytic form of PQ allows also to estimate both the risk function and the Value-at-Risk, and thus to improve the estimation of the financial risk.

Relationship between sweat chloride, sodium, and age in clinically obtained samples.

PubMed

Traeger, Nadav; Shi, Qiuhu; Dozor, Allen J

2014-01-01

The relationship between sweat electrolytes and age is uncertain, as is the value of measuring sodium or the chloride:sodium ratio. 13,785 sweat tests performed over 23 years at one center through the Macroduct collection in clinically obtained samples were analyzed. Sweat chloride tended to decrease over the first year of life, slowly increase until the fourth decade, then either level off or slightly decrease. In children, sweat sodium overlapped between those with positive and negative sweat tests, but not in adults. If the sweat test was positive, there was a higher likelihood of having a chloride:sodium ratio >1, but most subjects with a ratio >1 did not have CF. Sweat chloride and sodium vary with age. Measurement of sweat sodium did not add discriminatory value. The proportion of subjects with a chloride:sodium ratio >1, with or without CF, varied greatly between age ranges. © 2013. Published by Elsevier B.V. on behalf of European Cystic Fibrosis Society. All rights reserved.

Thermal, Dielectric Studies on Pure and Amino Acid L-Glutamic Acid, L-Histidine L-Valine Doped Potassium Dihydrogen Phosphate Single Crystals

NASA Astrophysics Data System (ADS)

Kumaresan, P.; Babu, S. Moorthy; Anbarasan, P. M.

Amino acids (L-Glutamic acid, L-Histidine, L-Valine) doped potassium dihydrogen phosphate crystals were grown by the solution growth technique. Slow cooling as well as slow evaporation methods were employed to grow these crystals. The concentration of dopants in the mother solution was varied from 0.1 mole % to 10 mole %. The solubility data for all dopant concentrations were determined. The variation in pH and the corresponding habit modification of the grown crystals were characterized with UV - VIS, FT-IR and SHG trace elements, and dielectric studies reveal slight distortion of lattice parameter for the heavily doped KDP crystals. TGA-DTA studies reveal good thermal stability. The dopants increase the hardness value of the material, which also depends on the concentration of the dopants. Amino acids doping improved the NLO properties. The detailed results on the spectral parameters, habit modifications and constant values will be presented.

Influence of nitrogen immersion on the mechanical properties of (NiO)x(Bi1.6 Pb0.4)Sr2Ca2Cu3O10-δ composite

NASA Astrophysics Data System (ADS)

Rahal, H. T.; Awad, R.; Abdel-Gaber, A. M.

2018-05-01

(NiO)x(Bi1.6 Pb0.4)Sr2Ca2Cu3O10-δ composite, where 0.0 ≤ x ≤ 0.2 wt%., were prepared using solid state reaction method. The prepared samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM) as well as transmission electron microscopy (TEM). Vickers microhardness measurements (HV) were carried out at room temperature under different applied loads varying from 0.49 to 9.8 N, and dwell times (40 and 59 s). It was noted that dwell time and Vickers microhardness were inversely proportional. HV values increase as x increases up to 0.1 wt%, and then they decrease with further increases in x. All samples exhibit indentation size effect (ISE) with normal trend, as Vickers microhardness decreases by increasing the applied loads. Also, Vickers microhardness measurements of the prepared samples were done during both loading forces up to 9.8 N and unloading downwards to 0.49 N. It was noted that unloading values of Vickers microhardness are slightly greater than loading values. The elastic/plastic deformation model (EPD) was used to interpret the loading and unloading Vickers microhardness results. It is clearly noted that values of do, the added elastic component the measured plastic indentation semi-diagonal (d),in the unloading results are much higher than those for loading data. The effect of liquid nitrogen immersion for 16 h on Vickers microhardness values was examined. A significant improvement in the Vickers microhardness of (Bi, Pb)-2223 samples immersed in liquid nitrogen was observed. Such behavior is attributed to the fact that nitrogen immersion increases the volume contraction of the superconductor matrix, causing the shrink of the pores and voids present in the samples. Different models were used to analyze the obtained results such as Meyer's law, Hays-Kendall (HK) approach, elastic/plastic deformation (EPD) model, and modified proportional specimen resistance (MPSR) model. The experimental results of Vickers microhardness of both samples without and with liquid nitrogen immersion are well fitted according to the MPSR model.

Ecological vulnerability: seasonal and spatial assessment of trace metals in soils and plants in the vicinity of a scrap metal recycling factory in Southwestern Nigeria.

PubMed

Owoade, O K; Awotoye, O O; Salami, O O

2014-10-01

The concentrations of selected heavy metals in the soil and vegetation in the immediate vicinity of a metal scrap recycling factory were determined in the dry and wet seasons using the Atomic Absorption Spectrophotometer. The results showed that the soil pH in all the sites indicated slight acidity (from 5.07 to 6.13), high soil organic matter content (from 2.08 to 5.60 %), and a well-drained soil of sandy loam textural composition. Soil heavy metal content in the dry season were 0.84-3.12 mg/kg for Pb, 0.26-0.46 mg/kg for Cd, 9.19-24.70 mg/kg for Zn, and 1.46-1.97 mg/kg for Cu. These values were higher than those in the wet season which ranged from 0.62-0.69 mg/kg for Pb, 0.67-0.78 mg/kg for Cd, 0.84-1.00 mg/kg for Zn, and 1.26-1.45 mg/kg for Cu. Except for cadmium in the dry season, the highest concentrations occurred in the northern side of the factory for all the elements in both seasons. An increase in the concentrations of the elements up to 350 m in most directions was also observed. There was no specific pattern in the level of the metals in the leaves of the plant used for the study. However, slightly elevated values were observed in the wet season (Pb 0.53 mg/kg, Cd 0.59 mg/kg, Cu 0.88 mg/kg) compared with the dry season values (Pb 0.50 mg/kg, Cd 0.57 mg/kg, Cu 0.83 mg/kg). This study showed that the elevated concentrations of these metals might be associated with the activities from the recycling plant, providing the basis for heavy metal pollution monitoring and control of this locality that is primarily used for agricultural purposes.

Evaluation of inter-observer agreement when using a clinical respiratory scoring system in pre-weaned dairy calves.

PubMed

Buczinski, S; Faure, C; Jolivet, S; Abdallah, A

2016-07-01

To determine inter-observer agreement for a clinical scoring system for the detection of bovine respiratory disease complex in calves, and the impact of classification of calves as sick or healthy based on different cut-off values. Two third-year veterinary students (Observer 1 and 2) and one post-graduate student (Observer 3) received 4 hours of training on scoring dairy calves for signs of respiratory disease, including rectal temperature, cough, eye and nasal discharge, and ear position. Observers 1 and 2 scored 40 pre-weaning dairy calves 24 hours apart (80 observations) over three visits to a calf-rearing facility, and Observers 1, 2 and 3 scored 20 calves on one visit. Inter-observer agreement was assessed using percentage of agreement (PA) and Kappa statistics for individual clinical signs, comparing Observers 1 and 2. Agreement between the three observers for total clinical score was assessed using cut-off values of ≥4, ≥5 and ≥6 to indicate unhealthy calves. Inter-observer PA for rectal temperature was 0.68, for cough 0.78, for nasal discharge 0.62, for eye discharge 0.63, and for ear position 0.85. Kappa values for all clinical signs indicated slight to fair agreement (<0.4), except temperature that had moderate agreement (0.6). The Fleiss' Kappa for total score, using cut-offs of ≥4, ≥5 and ≥6 to indicate unhealthy calves, was 0.35, 0.06 and 0.13, respectively, indicating slight to fair agreement. There was important inter-observer discrepancies in scoring clinical signs of respiratory disease, using relatively inexperienced observers. These disagreements may ultimately mean increased false negative or false positive diagnoses and incorrect treatment of cases. Visual assessment of clinical signs associated with bovine respiratory disease needs to be thoroughly validated when disease monitoring is based on the use of a clinical scoring system.

Weak gravitational lensing effects on the determination of Omega_mega_m and Omega_mega Lambda from SNeIa

NASA Astrophysics Data System (ADS)

Valageas, P.

2000-02-01

In this article we present an analytical calculation of the probability distribution of the magnification of distant sources due to weak gravitational lensing from non-linear scales. We use a realistic description of the non-linear density field, which has already been compared with numerical simulations of structure formation within hierarchical scenarios. Then, we can directly express the probability distribution P(mu ) of the magnification in terms of the probability distribution of the density contrast realized on non-linear scales (typical of galaxies) where the local slope of the initial linear power-spectrum is n=-2. We recover the behaviour seen by numerical simulations: P(mu ) peaks at a value slightly smaller than the mean < mu >=1 and it shows an extended large mu tail (as described in another article our predictions also show a good quantitative agreement with results from N-body simulations for a finite smoothing angle). Then, we study the effects of weak lensing on the derivation of the cosmological parameters from SNeIa. We show that the inaccuracy introduced by weak lensing is not negligible: {cal D}lta Omega_mega_m >~ 0.3 for two observations at z_s=0.5 and z_s=1. However, observations can unambiguously discriminate between Omega_mega_m =0.3 and Omega_mega_m =1. Moreover, in the case of a low-density universe one can clearly distinguish an open model from a flat cosmology (besides, the error decreases as the number of observ ed SNeIa increases). Since distant sources are more likely to be ``demagnified'' the most probable value of the observed density parameter Omega_mega_m is slightly smaller than its actual value. On the other hand, one may obtain some valuable information on the properties of the underlying non-linear density field from the measure of weak lensing distortions.

Interactive effects of a high-quality protein diet and high stocking density on the stress response and some innate immune parameters of Senegalese sole Solea senegalensis.

PubMed

Costas, Benjamín; Aragão, Cláudia; Dias, Jorge; Afonso, António; Conceição, Luís E C

2013-10-01

Amino acids (AA) regulate key metabolic pathways, including some immune responses. Therefore, this study aimed to assess whether an increased availability of dietary AA can mitigate the expected increase in plasma cortisol and metabolites levels due to high stocking density and its subsequent immunosuppression. Senegalese sole (Solea senegalensis) were maintained at low stocking density (LSD; 3.5 kg m(-2)) or high stocking density (HSD; 12 kg m(-2)) for 18 days. Additionally, both treatments were fed a control or a high protein (HP) diet (LSD, LSD HP, HSD and HSD HP). The HP diet slightly increased the levels of digestible indispensable AA, together with tyrosine and cysteine. HSD was effective in inducing a chronic stress response after 18 days of treatment since fish held at HSD presented higher plasma cortisol, glucose and lactate levels. Moreover, this increase in stress indicators translated in a decrease in plasma lysozyme, alternative complement pathway (ACP) and peroxidase activities, suggesting some degree of immunosuppression. Interestingly, while plasma glucose and lactate levels in HSD HP specimens decreased to similar values than LSD fish, plasma lysozyme, ACP and peroxidase activities increased, with even higher values than LSD groups for ACP activity. It is suggested that the HP diet may be used as functional feed since it may represent a metabolic advantage during stressful events and may counteract immunosuppression in sole.

Quantifying climatic impacts on peatland in the Zoige basin, China

NASA Astrophysics Data System (ADS)

Gao, P.; Li, Z.; Hu, X.

2017-12-01

Actual evapotranspiration (ET) of the Zoige basin in the Yellow River source region of China is a critical parameter for understanding water balance of peatland in the Zoige basin and hence the cause of the changing land cover. Using daily meteorological data sets of Zoige, Hongyuan, and Maqu stations from 1967 to 2011, the well-known FAO56 Penman-Monteith (P-M) formula was selected to calculate the reference crop evapotranspiration (ET0) in combination with the crop coefficient method in which the crop coefficient Kc is modified in terms of local climatic conditions. By classifying land cover of the Zoige basin in to swamp, grassland, water surface, and desert, the actual ET cover time for each type was obtained. Since late 1990s, the ET0 increased along with the increased air temperature. Different from previous studies, the ET of the swamp was slightly lower than that of water surface, but was slightly larger than the difference between annual precipitation and runoff in the Zoige basin. The increase of ET in the past 45 years was small in comparison with the change of the annual precipitation. More specifically, the annual precipitation, which was about 560-860 mm, slightly decreased between 1967 and 1997, and increased 2.23% in the 1998-2011 period. These results allowed us to conclude that though the slightly increased ET might be a factor leading to the long-term swamp dewatering, it cannot be the primary cause of the degraded peatland swamp and grassland in the Zoige basin.