AST1306, a potent EGFR inhibitor, antagonizes ATP-binding cassette subfamily G member 2-mediated multidrug resistance.

PubMed

Zhang, Hui; Wang, Yi-Jun; Zhang, Yun-Kai; Wang, De-Shen; Kathawala, Rishil J; Patel, Atish; Talele, Tanaji T; Chen, Zhe-Sheng; Fu, Li-Wu

2014-08-01

AST1306, an inhibitor of EGFR and ErbB2, is currently in phase I of clinical trials. We evaluated the effect of AST306 on the reversal of multidrug resistance (MDR) induced by ATP-binding cassette (ABC) transporters. We found that AST1306 significantly sensitized the ABC subfamily G member 2 (ABCG2)-overexpressing cells to ABCG2 substrate chemotherapeutics. AST1306 significantly increased intracellular accumulation of [(3)H]-mitoxantrone in ABCG2-overexpressing cells by blocking ABCG2 efflux function. Moreover, AST1306 stimulated the ATPase activity of ABCG2. Homology modeling predicted the binding conformation of AST1306 to be within the transmembrane region of ABCG2. In conclusion, AST1306 could notably reverse ABCG2-mediated MDR. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Peripheral inflammation induces up-regulation of TRPV2 expression in rat DRG.

PubMed

Shimosato, Goshun; Amaya, Fumimasa; Ueda, Masashi; Tanaka, Yoshifumi; Decosterd, Isabelle; Tanaka, Masaki

2005-12-15

The transient receptor potential vanilloid subfamily member 2 (TRPV2) is a cation channel activated by temperatures above 52 degrees C. To analyze the contribution of TRPV2 to the development of inflammation-induced hyperalgesia, the expression of TRPV2 in primary sensory neurons was analyzed after intraplantar injection of complete Freund's adjuvant (CFA). Using specific antibodies, an increase in TRPV2-expressing neurons was identified after inflammation. TRPV2 expression is concentrated in a subset of medium-sized dorsal root ganglion neurons, independent of transient receptor potential vanilloid subfamily member 1 (TRPV1) expression. A similar distribution of TRPV2 was observed after inflammation. Intraplantar injection of nerve growth factor increased TRPV1 expression but not TRPV2, suggesting that induction of TRPV2 expression is driven by a mechanism distinct from that for TRPV1. Heat hyperalgesia assessment after chemical desensitization of TRPV1 by resiniferatoxin demonstrates a possible role for TRPV2 in inflammation at high temperatures (>56 degrees C). These results suggest that TRPV2 upregulation contributes to peripheral sensitization during inflammation and is responsible for pain hypersensitivity to noxious high temperature stimuli.

The BBX subfamily IV: additional cogs and sprockets to fine-tune light-dependent development.

PubMed

Sarmiento, Felipe

2013-04-01

Plants depend on light during all phases of its life cycle, and have evolved a complex signaling network to constantly monitor its surroundings. Photomorphogenesis, a process during which the plant reprograms itself in order to dwell life in presence of light is one of the most studied phenomena in plants. Recent mutant analyses using model plant Arabidopsis thaliana and protein interaction assays have unraveled a new set of players, an 8-member subfamily of B-box proteins, known as BBX subfamily IV. For the members of this subfamily, positive (BBX21, BBX22) as well as negative (BBX24) functions have been described for its members, showing a strong association to two major players of the photomorphogenic cascade, HY5 and COP1. The roles of these new BBX regulators are not restricted to photomorphogenesis, but also have functions in other facets of light-dependent development. Therefore this newly identified set of regulators has opened up new insights into the understanding of the fine-tuning of this complex process.

Caged vanilloid ligands for activation of TRPV1 receptors by 1- and 2-photon excitation†

PubMed Central

Zhao, Jun; Gover, Tony D.; Muralidharan, Sukumaran; Auston, Darryl A.; Weinreich, Daniel; Kao, Joseph P. Y.

2008-01-01

Nociceptive neurons in the peripheral nervous system detect noxious stimuli and report the information to the central nervous system. Most nociceptive neurons express the vanilloid receptor, TRPV1, a non-selective cation channel gated by vanilloid ligands such as capsaicin, the pungent essence of chili peppers. Here, we report the synthesis and biological application of two caged vanilloids—biologically inert precursors that, when photolyzed, release bioactive vanilloid ligands. The two caged vanilloids, Nb-VNA and Nv-VNA, are photoreleased with quantum efficiency of 0.13 and 0.041, respectively. Under flash photolysis conditions, photorelease of Nb-VNA and Nv-VNA is 95% complete in ∼40 μs and ∼125 μs, respectively. Through 1-photon excitation with ultraviolet light (360 nm), or 2-photon excitation with red light (720 nm), the caged vanilloids can be photoreleased in situ to activate TRPV1 receptors on nociceptive neurons. The consequent increase in intracellular free Ca2+ concentration ([Ca2+]i) can be visualized by laser-scanning confocal imaging of neurons loaded with the fluorescent Ca2+ indicator, fluo-3. Stimulation results from TRPV1 receptor activation, because the response is blocked by capsazepine, a selective TRPV1 antagonist. In Ca2+-free extracellular medium, photoreleased vanilloid can still elevate [Ca2+]i, which suggests that TRPV1 receptors also reside on endomembranes in neurons and can mediate Ca2+ release from intracellular stores. Notably, whole-cell voltage clamp measurements showed that flash photorelease of vanilloid can activate TRPV1 channels in < 4 msec at 22°C. In combination with 1- or 2-photon excitation, caged vanilloids are a powerful tool for probing morphologically distinct structures of nociceptive sensory neurons with high spatial and temporal precision. PMID:16605259

A novel member of glycoside hydrolase family 30 subfamily 8 with altered substrate specificity

Treesearch

Franz J. St John; Diane Dietrich; Casey Crooks; Edwin Pozharski; Javier M. González; Elizabeth Bales; Kennon Smith; Jason C. Hurlbert

2014-01-01

Endoxylanases classified into glycoside hydrolase family 30 subfamily 8 (GH30-8) are known to hydrolyze the hemicellulosic polysaccharide glucuronoxylan (GX) but not arabinoxylan or neutral xylooligosaccharides. This is owing to the specificity of these enzymes for the

To the theory of mechanisms subfamilies

NASA Astrophysics Data System (ADS)

Fomin, A.; Dvornikov, L.; Paramonov, M.; Jahr, A.

2016-04-01

The principles of formation of mechanisms subfamilies based on the usage of different kinds of kinematic pairs within the families of mechanisms are substantiated in the current paper. The division of mechanisms into subfamilies allows defining not only fundamental differences in the structure of mechanisms, but also provides the necessary foundation for the synthesis of new structures. 57 subfamilies of mechanisms have been totally distinguished. Among them, 31 subfamilies - within the zero family, 15 subfamilies - within the first family, 7 subfamilies - within the second family, 3 subfamilies - within the third family and 1 subfamily-within the fourth family. There were separately viewed planar mechanisms of the third family with three general imposed constraints and spatial mechanisms of the second family with two general imposed constraints in terms of their subfamilies. New methods of kinematical and dynamical investigations of mechanisms might be developed according to their analytical equations describing structural organization of different subfamilies of mechanisms.

Detailed Analysis of the Binding Mode of Vanilloids to Transient Receptor Potential Vanilloid Type I (TRPV1) by a Mutational and Computational Study

PubMed Central

Mori, Yoshikazu; Ogawa, Kazuo; Warabi, Eiji; Yamamoto, Masahiro; Hirokawa, Takatsugu

2016-01-01

Transient receptor potential vanilloid type 1 (TRPV1) is a non-selective cation channel and a multimodal sensor protein. Since the precise structure of TRPV1 was obtained by electron cryo-microscopy, the binding mode of representative agonists such as capsaicin and resiniferatoxin (RTX) has been extensively characterized; however, detailed information on the binding mode of other vanilloids remains lacking. In this study, mutational analysis of human TRPV1 was performed, and four agonists (capsaicin, RTX, [6]-shogaol and [6]-gingerol) were used to identify amino acid residues involved in ligand binding and/or modulation of proton sensitivity. The detailed binding mode of each ligand was then simulated by computational analysis. As a result, three amino acids (L518, F591 and L670) were newly identified as being involved in ligand binding and/or modulation of proton sensitivity. In addition, in silico docking simulation and a subsequent mutational study suggested that [6]-gingerol might bind to and activate TRPV1 in a unique manner. These results provide novel insights into the binding mode of various vanilloids to the channel and will be helpful in developing a TRPV1 modulator. PMID:27606946

Effect of transient receptor potential vanilloid 6 gene silencing on the expression of calcium transport genes in chicken osteoblasts.

PubMed

Zhang, Jie; Deng, Yifeng; Ma, Huijie; Hou, Jiafa; Zhou, ZhenLei

2015-03-01

Ca2+ plays a major role in the regulation of signal transduction. Transient receptor potential vanilloid 6 is a Ca2+-selective channel that serves as an important rate-limiting step in the facilitation of Ca2+ entry into cells, but little is known about the regulation of transient receptor potential vanilloid 6 in chickens. In this study, we evaluated the effects of transient receptor potential vanilloid 6 gene interference on the expression of calbindin-D28K, Na+/Ca2+ exchangers, and plasma membrane Ca2+ ATPase 1b to investigate the mechanism underlying the regulation of transient receptor potential vanilloid 6. Three hairpin siRNA expression vectors targeting transient receptor potential vanilloid 6 (pSIREN- transient receptor potential vanilloid 6) and a negative control (pSIREN-control) were constructed and transfected into chicken osteoblasts. The mRNA and protein expression levels were evaluated by quantitative reverse transcription polymerase chain reaction and Western blot, respectively. The mRNA expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 45.7% (P<0.01) and 27.9% (P<0.01), respectively, 48 h after transfection with one of the three constructs (pSIREN- transient receptor potential vanilloid 6-3) compared with the level obtained in the untreated group. There was no significant difference in the mRNA expression levels of Na+/Ca2+ exchangers and plasma membrane Ca2+ ATPase 1b. The protein expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 40.2% (P<0.01) and 29.8% (P<0.01), respectively, 48 h after transfection with pSIREN-transient receptor potential vanilloid 6-3 compared with the level obtained in the untreated group. In conclusion, the vector-based transient receptor potential vanilloid 6-shRNA can efficiently suppress the mRNA and protein expression of transient receptor potential vanilloid 6 in chicken osteoblasts, and transient receptor potential vanilloid

Masitinib Antagonizes ATP-Binding Cassette Subfamily C Member 10-Mediated Paclitaxel Resistance: A Preclinical Study

PubMed Central

Kathawala, Rishil J.; Sodani, Kamlesh; Chen, Kang; Patel, Atish; Abuznait, Alaa H.; Anreddy, Nagaraju; Sun, Yue-Li; Kaddoumi, Amal; Ashby, Charles R.; Chen, Zhe-Sheng

2014-01-01

Paclitaxel displays clinical activity against a wide variety of solid tumors. However, resistance to paclitaxel significantly attenuates the response to chemotherapy. The ABC transporter subfamily C member 10 (ABCC10), also known as multi-drug resistance protein 7 (MRP7) efflux transporter, is a major mediator of paclitaxel resistance. In this study, we show that masitinib, a small molecule stem-cell growth factor receptor (c-Kit) tyrosine kinase inhibitor, at non-toxic concentrations, significantly attenuates paclitaxel resistance in HEK293 cells transfected with ABCC10. Our in vitro studies indicated that masitinib (2.5 μM) enhanced the intracellular accumulation and decreased the efflux of paclitaxel by inhibiting the ABCC10 transport activity without altering the expression level of ABCC10 protein. Furthermore, masitinib, in combination with paclitaxel, significantly inhibited the growth of ABCC10-expressing tumors in nude athymic mice in vivo. Masitinib administration also resulted in a significant increase in the levels of paclitaxel in the plasma, tumors and lungs compared to paclitaxel alone. In conclusion, the combination of paclitaxel and masitinib could serve as a novel and useful therapeutic strategy to reverse paclitaxel resistance mediated by ABCC10. PMID:24431074

Vanilloid receptor-related osmotically activated channel (VR-OAC), a candidate vertebrate osmoreceptor

PubMed Central

Liedtke, Wolfgang; Choe, Yong; Martí-Renom, Marc A.; Bell, Andrea M.; Denis, Charlotte S.; Šali, Andrej; Hudspeth, A. J.; Friedman, Jeffrey M.; Heller, Stefan

2008-01-01

SUMMARY The detection of osmotic stimuli is essential for all organisms, yet few osmoreceptive proteins are known, none of them in vertebrates. By employing a candidate-gene approach based on genes encoding members of the TRP superfamily of ion channels, we cloned cDNAs encoding the vanilloid receptor-related osmotically activated channel (VR-OAC) from the rat, mouse, human, and chicken. This novel cation-selective channel is gated by exposure to hypotonicity within the physiological range. In the central nevous system, the channel is expressed neurons of the circumventricular organs, neurosensory cells responsive to systemic osmotic pressure. The channel also occurs in other neurosensory cells, including inner-ear hair cells, sensory neurons, and Merkel cells. PMID:11081638

Expression Profiling of the Transient Receptor Potential Vanilloid (TRPV) Channels 1, 2, 3 and 4 in Mucosal Epithelium of Human Ulcerative Colitis.

PubMed

Rizopoulos, Theodoros; Papadaki-Petrou, Helen; Assimakopoulou, Martha

2018-06-15

The Transient Receptor Potential (TRP) family of selective and non-selective ion channels is well represented throughout the mammalian gastrointestinal track. Several members of the Transient Receptor Potential Vanilloid (TRPV) subfamily have been identified in contributing to modulation of mobility, secretion and sensitivity of the human intestine. Previous studies have focused on the detection of TRPV mRNA levels in colon tissue of patients with inflammatory bowel disease (IBD) whereas little information exists regarding TRPV channel expression in the colonic epithelium. The aim of this study was to evaluate the expression levels of TRPV1, TRPV2, TRPV3 and TRPV4 in mucosa epithelial cells of colonic biopsies from patients with ulcerative colitis (UC) in comparison to colonic resections from non-IBD patients (control group). Immunohistochemistry, using specific antibodies and quantitative analyses of TRPV-immunostained epithelial cells, was performed in semi-serial sections of the samples. TRPV1 expression was significantly decreased whereas TRPV4 expression was significantly increased in the colonic epithelium of UC patients compared to patients in the control group ( p < 0.05). No significant difference for TRPV2 and TRPV3 expression levels between UC and control specimens was detected ( p > 0.05). There was no correlation between TRPV channel expression and the clinical features of the disease ( p > 0.05). Further investigation is needed to clarify the role of TRPV channels in human bowel inflammatory response.

Structure-function analysis of HKE4, a member of the new LIV-1 subfamily of zinc transporters.

PubMed Central

Taylor, Kathryn M; Morgan, Helen E; Johnson, Andrea; Nicholson, Robert I

2004-01-01

The KE4 proteins are an emerging group of proteins with little known functional data. In the present study, we report the first characterization of the recombinant human KE4 protein in mammalian cells. The KE4 sequences are included in the subfamily of ZIP (Zrt-, Irt-like Proteins) zinc transporters, which we have termed LZT (LIV-1 subfamily of ZIP zinc Transporters). All these LZT sequences contain similarities to ZIP transporters, including the consensus sequence in transmembrane domain IV, which is essential for zinc transport. However, the new LZT subfamily can be separated from other ZIP transporters by the presence of a highly conserved potential metalloprotease motif (HEXPHEXGD) in transmembrane domain V. Here we report the location of HKE4 on intracellular membranes, including the endoplasmic reticulum, and its ability to increase the intracellular free zinc as measured with the zinc-specific fluorescent dye, Newport Green, in a time-, temperature- and concentration-dependent manner. This is in contrast with the zinc influx ability of another LZT protein, LIV-1, which was due to its plasma membrane location. Therefore we have added to the functionality of LZT proteins by reporting their ability to increase intracellular-free zinc, whether they are located on the plasma membrane or on intracellular membranes. This result, in combination with the crucial role that zinc plays in cell growth, emphasizes the importance of this new LZT subfamily, including the KE4 sequences, in the control of intracellular zinc homoeostasis, aberrations of which can lead to diseases such as cancer, immunological disorders and neurological dysfunction. PMID:14525538

Identification of a tetramerization domain in the C terminus of the vanilloid receptor.

PubMed

García-Sanz, Nuria; Fernández-Carvajal, Asia; Morenilla-Palao, Cruz; Planells-Cases, Rosa; Fajardo-Sánchez, Emmanuel; Fernández-Ballester, Gregorio; Ferrer-Montiel, Antonio

2004-06-09

TRPV1 (transient receptor potential vanilloid receptor subtype 1) is a member of the TRP channel family gated by vanilloids, protons, and heat. Structurally, TRPV1 appears to be a tetramer formed by the assembly of four identical subunits around a central aqueous pore. The molecular determinants that govern its subunit oligomerization remain elusive. Here, we report the identification of a segment comprising 684Glu-721Arg (referred to as the TRP-like domain) in the C terminus of TRPV1 as an association domain (AD) of the protein. Purified recombinant C terminus of TRPV1 (TRPV1-C) formed discrete and stable multimers in vitro. Yeast two-hybrid and pull-down assays showed that self-association of the TRPV1-C is blocked when segment 684Glu-721Arg is deleted. Biochemical and immunological analysis indicate that removal of the AD from full-length TRPV1 monomers blocks the formation of stable heteromeric assemblies with wild-type TRPV1 subunits. Deletion of the AD in a poreless TRPV1 subunit suppressed its robust dominant-negative phenotype. Together, these findings are consistent with the tenet that the TRP-like domain in TRPV1 is a molecular determinant of the tetramerization of receptor subunits into functional channels. Our observations suggest that the homologous TRP domain in the TRP protein family may function as a general, evolutionary conserved AD involved in subunit multimerization.

A role for calcium in the regulation of ATP-binding cassette, sub-family C, member 3 (ABCC3) gene expression in a model of epidermal growth factor-mediated breast cancer epithelial-mesenchymal transition.

PubMed

Stewart, Teneale A; Azimi, Iman; Thompson, Erik W; Roberts-Thomson, Sarah J; Monteith, Gregory R

2015-03-13

Epithelial-mesenchymal transition (EMT), a process implicated in cancer metastasis, is associated with the transcriptional regulation of members of the ATP-binding cassette superfamily of efflux pumps, and drug resistance in breast cancer cells. Epidermal growth factor (EGF)-induced EMT in MDA-MB-468 breast cancer cells is calcium signal dependent. In this study induction of EMT was shown to result in the transcriptional up-regulation of ATP-binding cassette, subfamily C, member 3 (ABCC3), a member of the ABC transporter superfamily, which has a recognized role in multidrug resistance. Buffering of cytosolic free calcium inhibited EGF-mediated ABCC3 increases, indicating a calcium-dependent mode of regulation. Silencing of TRPM7 (an ion channel involved in EMT associated vimentin induction) did not inhibit ABCC3 up-regulation. Silencing of the store operated calcium entry (SOCE) pathway components ORAI1 and STIM1 also did not alter ABCC3 induction by EGF. However, the calcium permeable ion channel transient receptor potential cation channel, subfamily C, member 1 (TRPC1) appears to contribute to the regulation of both basal and EGF-induced ABCC3 mRNA. Improved understanding of the relationship between calcium signaling, EMT and the regulation of genes important in therapeutic resistance may help identify novel therapeutic targets for breast cancer. Copyright © 2015 Elsevier Inc. All rights reserved.

Evolution, substrate specificity and subfamily classification of glycoside hydrolase family 5 (GH5).

PubMed

Aspeborg, Henrik; Coutinho, Pedro M; Wang, Yang; Brumer, Harry; Henrissat, Bernard

2012-09-20

The large Glycoside Hydrolase family 5 (GH5) groups together a wide range of enzymes acting on β-linked oligo- and polysaccharides, and glycoconjugates from a large spectrum of organisms. The long and complex evolution of this family of enzymes and its broad sequence diversity limits functional prediction. With the objective of improving the differentiation of enzyme specificities in a knowledge-based context, and to obtain new evolutionary insights, we present here a new, robust subfamily classification of family GH5. About 80% of the current sequences were assigned into 51 subfamilies in a global analysis of all publicly available GH5 sequences and associated biochemical data. Examination of subfamilies with catalytically-active members revealed that one third are monospecific (containing a single enzyme activity), although new functions may be discovered with biochemical characterization in the future. Furthermore, twenty subfamilies presently have no characterization whatsoever and many others have only limited structural and biochemical data. Mapping of functional knowledge onto the GH5 phylogenetic tree revealed that the sequence space of this historical and industrially important family is far from well dispersed, highlighting targets in need of further study. The analysis also uncovered a number of GH5 proteins which have lost their catalytic machinery, indicating evolution towards novel functions. Overall, the subfamily division of GH5 provides an actively curated resource for large-scale protein sequence annotation for glycogenomics; the subfamily assignments are openly accessible via the Carbohydrate-Active Enzyme database at http://www.cazy.org/GH5.html.

Odontomariinae, a new middle paleozoic subfamily of slit-bearing euophaloidean gastropods (Euophalomorpha, Gastropoda)

USGS Publications Warehouse

Fryda, J.; Heidelberger, D.; Blodgett, R.B.

2006-01-01

A new subfamily, the Odontomariinae subfam. nov., is established herein for a distinctive group of uncoiled, slit-bearing Middle Devonian euomphalid gastropods. Its taxonomic position is based on the recent discovery of open coiled protoconchs and it is placed within the Euomphalomorpha. The genera Odontomaria Odontomaria C. F. Roemer and Tubiconcha n. gen. belonging to this new subfamily are enlarged based on studies on new material of the following species: Odontomaria semiplicata (Sandberger & Sandberger), Odontomaria gracilis n. sp., Odontomaria jankei n. sp., Odontomaria cheeneetnukensis n. sp., Odontomaria cindiprellerae n. sp. and Tubiconcha leunissi (Heidelberger, 2001). Members of the Odontomariinae were mainly sedentary organisms in high-energy, moderately shallow water. ?? 2006 E. Schweizerbart'sche Verlagsbuchhandlung.

A novel member of glycoside hydrolase family 30 subfamily 8 with altered substrate specificity

PubMed Central

St John, Franz J.; Dietrich, Diane; Crooks, Casey; Pozharski, Edwin; González, Javier M.; Bales, Elizabeth; Smith, Kennon; Hurlbert, Jason C.

2014-01-01

Endoxylanases classified into glycoside hydrolase family 30 subfamily 8 (GH30-8) are known to hydrolyze the hemicellulosic polysaccharide glucuronoxylan (GX) but not arabinoxylan or neutral xylooligosaccharides. This is owing to the specificity of these enzymes for the α-1,2-linked glucuronate (GA) appendage of GX. Limit hydrolysis of this substrate produces a series of aldouronates each containing a single GA substituted on the xylose penultimate to the reducing terminus. In this work, the structural and biochemical characterization of xylanase 30A from Clostridium papyro­solvens (CpXyn30A) is presented. This xylanase possesses a high degree of amino-acid identity to the canonical GH30-8 enzymes, but lacks the hallmark β8–α8 loop region which in part defines the function of this GH30 subfamily and its role in GA recognition. CpXyn30A is shown to have a similarly low activity on all xylan substrates, while hydrolysis of xylohexaose revealed a competing transglycosylation reaction. These findings are directly compared with the model GH30-8 enzyme from Bacillus subtilis, XynC. Despite its high sequence identity to the GH30-8 enzymes, CpXyn30A does not have any apparent specificity for the GA appendage. These findings confirm that the typically conserved β8–α8 loop region of these enzymes influences xylan substrate specificity but not necessarily β-1,4-xylanase function. PMID:25372685

Leaf and Stem CO2 Uptake in the Three Subfamilies of the Cactaceae 1

PubMed Central

Nobel, Park S.; Hartsock, Terry L.

1986-01-01

Net CO2 uptake over 24-hour periods was examined for the leaves and for the stems of 11 species of cacti representing all three subfamilies. For Pereskia aculeata, Pereskia grandifolia, and Maihuenia poeppigii (subfamily Pereskioideae), all the net shoot CO2 uptake was by the leaves and during the daytime. In contrast, for the leafless species Carnegiea gigantea, Ferocactus acanthodes, Coryphantha vivipara, and Mammillaria dioica (subfamily Cactoideae), all the shoot net CO2 uptake was by the stems and at night. Similarly, for leafless Opuntia ficus-indica (subfamily Opuntioideae), all net CO2 uptake occurred at night. For leafy members of the Opuntioideae (Pereskiopsis porteri, Quiabentia chacoensis, Austrocylindropuntia subulata), at least 88% of the shoot CO2 uptake over 24 hours was by the leaves and some CO2 uptake occurred at night. Leaves responded to the instantaneous level of photosynthetically active radiation (PAR) during the daytime, as occurs for C3 plants, whereas nocturnal CO2 uptake by stems of O. ficus-indica and F. acanthodes responded to the total daily PAR, as occurs for Crassulacean acid metabolism (CAM) plants. Thus, under the well-watered conditions employed, the Pereskioideae behaved as C3 plants, the Cactoideae behaved as CAM plants, and the Opuntioideae exhibited characteristics of both pathways. PMID:16664741

Crystal Structure of Perakine Reductase, Founding Member of a Novel Aldo-Keto Reductase (AKR) Subfamily That Undergoes Unique Conformational Changes during NADPH Binding*

PubMed Central

Sun, Lianli; Chen, Yixin; Rajendran, Chitra; Mueller, Uwe; Panjikar, Santosh; Wang, Meitian; Mindnich, Rebekka; Rosenthal, Cindy; Penning, Trevor M.; Stöckigt, Joachim

2012-01-01

Perakine reductase (PR) catalyzes the NADPH-dependent reduction of the aldehyde perakine to yield the alcohol raucaffrinoline in the biosynthetic pathway of ajmaline in Rauvolfia, a key step in indole alkaloid biosynthesis. Sequence alignment shows that PR is the founder of the new AKR13D subfamily and is designated AKR13D1. The x-ray structure of methylated His6-PR was solved to 2.31 Å. However, the active site of PR was blocked by the connected parts of the neighbor symmetric molecule in the crystal. To break the interactions and obtain the enzyme-ligand complexes, the A213W mutant was generated. The atomic structure of His6-PR-A213W complex with NADPH was determined at 1.77 Å. Overall, PR folds in an unusual α8/β6 barrel that has not been observed in any other AKR protein to date. NADPH binds in an extended pocket, but the nicotinamide riboside moiety is disordered. Upon NADPH binding, dramatic conformational changes and movements were observed: two additional β-strands in the C terminus become ordered to form one α-helix, and a movement of up to 24 Å occurs. This conformational change creates a large space that allows the binding of substrates of variable size for PR and enhances the enzyme activity; as a result cooperative kinetics are observed as NADPH is varied. As the founding member of the new AKR13D subfamily, PR also provides a structural template and model of cofactor binding for the AKR13 family. PMID:22334702

New subfamilies of major intrinsic proteins in fungi suggest novel transport properties in fungal channels: implications for the host-fungal interactions

PubMed Central

2014-01-01

Background Aquaporins (AQPs) and aquaglyceroporins (AQGPs) belong to the superfamily of Major Intrinsic Proteins (MIPs) and are involved in the transport of water and neutral solutes across the membranes. MIP channels play significant role in plant-fungi symbiotic relationship and are believed to be important in host-pathogen interactions in human fungal diseases. In plants, at least five major MIP subfamilies have been identified. Fungal MIP subfamilies include orthodox aquaporins and five subgroups within aquaglyceroporins. XIP subfamily is common to both plants and fungi. In this study, we have investigated the extent of diversity in fungal MIPs and explored further evolutionary relationships with the plant MIP counterparts. Results We have extensively analyzed the available fungal genomes and examined nearly 400 fungal MIPs. Phylogenetic analysis and homology modeling exhibit the existence of a new MIP cluster distinct from any of the known fungal MIP subfamilies. All members of this cluster are found in microsporidia which are unicellular fungal parasites. Members of this family are small in size, charged and have hydrophobic residues in the aromatic/arginine selectivity filter and these features are shared by small and basic intrinsic proteins (SIPs), one of the plant MIP subfamilies. We have also found two new subfamilies (δ and γ2) within the AQGP group. Fungal AQGPs are the most diverse and possess the largest number of subgroups. We have also identified distinguishing features in loops E and D in the newly identified subfamilies indicating their possible role in channel transport and gating. Conclusions Fungal SIP-like MIP family is distinct from any of the known fungal MIP families including orthodox aquaporins and aquaglyceroporins. After XIPs, this is the second MIP subfamily from fungi that may have possible evolutionary link with a plant MIP subfamily. AQGPs in fungi are more diverse and possess the largest number of subgroups. The aromatic

Rational design and validation of a vanilloid-sensitive TRPV2 ion channel.

PubMed

Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie

2016-06-28

Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S-S498F-L505T-Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular "glue" that bridges the S4-S5 linker to the S1-S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor.

Phylogeny of Celastraceae subfamily Hippocrateoideae inferred from morphological characters and nuclear and plastid loci.

PubMed

Coughenour, Jennifer M; Simmons, Mark P; Lombardi, Julio A; Yakobson, Kendra; Archer, Robert H

2011-05-01

The phylogeny of Celastraceae subfamily Hippocrateoideae (∼ 100 species and 19 genera in the Old and New World tropics) was inferred using morphological characters together with plastid (matK, trnL-F) and nuclear (ITS and 26S rDNA) genes. The subfamily is easily recognized by the synapomorphies of transversely flattened, deeply lobed capsules and seeds with membranous basal wings or narrow stipes together with bisexual, 5-merous flowers that generally have an extrastaminal disk and three stamens. Hippocrateoideae, like Salacioideae, are inferred to have an Old World origin. The narrow stipes of Neotropical species that are water-dispersed are inferred to be derived within the subfamily from ancestral species with wind-dispersed winged seeds. Helictonema, a monotypic genus endemic to tropical Africa, has a small, white, spongy aril that is located at the base of the seed wing and appears to be unique within Hippocrateoideae. Our inference that Helictonema is sister to the remaining members of the subfamily, considered in the context of Sarawakodendron being sister to Salacioideae, suggests that small arils and capsular fruit were primitive within both subfamilies. The aril became dramatically enlarged within Salacioideae, in which the fruits are berries, and lost entirely within Hippocrateoideae, in which the fruits are transversely flattened capsules. All five Old World taxa of Prionostemma and all eight currently recognized species within Simirestis are transferred to Pristimera, one South African variety of Pristimera is raised to species level, and all three taxa in Pristimera subgenus Trochantha are transferred to the new genus Trochantha. Copyright © 2011 Elsevier Inc. All rights reserved.

The ZNF75 zinc finger gene subfamily: Isolation and mapping of the four members in humans and great apes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Villa, A.; Strina, D.; Frattini, A.

We have previously reported the characterization of the human ZNF75 gene located on Xq26, which has only limited homology (less than 65%) to other ZF genes in the databases. Here, we describe three human zinc finger genes with 86 to 95% homology to ZNF75 at the nucleotide level, which represent all the members of the human ZNF75 subfamily. One of these, ZNF75B, is a pseudogene mapped to chromosome 12q13. The other two, ZNF75A and ZNF75C, maintain on ORF in the sequenced region, and at least the latter is expressed in the U937 cell line. They were mapped to chromosomes 16more » and 11, respectively. All these genes are conserved in chimpanzees, gorillas, and orangutans. The ZNF75B homologue is a pseudogene in all three great apes, and in chimpanzee it is located on chromosome 10 (phylogenetic XII), at p13 (corresponding to the human 12q13). The chimpanzee homologue of ZNF75 is also located on the Xq26 chromosome, in the same region, as detected by in situ hybridization. As expected, nucleotide changes were clearly more abundant between human and organutan than between human and chimpanzee or gorilla homologues. Members of the same class were more similar to each other than to the other homologues within the same species. This suggests that the duplication and/or retrotranscription events occurred in a common ancestor long before great ape speciation. This, together with the existance of at least two genes in cows and horses, suggests a relatively high conservation of this gene family. 20 refs., 5 figs., 1 tab.« less

Characterisation of a collagen gene subfamily from the potato cyst nematode Globodera pallida.

PubMed

Gray, L J; Curtis, R H; Jones, J T

2001-01-24

We have isolated two full-length genomic DNA sequences, which encode the cuticle collagen proteins GP-COL-1 and GP-COL-2, from the potato cyst nematode Globodera pallida. A third, partial collagen gene ORF termed gp-col-t(t=truncated) has also been isolated and appears to represent an unexpressed pseudogene. The gp-col-1 and gp-col-2 genes both contain three short (<97 bp) introns which disrupt coding regions predicted to specify proteins with molecular weights of 33 and 32.7 kDa respectively. All three sequences show high similarity to each other and to the previously isolated G. pallida cDNA clone gp-col-8. The conserved pattern of cysteine residues and non-(Gly-X-Y)(n) region sequence similarity observed in all four G. pallida genes suggests that these molecules form part of the same subfamily of collagens. Southern analysis indicates that this subfamily is likely to contain further members. The G. pallida collagen sequences show striking similarity to twelve genes from Caenorhabditis elegans which collectively represent the recently classified Group 1a collagen subfamily. No data exists on the function of this subfamily in C. elegans. gp-col-1 and gp-col-2 are developmentally regulated with transcripts of both genes detected in adult virgin and gravid females but not in pre-parasitic second stage juveniles. A similar expression pattern is observed for the Group 1a collagen lemmi 5 from Meloidogyne incognita perhaps indicating a generic link between subfamily and function during the various changes in cuticular structure which accompany nematode growth and reproduction. Immunochemical studies indicate that the GP-COL-1 protein is specifically located in the hypodermis of G. pallida adult females.

Rational design and validation of a vanilloid-sensitive TRPV2 ion channel

PubMed Central

Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie

2016-01-01

Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S–S498F–L505T–Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular “glue” that bridges the S4–S5 linker to the S1–S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor. PMID:27298359

Genomic characterization of bacteriophage vB_PcaP_PP2 infecting Pectobacterium carotovorum subsp. carotovorum, a new member of a proposed genus in the subfamily Autographivirinae.

PubMed

Lim, Jeong-A; Heu, Sunggi; Park, Jinwoo; Roh, Eunjung

2017-08-01

Bacteriophage vB_PcaP_PP2 (PP2) is a novel virulent phage that infects the plant-pathogenic bacterium Pectobacterium carotovorum subsp. carotovorum. PP2 phage has a 41,841-bp double-stranded DNA encoding 47 proteins, and it was identified as a member of the family Podoviridae by transmission electron microscopy. Nineteen of its open reading frames (ORFs) show homology to functional proteins, and 28 ORFs have been characterized as hypothetical proteins. PP2 phage is homologous to Cronobacter phage vB_CskP_GAP227 and Dev-CD-23823. Based on phylogenetic analysis, PP2 and its homologous bacteriophages form a new group within the subfamily Autographivirinae in the family Podoviridae, suggesting the need to establish a new genus. No lysogenic-cycle-related genes or bacterial toxins were identified.

CYP3C1, the first member of a new cytochrome P450 subfamily found in zebrafish (Danio rerio).

PubMed

Corley-Smith, Graham E; Su, Hsiao-Ting; Wang-Buhler, Jun-Lan; Tseng, Hua-Pin; Hu, Chin-Hwa; Hoang, Thuy; Chung, Woon-Gye; Buhler, Donald R

2006-02-24

We report a new cytochrome P450 (CYP) subfamily CYP3C and the cloning through PCR from zebrafish (Danio rerio) of the first member, CYP3C1. The CYP3C1 gene is on Chromosome 3 with 13 ORF exons encoding a 505 amino acid protein which has 44-54% identities with mammalian and teleost CYP3A and CYP3B forms. As evidenced by spectral analysis, the CYP3C1 protein heterologously expressed in yeast is functional. In silico analysis identified, on the same region of the chromosome, three more genes encoding CYP3C1-like proteins that formed a clade with CYP3C1 in a phylogenetic tree. Using RT-PCR, the CYP3C1 mRNA was detected in 1-6dpf embryo/larvae and in adult fish liver and seven extrahepatic tissues. Whole-mount in situ hybridization using a riboprobe demonstrated expression in the brain during 12-120 hpf. At the 120 hpf larval stage, CYP3C1 mRNA was also detected in the pharynx and gastrointestinal tract. TCDD, dexamethasone, and rifampicin, which up-regulated CYP3A65 mRNA in zebrafish larvae, did not alter the CYP3C1 transcript levels suggesting regulatory differences between CYP3A and CYP3C enzymes in this species.

Characterization of two-step deglycosylation via oxidation by glycoside oxidoreductase and defining their subfamily

PubMed Central

Kim, Eun-Mi; Seo, Joo-Hyun; Baek, Kiheon; Kim, Byung-Gee

2015-01-01

Herein, we report a two-step deglycosylation mediated by the oxidation of glycoside which is different from traditional glycoside hydrolase (GH) mechanism. Previously, we reported a novel flavin adenine dinucleotide (FAD)-dependent glycoside oxidoreductase (FAD-GO) having deglycosylation activity. Various features of the reaction of FAD-GO such as including mechanism and catalytic residue and substrate specificity were studied. In addition, classification of novel FAD-GO subfamily was attempted. Deglycosylation of glycoside was performed spontaneously via oxidation of 3-OH of glycone moiety by FAD-GO mediated oxidation reaction. His493 residue was identified as a catalytic residue for the oxidation step. Interestingly, this enzyme has broad glycone and aglycon specificities. For the classification of FAD-GO enzyme subfamily, putative FAD-GOs were screened based on the FAD-GO from Rhizobium sp. GIN611 (gi 365822256) using BLAST search. The homologs of R. sp. GIN611 included the putative FAD-GOs from Stenotrophomonas strains, Sphingobacterium strains, Agrobacterium tumefaciens str. C58, and etc. All the cloned FAD-GOs from the three strains catalyzed the deglycosylation via enzymatic oxidation. Based on their substrate specificities, deglycosylation and oxidation activities to various ginsenosides, the FAD-GO subfamily members can be utilized as novel biocatalysts for the production of various aglycones. PMID:26057169

Transient receptor potential melastatin subfamily member 2 cation channel regulates detrimental immune cell invasion in ischemic stroke.

PubMed

Gelderblom, Mathias; Melzer, Nico; Schattling, Benjamin; Göb, Eva; Hicking, Gordon; Arunachalam, Priyadharshini; Bittner, Stefan; Ufer, Friederike; Herrmann, Alexander M; Bernreuther, Christian; Glatzel, Markus; Gerloff, Christian; Kleinschnitz, Christoph; Meuth, Sven G; Friese, Manuel A; Magnus, Tim

2014-11-01

Brain injury during stroke results in oxidative stress and the release of factors that include extracellular Ca(2+), hydrogen peroxide, adenosine diphosphate ribose, and nicotinic acid adenine dinucleotide phosphate. These alterations of the extracellular milieu change the activity of transient receptor potential melastatin subfamily member 2 (TRPM2), a nonselective cation channel expressed in the central nervous system and the immune system. Our goal was to evaluate the contribution of TRPM2 to the tissue damage after stroke. In accordance with current quality guidelines, we independently characterized Trpm2 in a murine ischemic stroke model in 2 different laboratories. Gene deficiency of Trpm2 resulted in significantly improved neurological outcome and decreased infarct size. Besides an already known moderate neuroprotective effect of Trpm2 deficiency in vitro, ischemic brain invasion by neutrophils and macrophages was particularly reduced in Trpm2-deficient mice. Bone marrow chimeric mice revealed that Trpm2 deficiency in the peripheral immune system is responsible for the protective phenotype. Furthermore, experiments with mixed bone marrow chimeras demonstrated that Trpm2 is essential for the migration of neutrophils and, to a lesser extent, also of macrophages into ischemic hemispheres. Notably, the pharmacological TRPM2 inhibitor, N-(p-amylcinnamoyl)anthranilic acid, was equally protective in the stroke model. Although a neuroprotective effect of TRPM2 in vitro is well known, we can show for the first time that the detrimental role of TRPM2 in stroke primarily depends on its role in activating peripheral immune cells. Targeting TRPM2 systemically represents a promising therapeutic approach for ischemic stroke. © 2014 American Heart Association, Inc.

Crystal structure of Staphylococcus aureus Zn-glyoxalase I: new subfamily of glyoxalase I family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chirgadze, Yuri N.; Boshkova, Eugenia A.; Battaile, Kevin P.

The crystal structures of protein SA0856 from Staphylococcus aureus in its apo-form and in complex with a Zn2+-ion have been presented. The 152 amino acid protein consists of two similar domains with α + β topology. In both crystalline state and in solution, the protein forms a dimer with monomers related by a twofold pseudo-symmetry rotation axis. A sequence homology search identified the protein as a member of the structural family Glyoxalase I. We have shown that the enzyme possesses glyoxalase I activity in the presence of Zn2+, Mg2+, Ni2+, and Co2+, in this order of preference. Sequence and structuremore » comparisons revealed that human glyoxalase I should be assigned to a subfamily A, while S. aureus glyoxalase I represents a new subfamily B, which includes also proteins from other bacteria. Both subfamilies have a similar protein chain fold but rather diverse sequences. The active sites of human and staphylococcus glyoxalases I are also different: the former contains one Zn-ion per chain; the latter incorporates two of these ions. In the active site of SA0856, the first Zn-ion is well coordinated by His58, Glu60 from basic molecule and Glu40*, His44* from adjacent symmetry-related molecule. The second Zn3-ion is coordinated only by residue His143 from protein molecule and one acetate ion. We suggest that only single Zn1-ion plays the role of catalytic center. The newly found differences between the two subfamilies could guide the design of new drugs against S. aureus, an important pathogenic micro-organism.« less

Functional transient receptor potential vanilloid 1 and transient receptor potential vanilloid 4 channels along different segments of the renal vasculature.

PubMed

Chen, L; Kaßmann, M; Sendeski, M; Tsvetkov, D; Marko, L; Michalick, L; Riehle, M; Liedtke, W B; Kuebler, W M; Harteneck, C; Tepel, M; Patzak, A; Gollasch, M

2015-02-01

Transient receptor potential vanilloid 1 (TRPV1) and vanilloid 4 (TRPV4) cation channels have been recently identified to promote endothelium-dependent relaxation of mouse mesenteric arteries. However, the role of TRPV1 and TRPV4 in the renal vasculature is largely unknown. We hypothesized that TRPV1/4 plays a role in endothelium-dependent vasodilation of renal blood vessels. We studied the distribution of functional TRPV1/4 along different segments of the renal vasculature. Mesenteric arteries were studied as control vessels. The TRPV1 agonist capsaicin relaxed mouse mesenteric arteries with an EC50 of 25 nm, but large mouse renal arteries or rat descending vasa recta only at >100-fold higher concentrations. The vasodilatory effect of capsaicin in the low-nanomolar concentration range was endothelium-dependent and absent in vessels of Trpv1 -/- mice. The TRPV4 agonist GSK1016790A relaxed large conducting renal arteries, mesenteric arteries and vasa recta with EC50 of 18, 63 nm and ~10 nm respectively. These effects were endothelium-dependent and inhibited by a TRPV4 antagonist, AB159908 (10 μm). Capsaicin and GSK1016790A produced vascular dilation in isolated mouse perfused kidneys with EC50 of 23 and 3 nm respectively. The capsaicin effects were largely reduced in Trpv1 -/- kidneys, and the effects of GSK1016790A were inhibited in Trpv4 -/- kidneys. Our results demonstrate that two TRPV channels have unique sites of vasoregulatory function in the kidney with functional TRPV1 having a narrow, discrete distribution in the resistance vasculature and TRPV4 having more universal, widespread distribution along different vascular segments. We suggest that TRPV1/4 channels are potent therapeutic targets for site-specific vasodilation in the kidney. © 2014 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.

Sex differences in mouse Transient Receptor Potential Cation Channel, Subfamily M, Member 8 expressing trigeminal ganglion neurons

PubMed Central

Caudle, Stephanie L.; Jenkins, Alan C.; Ahn, Andrew H.; Neubert, John K.

2017-01-01

The detection of cool temperatures is thought to be mediated by primary afferent neurons that express the cool temperature sensing protein Transient Receptor Potential Cation Channel, Subfamily M, Member 8 (TRPM8). Using mice, this study tested the hypothesis that sex differences in sensitivity to cool temperatures were mediated by differences in neurons that express TRPM8. Ion currents from TRPM8 expressing trigeminal ganglion (TRG) neurons in females demonstrated larger hyperpolarization-activated cyclic nucleotide-gated currents (Ih) than male neurons at both 30° and 18°C. Additionally, female neurons’ voltage gated potassium currents (Ik) were suppressed by cooling, whereas male Ik was not significantly affected. At the holding potential tested (-60mV) TRPM8 currents were not visibly activated in either sex by cooling. Modeling the effect of Ih and Ik on membrane potentials demonstrated that at 30° the membrane potential in both sexes is unstable. At 18°, female TRPM8 TRG neurons develop a large oscillating pattern in their membrane potential, whereas male neurons become highly stable. These findings suggest that the differences in Ih and Ik in the TRPM8 TRG neurons of male and female mice likely leads to greater sensitivity of female mice to the cool temperature. This hypothesis was confirmed in an operant reward/conflict assay. Female mice contacted an 18°C surface for approximately half the time that males contacted the cool surface. At 33° and 10°C male and female mice contacted the stimulus for similar amounts of time. These data suggest that sex differences in the functioning of Ih and Ik in TRPM8 expressing primary afferent neurons leads to differences in cool temperature sensitivity. PMID:28472061

Expression Profiling of Nuclear Receptors Identifies Key Roles of NR4A Subfamily in Uterine Fibroids

PubMed Central

Yin, Hanwei; Lo, Jay H.; Kim, Ji-Young; Marsh, Erica E.; Kim, J. Julie; Ghosh, Asish K.; Bulun, Serdar

2013-01-01

Uterine fibroids (UFs), also known as uterine leiomyomas, are benign, fibrotic smooth muscle tumors. Although the GnRH analog leuprolide acetate that suppresses gonadal steroid hormones is used as a treatment, it has significant side effects, thereby limiting its use. Availability of more effective therapy is limited because of a lack of understanding of molecular underpinnings of the disease. Although ovarian steroid hormones estrogen and progesterone and their receptors are clearly involved, the role of other nuclear receptors (NRs) in UFs is not well defined. We used quantitative real-time PCR to systematically profile the expression of 48 NRs and identified several NRs that were aberrantly expressed in UFs. Among others, expression of NR4A subfamily members including NGFIB (NR4A1), NURR1 (NR4A2), and NOR1 (NR4A3) were dramatically suppressed in leiomyoma compared with the matched myometrium. Restoration of expression of each of these NR4A members in the primary leiomyoma smooth muscle cells decreased cell proliferation. Importantly, NR4As regulate expressions of the profibrotic factors including TGFβ3 and SMAD3, and several collagens that are key components of the extracellular matrix. Finally, we identify NR4A members as targets of leuprolide acetate treatment. Together, our results implicate several NRs including the NR4A subfamily in leiomyoma etiology and identify NR4As as potential therapeutic targets for treating fibrotic diseases. PMID:23550059

Identification and Characterization of Three Orchid MADS-Box Genes of the AP1/AGL9 Subfamily during Floral Transition1

PubMed Central

Yu, Hao; Goh, Chong Jin

2000-01-01

Gene expressions associated with in vitro floral transition in an orchid hybrid (Dendrobium grex Madame Thong-In) were investigated by differential display. One clone, orchid transitional growth related gene 7 (otg7), encoding a new MADS-box gene, was identified to be specifically expressed in the transitional shoot apical meristem (TSAM). Using this clone as a probe, three orchid MADS-box genes, DOMADS1, DOMADS2, and DOMADS3, were subsequently isolated from the TSAM cDNA library. Phylogenetic analyses show that DOMADS1 and DOMADS2 are new members of the AGL2 subfamily and SQUA subfamily, respectively. DOMADS3 contains the signature amino acids as with the members in the independent OSMADS1 subfamily separated from the AGL2 subfamily. All three of the DOMADS genes were expressed in the TSAM during floral transition and later in mature flowers. DOMADS1 RNA was uniformly expressed in both of the inflorescence meristem and the floral primordium and later localized in all of the floral organs. DOMADS2 showed a novel expression pattern that has not been previously characterized for any other MADS-box genes. DOMADS2 transcript was expressed early in the 6-week-old vegetative shoot apical meristem in which the obvious morphological change to floral development had yet to occur. It was expressed throughout the process of floral transition and later in the columns of mature flowers. The onset of DOMADS3 transcription was in the early TSAM at the stage before the differentiation of the first flower primordium. Later, DOMADS3 transcript was only detectable in the pedicel tissues. Our results suggest that the DOMADS genes play important roles in the process of floral transition. PMID:10938351

Identification and analysis of evolutionary selection pressures acting at the molecular level in five forkhead subfamilies.

PubMed

Fetterman, Christina D; Rannala, Bruce; Walter, Michael A

2008-09-24

Members of the forkhead gene family act as transcription regulators in biological processes including development and metabolism. The evolution of forkhead genes has not been widely examined and selection pressures at the molecular level influencing subfamily evolution and differentiation have not been explored. Here, in silico methods were used to examine selection pressures acting on the coding sequence of five multi-species FOX protein subfamily clusters; FoxA, FoxD, FoxI, FoxO and FoxP. Application of site models, which estimate overall selection pressures on individual codons throughout the phylogeny, showed that the amino acid changes observed were either neutral or under negative selection. Branch-site models, which allow estimated selection pressures along specified lineages to vary as compared to the remaining phylogeny, identified positive selection along branches leading to the FoxA3 and Protostomia clades in the FoxA cluster and the branch leading to the FoxO3 clade in the FoxO cluster. Residues that may differentiate paralogs were identified in the FoxA and FoxO clusters and residues that differentiate orthologs were identified in the FoxA cluster. Neutral amino acid changes were identified in the forkhead domain of the FoxA, FoxD and FoxP clusters while positive selection was identified in the forkhead domain of the Protostomia lineage of the FoxA cluster. A series of residues under strong negative selection adjacent to the N- and C-termini of the forkhead domain were identified in all clusters analyzed suggesting a new method for refinement of domain boundaries. Extrapolation of domains among cluster members in conjunction with selection pressure information allowed prediction of residue function in the FoxA, FoxO and FoxP clusters and exclusion of known domain function in residues of the FoxA and FoxI clusters. Consideration of selection pressures observed in conjunction with known functional information allowed prediction of residue function and

Transient receptor potential cation channel, subfamily V, member 4 and airway sensory afferent activation: Role of adenosine triphosphate.

PubMed

Bonvini, Sara J; Birrell, Mark A; Grace, Megan S; Maher, Sarah A; Adcock, John J; Wortley, Michael A; Dubuis, Eric; Ching, Yee-Man; Ford, Anthony P; Shala, Fisnik; Miralpeix, Montserrat; Tarrason, Gema; Smith, Jaclyn A; Belvisi, Maria G

2016-07-01

Sensory nerves innervating the airways play an important role in regulating various cardiopulmonary functions, maintaining homeostasis under healthy conditions and contributing to pathophysiology in disease states. Hypo-osmotic solutions elicit sensory reflexes, including cough, and are a potent stimulus for airway narrowing in asthmatic patients, but the mechanisms involved are not known. Transient receptor potential cation channel, subfamily V, member 4 (TRPV4) is widely expressed in the respiratory tract, but its role as a peripheral nociceptor has not been explored. We hypothesized that TRPV4 is expressed on airway afferents and is a key osmosensor initiating reflex events in the lung. We used guinea pig primary cells, tissue bioassay, in vivo electrophysiology, and a guinea pig conscious cough model to investigate a role for TRPV4 in mediating sensory nerve activation in vagal afferents and the possible downstream signaling mechanisms. Human vagus nerve was used to confirm key observations in animal tissues. Here we show TRPV4-induced activation of guinea pig airway-specific primary nodose ganglion cells. TRPV4 ligands and hypo-osmotic solutions caused depolarization of murine, guinea pig, and human vagus and firing of Aδ-fibers (not C-fibers), which was inhibited by TRPV4 and P2X3 receptor antagonists. Both antagonists blocked TRPV4-induced cough. This study identifies the TRPV4-ATP-P2X3 interaction as a key osmosensing pathway involved in airway sensory nerve reflexes. The absence of TRPV4-ATP-mediated effects on C-fibers indicates a distinct neurobiology for this ion channel and implicates TRPV4 as a novel therapeutic target for neuronal hyperresponsiveness in the airways and symptoms, such as cough. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Regression of atherosclerosis with apple procyanidins by activating the ATP-binding cassette subfamily A member 1 in a rabbit model.

PubMed

Wang, Liang; Fumoto, Toshio; Masumoto, Saeko; Shoji, Toshihiko; Miura, Tomisato; Naraoka, Masato; Matsuda, Naoya; Imaizumi, Tadaatsu; Ohkuma, Hiroki

2017-03-01

Apple polyphenol contains abundant procyanidins, which have been associated with an anti-atherosclerosis and cholesterol-lowering effect. The aim of this study was to investigate whether apple procyanidins (APCs) feature therapeutic efficacy in terms of regressing atherosclerosis and whether this efficacy is due to mechanisms other than a cholesterol-lowering effect. After eight weeks on an atherogenic diet, rabbits were given a normal diet for another eight weeks to normalize the increased serum lipids level. The rabbits in the baseline group were sacrificed at this stage. The control group was subsequently fed a normal diet for eight weeks, while the APCs group was administrated 50 mg/kg/day of APCs in addition to the normal diet. Serum lipids and aortic intimal-medial thickness (IMT) were serially examined, and the resected aorta was examined histologically and through molecular biology. Aortic IMT on ultrasonography and the lipid accumulation area examined using Sudan IV staining were significantly reduced in the APCs group as compared to the control group. Serum lipid profiles were not different between the groups. Immunohistochemistry showed significantly decreased staining of an oxidative stress marker and significantly increased staining of ATP-binding cassette subfamily A member 1 (ABCA1) in the APCs group. Western blotting and RT-PCR also showed increased expression of ABCA1 mRNA and its protein in the APCs group. This study revealed that APCs administration causes a regression of atherosclerosis. APCs might hold promise as an anti-atherosclerotic agent. Copyright © 2017 Elsevier B.V. All rights reserved.

The StarD4 subfamily of steroidogenic acute regulatory-related lipid transfer (START) domain proteins: new players in cholesterol metabolism

PubMed Central

Calderon-Dominguez, Maria; Gil, Gregorio; Medina, Miguel Angel; Pandak, William M.; Rodríguez-Agudo, Daniel

2014-01-01

Cholesterol levels in the body are maintained through the coordinated regulation of its uptake, synthesis, distribution, storage and efflux. However, the way cholesterol is sorted within cells remains poorly defined. The discovery of the newly described StarD4 subfamily, part of the steroidogenic acute regulatory lipid transfer (START) domain family of proteins, affords an opportunity for the study of intracellular cholesterol movement, metabolism and its disorders. The three members of this intracelular subfamily of proteins (StarD4, StarD5 and StarD6) have a similar lipid binding pocket specific for sterols (cholesterol in particular), but differing regulation and localization. The ability to bind and transport cholesterol through a non-vesicular mean suggests that they play a previously unappreciated role in cholesterol homeostasis. PMID:24440759

Dense transient receptor potential cation channel, vanilloid family, type 2 (TRPV2) immunoreactivity defines a subset of motoneurons in the dorsal lateral nucleus of the spinal cord, the nucleus ambiguus and the trigeminal motor nucleus in rat.

PubMed

Lewinter, R D; Scherrer, G; Basbaum, A I

2008-01-02

The transient receptor potential cation channel, vanilloid family, type 2 (TRPV2) is a member of the TRPV family of proteins and is a homologue of the capsaicin/vanilloid receptor (transient receptor potential cation channel, vanilloid family, type 1, TRPV1). Like TRPV1, TRPV2 is expressed in a subset of dorsal root ganglia (DRG) neurons that project to superficial laminae of the spinal cord dorsal horn. Because noxious heat (>52 degrees C) activates TRPV2 in transfected cells this channel has been implicated in the processing of high intensity thermal pain messages in vivo. In contrast to TRPV1, however, which is restricted to small diameter DRG neurons, there is significant TRPV2 immunoreactivity in a variety of CNS regions. The present report focuses on a subset of neurons in the brainstem and spinal cord of the rat including the dorsal lateral nucleus (DLN) of the spinal cord, the nucleus ambiguus, and the motor trigeminal nucleus. Double label immunocytochemistry with markers of motoneurons, combined with retrograde labeling, established that these cells are, in fact, motoneurons. With the exception of their smaller diameter, these cells did not differ from other motoneurons, which are only lightly TRPV2-immunoreactive. As for the majority of DLN neurons, the densely-labeled populations co-express androgen receptor and follow normal DLN ontogeny. The functional significance of the very intense TRPV2 expression in these three distinct spinal cord and brainstem motoneurons groups remains to be determined.

Inferences of biogeographical histories within subfamily Hyacinthoideae using S-DIVA and Bayesian binary MCMC analysis implemented in RASP (Reconstruct Ancestral State in Phylogenies)

PubMed Central

Ali, Syed Shujait; Yu, Yan; Pfosser, Martin; Wetschnig, Wolfgang

2012-01-01

Background and Aims Subfamily Hyacinthoideae (Hyacinthaceae) comprises more than 400 species. Members are distributed in sub-Saharan Africa, Madagascar, India, eastern Asia, the Mediterranean region and Eurasia. Hyacinthoideae, like many other plant lineages, show disjunct distribution patterns. The aim of this study was to reconstruct the biogeographical history of Hyacinthoideae based on phylogenetic analyses, to find the possible ancestral range of Hyacinthoideae and to identify factors responsible for the current disjunct distribution pattern. Methods Parsimony and Bayesian approaches were applied to obtain phylogenetic trees, based on sequences of the trnL-F region. Biogeographical inferences were obtained by applying statistical dispersal-vicariance analysis (S-DIVA) and Bayesian binary MCMC (BBM) analysis implemented in RASP (Reconstruct Ancestral State in Phylogenies). Key Results S-DIVA and BBM analyses suggest that the Hyacinthoideae clade seem to have originated in sub-Saharan Africa. Dispersal and vicariance played vital roles in creating the disjunct distribution pattern. Results also suggest an early dispersal to the Mediterranean region, and thus the northward route (from sub-Saharan Africa to Mediterranean) of dispersal is plausible for members of subfamily Hyacinthoideae. Conclusions Biogeographical analyses reveal that subfamily Hyacinthoideae has originated in sub-Saharan Africa. S-DIVA indicates an early dispersal event to the Mediterranean region followed by a vicariance event, which resulted in Hyacintheae and Massonieae tribes. By contrast, BBM analysis favours dispersal to the Mediterranean region, eastern Asia and Europe. Biogeographical analysis suggests that sub-Saharan Africa and the Mediterranean region have played vital roles as centres of diversification and radiation within subfamily Hyacinthoideae. In this bimodal distribution pattern, sub-Saharan Africa is the primary centre of diversity and the Mediterranean region is the

TRPV3 in Drug Development

PubMed Central

Broad, Lisa M.; Mogg, Adrian J.; Eberle, Elizabeth; Tolley, Marcia; Li, Dominic L.; Knopp, Kelly L.

2016-01-01

Transient receptor potential vanilloid 3 (TRPV3) is a member of the TRP (Transient Receptor Potential) super-family. It is a relatively underexplored member of the thermo-TRP sub-family (Figure 1), however, genetic mutations and use of gene knock-outs and selective pharmacological tools are helping to provide insights into its role and therapeutic potential. TRPV3 is highly expressed in skin, where it is implicated in skin physiology and pathophysiology, thermo-sensing and nociception. Gain of function TRPV3 mutations in rodent and man have enabled the role of TRPV3 in skin health and disease to be particularly well defined. Pre-clinical studies provide some rationale to support development of TRPV3 antagonists for therapeutic application for the treatment of inflammatory skin conditions, itch and pain. However, to date, only one compound directed towards block of the TRPV3 receptor (GRC15300) has progressed into clinical trials. Currently, there are no known clinical trials in progress employing a TRPV3 antagonist. PMID:27618069

Immunolocalization and distribution of functional temperature-sensitive TRP channels in salivary glands.

PubMed

Sobhan, Ubaidus; Sato, Masaki; Shinomiya, Takashi; Okubo, Migiwa; Tsumura, Maki; Muramatsu, Takashi; Kawaguchi, Mitsuru; Tazaki, Masakazu; Shibukawa, Yoshiyuki

2013-11-01

Transient receptor potential (TRP) cation channels are unique cellular sensors involved in multiple cellular functions. Their role in salivary secretion remains to be elucidated. The expression and localization of temperature-sensitive TRP channels in salivary (submandibular, sublingual and parotid) glands were analyzed by immunohistochemistry and quantitative real-time reverse transcription plus the polymerase chain reaction (RT-PCR). The effects of various TRP channel agonists on carbachol (CCh)-induced salivary secretion in the submandibular gland and on the intracellular Ca(2+) concentration ([Ca(2+)]i) in a submandibular epithelial cell line were also investigated. Immunohistochemistry revealed the expression of TRP-melastatin subfamily member 8 (TRPM8) and TRP-ankyrin subfamily member 1 (TRPA1) in myoepithelial, acinar and ductal cells in the sublingual, submandibular and parotid glands. In addition, TRP-vanilloid subfamily member 1 (TRPV1), TRPV3 and TRPV4 were also expressed in myoepithelial, acinar and ductal cells in all three types of gland. Quantitative real-time RT-PCR results demonstrated the mRNA expression of TRPV1, TRPV3, TRPV4, TRPM8 and TRPA1 in acinar and ductal cells in these salivary glands. Perfusion of the entire submandibular gland with the TRPV1 agonist capsaicin (1 μM) via the submandibular artery significantly increased CCh-induced salivation, whereas perfusion with TRPM8 and TRPA1 agonists (0.5 μM WS12 and 100 μM allyl isothiocyanate) decreased it. Application of agonists for each of the thermosensitive TRP channels increased [Ca(2+)]i in a submandibular epithelial cell line. These results indicate that temperature-sensitive TRP channels are localized and distributed in acinar, ductal and myoepithelial cells in salivary glands and that they play a functional role in the regulation and/or modulation of salivary secretion.

Up-regulation of the fibroblast growth factor 8 subfamily in human hepatocellular carcinoma for cell survival and neoangiogenesis.

PubMed

Gauglhofer, Christine; Sagmeister, Sandra; Schrottmaier, Waltraud; Fischer, Carina; Rodgarkia-Dara, Chantal; Mohr, Thomas; Stättner, Stefan; Bichler, Christoph; Kandioler, Daniela; Wrba, Fritz; Schulte-Hermann, Rolf; Holzmann, Klaus; Grusch, Michael; Marian, Brigitte; Berger, Walter; Grasl-Kraupp, Bettina

2011-03-01

Fibroblast growth factors (FGFs) and their high-affinity receptors [fibroblast growth factor receptors (FGFRs)] contribute to autocrine and paracrine growth stimulation in several non-liver cancer entities. Here we report that at least one member of the FGF8 subfamily (FGF8, FGF17, and FGF18) was up-regulated in 59% of 34 human hepatocellular carcinoma (HCC) samples that we investigated. The levels of the corresponding receptors (FGFR2, FGFR3, and FGFR4) were also elevated in the great majority of the HCC cases. Overall, 82% of the HCC cases showed overexpression of at least one FGF and/or FGFR. The functional implications of the deregulated FGF/FGFR system were investigated by the simulation of an insufficient blood supply. When HCC-1.2, HepG2, or Hep3B cells were subjected to serum withdrawal or the hypoxia-mimetic drug deferoxamine mesylate, the expression of FGF8 subfamily members increased dramatically. In the serum-starved cells, the incidence of apoptosis was elevated, whereas the addition of FGF8, FGF17, or FGF18 impaired apoptosis, which was associated with phosphorylation of extracellular signal-regulated kinase 1/2 and ribosomal protein S6. In contrast, down-modulation of FGF18 by small interfering RNA (siRNA) significantly reduced the viability of the hepatocarcinoma cells. siRNA targeting FGF18 also impaired the cells' potential to form clones at a low cell density or in soft agar. With respect to the tumor microenvironment, FGF17 and FGF18 stimulated the growth of HCC-derived myofibroblasts, and FGF8, FGF17, and FGF18 induced the proliferation and tube formation of hepatic endothelial cells. FGF8, FGF17, and FGF18 are involved in autocrine and paracrine signaling in HCC and enhance the survival of tumor cells under stress conditions, malignant behavior, and neoangiogenesis. Thus, the FGF8 subfamily supports the development and progression of hepatocellular malignancy. Copyright © 2010 American Association for the Study of Liver Diseases.

Characterization of calmodulin binding domains in TRPV2 and TRPV5 C-tails.

PubMed

Holakovska, Blanka; Grycova, Lenka; Bily, Jan; Teisinger, Jan

2011-02-01

The transient receptor potential channels TRPV2 and TRPV5 belong to the vanilloid TRP subfamily. TRPV2 is highly similar to TRPV1 and shares many common properties with it. TRPV5 (and also its homolog TRPV6) is a rather distinct member of the TRPV subfamily. It is distant for being strictly Ca(2+)-selective and features quite different properties from the rest of the TRPV subfamily. It is known that TRP channels are regulated by calmodulin in a calcium-dependent manner. In our study we identified a calmodulin binding site on the C-termini of TRPV2 (654-683) and TRPV5 (587-616) corresponding to the consensus CaM binding motif 1-5-10. The R679 and K681 single mutants of TRPV2 caused a 50% decrease in binding affinity and a double mutation of K661/K664 of the same peptide lowered the binding affinity by up to 75%. A double mutation of R606/K607 and triple mutation of R594/R606/R610 in TRPV5 C-terminal peptide resulted in the total loss of binding affinity to calmodulin. These results demonstrate that the TRPV2 C-tail and TRPV5 C-tail contain calmodulin binding sites and that the basic residues are strongly involved in TRP channel binding to calmodulin.

Coarse Architecture of the Transient Receptor Potential Vanilloid 1 (TRPV1) Ion Channel Determined by Fluorescence Resonance Energy Transfer*

PubMed Central

De-la-Rosa, Víctor; Rangel-Yescas, Gisela E.; Ladrón-de-Guevara, Ernesto; Rosenbaum, Tamara; Islas, León D.

2013-01-01

The transient receptor potential vanilloid 1 ion channel is responsible for the perception of high temperatures and low extracellular pH, and it is also involved in the response to some pungent compounds. Importantly, it is also associated with the perception of pain and noxious stimuli. Here, we attempt to discern the molecular organization and location of the N and C termini of the transient receptor potential vanilloid 1 ion channel by measuring FRET between genetically attached enhanced yellow and cyan fluorescent protein to the N or C terminus of the channel protein, expressed in transfected HEK 293 cells or Xenopus laevis oocytes. The static measurements of the domain organization were mapped into an available cryo-electron microscopy density of the channel with good agreement. These measurements also provide novel insights into the organization of terminal domains and their proximity to the plasma membrane. PMID:23965996

Coarse architecture of the transient receptor potential vanilloid 1 (TRPV1) ion channel determined by fluorescence resonance energy transfer.

PubMed

De-la-Rosa, Víctor; Rangel-Yescas, Gisela E; Ladrón-de-Guevara, Ernesto; Rosenbaum, Tamara; Islas, León D

2013-10-11

The transient receptor potential vanilloid 1 ion channel is responsible for the perception of high temperatures and low extracellular pH, and it is also involved in the response to some pungent compounds. Importantly, it is also associated with the perception of pain and noxious stimuli. Here, we attempt to discern the molecular organization and location of the N and C termini of the transient receptor potential vanilloid 1 ion channel by measuring FRET between genetically attached enhanced yellow and cyan fluorescent protein to the N or C terminus of the channel protein, expressed in transfected HEK 293 cells or Xenopus laevis oocytes. The static measurements of the domain organization were mapped into an available cryo-electron microscopy density of the channel with good agreement. These measurements also provide novel insights into the organization of terminal domains and their proximity to the plasma membrane.

The vanilloid receptor TRPV1 is tonically activated in vivo and involved in body temperature regulation.

PubMed

Gavva, Narender R; Bannon, Anthony W; Surapaneni, Sekhar; Hovland, David N; Lehto, Sonya G; Gore, Anu; Juan, Todd; Deng, Hong; Han, Bora; Klionsky, Lana; Kuang, Rongzhen; Le, April; Tamir, Rami; Wang, Jue; Youngblood, Brad; Zhu, Dawn; Norman, Mark H; Magal, Ella; Treanor, James J S; Louis, Jean-Claude

2007-03-28

The vanilloid receptor TRPV1 (transient receptor potential vanilloid 1) is a cation channel that serves as a polymodal detector of pain-producing stimuli such as capsaicin, protons (pH <5.7), and heat. TRPV1 antagonists block pain behaviors in rodent models of inflammatory, neuropathic, and cancer pain, suggesting their utility as analgesics. Here, we report that TRPV1 antagonists representing various chemotypes cause an increase in body temperature (hyperthermia), identifying a potential issue for their clinical development. Peripheral restriction of antagonists did not eliminate hyperthermia, suggesting that the site of action is predominantly outside of the blood-brain barrier. Antagonists that are ineffective against proton activation also caused hyperthermia, indicating that blocking capsaicin and heat activation of TRPV1 is sufficient to produce hyperthermia. All TRPV1 antagonists evaluated here caused hyperthermia, suggesting that TRPV1 is tonically activated in vivo and that TRPV1 antagonism and hyperthermia are not separable. TRPV1 antagonists caused hyperthermia in multiple species (rats, dogs, and monkeys), demonstrating that TRPV1 function in thermoregulation is conserved from rodents to primates. Together, these results indicate that tonic TRPV1 activation regulates body temperature.

Essential-Oil Constituents and Alkanes of Cephalaria ambrosioides Roem. & Schult. (Family Caprifoliaceae, Subfamily Dipsacaceae) and (Chemo)taxonomic Discernment of the Subfamilies Dipsacaceae and Morinaceae.

PubMed

Vukićević, Dušan R; Stevanović, Dragana D; Genčić, Marija S; Blagojević, Polina D; Radulović, Niko S

2016-02-01

Herein, the results of the first study of the volatile and alkane profiles of Cephalaria ambrosioides Roem. & Schult. (Caprifoliaceae, subfamily Dipsacaceae) were reported. The GC-FID and GC/MS analyses of the essential oils hydrodistilled from leaves and stems (CA1) and flowers (CA2) of C. ambrosioides allowed the identification of 284 different components. The main compounds of the studied oil samples were palmitic acid (24.3 and 32.5% for CA1 and CA2, resp.), hexahydrofarnesyl acetone (1.4 and 10.8% for CA1 and CA2, resp.), (Z)-hex-3-en-1-ol (7.0 and <0.1% for CA1 and CA2, resp.), and linoleic acid (1.9 and 6.5% for CA1 and CA2, resp.). Essential-oil compositional data of selected plant species belonging to the Dipsacaceae (15) and Morinaceae (2) subfamilies were used to resolve taxonomical ambiguities regarding the genus Cephalaria and its infrageneric relations, especially concerning the subfamily Morinaceae (formerly a genus within Dipsacaceae). The results of multivariate statistical analyses (25 different essential-oil samples) supported the exclusion of Morina species from the Dipsacaceae subfamily. The relative abundances of alkanes from n-, iso-, and anteiso-series followed a (distorted) Gaussian-like distribution and suggested that the biosyntheses of n- and branched alkanes in C. ambrosioides are possibly not controlled by the same elongase. Also, the obtained results suggested that there was a difference in the biosynthesis/accumulation of alkanes in the vegetative and reproductive parts of C. ambrosioides. Copyright © 2016 Verlag Helvetica Chimica Acta AG, Zürich.

Gingerols: a novel class of vanilloid receptor (VR1) agonists

PubMed Central

Dedov, Vadim N; Tran, Van H; Duke, Colin C; Connor, Mark; Christie, MacDonald J; Mandadi, Sravan; Roufogalis, Basil D

2002-01-01

Gingerols, the pungent constituents of ginger, were synthesized and assessed as agonists of the capsaicin-activated VR1 (vanilloid) receptor. [6]-Gingerol and [8]-gingerol evoked capsaicin-like intracellular Ca2+ transients and ion currents in cultured DRG neurones. These effects of gingerols were blocked by capsazepine, the VR1 receptor antagonist. The potency of gingerols increased with increasing size of the side chain and with the overall hydrophobicity in the series. We conclude that gingerols represent a novel class of naturally occurring VR1 receptor agonists that may contribute to the medicinal properties of ginger, which have been known for centuries. The gingerol structure may be used as a template for the development of drugs acting as moderately potent activators of the VR1 receptor. PMID:12411409

Key to adults of North American genera of the subfamily Cecidomyiinae (Diptera: Cecidomyiidae)

USDA-ARS?s Scientific Manuscript database

Keys to the subfamilies of Cecidomyiidae and to the 150 genera of Cecidomyiinae known to occur in North America are presented. Information is given for each of the genera on distribution, number of species and habits. Patterns of general distribution for the subfamily are discussed. A glossary to an...

Intragastric Dai-Kenchu-To, a Japanese herbal medicine, stimulates colonic motility via transient receptor potential cation channel subfamily V member 1 in dogs.

PubMed

Kikuchi, Daisuke; Shibata, Chikashi; Imoto, Hirofumi; Naitoh, Takeshi; Miura, Koh; Unno, Michiaki

2013-08-01

Japanese herbal medicine, also known as Kampo, is used for various diseases in Japan. One of those medicines, Dai-Kenchu-To (DKT), is considered clinically effective for adhesive bowel obstruction and chronic constipation. Although scientific evidence of DKT to improve adhesive bowel obstruction was shown in several previous reports, mechanism of DKT to improve constipation remains unknown. Our aim was to study the effect of intragastric DKT on colonic motility and defecation, and the involvement of various receptors in DKT-induced colonic contractions. Five beagle dogs were instructed with serosal strain-gauge force transducers to measure circular muscle activity at the proximal, middle, and distal colon. Dogs are suitable for a present study to administer the drugs repeatedly to the same individual and look at its effect on colonic motility. We studied the effects of DKT (2.5 or 5 g) administered into the stomach on colonic motility. Muscarinic receptor antagonist atropine, nicotinic receptor antagonist hexamthonium, or 5-hydroxytryptamine-3 receptor antagonist ondansetron was injected intravenously 10 min before DKT administration. Capsazepine, an antagonist to transient receptor potential cation channel subfamily V member 1 (TRPV1), was administered into the stomach 5 min before DKT administration. Intragastric DKT (2.5 or 5 g) induced colonic contractions within 10 min after administration but did not induce defecation. Pretreatment with atropine, hexamthonium, ondansetron, or capsazepine inhibited DKT-induced colonic contractions. These results indicate that orally administered DKT stimulates colonic motility via TRPV1, muscarinic, nicotinic, and 5-hydroxytryptamine-3 receptors, thereby providing scientific support for the efficacy of oral DKT in chronic constipation.

CDD/SPARCLE: functional classification of proteins via subfamily domain architectures.

PubMed

Marchler-Bauer, Aron; Bo, Yu; Han, Lianyi; He, Jane; Lanczycki, Christopher J; Lu, Shennan; Chitsaz, Farideh; Derbyshire, Myra K; Geer, Renata C; Gonzales, Noreen R; Gwadz, Marc; Hurwitz, David I; Lu, Fu; Marchler, Gabriele H; Song, James S; Thanki, Narmada; Wang, Zhouxi; Yamashita, Roxanne A; Zhang, Dachuan; Zheng, Chanjuan; Geer, Lewis Y; Bryant, Stephen H

2017-01-04

NCBI's Conserved Domain Database (CDD) aims at annotating biomolecular sequences with the location of evolutionarily conserved protein domain footprints, and functional sites inferred from such footprints. An archive of pre-computed domain annotation is maintained for proteins tracked by NCBI's Entrez database, and live search services are offered as well. CDD curation staff supplements a comprehensive collection of protein domain and protein family models, which have been imported from external providers, with representations of selected domain families that are curated in-house and organized into hierarchical classifications of functionally distinct families and sub-families. CDD also supports comparative analyses of protein families via conserved domain architectures, and a recent curation effort focuses on providing functional characterizations of distinct subfamily architectures using SPARCLE: Subfamily Protein Architecture Labeling Engine. CDD can be accessed at https://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml. Published by Oxford University Press on behalf of Nucleic Acids Research 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Evolution of EF-hand calcium-modulated proteins. II. Domains of several subfamilies have diverse evolutionary histories

NASA Technical Reports Server (NTRS)

Nakayama, S.; Moncrief, N. D.; Kretsinger, R. H.

1992-01-01

In the first report in this series we described the relationships and evolution of 152 individual proteins of the EF-hand subfamilies. Here we add 66 additional proteins and define eight (CDC, TPNV, CLNB, LPS, DGK, 1F8, VIS, TCBP) new subfamilies and seven (CAL, SQUD, CDPK, EFH5, TPP, LAV, CRGP) new unique proteins, which we assume represent new subfamilies. The main focus of this study is the classification of individual EF-hand domains. Five subfamilies--calmodulin, troponin C, essential light chain, regulatory light chain, CDC31/caltractin--and three uniques--call, squidulin, and calcium-dependent protein kinase--are congruent in that all evolved from a common four-domain precursor. In contrast calpain and sarcoplasmic calcium-binding protein (SARC) each evolved from its own one-domain precursor. The remaining 19 subfamilies and uniques appear to have evolved by translocation and splicing of genes encoding the EF-hand domains that were precursors to the congruent eight and to calpain and to SARC. The rates of evolution of the EF-hand domains are slower following formation of the subfamilies and establishment of their functions. Subfamilies are not readily classified by patterns of calcium coordination, interdomain linker stability, and glycine and proline distribution. There are many homoplasies indicating that similar variants of the EF-hand evolved by independent pathways.

DNA methylation and hydroxymethylation analyses of the active LINE-1 subfamilies in mice.

PubMed

Murata, Yui; Bundo, Miki; Ueda, Junko; Kubota-Sakashita, Mie; Kasai, Kiyoto; Kato, Tadafumi; Iwamoto, Kazuya

2017-10-19

Retrotransposon long interspersed nuclear element-1 (LINE-1) occupies a large proportion of the mammalian genome, comprising approximately 100,000 genomic copies in mice. Epigenetic status of the 5' untranslated region (5'-UTR) of LINE-1 is critical for its promoter activity. DNA methylation levels in the 5'-UTR of human active LINE-1 subfamily can be measured by well-established methods, such as a pyrosequencing-based assay. However, because of the considerable sequence and structural diversity in LINE-1 among species, methods for such assays should be adapted for the species of interest. Here we developed pyrosequencing-based assays to examine methylcytosine (mC) and hydroxymethylcytosine (hmC) levels of the three active LINE-1 subfamilies in mice (TfI, A, and GfII). Using these assays, we quantified mC and hmC levels in four brain regions and four nonbrain tissues including tail, heart, testis, and ovary. We observed tissue- and subfamily-specific mC and hmC differences. We also found that mC levels were strongly correlated among different brain regions, but mC levels of the testis showed a poor correlation with those of other tissues. Interestingly, mC levels in the A and GfII subfamilies were highly correlated, possibly reflecting their close evolutionary relationship. Our assays will be useful for exploring the epigenetic regulation of the active LINE-1 subfamilies in mice.

Comparative ribotyping of Staphylococcus intermedius isolated from members of the Canoidea gives possible evidence for host-specificity and co-evolution of bacteria and hosts.

PubMed

Aarestrup, F M

2001-07-01

A total of 41 Staphylococcus intermedius isolates were isolated from skin of healthy members of six phylogenetic groups within the Canoidea (the dog family, skunk subfamily, weasel subfamily, racoon family, red panda and bear family) of different geographical origin and compared by EcoRI ribotyping and cluster analysis. The S. intermedius isolates from the different families and subfamilies clustered together in separate groups, almost completely following the phylogenetic relationship of the animal hosts. These ribotype data indicate host-specificity of different types of S. intermedius and suggest co-evolution between the animal hosts within the Canoidea and S. intermedius.

Multi-Protein Dynamic Combinatorial Chemistry: A Novel Strategy that Leads to Simultaneous Discovery of Subfamily-Selective Inhibitors for Nucleic Acid Demethylases FTO and ALKBH3.

PubMed

Das, Mohua; Tianming, Yang; Jinghua, Dong; Prasetya, Fransisca; Yiming, Xie; Wong, Kendra; Cheong, Adeline; Woon, Esther C Y

2018-06-19

Dynamic combinatorial chemistry (DCC) is a powerful supramolecular approach for discovering ligands for biomolecules. To date, most, if not all, biologically-templated DCC employ only a single biomolecule in directing the self-assembly process. To expand the scope and potential of DCC, herein, we developed a novel multi-protein DCC strategy which combines the discriminatory power of zwitterionic 'thermal-tag' with the sensitivity of differential scanning fluorimetry. This strategy enables the discovery of ligands against several proteins of interest concurrently. It is remarkably sensitive and could differentiate the binding of ligands to structurally-similar subfamily members, which is extremely challenging to achieve. Through this approach, we were able to simultaneously identify subfamily-selective probes against two clinically important epigenetic enzymes, FTO (7; IC₅₀ = 2.6 µM) and ALKBH3 (8; IC₅₀ = 3.7 µM). To our knowledge, this is the first report of a subfamily-selective ALKBH3 inhibitor. The developed strategy could, in principle, be adapted to a broad range of proteins, thus it shall be of widespread scientific interest. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Protein interactions and ligand binding: from protein subfamilies to functional specificity.

PubMed

Rausell, Antonio; Juan, David; Pazos, Florencio; Valencia, Alfonso

2010-02-02

The divergence accumulated during the evolution of protein families translates into their internal organization as subfamilies, and it is directly reflected in the characteristic patterns of differentially conserved residues. These specifically conserved positions in protein subfamilies are known as "specificity determining positions" (SDPs). Previous studies have limited their analysis to the study of the relationship between these positions and ligand-binding specificity, demonstrating significant yet limited predictive capacity. We have systematically extended this observation to include the role of differential protein interactions in the segregation of protein subfamilies and explored in detail the structural distribution of SDPs at protein interfaces. Our results show the extensive influence of protein interactions in the evolution of protein families and the widespread association of SDPs with protein interfaces. The combined analysis of SDPs in interfaces and ligand-binding sites provides a more complete picture of the organization of protein families, constituting the necessary framework for a large scale analysis of the evolution of protein function.

Structural and Functional Elucidation of Peptide Ts11 Shows Evidence of a Novel Subfamily of Scorpion Venom Toxins

PubMed Central

Cremonez, Caroline M.; Maiti, Mohitosh; Peigneur, Steve; Cassoli, Juliana Silva; Dutra, Alexandre A. A.; Waelkens, Etienne; Lescrinier, Eveline; Herdewijn, Piet; de Lima, Maria Elena; Pimenta, Adriano M. C.; Arantes, Eliane C.; Tytgat, Jan

2016-01-01

To date, several families of peptide toxins specifically interacting with ion channels in scorpion venom have been described. One of these families comprise peptide toxins (called KTxs), known to modulate potassium channels. Thus far, 202 KTxs have been reported, belonging to several subfamilies of KTxs (called α, β, γ, κ, δ, and λ-KTxs). Here we report on a previously described orphan toxin from Tityus serrulatus venom, named Ts11. We carried out an in-depth structure-function analysis combining 3D structure elucidation of Ts11 and electrophysiological characterization of the toxin. The Ts11 structure is highlighted by an Inhibitor Cystine Knot (ICK) type scaffold, completely devoid of the classical secondary structure elements (α-helix and/or β-strand). This has, to the best of our knowledge, never been described before for scorpion toxins and therefore represents a novel, 6th type of structural fold for these scorpion peptides. On the basis of their preferred interaction with voltage-gated K channels, as compared to all the other targets tested, it can be postulated that Ts11 is the first member of a new subfamily, designated as ε-KTx. PMID:27706049

Structural and Functional Elucidation of Peptide Ts11 Shows Evidence of a Novel Subfamily of Scorpion Venom Toxins.

PubMed

Cremonez, Caroline M; Maiti, Mohitosh; Peigneur, Steve; Cassoli, Juliana Silva; Dutra, Alexandre A A; Waelkens, Etienne; Lescrinier, Eveline; Herdewijn, Piet; de Lima, Maria Elena; Pimenta, Adriano M C; Arantes, Eliane C; Tytgat, Jan

2016-09-30

To date, several families of peptide toxins specifically interacting with ion channels in scorpion venom have been described. One of these families comprise peptide toxins (called KTxs), known to modulate potassium channels. Thus far, 202 KTxs have been reported, belonging to several subfamilies of KTxs (called α, β, γ, κ, δ, and λ-KTxs). Here we report on a previously described orphan toxin from Tityus serrulatus venom, named Ts11. We carried out an in-depth structure-function analysis combining 3D structure elucidation of Ts11 and electrophysiological characterization of the toxin. The Ts11 structure is highlighted by an Inhibitor Cystine Knot (ICK) type scaffold, completely devoid of the classical secondary structure elements (α-helix and/or β-strand). This has, to the best of our knowledge, never been described before for scorpion toxins and therefore represents a novel, 6th type of structural fold for these scorpion peptides. On the basis of their preferred interaction with voltage-gated K channels, as compared to all the other targets tested, it can be postulated that Ts11 is the first member of a new subfamily, designated as ε-KTx.

DR-78, a novel Drosophila melanogaster genomic DNA fragment highly homologous to the DNA-binding domain of thyroid hormone-retinoic acid-vitamin D receptor subfamily.

PubMed

Martín-Blanco, E; Kornberg, T B

1993-11-16

Degenerate oligodeoxyribonucleotides were designed for both ends of the DNA-binding domain of members of the nuclear receptor superfamily. PCR amplified Drosophila melanogaster DNA was purified and cloned (DR plasmids). Genomic lambda DASH clones were identified at high stringency with an amplified DR-78 plasmid DNA and isolated. The partial sequence shows a very probable open reading frame which would encode a peptide highly homologous to members of the thyroid hormone-retinoic acid-vitamin D receptor subfamily. The fragment corresponds to a single copy gene and was mapped at position 78D of chromosome three by in situ hybridization.

Molecular Evolution of the CYP2D Subfamily in Primates: Purifying Selection on Substrate Recognition Sites without the Frequent or Long-Tract Gene Conversion

PubMed Central

Yasukochi, Yoshiki; Satta, Yoko

2015-01-01

The human cytochrome P450 (CYP) 2D6 gene is a member of the CYP2D gene subfamily, along with the CYP2D7P and CYP2D8P pseudogenes. Although the CYP2D6 enzyme has been studied extensively because of its clinical importance, the evolution of the CYP2D subfamily has not yet been fully understood. Therefore, the goal of this study was to reveal the evolutionary process of the human drug metabolic system. Here, we investigate molecular evolution of the CYP2D subfamily in primates by comparing 14 CYP2D sequences from humans to New World monkey genomes. Window analysis and statistical tests revealed that entire genomic sequences of paralogous genes were extensively homogenized by gene conversion during molecular evolution of CYP2D genes in primates. A neighbor-joining tree based on genomic sequences at the nonsubstrate recognition sites showed that CYP2D6 and CYP2D8 genes were clustered together due to gene conversion. In contrast, a phylogenetic tree using amino acid sequences at substrate recognition sites did not cluster the CYP2D6 and CYP2D8 genes, suggesting that the functional constraint on substrate specificity is one of the causes for purifying selection at the substrate recognition sites. Our results suggest that the CYP2D gene subfamily in primates has evolved to maintain the regioselectivity for a substrate hydroxylation activity between individual enzymes, even though extensive gene conversion has occurred across CYP2D coding sequences. PMID:25808902

A phylogeny of robber flies (Diptera: Asilidae) at the subfamilial level: molecular evidence.

PubMed

Bybee, Seth M; Taylor, Sean D; Riley Nelson, C; Whiting, Michael F

2004-03-01

We present the first formal analysis of phylogenetic relationships among the Asilidae, based on four genes: 16S rDNA, 18S rDNA, 28S rDNA, and cytochrome oxidase II. Twenty-six ingroup taxa representing 11 of the 12 described subfamilies were selected to produce a phylogenetic estimate of asilid subfamilial relationships via optimization alignment, parsimony, and maximum likelihood techniques. Phylogenetic analyses support the monophyly of Asilidae with Leptogastrinae as the most basal robber fly lineage. Apocleinae+(Asilinae+Ommatiinae) is supported as monophyletic. The laphriinae-group (Laphriinae+Laphystiinae) and the dasypogoninae-group (Dasypogoninae+Stenopogoninae+Stichopogoninae+ Trigonomiminae) are paraphyletic. These results suggest that current subfamilial classification only partially reflects robber fly phylogeny, indicating the need for further phylogenetic investigation of this group.

Molecular cloning and 3D model of first cytochrome P450 from CYP3A subfamily in saltwater crocodile (Crocodylus porosus).

PubMed

Tabassum, Rabia

2017-10-18

Cytochrome P450s (CYPs) play critical role in oxidative metabolism of numerous xenobiotics and endogenous compounds. The first CYP3A subfamily member in saltwater crocodile has been cloned and modelled for three-dimensional (3D) structure. The full-length cDNA was obtained employing reverse transcription polymerase chain reaction (RT-PCR) strategy and rapid amplification of cDNA ends (RACE). The cDNA sequence of 1659 nucleotides includes 132 nucleotides from 5' untranslated region (UTR), an open reading frame of 1527 nucleotides encoding 509 amino acids designated as CYP3A163. The alignment of CYP3A163 sequence with CYP3A subfamily across the lineages exhibit the loss of 1 residue in birds and 7 residues in mammals in comparison to reptiles suggesting the adaptation processes during evolution. The amino acid identity of CYP3A163 with Alligator mississippiensis CYP3A77 and Homo sapiens CYP3A4 is 91% and 62% respectively. The 3D structure of CYP3A163 modelled using human CYP3A4 structure as a template with Phyre 2 software, represents high similarity with its functionally important motifs and catalytic domain. Both sequence and structure of CYP3A163 display the common and conserved features of CYP3A subfamily. Overall, this study provides primary molecular and structural data of CYP3A163 required to investigate the xenobiotic metabolism in saltwater crocodiles. Copyright © 2017 Elsevier Inc. All rights reserved.

Nociceptin inhibits vanilloid TRPV-1-mediated neurosensitization induced by fenoterol in human isolated bronchi.

PubMed

Faisy, Christophe; Naline, Emmanuel; Rouget, Céline; Risse, Paul-André; Guerot, Emmanuel; Fagon, Jean-Yves; Chinet, Thierry; Roche, Nicolas; Advenier, Charles

2004-09-01

Chronic exposure to beta(2)-adrenoceptor agonists, especially fenoterol, has been shown to increase smooth muscle contraction to endothelin-1 in human bronchi partly through tachykinin-mediated pathways. The purpose of this work was to further investigate the role of sensory nerves in fenoterol-induced sensitization of human airways and the effect of nociceptin, a nociceptin/orphanin FQ (NOP) receptor agonist, on the increase in contraction after fenoterol exposure. Human bronchi from 62 patients were sensitized to endothelin-1 by prolonged incubation with fenoterol (0.1 microM, 15 h). The sensitizing effect of fenoterol was inhibited by high concentration of capsaicin (10 microM, 30 min before fenoterol sensitization), which induces depletion of mediators from sensory nerves, or co-incubation of fenoterol and capsazepine (1 microM), a vanilloid TRPV-1 receptor antagonist. Moreover, short pretreatment of bronchi with capsaicin (10 microM) or capsazepine (1 microM) after sensitization by fenoterol decreased the rise in smooth muscle contraction to endothelin-1. Nociceptin (1 microM) also inhibited the increased contraction in fenoterol-sensitized bronchi. Tertiapin (10 microM), an inhibitor of the inward-rectifier K(+) channels, but not naloxone (0.1 microM), a DOP/KOP/MOP receptor antagonist, prevented the inhibitory effect of nociceptin. In conclusion, fenoterol induces sensitization of human isolated bronchi to endothelin-1 in part through the stimulation of the vanilloid TRPV-1 receptor on tachykininergic sensory nerves. Nociceptin inhibits airway hyperresponsiveness via NOP receptor activation. This effect involves inward-rectifier K(+) channels.

Comparative chloroplast genomics reveals the evolution of Pinaceae genera and subfamilies.

PubMed

Lin, Ching-Ping; Huang, Jen-Pan; Wu, Chung-Shien; Hsu, Chih-Yao; Chaw, Shu-Miaw

2010-01-01

As the largest and the basal-most family of conifers, Pinaceae provides key insights into the evolutionary history of conifers. We present comparative chloroplast genomics and analysis of concatenated 49 chloroplast protein-coding genes common to 19 gymnosperms, including 15 species from 8 Pinaceous genera, to address the long-standing controversy about Pinaceae phylogeny. The complete cpDNAs of Cathaya argyrophylla and Cedrus deodara (Abitoideae) and draft cpDNAs of Larix decidua, Picea morrisonicola, and Pseudotsuga wilsoniana are reported. We found 21- and 42-kb inversions in congeneric species and different populations of Pinaceous species, which indicates that structural polymorphics may be common and ancient in Pinaceae. Our phylogenetic analyses reveal that Cedrus is clustered with Abies-Keteleeria rather than the basal-most genus of Pinaceae and that Cathaya is closer to Pinus than to Picea or Larix-Pseudotsuga. Topology and structural change tests and indel-distribution comparisons lend further evidence to our phylogenetic finding. Our molecular datings suggest that Pinaceae first evolved during Early Jurassic, and diversification of Pinaceous subfamilies and genera took place during Mid-Jurassic and Lower Cretaceous, respectively. Using different maximum-likelihood divergences as thresholds, we conclude that 2 (Abietoideae and Larix-Pseudotsuga-Piceae-Cathaya-Pinus), 4 (Cedrus, non-Cedrus Abietoideae, Larix-Pseudotsuga, and Piceae-Cathaya-Pinus), or 5 (Cedrus, non-Cedrus Abietoideae, Larix-Pseudotsuga, Picea, and Cathaya-Pinus) groups/subfamilies are more reasonable delimitations for Pinaceae. Specifically, our views on subfamilial classifications differ from previous studies in terms of the rank of Cedrus and with recognition of more than two subfamilies.

Comparative Chloroplast Genomics Reveals the Evolution of Pinaceae Genera and Subfamilies

PubMed Central

Lin, Ching-Ping; Huang, Jen-Pan; Wu, Chung-Shien; Hsu, Chih-Yao; Chaw, Shu-Miaw

2010-01-01

As the largest and the basal-most family of conifers, Pinaceae provides key insights into the evolutionary history of conifers. We present comparative chloroplast genomics and analysis of concatenated 49 chloroplast protein-coding genes common to 19 gymnosperms, including 15 species from 8 Pinaceous genera, to address the long-standing controversy about Pinaceae phylogeny. The complete cpDNAs of Cathaya argyrophylla and Cedrus deodara (Abitoideae) and draft cpDNAs of Larix decidua, Picea morrisonicola, and Pseudotsuga wilsoniana are reported. We found 21- and 42-kb inversions in congeneric species and different populations of Pinaceous species, which indicates that structural polymorphics may be common and ancient in Pinaceae. Our phylogenetic analyses reveal that Cedrus is clustered with Abies–Keteleeria rather than the basal-most genus of Pinaceae and that Cathaya is closer to Pinus than to Picea or Larix–Pseudotsuga. Topology and structural change tests and indel-distribution comparisons lend further evidence to our phylogenetic finding. Our molecular datings suggest that Pinaceae first evolved during Early Jurassic, and diversification of Pinaceous subfamilies and genera took place during Mid-Jurassic and Lower Cretaceous, respectively. Using different maximum-likelihood divergences as thresholds, we conclude that 2 (Abietoideae and Larix–Pseudotsuga–Piceae–Cathaya–Pinus), 4 (Cedrus, non-Cedrus Abietoideae, Larix–Pseudotsuga, and Piceae–Cathaya–Pinus), or 5 (Cedrus, non-Cedrus Abietoideae, Larix–Pseudotsuga, Picea, and Cathaya–Pinus) groups/subfamilies are more reasonable delimitations for Pinaceae. Specifically, our views on subfamilial classifications differ from previous studies in terms of the rank of Cedrus and with recognition of more than two subfamilies. PMID:20651328

The Role of Recombination in the Origin and Evolution of Alu Subfamilies

PubMed Central

Teixeira-Silva, Ana; Silva, Raquel M.; Carneiro, João; Amorim, António; Azevedo, Luísa

2013-01-01

Alus are the most abundant and successful short interspersed nuclear elements found in primate genomes. In humans, they represent about 10% of the genome, although few are retrotransposition-competent and are clustered into subfamilies according to the source gene from which they evolved. Recombination between them can lead to genomic rearrangements of clinical and evolutionary significance. In this study, we have addressed the role of recombination in the origin of chimeric Alu source genes by the analysis of all known consensus sequences of human Alus. From the allelic diversity of Alu consensus sequences, validated in extant elements resulting from whole genome searches, distinct events of recombination were detected in the origin of particular subfamilies of AluS and AluY source genes. These results demonstrate that at least two subfamilies are likely to have emerged from ectopic Alu-Alu recombination, which stimulates further research regarding the potential of chimeric active Alus to punctuate the genome. PMID:23750218

The role of recombination in the origin and evolution of Alu subfamilies.

PubMed

Teixeira-Silva, Ana; Silva, Raquel M; Carneiro, João; Amorim, António; Azevedo, Luísa

2013-01-01

Alus are the most abundant and successful short interspersed nuclear elements found in primate genomes. In humans, they represent about 10% of the genome, although few are retrotransposition-competent and are clustered into subfamilies according to the source gene from which they evolved. Recombination between them can lead to genomic rearrangements of clinical and evolutionary significance. In this study, we have addressed the role of recombination in the origin of chimeric Alu source genes by the analysis of all known consensus sequences of human Alus. From the allelic diversity of Alu consensus sequences, validated in extant elements resulting from whole genome searches, distinct events of recombination were detected in the origin of particular subfamilies of AluS and AluY source genes. These results demonstrate that at least two subfamilies are likely to have emerged from ectopic Alu-Alu recombination, which stimulates further research regarding the potential of chimeric active Alus to punctuate the genome.

Molecular evolution of the CYP2D subfamily in primates: purifying selection on substrate recognition sites without the frequent or long-tract gene conversion.

PubMed

Yasukochi, Yoshiki; Satta, Yoko

2015-03-25

The human cytochrome P450 (CYP) 2D6 gene is a member of the CYP2D gene subfamily, along with the CYP2D7P and CYP2D8P pseudogenes. Although the CYP2D6 enzyme has been studied extensively because of its clinical importance, the evolution of the CYP2D subfamily has not yet been fully understood. Therefore, the goal of this study was to reveal the evolutionary process of the human drug metabolic system. Here, we investigate molecular evolution of the CYP2D subfamily in primates by comparing 14 CYP2D sequences from humans to New World monkey genomes. Window analysis and statistical tests revealed that entire genomic sequences of paralogous genes were extensively homogenized by gene conversion during molecular evolution of CYP2D genes in primates. A neighbor-joining tree based on genomic sequences at the nonsubstrate recognition sites showed that CYP2D6 and CYP2D8 genes were clustered together due to gene conversion. In contrast, a phylogenetic tree using amino acid sequences at substrate recognition sites did not cluster the CYP2D6 and CYP2D8 genes, suggesting that the functional constraint on substrate specificity is one of the causes for purifying selection at the substrate recognition sites. Our results suggest that the CYP2D gene subfamily in primates has evolved to maintain the regioselectivity for a substrate hydroxylation activity between individual enzymes, even though extensive gene conversion has occurred across CYP2D coding sequences. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Over-expression in Escherichia coli, purification and reconstitution in liposomes of the third member of the OCTN sub-family: The mouse carnitine transporter OCTN3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Scalise, Mariafrancesca; Galluccio, Michele; Pochini, Lorena

2012-05-25

Highlights: Black-Right-Pointing-Pointer mOCTN3 transport protein has been cloned in pET-21a(+) and over-expressed in Escherichia coli. Black-Right-Pointing-Pointer The expressed mOCTN3 has been purified to homogeneity by Ni-chelating chromatography. Black-Right-Pointing-Pointer The protein solubilised in Triton X-100 has been reconstituted in liposomes. Black-Right-Pointing-Pointer Recombinant mOCTN3 catalyses transport of carnitine by a uniport mode. -- Abstract: pET-21a(+)-mOCTN3-6His was constructed and used for over-expression in Escherichia coli Rosetta(DE3)pLysS. After IPTG induction a protein with apparent molecular mass of 53 kDa was collected in the insoluble fraction of the cell lysate and purified by Ni{sup 2+}-chelating chromatography with a yield of 2 mg/l of cell culture.more » The over-expressed protein was identified with mOCTN3 by anti-His antibody and reconstitution in liposomes. mOCTN3 required peculiar conditions for optimal expression and reconstitution in liposomes. The protein catalyzed a time dependent [{sup 3}H]carnitine uptake which was stimulated by intraliposomal ATP and nearly independent of the pH. The K{sub m} for carnitine was 36 {mu}M. [{sup 3}H]carnitine transport was inhibited by carnitine analogues and some Cys and NH{sub 2} reagents. This paper represents the first outcome in over-expressing, in active form, the third member of the OCTN sub-family, mOCTN3, in E. coli.« less

Molecular systematics of the subfamily Limenitidinae (Lepidoptera: Nymphalidae)

PubMed Central

Dhungel, Bidur

2018-01-01

We studied the systematics of the subfamily Limenitidinae (Lepidoptera: Nymphalidae) using molecular methods to reconstruct a robust phylogenetic hypothesis. The molecular data matrix comprised 205 Limenitidinae species, four outgroups, and 11,327 aligned nucleotide sites using up to 18 genes per species of which seven genes (CycY, Exp1, Nex9, PolII, ProSup, PSb and UDPG6DH) have not previously been used in phylogenetic studies. We recovered the monophyly of the subfamily Limenitidinae and seven higher clades corresponding to four traditional tribes Parthenini, Adoliadini, Neptini, Limenitidini as well as three additional independent lineages. One contains the genera Harma + Cymothoe and likely a third, Bhagadatta, and the other two independent lineages lead to Pseudoneptis and to Pseudacraea. These independent lineages are circumscribed as new tribes. Parthenini was recovered as sister to rest of Limenitidinae, but the relationships of the remaining six lineages were ambiguous. A number of genera were found to be non-monophyletic, with Pantoporia, Euthalia, Athyma, and Parasarpa being polyphyletic, whereas Limenitis, Neptis, Bebearia, Euryphura, and Adelpha were paraphyletic. PMID:29416955

Distribution profiles of transient receptor potential melastatin- and vanilloid-related channels in rat spermatogenic cells and sperm.

PubMed

Li, Shilin; Wang, Xinghuan; Ye, Haixia; Gao, Weicheng; Pu, Xiaoyong; Yang, Zhonghua

2010-03-01

In the present study, we aimed to investigate the expression and distribution of transient receptor potential melastatin (TRPM)- and vanilloid (TRPV)- related channels in rat spermatogenic cells and spermatozoa. Spermatogenic cells and spermatozoa were obtained from male Sprague-Dawley rats. Reverse transcription polymerase chain reaction (RT-PCR) were used to detect the expression of all TRPM and TRPV channel members with specific primers. Western blot analysis was applied for detecting the expression of TRPM and TRPV channel proteins. Immunohistochemistry staining for TRPM4, TRPM7 and TRPV5 was also performed in rat testis. The mRNAs of TRPM3, TRPM4, TRPM7 and TRPV5 were detected in the spermatogenic cells and spermatozoa in rat. Western blot analysis verified the expression of TRPM4, TRPM7 and TRPV5 in the rat spermatogenic cells and spermatozoa. Immunocytochemistry staining for TRPM and TRPV channel families indicated that TRPM4 and TRPM7 proteins were highly expressed in different stages of spermatogenic cells and spermatozoa, while TRPV5 protein was lowly expressed in these cells. Our results demonstrate that mRNAs or proteins for TRPM3, TRPM4, TRPM7 and TRPV5 exist in rat spermatogenic cells and spermatozoa. These data presented here may assist in elucidating the possible physiological function of TRPM and TRPV channels in spermatogenic cells and spermatozoa.

Generic revision of the ant subfamily Dorylinae (Hymenoptera, Formicidae)

PubMed Central

Borowiec, Marek L.

2016-01-01

Abstract The generic classification of the ant subfamily Dorylinae is revised, with the aim of facilitating identification of easily-diagnosable monophyletic genera. The new classification is based on recent molecular phylogenetic evidence and a critical reappraisal of doryline morphology. New keys and diagnoses based on workers and males are provided, along with reviews of natural history and phylogenetic relationships, distribution maps, and a list of valid species for each lineage. Twenty-eight genera (27 extant and 1 extinct) are recognized within the subfamily, an increase from 20 in the previous classification scheme. Species classified in the polyphyletic Cerapachys and Sphinctomyrmex prior to this publication are here distributed among 9 and 3 different genera, respectively. Amyrmex and Asphinctanilloides are synonymized under Leptanilloides and the currently recognized subgenera are synonymized for Dorylus. No tribal classification is proposed for the subfamily, but several apparently monophyletic genus-groups are discussed. Valid generic names recognized here include: Acanthostichus (= Ctenopyga), Aenictogiton, Aenictus (= Paraenictus, Typhlatta), Cerapachys (= Ceratopachys), Cheliomyrmex, Chrysapace gen. rev., Cylindromyrmex (= Holcoponera, Hypocylindromyrmex, Metacylindromyrmex), Dorylus (= Alaopone syn. n., Anomma syn. n., Cosmaecetes, Dichthadia syn. n., Rhogmus syn. n., Shuckardia, Sphecomyrmex, Sphegomyrmex, Typhlopone syn. n.), Eburopone gen. n., Eciton (= Camptognatha, Holopone, Mayromyrmex), Eusphinctus gen. rev., Labidus (= Nycteresia, Pseudodichthadia), Leptanilloides (= Amyrmex syn. n., Asphinctanilloides syn. n.), Lioponera gen. rev. (= Neophyracaces syn. n., Phyracaces syn. n.), Lividopone, Neivamyrmex (= Acamatus, Woitkowskia), Neocerapachys gen. n., Nomamyrmex, Ooceraea gen. rev. (= Cysias syn. n.), Parasyscia gen. rev., †Procerapachys, Simopone, Sphinctomyrmex, Syscia gen. rev., Tanipone, Vicinopone, Yunodorylus gen. rev., Zasphinctus

Multi-locus phylogeny of dolphins in the subfamily Lissodelphininae: character synergy improves phylogenetic resolution

PubMed Central

Harlin-Cognato, April D; Honeycutt, Rodney L

2006-01-01

Background Dolphins of the genus Lagenorhynchus are anti-tropically distributed in temperate to cool waters. Phylogenetic analyses of cytochrome b sequences have suggested that the genus is polyphyletic; however, many relationships were poorly resolved. In this study, we present a combined-analysis phylogenetic hypothesis for Lagenorhynchus and members of the subfamily Lissodelphininae, which is derived from two nuclear and two mitochondrial data sets and the addition of 34 individuals representing 9 species. In addition, we characterize with parsimony and Bayesian analyses the phylogenetic utility and interaction of characters with statistical measures, including the utility of highly consistent (non-homoplasious) characters as a conservative measure of phylogenetic robustness. We also explore the effects of removing sources of character conflict on phylogenetic resolution. Results Overall, our study provides strong support for the monophyly of the subfamily Lissodelphininae and the polyphyly of the genus Lagenorhynchus. In addition, the simultaneous parsimony analysis resolved and/or improved resolution for 12 nodes including: (1) L. albirostris, L. acutus; (2) L. obscurus and L. obliquidens; and (3) L. cruciger and L. australis. In addition, the Bayesian analysis supported the monophyly of the Cephalorhynchus, and resolved ambiguities regarding the relationship of L. australis/L. cruciger to other members of the genus Lagenorhynchus. The frequency of highly consistent characters varied among data partitions, but the rate of evolution was consistent within data partitions. Although the control region was the greatest source of character conflict, removal of this data partition impeded phylogenetic resolution. Conclusion The simultaneous analysis approach produced a more robust phylogenetic hypothesis for Lagenorhynchus than previous studies, thus supporting a phylogenetic approach employing multiple data partitions that vary in overall rate of evolution. Even in

Comparative genomic analysis of the eight-membered ring cystine knot-containing bone morphogenetic protein antagonists.

PubMed

Avsian-Kretchmer, Orna; Hsueh, Aaron J W

2004-01-01

TGF-beta family proteins with a cystine knot motif serve as ligands for diverse families of plasma membrane receptors. Bone morphogenetic protein (BMP) antagonists represent a subgroup of these proteins, some of which bind BMPs and antagonize their actions during development and morphogenesis. Availability of completed genome sequences from diverse organisms allows bioinformatic analysis of the evolution of BMP antagonists and facilitates their classification. Using a regular expression algorithm (http://BioRegEx.stanford.edu), an exhaustive search of the human genome identified all cystine knot-containing BMP antagonists. Based on the size of the cystine ring, these proteins were divided into three subfamilies: CAN (eight-membered ring), twisted gastrulation (nine-membered ring), as well as chordin and noggin (10-membered ring). The CAN family can be divided further into four subgroups based on a conserved arrangement of additional cysteine residues-gremlin and PRDC, cerberus and coco, and DAN, together with USAG-1 and sclerostin. We searched for orthologs of human BMP antagonists in the genomes of model organisms and analyzed their phylogenetic relationship. New human paralogs were identified together with the verification of orthologous relationships of known genes. We also discuss the physiological roles of the CAN subfamily of BMP antagonists and the associated genetic defects. Based on the known three-dimensional structure of key cystine knot proteins, we postulated disulfide bondings for eight-membered ring BMP antagonists to predict their potential folding and dimerization.

Molecular phylogeny of the highly diversified catfish subfamily Loricariinae (Siluriformes, Loricariidae) reveals incongruences with morphological classification.

PubMed

Covain, Raphaël; Fisch-Muller, Sonia; Oliveira, Claudio; Mol, Jan H; Montoya-Burgos, Juan I; Dray, Stéphane

2016-01-01

The Loricariinae belong to the Neotropical mailed catfish family Loricariidae, the most species-rich catfish family. Among loricariids, members of the Loricariinae are united by a long and flattened caudal peduncle and the absence of an adipose fin. Despite numerous studies of the Loricariidae, there is no comprehensive phylogeny of this morphologically highly diversified subfamily. To fill this gap, we present a molecular phylogeny of this group, including 350 representatives, based on the analysis of mitochondrial and nuclear genes (8426 positions). The resulting phylogeny indicates that Loricariinae are distributed into two sister tribes: Harttiini and Loricariini. The Harttiini tribe, as classically defined, constitutes a paraphyletic assemblage and is here restricted to the three genera Harttia, Cteniloricaria, and Harttiella. Two subtribes are distinguished within Loricariini: Farlowellina and Loricariina. Within Farlowellina, the nominal genus formed a paraphyletic group, as did Sturisoma and Sturisomatichthys. Within Loricariina, Loricaria, Crossoloricaria, and Apistoloricaria are also paraphyletic. To solve these issues, and given the lack of clear morphological diagnostic features, we propose here to synonymize several genera (Quiritixys with Harttia; East Andean members of Crossoloricaria, and Apistoloricaria with Rhadinoloricaria; Ixinandria, Hemiloricaria, Fonchiiichthys, and Leliella with Rineloricaria), to restrict others (Crossoloricaria, and Sturisomatichthys to the West Andean members, and Sturisoma to the East Andean species), and to revalidate the genus Proloricaria. Copyright © 2015 Elsevier Inc. All rights reserved.

Identification and expression analysis of zebrafish polypeptide α-N-acetylgalactosaminyltransferase Y-subfamily genes during embryonic development.

PubMed

Nakayama, Yoshiaki; Nakamura, Naosuke; Kawai, Tamiko; Kaneda, Eiichi; Takahashi, Yui; Miyake, Ayumi; Itoh, Nobuyuki; Kurosaka, Akira

2014-09-01

Mucin-type glycosylation is one of the most common posttranslational modifications of secretory and membrane proteins and has diverse physiological functions. The initial biosynthesis of mucin-type carbohydrates is catalyzed by UDP-GalNAc: polypeptide α-N-acetylgalactosaminyltransferases (GalNAc-Ts) encoded by GALNT genes. Among these, GalNAc-T8, -T9, -T17, and -T18 form a characteristic subfamily called "Y-subfamily" and have no or very low in vitro transferase activities when assayed with typical mucin peptides as acceptor substrates. Although the Y-subfamily isozymes have been reported to be possibly involved in various diseases, their in vivo functions have not been reported. Here, we isolated zebrafish Y-subfamily galnt genes, and determined their spatial and temporal expressions during the early development of zebrafish. Our study demonstrated that all the Y-subfamily isozymes were well conserved in zebrafish with GalNAc-T18 having two orthologs, galnt18a and galnt18b, and with the other three isozymes each having a corresponding ortholog, galnt8, galnt9, and galnt17. The galnt8 was expressed in the cephalic mesoderm and hatching gland during early developmental stages, and differently expressed in the head, somatic muscles, and liver in the later stages. The other three orthologs also exhibited the characteristic expression patterns, although their expressions were generally strong in the nervous systems. In addition to the expression in the brain, galnt17 and galnt18a were expressed in the somitic muscles, and galnt18a and galnt18b in the notochord. These expression patterns may contribute to the functional analysis of the Y-subfamily, whose physiological roles still remain to be elucidated. Copyright © 2014 Elsevier B.V. All rights reserved.

Cloning and characterization of mouse ACF7, a novel member of the dystonin subfamily of actin binding proteins.

PubMed

Bernier, G; Mathieu, M; De Repentigny, Y; Vidal, S M; Kothary, R

1996-11-15

We have recently cloned the gene responsible for the mouse neurological disorder dystonia musculorum. The predicted product of this gene, dystonin (Dst), is a neural isoform of bullous pemphigoid antigen 1 (Bpag1) with an N-terminal actin binding domain. Here we report on the cloning and characterization of mouse ACF7. Sequence analysis revealed extended homology of mACF7 with both the actin binding domain (ABD) and the Bpag1 portions of dystonin. Moreover, mACF7 and Dst display similar isoform diversity and encode similar sized transcripts in the nervous system. Phylogenetic analysis of mACF7 and dystonin ABD sequences suggests a recent evolutionary origin and that these proteins form a separate novel subfamily within the beta-spectrin superfamily of actin binding proteins. Given the implication of several actin binding proteins in genetic disorders, it is important to know the pattern of mACF7 expression. mACF7 transcripts are detected principally in lung, brain, spinal cord, skeletal and cardiac muscle, and skin. Intriguingly, mACF7 expression in lung is strongly induced just before birth and is restricted to type II alveolar cells. To determine whether spontaneous mutants that may be defective in mACF7 exist, we have mapped the mACF7 gene to mouse chromosome 4.

Nociceptive vascular reflexes evoked by scorpion venom modulate cardiorespiratory parameters involving vanilloid receptor 1 in anaesthetised rats.

PubMed

Singh, Sanjeev K; Deshpande, Shripad B

2009-02-27

Involvement of vanilloid and 5-HT(3) receptors in the cardiorespiratory reflexes evoked by intra-arterial (i.a.) injection of Mesobuthus tamulus (BT) venom was examined. In anaesthetised rats, blood pressure, respiratory excursions and ECG were recorded for 60min after the injection of venom in the absence or presence of antagonists. Injection of BT venom (1mg/kg, i.a.) produced alterations in respiratory frequency (RF), blood pressure (BP) and heart rate (HR). The changes in RF were manifested as immediate increase (40%) followed by a decrease (40%) and subsequent sustained increase (60%). In case of BP, the increase began around 40s, peaked at 5min (50%) and remained above the initial level subsequently. The bradycardiac response began around 5min which peaked (50% of the initial) around 25min and remained at that level. Thus, exhibiting immediate-tachypnoeic, intermediate-hypertensive and delayed-bradycardiac responses. Pretreatment with lignocaine, blocked the respiratory responses and attenuated the pressor responses evoked by venom. Pretreatment with capsazepine, vanilloid receptor 1 (VR1) antagonist, antagonized all the three parameters of cardiorespiratory responses evoked by venom. Whereas, ondansetron (5-HT(3) antagonist) attenuated the pressor and bradycardiac responses significantly but not the respiratory responses. These observations indicate that the cardiorespiratory changes induced by intra-arterial injection of venom are carried by afferents in addition to somatic nerves, involving mainly VR1 receptors and partially by 5-HT(3) receptors.

The mariner transposons belonging to the irritans subfamily were maintained in chordate genomes by vertical transmission.

PubMed

Sinzelle, Ludivine; Chesneau, Albert; Bigot, Yves; Mazabraud, André; Pollet, Nicolas

2006-01-01

Mariner-like elements (MLEs) belong to the Tc1-mariner superfamily of DNA transposons, which is very widespread in animal genomes. We report here the first complete description of a MLE, Xtmar1, within the genome of a poikilotherm vertebrate, the amphibian Xenopus tropicalis. A close relative, XlMLE, is also characterized within the genome of a sibling species, Xenopus laevis. The phylogenetic analysis of the relationships between MLE transposases reveals that Xtmar1 is closely related to Hsmar2 and Bytmar1 and that together they form a second distinct lineage of the irritans subfamily. All members of this lineage are also characterized by the 36- to 43-bp size of their imperfectly conserved inverted terminal repeats and by the -8-bp motif located at their outer extremity. Since XlMLE, Xlmar1, and Hsmar2 are present in species located at both extremities of the vertebrate evolutionary tree, we looked for MLE relatives belonging to the same subfamily in the available sequencing projects using the amino acid consensus sequence of the Hsmar2 transposase as an in silico probe. We found that irritans MLEs are present in chordate genomes including most craniates. This therefore suggests that these elements have been present within chordate genomes for 750 Myr and that the main way they have been maintained in these species has been via vertical transmission. The very small number of stochastic losses observed in the data available suggests that their inactivation during evolution has been very slow.

Sequence Analysis and Characterization of Active Human Alu Subfamilies Based on the 1000 Genomes Pilot Project.

PubMed

Konkel, Miriam K; Walker, Jerilyn A; Hotard, Ashley B; Ranck, Megan C; Fontenot, Catherine C; Storer, Jessica; Stewart, Chip; Marth, Gabor T; Batzer, Mark A

2015-08-29

The goal of the 1000 Genomes Consortium is to characterize human genome structural variation (SV), including forms of copy number variations such as deletions, duplications, and insertions. Mobile element insertions, particularly Alu elements, are major contributors to genomic SV among humans. During the pilot phase of the project we experimentally validated 645 (611 intergenic and 34 exon targeted) polymorphic "young" Alu insertion events, absent from the human reference genome. Here, we report high resolution sequencing of 343 (322 unique) recent Alu insertion events, along with their respective target site duplications, precise genomic breakpoint coordinates, subfamily assignment, percent divergence, and estimated A-rich tail lengths. All the sequenced Alu loci were derived from the AluY lineage with no evidence of retrotransposition activity involving older Alu families (e.g., AluJ and AluS). AluYa5 is currently the most active Alu subfamily in the human lineage, followed by AluYb8, and many others including three newly identified subfamilies we have termed AluYb7a3, AluYb8b1, and AluYa4a1. This report provides the structural details of 322 unique Alu variants from individual human genomes collectively adding about 100 kb of genomic variation. Many Alu subfamilies are currently active in human populations, including a surprising level of AluY retrotransposition. Human Alu subfamilies exhibit continuous evolution with potential drivers sprouting new Alu lineages. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

DNA Barcoding of the parasitoid wasp subfamily Doryctinae (Hymenoptera: Braconidae) from Chamela, Mexico.

PubMed

Gutiérrez-Arellano, Daniela; Gutiérrez-Arellano, Claudia Renata; Zaldívar-Riverón, Alejandro

2015-01-01

Background and aims. The Doryctinae is a considerably diverse, poorly studied group of parasitoid wasps and one of the most diverse subfamilies within Braconidae. Taxonomic knowledge of this group remains highly incomplete, specially in the tropics. In Mexico, it has been reported as the subfamily with the highest number of recorded genera. A preliminary Barcoding study carried out in the Chamela region, located near the Mexican pacific coast in Jalisco, identified 185 barcoding species of Dorytinae assigned to 19 identified doryctine genera. This work updates the later study, representing a three years effort to assess the species richness of this subfamily for the Chamela region. Materials and methods. Ten collecting field trips of 5 to 10 days each were carried out from June 2009 to May 2011. A 2% divergence criterion using the BIN system implemented in BOLD was followed in order to establish species boundaries among the specimens that were collected. Results and conclusions. A total of 961 specimens were collected, from which 883 COI sequences were obtained. The sequences generated corresponded to 289 barcoding species and 30 identified genera. The most speciose genera were Heterospilus Haliday (170 spp.), Ecphylus Förster (19 spp.), Allorhogas Gahan (15 spp.) and Callihormius Ashmead (14 spp.). Addition of previously collected material increased the diversity of the subfamily in the region to 34 genera and 290 species. Paraphyly of Heterospilus with respect to Neoheterospilus and Heterospathius was again recovered. Twenty new species and two new genera (Sabinita Belokobylskij, Zaldívar-Riverón et Martínez, Ficobolus Martínez, Belokobylskij et Zaldívar-Riverón) have been described so far from the material collected in this work.

A genomic view of the NOD-like receptor family in teleost fish: Identification of a novel NLR subfamily in zebrafish

USGS Publications Warehouse

Laing, K.J.; Purcell, M.K.; Winton, J.R.; Hansen, J.D.

2008-01-01

Background. A large multigene family of NOD-like receptor (NLR) molecules have been described in mammals and implicated in immunity and apoptosis. Little information, however, exists concerning this gene family in non-mammalian taxa. This current study, therefore, provides an in-depth investigation of this gene family in lower vertebrates including extensive phylogenetic comparison of zebrafish NLRs with orthologs in tetrapods, and analysis of their tissue-specific expression. Results. Three distinct NLR subfamilies were identified by mining genome databases of various non-mammalian vertebrates; the first subfamily (NLR-A) resembles mammalian NODs, the second (NLR-B) resembles mammalian NALPs, while the third (NLR-C) appears to be unique to teleost fish. In zebrafish, NLR-A and NLR-B subfamilies contain five and six genes respectively. The third subfamily is large, containing several hundred NLR-C genes, many of which are predicted to encode a C-terminal B30.2 domain. This subfamily most likely evolved from a NOD3-like molecule. Gene predictions for zebrafish NLRs were verified using sequence derived from ESTs or direct sequencing of cDNA. Reverse-transcriptase (RT)-PCR analysis confirmed expression of representative genes from each subfamily in selected tissues. Conclusion. Our findings confirm the presence of multiple NLR gene orthologs, which form a large multigene family in teleostei. Although the functional significance of the three major NLR subfamilies is unclear, we speculate that conservation and abundance of NLR molecules in all teleostei genomes, reflects an essential role in cellular control, apoptosis or immunity throughout bony fish. ?? 2008 Laing et al; licensee BioMed Central Ltd.

Plastid phylogenomics of the cool-season grass subfamily: clarification of relationships among early-diverging tribes.

PubMed

Saarela, Jeffery M; Wysocki, William P; Barrett, Craig F; Soreng, Robert J; Davis, Jerrold I; Clark, Lynn G; Kelchner, Scot A; Pires, J Chris; Edger, Patrick P; Mayfield, Dustin R; Duvall, Melvin R

2015-05-04

Whole plastid genomes are being sequenced rapidly from across the green plant tree of life, and phylogenetic analyses of these are increasing resolution and support for relationships that have varied among or been unresolved in earlier single- and multi-gene studies. Pooideae, the cool-season grass lineage, is the largest of the 12 grass subfamilies and includes important temperate cereals, turf grasses and forage species. Although numerous studies of the phylogeny of the subfamily have been undertaken, relationships among some 'early-diverging' tribes conflict among studies, and some relationships among subtribes of Poeae have not yet been resolved. To address these issues, we newly sequenced 25 whole plastomes, which showed rearrangements typical of Poaceae. These plastomes represent 9 tribes and 11 subtribes of Pooideae, and were analysed with 20 existing plastomes for the subfamily. Maximum likelihood (ML), maximum parsimony (MP) and Bayesian inference (BI) robustly resolve most deep relationships in the subfamily. Complete plastome data provide increased nodal support compared with protein-coding data alone at nodes that are not maximally supported. Following the divergence of Brachyelytrum, Phaenospermateae, Brylkinieae-Meliceae and Ampelodesmeae-Stipeae are the successive sister groups of the rest of the subfamily. Ampelodesmeae are nested within Stipeae in the plastome trees, consistent with its hybrid origin between a phaenospermatoid and a stipoid grass (the maternal parent). The core Pooideae are strongly supported and include Brachypodieae, a Bromeae-Triticeae clade and Poeae. Within Poeae, a novel sister group relationship between Phalaridinae and Torreyochloinae is found, and the relative branching order of this clade and Aveninae, with respect to an Agrostidinae-Brizinae clade, are discordant between MP and ML/BI trees. Maximum likelihood and Bayesian analyses strongly support Airinae and Holcinae as the successive sister groups of a Dactylidinae

Plastid phylogenomics of the cool-season grass subfamily: clarification of relationships among early-diverging tribes

PubMed Central

Saarela, Jeffery M.; Wysocki, William P.; Barrett, Craig F.; Soreng, Robert J.; Davis, Jerrold I.; Clark, Lynn G.; Kelchner, Scot A.; Pires, J. Chris; Edger, Patrick P.; Mayfield, Dustin R.; Duvall, Melvin R.

2015-01-01

Whole plastid genomes are being sequenced rapidly from across the green plant tree of life, and phylogenetic analyses of these are increasing resolution and support for relationships that have varied among or been unresolved in earlier single- and multi-gene studies. Pooideae, the cool-season grass lineage, is the largest of the 12 grass subfamilies and includes important temperate cereals, turf grasses and forage species. Although numerous studies of the phylogeny of the subfamily have been undertaken, relationships among some ‘early-diverging’ tribes conflict among studies, and some relationships among subtribes of Poeae have not yet been resolved. To address these issues, we newly sequenced 25 whole plastomes, which showed rearrangements typical of Poaceae. These plastomes represent 9 tribes and 11 subtribes of Pooideae, and were analysed with 20 existing plastomes for the subfamily. Maximum likelihood (ML), maximum parsimony (MP) and Bayesian inference (BI) robustly resolve most deep relationships in the subfamily. Complete plastome data provide increased nodal support compared with protein-coding data alone at nodes that are not maximally supported. Following the divergence of Brachyelytrum, Phaenospermateae, Brylkinieae–Meliceae and Ampelodesmeae–Stipeae are the successive sister groups of the rest of the subfamily. Ampelodesmeae are nested within Stipeae in the plastome trees, consistent with its hybrid origin between a phaenospermatoid and a stipoid grass (the maternal parent). The core Pooideae are strongly supported and include Brachypodieae, a Bromeae–Triticeae clade and Poeae. Within Poeae, a novel sister group relationship between Phalaridinae and Torreyochloinae is found, and the relative branching order of this clade and Aveninae, with respect to an Agrostidinae–Brizinae clade, are discordant between MP and ML/BI trees. Maximum likelihood and Bayesian analyses strongly support Airinae and Holcinae as the successive sister groups of a

An endogenous capsaicin-like substance with high potency at recombinant and native vanilloid VR1 receptors

PubMed Central

Huang, Susan M.; Bisogno, Tiziana; Trevisani, Marcello; Al-Hayani, Abdulmonem; De Petrocellis, Luciano; Fezza, Filomena; Tognetto, Michele; Petros, Timothy J.; Krey, Jocelyn F.; Chu, Constance J.; Miller, Jeffrey D.; Davies, Stephen N.; Geppetti, Pierangelo; Walker, J. Michael; Di Marzo, Vincenzo

2002-01-01

The vanilloid receptor VR1 is a nonselective cation channel that is most abundant in peripheral sensory fibers but also is found in several brain nuclei. VR1 is gated by protons, heat, and the pungent ingredient of “hot” chili peppers, capsaicin. To date, no endogenous compound with potency at this receptor comparable to that of capsaicin has been identified. Here we examined the hypothesis, based on previous structure-activity relationship studies and the availability of biosynthetic precursors, that N-arachidonoyl-dopamine (NADA) is an endogenous “capsaicin-like” substance in mammalian nervous tissues. We found that NADA occurs in nervous tissues, with the highest concentrations being found in the striatum, hippocampus, and cerebellum and the lowest concentrations in the dorsal root ganglion. We also gained evidence for the existence of two possible routes for NADA biosynthesis and mechanisms for its inactivation in rat brain. NADA activates both human and rat VR1 overexpressed in human embryonic kidney (HEK)293 cells, with potency (EC50 ≈ 50 nM) and efficacy similar to those of capsaicin. Furthermore, NADA potently activates native vanilloid receptors in neurons from rat dorsal root ganglion and hippocampus, thereby inducing the release of substance P and calcitonin gene-related peptide (CGRP) from dorsal spinal cord slices and enhancing hippocampal paired-pulse depression, respectively. Intradermal NADA also induces VR1-mediated thermal hyperalgesia (EC50 = 1.5 ± 0.3 μg). Our data demonstrate the existence of a brain substance similar to capsaicin not only with respect to its chemical structure but also to its potency at VR1 receptors. PMID:12060783

Use Dependence of Heat Sensitivity of Vanilloid Receptor TRPV2

PubMed Central

Liu, Beiying; Qin, Feng

2016-01-01

Thermal TRP channels mediate temperature transduction and pain sensation. The vanilloid receptor TRPV2 is involved in detection of noxious heat in a subpopulation of high-threshold nociceptors. It also plays a critical role in development of thermal hyperalgesia, but the underlying mechanism remains uncertain. Here we analyze the heat sensitivity of the TRPV2 channel. Heat activation of the channel exhibits strong use dependence. Prior heat activation can profoundly alter its subsequent temperature responsiveness, causing decreases in both temperature activation threshold and slope sensitivity of temperature dependence while accelerating activation time courses. Notably, heat and agonist activations differ in cross use-dependence. Prior heat stimulation can dramatically sensitize agonist responses, but not conversely. Quantitative analyses indicate that the use dependence in heat sensitivity is pertinent to the process of temperature sensing by the channel. The use dependence of TRPV2 reveals that the channel can have a dynamic temperature sensitivity. The temperature sensing structures within the channel have multiple conformations and the temperature activation pathway is separate from the agonist activation pathway. Physiologically, the use dependence of TRPV2 confers nociceptors with a hypersensitivity to heat and thus provides a mechanism for peripheral thermal hyperalgesia. PMID:27074678

Seed morphology and anatomy and its utility in recognizing subfamilies and tribes of Zingiberaceae.

PubMed

Benedict, John C; Smith, Selena Y; Collinson, Margaret E; Leong-Škorničková, Jana; Specht, Chelsea D; Marone, Federica; Xiao, Xianghui; Parkinson, Dilworth Y

2015-11-01

Recent phylogenetic analyses based on molecular data suggested that the monocot family Zingiberaceae be separated into four subfamilies and four tribes. Robust morphological characters to support these clades are lacking. Seeds were analyzed in a phylogenetic context to test independently the circumscription of clades and to better understand evolution of seed characters within Zingiberaceae. Seventy-five species from three of the four subfamilies were analyzed using synchrotron based x-ray tomographic microscopy (SRXTM) and scored for 39 morphoanatomical characters. Zingiberaceae seeds are some of the most structurally complex seeds in angiosperms. No single seed character was found to distinguish each subfamily, but combinations of characters were found to differentiate between the subfamilies. Recognition of the tribes based on seeds was possible for Globbeae, but not for Alpinieae, Riedelieae, or Zingibereae, due to considerable variation. SRXTM is an excellent, nondestructive tool to capture morphoanatomical variation of seeds and allows for the study of taxa with limited material available. Alpinioideae, Siphonochiloideae, Tamijioideae, and Zingiberoideae are well supported based on both molecular and morphological data, including multiple seed characters. Globbeae are well supported as a distinctive tribe within the Zingiberoideae, but no other tribe could be differentiated using seeds due to considerable homoplasy when compared with currently accepted relationships based on molecular data. Novel seed characters suggest tribal affinities for two currently unplaced Zingiberaceae taxa: Siliquamomum may be related to Riedelieae and Monolophus to Zingibereae, but further work is needed before formal revision of the family. © 2015 Botanical Society of America.

Seed morphology and anatomy and its utility in recognizing subfamilies and tribes of Zingiberaceae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Benedict, John C.; Smith, Selena Y.; Collinson, Margaret E.

PREMISE OF THE STUDY: Recent phylogenetic analyses based on molecular data suggested that the monocot family Zingiberaceae be separated into four subfamilies and four tribes. Robust morphological characters to support these clades are lacking. Seeds were analyzed in a phylogenetic context to test independently the circumscription of clades and to better understand evolution of seed characters within Zingiberaceae. METHODS: Seventy-five species from three of the four subfamilies were analyzed using synchrotron based x-ray tomographic microscopy (SRXTM) and scored for 39 morphoanatomical characters. KEY RESULTS: Zingiberaceae seeds are some of the most structurally complex seeds in angiosperms. No single seed charactermore » was found to distinguish each subfamily, but combinations of characters were found to differentiate between the subfamilies. Recognition of the tribes based on seeds was possible for Globbeae, but not for Alpinieae, Riedelieae, or Zingibereae, due to considerable variation. CONCLUSIONS: SRXTM is an excellent, nondestructive tool to capture morphoanatomical variation of seeds and allows for the study of taxa with limited material available. Alpinioideae, Siphonochiloideae, Tamijioideae, and Zingiberoideae are well supported based on both molecular and morphological data, including multiple seed characters. Globbeae are well supported as a distinctive tribe within the Zingiberoideae, but no other tribe could be differentiated using seeds due to considerable homoplasy when compared with currently accepted relationships based on molecular data. Novel seed characters suggest tribal affinities for two currently unplaced Zingiberaceae taxa: Siliquamomum may be related to Riedelieae and Monolophus to Zingibereae, but further work is needed before formal revision of the family.« less

Relicts from Tertiary Australasia: undescribed families and subfamilies of songbirds (Passeriformes) and their zoogeographic signal.

PubMed

Schodde, Richard; Christidis, Les

2014-04-14

A number of hitherto unrecognized, deeply divergent taxa of Australasian songbirds have been revealed by DNA sequence studies in the last decade. Differentiation among them is at levels equivalent to family and subfamily rank among songbirds generally. Accordingly, the purpose of this paper is to name and describe eleven of them formally under Articles 13.1, 13.2, 16.1 and 16.2 of the International Code of Zoological Nomenclature so that they are made available for use in zoology. The taxa are: families Oreoicidae, Eulacestomatidae, Rhagologidae, Ifritidae and Melampittidae, and subfamilies Pachycareinae, Oreoscopinae, Toxorhamphinae, Oedistomatinae, Peltopsinae and Lamproliinae. The families to which the subfamilies belong are documented. Morphological and behavioural traits of the new family-group taxa are discussed; reasons for taxonomic rankings are summarized; and grounds for the geographic origin of corvoid songbirds, to which all the new families belong, are briefly addressed. One new genus,Megalampitta in Melampittidae, is also described.

Leaf and stem CO/sub 2/ uptake in the three subfamilies of the Cactaceae. [Pereskia aculeata; Pereskia grandifolia; Maihuenia poeppigii; Carnegiea gigantea; Ferocactus acanthodes; Coryphantha vivipara; Mammillaria dioica; Opuntia ficus-inidica; Pereskiopsis porteri; Quiabentia chacoensis; Austrocylindropuntia subulata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nobel, P.S.; Hartsock, T.L.

Net CO/sub 2/ uptake over 24-hour periods was examined for the leaves and for the stems of 11 species of cacti representing all three subfamilies. For Pereskia aculeata, Pereskia grandifolia, and Maihuenia poeppigii (subfamily Pereskioideae), all the net shoot CO/sub 2/ uptake was by the leaves and during the daytime. In contrast, for the leafless species Carnegiea gigantea, Ferocactus acanthodes, Coryphantha vivipara, and Mammillaria dioica (subfamily Cactoideae), all the shoot net CO/sub 2/ uptake was by the stems and at night. Similarly, for leafless Opuntia ficus-indica (subfamily Opuntioideae), all net CO/sub 2/ uptake occurred at night. For leafy members ofmore » the Opuntioideae (Pereskiopsis porteri, Quiabentia chacoensis, Austrocylindropuntia subulata), at least 88% of the shoot CO/sub 2/ uptake over 24 hours was by the leaves and some CO/sub 2/ uptake occurred at night. Leaves responded to the instantaneous level of photosynthetically active radiation (PAR) during the daytime, as occurs for C/sub 3/ plants, whereas nocturnal CO/sub 2/ uptake by stems of O. ficus-indica and F. acanthodes responded to the total daily PAR, as occurs for Crassulacean acid metabolism (CAM) plants. Thus, under the well-watered conditions employed, the Pereskioideae behaved as C/sub 3/ plants, the Cactoideae behaved as CAM plants, and the Opuntioideae exhibited characteristics of both pathways.« less

DNA Barcoding of the parasitoid wasp subfamily Doryctinae (Hymenoptera: Braconidae) from Chamela, Mexico

PubMed Central

Gutiérrez-Arellano, Daniela; Gutiérrez-Arellano, Claudia Renata

2015-01-01

Abstract Background and aims. The Doryctinae is a considerably diverse, poorly studied group of parasitoid wasps and one of the most diverse subfamilies within Braconidae. Taxonomic knowledge of this group remains highly incomplete, specially in the tropics. In Mexico, it has been reported as the subfamily with the highest number of recorded genera. A preliminary Barcoding study carried out in the Chamela region, located near the Mexican pacific coast in Jalisco, identified 185 barcoding species of Dorytinae assigned to 19 identified doryctine genera. This work updates the later study, representing a three years effort to assess the species richness of this subfamily for the Chamela region. Materials and methods. Ten collecting field trips of 5 to 10 days each were carried out from June 2009 to May 2011. A 2% divergence criterion using the BIN system implemented in BOLD was followed in order to establish species boundaries among the specimens that were collected. Results and conclusions. A total of 961 specimens were collected, from which 883 COI sequences were obtained. The sequences generated corresponded to 289 barcoding species and 30 identified genera. The most speciose genera were Heterospilus Haliday (170 spp.), Ecphylus Förster (19 spp.), Allorhogas Gahan (15 spp.) and Callihormius Ashmead (14 spp.). Addition of previously collected material increased the diversity of the subfamily in the region to 34 genera and 290 species. Paraphyly of Heterospilus with respect to Neoheterospilus and Heterospathius was again recovered. Twenty new species and two new genera (Sabinita Belokobylskij, Zaldívar-Riverón et Martínez, Ficobolus Martínez, Belokobylskij et Zaldívar-Riverón) have been described so far from the material collected in this work. PMID:26023287

Isofunctional Protein Subfamily Detection Using Data Integration and Spectral Clustering.

PubMed

Boari de Lima, Elisa; Meira, Wagner; Melo-Minardi, Raquel Cardoso de

2016-06-01

As increasingly more genomes are sequenced, the vast majority of proteins may only be annotated computationally, given experimental investigation is extremely costly. This highlights the need for computational methods to determine protein functions quickly and reliably. We believe dividing a protein family into subtypes which share specific functions uncommon to the whole family reduces the function annotation problem's complexity. Hence, this work's purpose is to detect isofunctional subfamilies inside a family of unknown function, while identifying differentiating residues. Similarity between protein pairs according to various properties is interpreted as functional similarity evidence. Data are integrated using genetic programming and provided to a spectral clustering algorithm, which creates clusters of similar proteins. The proposed framework was applied to well-known protein families and to a family of unknown function, then compared to ASMC. Results showed our fully automated technique obtained better clusters than ASMC for two families, besides equivalent results for other two, including one whose clusters were manually defined. Clusters produced by our framework showed great correspondence with the known subfamilies, besides being more contrasting than those produced by ASMC. Additionally, for the families whose specificity determining positions are known, such residues were among those our technique considered most important to differentiate a given group. When run with the crotonase and enolase SFLD superfamilies, the results showed great agreement with this gold-standard. Best results consistently involved multiple data types, thus confirming our hypothesis that similarities according to different knowledge domains may be used as functional similarity evidence. Our main contributions are the proposed strategy for selecting and integrating data types, along with the ability to work with noisy and incomplete data; domain knowledge usage for detecting

Isofunctional Protein Subfamily Detection Using Data Integration and Spectral Clustering

PubMed Central

Boari de Lima, Elisa; Meira, Wagner; de Melo-Minardi, Raquel Cardoso

2016-01-01

As increasingly more genomes are sequenced, the vast majority of proteins may only be annotated computationally, given experimental investigation is extremely costly. This highlights the need for computational methods to determine protein functions quickly and reliably. We believe dividing a protein family into subtypes which share specific functions uncommon to the whole family reduces the function annotation problem’s complexity. Hence, this work’s purpose is to detect isofunctional subfamilies inside a family of unknown function, while identifying differentiating residues. Similarity between protein pairs according to various properties is interpreted as functional similarity evidence. Data are integrated using genetic programming and provided to a spectral clustering algorithm, which creates clusters of similar proteins. The proposed framework was applied to well-known protein families and to a family of unknown function, then compared to ASMC. Results showed our fully automated technique obtained better clusters than ASMC for two families, besides equivalent results for other two, including one whose clusters were manually defined. Clusters produced by our framework showed great correspondence with the known subfamilies, besides being more contrasting than those produced by ASMC. Additionally, for the families whose specificity determining positions are known, such residues were among those our technique considered most important to differentiate a given group. When run with the crotonase and enolase SFLD superfamilies, the results showed great agreement with this gold-standard. Best results consistently involved multiple data types, thus confirming our hypothesis that similarities according to different knowledge domains may be used as functional similarity evidence. Our main contributions are the proposed strategy for selecting and integrating data types, along with the ability to work with noisy and incomplete data; domain knowledge usage for detecting

Novel triterpene oxidizing activity of Arabidopsis thaliana CYP716A subfamily enzymes.

PubMed

Yasumoto, Shuhei; Fukushima, Ery O; Seki, Hikaru; Muranaka, Toshiya

2016-02-01

Triterpenoids have diverse chemical structures and bioactivities. Cytochrome P450 monooxygenases play a key role in their structural diversification. In higher plants, CYP716A subfamily enzymes are triterpene oxidases. In this study, Arabidopsis thaliana CYP716A1 and CYP716A2 were characterized by heterologously expressing them in simple triterpene-producing yeast strains. In contrast to the C-28 oxidative activity of CYP716A1 shown in several CYP716A subfamily enzymes, remarkably, CYP716A2 displayed 22α-hydroxylation activity against α-amyrin that has not been previously reported, which produces the cytotoxic triterpenoid, 22α-hydroxy-α-amyrin. Our results contribute to the enrichment of the molecular toolbox that allows for the combinatorial biosynthesis of diverse triterpenoids. © 2016 Federation of European Biochemical Societies.

Soybean (Glycine max) expansin gene superfamily origins: segmental and tandem duplication events followed by divergent selection among subfamilies

PubMed Central

2014-01-01

Background Expansins are plant cell wall loosening proteins that are involved in cell enlargement and a variety of other developmental processes. The expansin superfamily contains four subfamilies; namely, α-expansin (EXPA), β-expansin (EXPB), expansin-like A (EXLA), and expansin-like B (EXLB). Although the genome sequencing of soybeans is complete, our knowledge about the pattern of expansion and evolutionary history of soybean expansin genes remains limited. Results A total of 75 expansin genes were identified in the soybean genome, and grouped into four subfamilies based on their phylogenetic relationships. Structural analysis revealed that the expansin genes are conserved in each subfamily, but are divergent among subfamilies. Furthermore, in soybean and Arabidopsis, the expansin gene family has been mainly expanded through tandem and segmental duplications; however, in rice, segmental duplication appears to be the dominant process that generates this superfamily. The transcriptome atlas revealed notable differential expression in either transcript abundance or expression patterns under normal growth conditions. This finding was consistent with the differential distribution of the cis-elements in the promoter region, and indicated wide functional divergence in this superfamily. Moreover, some critical amino acids that contribute to functional divergence and positive selection were detected. Finally, site model and branch-site model analysis of positive selection indicated that the soybean expansin gene superfamily is under strong positive selection, and that divergent selection constraints might have influenced the evolution of the four subfamilies. Conclusion This study demonstrated that the soybean expansin gene superfamily has expanded through tandem and segmental duplication. Differential expression indicated wide functional divergence in this superfamily. Furthermore, positive selection analysis revealed that divergent selection constraints might have

Capsaicin and N-arachidonoyl-dopamine (NADA) decrease tension by activating both cannabinoid and vanilloid receptors in fast skeletal muscle fibers of the frog.

PubMed

Trujillo, Xóchitl; Ortiz-Mesina, Mónica; Uribe, Tannia; Castro, Elena; Montoya-Pérez, Rocío; Urzúa, Zorayda; Feria-Velasco, Alfredo; Huerta, Miguel

2015-02-01

Previous studies have indicated that vanilloid receptor (VR1) mRNA is expressed in muscle fibers. In this study, we evaluated the functional effects of VR1 activation. We measured caffeine-induced contractions in bundles of the extensor digitorum longus muscle of Rana pipiens. Isometric tension measurements showed that two VR1 agonists, capsaicin (CAP) and N-arachidonoyl-dopamine (NADA), reduced muscle peak tension to 57 ± 4 % and 71 ± 3% of control, respectively. The effect of CAP was partially blocked by a VR1 blocker, capsazepine (CPZ), but the effect of NADA was not changed by CPZ. Because NADA is able to act on cannabinoid receptors, which are also present in muscle fibers, we tested the cannabinoid antagonist AM281. We found that AM281 antagonized both CAP and NADA effects. AM281 alone reduced peak tension to 80 ± 6 % of control. With both antagonists, the CAP effect was completely blocked, and the NADA effect was partially blocked. These results provide pharmacological evidence of the functional presence of the VR1 receptor in fast skeletal muscle fibers of the frog and suggest that capsaicin and NADA reduce tension by activating both cannabinoid and vanilloid receptors.

The sympathetic nervous system is controlled by transient receptor potential vanilloid 1 in the regulation of body temperature

PubMed Central

Alawi, Khadija M.; Aubdool, Aisah A.; Liang, Lihuan; Wilde, Elena; Vepa, Abhinav; Psefteli, Maria-Paraskevi; Brain, Susan D.; Keeble, Julie E.

2015-01-01

Transient receptor potential vanilloid 1 (TRPV1) is involved in sensory nerve nociceptive signaling. Recently, it has been discovered that TRPV1 receptors also regulate basal body temperature in multiple species from mice to humans. In the present study, we investigated whether TRPV1 modulates basal sympathetic nervous system (SNS) activity. C57BL6/J wild-type (WT) mice and TRPV1 knockout (KO) mice were implanted with radiotelemetry probes for measurement of core body temperature. AMG9810 (50 mg/kg) or vehicle (2% DMSO/5% Tween 80/10 ml/kg saline) was injected intraperitoneally. Adrenoceptor antagonists or vehicle (5 ml/kg saline) was injected subcutaneously. In WT mice, the TRPV1 antagonist, AMG9810, caused significant hyperthermia, associated with increased noradrenaline concentrations in brown adipose tissue. The hyperthermia was significantly attenuated by the β-adrenoceptor antagonist propranolol, the mixed α-/β-adrenoceptor antagonist labetalol, and the α1-adrenoceptor antagonist prazosin. TRPV1 KO mice have a normal basal body temperature, indicative of developmental compensation. d-Amphetamine (potent sympathomimetic) caused hyperthermia in WT mice, which was reduced in TRPV1 KO mice, suggesting a decreased sympathetic drive in KOs. This study provides new evidence that TRPV1 controls thermoregulation upstream of the SNS, providing a potential therapeutic target for sympathetic hyperactivity thermoregulatory disorders.—Alawi, K. M., Aubdool, A. A., Liang, L., Wilde, E., Vepa, A., Psefteli, M.-P., Brain, S. D., Keeble, J. E. The sympathetic nervous system is controlled by transient receptor potential vanilloid 1 in the regulation of body temperature. PMID:26136480

A conserved human DJ1-subfamily motif (DJSM) is critical for anti-oxidative and deglycase activities of Plasmodium falciparum DJ1.

PubMed

Nair, Divya N; Prasad, Rajesh; Singhal, Neha; Bhattacharjee, Manish; Sudhakar, Renu; Singh, Pushpa; Thanumalayan, Subramonian; Kiran, Uday; Sharma, Yogendra; Sijwali, Puran Singh

2018-06-01

Plasmodium falciparum DJ1 (PfDJ1) belongs to the DJ-1/ThiJ/PfpI superfamily whose members are present in all the kingdoms of life and exhibit diverse cellular functions and biochemical activities. The common feature of the superfamily is the class I glutamine amidotransferase domain with a conserved redox-active cysteine residue, which mediates various activities of the superfamily members, including anti-oxidative activity in PfDJ1 and human DJ1 (hDJ1). As the superfamily members represent diverse functional classes, to investigate if there is any sequence feature unique to hDJ1-like proteins, sequences of the representative proteins of different functional classes were compared and analysed. A novel motif unique to PfDJ1 and several other hDJ1-like proteins, with the consensus sequence of TSXGPX5FXLX5L, was identified that we designated as the hDJ1-subfamily motif (DJSM). Several mutations that have been associated with Parkinson's disease are also present in DJSM, suggesting its functional importance in hDJ1-like proteins. Mutations of the conserved residues of DJSM of PfDJ1 did not significantly affect overall secondary structure, but caused both a significant loss (S151A and P154A) and gain (L168A) of anti-oxidative activity. We also report that PfDJ1 has deglycase activity, which was significantly decreased in its mutants of the catalytic cysteine (C106A) and DJSM (S151A and P154A). Episomal expression of the catalytic cysteine (C106A) or DJSM (P154A) mutant decreased growth rates of parasites as compared to that of wild type parasites or parasites expressing wild type PfDJ1. S151 appears to properly position the nucleophilic elbow containing C106 and P154 forms a hydrogen bond with C106, which could be a reason for the loss of activities of PfDJ1 upon their mutations. Taken together, DJSM delineates PfDJ1 and other hDJ1-subfamily proteins from the remaining superfamily, and is critical for anti-oxidative and deglycase activities of PfDJ1. Copyright © 2018

Analysis of the murine Dtk gene identifies conservation of genomic structure within a new receptor tyrosine kinase subfamily

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lewis, P.M.; Crosier, K.E.; Crosier, P.S.

The receptor tyrosine kinase Dtk/Tyro 3/Sky/rse/brt/tif is a member of a new subfamily of receptors that also includes Axl/Ufo/Ark and Eyk/Mer. These receptors are characterized by the presence of two immunoglobulin-like loops and two fibronectin type III repeats in their extracellular domains. The structure of the murine Dtk gene has been determined. The gene consists of 21 exons that are distributed over 21 kb of genomic DNA. An isoform of Dtk is generated by differential splicing of exons from the 5{prime} region of the gene. The overall genomic structure of Dtk is virtually identical to that determined for the humanmore » UFO gene. This particular genomic organization is likely to have been duplicated and closely maintained throughout evolution. 38 refs., 3 figs., 1 tab.« less

Unrelated sequences at the 5' end of mouse LINE-1 repeated elements define two distinct subfamilies.

PubMed Central

Wincker, P; Jubier-Maurin, V; Roizès, G

1987-01-01

Some full length members of the mouse long interspersed repeated DNA family L1Md have been shown to be associated at their 5' end with a variable number of tandem repetitions, the A repeats, that have been suggested to be transcription controlling elements. We report that the other type of repeat, named F, found at the 5' end of a few L1 elements is also an integral part of full length L1 copies. Sequencing shows that the F repeats are GC rich, and organized in tandem. The L1 copies associated with either A or F repeats can be correlated with two different subsets of L1 sequences distinguished by a series of variant nucleotides specific to each and by unassociated but frequent restriction sites. These findings suggest that sequence replacement has occurred at least once in 5' of L1Md, and is related to the generation of specific subfamilies. Images PMID:3684566

Discovering the silk road: Nuclear and mitochondrial sequence data resolve the phylogenetic relationships among theraphosid spider subfamilies.

PubMed

Lüddecke, Tim; Krehenwinkel, Henrik; Canning, Gregory; Glaw, Frank; Longhorn, Stuart J; Tänzler, René; Wendt, Ingo; Vences, Miguel

2018-02-01

The mygalomorph spiders in the family Theraphosidae, also known as "tarantulas", are one of the most popular and diverse groups of arachnids, but their evolutionary history remains poorly understood because morphological analyses have only provided mostly controversial results, and a broad molecular perspective has been lacking until now. In this study we provide a preliminary molecular phylogenetic hypothesis of relationships among theraphosid subfamilies, based on 3.5 kbp of three nuclear and three mitochondrial markers, for 52 taxa representing 10 of the 11 commonly accepted subfamilies. Our analysis confirms the monophyly of the Theraphosidae and of most recognized theraphosid subfamilies, supports the validity of the Stromatopelminae and Poecilotheriinae, and indicates paraphyly of the Schismatothelinae. The placement of representatives of Schismatothelinae also indicates possible non-monophyly of Aviculariinae and supports the distinction of the previously contentious subfamily Psalmopoeinae. Major clades typically corresponded to taxa occurring in the same biogeographic region, with two of them each occurring in Africa, South America and Asia. Because relationships among these major clades were poorly supported, more extensive molecular data sets are required to test the hypothesis of independent colonization and multiple dispersal events among these continents. Copyright © 2017 Elsevier Inc. All rights reserved.

Ancient Complexity, Opisthokont Plasticity, and Discovery of the 11th Subfamily of Arf GAP Proteins

PubMed Central

Schlacht, Alexander; Mowbrey, Kevin; Elias, Marek; Kahn, Richard A.; Dacks, Joel B.

2013-01-01

The organelle paralogy hypothesis is one model for the acquisition of non-endosymbiotic organelles, generated from molecular evolutionary analyses of proteins encoding specificity in the membrane traffic system. GTPase Activating Proteins (GAPs) for the ADP-ribosylation factor (Arfs) GTPases are additional regulators of the kinetics and fidelity of membrane traffic. Here we describe molecular evolutionary analyses of Arf GAP protein family. Of the ten subfamilies previously defined in humans, we find that five were likely present in the Last Eukaryotic Common Ancestor (LECA). Of the three more recently derived subfamilies, one was likely present in the ancestor of opisthokonts (animals and fungi) and apusomonads (flagellates classified as the sister lineage to opisthokonts), while two arose in the holozoan lineage. We also propose to have identified a novel ancient subfamily (ArfGAPC2), present in diverse eukaryotes but which is lost frequently, including in the opisthokonts. Surprisingly few ancient domains accompanying the ArfGAP domain were identified, in marked contrast to the extensively decorated human Arf GAPs. Phylogenetic analyses of the subfamilies reveal patterns of single and multiple gene duplications specific to the Holozoa, to some degree mirroring evolution of Arf GAP targets, the Arfs. Conservation, and lack thereof, of various residues in the ArfGAP structure provide contextualization of previously identified functional amino acids and their application to Arf GAP biology in general. Overall, our results yield insights into current Arf GAP biology, reveal complexity in the ancient eukaryotic ancestor, and integrate the Arf GAP family into a proposed mechanism for the evolution of non-endosymbiotic organelles. PMID:23433073

Use Dependence of Heat Sensitivity of Vanilloid Receptor TRPV2.

PubMed

Liu, Beiying; Qin, Feng

2016-04-12

Thermal TRP channels mediate temperature transduction and pain sensation. The vanilloid receptor TRPV2 is involved in detection of noxious heat in a subpopulation of high-threshold nociceptors. It also plays a critical role in development of thermal hyperalgesia, but the underlying mechanism remains uncertain. Here we analyze the heat sensitivity of the TRPV2 channel. Heat activation of the channel exhibits strong use dependence. Prior heat activation can profoundly alter its subsequent temperature responsiveness, causing decreases in both temperature activation threshold and slope sensitivity of temperature dependence while accelerating activation time courses. Notably, heat and agonist activations differ in cross use-dependence. Prior heat stimulation can dramatically sensitize agonist responses, but not conversely. Quantitative analyses indicate that the use dependence in heat sensitivity is pertinent to the process of temperature sensing by the channel. The use dependence of TRPV2 reveals that the channel can have a dynamic temperature sensitivity. The temperature sensing structures within the channel have multiple conformations and the temperature activation pathway is separate from the agonist activation pathway. Physiologically, the use dependence of TRPV2 confers nociceptors with a hypersensitivity to heat and thus provides a mechanism for peripheral thermal hyperalgesia. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Nonpsychotropic plant cannabinoids, cannabidivarin (CBDV) and cannabidiol (CBD), activate and desensitize transient receptor potential vanilloid 1 (TRPV1) channels in vitro: potential for the treatment of neuronal hyperexcitability.

PubMed

Iannotti, Fabio Arturo; Hill, Charlotte L; Leo, Antonio; Alhusaini, Ahlam; Soubrane, Camille; Mazzarella, Enrico; Russo, Emilio; Whalley, Benjamin J; Di Marzo, Vincenzo; Stephens, Gary J

2014-11-19

Epilepsy is the most common neurological disorder, with over 50 million people worldwide affected. Recent evidence suggests that the transient receptor potential cation channel subfamily V member 1 (TRPV1) may contribute to the onset and progression of some forms of epilepsy. Since the two nonpsychotropic cannabinoids cannabidivarin (CBDV) and cannabidiol (CBD) exert anticonvulsant activity in vivo and produce TRPV1-mediated intracellular calcium elevation in vitro, we evaluated the effects of these two compounds on TRPV1 channel activation and desensitization and in an in vitro model of epileptiform activity. Patch clamp analysis in transfected HEK293 cells demonstrated that CBD and CBDV dose-dependently activate and rapidly desensitize TRPV1, as well as TRP channels of subfamily V type 2 (TRPV2) and subfamily A type 1 (TRPA1). TRPV1 and TRPV2 transcripts were shown to be expressed in rat hippocampal tissue. When tested on epileptiform neuronal spike activity in hippocampal brain slices exposed to a Mg(2+)-free solution using multielectrode arrays (MEAs), CBDV reduced both epileptiform burst amplitude and duration. The prototypical TRPV1 agonist, capsaicin, produced similar, although not identical effects. Capsaicin, but not CBDV, effects on burst amplitude were reversed by IRTX, a selective TRPV1 antagonist. These data suggest that CBDV antiepileptiform effects in the Mg(2+)-free model are not uniquely mediated via activation of TRPV1. However, TRPV1 was strongly phosphorylated (and hence likely sensitized) in Mg(2+)-free solution-treated hippocampal tissue, and both capsaicin and CBDV caused TRPV1 dephosphorylation, consistent with TRPV1 desensitization. We propose that CBDV effects on TRP channels should be studied further in different in vitro and in vivo models of epilepsy.

Acetaminophen Metabolite N-Acylphenolamine Induces Analgesia via Transient Receptor Potential Vanilloid 1 Receptors Expressed on the Primary Afferent Terminals of C-fibers in the Spinal Dorsal Horn.

PubMed

Ohashi, Nobuko; Uta, Daisuke; Sasaki, Mika; Ohashi, Masayuki; Kamiya, Yoshinori; Kohno, Tatsuro

2017-08-01

The widely used analgesic acetaminophen is metabolized to N-acylphenolamine, which induces analgesia by acting directly on transient receptor potential vanilloid 1 or cannabinoid 1 receptors in the brain. Although these receptors are also abundant in the spinal cord, no previous studies have reported analgesic effects of acetaminophen or N-acylphenolamine mediated by the spinal cord dorsal horn. We hypothesized that clinical doses of acetaminophen induce analgesia via these spinal mechanisms. We assessed our hypothesis in a rat model using behavioral measures. We also used in vivo and in vitro whole cell patch-clamp recordings of dorsal horn neurons to assess excitatory synaptic transmission. Intravenous acetaminophen decreased peripheral pinch-induced excitatory responses in the dorsal horn (53.1 ± 20.7% of control; n = 10; P < 0.01), while direct application of acetaminophen to the dorsal horn did not reduce these responses. Direct application of N-acylphenolamine decreased the amplitudes of monosynaptic excitatory postsynaptic currents evoked by C-fiber stimulation (control, 462.5 ± 197.5 pA; N-acylphenolamine, 272.5 ± 134.5 pA; n = 10; P = 0.022) but not those evoked by stimulation of Aδ-fibers. These phenomena were mediated by transient receptor potential vanilloid 1 receptors, but not cannabinoid 1 receptors. The analgesic effects of acetaminophen and N-acylphenolamine were stronger in rats experiencing an inflammatory pain model compared to naïve rats. Our results suggest that the acetaminophen metabolite N-acylphenolamine induces analgesia directly via transient receptor potential vanilloid 1 receptors expressed on central terminals of C-fibers in the spinal dorsal horn and leads to conduction block, shunt currents, and desensitization of these fibers.

Two new subfamilies of DNA mismatch repair proteins (MutS) specifically abundant in the marine environment

PubMed Central

Ogata, Hiroyuki; Ray, Jessica; Toyoda, Kensuke; Sandaa, Ruth-Anne; Nagasaki, Keizo; Bratbak, Gunnar; Claverie, Jean-Michel

2011-01-01

MutS proteins are ubiquitous in cellular organisms and have important roles in DNA mismatch repair or recombination. In the virus world, the amoeba-infecting Mimivirus, as well as the recently sequenced Cafeteria roenbergensis virus are known to encode a MutS related to the homologs found in octocorals and ɛ-proteobacteria. To explore the presence of MutS proteins in other viral genomes, we performed a genomic survey of four giant viruses (‘giruses') (Pyramimonas orientalis virus (PoV), Phaeocystis pouchetii virus (PpV), Chrysochromulina ericina virus (CeV) and Heterocapsa circularisquama DNA virus (HcDNAV)) that infect unicellular marine algae. Our analysis revealed the presence of a close homolog of Mimivirus MutS in all the analyzed giruses. These viral homologs possess a specific domain structure, including a C-terminal HNH-endonuclease domain, defining the new MutS7 subfamily. We confirmed the presence of conserved mismatch recognition residues in all members of the MutS7 subfamily, suggesting their role in DNA mismatch repair rather than DNA recombination. PoV and PpV were found to contain an additional type of MutS, which we propose to call MutS8. The MutS8 proteins in PoV and PpV were found to be closely related to homologs from ‘Candidatus Amoebophilus asiaticus', an obligate intracellular amoeba-symbiont belonging to the Bacteroidetes. Furthermore, our analysis revealed that MutS7 and MutS8 are abundant in marine microbial metagenomes and that a vast majority of these environmental sequences are likely of girus origin. Giruses thus seem to represent a major source of the underexplored diversity of the MutS family in the microbial world. PMID:21248859

The reprogramming factor nuclear receptor subfamily 5, group A, member 2 cannot replace octamer-binding transcription factor 4 function in the self-renewal of embryonic stem cells.

PubMed

Choi, Kyeng-Won; Oh, Hye-Rim; Lee, Jaeyoung; Lim, Bobae; Han, Yong-Mahn; Oh, Junseo; Kim, Jungho

2014-02-01

Although octamer-binding transcription factor 4 (Oct-4) is one of the most intensively studied factors in mammalian development, no cellular genes capable of replacing Oct-4 function in embryonic stem (ES) cells have been found. Recent data show that nuclear receptor subfamily 5, group A, member 2 (Nr5a2) is able to replace Oct-4 function in the reprogramming process; however, it is unclear whether Nr5a2 can replace Oct-4 function in ES cells. In this study, the ability of Nr5a2 to maintain self-renewal and pluripotency in ES cells was investigated. Nr5a2 localized to the nucleus in ES cells, similarly to Oct-4. However, expression of Nr5a2 failed to rescue the stem cell phenotype or to maintain the self-renewal ability of ES cells. Furthermore, as compared with Oct-4-expressing ES cells, Nr5a2-expressing ES cells showed a reduced number of cells in S-phase, did not expand normally, and did not remain in an undifferentiated state. Ectopic expression of Nr5a2 in ES cells was not able to activate transcription of ES cell-specific genes, and gene expression profiling demonstrated differences between Nr5a2-expressing and Oct-4-expressing ES cells. In addition, Nr5a2-expressing ES cells were not able to form teratomas in nude mice. Taken together, these results strongly suggest that the gene regulation properties of Nr5a2 and Oct-4 and their abilities to confer self-renewal and pluripotency of ES cells differ. The present study provides strong evidence that Nr5a2 cannot replace Oct-4 function in ES cells. © 2013 FEBS.

ATP-binding cassette subfamily A, member 4 intronic variants c.4773+3A>G and c.5461-10T>C cause Stargardt disease due to defective splicing.

PubMed

Jonsson, Frida; Westin, Ida Maria; Österman, Lennart; Sandgren, Ola; Burstedt, Marie; Holmberg, Monica; Golovleva, Irina

2018-02-20

Inherited retinal dystrophies (IRDs) represent a group of progressive conditions affecting the retina. There is a great genetic heterogeneity causing IRDs, and to date, more than 260 genes are associated with IRDs. Stargardt disease, type 1 (STGD1) or macular degeneration with flecks, STGD1 represents a disease with early onset, central visual impairment, frequent appearance of yellowish flecks and mutations in the ATP-binding cassette subfamily A, member 4 (ABCA4) gene. A large number of intronic sequence variants in ABCA4 have been considered pathogenic although their functional effect was seldom demonstrated. In this study, we aimed to reveal how intronic variants present in patients with Stargardt from the same Swedish family affect splicing. The splicing of the ABCA4 gene was studied in human embryonic kidney cells, HEK293T, and in human retinal pigment epithelium cells, ARPE-19, using a minigene system containing variants c.4773+3A>G and c.5461-10T>C. We showed that both ABCA4 variants, c.4773+3A>G and c.5461-10T>C, cause aberrant splicing of the ABCA4 minigene resulting in exon skipping. We also demonstrated that splicing of ABCA4 has different outcomes depending on transfected cell type. Two intronic variants c.4773+3A>G and c.5461-10T>C, both predicted to affect splicing, are indeed disease-causing mutations due to skipping of exons 33, 34, 39 and 40 of ABCA4 gene. The experimental proof that ABCA4 mutations in STGD patients affect protein function is crucial for their inclusion to future clinical trials; therefore, functional testing of all ABCA4 intronic variants associated with Stargardt disease by minigene technology is desirable. © 2018 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

The Exiguobacterium sibiricum 255-15 GtfC Enzyme Represents a Novel Glycoside Hydrolase 70 Subfamily of 4,6-α-Glucanotransferase Enzymes.

PubMed

Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert

2016-01-15

The glycoside hydrolase 70 (GH70) family originally was established for glucansucrase enzymes found solely in lactic acid bacteria synthesizing α-glucan polysaccharides from sucrose (e.g., GtfA). In recent years, we have characterized GtfB and related Lactobacillus enzymes as 4,6-α-glucanotransferase enzymes. These GtfB-type enzymes constitute the first GH70 subfamily of enzymes that are unable to act on sucrose as a substrate but are active with maltodextrins and starch, cleave α1→4 linkages, and synthesize linear α1→6-glucan chains. The GtfB disproportionating type of activity results in the conversion of malto-oligosaccharides into isomalto/malto-polysaccharides with a relatively high percentage of α1→6 linkages. This paper reports the identification of the members of a second GH70 subfamily (designated GtfC enzymes) and the characterization of the Exiguobacterium sibiricum 255-15 GtfC enzyme, which is also inactive with sucrose and displays 4,6-α-glucanotransferase activity with malto-oligosaccharides. GtfC differs from GtfB in synthesizing isomalto/malto-oligosaccharides. Biochemically, the GtfB- and GtfC-type enzymes are related, but phylogenetically, they clearly constitute different GH70 subfamilies, displaying only 30% sequence identity. Whereas the GtfB-type enzyme largely has the same domain order as glucansucrases (with α-amylase domains A, B, and C plus domains IV and V), this GtfC-type enzyme differs in the order of these domains and completely lacks domain V. In GtfC, the sequence of conserved regions I to IV of clan GH-H is identical to that in GH13 (I-II-III-IV) but different from that in GH70 (II-III-IV-I because of a circular permutation of the (β/α)8 barrel. The GtfC 4,6-α-glucanotransferase enzymes thus represent structurally and functionally very interesting evolutionary intermediates between α-amylase and glucansucrase enzymes. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Phylogeny and Evolutionary Patterns in the Dwarf Crayfish Subfamily (Decapoda: Cambarellinae)

PubMed Central

Pedraza-Lara, Carlos; Doadrio, Ignacio; Breinholt, Jesse W.; Crandall, Keith A.

2012-01-01

The Dwarf crayfish or Cambarellinae, is a morphologically singular subfamily of decapod crustaceans that contains only one genus, Cambarellus. Its intriguing distribution, along the river basins of the Gulf Coast of United States (Gulf Group) and into Central México (Mexican Group), has until now lacked of satisfactory explanation. This study provides a comprehensive sampling of most of the extant species of Cambarellus and sheds light on its evolutionary history, systematics and biogeography. We tested the impact of Gulf Group versus Mexican Group geography on rates of cladogenesis using a maximum likelihood framework, testing different models of birth/extinction of lineages. We propose a comprehensive phylogenetic hypothesis for the subfamily based on mitochondrial and nuclear loci (3,833 bp) using Bayesian and Maximum Likelihood methods. The phylogenetic structure found two phylogenetic groups associated to the two main geographic components (Gulf Group and Mexican Group) and is partially consistent with the historical structure of river basins. The previous hypothesis, which divided the genus into three subgenera based on genitalia morphology was only partially supported (P = 0.047), resulting in a paraphyletic subgenus Pandicambarus. We found at least two cases in which phylogenetic structure failed to recover monophyly of recognized species while detecting several cases of cryptic diversity, corresponding to lineages not assigned to any described species. Cladogenetic patterns in the entire subfamily are better explained by an allopatric model of speciation. Diversification analyses showed similar cladogenesis patterns between both groups and did not significantly differ from the constant rate models. While cladogenesis in the Gulf Group is coincident in time with changes in the sea levels, in the Mexican Group, cladogenesis is congruent with the formation of the Trans-Mexican Volcanic Belt. Our results show how similar allopatric divergence in

A large-scale chloroplast phylogeny of the Lamiaceae sheds new light on its subfamilial classification

PubMed Central

Li, Bo; Cantino, Philip D.; Olmstead, Richard G.; Bramley, Gemma L. C.; Xiang, Chun-Lei; Ma, Zhong-Hui; Tan, Yun-Hong; Zhang, Dian-Xiang

2016-01-01

Lamiaceae, the sixth largest angiosperm family, contains more than 7000 species distributed all over the world. However, although considerable progress has been made in the last two decades, its phylogenetic backbone has never been well resolved. In the present study, a large-scale phylogenetic reconstruction of Lamiaceae using chloroplast sequences was carried out with the most comprehensive sampling of the family to date (288 species in 191 genera, representing approximately 78% of the genera of Lamiaceae). Twelve strongly supported primary clades were inferred, which form the phylogenetic backbone of Lamiaceae. Six of the primary clades correspond to the current recognized subfamilies Ajugoideae, Lamioideae, Nepetoideae, Prostantheroideae, Scutellarioideae, and Symphorematoideae, and one corresponds to a portion of Viticoideae. The other five clades comprise: 1) Acrymia and Cymaria; 2) Hymenopyramis, Petraeovitex, Peronema, and Garrettia; 3) Premna, Gmelina, and Cornutia; 4) Callicarpa; and 5) Tectona. Based on these results, three new subfamilies—Cymarioideae, Peronematoideae, and Premnoideae—are described, and the compositions of other subfamilies are updated based on new findings from the last decade. Furthermore, our analyses revealed five strongly supported, more inclusive clades that contain subfamilies, and we give them phylogenetically defined, unranked names: Cymalamiina, Scutelamiina, Perolamiina, Viticisymphorina, and Calliprostantherina. PMID:27748362

Prevalent Exon-Intron Structural Changes in the APETALA1/FRUITFULL, SEPALLATA, AGAMOUS-LIKE6, and FLOWERING LOCUS C MADS-Box Gene Subfamilies Provide New Insights into Their Evolution

PubMed Central

Yu, Xianxian; Duan, Xiaoshan; Zhang, Rui; Fu, Xuehao; Ye, Lingling; Kong, Hongzhi; Xu, Guixia; Shan, Hongyan

2016-01-01

AP1/FUL, SEP, AGL6, and FLC subfamily genes play important roles in flower development. The phylogenetic relationships among them, however, have been controversial, which impedes our understanding of the origin and functional divergence of these genes. One possible reason for the controversy may be the problems caused by changes in the exon-intron structure of genes, which, according to recent studies, may generate non-homologous sites and hamper the homology-based sequence alignment. In this study, we first performed exon-by-exon alignments of these and three outgroup subfamilies (SOC1, AG, and STK). Phylogenetic trees reconstructed based on these matrices show improved resolution and better congruence with species phylogeny. In the context of these phylogenies, we traced evolutionary changes of exon-intron structures in each subfamily. We found that structural changes have occurred frequently following gene duplication and speciation events. Notably, exons 7 and 8 (if present) suffered more structural changes than others. With the knowledge of exon-intron structural changes, we generated more reasonable alignments containing all the focal subfamilies. The resulting trees showed that the SEP subfamily is sister to the monophyletic group formed by AP1/FUL and FLC subfamily genes and that the AGL6 subfamily forms a sister group to the three abovementioned subfamilies. Based on this topology, we inferred the evolutionary history of exon-intron structural changes among different subfamilies. Particularly, we found that the eighth exon originated before the divergence of AP1/FUL, FLC, SEP, and AGL6 subfamilies and degenerated in the ancestral FLC-like gene. These results provide new insights into the origin and evolution of the AP1/FUL, FLC, SEP, and AGL6 subfamilies. PMID:27200066

Unequal subfamily proportions among honey bee queen and worker brood

PubMed

Tilley; Oldroyd

1997-12-01

Queens from three colonies of feral honey bees, Apis mellifera were removed and placed in separate nucleus colonies. For each colony, eggs and larvae were taken from the nucleus and placed in the main hive on each of 3-4 consecutive weeks. Workers in the queenless parts selected young larvae to rear as queens. Queen pupae, together with the surrounding worker pupae, were removed from each colony and analysed at two to three microsatellite loci to determine their paternity. In all three colonies, the paternity of larvae chosen by the bees to rear as queens was not a random sample of the paternities in the worker brood, with certain subfamilies being over-represented in queens. These results support an important prediction of kin selection theory: when colonies are queenless, unequal relatedness within colonies could lead to the evolution of reproductive competition, that is some subfamilies achieving greater reproductive success than others. The mechanism by which such dominance is achieved could be through a system of kin recognition and nepotism, but we conclude that genetically based differential attractiveness of larvae for rearing as queens is more likely.Copyright 1997 The Association for the Study of Animal BehaviourCopyright 1997The Association for the Study of Animal Behaviour.

Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across Vitis and Arabidopsis genomes

PubMed Central

Matus, José Tomás; Aquea, Felipe; Arce-Johnson, Patricio

2008-01-01

Background The MYB superfamily constitutes the most abundant group of transcription factors described in plants. Members control processes such as epidermal cell differentiation, stomatal aperture, flavonoid synthesis, cold and drought tolerance and pathogen resistance. No genome-wide characterization of this family has been conducted in a woody species such as grapevine. In addition, previous analysis of the recently released grape genome sequence suggested expansion events of several gene families involved in wine quality. Results We describe and classify 108 members of the grape R2R3 MYB gene subfamily in terms of their genomic gene structures and similarity to their putative Arabidopsis thaliana orthologues. Seven gene models were derived and analyzed in terms of gene expression and their DNA binding domain structures. Despite low overall sequence homology in the C-terminus of all proteins, even in those with similar functions across Arabidopsis and Vitis, highly conserved motif sequences and exon lengths were found. The grape epidermal cell fate clade is expanded when compared with the Arabidopsis and rice MYB subfamilies. Two anthocyanin MYBA related clusters were identified in chromosomes 2 and 14, one of which includes the previously described grape colour locus. Tannin related loci were also detected with eight candidate homologues in chromosomes 4, 9 and 11. Conclusion This genome wide transcription factor analysis in Vitis suggests that clade-specific grape R2R3 MYB genes are expanded while other MYB genes could be well conserved compared to Arabidopsis. MYB gene abundance, homology and orientation within particular loci also suggests that expanded MYB clades conferring quality attributes of grapes and wines, such as colour and astringency, could possess redundant, overlapping and cooperative functions. PMID:18647406

Iron overload causes osteoporosis in thalassemia major patients through interaction with transient receptor potential vanilloid type 1 (TRPV1) channels

PubMed Central

Rossi, Francesca; Perrotta, Silverio; Bellini, Giulia; Luongo, Livio; Tortora, Chiara; Siniscalco, Dario; Francese, Matteo; Torella, Marco; Nobili, Bruno; Di Marzo, Vincenzo; Maione, Sabatino

2014-01-01

The pathogenesis of bone resorption in β-thalassemia major is multifactorial and our understanding of the underlying molecular and cellular mechanisms remains incomplete. Considering the emerging importance of the endocannabinoid/endovanilloid system in bone metabolism, it may be instructive to examine a potential role for this system in the development of osteoporosis in patients with β-thalassemia major and its relationship with iron overload and iron chelation therapy. This study demonstrates that, in thalassemic-derived osteoclasts, tartrate-resistant acid phosphatase expression inversely correlates with femoral and lumbar bone mineral density, and directly correlates with ferritin levels and liver iron concentration. The vanilloid agonist resiniferatoxin dramatically reduces cathepsin K levels and osteoclast numbers in vitro, without affecting tartrate-resistant acid phosphatase expression. The iron chelators deferoxamine, deferiprone and deferasirox decrease both tartrate-resistant acid phosphatase and cathepsin K expression, as well as osteoclast activity. Taken together, these data show that transient receptor potential vanilloid type 1 activation/desensitization influences tartrate-resistant acid phosphatase expression and activity, and this effect is dependent on iron, suggesting a pivotal role for iron overload in the dysregulation of bone metabolism in patients with thalassemia major. Our applied pharmacology provides evidence for the potential of iron chelators to abrogate these effects by reducing osteoclast activity. Whether iron chelation therapy is capable of restoring bone health in humans requires further study, but the potential to provide dual benefits for patients with β-thalassemia major –preventing iron-overload and alleviating associated osteoporotic changes – is exciting. PMID:25216685

HCV proteins and immunoglobulin variable gene (IgV) subfamilies in HCV-induced type II mixed cryoglobulinemia: a concurrent pathogenetic role.

PubMed

Sautto, Giuseppe; Mancini, Nicasio; Solforosi, Laura; Diotti, Roberta A; Clementi, Massimo; Burioni, Roberto

2012-01-01

The association between hepatitis C virus (HCV) infection and type II mixed cryoglobulinemia (MCII) is well established, but the role played by distinct HCV proteins and by specific components of the anti-HCV humoral immune response remains to be clearly defined. It is widely accepted that HCV drives the expansion of few B-cell clones expressing a restricted pool of selected immunoglobulin variable (IgV) gene subfamilies frequently endowed with rheumatoid factor (RF) activity. Moreover, the same IgV subfamilies are frequently observed in HCV-transformed malignant B-cell clones occasionally complicating MCII. In this paper, we analyze both the humoral and viral counterparts at the basis of cryoglobulins production in HCV-induced MCII, with particular attention reserved to the single IgV subfamilies most frequently involved.

Molecular Evolutionary Characterization of a V1R Subfamily Unique to Strepsirrhine Primates

PubMed Central

Yoder, Anne D.; Chan, Lauren M.; dos Reis, Mario; Larsen, Peter A.; Campbell, C. Ryan; Rasoloarison, Rodin; Barrett, Meredith; Roos, Christian; Kappeler, Peter; Bielawski, Joseph; Yang, Ziheng

2014-01-01

Vomeronasal receptor genes have frequently been invoked as integral to the establishment and maintenance of species boundaries among mammals due to the elaborate one-to-one correspondence between semiochemical signals and neuronal sensory inputs. Here, we report the most extensive sample of vomeronasal receptor class 1 (V1R) sequences ever generated for a diverse yet phylogenetically coherent group of mammals, the tooth-combed primates (suborder Strepsirrhini). Phylogenetic analysis confirms our intensive sampling from a single V1R subfamily, apparently unique to the strepsirrhine primates. We designate this subfamily as V1Rstrep. The subfamily retains extensive repertoires of gene copies that descend from an ancestral gene duplication that appears to have occurred prior to the diversification of all lemuriform primates excluding the basal genus Daubentonia (the aye-aye). We refer to the descendent clades as V1Rstrep-α and V1Rstrep-β. Comparison of the two clades reveals different amino acid compositions corresponding to the predicted ligand-binding site and thus potentially to altered functional profiles between the two. In agreement with previous studies of the mouse lemur (genus, Microcebus), the majority of V1Rstrep gene copies appear to be intact and under strong positive selection, particularly within transmembrane regions. Finally, despite the surprisingly high number of gene copies identified in this study, it is nonetheless probable that V1R diversity remains underestimated in these nonmodel primates and that complete characterization will be limited until high-coverage assembled genomes are available. PMID:24398377

Analysis of Species-Selectivity of Human, Mouse and Rat Cytochrome P450 1A and 2B Subfamily Enzymes using Molecular Modeling, Docking and Dynamics Simulations.

PubMed

Karthikeyan, Bagavathy Shanmugam; Suvaithenamudhan, Suvaiyarasan; Akbarsha, Mohammad Abdulkader; Parthasarathy, Subbiah

2018-06-01

Cytochrome P450 (CYP) 1A and 2B subfamily enzymes are important drug metabolizing enzymes, and are highly conserved across species in terms of sequence homology. However, there are major to minor structural and macromolecular differences which provide for species-selectivity and substrate-selectivity. Therefore, species-selectivity of CYP1A and CYP2B subfamily proteins across human, mouse and rat was analyzed using molecular modeling, docking and dynamics simulations when the chiral molecules quinine and quinidine were used as ligands. The three-dimensional structures of 17 proteins belonging to CYP1A and CYP2B subfamilies of mouse and rat were predicted by adopting homology modeling using the available structures of human CYP1A and CYP2B proteins as templates. Molecular docking and dynamics simulations of quinine and quinidine with CYP1A subfamily proteins revealed the existence of species-selectivity across the three species. On the other hand, in the case of CYP2B subfamily proteins, no role for chirality of quinine and quinidine in forming complexes with CYP2B subfamily proteins of the three species was indicated. Our findings reveal the roles of active site amino acid residues of CYP1A and CYP2B subfamily proteins and provide insights into species-selectivity of these enzymes across human, mouse, and rat.

Involvement of Transient Receptor Potential Vanilloid (TRPV) 4 in mouse sperm thermotaxis.

PubMed

Hamano, Koh-Ichi; Kawanishi, Tae; Mizuno, Atsuko; Suzuki, Makoto; Takagi, Yuji

2016-08-25

Transient Receptor Potential Vanilloid (TRPV) 4 is one of the temperature-sensitive ion channels involved in temperature receptors, and it is known to be activated from 35 to 40ºC. Here we analyzed sperm motility function of Trpv4 knockout (KO) mouse in temperature-gradient conditions to elucidate the thermotaxis of mouse sperm and the involvement of TRPV4 in thermotaxis. The sperm were introduced at the vertical column end of a T-shaped chamber filled with medium in a plastic dish, and we measured the number of sperm that arrived at both ends of the wide column where we had established a temperature gradient of approx. 2ºC, and we evaluated the sperm's thermotaxis. Large numbers of wild-type (WT) mouse sperm migrated into the high level of the temperature gradient that was set in the wide column, and thermotaxis was confirmed. The ratio of migrated sperm at the high temperature level of the T-shaped chamber was decreased in the KO sperm and Ruthenium red (a TRPV antagonist) treated sperm compared with the WT sperm. The thermotaxis of the mouse sperm was confirmed, and the involvement of TRPV4 in this thermotaxis was suggested.

Phylogeny of the most species-rich freshwater bivalve family (Bivalvia: Unionida: Unionidae): Defining modern subfamilies and tribes.

PubMed

Lopes-Lima, Manuel; Froufe, Elsa; Do, Van Tu; Ghamizi, Mohamed; Mock, Karen E; Kebapçı, Ümit; Klishko, Olga; Kovitvadhi, Satit; Kovitvadhi, Uthaiwan; Paulo, Octávio S; Pfeiffer, John M; Raley, Morgan; Riccardi, Nicoletta; Şereflişan, Hülya; Sousa, Ronaldo; Teixeira, Amílcar; Varandas, Simone; Wu, Xiaoping; Zanatta, David T; Zieritz, Alexandra; Bogan, Arthur E

2017-01-01

Freshwater mussels of the order Unionida are key elements of freshwater habitats and are responsible for important ecological functions and services. Unfortunately, these bivalves are among the most threatened freshwater taxa in the world. However, conservation planning and management are hindered by taxonomic problems and a lack of detailed ecological data. This highlights the urgent need for advances in the areas of systematics and evolutionary relationships within the Unionida. This study presents the most comprehensive phylogeny to date of the larger Unionida family, i.e., the Unionidae. The phylogeny is based on a combined dataset of 1032bp (COI+28S) of 70 species in 46 genera, with 7 of this genera being sequenced for the first time. The resulting phylogeny divided the Unionidae into 6 supported subfamilies and 18 tribes, three of which are here named for the first time (i.e., Chamberlainiini nomen novum, Cristariini nomen novum and Lanceolariini nomen novum). Molecular analyses were complemented by investigations of selected morphological, anatomical and behavioral characters used in traditional phylogenetic studies. No single morphological, anatomical or behavioral character was diagnostic at the subfamily level and few were useful at the tribe level. However, within subfamilies, many tribes can be recognized based on a subset of these characters. The geographical distribution of each of the subfamilies and tribes is also presented. The present study provides important advances in the systematics of these extraordinary taxa with implications for future ecological and conservation studies. Copyright © 2016 Elsevier Inc. All rights reserved.

Evolutionary and biogeographic history of the subfamily Neoplecostominae (Siluriformes: Loricariidae)

PubMed Central

Roxo, Fábio F; Zawadzki, Cláudio H; Alexandrou, Markos A; Costa Silva, Guilherme J; Chiachio, Marcio C; Foresti, Fausto; Oliveira, Claudio

2012-01-01

Freshwater fish evolution has been shaped by changes in the earth's surface involving changes in the courses of rivers and fluctuations in sea level. The main objective of this study is to improve our knowledge of the evolution of loricariids, a numerous and adaptive group of freshwater catfish species, and the role of geological changes in their evolution. We use a number of different phylogenetic methods to test the relationships among 52 representative taxa within the Neoplecostominae using 4676 bps of mitochondrial and nuclear DNA. Our analysis revealed that the subfamily Neoplecostominae is monophyletic, including Pseudotocinclus, with three lineages recognized. The first lineage is composed of part of Pareiorhina rudolphi, P. cf. rudolphi, and Pseudotocinclus; the second is composed of Isbrueckerichthys, Pareiorhaphis, Kronichthys, and the species Neoplecostomus ribeirensis; and the third is composed of Pareiorhina carrancas, P. cf. carrancas, Pareiorhina sp. 1, a new genus, and all the species of the genus Neoplecostomus, except N. ribeirensis. The relaxed molecular clock calibration provides a temporal framework for the evolution of the group, which we use for a likelihood-based historical biogeographic analysis to test relevant hypotheses on the formation of southeast Brazil. We hypothesize that headwater capture events and marine regressions have shaped the patterns of distribution within the subfamily Neoplecostominae throughout the distinct basins of southeast Brazil. PMID:23145330

HCV Proteins and Immunoglobulin Variable Gene (IgV) Subfamilies in HCV-Induced Type II Mixed Cryoglobulinemia: A Concurrent Pathogenetic Role

PubMed Central

Sautto, Giuseppe; Mancini, Nicasio; Solforosi, Laura; Diotti, Roberta A.; Clementi, Massimo; Burioni, Roberto

2012-01-01

The association between hepatitis C virus (HCV) infection and type II mixed cryoglobulinemia (MCII) is well established, but the role played by distinct HCV proteins and by specific components of the anti-HCV humoral immune response remains to be clearly defined. It is widely accepted that HCV drives the expansion of few B-cell clones expressing a restricted pool of selected immunoglobulin variable (IgV) gene subfamilies frequently endowed with rheumatoid factor (RF) activity. Moreover, the same IgV subfamilies are frequently observed in HCV-transformed malignant B-cell clones occasionally complicating MCII. In this paper, we analyze both the humoral and viral counterparts at the basis of cryoglobulins production in HCV-induced MCII, with particular attention reserved to the single IgV subfamilies most frequently involved. PMID:22690241

A multilocus phylogeny of Podoctidae (Arachnida, Opiliones, Laniatores) and parametric shape analysis reveal the disutility of subfamilial nomenclature in armored harvestman systematics.

PubMed

Sharma, Prashant P; Santiago, Marc A; Kriebel, Ricardo; Lipps, Savana M; Buenavente, Perry A C; Diesmos, Arvin C; Janda, Milan; Boyer, Sarah L; Clouse, Ronald M; Wheeler, Ward C

2017-01-01

The taxonomy and systematics of the armored harvestmen (suborder Laniatores) are based on various sets of morphological characters pertaining to shape, armature, pedipalpal setation, and the number of articles of the walking leg tarsi. Few studies have tested the validity of these historical character systems in a comprehensive way, with reference to an independent data class, i.e., molecular sequence data. We examined as a test case the systematics of Podoctidae, a family distributed throughout the Indo-Pacific. We tested the validity of the three subfamilies of Podoctidae using a five-locus phylogeny, and examined the evolution of dorsal shape as a proxy for taxonomic utility, using parametric shape analysis. Here we show that two of the three subfamilies, Ibaloniinae and Podoctinae, are non-monophyletic, with the third subfamily, Erecananinae, recovered as non-monophyletic in a subset of analyses. Various genera were also recovered as non-monophyletic. As first steps toward revision of Podoctidae, the subfamilies Erecananinae Roewer, 1912 and Ibaloniinae Roewer, 1912 are synonymized with Podoctinae Roewer, 1912 new synonymies, thereby abolishing unsubstantiated subfamilial divisions within Podoctidae. We once again synonymize the genus Paralomanius Goodnight & Goodnight, 1948 with Lomanius Roewer, 1923 revalidated. We additionally show that eggs carried on the legs of male Podoctidae are not conspecific to the males, falsifying the hypothesis of paternal care in this group. Copyright © 2016 Elsevier Inc. All rights reserved.

Mutation of I696 and W697 in the TRP box of vanilloid receptor subtype I modulates allosteric channel activation.

PubMed

Gregorio-Teruel, Lucia; Valente, Pierluigi; González-Ros, José Manuel; Fernández-Ballester, Gregorio; Ferrer-Montiel, Antonio

2014-03-01

The transient receptor potential vanilloid receptor subtype I (TRPV1) channel acts as a polymodal sensory receptor gated by chemical and physical stimuli. Like other TRP channels, TRPV1 contains in its C terminus a short, conserved domain called the TRP box, which is necessary for channel gating. Substitution of two TRP box residues-I696 and W697-with Ala markedly affects TRPV1's response to all activating stimuli, which indicates that these two residues play a crucial role in channel gating. We systematically replaced I696 and W697 with 18 native l-amino acids (excluding cysteine) and evaluated the effect on voltage- and capsaicin-dependent gating. Mutation of I696 decreased channel activation by either voltage or capsaicin; furthermore, gating was only observed with substitution of hydrophobic amino acids. Substitution of W697 with any of the 18 amino acids abolished gating in response to depolarization alone, shifting the threshold to unreachable voltages, but not capsaicin-mediated gating. Moreover, vanilloid-activated responses of W697X mutants showed voltage-dependent gating along with a strong voltage-independent component. Analysis of the data using an allosteric model of activation indicates that mutation of I696 and W697 primarily affects the allosteric coupling constants of the ligand and voltage sensors to the channel pore. Together, our findings substantiate the notion that inter- and/or intrasubunit interactions at the level of the TRP box are critical for efficient coupling of stimulus sensing and gate opening. Perturbation of these interactions markedly reduces the efficacy and potency of the activating stimuli. Furthermore, our results identify these interactions as potential sites for pharmacological intervention.

Alphasatellitidae: a new family with two subfamilies for the classification of geminivirus- and nanovirus-associated alphasatellites.

PubMed

Briddon, Rob W; Martin, Darren P; Roumagnac, Philippe; Navas-Castillo, Jesús; Fiallo-Olivé, Elvira; Moriones, Enrique; Lett, Jean-Michel; Zerbini, F Murilo; Varsani, Arvind

2018-05-09

Nanoviruses and geminiviruses are circular, single stranded DNA viruses that infect many plant species around the world. Nanoviruses and certain geminiviruses that belong to the Begomovirus and Mastrevirus genera are associated with additional circular, single stranded DNA molecules (~ 1-1.4 kb) that encode a replication-associated protein (Rep). These Rep-encoding satellite molecules are commonly referred to as alphasatellites and here we communicate the establishment of the family Alphasatellitidae to which these have been assigned. Within the Alphasatellitidae family two subfamilies, Geminialphasatellitinae and Nanoalphasatellitinae, have been established to respectively accommodate the geminivirus- and nanovirus-associated alphasatellites. Whereas the pairwise nucleotide sequence identity distribution of all the known geminialphasatellites (n = 628) displayed a troughs at ~ 70% and 88% pairwise identity, that of the known nanoalphasatellites (n = 54) had a troughs at ~ 67% and ~ 80% pairwise identity. We use these pairwise identity values as thresholds together with phylogenetic analyses to establish four genera and 43 species of geminialphasatellites and seven genera and 19 species of nanoalphasatellites. Furthermore, a divergent alphasatellite associated with coconut foliar decay disease is assigned to a species but not a subfamily as it likely represents a new alphasatellite subfamily that could be established once other closely related molecules are discovered.

Functional diversity for biomass deconstruction in family 5 subfamily 5 (GH5_5) of fungal endo-β1,4-glucanases.

PubMed

Li, Bingyao; Walton, Jonathan D

2017-05-01

Endo-β1,4-glucanases in glycosyl hydrolase family 5 (GH5) are ubiquitous enzymes in the multicellular fungi and are common components of enzyme cocktails for biomass conversion. We recently showed that an endo-glucanase of subfamily 5 of GH5 (GH5_5) from Sporotrichum thermophile (StCel5A) was more effective at releasing glucose from pretreated corn stover, when part of an eight-component synthetic enzyme mixture, compared to its closely related counterpart from Trichoderma reesei, TrCel5A. StCel5A and TrCel5A belong to different clades of GH5_5 (GH5_5_1 and GH5_5_2, respectively). To test whether the superior activity of StCel5A was a general property of all enzymes in the GH5_5_2 clade, StCel5A, TrCel5A, and two additional members of each subfamily were expressed in a common host that had been engineered to suppress its native cellulases (T. reesei Δxyr1) and compared against each other alone on pure substrates, in synthetic mixtures on pure substrates, and against each other in synthetic mixtures on real biomass. The results indicated that superiority is a unique property of StCel5A and not of GH5_5_2 generally. The six Cel5A enzymes had significant differences in relative activities on different substrates, in specific activities, and in sensitivities to mannan inhibition. Importantly, the behavior of the six endo-glucanases on pure cellulose substrates did not predict their behavior in combination with other cellulolytic enzymes on a real lignocellulosic biomass substrate.

The role of endogenous molecules in modulating pain through transient receptor potential vanilloid 1 (TRPV1)

PubMed Central

Morales-Lázaro, Sara L; Simon, Sidney A; Rosenbaum, Tamara

2013-01-01

Pain is a physiological response to a noxious stimulus that decreases the quality of life of those sufferring from it. Research aimed at finding new therapeutic targets for the treatment of several maladies, including pain, has led to the discovery of numerous molecular regulators of ion channels in primary afferent nociceptive neurons. Among these receptors is TRPV1 (transient receptor potential vanilloid 1), a member of the TRP family of ion channels. TRPV1 is a calcium-permeable channel, which is activated or modulated by diverse exogenous noxious stimuli such as high temperatures, changes in pH, and irritant and pungent compounds, and by selected molecules released during tissue damage and inflammatory processes. During the last decade the number of endogenous regulators of TRPV1's activity has increased to include lipids that can negatively regulate TRPV1, as is the case for cholesterol and PIP2 (phosphatidylinositol 4,5-biphosphate) while, in contrast, other lipids produced in response to tissue injury and ischaemic processes are known to positively regulate TRPV1. Among the latter, lysophosphatidic acid activates TRPV1 while amines such as N-acyl-ethanolamines and N-acyl-dopamines can sensitize or directly activate TRPV1. It has also been found that nucleotides such as ATP act as mediators of chemically induced nociception and pain and gases, such as hydrogen sulphide and nitric oxide, lead to TRPV1 activation. Finally, the products of lipoxygenases and omega-3 fatty acids among other molecules, such as divalent cations, have also been shown to endogenously regulate TRPV1 activity. Here we provide a comprehensive review of endogenous small molecules that regulate the function of TRPV1. Acting through mechanisms that lead to sensitization and desensitization of TRPV1, these molecules regulate pathways involved in pain and nociception. Understanding how these compounds modify TRPV1 activity will allow us to comprehend how some pathologies are associated with

The role of endogenous molecules in modulating pain through transient receptor potential vanilloid 1 (TRPV1).

PubMed

Morales-Lázaro, Sara L; Simon, Sidney A; Rosenbaum, Tamara

2013-07-01

Pain is a physiological response to a noxious stimulus that decreases the quality of life of those sufferring from it. Research aimed at finding new therapeutic targets for the treatment of several maladies, including pain, has led to the discovery of numerous molecular regulators of ion channels in primary afferent nociceptive neurons. Among these receptors is TRPV1 (transient receptor potential vanilloid 1), a member of the TRP family of ion channels. TRPV1 is a calcium-permeable channel, which is activated or modulated by diverse exogenous noxious stimuli such as high temperatures, changes in pH, and irritant and pungent compounds, and by selected molecules released during tissue damage and inflammatory processes. During the last decade the number of endogenous regulators of TRPV1's activity has increased to include lipids that can negatively regulate TRPV1, as is the case for cholesterol and PIP2 (phosphatidylinositol 4,5-biphosphate) while, in contrast, other lipids produced in response to tissue injury and ischaemic processes are known to positively regulate TRPV1. Among the latter, lysophosphatidic acid activates TRPV1 while amines such as N-acyl-ethanolamines and N-acyl-dopamines can sensitize or directly activate TRPV1. It has also been found that nucleotides such as ATP act as mediators of chemically induced nociception and pain and gases, such as hydrogen sulphide and nitric oxide, lead to TRPV1 activation. Finally, the products of lipoxygenases and omega-3 fatty acids among other molecules, such as divalent cations, have also been shown to endogenously regulate TRPV1 activity. Here we provide a comprehensive review of endogenous small molecules that regulate the function of TRPV1. Acting through mechanisms that lead to sensitization and desensitization of TRPV1, these molecules regulate pathways involved in pain and nociception. Understanding how these compounds modify TRPV1 activity will allow us to comprehend how some pathologies are associated with

Systematics of Australian Thrasorinae (Hymenoptera, Cynipoidea, Figitidae) with descriptions of Mikeiinae, new subfamily, two new genera, and three new species

PubMed Central

Paretas-Martínez, J.; Restrepo-Ortiz, C.; Buffington, M.; Pujade-Villar, J.

2011-01-01

Abstract The Australian Thrasorinae are revised and Mikeius is transferred to Mikeiinae Paretas-Martínez & Pujade-Villar, subfam. n., and Mikeius clavatus Pujade-Villar & Restrepo-Ortiz, sp. n., is described. Two new genera of Thrasorinae are erected: Cicatrix Paretas-Martínez, gen. n., including Cicatrix pilosiscutum(Girault), comb. n. from Amblynotus, Cicatrix schauffi (Buffington), comb. n. from Mikeius, and Cicatrix neumannoides Paretas-Martínez & Restrepo-Ortiz, sp. n.; and Palmiriella Pujade-Villar & Paretas-Martínez, gen. n., including Palmiriella neumanni (Buffington), comb. n. from Mikeius, Thrasorus rieki Paretas-Martínez & Pujade-Villar, sp. n., is also described. A phylogenetic analysis of 176 morphological and biological characters, including all these new taxa and all genera previously included in Thrasorinae, was conducted. All subfamilies were recovered as monophyletic, with the following relationships: Parnipinae (Euceroptrinae (Mikeiinae (Plectocynipinae (Thrasorinae)))). A worldwide key to the subfamilies of Figitidae is provided that includes the new subfamily, as well as a key to genera Thrasorinae. PMID:21852926

The phylogeny of the family Lacertidae (Reptilia) based on nuclear DNA sequences: convergent adaptations to arid habitats within the subfamily Eremiainae.

PubMed

Mayer, Werner; Pavlicev, Mihaela

2007-09-01

The family Lacertidae encompasses more than 250 species distributed in the Palearctis, Ethiopis and Orientalis. Lacertids have been subjected in the past to several morphological and molecular studies to establish their phylogeny. However, the problems of convergent adaptation in morphology and of excessively variable molecular markers have hampered the establishment of well supported deeper phylogenetic relationships. Particularly the adaptations to xeric environments have often been used to establish a scenario for the origin and radiation of major lineages within lacertids. Here we present a molecular phylogenetic study based on two nuclear marker genes and representatives of 37 lacertid genera and distinct species groups (as in the case of the collective genus Lacerta). Roughly 1600 bp of the nuclear rag1 and c-mos genes were sequenced and analyzed. While the results provide good support to the hitherto suggested main subfamilies of Gallotiinae (Gallotia and Psammodromus), Eremiainae and Lacertinae [Harris, D.J., Arnold, E.N., Thomas, R.H., 1998. Relationships of lacertid lizards (Reptilia: Lacertidae) estimated from mitochondrial DNA sequences and morphology. Proc. R. Soc. Lond. B 265, 1939-1948], they also suggest unexpected relationships. In particular, the oriental genus Takydromus, previously considered the sister-group to the three subfamilies, is nested within Lacertinae. Moreover, the genera within the Eremiainae are further divided into two groups, roughly corresponding to their respective geographical distributions in the Ethiopian and the Saharo-Eurasian ranges. The results support an independent origin of adaptations to xeric conditions in different subfamilies. The relationships within the subfamily Lacertinae could not be resolved with the markers used. The species groups of the collective genus Lacerta show a bush-like topology in the inferred Bayesian tree, suggesting rapid radiation. The composition of the subfamilies Eremiainae and Lacertinae

Local delivery of molecules from a nanopipette for quantitative receptor mapping on live cells.

PubMed

Babakinejad, Babak; Jönsson, Peter; López Córdoba, Ainara; Actis, Paolo; Novak, Pavel; Takahashi, Yasufumi; Shevchuk, Andrew; Anand, Uma; Anand, Praveen; Drews, Anna; Ferrer-Montiel, Antonio; Klenerman, David; Korchev, Yuri E

2013-10-01

Using nanopipettes to locally deliver molecules to the surface of living cells could potentially open up studies of biological processes down to the level of single molecules. However, in order to achieve precise and quantitative local delivery it is essential to be able to determine the amount and distribution of the molecules being delivered. In this work, we investigate how the size of the nanopipette, the magnitude of the applied pressure or voltage, which drives the delivery, and the distance to the underlying surface influences the number and spatial distribution of the delivered molecules. Analytical expressions describing the delivery are derived and compared with the results from finite element simulations and experiments on delivery from a 100 nm nanopipette in bulk solution and to the surface of sensory neurons. We then developed a setup for rapid and quantitative delivery to multiple subcellular areas, delivering the molecule capsaicin to stimulate opening of Transient Receptor Potential Vanilloid subfamily member 1 (TRPV1) channels, membrane receptors involved in pain sensation. Overall, precise and quantitative delivery of molecules from nanopipettes has been demonstrated, opening up many applications in biology such as locally stimulating and mapping receptors on the surface of live cells.

Current status of subfamily Ichneumoninae (Hymenoptera: Ichneumonidae) from Malaysia and Singapore

NASA Astrophysics Data System (ADS)

Norhafiza, A. F.; Idris, A. B.

2013-11-01

In this paper, 25 genera and 38 species under 10 tribes (Alomyini, Compsophorini, Goedartiini, Heresiarchini, Ichneumonini, Ischnojoppini, Joppocryptini, Listrodromini, Oedicephalini and Platylabini) of the subfamily Ichneumoninae housed in the Centre for Insect Systematics, UKM and Raffles Museum of Biodiversity Research (National University of Singapore) are reported from Malaysia and Singapore. The tribe Heresiarchini has the greatest number of species (13) followed by Ichneumonini with six species. Imeria is the largest genus which contains five species recorded. Six species in this study are new records for Malaysia.

Isolation and characterization of the chicken trypsinogen gene family.

PubMed Central

Wang, K; Gan, L; Lee, I; Hood, L

1995-01-01

Based on genomic Southern hybridizations and cDNA sequence analyses, the chicken trypsinogen gene family can be divided into two multi-member subfamilies, a six-member trypsinogen I subfamily which encodes the cationic trypsin isoenzymes and a three-member trypsinogen II subfamily which encodes the anionic trypsin isoenzymes. The chicken cDNA and genomic clones containing these two subfamilies were isolated and characterized by DNA sequence analysis. The results indicated that the chicken trypsinogen genes encoded a signal peptide of 15 to 16 amino acid residues, an activation peptide of 9 to 10 residues and a trypsin of 223 amino acid residues. The chicken trypsinogens contain all the common catalytic and structural features for trypsins, including the catalytic triad His, Asp and Ser and the six disulphide bonds. The trypsinogen I and II subfamilies share approximately 70% sequence identity at the nucleotide and amino acid level. The sequence comparison among chicken trypsinogen subfamily members and trypsin sequences from other species suggested that the chicken trypsinogen genes may have evolved in coincidental or concerted fashion. Images Figure 6 Figure 7 PMID:7733885

Whole genome comparisons of Fragaria, Prunus and Malus reveal different modes of evolution between Rosaceous subfamilies

PubMed Central

2012-01-01

Background Rosaceae include numerous economically important and morphologically diverse species. Comparative mapping between the member species in Rosaceae have indicated some level of synteny. Recently the whole genome of three crop species, peach, apple and strawberry, which belong to different genera of the Rosaceae family, have been sequenced, allowing in-depth comparison of these genomes. Results Our analysis using the whole genome sequences of peach, apple and strawberry identified 1399 orthologous regions between the three genomes, with a mean length of around 100 kb. Each peach chromosome showed major orthology mostly to one strawberry chromosome, but to more than two apple chromosomes, suggesting that the apple genome went through more chromosomal fissions in addition to the whole genome duplication after the divergence of the three genera. However, the distribution of contiguous ancestral regions, identified using the multiple genome rearrangements and ancestors (MGRA) algorithm, suggested that the Fragaria genome went through a greater number of small scale rearrangements compared to the other genomes since they diverged from a common ancestor. Using the contiguous ancestral regions, we reconstructed a hypothetical ancestral genome for the Rosaceae 7 composed of nine chromosomes and propose the evolutionary steps from the ancestral genome to the extant Fragaria, Prunus and Malus genomes. Conclusion Our analysis shows that different modes of evolution may have played major roles in different subfamilies of Rosaceae. The hypothetical ancestral genome of Rosaceae and the evolutionary steps that lead to three different lineages of Rosaceae will facilitate our understanding of plant genome evolution as well as have a practical impact on knowledge transfer among member species of Rosaceae. PMID:22475018

Cytochrome P450 CYP3A in marsupials: cloning and identification of the first CYP3A subfamily member, isoform 3A70 from Eastern gray kangaroo (Macropus giganteus).

PubMed

El-Merhibi, Adaweyah; Ngo, Suong N T; Marchant, Ceilidh L; Height, Tamara A; Stupans, Ieva; McKinnon, Ross A

2012-09-15

Australian marsupials are unique fauna that have evolved and adapted to unique environments and thus it is likely that their detoxification systems differ considerably from those of well-studied eutherian mammals. Knowledge of these processes in marsupials is therefore vital to understanding the consequences of exposure to xenobiotics. Cytochromes P450 (CYPs) are critically important in the oxidative metabolism of a diverse array of both xenobiotics and endogenous substrates. In this study we have cloned and characterized CYP3A70, the first identified member of the CYP3A gene subfamily from Eastern gray kangaroo (Macropus giganteus). A 1665 base pair kangaroo hepatic CYP3A complete cDNA, designated CYP3A70, was cloned by reverse transcription-polymerase chain reaction approaches, which encodes a protein of 506 amino acids. The CYP3A70 cDNA shares approximately 71% nucleotide and 65% amino acid sequence homology to human CYP3A4 and displays high sequence similarity to other published mammalian CYP3As from human, monkey, cow, pig, dog, rat, rabbit, mouse, hamster, and guinea pig. Transfection of the CYP3A70 cDNAs into 293T cells resulted in stable cell lines expressing a CYP3A immuno-reactive protein that was recognized by a goat anti-human CYP3A4 polyclonal antibody. The anti-human CYP3A4 antibody also detected immunoreactive proteins in liver microsomes from all test marsupials, including the kangaroo, koala, wallaby, and wombat, with multiple CYP3A immunoreactive bands observed in kangaroo and wallaby tissues. Relatively, very low CYP catalytic activity was detected for the kangaroo CYP3A70 cDNA-expressed proteins (19.6 relative luminescent units/μg protein), which may be due to low protein expression levels. Collectively, this study provides primary molecular data regarding the Eastern kangaroo hepatic CYP3A70 gene and enables further functional analyses of CYP3A enzymes in marsupials. Copyright © 2012 Elsevier B.V. All rights reserved.

In silico cloning and characterization of the TGA (TGACG MOTIF-BINDING FACTOR) transcription factors subfamily in Carica papaya.

PubMed

Idrovo Espín, Fabio Marcelo; Peraza-Echeverria, Santy; Fuentes, Gabriela; Santamaría, Jorge M

2012-05-01

The TGA transcription factors belong to the subfamily of bZIP group D that play a major role in disease resistance and development. Most of the TGA identified in Arabidopsis interact with the master regulator of SAR, NPR1 that controls the expression of PR genes. As a first approach to determine the possible involvement of these transcription factors in papaya defense, we characterized Arabidopsis TGA orthologs from the genome of Carica papaya cv. SunUp. Six orthologs CpTGA1 to CpTGA6, were identified. The predicted CpTGA proteins were highly similar to AtTGA sequences and probably share the same DNA binding properties and transcriptional regulation features. The protein sequences alignment evidenced the presence of conserved domains, characteristic of this group of transcription factors. The phylogeny showed that CpTGA evolved into three different subclades associated with defense and floral development. This is the first report of basal expression patterns assessed by RT-PCR, from the whole subfamily of CpTGA members in different tissues from papaya cv. Maradol mature plants. Overall, CpTGA1, CpTGA3 CpTGA6 and CpTGA4 showed a basal expression in all tissues tested; CpTGA2 expressed strongly in all tissues except in petioles while CpTGA5 expressed only in petals and to a lower extent in petioles. Although more detailed studies in anthers and other floral structures are required, we suggest that CpTGA5 might be tissue-specific, and it might be involved in papaya floral development. On the other hand, we report here for the first time, the expression of the whole family of CpTGA in response to salicylic acid (SA). The expression of CpTGA3, CpTGA4 and CpTGA6 increased in response to SA, what would suggest its involvement in the SAR response in papaya. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

First contact pheromone identified for a longhorned beetle (Coleoptera: Cerambycidae) in the subfamily Prioninae

Treesearch

Annie E. Spikes; Matthew A. Paschen; Jocelyn G. Miller; Jardel A. Moreira; Paul B. Hamel; Nathan M. Schiff; Matthew D. Ginzel

2010-01-01

Little is known of the reproductive behavior of longhorned beetles (Coleoptera: Cerambycidae) in the subfamily Prioninae. Mallodon dasystomus (Say), the hardwood stump borer, is a widely distributed prionine that is native to the southern U.S. Here, we explored the chemically-mediated mating behavior of M dasystomus, and tested the hypothesis that males recognize...

Aquaporins in Digestive System.

PubMed

Zhu, Shuai; Ran, Jianhua; Yang, Baoxue; Mei, Zhechuan

2017-01-01

In this chapter, we mainly discuss the expression and function of aquaporins (AQPs ) expressed in digestive system . AQPs in gastrointestinal tract include four members of aquaporin subfamily: AQP1, AQP4, AQP5 and AQP8, and a member of aquaglyceroporin subfamily: AQP3. In the digestive glands, especially the liver, we discuss three members of aquaporin subfamily: AQP1, AQP5 and AQP8, a member of aquaglyceroporin subfamily: AQP9. AQP3 is involved in the diarrhea and inflammatory bowel disease; AQP5 is relevant to gastric carcinoma cell proliferation and migration; AQP9 plays considerable role in glycerol metabolism , urea transport and hepatocellular carcinoma. Further investigation is necessary for specific locations and functions of AQPs in digestive system.

Single-residue molecular switch for high-temperature dependence of vanilloid receptor TRPV3

PubMed Central

Liu, Beiying; Qin, Feng

2017-01-01

Thermal transient receptor potential (TRP) channels, a group of ion channels from the transient receptor potential family, play important functions in pain and thermal sensation. These channels are directly activated by temperature and possess strong temperature dependence. Furthermore, their temperature sensitivity can be highly dynamic and use-dependent. For example, the vanilloid receptor transient receptor potential 3 (TRPV3), which has been implicated as a warmth detector, becomes responsive to warm temperatures only after intensive stimulation. Upon initial activation, the channel exhibits a high-temperature threshold in the noxious temperature range above 50 °C. This use dependence of heat sensitivity thus provides a mechanism for sensitization of thermal channels. However, how the channels acquire the use dependence remains unknown. Here, by comparative studies of chimeric channels between use-dependent and use-independent homologs, we have determined the molecular basis that underlies the use dependence of temperature sensitivity of TRPV3. Remarkably, the restoration of a single residue that is apparently missing in the use-dependent homologs could largely eliminate the use dependence of heat sensitivity of TRPV3. The location of the region suggests a mechanism of temperature-dependent gating of thermal TRP channels involving an intracellular region assembled around the TRP domain. PMID:28154143

Novel role of transient receptor potential vanilloid 2 in the regulation of cardiac performance

PubMed Central

Lasko, Valerie M.; Koch, Sheryl E.; Singh, Vivek P.; Carreira, Vinicius; Robbins, Nathan; Patel, Amit R.; Jiang, Min; Bidwell, Philip; Kranias, Evangelia G.; Jones, W. Keith; Lorenz, John N.

2013-01-01

Transient receptor potential cation channels have been implicated in the regulation of cardiovascular function, but only recently has our laboratory described the vanilloid-2 subtype (TRPV2) in the cardiomyocyte, though its exact mechanism of action has not yet been established. This study tests the hypothesis that TRPV2 plays an important role in regulating myocyte contractility under physiological conditions. Therefore, we measured cardiac and vascular function in wild-type and TRPV2−/− mice in vitro and in vivo and found that TRPV2 deletion resulted in a decrease in basal systolic and diastolic function without affecting loading conditions or vascular tone. TRPV2 stimulation with probenecid, a relatively selective TRPV2 agonist, caused an increase in both inotropy and lusitropy in wild-type mice that was blunted in TRPV2−/− mice. We examined the mechanism of TRPV2 inotropy/lusitropy in isolated myocytes and found that it modulates Ca2+ transients and sarcoplasmic reticulum Ca2+ loading. We show that the activity of this channel is necessary for normal cardiac function and that there is increased contractility in response to agonism of TRPV2 with probenecid. PMID:24322617

The effects of IL-20 subfamily cytokines on reconstituted human epidermis suggest potential roles in cutaneous innate defense and pathogenic adaptive immunity in psoriasis.

PubMed

Sa, Susan M; Valdez, Patricia A; Wu, Jianfeng; Jung, Kenneth; Zhong, Fiona; Hall, Linda; Kasman, Ian; Winer, Jane; Modrusan, Zora; Danilenko, Dimitry M; Ouyang, Wenjun

2007-02-15

IL-19, IL-20, IL-22, IL-24, and IL-26 are members of the IL-10 family of cytokines that have been shown to be up-regulated in psoriatic skin. Contrary to IL-10, these cytokines signal using receptor complex R1 subunits that are preferentially expressed on cells of epithelial origin; thus, we henceforth refer to them as the IL-20 subfamily cytokines. In this study, we show that primary human keratinocytes (KCs) express receptors for these cytokines and that IL-19, IL-20, IL-22, and IL-24 induce acanthosis in reconstituted human epidermis (RHE) in a dose-dependent manner. These cytokines also induce expression of the psoriasis-associated protein S100A7 and keratin 16 in RHE and cause persistent activation of Stat3 with nuclear localization. IL-22 had the most pronounced effects on KC proliferation and on the differentiation of KCs in RHE, inducing a decrease in the granular cell layer (hypogranulosis). Furthermore, gene expression analysis performed on cultured RHE treated with these cytokines showed that IL-19, IL-20, IL-22, and IL-24 regulate many of these same genes to variable degrees, inducing a gene expression profile consistent with inflammatory responses, wound healing re-epithelialization, and altered differentiation. Many of these genes have also been found to be up-regulated in psoriatic skin, including several chemokines, beta-defensins, S100 family proteins, and kallikreins. These results confirm that IL-20 subfamily cytokines are important regulators of epidermal KC biology with potentially pivotal roles in the immunopathology of psoriasis.

A new genus and species of subfamily Banchinae (Hymenoptera, Ichneumonidae) from China.

PubMed

Sheng, Mao-Ling; Sun, Shu-Ping; Wang, Xi-Nan; Wu, Hai-Wei

2018-04-23

A new genus, Verruca Sheng Sun gen. nov., of the ichneumonid tribe Atrophini, subfamily Banchinae is described for one new species, Verruca dentia Sheng Sun, sp. nov. The species was collected from Shandong and Jiangxi Provinces, situated near the northern border of the Oriental part of China. The new genus is placed within the existing key to genera. A key to the genera of Atrophini, with the apical portion of the ovipositor with ridges, is also provided.

Discovery of germacrene A synthases in Barnadesia spinosa: The first committed step in sesquiterpene lactone biosynthesis in the basal member of the Asteraceae.

PubMed

Nguyen, Trinh-Don; Faraldos, Juan A; Vardakou, Maria; Salmon, Melissa; O'Maille, Paul E; Ro, Dae-Kyun

2016-10-28

The Andes-endemic Barnadesioideae lineage is the oldest surviving and phylogenetically basal subfamily of the Asteraceae (Compositae), a prolific group of flowering plants with world-wide distribution (∼24,000 species) marked by a rich diversity of sesquiterpene lactones (STLs). Intriguingly, there is no evidence that members of the Barnadesioideae produce STLs, specialized metabolites thought to have contributed to the adaptive success of the Asteraceae family outside South America. The biosynthesis of STLs requires the intimate expression and functional integration of germacrene A synthase (GAS) and germacrene A oxidase (GAO) to sequentially cyclize and oxidize farnesyl diphosphate into the advanced intermediate germacrene A acid leading to diverse STLs. Our previous discovery of GAO activity conserved across all major subfamilies of Asteraceae, including the phylogenetically basal lineage of Barnadesioideae, prompted further investigation of the presence of the gateway GAS in Barnadesioideae. Herein we isolated two terpene synthases (BsGAS1/BsGAS2) from the basal Barnadesia spinosa (Barnadesioideae) that displayed robust GAS activity when reconstituted in yeast and characterized in vitro. Despite the apparent lack of STLs in the Barnadesioideae, this work unambiguously confirms the presence of GAS in the basal genera of the Asteraceae. Phylogenetic analysis reveals that the two BsGASs fall into two distinct clades of the Asteraceae's GASs, and BsGAS1 clade is only retained in the evolutionary closer Cichorioideae subfamily, implicating BsGAS2 is likely the ancestral base of most GASs found in the lineages outside the Barnadesioideae. Taken together, these results show the enzymatic capacities of GAS and GAO emerged prior to the subsequent radiation of STL-producing Asteraceae subfamilies. Copyright © 2016 Elsevier Inc. All rights reserved.

Repeat low-level blast exposure increases transient receptor potential vanilloid 1 (TRPV1) and endothelin-1 (ET-1) expression in the trigeminal ganglion

PubMed Central

Burke, Teresa A.; Doyle Brackley, Allison; Jeske, Nathaniel A.; Cleland, Jeffery M.; Lund, Brian J.

2017-01-01

Blast-associated sensory and cognitive trauma sustained by military service members is an area of extensively studied research. Recent studies in our laboratory have revealed that low-level blast exposure increased expression of transient receptor potential vanilloid 1 (TRPV1) and endothelin-1 (ET-1), proteins well characterized for their role in mediating pain transmission, in the cornea. Determining the functional consequences of these alterations in protein expression is critical to understanding blast-related sensory trauma. Thus, the purpose of this study was to examine TRPV1 and ET-1 expression in ocular associated sensory tissues following primary and tertiary blast. A rodent model of blast injury was used in which anesthetized animals, unrestrained or restrained, received a single or repeat blast (73.8 ± 5.5 kPa) from a compressed air shock tube once or daily for five consecutive days, respectively. Behavioral and functional analyses were conducted to assess blast effects on nocifensive behavior and TRPV1 activity. Immunohistochemistry and Western Blot were also performed with trigeminal ganglia (TG) to determine TRPV1, ET-1 and glial fibrillary associated protein (GFAP) expression following blast. Increased TRPV1, ET-1 and GFAP were detected in the TG of animals exposed to repeat blast. Increased nocifensive responses were also observed in animals exposed to repeat, tertiary blast as compared to single blast and control. Moreover, decreased TRPV1 desensitization was observed in TG neurons exposed to repeat blast. Repeat, tertiary blast resulted in increased TRPV1, ET-1 and GFAP expression in the TG, enhanced nociception and decreased TRPV1 desensitization. PMID:28797041

Modelling and mutational analysis of Aspergillus nidulans UreA, a member of the subfamily of urea/H+ transporters in fungi and plants

PubMed Central

Sanguinetti, Manuel; Amillis, Sotiris; Pantano, Sergio; Scazzocchio, Claudio; Ramón, Ana

2014-01-01

We present the first account of the structure–function relationships of a protein of the subfamily of urea/H+ membrane transporters of fungi and plants, using Aspergillus nidulans UreA as a study model. Based on the crystal structures of the Vibrio parahaemolyticus sodium/galactose symporter (vSGLT) and of the Nucleobase-Cation-Symport-1 benzylhydantoin transporter from Microbacterium liquefaciens (Mhp1), we constructed a three-dimensional model of UreA which, combined with site-directed and classical random mutagenesis, led to the identification of amino acids important for UreA function. Our approach allowed us to suggest roles for these residues in the binding, recognition and translocation of urea, and in the sorting of UreA to the membrane. Residues W82, Y106, A110, T133, N275, D286, Y388, Y437 and S446, located in transmembrane helixes 2, 3, 7 and 11, were found to be involved in the binding, recognition and/or translocation of urea and the sorting of UreA to the membrane. Y106, A110, T133 and Y437 seem to play a role in substrate selectivity, while S446 is necessary for proper sorting of UreA to the membrane. Other amino acids identified by random classical mutagenesis (G99, R141, A163, G168 and P639) may be important for the basic transporter's structure, its proper folding or its correct traffic to the membrane. PMID:24966243

Functional characterization of type-B response regulators in the Arabidopsis cytokinin response.

PubMed

Hill, Kristine; Mathews, Dennis E; Kim, Hyo Jung; Street, Ian H; Wildes, Sarah L; Chiang, Yi-Hsuan; Mason, Michael G; Alonso, Jose M; Ecker, Joseph R; Kieber, Joseph J; Schaller, G Eric

2013-05-01

Cytokinins play critical roles in plant growth and development, with the transcriptional response to cytokinin being mediated by the type-B response regulators. In Arabidopsis (Arabidopsis thaliana), type-B response regulators (ARABIDOPSIS RESPONSE REGULATORS [ARRs]) form three subfamilies based on phylogenic analysis, with subfamily 1 having seven members and subfamilies 2 and 3 each having two members. Cytokinin responses are predominantly mediated by subfamily 1 members, with cytokinin-mediated effects on root growth and root meristem size correlating with type-B ARR expression levels. To determine which type-B ARRs can functionally substitute for the subfamily 1 members ARR1 or ARR12, we expressed different type-B ARRs from the ARR1 promoter and assayed their ability to rescue arr1 arr12 double mutant phenotypes. ARR1, as well as a subset of other subfamily 1 type-B ARRs, restore the cytokinin sensitivity to arr1 arr12. Expression of ARR10 from the ARR1 promoter results in cytokinin hypersensitivity and enhances shoot regeneration from callus tissue, correlating with enhanced stability of the ARR10 protein compared with the ARR1 protein. Examination of transfer DNA insertion mutants in subfamilies 2 and 3 revealed little effect on several well-characterized cytokinin responses. However, a member of subfamily 2, ARR21, restores cytokinin sensitivity to arr1 arr12 roots when expressed from the ARR1 promoter, indicating functional conservation of this divergent family member. Our results indicate that the type-B ARRs have diverged in function, such that some, but not all, can complement the arr1 arr12 mutant. In addition, our results indicate that type-B ARR expression profiles in the plant, along with posttranscriptional regulation, play significant roles in modulating their contribution to cytokinin signaling.

Tergal glands in termite soldiers of the subfamily Syntermitinae (Isoptera: Termitidae).

PubMed

Costa-Leonardo, Ana Maria; Haifig, Ives; Laranjo, Lara Teixeira

2012-02-01

The subfamily Syntermitinae comprises 14 genera of termites that are exclusively neotropical. The present study reports morphological data about mandibulate nasute soldiers from termite species belonging to three different genera within this subfamily. We describe tergal glands that were present under all tergites of soldiers of the following species: Cornitermes cumulans, Procornitermes araujoi, Syntermes nanus, and Syntermes wheeleri. The tergal glands were composed of class 2 and class 3 cells. Class 2 cells never reached the cuticle and were located below a flat layer of epidermal cells. Class 3 cells, composed of secretory cells and canal cells, were sporadic, whereas class 2 secretory cells were abundant. Secretory cells of class 3 were narrow and their cytoplasms were filled with several clear, oval-shaped vesicles with limiting membranes. The ultrastructure of class 2 cells showed well-developed smooth endoplasmic reticulum, Golgi apparatus, elongated mitochondria, several electron-lucent vesicles, and electron-dense granules that contain paracrystalline structures in S. nanus. Scanning electron micrographs displayed pores, campaniform sensilla and hairs in the outer cuticle of the soldier tergites. We hypothesize that soldier tergal glands may be involved in the production of defensive compounds, which occur in similar glands of certain cockroaches, or of primer pheromones, that might act in the regulation of soldier differentiation in the termite colony. To date, tergal glands have only been described in termite imagoes, and their occurrence in these soldiers of basal Syntermitinae implies a specific role in this caste that is still speculative and needs to be clarified. Copyright © 2011 Elsevier Ltd. All rights reserved.

Transient receptor potential vanilloid-type 2 targeting on stemness in liver cancer.

PubMed

Hu, Zecheng; Cao, Xiaocheng; Fang, Yu; Liu, Guoxing; Xie, Chengzhi; Qian, Ke; Lei, Xiaohua; Cao, Zhenyu; Du, Huihui; Cheng, Xiangding; Xu, Xundi

2018-06-12

The malignant phenotype of the cells resulting from human liver cancer is driven by liver cancer stem-like cells (LCSLCs). Transient Receptor Potential Vanilloid-type 2 channel (TRPV2) contributes to the progression of different tumor types, including liver cancer. In the current study, the TRPV2 expression levels give rise to the effect on stemness in liver cancer cell lines. TRPV2 knockdown in HepG2 cells enhanced spheroid and colony formation, and expression levels of CD133, CD44 and ALDH1 whereas the opposite effects were observed in TRPV2 enforced expression in SMMC-7721 cells. Furthermore, TRPV2 overexpression restored inhibition of spheroid and colony formation, and stem cell markers expression in HepG2 cells with TRPV2 silencing. The addition of the TRPV2 agonist probenecid and the TRPV2 antagonist tranilast suppressed and/or increased in vitro spheroid and colony formation, and stem cell marker expression of LCSLCs and/or liver cancer cell lines, respectively. Notably, probenecid and tranilast significantly inhibited or promoted tumor growth of HepG2 xenografts in the severe combined immunodeficiency (SCID) mouse model, respectively. TRPV2 expression at protein levels revealed converse correlation with those of CD133 and CD44 in human hepatocellular carcinoma (HCC) tissue. Collectively, the data demonstrate that TRPV2 exert effects on stemness of liver cancer and is a potential target in the treatment of human liver cancer patients. Copyright © 2018. Published by Elsevier Masson SAS.

Involvement of transient receptor potential vanilloid 2 in intra-oral incisional pain.

PubMed

Urata, K; Shinoda, M; Ikutame, D; Iinuma, T; Iwata, K

2018-03-05

To examine whether transient receptor potential vanilloid 2 (TRPV2) contributes to the changes in intra-oral thermal and mechanical sensitivity following the incision of buccal mucosa. Buccal mucosal pain threshold was measured after the incision. Changes in the number of TRPV2-immunoreactive (IR) trigeminal ganglion (TG) neurons which innervate the whisker pad skin and buccal mucosa, changes in the number of isolectin B4-negative/isolectin B4-positive TRPV2-IR TG neurons which innervate the whisker pad skin and the buccal mucosa, and the effect of peripheral TRPV2 antagonism on the pain threshold of incisional whisker pad skin and buccal mucosa were examined after these injuries. Buccal mucosal pain hypersensitivities were induced on day 3 following the incision. The total number of TRPV2-IR TG neurons and the number of isolectin B4-negative TRPV2-IR TG neurons which innervate the whisker pad skin and buccal mucosa were increased. Buccal mucosal TRPV2 antagonism completely suppressed the heat and mechanical hypersensitivities, but not cold hypersensitivity. TRPV2 antagonist administration to the incisional whisker pad skin only partially suppressed pain hypersensitivities. The increased expression of TRPV2 in peptidergic TG neurons innervating the incisional buccal mucosa is predominantly involved in buccal mucosal heat hyperalgesia and mechanical allodynia following buccal mucosal incision. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd. All rights reserved.

NRfamPred: a proteome-scale two level method for prediction of nuclear receptor proteins and their sub-families.

PubMed

Kumar, Ravindra; Kumari, Bandana; Srivastava, Abhishikha; Kumar, Manish

2014-10-29

Nuclear receptor proteins (NRP) are transcription factor that regulate many vital cellular processes in animal cells. NRPs form a super-family of phylogenetically related proteins and divided into different sub-families on the basis of ligand characteristics and their functions. In the post-genomic era, when new proteins are being added to the database in a high-throughput mode, it becomes imperative to identify new NRPs using information from amino acid sequence alone. In this study we report a SVM based two level prediction systems, NRfamPred, using dipeptide composition of proteins as input. At the 1st level, NRfamPred screens whether the query protein is NRP or non-NRP; if the query protein belongs to NRP class, prediction moves to 2nd level and predicts the sub-family. Using leave-one-out cross-validation, we were able to achieve an overall accuracy of 97.88% at the 1st level and an overall accuracy of 98.11% at the 2nd level with dipeptide composition. Benchmarking on independent datasets showed that NRfamPred had comparable accuracy to other existing methods, developed on the same dataset. Our method predicted the existence of 76 NRPs in the human proteome, out of which 14 are novel NRPs. NRfamPred also predicted the sub-families of these 14 NRPs.

Kunitz-Type Peptide HCRG21 from the Sea Anemone Heteractis crispa Is a Full Antagonist of the TRPV1 Receptor.

PubMed

Monastyrnaya, Margarita; Peigneur, Steve; Zelepuga, Elena; Sintsova, Oksana; Gladkikh, Irina; Leychenko, Elena; Isaeva, Marina; Tytgat, Jan; Kozlovskaya, Emma

2016-12-15

Sea anemone venoms comprise multifarious peptides modulating biological targets such as ion channels or receptors. The sequence of a new Kunitz-type peptide, HCRG21, belonging to the Heteractis crispa RG (HCRG) peptide subfamily was deduced on the basis of the gene sequence obtained from the Heteractis crispa cDNA. HCRG21 shares high structural homology with Kunitz-type peptides APHC1-APHC3 from H. crispa , and clusters with the peptides from so named "analgesic cluster" of the HCGS peptide subfamily but forms a separate branch on the NJ-phylogenetic tree. Three unique point substitutions at the N-terminus of the molecule, Arg1, Gly2, and Ser5, distinguish HCRG21 from other peptides of this cluster. The trypsin inhibitory activity of recombinant HCRG21 (rHCRG21) was comparable with the activity of peptides from the same cluster. Inhibition constants for trypsin and α-chymotrypsin were 1.0 × 10 -7 and 7.0 × 10 -7 M, respectively. Electrophysiological experiments revealed that rHCRG21 inhibits 95% of the capsaicin-induced current through transient receptor potential family member vanilloid 1 (TRPV1) and has a half-maximal inhibitory concentration of 6.9 ± 0.4 μM. Moreover, rHCRG21 is the first full peptide TRPV1 inhibitor, although displaying lower affinity for its receptor in comparison with other known ligands. Macromolecular docking and full atom Molecular Dynamics (MD) simulations of the rHCRG21-TRPV1 complex allow hypothesizing the existence of two feasible, intra- and extracellular, molecular mechanisms of blocking. These data provide valuable insights in the structural and functional relationships and pharmacological potential of bifunctional Kunitz-type peptides.

Molecular phylogenetics of subfamily Ornithogaloideae (Hyacinthaceae) based on nuclear and plastid DNA regions, including a new taxonomic arrangement

PubMed Central

Martínez-Azorín, Mario; Crespo, Manuel B.; Juan, Ana; Fay, Michael F.

2011-01-01

Background and Aims The taxonomic arrangement within subfamily Ornithogaloideae (Hyacinthaceae) has been a matter of controversy in recent decades: several new taxonomic treatments have been proposed, based exclusively on plastid DNA sequences, and these have resulted in classifications which are to a great extent contradictory. Some authors have recognized only a single genus Ornithogalum for the whole subfamily, including 250–300 species of variable morphology, whereas others have recognized many genera. In the latter case, the genera are inevitably much smaller and they are better defined morphologically. However, some are not monophyletic as circumscribed. Methods Phylogenetic analyses of Ornithogaloideae were based on nucleotide sequences of four plastid regions (trnL intron, trnL-F spacer, rbcL and matK) and a nuclear region (ITS). Eighty species covering all relevant taxonomic groups previously recognized in the subfamily were sampled. Parsimony and Bayesian analyses were performed. The molecular data were compared with a matrix of 34 morphological characters. Key Results Combinations of plastid and nuclear data yielded phylogenetic trees which are better resolved than those obtained with any plastid region alone or plastid regions in combination. Three main clades are found, corresponding to the previously recognized tribes Albuceae, Dipcadieae and Ornithogaleae. In these, up to 19 clades are described which are definable by morphology and biogeography. These mostly correspond to previously described taxa, though some need recircumscription. Morphological characters are assessed for their diagnostic value for taxonomy in the subfamily. Conclusions On the basis of the phylogenetic analyses, 19 monophyletic genera are accepted within Ornithogaloideae: Albuca, Avonsera, Battandiera, Cathissa, Coilonox, Dipcadi, Eliokarmos, Elsiea, Ethesia, Galtonia, Honorius, Loncomelos, Melomphis, Neopatersonia, Nicipe, Ornithogalum, Pseudogaltonia, Stellarioides and

Deletion of vanilloid receptor (TRPV1) in mice alters behavioral effects of ethanol

PubMed Central

Blednov, Y.A.; Harris, R.A.

2009-01-01

The vanilloid receptor TRPV1 is activated by ethanol and this may be important for some of the central and peripheral actions of ethanol. To determine if this receptor has a role in ethanol-mediated behaviors, we studied null mutant mice in which the Trpv1 gene was deleted. Mice lacking this gene showed significantly higher preference for ethanol and consumed more ethanol in a two-bottle choice test as compared with wild type littermates. Null mutant mice showed shorter duration of loss of righting reflex induced by low doses of ethanol (3.2 and 3.4 g/kg) and faster recovery from motor incoordination induced by ethanol (2 g/kg). However, there were no differences between null mutant and wild type mice in severity of ethanol-induced acute withdrawal (4 g/kg) or conditioned taste aversion to ethanol (2.5 g/kg). Two behavioral phenotypes (decreased sensitivity to ethanol-induced sedation and faster recovery from ethanol-induced motor incoordination) seen in null mutant mice were reproduced in wild type mice by injection of a TRPV1 antagonist, capsazepine (10 mg/kg). These two ethanol behaviors were changed in the opposite direction after injection of capsaicin, a selective TRPV1 agonist, in wild type mice. The studies provide the first evidence that TRPV1 is important for specific behavioral actions of ethanol. PMID:19705551

Comparative studies of a new subfamily of human Ste20-like kinases: homodimerization, subcellular localization, and selective activation of MKK3 and p38.

PubMed

Yustein, Jason T; Xia, Liang; Kahlenburg, J Michelle; Robinson, Dan; Templeton, Dennis; Kung, Hsing-Jien

2003-09-18

The Sterile-20 or Ste20 family of serine/threonine kinases is a group of signaling molecules whose physiological roles within mammalian cells are just starting to be elucidated. Here, in this report we present the characterization of three human Ste20-like kinases with greater than 90% similarity within their catalytic domains that define a novel subfamily of Ste20s. Members of this kinase family include rat thousand and one (TAO1) and chicken KFC (kinase from chicken). For the lack of a consensus nomenclature in the literature, in this report, we shall call this family hKFC (for their homology to chicken KFC) and the three members hKFC-A, hKFC-B, and hKFC-C, respectively. These kinases have many similarities including an aminoterminal kinase domain, a serine-rich region, and a coiled-coil configuration within the C-terminus. All three kinases are able to activate the p38 MAP kinase pathway through the specific activation of the upstream MKK3 kinase. We also offer evidence, both theoretical and biochemical, showing that these kinases can undergo self-association. Despite these similarities, these kinases differ in tissue distribution, apparent subcellular localization, and feature structural differences largely within the carboxyl-terminal sequence.

The Atypical Response Regulator Protein ChxR Has Structural Characteristics and Dimer Interface Interactions That Are Unique within the OmpR/PhoB Subfamily

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hickey, John M.; Lovell, Scott; Battaile, Kevin P.

2013-05-29

Typically as a result of phosphorylation, OmpR/PhoB response regulators form homodimers through a receiver domain as an integral step in transcriptional activation. Phosphorylation stabilizes the ionic and hydrophobic interactions between monomers. Recent studies have shown that some response regulators retain functional activity in the absence of phosphorylation and are termed atypical response regulators. The two currently available receiver domain structures of atypical response regulators are very similar to their phospho-accepting homologs, and their propensity to form homodimers is generally retained. An atypical response regulator, ChxR, from Chlamydia trachomatis, was previously reported to form homodimers; however, the residues critical to thismore » interaction have not been elucidated. We hypothesize that the intra- and intermolecular interactions involved in forming a transcriptionally competent ChxR are distinct from the canonical phosphorylation (activation) paradigm in the OmpR/PhoB response regulator subfamily. To test this hypothesis, structural and functional studies were performed on the receiver domain of ChxR. Two crystal structures of the receiver domain were solved with the recently developed method using triiodo compound I3C. These structures revealed many characteristics unique to OmpR/PhoB subfamily members: typical or atypical. Included was the absence of two {alpha}-helices present in all other OmpR/PhoB response regulators. Functional studies on various dimer interface residues demonstrated that ChxR forms relatively stable homodimers through hydrophobic interactions, and disruption of these can be accomplished with the introduction of a charged residue within the dimer interface. A gel shift study with monomeric ChxR supports that dimerization through the receiver domain is critical for interaction with DNA.« less

THE GRK4 SUBFAMILY OF G PROTEIN-COUPLED RECEPTOR KINASES: ALTERNATIVE SPLICING, GENE ORGANIZATION, AND SEQUENCE CONSERVATION

EPA Science Inventory

The GRK4 subfamily of G protein-coupled receptor kinases. Alternative splicing, gene organization, and sequence conservation.

Premont RT, Macrae AD, Aparicio SA, Kendall HE, Welch JE, Lefkowitz RJ.

Department of Medicine, Howard Hughes Medical Institute, Duke Univer...

Transient Receptor Potential Vanilloid 1 Expression Mediates Capsaicin-Induced Cell Death.

PubMed

Ramírez-Barrantes, Ricardo; Córdova, Claudio; Gatica, Sebastian; Rodriguez, Belén; Lozano, Carlo; Marchant, Ivanny; Echeverria, Cesar; Simon, Felipe; Olivero, Pablo

2018-01-01

The transient receptor potential (TRP) ion channel family consists of a broad variety of non-selective cation channels that integrate environmental physicochemical signals for dynamic homeostatic control. Involved in a variety of cellular physiological processes, TRP channels are fundamental to the control of the cell life cycle. TRP channels from the vanilloid (TRPV) family have been directly implicated in cell death. TRPV1 is activated by pain-inducing stimuli, including inflammatory endovanilloids and pungent exovanilloids, such as capsaicin (CAP). TRPV1 activation by high doses of CAP (>10 μM) leads to necrosis, but also exhibits apoptotic characteristics. However, CAP dose-response studies are lacking in order to determine whether CAP-induced cell death occurs preferentially via necrosis or apoptosis. In addition, it is not known whether cytosolic Ca 2+ and mitochondrial dysfunction participates in CAP-induced TRPV1-mediated cell death. By using TRPV1-transfected HeLa cells, we investigated the underlying mechanisms involved in CAP-induced TRPV1-mediated cell death, the dependence of CAP dose, and the participation of mitochondrial dysfunction and cytosolic Ca 2+ increase. Together, our results contribute to elucidate the pathophysiological steps that follow after TRPV1 stimulation with CAP. Low concentrations of CAP (1 μM) induce cell death by a mechanism involving a TRPV1-mediated rapid and transient intracellular Ca 2+ increase that stimulates plasma membrane depolarization, thereby compromising plasma membrane integrity and ultimately leading to cell death. Meanwhile, higher doses of CAP induce cell death via a TRPV1-independent mechanism, involving a slow and persistent intracellular Ca 2+ increase that induces mitochondrial dysfunction, plasma membrane depolarization, plasma membrane loss of integrity, and ultimately, cell death.

Multimodal use of calcitonin gene-related peptide and substance P in itch and acute pain uncovered by the elimination of vesicular glutamate transporter 2 from transient receptor potential cation channel subfamily V member 1 neurons.

PubMed

Rogoz, Katarzyna; Andersen, Helena H; Lagerström, Malin C; Kullander, Klas

2014-10-15

Primary afferents are known to use glutamate as their principal fast neurotransmitter. However, it has become increasingly clear that peptides have an influential role in both mediating and modulating sensory transmission. Here we describe the transmission accounting for different acute pain states and itch transmitted via the transient receptor potential cation channel subfamily V member 1 (TRPV1) population by either ablating Trpv1-Cre-expressing neurons or inducing vesicular glutamate transporter 2 (VGLUT2) deficiency in Trpv1-Cre-expressing neurons. Furthermore, by pharmacological inhibition of substance P or calcitonin gene-related peptide (CGRP) signaling in Vglut2-deficient mice, we evaluated the contribution of substance P or CGRP to these sensory modulations, with or without the presence of VGLUT2-mediated glutamatergic transmission in Trpv1-Cre neurons. This examination, together with c-Fos analyses, showed that glutamate via VGLUT2 in the Trpv1-Cre population together with substance P mediate acute cold pain, whereas glutamate together with CGRP mediate noxious heat. Moreover, we demonstrate that glutamate together with both substance P and CGRP mediate tissue-injury associated pain. We further show that itch, regulated by the VGLUT2-mediated transmission via the Trpv1-Cre population, depends on CGRP and gastrin-releasing peptide receptor (GRPR) transmission because pharmacological blockade of the CGRP or GRPR pathway, or genetic ablation of Grpr, led to a drastically attenuated itch. Our study reveals how different neurotransmitters combined can cooperate with each other to transmit or regulate various acute sensations, including itch. Copyright © 2014 the authors 0270-6474/14/3414055-14$15.00/0.

Using amphiphilic pseudo amino acid composition to predict enzyme subfamily classes.

PubMed

Chou, Kuo-Chen

2005-01-01

With protein sequences entering into databanks at an explosive pace, the early determination of the family or subfamily class for a newly found enzyme molecule becomes important because this is directly related to the detailed information about which specific target it acts on, as well as to its catalytic process and biological function. Unfortunately, it is both time-consuming and costly to do so by experiments alone. In a previous study, the covariant-discriminant algorithm was introduced to identify the 16 subfamily classes of oxidoreductases. Although the results were quite encouraging, the entire prediction process was based on the amino acid composition alone without including any sequence-order information. Therefore, it is worthy of further investigation. To incorporate the sequence-order effects into the predictor, the 'amphiphilic pseudo amino acid composition' is introduced to represent the statistical sample of a protein. The novel representation contains 20 + 2lambda discrete numbers: the first 20 numbers are the components of the conventional amino acid composition; the next 2lambda numbers are a set of correlation factors that reflect different hydrophobicity and hydrophilicity distribution patterns along a protein chain. Based on such a concept and formulation scheme, a new predictor is developed. It is shown by the self-consistency test, jackknife test and independent dataset tests that the success rates obtained by the new predictor are all significantly higher than those by the previous predictors. The significant enhancement in success rates also implies that the distribution of hydrophobicity and hydrophilicity of the amino acid residues along a protein chain plays a very important role to its structure and function.

An Uncharacterized Member of the Ribokinase Family in Thermococcus kodakarensis Exhibits myo-Inositol Kinase Activity*

PubMed Central

Sato, Takaaki; Fujihashi, Masahiro; Miyamoto, Yukika; Kuwata, Keiko; Kusaka, Eriko; Fujita, Haruo; Miki, Kunio; Atomi, Haruyuki

2013-01-01

Here we performed structural and biochemical analyses on the TK2285 gene product, an uncharacterized protein annotated as a member of the ribokinase family, from the hyperthermophilic archaeon Thermococcus kodakarensis. The three-dimensional structure of the TK2285 protein resembled those of previously characterized members of the ribokinase family including ribokinase, adenosine kinase, and phosphofructokinase. Conserved residues characteristic of this protein family were located in a cleft of the TK2285 protein as in other members whose structures have been determined. We thus examined the kinase activity of the TK2285 protein toward various sugars recognized by well characterized ribokinase family members. Although activity with sugar phosphates and nucleosides was not detected, kinase activity was observed toward d-allose, d-lyxose, d-tagatose, d-talose, d-xylose, and d-xylulose. Kinetic analyses with the six sugar substrates revealed high Km values, suggesting that they were not the true physiological substrates. By examining activity toward amino sugars, sugar alcohols, and disaccharides, we found that the TK2285 protein exhibited prominent kinase activity toward myo-inositol. Kinetic analyses with myo-inositol revealed a greater kcat and much lower Km value than those obtained with the monosaccharides, resulting in over a 2,000-fold increase in kcat/Km values. TK2285 homologs are distributed among members of Thermococcales, and in most species, the gene is positioned close to a myo-inositol monophosphate synthase gene. Our results suggest the presence of a novel subfamily of the ribokinase family whose members are present in Archaea and recognize myo-inositol as a substrate. PMID:23737529

Genome-wide analysis of the homeodomain-leucine zipper (HD-ZIP) gene family in peach (Prunus persica).

PubMed

Zhang, C H; Ma, R J; Shen, Z J; Sun, X; Korir, N K; Yu, M L

2014-04-08

In this study, 33 homeodomain-leucine zipper (HD-ZIP) genes were identified in peach using the HD-ZIP amino acid sequences of Arabidopsis thaliana as a probe. Based on the phylogenetic analysis and the individual gene or protein characteristics, the HD-ZIP gene family in peach can be classified into 4 subfamilies, HD-ZIP I, II, III, and IV, containing 14, 7, 4, and 8 members, respectively. The most closely related peach HD-ZIP members within the same subfamilies shared very similar gene structure in terms of either intron/exon numbers or lengths. Almost all members of the same subfamily shared common motif compositions, thereby implying that the HD-ZIP proteins within the same subfamily may have functional similarity. The 33 peach HD-ZIP genes were distributed across scaffolds 1 to 7. Although the primary structure varied among HD-ZIP family proteins, their tertiary structures were similar. The results from this study will be useful in selecting candidate genes from specific subfamilies for functional analysis.

Exploration of the Esophageal Mucosal Barrier in Non-Erosive Reflux Disease

PubMed Central

Rinsma, Nicolaas F.; Farré, Ricard; Troost, Fred J.; Elizalde, Montserrat; Keszthelyi, Daniel; Helyes, Zsuzsanna; Masclee, Ad A.; Conchillo, José M.

2017-01-01

In the absence of visible mucosal damage, it is hypothesized that the esophageal mucosal barrier is functionally impaired in patients with non-erosive reflux disease (NERD). The aim of the present study was to perform an exploratory analysis of the mucosal barrier in NERD compared to erosive esophagitis (EE) and controls. A second aim was to explore TRPV1 gene transcription in relation to the mucosal barrier function and heartburn symptoms. In this prospective study, 10 NERD patients, 11 patients with active erosive esophagitis and 10 healthy volunteers were included. Biopsies from non-eroded mucosa were obtained for (1) ex vivo analyses (Ussing chamber) of transepithelial electrical resistance (TEER) and permeability (2) gene transcription of tight-junction proteins and transient receptor potential vanilloid subfamily member 1 (TRPV1). No differences in TEER or permeability were found between NERD and healthy volunteers, whereas TEER was lower in patients with erosive esophagitis. TRPV1 gene transcription was not significantly different between EE, NERD and controls. Conclusions: esophageal mucosal barrier function and TRPV1 transcription is not significantly altered in NERD patients. Future research is needed to explore other potential mechanisms that may account for the high symptom burden in these patients. PMID:28534850

Recent advances in the study on capsaicinoids and capsinoids.

PubMed

Luo, Xiu-Ju; Peng, Jun; Li, Yuan-Jian

2011-01-10

Chili peppers are the major source of nature capsaicinoids, which consist of capsaicin, dihydrocapsaicin, nordihydrocapsaicin, homodihydrocapsaicin, and homocapsaicin, etc. Capsaicinoids are found to exert multiple pharmacological and physiological effects including the activities of analgesia, anticancer, anti-inflammation, antioxidant and anti-obesity. Therefore, capsaicinoids may have the potential value in clinic for pain relief, cancer prevention and weight loss. In addition, capsaicinoids also display the benefits on cardiovascular and gastrointestinal system. It has been shown that capsaicinoids are potential agonists of capsaicin receptor or transient receptor potential vanilloid subfamily member 1 (TRPV1). They could exert the effects not only through the receptor-dependent pathway but also through the receptor-independent one. CH-19 Sweet peppers are the source of nature capsinoids, which share similar structure with capsaicinoids and consist of capsiate, dihydrocapsiate, and nordihydrocapsiate, etc, Comparing with capsaicinoids, capsinoids are less pungent and easily broken down in the normal aqueous conditions. So far, it has been found that capsinoids possess the biological properties of antitumor, antioxidant and anti-obesity. Since capsinoids are less toxic than capsaicinoids, therefore, capsinoids may have the advantages over capsaicinoids in clinical applications such as cancer prevention and weight loss. Copyright © 2010 Elsevier B.V. All rights reserved.

TRPV6 calcium channel translocates to the plasma membrane via Orai1-mediated mechanism and controls cancer cell survival

PubMed Central

Raphaël, Maylis; Lehen’kyi, V’yacheslav; Vandenberghe, Matthieu; Beck, Benjamin; Khalimonchyk, Sergiy; Vanden Abeele, Fabien; Farsetti, Leonardo; Germain, Emmanuelle; Bokhobza, Alexandre; Mihalache, Adriana; Gosset, Pierre; Romanin, Christoph; Clézardin, Philippe; Skryma, Roman; Prevarskaya, Natalia

2014-01-01

Transient receptor potential vanilloid subfamily member 6 (TRPV6) is a highly selective calcium channel that has been considered as a part of store-operated calcium entry (SOCE). Despite its first discovery in the early 2000s, the role of this channel in prostate cancer (PCa) remained, until now, obscure. Here we show that TRPV6 mediates calcium entry, which is highly increased in PCa due to the remodeling mechanism involving the translocation of the TRPV6 channel to the plasma membrane via the Orai1/TRPC1-mediated Ca2+/Annexin I/S100A11 pathway, partially contributing to SOCE. The TRPV6 calcium channel is expressed de novo by the PCa cell to increase its survival by enhancing proliferation and conferring apoptosis resistance. Xenografts in nude mice and bone metastasis models confirmed the remarkable aggressiveness of TRPV6-overexpressing tumors. Immunohistochemical analysis of these demonstrated the increased expression of clinical markers such as Ki-67, prostate specific antigen, synaptophysin, CD31, and CD56, which are strongly associated with a poor prognosis. Thus, the TRPV6 channel acquires its oncogenic potential in PCa due to the remodeling mechanism via the Orai1-mediated Ca2+/Annexin I/S100A11 pathway. PMID:25172921

Regulation of protease-activated receptor 1 signaling by the adaptor protein complex 2 and R4 subfamily of regulator of G protein signaling proteins.

PubMed

Chen, Buxin; Siderovski, David P; Neubig, Richard R; Lawson, Mark A; Trejo, Joann

2014-01-17

The G protein-coupled protease-activated receptor 1 (PAR1) is irreversibly proteolytically activated by thrombin. Hence, the precise regulation of PAR1 signaling is important for proper cellular responses. In addition to desensitization, internalization and lysosomal sorting of activated PAR1 are critical for the termination of signaling. Unlike most G protein-coupled receptors, PAR1 internalization is mediated by the clathrin adaptor protein complex 2 (AP-2) and epsin-1, rather than β-arrestins. However, the function of AP-2 and epsin-1 in the regulation of PAR1 signaling is not known. Here, we report that AP-2, and not epsin-1, regulates activated PAR1-stimulated phosphoinositide hydrolysis via two different mechanisms that involve, in part, a subset of R4 subfamily of "regulator of G protein signaling" (RGS) proteins. A significantly greater increase in activated PAR1 signaling was observed in cells depleted of AP-2 using siRNA or in cells expressing a PAR1 (420)AKKAA(424) mutant with defective AP-2 binding. This effect was attributed to AP-2 modulation of PAR1 surface expression and efficiency of G protein coupling. We further found that ectopic expression of R4 subfamily members RGS2, RGS3, RGS4, and RGS5 reduced activated PAR1 wild-type signaling, whereas signaling by the PAR1 AKKAA mutant was minimally affected. Intriguingly, siRNA-mediated depletion analysis revealed a function for RGS5 in the regulation of signaling by the PAR1 wild type but not the AKKAA mutant. Moreover, activation of the PAR1 wild type, and not the AKKAA mutant, induced Gαq association with RGS3 via an AP-2-dependent mechanism. Thus, AP-2 regulates activated PAR1 signaling by altering receptor surface expression and through recruitment of RGS proteins.

Berberine via suppression of transient receptor potential vanilloid 4 channel improves vascular stiffness in mice

PubMed Central

Wang, Jie; Guo, Tao; Peng, Qi-Sheng; Yue, Shou-Wei; Wang, Shuang-Xi

2015-01-01

Berberine, as an alkaloid found in many Chinese herbs, improves vascular functions in patients with cardiovascular diseases. We determined the effects of berberine in hypertension and vascular ageing, and elucidated the underlying mechanisms. In isolated aortas, berberine dose-dependently elicited aortic relaxation. In cultured cells, berberine induced the relaxation of vascular smooth muscle cells (VSMCs). Overexpression of transient receptor potential vanilloid 4 (TRPV4) channel by genetic approaches abolished the berberine-induced reduction in intracellular Ca2+ concentration in VSMCs and attenuated berberine-elicited vessel dilation in mice aortas. In deoxycorticosterone acetate (DOCA)-induced hypertensive model, treatment of mice with berberine or RN-1734, a pharmacological inhibitor of TRPV4, significantly decreased systemic blood pressure (BP) in control mice or mice infected with an adenovirus vector. However, berberine-induced effects of lowering BP were reversed by overexpressing TRPV4 in mice by infecting with adenovirus. Furthermore, long-term administration of berberine decreased mean BP and pulse BP, increased artery response to vasodilator and reduced vascular collagen content in aged mice deficient in apolipoprotein E (Apoe-KO), but not in Apoe-KO old mice with lentivirus-mediated overexpression of TRPV4 channel. In conclusion, berberine induces direct vasorelaxation to lower BP and reduces vascular stiffness in aged mice through suppression of TRPV4. PMID:26177349

AOX1-Subfamily Gene Members in Olea europaea cv. "Galega Vulgar"-Gene Characterization and Expression of Transcripts during IBA-Induced in Vitro Adventitious Rooting.

PubMed

Velada, Isabel; Grzebelus, Dariusz; Lousa, Diana; M Soares, Cláudio; Santos Macedo, Elisete; Peixe, Augusto; Arnholdt-Schmitt, Birgit; G Cardoso, Hélia

2018-02-17

Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar "Galega vulgar". The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars.

The stress protein heat shock cognate 70 (Hsc70) inhibits the Transient Receptor Potential Vanilloid type 1 (TRPV1) channel.

PubMed

Iftinca, Mircea; Flynn, Robyn; Basso, Lilian; Melo, Helvira; Aboushousha, Reem; Taylor, Lauren; Altier, Christophe

2016-01-01

Specialized cellular defense mechanisms prevent damage from chemical, biological, and physical hazards. The heat shock proteins have been recognized as key chaperones that maintain cell survival against a variety of exogenous and endogenous stress signals including noxious temperature. However, the role of heat shock proteins in nociception remains poorly understood. We carried out an expression analysis of the constitutively expressed 70 kDa heat-shock cognate protein, a member of the stress-induced HSP70 family in lumbar dorsal root ganglia from a mouse model of Complete Freund's Adjuvant-induced chronic inflammatory pain. We used immunolabeling of dorsal root ganglion neurons, behavioral analysis and patch clamp electrophysiology in both dorsal root ganglion neurons and HEK cells transfected with Hsc70 and Transient Receptor Potential Channels to examine their functional interaction in heat shock stress condition. We report an increase in protein levels of Hsc70 in mouse dorsal root ganglia, 3 days post Complete Freund's Adjuvant injection in the hind paw. Immunostaining of Hsc70 was observed in most of the dorsal root ganglion neurons, including the small size nociceptors immunoreactive to the TRPV1 channel. Standard whole-cell patch-clamp technique was used to record Transient Receptor Potential Vanilloid type 1 current after exposure to heat shock. We found that capsaicin-evoked currents are inhibited by heat shock in dorsal root ganglion neurons and transfected HEK cells expressing Hsc70 and TRPV1. Blocking Hsc70 with matrine or spergualin compounds prevented heat shock-induced inhibition of the channel. We also found that, in contrast to TRPV1, both the cold sensor channels TRPA1 and TRPM8 were unresponsive to heat shock stress. Finally, we show that inhibition of TRPV1 depends on the ATPase activity of Hsc70 and involves the rho-associated protein kinase. Our work identified Hsc70 and its ATPase activity as a central cofactor of TRPV1 channel function

Two CRM protein subfamilies cooperate in the splicing of group IIB introns in chloroplasts.

PubMed

Asakura, Yukari; Bayraktar, Omer Ali; Barkan, Alice

2008-11-01

Chloroplast genomes in angiosperms encode approximately 20 group II introns, approximately half of which are classified as subgroup IIB. The splicing of all but one of the subgroup IIB introns requires a heterodimer containing the peptidyl-tRNA hydrolase homolog CRS2 and one of two closely related proteins, CAF1 or CAF2, that harbor a recently recognized RNA binding domain called the CRM domain. Two CRS2/CAF-dependent introns require, in addition, a CRM domain protein called CFM2 that is only distantly related to CAF1 and CAF2. Here, we show that CFM3, a close relative of CFM2, associates in vivo with those CRS2/CAF-dependent introns that are not CFM2 ligands. Mutant phenotypes in rice and Arabidopsis support a role for CFM3 in the splicing of most of the introns with which it associates. These results show that either CAF1 or CAF2 and either CFM2 or CFM3 simultaneously bind most chloroplast subgroup IIB introns in vivo, and that the CAF and CFM subunits play nonredundant roles in splicing. These results suggest that the expansion of the CRM protein family in plants resulted in two subfamilies that play different roles in group II intron splicing, with further diversification within a subfamily to accommodate multiple intron ligands.

Towards a molecular taxonomic key of the Aurantioideae subfamily using chloroplastic SNP diagnostic markers of the main clades genotyped by competitive allele-specific PCR.

PubMed

Oueslati, Amel; Ollitrault, Frederique; Baraket, Ghada; Salhi-Hannachi, Amel; Navarro, Luis; Ollitrault, Patrick

2016-08-18

Chloroplast DNA is a primary source of molecular variations for phylogenetic analysis of photosynthetic eukaryotes. However, the sequencing and analysis of multiple chloroplastic regions is difficult to apply to large collections or large samples of natural populations. The objective of our work was to demonstrate that a molecular taxonomic key based on easy, scalable and low-cost genotyping method should be developed from a set of Single Nucleotide Polymorphisms (SNPs) diagnostic of well-established clades. It was applied to the Aurantioideae subfamily, the largest group of the Rutaceae family that includes the cultivated citrus species. The publicly available nucleotide sequences of eight plastid genomic regions were compared for 79 accessions of the Aurantioideae subfamily to search for SNPs revealing taxonomic differentiation at the inter-tribe, inter-subtribe, inter-genus and interspecific levels. Diagnostic SNPs (DSNPs) were found for 46 of the 54 clade levels analysed. Forty DSNPs were selected to develop KASPar markers and their taxonomic value was tested by genotyping 108 accessions of the Aurantioideae subfamily. Twenty-seven markers diagnostic of 24 clades were validated and they displayed a very high rate of transferability in the Aurantioideae subfamily (only 1.2 % of missing data on average). The UPGMA from the validated markers produced a cladistic organisation that was highly coherent with the previous phylogenetic analysis based on the sequence data of the eight plasmid regions. In particular, the monophyletic origin of the "true citrus" genera plus Oxanthera was validated. However, some clarification remains necessary regarding the organisation of the other wild species of the Citreae tribe. We validated the concept that with well-established clades, DSNPs can be selected and efficiently transformed into competitive allele-specific PCR markers (KASPar method) allowing cost-effective highly efficient cladistic analysis in large collections at

Comparative Mitogenomic Analysis of Species Representing Six Subfamilies in the Family Tenebrionidae

PubMed Central

Zhang, Hong-Li; Liu, Bing-Bing; Wang, Xiao-Yang; Han, Zhi-Ping; Zhang, Dong-Xu; Su, Cai-Na

2016-01-01

To better understand the architecture and evolution of the mitochondrial genome (mitogenome), mitogenomes of ten specimens representing six subfamilies in Tenebrionidae were selected, and comparative analysis of these mitogenomes was carried out in this study. Ten mitogenomes in this family share a similar gene composition, gene order, nucleotide composition, and codon usage. In addition, our results show that nucleotide bias was strongly influenced by the preference of codon usage for A/T rich codons which significantly correlated with the G + C content of protein coding genes (PCGs). Evolutionary rate analyses reveal that all PCGs have been subjected to a purifying selection, whereas 13 PCGs displayed different evolution rates, among which ATPase subunit 8 (ATP8) showed the highest evolutionary rate. We inferred the secondary structure for all RNA genes of Tenebrio molitor (Te2) and used this as the basis for comparison with the same genes from other Tenebrionidae mitogenomes. Some conserved helices (stems) and loops of RNA structures were found in different domains of ribosomal RNAs (rRNAs) and the cloverleaf structure of transfer RNAs (tRNAs). With regard to the AT-rich region, we analyzed tandem repeat sequences located in this region and identified some essential elements including T stretches, the consensus motif at the flanking regions of T stretch, and the secondary structure formed by the motif at the 3′ end of T stretch in major strand, which are highly conserved in these species. Furthermore, phylogenetic analyses using mitogenomic data strongly support the relationships among six subfamilies: ((Tenebrionidae incertae sedis + (Diaperinae + Tenebrioninae)) + (Pimeliinae + Lagriinae)), which is consistent with phylogenetic results based on morphological traits. PMID:27258256

Novel members of the adipokinetic hormone family in beetles of the superfamily Scarabaeoidea.

PubMed

Gäde, Gerd; Šimek, Petr; Marco, Heather G

2016-12-01

Eight beetle species of the superfamily Scarabaeoidea were investigated with respect to peptides belonging to the adipokinetic hormone (AKH) family in their neurohemal organs, the corpora cardiaca (CC). The following beetle families are represented: Scarabaeidae, Lucanidae, and Geotrupidae. AKH peptides were identified through a heterospecific trehalose-mobilizing bioassay and by sequence analyses, using liquid chromatography coupled to positive electrospray mass spectrometry (LC-ESI-MS) and analysis of the tandem MS 2 spectra obtained by collision-induced dissociation. All the beetle species have octapeptide AKHs; some have two AKHs, while others have only one. Novel AKH members were found in Euoniticellus intermedius and Circellium bacchus (family Scarabaeidae), as well as in Dorcus parallelipipedus (family Lucanidae). Two species of the family Geotrupidae and two species of the Scarabaeidae subfamily Cetoniinae contain one known AKH peptide, Melme-CC, while E. intermedius produces a novel peptide code named Euoin-AKH: pEINFTTGWamide. Two AKH peptides were each identified in CC of C. bacchus and D. parallelipipedus: the novel Cirba-AKH: pEFNFSAGWamide and the known peptide, Scade-CC-I in the former, and the novel Dorpa-AKH: pEVNYSPVW amide and the known peptide, Melme-CC in the latter. Kheper bonelli (subfamily Scarabaeinae) also has two AKHs, the known Scade-CC-I and Scade-CC-II. All the novel peptides were synthesized and the amino acid sequence assignments were unequivocally confirmed by co-elution of the synthetic peptides with their natural equivalent, and identical MS parameters of the two forms. The novel synthetic peptides are all active in inducing hypertrehalosemia in cockroaches.

Flower development: the evolutionary history and functions of the AGL6 subfamily MADS-box genes.

PubMed

Dreni, Ludovico; Zhang, Dabing

2016-03-01

AGL6 is an ancient subfamily of MADS-box genes found in both gymnosperms and angiosperms. Its functions remained elusive despite the fact that the MADS-box genes and the ABC model have been studied for >20 years. Nevertheless, recent discoveries in petunia, rice, and maize support its involvement in the 'E' function of floral development, very similar to the closely related AGL2 (SEPALLATA) subfamily which has been well characterized. The known functions of AGL6 span from ancient conserved roles to new functions acquired in specific plant families. The AGL6 genes are involved in floral meristem regulation, in floral organs, and ovule (integument) and seed development, and have possible roles in both male and female germline and gametophyte development. In grasses, they are also important for the development of the first whorl of the flower, whereas in Arabidopsis they may play additional roles before floral meristem formation. This review covers these recent insights and some other aspects that are not yet fully elucidated, which deserve more studies in the future. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Kunitz-Type Peptide HCRG21 from the Sea Anemone Heteractis crispa Is a Full Antagonist of the TRPV1 Receptor

PubMed Central

Monastyrnaya, Margarita; Peigneur, Steve; Zelepuga, Elena; Sintsova, Oksana; Gladkikh, Irina; Leychenko, Elena; Isaeva, Marina; Tytgat, Jan; Kozlovskaya, Emma

2016-01-01

Sea anemone venoms comprise multifarious peptides modulating biological targets such as ion channels or receptors. The sequence of a new Kunitz-type peptide, HCRG21, belonging to the Heteractis crispa RG (HCRG) peptide subfamily was deduced on the basis of the gene sequence obtained from the Heteractis crispa cDNA. HCRG21 shares high structural homology with Kunitz-type peptides APHC1–APHC3 from H. crispa, and clusters with the peptides from so named “analgesic cluster” of the HCGS peptide subfamily but forms a separate branch on the NJ-phylogenetic tree. Three unique point substitutions at the N-terminus of the molecule, Arg1, Gly2, and Ser5, distinguish HCRG21 from other peptides of this cluster. The trypsin inhibitory activity of recombinant HCRG21 (rHCRG21) was comparable with the activity of peptides from the same cluster. Inhibition constants for trypsin and α-chymotrypsin were 1.0 × 10−7 and 7.0 × 10−7 M, respectively. Electrophysiological experiments revealed that rHCRG21 inhibits 95% of the capsaicin-induced current through transient receptor potential family member vanilloid 1 (TRPV1) and has a half-maximal inhibitory concentration of 6.9 ± 0.4 μM. Moreover, rHCRG21 is the first full peptide TRPV1 inhibitor, although displaying lower affinity for its receptor in comparison with other known ligands. Macromolecular docking and full atom Molecular Dynamics (MD) simulations of the rHCRG21–TRPV1 complex allow hypothesizing the existence of two feasible, intra- and extracellular, molecular mechanisms of blocking. These data provide valuable insights in the structural and functional relationships and pharmacological potential of bifunctional Kunitz-type peptides. PMID:27983679

Role for ribosome-associated complex and stress-seventy subfamily B (RAC-Ssb) in integral membrane protein translation.

PubMed

Acosta-Sampson, Ligia; Döring, Kristina; Lin, Yuping; Yu, Vivian Y; Bukau, Bernd; Kramer, Günter; Cate, Jamie H D

2017-12-01

Targeting of most integral membrane proteins to the endoplasmic reticulum is controlled by the signal recognition particle, which recognizes a hydrophobic signal sequence near the protein N terminus. Proper folding of these proteins is monitored by the unfolded protein response and involves protein degradation pathways to ensure quality control. Here, we identify a new pathway for quality control of major facilitator superfamily transporters that occurs before the first transmembrane helix, the signal sequence recognized by the signal recognition particle, is made by the ribosome. Increased rates of translation elongation of the N-terminal sequence of these integral membrane proteins can divert the nascent protein chains to the ribosome-associated complex and stress-seventy subfamily B chaperones. We also show that quality control of integral membrane proteins by ribosome-associated complex-stress-seventy subfamily B couples translation rate to the unfolded protein response, which has implications for understanding mechanisms underlying human disease and protein production in biotechnology. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Rediscovered and new perisphaerine cockroaches from SW China with a review of subfamilial diagnosis (Blattodea: Blaberidae).

PubMed

Li, Xin-Ran; Wang, Li-Li; Wang, Zong-Qing

2018-04-17

The taxonomic records of Chinese perisphaerine cockroaches were scattered in literature, and therefore a dedicated study is desired to update our knowledge. This paper reviews the subfamilial diagnosis and Chinese species, mostly from southwestern China. We provide high-definition habitus photos and drawings, the latter emphasizes the genitalia of both sexes, which are generalized with diagrams, abstracted from specimens examined. A total of 18 species are recorded in four genera, including Perisphaerus, or pill cockroach, the type genus of the subfamily. Two new genera and three new species are proposed: Achatiblatta achates gen. sp. nov., Frumentiforma frumentiformis gen. sp. nov., and Pseudoglomeris montana sp. nov.. Pseudoglomeris has five new junior synonyms: Corydidarum, Trichoblatta, Kurokia, Glomerexis, and Glomeriblatta; the following combinations are thus revived or new: Ps. aerea comb. nov., Ps. angustifolia comb. nov., Ps. beybienkoi comb. nov., Ps. fallax comb. nov., Ps. magnifica comb. rev., Ps. montshadskii comb. nov., Ps. nigra comb. nov., Ps. sculpta comb. nov., Ps. semisulcata comb. rev., Ps. tibetana comb. nov., and Ps. valida moderata comb. nov.. The following species are revalidated and combinations revived: Pe. pygmaeus comb. rev., Ps. dubia comb. sp. rev., and Ps. planiuscla comb. sp. rev.

BTG/Tob family members Tob1 and Tob2 inhibit proliferation of mouse embryonic stem cells via Id3 mRNA degradation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Yuanfan; Wang, Chenchen; Peking University Stem Cell Research Center, China National Center for International Research, Peking University Health Science Center, Beijing 100191

2015-07-03

The mammalian BTG/Tob family is a group of proteins with anti-proliferative ability, and there are six members including BTG1, BTG2/PC3/Tis21, BTG3/ANA, BTG4/PC3B, Tob1/Tob and Tob2. Among them, Tob subfamily members, specifically Tob1/Tob and Tob2, have the most extensive C-terminal regions. As previously reported, overexpression of BTG/Tob proteins is associated with the inhibition of G1 to S-phase cell cycle progression and decreased cell proliferation in a variety of cell types. Tob subfamily proteins have similar anti-proliferative effects on cell cycle progression in cultured tumor cells. An important unresolved question is whether or not they have function in rapidly proliferating cells, suchmore » as embryonic stem cells (ESCs). Tob1 and Tob2 were expressed ubiquitously in mouse ESCs (mESCs), suggesting a possible role in early embryonic development and mESCs. To address the above question and explore the possible functions of the Tob subfamily in ESCs, we established ESCs from different genotypic knockout inner cell mass (ICM). We found that Tob1{sup −/−}, Tob2{sup −/−}, and Tob1/2 double knockout (DKO, Tob1{sup −/−} & Tob2{sup −/−}) ESCs grew faster than wild type (WT) ESCs without losing pluripotency, and we provide a possible mechanistic explanation for these observations: Tob1 and Tob2 inhibit the cell cycle via degradation of Id3 mRNA, which is a set of directly targeted genes of BMP4 signaling in mESCs that play critical roles in the maintenance of ESC properties. Together, our data suggest that BTG/Tob family protein Tob1 and Tob2 regulation cell proliferation does not compromise the basic properties of mESCs. - Highlights: • We established mouse Tob1/2 double knockout embryonic stem cells. • Tob1 and Tob2 inhibit the proliferation of ESCs without effect on pluripotency. • Tob1 and Tob2 involved in the degradation of Id3 in mESCs.« less

Salt-dependent regulation of a CNG channel subfamily in Arabidopsis.

PubMed

Kugler, Annette; Köhler, Barbara; Palme, Klaus; Wolff, Patricia; Dietrich, Petra

2009-11-27

In Arabidopsis thaliana, the family of cyclic nucleotide-gated channels (CNGCs) is composed of 20 members. Previous studies indicate that plant CNGCs are involved in the control of growth processes and responses to abiotic and biotic stresses. According to their proposed function as cation entry pathways these channels contribute to cellular cation homeostasis, including calcium and sodium, as well as to stress-related signal transduction. Here, we studied the expression patterns and regulation of CNGC19 and CNGC20, which constitute one of the five CNGC subfamilies. GUS, GFP and luciferase reporter assays were used to study the expression of CNGC19 and CNGC20 genes from Arabidopsis thaliana in response to developmental cues and salt stress. CNGC19 and CNGC20 were differentially expressed in roots and shoots. The CNGC19 gene was predominantly active in roots already at early growth stages. Major expression was observed in the phloem. CNGC20 showed highest promoter activity in mesophyll cells surrounding the veins. Its expression increased during development and was maximal in mature and senescent leaves. Both genes were upregulated in the shoot in response to elevated NaCl but not mannitol concentrations. While in the root, CNGC19 did not respond to changes in the salt concentration, in the shoot it was strongly upregulated in the observed time frame (6-72 hours). Salt-induction of CNGC20 was also observed in the shoot, starting already one hour after stress treatment. It occurred with similar kinetics, irrespective of whether NaCl was applied to roots of intact plants or to the petiole of detached leaves. No differences in K and Na contents of the shoots were measured in homozygous T-DNA insertion lines for CNGC19 and CNGC20, respectively, which developed a growth phenotype in the presence of up to 75 mM NaCl similar to that of the wild type. Together, the results strongly suggest that both channels are involved in the salinity response of different cell types in

A new phylogeny-based tribal classification of subfamily Detarioideae, an early branching clade of florally diverse tropical arborescent legumes.

PubMed

de la Estrella, Manuel; Forest, Félix; Klitgård, Bente; Lewis, Gwilym P; Mackinder, Barbara A; de Queiroz, Luciano P; Wieringa, Jan J; Bruneau, Anne

2018-05-02

Detarioideae (81 genera, c. 760 species) is one of the six Leguminosae subfamilies recently reinstated by the Legume Phylogeny Working Group. This subfamily displays high morphological variability and is one of the early branching clades in the evolution of legumes. Using previously published and newly generated sequences from four loci (matK-trnK, rpL16, trnG-trnG2G and ITS), we develop a new densely sampled phylogeny to assess generic relationships and tribal delimitations within Detarioideae. The ITS phylogenetic trees are poorly resolved, but the plastid data recover several strongly supported clades, which also are supported in a concatenated plastid + ITS sequence analysis. We propose a new phylogeny-based tribal classification for Detarioideae that includes six tribes: re-circumscribed Detarieae and Amherstieae, and the four new tribes Afzelieae, Barnebydendreae, Saraceae and Schotieae. An identification key and descriptions for each of the tribes are also provided.

Mechanisms of transient receptor potential vanilloid 1 activation and sensitization by allyl isothiocyanate.

PubMed

Gees, Maarten; Alpizar, Yeranddy A; Boonen, Brett; Sanchez, Alicia; Everaerts, Wouter; Segal, Andrei; Xue, Fenqin; Janssens, Annelies; Owsianik, Grzegorz; Nilius, Bernd; Voets, Thomas; Talavera, Karel

2013-09-01

Allyl isothiocyanate (AITC; aka, mustard oil) is a powerful irritant produced by Brassica plants as a defensive trait against herbivores and confers pungency to mustard and wasabi. AITC is widely used experimentally as an inducer of acute pain and neurogenic inflammation, which are largely mediated by the activation of nociceptive cation channels transient receptor potential ankyrin 1 and transient receptor potential vanilloid 1 (TRPV1). Although it is generally accepted that electrophilic agents activate these channels through covalent modification of cytosolic cysteine residues, the mechanism underlying TRPV1 activation by AITC remains unknown. Here we show that, surprisingly, AITC-induced activation of TRPV1 does not require interaction with cysteine residues, but is largely dependent on S513, a residue that is involved in capsaicin binding. Furthermore, AITC acts in a membrane-delimited manner and induces a shift of the voltage dependence of activation toward negative voltages, which is reminiscent of capsaicin effects. These data indicate that AITC acts through reversible interactions with the capsaicin binding site. In addition, we show that TRPV1 is a locus for cross-sensitization between AITC and acidosis in nociceptive neurons. Furthermore, we show that residue F660, which is known to determine the stimulation by low pH in human TRPV1, is also essential for the cross-sensitization of the effects of AITC and low pH. Taken together, these findings demonstrate that not all reactive electrophiles stimulate TRPV1 via cysteine modification and help understanding the molecular bases underlying the surprisingly large role of this channel as mediator of the algesic properties of AITC.

The Crystal Structure of Streptococcus pyogenes Uridine Phosphorylase Reveals a Distinct Subfamily of Nucleoside Phosphorylases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tran, Timothy H.; Christoffersen, S.; Allan, Paula W.

2011-09-20

Uridine phosphorylase (UP), a key enzyme in the pyrimidine salvage pathway, catalyzes the reversible phosphorolysis of uridine or 2'-deoxyuridine to uracil and ribose 1-phosphate or 2'-deoxyribose 1-phosphate. This enzyme belongs to the nucleoside phosphorylase I superfamily whose members show diverse specificity for nucleoside substrates. Phylogenetic analysis shows Streptococcus pyogenes uridine phosphorylase (SpUP) is found in a distinct branch of the pyrimidine subfamily of nucleoside phosphorylases. To further characterize SpUP, we determined the crystal structure in complex with the products, ribose 1-phosphate and uracil, at 1.8 {angstrom} resolution. Like Escherichia coli UP (EcUP), the biological unit of SpUP is a hexamermore » with an ?/? monomeric fold. A novel feature of the active site is the presence of His169, which structurally aligns with Arg168 of the EcUP structure. A second active site residue, Lys162, is not present in previously determined UP structures and interacts with O2 of uracil. Biochemical studies of wild-type SpUP showed that its substrate specificity is similar to that of EcUP, while EcUP is {approx}7-fold more efficient than SpUP. Biochemical studies of SpUP mutants showed that mutations of His169 reduced activity, while mutation of Lys162 abolished all activity, suggesting that the negative charge in the transition state resides mostly on uracil O2. This is in contrast to EcUP for which transition state stabilization occurs mostly at O4.« less

A consistent nomenclature of antimicrobial peptides isolated from frogs of the subfamily Phyllomedusinae.

PubMed

Amiche, Mohamed; Ladram, Ali; Nicolas, Pierre

2008-11-01

A growing number of cationic antimicrobial peptides have been isolated from the skin of hylid frogs belonging to the Phyllomedusinae subfamily. The amino acid sequences of these peptides are currently located in several databases under identifiers with no consistent system of nomenclature to describe them. In order to provide a workable terminology for antimicrobial peptides from Phyllomedusid frogs, we have made a systematic effort to collect, analyze, and classify all the Phyllomedusid peptide sequences available in databases. We propose that frogs belonging to the Phyllomedusinae subfamily should be described by the species names set out in Amphibian Species of the World: http://research.amnh.org/herpetology/amphibia/index.php, American Museum of Natural History, New York, USA. Multiple alignments analysis of at least 80 antimicrobial peptides isolated from 12 Phyllomedusinae species were distributed in seven distinct peptide families including dermaseptin, phylloseptin, plasticin, dermatoxin, phylloxin, hyposin and orphan peptides, and will be considered as the name of the headgroup of each family. The parent peptide's name should be followed by the first upper letter of the species for orthologous peptides and publication date determines priority. For example, the abbreviation B for bicolor and H for hypochondrialis. When two species begin with the same letter, two letters in upper case should be used (the first letter followed by the second or the third letter and so on). For example, the abbreviation DI for distincta, DU for duellmani, VA for vaillanti and VN for vanzolinii. Paralogous peptides should bear letter(s) in upper case followed by numbers.

The X-ray Crystallographic Structure and Activity Analysis of a Pseudomonas-Specific Subfamily of the HAD Enzyme Superfamily Evidences a Novel Biochemical Function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peisach,E.; Wang, L.; Burroughs, A.

2008-01-01

The haloacid dehalogenase (HAD) superfamily is a large family of proteins dominated by phosphotransferases. Thirty-three sequence families within the HAD superfamily (HADSF) have been identified to assist in function assignment. One such family includes the enzyme phosphoacetaldehyde hydrolase (phosphonatase). Phosphonatase possesses the conserved Rossmanniod core domain and a C1-type cap domain. Other members of this family do not possess a cap domain and because the cap domain of phosphonatase plays an important role in active site desolvation and catalysis, the function of the capless family members must be unique. A representative of the capless subfamily, PSPTO{_}2114, from the plant pathogenmore » Pseudomonas syringae, was targeted for catalytic activity and structure analyses. The X-ray structure of PSPTO{_}2114 reveals a capless homodimer that conserves some but not all of the intersubunit contacts contributed by the core domains of the phosphonatase homodimer. The region of the PSPTO{_}2114 that corresponds to the catalytic scaffold of phosphonatase (and other HAD phosphotransfereases) positions amino acid residues that are ill suited for Mg+2 cofactor binding and mediation of phosphoryl group transfer between donor and acceptor substrates. The absence of phosphotransferase activity in PSPTO{_}2114 was confirmed by kinetic assays. To explore PSPTO{_}2114 function, the conservation of sequence motifs extending outside of the HADSF catalytic scaffold was examined. The stringently conserved residues among PSPTO{_}2114 homologs were mapped onto the PSPTO{_}2114 three-dimensional structure to identify a surface region unique to the family members that do not possess a cap domain. The hypothesis that this region is used in protein-protein recognition is explored to define, for the first time, HADSF proteins which have acquired a function other than that of a catalyst. Proteins 2008.« less

Activation of transient receptor potential vanilloid-1 (TRPV1) influences how retinal ganglion cell neurons respond to pressure-related stress

PubMed Central

Sappington, Rebecca M; Sidorova, Tatiana; Ward, Nicholas J; Chakravarthy, Rohini; Ho, Karen W; Calkins, David J

2015-01-01

Our recent studies implicate the transient receptor potential vanilloid-1 (TRPV1) channel as a mediator of retinal ganglion cell (RGC) function and survival. With elevated pressure in the eye, TRPV1 increases in RGCs, supporting enhanced excitability, while Trpv1 -/- accelerates RGC degeneration in mice. Here we find TRPV1 localized in monkey and human RGCs, similar to rodents. Expression increases in RGCs exposed to acute changes in pressure. In retinal explants, contrary to our animal studies, both Trpv1 -/- and pharmacological antagonism of the channel prevented pressure-induced RGC apoptosis, as did chelation of extracellular Ca2+. Finally, while TRPV1 and TRPV4 co-localize in some RGC bodies and form a protein complex in the retina, expression of their mRNA is inversely related with increasing ocular pressure. We propose that TRPV1 activation by pressure-related insult in the eye initiates changes in expression that contribute to a Ca2+-dependent adaptive response to maintain excitatory signaling in RGCs. PMID:25713995

Analgesia and Opioids: A Pharmacogenetics Shortlist for Implementation in Clinical Practice.

PubMed

Matic, Maja; de Wildt, Saskia N; Tibboel, Dick; van Schaik, Ron H N

2017-07-01

The use of opioids to alleviate pain is complicated by the risk of severe adverse events and the large variability in dose requirements. Pharmacogenetics (PGx) could possibly be used to tailor pain medication based on an individual's genetic background. Many potential genetic markers have been described, and the importance of genetic predisposition in opioid efficacy and toxicity has been demonstrated in knockout mouse models and human twin studies. Such predictors are especially of value for neonates and young children, in whom the assessment of efficacy or side effects is complicated by the inability of the patient to communicate this properly. The current problem is determining which of the many potential candidates to focus on for clinical implementation. We systematically searched publications on PGx for opioids in 5 databases, aiming to identify PGx markers with sufficient robust data and high enough occurrence for potential clinical application. The initial search yielded 4257 unique citations, eventually resulting in 852 relevant articles covering 24 genes. From these genes, we evaluated the evidence and selected the most promising 10 markers: cytochrome P450 family 2 subfamily D member 6 ( CYP2D6 ), cytochrome P450 family 3 subfamily A member 4 ( CYP3A4 ), cytochrome P450 family 3 subfamily A member 5 ( CYP3A5 ), UDP glucuronosyltransferase family 2 member B7 ( UGT2B7 ), ATP binding cassette subfamily B member 1 ( ABCB1 ), ATP binding cassette subfamily C member 3 ( ABCC3 ), solute carrier family 22 member 1 ( SLC22A1 ), opioid receptor kappa 1 ( OPRM1 ), catechol- O -methyltransferase ( COMT ), and potassium voltage-gated channel subfamily J member 6 ( KCNJ6 ). Treatment guidelines based on genotype are already available only for CYP2D6 . The application of PGx in the management of pain with opioids has the potential to improve therapy. We provide a shortlist of 10 genes that are the most promising markers for clinical use in this context. © 2016

Targeting the Transient Receptor Potential Vanilloid Type 1 (TRPV1) Assembly Domain Attenuates Inflammation-induced Hypersensitivity*

PubMed Central

Flynn, Robyn; Chapman, Kevin; Iftinca, Mircea; Aboushousha, Reem; Varela, Diego; Altier, Christophe

2014-01-01

The transient receptor potential channel vanilloid type 1 (TRPV1) is a non-selective cation channel expressed in sensory neurons of the dorsal root and trigeminal ganglia. TRPV1 is a polymodal channel activated by noxious heat, capsaicin, and protons. As a sensor for noxious stimuli, TRPV1 channel has been described as a key contributor to pain signaling. To form a functional channel, TRPV1 subunits must assemble into tetramers, and several studies have identified the TRPV1 C terminus as an essential element in subunit association. Here we combined biochemical assays with electrophysiology and imaging-based bimolecular fluorescence complementation (BiFC) and bioluminescence resonance energy transfer (BRET) in live cells to identify a short motif in the C-terminal tail of the TRPV1 subunit that governs channel assembly. Removing this region through early truncation or targeted deletion results in loss of subunit association and channel function. Importantly, we found that interfering with TRPV1 subunit association using a plasma membrane-tethered peptide attenuated mechanical and thermal hypersensitivity in two mouse models of inflammatory hyperalgesia. This represents a novel mechanism to disrupt TRPV1 subunit assembly and hence may offer a new analgesic tool for pain relief. PMID:24808184

Expression and diagnosis of transient receptor potential vanilloid1 in urothelium of patients with overactive bladder.

PubMed

Zhang, H Y; Chu, J F; Li, P; Li, N; Lv, Z H

2015-01-01

This study was carried out to test expression of transient receptor potential vanilloid1 (TRPV1) in urothelium of female patients with overactive bladder (OAB) and explore clinical significance of TRPV1 in diagnosing female OAB. TRPV1 expression in urothelium of female OAB patients (n=21) and healthy females (n=9) was detected using Strept Avidin-Biotin Complex (SABC), an immunohistochemical method and image analysis system. Relative content of TRPV1 was expressed by average optical density (AOD) and was analyzed through data of urodynamics. Compared to TRPV1 expression in urothelium of healthy females (AOD 0.3658 ± 0.1009), TRPV1 expression in OAB patients was much higher (AOD 0.4834 ± 0.1252) and the difference was significant P less than 0.05. Observation and comparison in clinic of urodynamic parameters of female patients and healthy females revealed that the former had lower indexes with remarkable differences (P less than 0.05) such as Qmax, first desire volume (FDV), strong desire volume (SDV), maximum cyst capacity (MCC) and bladder compliance (BC). Thus high expression of TRPV1 in urothelium of female OAB patients is closely correlated to OAB occurrence, showing great importance of improved bladder sensitivity in female OAB occurrence mechanism.

Targeting the transient receptor potential vanilloid type 1 (TRPV1) assembly domain attenuates inflammation-induced hypersensitivity.

PubMed

Flynn, Robyn; Chapman, Kevin; Iftinca, Mircea; Aboushousha, Reem; Varela, Diego; Altier, Christophe

2014-06-13

The transient receptor potential channel vanilloid type 1 (TRPV1) is a non-selective cation channel expressed in sensory neurons of the dorsal root and trigeminal ganglia. TRPV1 is a polymodal channel activated by noxious heat, capsaicin, and protons. As a sensor for noxious stimuli, TRPV1 channel has been described as a key contributor to pain signaling. To form a functional channel, TRPV1 subunits must assemble into tetramers, and several studies have identified the TRPV1 C terminus as an essential element in subunit association. Here we combined biochemical assays with electrophysiology and imaging-based bimolecular fluorescence complementation (BiFC) and bioluminescence resonance energy transfer (BRET) in live cells to identify a short motif in the C-terminal tail of the TRPV1 subunit that governs channel assembly. Removing this region through early truncation or targeted deletion results in loss of subunit association and channel function. Importantly, we found that interfering with TRPV1 subunit association using a plasma membrane-tethered peptide attenuated mechanical and thermal hypersensitivity in two mouse models of inflammatory hyperalgesia. This represents a novel mechanism to disrupt TRPV1 subunit assembly and hence may offer a new analgesic tool for pain relief. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Targeting Transient Receptor Potential Vanilloid 1 (TRPV1) Channel Softly: The Discovery of Passerini Adducts as a Topical Treatment for Inflammatory Skin Disorders.

PubMed

Serafini, Marta; Griglio, Alessia; Aprile, Silvio; Seiti, Fabio; Travelli, Cristina; Pattarino, Franco; Grosa, Giorgio; Sorba, Giovanni; Genazzani, Armando A; Gonzalez-Rodriguez, Sara; Butron, Laura; Devesa, Isabel; Fernandez-Carvajal, Asia; Pirali, Tracey; Ferrer-Montiel, Antonio

2018-05-24

Despite being an old molecule, capsaicin is still a hot topic in the scientific community, and the development of new capsaicinoids is a promising pharmacological approach in the management of skin disorders related to inflammation and pruritus. Here we report the synthesis and the evaluation of capsaicin soft drugs that undergo deactivation by the hydrolyzing activity of skin esterases. The implanting of an ester group in the lipophilic moiety of capsaicinoids by the Passerini multicomponent reaction affords both agonists and antagonists that retain transient receptor potential vanilloid 1 channel (TRPV1) modulating activity and, at the same time, are susceptible to hydrolysis. The most promising antagonist identified shows in vivo anti-nociceptive activity on pruritus and hyperalgesia without producing hyperthermia, thus validating it as novel treatment for dermatological conditions that implicate TRPV1 channel dysfunction.

The Transient Receptor Potential Vanilloid 1 Antagonist Capsazepine Improves the Impaired Lung Mechanics during Endotoxemia.

PubMed

Cabral, Layla D M; Giusti-Paiva, Alexandre

2016-11-01

Acute lung injury (ALI) caused by systemic inflammatory response remains a leading cause of morbidity and mortality in critically ill patients. Management of patients with sepsis is largely limited to supportive therapies, reflecting an incomplete understanding of the underlying pathophysiology. Furthermore, there have been limited advances in the treatments for ALI. In this study, lung function and a histological analysis were performed to evaluate the impact of transient receptor potential vanilloid-1 receptor (TRPV1) antagonist (capsazepine; CPZ) on the lipopolysaccharide (LPS)-induced lung injury in mice. For this, adult mice pre-treated with CPZ or vehicle received intraperitoneal injections of LPS or saline and 24 hr after, the mice were anaesthetized, and lung mechanics was evaluated. The LPS-challenged mice exhibited substantial mechanical impairment, characterized by increases in respiratory system resistance, respiratory system elastance, tissue damping and tissue elastance. The pre-treatment with CPZ prevented the increase in respiratory system resistance and decreased the increase in tissue damping during endotoxemia. In addition, mice pre-treated with CPZ had an attenuated lung injury evidenced by reduction on collapsed area of the lung parenchyma induced by LPS. This suggests that the TRPV1 antagonist capsazepine has a protective effect on lung mechanics in ALI during endotoxemia and that it may be a target for enhanced therapeutic efficacy in ALI. © 2016 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).

Alu Sb2 subfamily is present in all higher primates but was most succesfully amplified in humans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richer, C.; Zietkiewicz, E.; Labuda, D.

Alu repeats can be classified into subfamilies which amplified in primate genomes at different evolutionary time periods. A young Alu subfamily, Sb2, with a characteristic 7-nucleotide duplication at position 256, has been described in seven human loci. An Sb2 insertion found near the HD gene was unique to two HD families, indicating that Sb2 was still retropositionally active. Here, we have shown that the Sb2 insertion in the CHOL locus was similarly rare, being absent in 120 individuals of Caucasian, Oriental and Black origin. In contrast, Sb2 inserts in five other loci were found fixed (non-polymorphic), based on measurements inmore » the same population sample, but absent from orthologous positions in higher apes. This suggest that Sb2 repeats spread relatively early in the human lineage following divergence from other primates and that these elements may be human-specific. By quantitative PCR, we investigated the presence of Sb2 sequences in different primate DNA, using one PCR primer anchored at the 5{prime} Alu-end and the other complementary to the duplicated Sb2-specific segment. With an Sb2-containing plasmid as a standard, we estimated the number of Sb2 repeats at 1500-1800 copies per human haploid equivalent; corresponding numbers in chimpanzee and gorilla were almost two orders of magnitude lower, while the signal observed in orangutan and gibbon DNAs was consistent with the presence of a single copy. The analysis of 22 human, 11 chimpanzee and 10 gorilla sequences indicates that the Alu Sb2 dispersed independently in these three primate lineages; gorilla consensus differs from the human Sb2 sequence by one position, while all chimpanzee repeats have their linker expanded by up to eight A-residues. Should they be thus considered as separate subfamilies? It is possible that sequence modifications with respect to the human consensus are responsible for poor retroposition of Sb2 in apes.« less

Structural Determinants of Substrate Recognition in the HAD Superfamily Member D-glycero-D-manno-Heptose-1,7-bisphosphate Phosphatase (GmhB)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, H.; Wang, L; Huang, H

2010-01-01

The haloalkanoic acid dehalogenase (HAD) enzyme superfamily is the largest family of phosphohydrolases. In HAD members, the structural elements that provide the binding interactions that support substrate specificity are separated from those that orchestrate catalysis. For most HAD phosphatases, a cap domain functions in substrate recognition. However, for the HAD phosphatases that lack a cap domain, an alternate strategy for substrate selection must be operative. One such HAD phosphatase, GmhB of the HisB subfamily, was selected for structure-function analysis. Herein, the X-ray crystallographic structures of Escherichia coli GmhB in the apo form (1.6 {angstrom} resolution), in a complex with Mg{supmore » 2+} and orthophosphate (1.8 {angstrom} resolution), and in a complex with Mg{sup 2+} and D-glycero-D-manno-heptose 1{beta},7-bisphosphate (2.2 {angstrom} resolution) were determined, in addition to the structure of Bordetella bronchiseptica GmhB bound to Mg{sup 2+} and orthophosphate (1.7 {angstrom} resolution). The structures show that in place of a cap domain, the GmhB catalytic site is elaborated by three peptide inserts or loops that pack to form a concave, semicircular surface around the substrate leaving group. Structure-guided kinetic analysis of site-directed mutants was conducted in parallel with a bioinformatics study of sequence diversification within the HisB subfamily to identify loop residues that serve as substrate recognition elements and that distinguish GmhB from its subfamily counterpart, the histidinol-phosphate phosphatase domain of HisB. We show that GmhB and the histidinol-phosphate phosphatase domain use the same design of three substrate recognition loops inserted into the cap domain yet, through selective residue usage on the loops, have achieved unique substrate specificity and thus novel biochemical function.« less

Characterization of the starch-acting MaAmyB enzyme from Microbacterium aurum B8.A representing the novel subfamily GH13_42 with an unusual, multi-domain organization

PubMed Central

Valk, Vincent; van der Kaaij, Rachel M.; Dijkhuizen, Lubbert

2016-01-01

The bacterium Microbacterium aurum strain B8.A degrades granular starches, using the multi-domain MaAmyA α-amylase to initiate granule degradation through pore formation. This paper reports the characterization of the M. aurum B8.A MaAmyB enzyme, a second starch-acting enzyme with multiple FNIII and CBM25 domains. MaAmyB was characterized as an α-glucan 1,4-α-maltohexaosidase with the ability to subsequently hydrolyze maltohexaose to maltose through the release of glucose. MaAmyB also displays exo-activity with a double blocked PNPG7 substrate, releasing PNP. In M. aurum B8.A, MaAmyB may contribute to degradation of starch granules by rapidly hydrolyzing the helical and linear starch chains that become exposed after pore formation by MaAmyA. Bioinformatics analysis showed that MaAmyB represents a novel GH13 subfamily, designated GH13_42, currently with 165 members, all in Gram-positive soil dwelling bacteria, mostly Streptomyces. All members have an unusually large catalytic domain (AB-regions), due to three insertions compared to established α-amylases, and an aberrant C-region, which has only 30% identity to established GH13 C-regions. Most GH13_42 members have three N-terminal domains (2 CBM25 and 1 FNIII). This is unusual as starch binding domains are commonly found at the C-termini of α-amylases. The evolution of the multi-domain M. aurum B8.A MaAmyA and MaAmyB enzymes is discussed. PMID:27808246

On the value of nuclear and mitochondrial gene sequences for reconstructing the phylogeny of vanilloid orchids (Vanilloideae, Orchidaceae)

PubMed Central

Cameron, Kenneth M.

2009-01-01

Background and Aims Most molecular phylogenetic studies of Orchidaceae have relied heavily on DNA sequences from the plastid genome. Nuclear and mitochondrial loci have only been superficially examined for their systematic value. Since 40% of the genera within Vanilloideae are achlorophyllous mycoheterotrophs, this is an ideal group of orchids in which to evaluate non-plastid gene sequences. Methods Phylogenetic reconstructions for Vanilloideae were produced using independent and combined data from the nuclear 18S, 5·8S and 26S rDNA genes and the mitochondrial atpA gene and nad1b-c intron. Key Results These new data indicate placements for genera such as Lecanorchis and Galeola, for which plastid gene sequences have been mostly unavailable. Nuclear and mitochondrial parsimony jackknife trees are congruent with each other and previously published trees based solely on plastid data. Because of high rates of sequence divergence among vanilloid orchids, even the short 5·8S rDNA gene provides impressive levels of resolution and support. Conclusions Orchid systematists are encouraged to sequence nuclear and mitochondrial gene regions along with the growing number of plastid loci available. PMID:19251715

Molecular Cloning and Functional Characterization of Xenopus tropicalis Frog Transient Receptor Potential Vanilloid 1 Reveal Its Functional Evolution for Heat, Acid, and Capsaicin Sensitivities in Terrestrial Vertebrates*

PubMed Central

Ohkita, Masashi; Saito, Shigeru; Imagawa, Toshiaki; Takahashi, Kenji; Tominaga, Makoto; Ohta, Toshio

2012-01-01

The functional difference of thermosensitive transient receptor potential (TRP) channels in the evolutionary context has attracted attention, but thus far little information is available on the TRP vanilloid 1 (TRPV1) function of amphibians, which diverged earliest from terrestrial vertebrate lineages. In this study we cloned Xenopus tropicalis frog TRPV1 (xtTRPV1), and functional characterization was performed using HeLa cells heterologously expressing xtTRPV1 (xtTRPV1-HeLa) and dorsal root ganglion neurons isolated from X. tropicalis (xtDRG neurons) by measuring changes in the intracellular calcium concentration ([Ca2+]i). The channel activity was also observed in xtTRPV1-expressing Xenopus oocytes. Furthermore, we tested capsaicin- and heat-induced nocifensive behaviors of the frog X. tropicalis in vivo. At the amino acid level, xtTRPV1 displays ∼60% sequence identity to other terrestrial vertebrate TRPV1 orthologues. Capsaicin induced [Ca2+]i increases in xtTRPV1-HeLa and xtDRG neurons and evoked nocifensive behavior in X. tropicalis. However, its sensitivity was extremely low compared with mammalian orthologues. Low extracellular pH and heat activated xtTRPV1-HeLa and xtDRG neurons. Heat also evoked nocifensive behavior. In oocytes expressing xtTRPV1, inward currents were elicited by heat and low extracellular pH. Mutagenesis analysis revealed that two amino acids (tyrosine 523 and alanine 561) were responsible for the low sensitivity to capsaicin. Taken together, our results indicate that xtTRPV1 functions as a polymodal receptor similar to its mammalian orthologues. The present study demonstrates that TRPV1 functions as a heat- and acid-sensitive channel in the ancestor of terrestrial vertebrates. Because it is possible to examine vanilloid and heat sensitivities in vitro and in vivo, X. tropicalis could be the ideal experimental lower vertebrate animal for the study of TRPV1 function. PMID:22130664

Molecular and enzymatic characterization of a subfamily I.4 lipase from an edible oil-degrader Bacillus sp. HH-01.

PubMed

Kamijo, Takashi; Saito, Akihiro; Ema, Sadaharu; Yoh, Inchi; Hayashi, Hiroko; Nagata, Ryo; Nagata, Yoshiho; Ando, Akikazu

2011-02-01

An edible-oil degrading bacterial strain HH-01 was isolated from oil plant gummy matter and was classified as a member of the genus Bacillus on the basis of the nucleotide sequence of the 16S rRNA gene. A putative lipase gene and its flanking regions were cloned from the strain based on its similarity to lipase genes from other Bacillus spp. The deduced product was composed of 214 amino acids and the putative mature protein, consisting of 182 amino acids, exhibited 82% amino acid sequence identity with the subfamily I.4 lipase LipA of Bacillus subtilis 168. The recombinant product was successfully overproduced as a soluble form in Escherichia coli and showed lipase activity. The gene was, therefore, designated as lipA of HH-01. HH-01 LipA was stable at pH 4-11 and up to 30°C, and its optimum pH and temperature were 8-9 and 30°C, respectively. The enzyme showed preferential hydrolysis of the 1(3)-position ester bond in trilinolein. The activity was, interestingly, enhanced by supplementing with 1 mM CoCl(2), in contrast to other Bacillus lipases. The lipA gene seemed to be constitutively transcribed during the exponential growth phase, regardless of the presence of edible oil.

Sensing of blood pressure increase by transient receptor potential vanilloid 1 receptors on baroreceptors.

PubMed

Sun, Hao; Li, De-Pei; Chen, Shao-Rui; Hittelman, Walter N; Pan, Hui-Lin

2009-12-01

The arterial baroreceptor is critically involved in the autonomic regulation of homoeostasis. The transient receptor potential vanilloid 1 (TRPV1) receptor is expressed on both somatic and visceral sensory neurons. Here, we examined the TRPV1 innervation of baroreceptive pathways and its functional significance in the baroreflex. Resiniferatoxin (RTX), an ultrapotent analog of capsaicin, was used to ablate TRPV1-expressing afferent neurons and fibers in adult rats. Immunofluorescence labeling revealed that TRPV1 immunoreactivity was present on nerve fibers and terminals in the adventitia of the ascending aorta and aortic arch, the nodose ganglion neurons, and afferent fibers in the solitary tract of the brainstem. RTX treatment eliminated TRPV1 immunoreactivities in the aorta, nodose ganglion, and solitary tract. Renal sympathetic nerve activity, blood pressure, and heart rate were recorded in anesthetized rats. The baroreflex was triggered by lowering and raising blood pressure through intravenous infusion of sodium nitroprusside and phenylephrine, respectively. Inhibition of sympathetic nerve activity and heart rate by the phenylephrine-induced increase in blood pressure was largely impaired in RTX-treated rats. The maximum gain of the baroreflex function was significantly lower in RTX-treated than vehicle-treated rats. Furthermore, blocking of TRPV1 receptors significantly blunted the baroreflex and decreased the maximum gain of baroreflex function in the high blood pressure range. Our findings provide important new information that TRPV1 is expressed along the entire baroreceptive afferent pathway. TRPV1 receptors expressed on baroreceptive nerve endings can function as mechanoreceptors to detect the increase in blood pressure and maintain the homoeostasis.

Sensing of Blood Pressure Increase by Transient Receptor Potential Vanilloid 1 Receptors on Baroreceptors

PubMed Central

Sun, Hao; Li, De-Pei; Chen, Shao-Rui; Hittelman, Walter N.

2009-01-01

The arterial baroreceptor is critically involved in the autonomic regulation of homoeostasis. The transient receptor potential vanilloid 1 (TRPV1) receptor is expressed on both somatic and visceral sensory neurons. Here, we examined the TRPV1 innervation of baroreceptive pathways and its functional significance in the baroreflex. Resiniferatoxin (RTX), an ultrapotent analog of capsaicin, was used to ablate TRPV1-expressing afferent neurons and fibers in adult rats. Immunofluorescence labeling revealed that TRPV1 immunoreactivity was present on nerve fibers and terminals in the adventitia of the ascending aorta and aortic arch, the nodose ganglion neurons, and afferent fibers in the solitary tract of the brainstem. RTX treatment eliminated TRPV1 immunoreactivities in the aorta, nodose ganglion, and solitary tract. Renal sympathetic nerve activity, blood pressure, and heart rate were recorded in anesthetized rats. The baroreflex was triggered by lowering and raising blood pressure through intravenous infusion of sodium nitroprusside and phenylephrine, respectively. Inhibition of sympathetic nerve activity and heart rate by the phenylephrine-induced increase in blood pressure was largely impaired in RTX-treated rats. The maximum gain of the baroreflex function was significantly lower in RTX-treated than vehicle-treated rats. Furthermore, blocking of TRPV1 receptors significantly blunted the baroreflex and decreased the maximum gain of baroreflex function in the high blood pressure range. Our findings provide important new information that TRPV1 is expressed along the entire baroreceptive afferent pathway. TRPV1 receptors expressed on baroreceptive nerve endings can function as mechanoreceptors to detect the increase in blood pressure and maintain the homoeostasis. PMID:19726694

Genome-wide characterization of the β-1,3-glucanase gene family in Gossypium by comparative analysis

PubMed Central

Xu, Xiaoyang; Feng, Yue; Fang, Shuai; Xu, Jun; Wang, Xinyu; Guo, Wangzhen

2016-01-01

The β-1,3-glucanase gene family is involved in a wide range of plant developmental processes as well as pathogen defense mechanisms. Comprehensive analyses of β-1,3-glucanase genes (GLUs) have not been reported in cotton. Here, we identified 67, 68, 130 and 158 GLUs in four sequenced cotton species, G. raimondii (D5), G. arboreum (A2), G. hirsutum acc. TM-1 (AD1), and G. barbadense acc. 3–79 (AD2), respectively. Cotton GLUs can be classified into the eight subfamilies (A–H), and their protein domain architecture and intron/exon structure are relatively conserved within each subfamily. Sixty-seven GLUs in G. raimondii were anchored onto 13 chromosomes, with 27 genes involved in segmental duplications, and 13 in tandem duplications. Expression patterns showed highly developmental and spatial regulation of GLUs in TM-1. In particular, the expression of individual member of GLUs in subfamily E was limited to roots, leaves, floral organs or fibers. Members of subfamily E also showed more protein evolution and subgenome expression bias compared with members of other subfamilies. We clarified that GLU42 and GLU43 in subfamily E were preferentially expressed in root and leaf tissues and significantly upregulated after Verticillium dahliae inoculation. Silencing of GLU42 and GLU43 significantly increased the susceptibility of cotton to V. dahliae. PMID:27353015

Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).

PubMed

Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W

2015-12-29

GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.

The role of transient receptor potential vanilloid type-2 ion channels in innate and adaptive immune responses

PubMed Central

Santoni, Giorgio; Farfariello, Valerio; Liberati, Sonia; Morelli, Maria B.; Nabissi, Massimo; Santoni, Matteo; Amantini, Consuelo

2013-01-01

The transient receptor potential vanilloid type-2 (TRPV2), belonging to the transient receptor potential channel family, is a specialized ion channel expressed in human and other mammalian immune cells. This channel has been found to be expressed in CD34+ hematopoietic stem cells, where its cytosolic Ca2+ activity is crucial for stem/progenitor cell cycle progression, growth, and differentiation. In innate immune cells, TRPV2 is expressed in granulocytes, macrophages, and monocytes where it stimulates fMet-Leu-Phe migration, zymosan-, immunoglobulin G-, and complement-mediated phagocytosis, and lipopolysaccharide-induced tumor necrosis factor-alpha and interleukin-6 production. In mast cells, activation of TRPV2 allows intracellular Ca2+ ions flux, thus stimulating protein kinase A-dependent degranulation. In addition, TRPV2 is highly expressed in CD56+ natural killer cells. TRPV2 orchestrates Ca2+ signal in T cell activation, proliferation, and effector functions. Moreover, messenger RNA for TRPV2 are expressed in CD4+ and CD8+ T lymphocytes. Finally, TRPV2 is expressed in CD19+ B lymphocytes where it regulates Ca2+ release during B cell development and activation. Overall, the specific expression of TRPV2 in immune cells suggests a role in immune-mediated diseases and offers new potential targets for immunomodulation. PMID:23420671

Key biosynthetic gene subfamily recruited for pheromone production prior to the extensive radiation of Lepidoptera

PubMed Central

2008-01-01

Background Moths have evolved highly successful mating systems, relying on species-specific mixtures of sex pheromone components for long-distance mate communication. Acyl-CoA desaturases are key enzymes in the biosynthesis of these compounds and to a large extent they account for the great diversity of pheromone structures in Lepidoptera. A novel desaturase gene subfamily that displays Δ11 catalytic activities has been highlighted to account for most of the unique pheromone signatures of the taxonomically advanced ditrysian species. To assess the mechanisms driving pheromone evolution, information is needed about the signalling machinery of primitive moths. The currant shoot borer, Lampronia capitella, is the sole reported primitive non-ditrysian moth known to use unsaturated fatty-acid derivatives as sex-pheromone. By combining biochemical and molecular approaches we elucidated the biosynthesis paths of its main pheromone component, the (Z,Z)-9,11-tetradecadien-1-ol and bring new insights into the time point of the recruitment of the key Δ11-desaturase gene subfamily in moth pheromone biosynthesis. Results The reconstructed evolutionary tree of desaturases evidenced two ditrysian-specific lineages (the Δ11 and Δ9 (18C>16C)) to have orthologs in the primitive moth L. capitella despite being absent in Diptera and other insect genomes. Four acyl-CoA desaturase cDNAs were isolated from the pheromone gland, three of which are related to Δ9-desaturases whereas the fourth cDNA clusters with Δ11-desaturases. We demonstrated that this transcript (Lca-KPVQ) exclusively accounts for both steps of desaturation involved in pheromone biosynthesis. This enzyme possesses a Z11-desaturase activity that allows transforming the palmitate precursor (C16:0) into (Z)-11-hexadecenoic acid and the (Z)-9-tetradecenoic acid into the conjugated intermediate (Z,Z)-9,11-tetradecadienoic acid. Conclusion The involvement of a single Z11-desaturase in pheromone biosynthesis of a non

Ontogenetic expression of the vanilloid receptors TRPV1 and TRPV2 in the rat retina.

PubMed

Leonelli, Mauro; Martins, Daniel O; Kihara, Alexandre H; Britto, Luiz R G

2009-11-01

The present study aimed to analyze the gene and protein expression and the pattern of distribution of the vanilloid receptors TRPV1 and TRPV2 in the developing rat retina. During the early phases of development, TRPV1 was found mainly in the neuroblastic layer of the retina and in the pigmented epithelium. In the adult, TRPV1 was found in microglial cells, blood vessels, astrocytes and in neuronal structures, namely synaptic boutons of both retinal plexiform layers, as well as in cell bodies of the inner nuclear layer and the ganglion cell layer. The pattern of distribution of TRPV1 was mainly punctate, and there was higher TRPV1 labeling in the peripheral retina than in central regions. TRPV2 expression was quite distinct. Its expression was virtually undetectable by immunoblotting before P1, and that receptor was found by immunohistochemistry only by postnatal day 15 (P15). RNA and protein analysis showed that the adult levels are only reached by P60, which includes small processes in the retinal plexiform layers, and labeled cellular bodies in the inner nuclear layer and the ganglion cell layer. There was no overlapping between the signal observed for both receptors. In conclusion, our results showed that the patterns of distribution of TRPV1 and TRPV2 are different during the development of the rat retina, suggesting that they have specific roles in both visual processing and in providing specific cues to neural development.

Pharmacology of modality-specific transient receptor potential vanilloid-1 antagonists that do not alter body temperature.

PubMed

Reilly, Regina M; McDonald, Heath A; Puttfarcken, Pamela S; Joshi, Shailen K; Lewis, LaGeisha; Pai, Madhavi; Franklin, Pamela H; Segreti, Jason A; Neelands, Torben R; Han, Ping; Chen, Jun; Mantyh, Patrick W; Ghilardi, Joseph R; Turner, Teresa M; Voight, Eric A; Daanen, Jerome F; Schmidt, Robert G; Gomtsyan, Arthur; Kort, Michael E; Faltynek, Connie R; Kym, Philip R

2012-08-01

The transient receptor potential vanilloid-1 (TRPV1) channel is involved in the development and maintenance of pain and participates in the regulation of temperature. The channel is activated by diverse agents, including capsaicin, noxious heat (≥ 43°C), acidic pH (< 6), and endogenous lipids including N-arachidonoyl dopamine (NADA). Antagonists that block all modes of TRPV1 activation elicit hyperthermia. To identify efficacious TRPV1 antagonists that do not affect temperature antagonists representing multiple TRPV1 pharmacophores were evaluated at recombinant rat and human TRPV1 channels with Ca(2+) flux assays, and two classes of antagonists were identified based on their differential ability to inhibit acid activation. Although both classes of antagonists completely blocked capsaicin- and NADA-induced activation of TRPV1, select compounds only partially inhibited activation of the channel by protons. Electrophysiology and calcitonin gene-related peptide release studies confirmed the differential pharmacology of these antagonists at native TRPV1 channels in the rat. Comparison of the in vitro pharmacological properties of these TRPV1 antagonists with their in vivo effects on core body temperature confirms and expands earlier observations that acid-sparing TRPV1 antagonists do not significantly increase core body temperature. Although both classes of compounds elicit equivalent analgesia in a rat model of knee joint pain, the acid-sparing antagonist tested is not effective in a mouse model of bone cancer pain.

AOX1-Subfamily Gene Members in Olea europaea cv. “Galega Vulgar”—Gene Characterization and Expression of Transcripts during IBA-Induced in Vitro Adventitious Rooting

PubMed Central

Lousa, Diana; M. Soares, Cláudio; Santos Macedo, Elisete; Arnholdt-Schmitt, Birgit

2018-01-01

Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar ”Galega vulgar”. The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars. PMID:29462998

Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants.

PubMed

Liu, Ping-Li; Du, Liang; Huang, Yuan; Gao, Shu-Min; Yu, Meng

2017-02-07

Leucine-rich repeat receptor-like protein kinases (LRR-RLKs) are the largest group of receptor-like kinases in plants and play crucial roles in development and stress responses. The evolutionary relationships among LRR-RLK genes have been investigated in flowering plants; however, no comprehensive studies have been performed for these genes in more ancestral groups. The subfamily classification of LRR-RLK genes in plants, the evolutionary history and driving force for the evolution of each LRR-RLK subfamily remain to be understood. We identified 119 LRR-RLK genes in the Physcomitrella patens moss genome, 67 LRR-RLK genes in the Selaginella moellendorffii lycophyte genome, and no LRR-RLK genes in five green algae genomes. Furthermore, these LRR-RLK sequences, along with previously reported LRR-RLK sequences from Arabidopsis thaliana and Oryza sativa, were subjected to evolutionary analyses. Phylogenetic analyses revealed that plant LRR-RLKs belong to 19 subfamilies, eighteen of which were established in early land plants, and one of which evolved in flowering plants. More importantly, we found that the basic structures of LRR-RLK genes for most subfamilies are established in early land plants and conserved within subfamilies and across different plant lineages, but divergent among subfamilies. In addition, most members of the same subfamily had common protein motif compositions, whereas members of different subfamilies showed variations in protein motif compositions. The unique gene structure and protein motif compositions of each subfamily differentiate the subfamily classifications and, more importantly, provide evidence for functional divergence among LRR-RLK subfamilies. Maximum likelihood analyses showed that some sites within four subfamilies were under positive selection. Much of the diversity of plant LRR-RLK genes was established in early land plants. Positive selection contributed to the evolution of a few LRR-RLK subfamilies.

A review of Cunaxidae (Acariformes, Trombidiformes): Histories and diagnoses of subfamilies and genera, keys to world species, and some new locality records

PubMed Central

Skvarla, Michael J.; Fisher, J. Ray; Dowling, Ashley P. G.

2014-01-01

Abstract Cunaxidae are predaceous mites found in a variety of habitats. This work provides comprehensive keys to world subfamilies, genera, and species. Diagnoses and historical reviews are provided for subfamilies and genera. Cunaxa boneti, C. denmarki, C. exoterica, C. floridanus, C. lehmanae, C. lukoschusi, C. metzi, C. myabunderensis, C newyorkensis, C. rackae, C. reevesi, and C. reticulatus are moved to Rubroscirus and C. otiosus, C. valentis, and C. rasile are returned to Rubroscirus. Cunaxoides neopectinatus is moved to Pulaeus. Neocunaxoides pradhani and N. gilbertoi are transferred to Scutopalus. Pulaeus minutus and P. subterraneus are moved to Lupaeus. Pseudobonzia bakari, P. malookensis, and P. shamshadi are transferred to Neobonzia. Dactyloscirus bifidus is transferred to Armascirus. Scirula papillata is reported from the Western Hemisphere for the first time. Armascirus ozarkensis, A. primigenius, and Dactyloscirus dolichosetosus are reported from new localities. PMID:25061358

Union Members Are Community Members

ERIC Educational Resources Information Center

Gray, David

2013-01-01

Unions serve their members' interests. But union members are also community members, and their interests go well beyond increasing pay and benefits. A local union president has found that his members are best served by participating in a community-wide coalition. Providing eyeglasses to needy students, promoting healthy eating, and increasing…

Current knowledge on bioacoustics of the subfamily Lophyohylinae (Hylidae, Anura) and description of Ocellated treefrog Itapotihyla langsdorffii vocalizations.

PubMed

Forti, Lucas Rodriguez; Foratto, Roseli Maria; Márquez, Rafael; Pereira, Vânia Rosa; Toledo, Luís Felipe

2018-01-01

Anuran vocalizations, such as advertisement and release calls, are informative for taxonomy because species recognition can be based on those signals. Thus, a proper acoustic description of the calls may support taxonomic decisions and may contribute to knowledge about amphibian phylogeny. Here we present a perspective on advertisement call descriptions of the frog subfamily Lophyohylinae, through a literature review and a spatial analysis presenting bioacoustic coldspots (sites with high diversity of species lacking advertisement call descriptions) for this taxonomic group. Additionally, we describe the advertisement and release calls of the still poorly known treefrog, Itapotihyla langsdorffii . We analyzed recordings of six males using the software Raven Pro 1.4 and calculated the coefficient of variation for classifying static and dynamic acoustic properties. We found that more than half of the species within the subfamily do not have their vocalizations described yet. Most of these species are distributed in the western and northern Amazon, where recording sampling effort should be strengthened in order to fill these gaps. The advertisement call of I. langsdorffii is composed of 3-18 short unpulsed notes (mean of 13 ms long), presents harmonic structure, and has a peak dominant frequency of about 1.4 kHz. This call usually presents amplitude modulation, with decreasing intensity along the sequence of notes. The release call is a simple unpulsed note with an average duration of 9 ms, and peak dominant frequency around 1.8 kHz. Temporal properties presented higher variations than spectral properties at both intra- and inter-individual levels. However, only peak dominant frequency was static at intra-individual level. High variability in temporal properties and lower variations related to spectral ones is usual for anurans; The first set of variables is determined by social environment or temperature, while the second is usually related to species

Centromeric retrotransposon lineages predate the maize/rice divergence and differ in abundance and activity.

PubMed

Sharma, Anupma; Presting, Gernot G

2008-02-01

Centromeric retrotransposons (CR) are located almost exclusively at the centromeres of plant chromosomes. Analysis of the emerging Zea mays inbred B73 genome sequence revealed two novel subfamilies of CR elements of maize (CRM), bringing the total number of known CRM subfamilies to four. Orthologous subfamilies of each of these CRM subfamilies were discovered in the rice lineage, and the orthologous relationships were demonstrated with extensive phylogenetic analyses. The much higher number of CRs in maize versus Oryza sativa is due primarily to the recent expansion of the CRM1 subfamily in maize. At least one incomplete copy of a CRM1 homolog was found in O. sativa ssp. indica and O. officinalis, but no member of this subfamily could be detected in the finished O. sativa ssp. japonica genome, implying loss of this prolific subfamily in that subspecies. CRM2 and CRM3, as well as the corresponding rice subfamilies, have been recently active but are present in low numbers. CRM3 is a full-length element related to the non-autonomous CentA, which is the first described CRM. The oldest subfamily (CRM4), as well as its rice counterpart, appears to contain only inactive members that are not located in currently active centromeres. The abundance of active CR elements is correlated with chromosome size in the three plant genomes for which high quality genomic sequence is available, and the emerging picture of CR elements is one in which different subfamilies are active at different evolutionary times. We propose a model by which CR elements might influence chromosome and genome size.

Structural insights into transient receptor potential vanilloid type 1 (TRPV1) from homology modeling, flexible docking, and mutational studies.

PubMed

Lee, Jin Hee; Lee, Yoonji; Ryu, HyungChul; Kang, Dong Wook; Lee, Jeewoo; Lazar, Jozsef; Pearce, Larry V; Pavlyukovets, Vladimir A; Blumberg, Peter M; Choi, Sun

2011-04-01

The transient receptor potential vanilloid subtype 1 (TRPV1) is a non-selective cation channel composed of four monomers with six transmembrane helices (TM1-TM6). TRPV1 is found in the central and peripheral nervous system, and it is an important therapeutic target for pain relief. We describe here the construction of a tetrameric homology model of rat TRPV1 (rTRPV1). We experimentally evaluated by mutational analysis the contribution of residues of rTRPV1 contributing to ligand binding by the prototypical TRPV1 agonists, capsaicin and resiniferatoxin (RTX). We then performed docking analysis using our homology model. The docking results with capsaicin and RTX showed that our homology model was reliable, affording good agreement with our mutation data. Additionally, the binding mode of a simplified RTX (sRTX) ligand as predicted by the modeling agreed well with those of capsaicin and RTX, accounting for the high binding affinity of the sRTX ligand for TRPV1. Through the homology modeling, docking and mutational studies, we obtained important insights into the ligand-receptor interactions at the molecular level which should prove of value in the design of novel TRPV1 ligands.

Structural insights into transient receptor potential vanilloid type 1 (TRPV1) from homology modeling, flexible docking, and mutational studies

NASA Astrophysics Data System (ADS)

Lee, Jin Hee; Lee, Yoonji; Ryu, HyungChul; Kang, Dong Wook; Lee, Jeewoo; Lazar, Jozsef; Pearce, Larry V.; Pavlyukovets, Vladimir A.; Blumberg, Peter M.; Choi, Sun

2011-04-01

The transient receptor potential vanilloid subtype 1 (TRPV1) is a non-selective cation channel composed of four monomers with six transmembrane helices (TM1-TM6). TRPV1 is found in the central and peripheral nervous system, and it is an important therapeutic target for pain relief. We describe here the construction of a tetrameric homology model of rat TRPV1 (rTRPV1). We experimentally evaluated by mutational analysis the contribution of residues of rTRPV1 contributing to ligand binding by the prototypical TRPV1 agonists, capsaicin and resiniferatoxin (RTX). We then performed docking analysis using our homology model. The docking results with capsaicin and RTX showed that our homology model was reliable, affording good agreement with our mutation data. Additionally, the binding mode of a simplified RTX (sRTX) ligand as predicted by the modeling agreed well with those of capsaicin and RTX, accounting for the high binding affinity of the sRTX ligand for TRPV1. Through the homology modeling, docking and mutational studies, we obtained important insights into the ligand-receptor interactions at the molecular level which should prove of value in the design of novel TRPV1 ligands.

Morphological "primary homology" and expression of AG-subfamily MADS-box genes in pines, podocarps, and yews.

PubMed

Englund, Marie; Carlsbecker, Annelie; Engström, Peter; Vergara-Silva, Francisco

2011-01-01

The morphological variation among reproductive organs of extant gymnosperms is remarkable, especially among conifers. Several hypotheses concerning morphological homology between various conifer reproductive organs have been put forward, in particular in relation to the pine ovuliferous scale. Here, we use the expression patterns of orthologs of the ABC-model MADS-box gene AGAMOUS (AG) for testing morphological homology hypotheses related to organs of the conifer female cone. To this end, we first developed a tailored 3'RACE procedure that allows reliable amplification of partial sequences highly similar to gymnosperm-derived members of the AG-subfamily of MADS-box genes. Expression patterns of two novel conifer AG orthologs cloned with this procedure-namely PodAG and TgAG, obtained from the podocarp Podocarpus reichei and the yew Taxus globosa, respectively-are then further characterized in the morphologically divergent female cones of these species. The expression patterns of PodAG and TgAG are compared with those of DAL2, a previously discovered Picea abies (Pinaceae) AG ortholog. By treating the expression patterns of DAL2, PodAG, and TgAG as character states mapped onto currently accepted cladogram topologies, we suggest that the epimatium-that is, the podocarp female cone organ previously postulated as a "modified" ovuliferous scale-and the canonical Pinaceae ovuliferous scale can be legitimally conceptualized as "primary homologs." Character state mapping for TgAG suggests in turn that the aril of Taxaceae should be considered as a different type of organ. This work demonstrates how the interaction between developmental-genetic data and formal cladistic theory could fruitfully contribute to gymnosperm systematics. © 2011 Wiley Periodicals, Inc.

Evolutionary history of fumitories (subfamily Fumarioideae, Papaveraceae): An old story shaped by the main geological and climatic events in the Northern Hemisphere.

PubMed

Pérez-Gutiérrez, Miguel A; Romero-García, Ana T; Fernández, M Carmen; Blanca, G; Salinas-Bonillo, María J; Suárez-Santiago, Víctor N

2015-07-01

Fumitories (subfamily Fumarioideae, Papaveraceae) represent, by their wide mainly northern temperate distribution (also present in South Africa) a suitable plant group to use as a model system for studying biogeographical links between floristic regions of the Northern Hemisphere and also the Southern Hemisphere Cape region. However, the phylogeny of the entire Fumarioideae subfamily is not totally known. In this work, we infer a molecular phylogeny of Fumarioideae, which we use to interpret the biogeographical patterns in the subfamily and to establish biogeographical links between floristic regions, such as those suggested by its different inter- and intra-continental disjunctions. The tribe Hypecoeae is the sister group of tribe Fumarieae, this latter holding a basal grade of monotypic or few-species genera with bisymmetric flowers, and a core group, Core Fumarieae, of more specious rich genera with zygomorphic flowers. The biogeographical analysis shows a subfamily that originated in East Asia at the end of the Early Cretaceous. From here, ancestral range expansions followed three different directions, one at the beginning of the Late Cretaceous by the ancestor of tribe Hypecoeae towards central Asia, and two during the Cretaceous-Palaeogene transition towards western North America and Indochina by the ancestor of the tribe Fumarieae. The ancestor of Core Fumarieae expanded its range from East Asia into the Himalayas before to the middle Eocene. The uplifts of the Qinghai-Tibetan Plateau together with the zonal climate pattern of the Palaeogene are suggested to be responsible both for the accelerated diversification rate resulting in the origin of the basal lineages of Core Fumarieae as well as for the westward migration of the ancestor of Fumarieae s.str. into the Irano-Turanian region. From here, this latter group reached South Africa during late Eocene and Mediterranean basin during Oligocene. There were two colonization waves of the Mediterranean following

Transient receptor potential vanilloid 2 (TRPV2), a potential novel biomarker in childhood asthma.

PubMed

Cai, Xin; Yang, Yong-chang; Wang, Jing-feng; Wang, Qiang; Gao, Jie; Fu, Wen-liang; Zhu, Ze-yi; Wang, Yuan-yuan; Zou, Min-ji; Wang, Jia-xi; Xu, Dong-qun; Xu, Dong-gang

2013-03-01

The presence of transient receptor potential vanilloid 2 (TRPV2) in human peripheral blood cells may suggest a role under pathological conditions. The aim of this study was to explore the relationship between the expression profile of TRPV2 gene and childhood asthma in the north of China. The effects of allergens exposure on the expression of TRPV2 gene were also investigated. Sixty asthmatics children confirmed by physician diagnosis and 60 healthy children as a control group were recruited. Serum total IgE and specific IgE were measured. Using quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR), TRPV2 was detected in total RNA extracted from peripheral blood lymphocytes. Student's t-test and chi-square test were used to analyze the relationship between TRPV2 transcript and different parameter variables on susceptibility of childhood asthma. Multiple logistic regression was used to analyze the associations between TRPV2 gene and allergens. The expression level of TRPV2 gene was increased 2.6 times in asthmatic children compared with controls (p < .01). The up-regulation of TRPV2 gene and sensitization to one of three the allergens-spring pollen, dust mite, and dog and cat hair-were correlated with childhood asthma. In addition, the hypersensitivity to spring pollen, cockroach, and dust mite and up-regulation of TRPV2 gene expression may be the risk factors for the childhood asthma in Beijing. The increased expression of TRPV2 gene in peripheral lymphocytes is closely correlated with childhood asthma in the north of China. This study provides a potential new biomarker of childhood asthma and lays the basis for further clarification of the pathogenesis underlying asthma.

New taxa and notes on crickets of the subfamily Landrevinae (Orthoptera: Gryllidae) from Brunei Darussalam, Borneo.

PubMed

Tan, Ming Kai; Wahab, Rodzay Bin Haji Abdul

2017-12-19

New taxa from the subfamily Landrevinae (Orthoptera: Gryllidae) are expected despite recent work on its taxonomy. Here, two more new species from Brunei Darussalam, Borneo are described: Duolandrevus (Eulandrevus) kawataredoki sp. nov. and Endodrelanva nympha sp. nov. The male calling song of D. (E.) kawataredoki sp. nov. is also described. We report the occurrence of a Duolandrevus (Bejorama) from Brunei close to (nr.) luzonensis Otte, 1988. We also document from Brunei a case of parasitic wasp from the genus Liris (Hymenoptera: Crabronidae: Larrini) hunting a Landrevinae.

Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

PubMed

Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

2015-12-01

The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions.

Application of Microarrays and qPCR to Identify Phylogenetic and Functional Biomarkers Diagnostic of Microbial Communities that Biodegrade Chlorinated Solvents to Ethene

DTIC Science & Technology

2012-01-01

Acidobacteria, Actinobacteria , Bacteroidetes, Chloroflexi, Cyanobacteria, Firmicutes, and all classes of Proteobacteria accounted for 76% of this dynamic...the course of treatment (Figure 4). The dominant members in cluster group 2 were from Actinobacteria (24 subfamilies), Bacteroidetes (25 subfamilies

Fourfold polyphyly of the genus formerly known as Upucerthia, with notes on the systematics and evolution of the avian subfamily Furnariinae

USGS Publications Warehouse

Chesser, R.T.; Barker, F.K.; Brumfield, R.T.

2007-01-01

The traditional avian subfamily Furnariinae, a group of terrestrial ovenbirds typical of the Andean and Patagonian arid zones, consists of the genera Furnarius, Cinclodes, Geositta, Upucerthia, Chilia, and Eremobius. We investigated phylogenetic relationships within the Furnariinae, with particular attention to the nine species of the genus Upucerthia, using nuclear and mitochondrial DNA sequences from all genera in the subfamily. Upucerthia was found to be highly polyphyletic, its constituent species forming four non-sister clades: (1) a basal lineage consisting of two Upucerthia species, U. ruficaudus and U. andaecola, as well as the monotypic genera Eremobius and Chilia; (2) a lineage consisting of U. harterti and U. certhioides, two species behaviorally divergent from other Upucerthia species; (3) a lineage consisting of U. serrana, which is not closely related to any other Upucerthia species; and (4) a lineage, sister to Cinclodes, consisting of the four Upucerthia species U. dumetaria, U. albigula, U. validirostris, and U. jelskii. The larger Furnariinae was also found to be highly polyphyletic; the terrestrial open country ecotype characteristic of this subfamily occurs in four unrelated clades in the family Furnariidae, including a basal lineage as well as derived lineages. Although the large degree of divergence among Upucerthia clades was not previously recognized, owing to ecological, behavioral, and morphological similarities, the groupings correspond closely to relationships suggested by plumage. This is in contrast to studies of other avian genera in which plumage patterns have been shown to be extensively convergent. The generic names Upucerthia and Ochetorhynchus are available for two of the former Upucerthia clades; new generic names may be warranted for the other two.

A Rationally Designed Agonist Defines Subfamily IIIA Abscisic Acid Receptors As Critical Targets for Manipulating Transpiration.

PubMed

Vaidya, Aditya S; Peterson, Francis C; Yarmolinsky, Dmitry; Merilo, Ebe; Verstraeten, Inge; Park, Sang-Youl; Elzinga, Dezi; Kaundal, Amita; Helander, Jonathan; Lozano-Juste, Jorge; Otani, Masato; Wu, Kevin; Jensen, Davin R; Kollist, Hannes; Volkman, Brian F; Cutler, Sean R

2017-11-17

Increasing drought and diminishing freshwater supplies have stimulated interest in developing small molecules that can be used to control transpiration. Receptors for the plant hormone abscisic acid (ABA) have emerged as key targets for this application, because ABA controls the apertures of stomata, which in turn regulate transpiration. Here, we describe the rational design of cyanabactin, an ABA receptor agonist that preferentially activates Pyrabactin Resistance 1 (PYR1) with low nanomolar potency. A 1.63 Å X-ray crystallographic structure of cyanabactin in complex with PYR1 illustrates that cyanabactin's arylnitrile mimics ABA's cyclohexenone oxygen and engages the tryptophan lock, a key component required to stabilize activated receptors. Further, its sulfonamide and 4-methylbenzyl substructures mimic ABA's carboxylate and C6 methyl groups, respectively. Isothermal titration calorimetry measurements show that cyanabactin's compact structure provides ready access to high ligand efficiency on a relatively simple scaffold. Cyanabactin treatments reduce Arabidopsis whole-plant stomatal conductance and activate multiple ABA responses, demonstrating that its in vitro potency translates to ABA-like activity in vivo. Genetic analyses show that the effects of cyanabactin, and the previously identified agonist quinabactin, can be abolished by the genetic removal of PYR1 and PYL1, which form subclade A within the dimeric subfamily III receptors. Thus, cyanabactin is a potent and selective agonist with a wide spectrum of ABA-like activities that defines subfamily IIIA receptors as key target sites for manipulating transpiration.

Effects of body temperature on neural activity in the hippocampus: regulation of resting membrane potentials by transient receptor potential vanilloid 4.

PubMed

Shibasaki, Koji; Suzuki, Makoto; Mizuno, Atsuko; Tominaga, Makoto

2007-02-14

Physiological body temperature is an important determinant for neural functions, and it is well established that changes in temperature have dynamic influences on hippocampal neural activities. However, the detailed molecular mechanisms have never been clarified. Here, we show that hippocampal neurons express functional transient receptor potential vanilloid 4 (TRPV4), one of the thermosensitive TRP (transient receptor potential) channels, and that TRPV4 is constitutively active at physiological temperature. Activation of TRPV4 at 37 degrees C depolarized the resting membrane potential in hippocampal neurons by allowing cation influx, which was observed in wild-type (WT) neurons, but not in TRPV4-deficient (TRPV4KO) cells, although dendritic morphology, synaptic marker clustering, and synaptic currents were indistinguishable between the two genotypes. Furthermore, current injection studies revealed that TRPV4KO neurons required larger depolarization to evoke firing, equivalent to WT neurons, indicating that TRPV4 is a key regulator for hippocampal neural excitabilities. We conclude that TRPV4 is activated by physiological temperature in hippocampal neurons and thereby controls their excitability.

Testing the reliability of standard and complementary DNA barcodes for the monocot subfamily Alooideae from South Africa.

PubMed

Daru, Barnabas H; van der Bank, Michelle; Bello, Abubakar; Yessoufou, Kowiyou

2017-04-01

Although a standard DNA barcode has been identified for plants, it does not always provide species-level specimen identifications for investigating important ecological questions. In this study, we assessed the species-level discriminatory power of standard (rbcLa + matK) and complementary barcodes (ITS1 and trnH-psbA) within the subfamily Alooideae (Asphodelaceae), a large and recent plant radiation, whose species are important in horticulture yet are threatened. Alooideae has its centre of endemism in southern Africa, with some outlier species occurring elsewhere in Africa and Madagascar. We sampled 360 specimens representing 235 species within all 11 genera of the subfamily. With three distance-based methods, all markers performed poorly for our combined data set, with the highest proportion of correct species-level specimen identifications (30%) found for ITS1. However, when performance was assessed across genera, the discriminatory power varied from 0% for all single markers and combinations in Gasteria to 63% in Haworthiopsis, again for ITS1, suggesting that DNA barcoding success may be related to the evolutionary history of the lineage considered. Although ITS1 could be a good barcode for Haworthiopsis, the generally poor performance of all markers suggests that Alooideae remains a challenge. As species boundaries within Alooideae remain controversial, we call for continued search for suitable markers or the use of genomics approaches to further explore species discrimination in the group.

PANTHER: a browsable database of gene products organized by biological function, using curated protein family and subfamily classification.

PubMed

Thomas, Paul D; Kejariwal, Anish; Campbell, Michael J; Mi, Huaiyu; Diemer, Karen; Guo, Nan; Ladunga, Istvan; Ulitsky-Lazareva, Betty; Muruganujan, Anushya; Rabkin, Steven; Vandergriff, Jody A; Doremieux, Olivier

2003-01-01

The PANTHER database was designed for high-throughput analysis of protein sequences. One of the key features is a simplified ontology of protein function, which allows browsing of the database by biological functions. Biologist curators have associated the ontology terms with groups of protein sequences rather than individual sequences. Statistical models (Hidden Markov Models, or HMMs) are built from each of these groups. The advantage of this approach is that new sequences can be automatically classified as they become available. To ensure accurate functional classification, HMMs are constructed not only for families, but also for functionally distinct subfamilies. Multiple sequence alignments and phylogenetic trees, including curator-assigned information, are available for each family. The current version of the PANTHER database includes training sequences from all organisms in the GenBank non-redundant protein database, and the HMMs have been used to classify gene products across the entire genomes of human, and Drosophila melanogaster. The ontology terms and protein families and subfamilies, as well as Drosophila gene c;assifications, can be browsed and searched for free. Due to outstanding contractual obligations, access to human gene classifications and to protein family trees and multiple sequence alignments will temporarily require a nominal registration fee. PANTHER is publicly available on the web at http://panther.celera.com.

Plastome-Wide Nucleotide Substitution Rates Reveal Accelerated Rates in Papilionoideae and Correlations with Genome Features Across Legume Subfamilies.

PubMed

Schwarz, Erika N; Ruhlman, Tracey A; Weng, Mao-Lun; Khiyami, Mohammad A; Sabir, Jamal S M; Hajarah, Nahid H; Alharbi, Njud S; Rabah, Samar O; Jansen, Robert K

2017-04-01

This study represents the most comprehensive plastome-wide comparison of nucleotide substitution rates across the three subfamilies of Fabaceae: Caesalpinioideae, Mimosoideae, and Papilionoideae. Caesalpinioid and mimosoid legumes have large, unrearranged plastomes compared with papilionoids, which exhibit varying levels of rearrangement including the loss of the inverted repeat (IR) in the IR-lacking clade (IRLC). Using 71 genes common to 39 legume taxa representing all the three subfamilies, we show that papilionoids consistently have higher nucleotide substitution rates than caesalpinioids and mimosoids, and rates in the IRLC papilionoids are generally higher than those in the IR-containing papilionoids. Unsurprisingly, this pattern was significantly correlated with growth habit as most papilionoids are herbaceous, whereas caesalpinioids and mimosoids are largely woody. Both nonsynonymous (dN) and synonymous (dS) substitution rates were also correlated with several biological features including plastome size and plastomic rearrangements such as the number of inversions and indels. In agreement with previous reports, we found that genes in the IR exhibit between three and fourfold reductions in the substitution rates relative to genes within the large single-copy or small single-copy regions. Furthermore, former IR genes in IR-lacking taxa exhibit accelerated rates compared with genes contained in the IR.

Checklist of the subfamily Adoncholaiminae Gerlach and Riemann, 1974 (Nematoda: Oncholaimida: Oncholaimidae) of the world: genera, species, distribution, and reference list for taxonomists and ecologists

PubMed Central

2016-01-01

Abstract Background Adoncholaiminae is one of the seven subfamilies in the free-living aquatic nematode family Oncholaimidae. Nematodes in Adoncholaiminae are found from various water environment of the world. However, a checklist of all Adoncholaiminae species including full literature, especially information of experimental (not taxonomic) works, has not been updated for more than 40 years. New information A revised checklist of the subfamily Adoncholaiminae of the world is provided. It contains 31 valid and 13 invalid species names in four genera with synonyms, collection records, and full literature from 1860's to 2015 for each species. A literature survey of total 477 previous papers was conducted in this work, and 362 of them are newly added to checklist. PMID:26929708

Sensitization of transient receptor potential vanilloid 1 by the prokineticin receptor agonist Bv8.

PubMed

Vellani, Vittorio; Colucci, Mariantonella; Lattanzi, Roberta; Giannini, Elisa; Negri, Lucia; Melchiorri, Pietro; McNaughton, Peter A

2006-05-10

Small mammalian proteins called the prokineticins [prokineticin 1 (PK1) and PK2] and two corresponding G-protein-coupled receptors [prokineticin receptor 1 (PKR1) and PKR2] have been identified recently, but the physiological role of the PK/PKR system remains mostly unexplored. Bv8, a protein extracted from frog skin, is a convenient and potent agonist for both PKR1 and PKR2, and injection of Bv8 in vivo causes a potent and long-lasting hyperalgesia. Here, we investigate the cellular basis of hyperalgesia caused by activation of PKRs. Bv8 caused increases in [Ca]i in a population of isolated dorsal root ganglion (DRG) neurons, which we identified as nociceptors, or sensors for painful stimuli, from their responses to capsaicin, bradykinin, mustard oil, or proteases. Bv8 enhanced the inward current carried by the heat and capsaicin receptor, transient receptor potential vanilloid 1 (TRPV1) via a pathway involving activation of protein kinase Cepsilon (PKCepsilon), because Bv8 caused translocation of PKCepsilon to the neuronal membrane and because PKC antagonists reduced both the enhancement of current carried by TRPV1 and behavioral hyperalgesia in rodents. The neuronal population expressing PKRs consisted partly of small peptidergic neurons and partly of neurons expressing the N52 marker for myelinated fibers. Using single-cell reverse transcriptase-PCR, we found that mRNA for PKR1 was mainly expressed in small DRG neurons. Exposure to GDNF (glial cell line-derived neurotrophic factor) induced de novo expression of functional receptors for Bv8 in a nonpeptidergic population of neurons. These results show that prokineticin receptors are expressed in nociceptors and cause heat hyperalgesia by sensitizing TRPV1 through activation of PKCepsilon. The results suggest a role for prokineticins in physiological inflammation and hyperalgesia.

Transfer of All Cybalomiinae to other Subfamilies (Crambidae: Pyraloidea: Lepidoptera: Elusia Schaus, Dichochroma Forbes, Schacontia Dyar, Cybalomia extorris Warren, and C. lojanalis Dognin

USDA-ARS?s Scientific Manuscript database

The Cybalomiinae contained 4 genera and 9 species in the Western Hemisphere, according to Munroe (1995). These species were morphologically compared with the type species, Cybalomia pentadalis Lederer, of Cybalomiinae. All species were found to belong to other subfamilies and the following new com...

Activation of Adhesion G Protein-coupled Receptors: AGONIST SPECIFICITY OF STACHEL SEQUENCE-DERIVED PEPTIDES.

PubMed

Demberg, Lilian M; Winkler, Jana; Wilde, Caroline; Simon, Kay-Uwe; Schön, Julia; Rothemund, Sven; Schöneberg, Torsten; Prömel, Simone; Liebscher, Ines

2017-03-17

Members of the adhesion G protein-coupled receptor (aGPCR) family carry an agonistic sequence within their large ectodomains. Peptides derived from this region, called the Stachel sequence, can activate the respective receptor. As the conserved core region of the Stachel sequence is highly similar between aGPCRs, the agonist specificity of Stachel sequence-derived peptides was tested between family members using cell culture-based second messenger assays. Stachel peptides derived from aGPCRs of subfamily VI (GPR110/ADGRF1, GPR116/ADGRF5) and subfamily VIII (GPR64/ADGRG2, GPR126/ADGRG6) are able to activate more than one member of the respective subfamily supporting their evolutionary relationship and defining them as pharmacological receptor subtypes. Extended functional analyses of the Stachel sequences and derived peptides revealed agonist promiscuity, not only within, but also between aGPCR subfamilies. For example, the Stachel -derived peptide of GPR110 (subfamily VI) can activate GPR64 and GPR126 (both subfamily VIII). Our results indicate that key residues in the Stachel sequence are very similar between aGPCRs allowing for agonist promiscuity of several Stachel -derived peptides. Therefore, aGPCRs appear to be pharmacologically more closely related than previously thought. Our findings have direct implications for many aGPCR studies, as potential functional overlap has to be considered for in vitro and in vivo studies. However, it also offers the possibility of a broader use of more potent peptides when the original Stachel sequence is less effective. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

That awkward age for butterflies: insights from the age of the butterfly subfamily Nymphalinae (Lepidoptera: Nymphalidae).

PubMed

Wahlberg, Niklas

2006-10-01

The study of the historical biogeography of butterflies has been hampered by a lack of well-resolved phylogenies and a good estimate of the temporal span over which butterflies have evolved. Recently there has been surge of phylogenetic hypotheses for various butterfly groups, but estimating ages of divergence is still in its infancy for this group of insects. The main problem has been the sparse fossil record for butterflies. In this study I have used a surprisingly good fossil record for the subfamily Nymphalinae (Lepidoptera: Nymphalidae) to estimate the ages of diversification of major lineages using Bayesian relaxed clock methods. I have investigated the effects of varying priors on posterior estimates in the analyses. For this data set, it is clear that the prior of the rate of molecular evolution at the ingroup node had the largest effect on the results. Taking this into account, I have been able to arrive at a plausible history of lineage splits, which appears to be correlated with known paleogeological events. The subfamily appears to have diversified soon after the K/T event about 65 million years ago. Several splits are coincident with major paleogeological events, such as the connection of the African and Asian continents about 21 million years ago and the presence of a peninsula of land connecting the current Greater Antilles to the South American continent 35 to 33 million years ago. My results suggest that the age of Nymphalidae is older than the 70 million years speculated to be the age of butterflies as a whole.

The sympathetic nervous system is controlled by transient receptor potential vanilloid 1 in the regulation of body temperature.

PubMed

Alawi, Khadija M; Aubdool, Aisah A; Liang, Lihuan; Wilde, Elena; Vepa, Abhinav; Psefteli, Maria-Paraskevi; Brain, Susan D; Keeble, Julie E

2015-10-01

Transient receptor potential vanilloid 1 (TRPV1) is involved in sensory nerve nociceptive signaling. Recently, it has been discovered that TRPV1 receptors also regulate basal body temperature in multiple species from mice to humans. In the present study, we investigated whether TRPV1 modulates basal sympathetic nervous system (SNS) activity. C57BL6/J wild-type (WT) mice and TRPV1 knockout (KO) mice were implanted with radiotelemetry probes for measurement of core body temperature. AMG9810 (50 mg/kg) or vehicle (2% DMSO/5% Tween 80/10 ml/kg saline) was injected intraperitoneally. Adrenoceptor antagonists or vehicle (5 ml/kg saline) was injected subcutaneously. In WT mice, the TRPV1 antagonist, AMG9810, caused significant hyperthermia, associated with increased noradrenaline concentrations in brown adipose tissue. The hyperthermia was significantly attenuated by the β-adrenoceptor antagonist propranolol, the mixed α-/β-adrenoceptor antagonist labetalol, and the α1-adrenoceptor antagonist prazosin. TRPV1 KO mice have a normal basal body temperature, indicative of developmental compensation. d-Amphetamine (potent sympathomimetic) caused hyperthermia in WT mice, which was reduced in TRPV1 KO mice, suggesting a decreased sympathetic drive in KOs. This study provides new evidence that TRPV1 controls thermoregulation upstream of the SNS, providing a potential therapeutic target for sympathetic hyperactivity thermoregulatory disorders. © FASEB.

The molecular basis of urgency: regional difference of vanilloid receptor expression in the human urinary bladder.

PubMed

Liu, Lu; Mansfield, Kylie J; Kristiana, Ika; Vaux, Kenneth J; Millard, Richard J; Burcher, Elizabeth

2007-01-01

Treatments targeting vanilloid receptor TRPV1 are effective in some bladder disorders. Our aim was to determine the expression profiles of TRPV1 in regions of human bladder and test the hypothesis that there would be an upregulation of TRPV1 in mucosa of patients with bladder hypersensitivity but not idiopathic detrusor overactivity (IDO). Women with sensory urgency (SU), interstitial cystitis (IC), and IDO were investigated by videourodynamics and cystoscopy. Control biopsies were used for comparison. Biopsies were dissected into mucosa and muscle, and evaluated for TRPV1 mRNA expression using quantitative competitive RT-PCR (QC-RT-PCR). TRPV1 mRNA from SU trigonal mucosa was significantly higher than control trigonal mucosa or SU bladder body mucosa. In contrast, in IDO patients, there was no difference between trigonal mucosa and body mucosa. In IC biopsies, RNA quality was substandard and unable to be used for analysis. The most striking finding was that TRPV1 mRNA expressed in SU trigonal mucosa was significantly inversely correlated with the bladder volume at first sensation of filling during cystometry. No such relationship was seen for IDO trigonal mucosa. No difference was seen in bladder body mucosa from any disease groups compared with age-matched control. The symptoms of SU were associated with the increased expression of TRPV1 mRNA in the trigonal mucosa. No upregulation or regional differences of TRPV1 mRNA were seen in IDO patients. TRPV1 may play a role in SU and premature first bladder sensation on filling.

Genome-Wide Identification and Expression Analysis of Homeodomain Leucine Zipper Subfamily IV (HDZ IV) Gene Family from Musa accuminata

PubMed Central

Pandey, Ashutosh; Misra, Prashant; Alok, Anshu; Kaur, Navneet; Sharma, Shivani; Lakhwani, Deepika; Asif, Mehar H.; Tiwari, Siddharth; Trivedi, Prabodh K.

2016-01-01

The homeodomain zipper family (HD-ZIP) of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV) has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV encoding genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana, and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV encoding genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV encoding genes and for their possible use in the banana improvement programs. PMID:26870050

Two ways of legumin-precursor processing in conifers. Characterization and evolutionary relationships of Metasequoia cDNAs representing two divergent legumin gene subfamilies.

PubMed

Häger, K P; Wind, C

1997-06-15

Subunit monomers and oligomers of crystalloid-type legumins are major components of SDS-soluble fractions from Metasequoia glyptostroboides (Dawn redwood, Taxodiaceae) seed proteins. The subunits are made up of disulfide linked alpha-polypeptides and beta-polypeptides with molecular masses of 33 kDa and 23-25 kDa, respectively. Unusually for legumins, those from Metasequoia are glycosylated and the carbohydrate moieties are residing in the C-terminal region of the respective beta-polypeptides. A Metasequoia endosperm cDNA library has been constructed and legumin-encoding transcripts representing two divergent gene subfamilies have been characterized. Intersubfamily comparisons reveal 75% identity at the amino acid level and the values range from 53-35% when the legumin precursors deduced were compared with those from angiosperms. The predicted sequences together with data from amino acid sequencing prove that post-translational processing of Metasequoia prolegumins is directed to two different processing sites, each of them specific for one of the legumin subfamilies. The sites involved differ in their relative position and in the junction to be cleaved: Metasequoia legumin precursors MgLeg18 and MgLeg26 contain the conventional post-translational Asn-Gly processing site, which is generally regarded as highly conserved. In contrast, the MgLeg4 precursor is lacking this site and post-translational cleavage is directed to an unusual Asn-Thr processing site located in its hypervariable region, causing N-terminal extension of the beta-polypeptide relative to those hitherto known. Evidence is given that the unusual variant of processing also occurs in other conifers. Phylogenetic analysis reveals the precursors concerned as representatives of a distinct legumin subfamily, originating from duplication of an ancestral gene prior to or at the beginning of Taxodiaceae diversification.

Unravelling the Mystery of Capsaicin: A Tool to Understand and Treat Pain

PubMed Central

Brock, Christina; Olesen, Anne Estrup; Andresen, Trine; Nilsson, Matias; Dickenson, Anthony H.

2012-01-01

A large number of pharmacological studies have used capsaicin as a tool to activate many physiological systems, with an emphasis on pain research but also including functions such as the cardiovascular system, the respiratory system, and the urinary tract. Understanding the actions of capsaicin led to the discovery its receptor, transient receptor potential (TRP) vanilloid subfamily member 1 (TRPV1), part of the superfamily of TRP receptors, sensing external events. This receptor is found on key fine sensory afferents, and so the use of capsaicin to selectively activate pain afferents has been exploited in animal studies, human psychophysics, and imaging studies. Its effects depend on the dose and route of administration and may include sensitization, desensitization, withdrawal of afferent nerve terminals, or even overt death of afferent fibers. The ability of capsaicin to generate central hypersensitivity has been valuable in understanding the consequences and mechanisms behind enhanced central processing of pain. In addition, capsaicin has been used as a therapeutic agent when applied topically, and antagonists of the TRPV1 receptor have been developed. Overall, the numerous uses for capsaicin are clear; hence, the rationale of this review is to bring together and discuss the different types of studies that exploit these actions to shed light upon capsaicin working both as a tool to understand pain but also as a treatment for chronic pain. This review will discuss the various actions of capsaicin and how it lends itself to these different purposes. PMID:23023032

Molecular Modeling of the Structural and Dynamical Changes in Calcium Channel TRPV5 Induced by the African-Specific A563T Variation.

PubMed

Wang, Lingyun; Holmes, Ross P; Peng, Ji-Bin

2016-03-01

Transient receptor potential cation channels, vanilloid subfamily, member 5 (TRPV5) plays a key role in active Ca(2+) reabsorption in the kidney. Variations in TRPV5 occur at high frequency in African populations and may contribute to their higher efficiency of Ca(2+) reabsorption. One of the African specific variations, A563T, exhibits increased Ca(2+) transport ability. However, it is unclear how this variation influences the channel pore. On the basis of the structure of TRPV1, a TRPV5 model was generated to simulate the structural and dynamical changes induced by the A563T variation. On the basis of this model, amino acid residue 563 interacts with V540, which is one residue away from the key residue, D542, involved in Ca(2+) selectivity and Mg(2+) blockade. The A563T variation increases secondary structure stability and reduces dynamical motion of D542. In addition, the A563T variation alters the electrostatic potential of the outer surface of the pore. Differences in contact between selective filter residues and residue 563 and in electrostatic potential between the two TRPV5 variants were also observed in another model derived from an alternative alignment in the selective filters between TRPV5 and TRPV1. These findings indicate that the A563T variation induces structural, dynamical, and electrostatic changes in the TRPV5 pore, providing structural insight into the functional alterations associated with the A563T variation.

A Species-Level Phylogeny of Extant Snakes with Description of a New Colubrid Subfamily and Genus.

PubMed

Figueroa, Alex; McKelvy, Alexander D; Grismer, L Lee; Bell, Charles D; Lailvaux, Simon P

2016-01-01

With over 3,500 species encompassing a diverse range of morphologies and ecologies, snakes make up 36% of squamate diversity. Despite several attempts at estimating higher-level snake relationships and numerous assessments of generic- or species-level phylogenies, a large-scale species-level phylogeny solely focusing on snakes has not been completed. Here, we provide the largest-yet estimate of the snake tree of life using maximum likelihood on a supermatrix of 1745 taxa (1652 snake species + 7 outgroup taxa) and 9,523 base pairs from 10 loci (5 nuclear, 5 mitochondrial), including previously unsequenced genera (2) and species (61). Increased taxon sampling resulted in a phylogeny with a new higher-level topology and corroborate many lower-level relationships, strengthened by high nodal support values (> 85%) down to the species level (73.69% of nodes). Although the majority of families and subfamilies were strongly supported as monophyletic with > 88% support values, some families and numerous genera were paraphyletic, primarily due to limited taxon and loci sampling leading to a sparse supermatrix and minimal sequence overlap between some closely-related taxa. With all rogue taxa and incertae sedis species eliminated, higher-level relationships and support values remained relatively unchanged, except in five problematic clades. Our analyses resulted in new topologies at higher- and lower-levels; resolved several previous topological issues; established novel paraphyletic affiliations; designated a new subfamily, Ahaetuliinae, for the genera Ahaetulla, Chrysopelea, Dendrelaphis, and Dryophiops; and appointed Hemerophis (Coluber) zebrinus to a new genus, Mopanveldophis. Although we provide insight into some distinguished problematic nodes, at the deeper phylogenetic scale, resolution of these nodes may require sampling of more slowly-evolving nuclear genes.

A Species-Level Phylogeny of Extant Snakes with Description of a New Colubrid Subfamily and Genus

PubMed Central

McKelvy, Alexander D.; Grismer, L. Lee; Bell, Charles D.; Lailvaux, Simon P.

2016-01-01

Background With over 3,500 species encompassing a diverse range of morphologies and ecologies, snakes make up 36% of squamate diversity. Despite several attempts at estimating higher-level snake relationships and numerous assessments of generic- or species-level phylogenies, a large-scale species-level phylogeny solely focusing on snakes has not been completed. Here, we provide the largest-yet estimate of the snake tree of life using maximum likelihood on a supermatrix of 1745 taxa (1652 snake species + 7 outgroup taxa) and 9,523 base pairs from 10 loci (5 nuclear, 5 mitochondrial), including previously unsequenced genera (2) and species (61). Results Increased taxon sampling resulted in a phylogeny with a new higher-level topology and corroborate many lower-level relationships, strengthened by high nodal support values (> 85%) down to the species level (73.69% of nodes). Although the majority of families and subfamilies were strongly supported as monophyletic with > 88% support values, some families and numerous genera were paraphyletic, primarily due to limited taxon and loci sampling leading to a sparse supermatrix and minimal sequence overlap between some closely-related taxa. With all rogue taxa and incertae sedis species eliminated, higher-level relationships and support values remained relatively unchanged, except in five problematic clades. Conclusion Our analyses resulted in new topologies at higher- and lower-levels; resolved several previous topological issues; established novel paraphyletic affiliations; designated a new subfamily, Ahaetuliinae, for the genera Ahaetulla, Chrysopelea, Dendrelaphis, and Dryophiops; and appointed Hemerophis (Coluber) zebrinus to a new genus, Mopanveldophis. Although we provide insight into some distinguished problematic nodes, at the deeper phylogenetic scale, resolution of these nodes may require sampling of more slowly-evolving nuclear genes. PMID:27603205

First record of the subfamily Anoplophilinae (Orthoptera: Rhaphidophoridae) from Russia with description of a new species of the genus Alpinanoplophilus Ishikawa, 1993.

PubMed

Storozhenko, Sergey Yu

2015-06-17

The subfamily Anoplophilinae (Rhaphidophopridae) is recorded from Russia for the first time. Alpinanoplophilus kurilensis Storozhenko, sp. nov. is described from Kunashir Island. The holotype of the new species is deposited in the Zoological Institute of Russian Academy of Science (St. Petersburg, Russia). A revised key to the species of the genus Alpinanoplophilus Ishikawa, 1993 is provided.

PHISTc protein family members localize to different subcellular organelles and bind Plasmodium falciparum major virulence factor PfEMP-1.

PubMed

Kumar, Vikash; Kaur, Jasweer; Singh, Amrit P; Singh, Vineeta; Bisht, Anjali; Panda, Jiban J; Mishra, Prakash C; Hora, Rachna

2018-01-01

Plasmodium falciparum encodes a novel repertoire of the Plasmodium helical interspersed subtelomeric (PHIST) family of exported proteins, which play diverse roles in infected red blood cells, contributing to malaria pathogenesis. PHIST proteins are central to parasite biology and modify human erythrocytes by interacting with parasite and host proteins. Here, we have attempted to understand the localization and function of two unexplored proteins of the PHISTc subfamily, PFD1140w and PF11_0503, and compared these with a well-characterized member, PFI1780w. We demonstrate that Phist domains assume different oligomeric states owing to a distinct array of subunit interface residues. Colocalization of a Maurer's cleft signature protein, P. falciparum skeleton-binding protein-1 (PfSBP-1), and P. falciparum erythrocyte membrane protein-1 (PfEMP-1) revealed different subcellular destinations for these PHIST members. We further show the binding of recombinant PHIST proteins to the cytoplasmic tail of PfEMP-1 and a novel interaction with PfSBP-1. Interestingly, PFD1140w interacts with PfEMP-1 and PfSBP-1 simultaneously in vitro leading to formation of a complex. These two distant PHISTc members also bind PfEMP-1 on distinct sites, despite sharing the Phist domain. Our data re-emphasize a supportive role for PHIST proteins in cytoadhesion, and identify a new binding partner, PfSBP-1, for members of this family. This information therefore adds another chapter to the understanding of P. falciparum biology and highlights the significance of the unexplored PHIST family. © 2017 Federation of European Biochemical Societies.

"Phylogenetic and evolutionary analysis of functional divergence among Gamma glutamyl transpeptidase (GGT) subfamilies".

PubMed

Verma, Ved Vrat; Gupta, Rani; Goel, Manisha

2015-09-14

γ-glutamyltranspeptidase (GGT) is a bi-substrate enzyme conserved in all three domains of life. It catalyzes the cleavage and transfer of γ-glutamyl moiety of glutathione to either water (hydrolysis) or substrates like peptides (transpeptidation). GGTs exhibit great variability in their enzyme kinetics although the mechanism of catalysis is conserved. Recently, GGT has been shown to be a virulence factor in microbes like Helicobacter pylori and Bacillus anthracis. In mammalian cells also, GGT inhibition prior to chemotherapy has been shown to sensitize tumors to the therapy. Therefore, lately both bacterial and eukaryotic GGTs have emerged as potential drug targets, but the efforts directed towards finding suitable inhibitors have not yielded any significant results yet. We propose that delineating the residues responsible for the functional diversity associated with these proteins could help in design of species/clade specific inhibitors. In the present study, we have carried out phylogenetic analysis on a set of 47 GGT-like proteins to address the functional diversity. These proteins segregate into various subfamilies, forming separate clades on the tree. Sequence conservation and motif prediction studies show that even though most of the highly conserved residues have been characterized biochemically in previous studies, a significant number of novel putative sites and motifs are discovered that vary in a clade specific manner. Many of the putative sites predicted during the functional divergence type I and type II analysis, lie close to the known catalytic residues and line the walls of the substrate binding cavity, reinforcing their role in modulating the substrate specificity, catalytic rates and stability of this protein. The study offers interesting insights into the evolution of GGT-like proteins in pathogenic vs. non-pathogenic bacteria, archaea and eukaryotes. Our analysis delineates residues that are highly specific to each GGT subfamily. We propose

Periaqueductal gray glutamatergic, cannabinoid and vanilloid receptor interplay in defensive behavior and aversive memory formation.

PubMed

Back, Franklin P; Carobrez, Antonio P

2018-06-01

Stimulation of the midbrain periaqueductal gray matter (PAG) in humans elicits sensations of fear and impending terror, and mediates predator defensive responses in rodents. In rats, pharmacological stimulation of the dorsolateral portion of the PAG (dlPAG) with N-Methyl-d-Aspartate (NMDA) induces aversive conditioning that acts as an unconditioned stimulus (US). In the present work, we investigated the interplay between the vanilloid TRPV1 and cannabinoid CB1 receptors in the NMDA-dlPAG defensive response and in subsequent aversive learning. Rats were subjected to dlPAG NMDA infusion in an olfactory conditioned stimulus (CS) task allowing the evaluation of immediate and long-term defensive behavioral responses during CS presentation. The results indicated that an intermediate dose of NMDA (50 pmol) induced both immediate and long-term effects. A sub-effective dose of NMDA (25 pmol) was potentiated by the TRPV1 receptor agonist capsaicin (CAP, 1 nmol) and the CB1 receptor antagonist, AM251 (200 pmol). CAP (10 nmol) or the combination of CAP (1 nmol) and AM251 (200 pmol) induced long-term effects without increasing immediate defensive responses. The glutamate release inhibitor riluzole (2 or 4 nmol) and the AMPA/kainate receptor antagonist DNQX (2 or 4 nmol) potentiated the immediate effects but blocked the long-term effects. The results showed that immediate defensive responses rely on NMDA receptors, and aversive learning on the fine-tuning of TRPV1, CB1, metabotropic glutamate and AMPA receptors located in pre- and postsynaptic membranes. In conclusion, the activity of the dlPAG determines core affective aspects of aversive memory formation controlled by local TRPV1/CB1 balance. Copyright © 2018 Elsevier Ltd. All rights reserved.

Ligand, receptor, and cell type-dependent regulation of ABCA1 and ABCG1 mRNA in prostate cancer epithelial cells

USDA-ARS?s Scientific Manuscript database

Recent evidence suggests that the liver X receptor (LXR) is a potential anti-cancer target in prostate carcinoma. There is little characterization, however, of how the two major isoforms LXRa or LXRß regulate the LXR-responsive genes ATP-binding cassette sub-family A 1 (ABCA1) and sub-family member ...

Molecular phylogeny of moth-specialized spider sub-family Cyrtarachninae, which includes bolas spiders.

PubMed

Tanikawa, Akio; Shinkai, Akira; Miyashita, Tadashi

2014-11-01

The evolutionary process of the unique web architectures of spiders of the sub-family Cyrtarachninae, which includes the triangular web weaver, bolas spider, and webless spider, is thought to be derived from reduction of orbicular 'spanning-thread webs' resembling ordinal orb webs. A molecular phylogenetic analysis was conducted to explore this hypothesis using orbicular web spiders Cyrtarachne, Paraplectana, Poecilopachys, triangular web spider Pasilobus, bolas spiders Ordgarius and Mastophora, and webless spider Celaenia. The phylogeny inferred from partial sequences of mt-COI, nuclear 18S-rRNA and 28S-rRNA showed that the common ancestor of these spiders diverged into two clades: a spanning-thread web clade and a bolas or webless clade. This finding suggests that the triangular web evolved by reduction of an orbicular spanning web, but that bolas spiders evolved in the early stage, which does not support the gradual web reduction hypothesis.

Developmental morphology of flattened shoots in Dalzellia ubonensis and Indodalzellia gracilis with implications for the evolution of diversified shoot morphologies in the subfamily Tristichoideae (Podostemaceae).

PubMed

Fujinami, Rieko; Imaichi, Ryoko

2015-06-01

Podostemaceae is a unique family of aquatic angiosperms that grow in swift-running water on rock surfaces in the tropics. Their plant bodies show a remarkable adaptation: the main plant body is mostly creeping or flattened, or in extreme cases foliose, functioning as an adhering and photosynthetic organ. In the subfamily Podostemoideae, the root is foliose, whereas in the subfamily Tristichoideae, the shoot is foliose. An evolutionary scenario for the foliose root has already been proposed, but that for the foliose shoot remains to be addressed. Shoots of Indodalzellia gracilis and Dalzellia ubonensis (subfamily Tristichoideae) were observed using light microscopy and scanning electron microscopy. Gene expression patterns of orthologs of marker genes for the shoot apical meristem, i.e., SHOOT MERISTEMLESS and WUSCHEL, in D. ubonensis were analyzed. When very young, the phyllotaxis is tristichous in both genera: a set of one dorsal and two marginal leaves forms. When the shoot branches, extra-axillary buds of two subsequent marginal leaves form as new (lateral) shoots, and the original shoot stops growing; this growth pattern is called sympodial branching. Due to zonal growth in the common zone just below the original and lateral shoot apices, flattened or foliose shoots result. The expression patterns of DuSTM and DuWUS in the shoot apices of Dalzellia were similar to those published for Terniopsis. The foliose shoots of Indodalzellia and Dalzellia evolved as a result of congenital fusion among several original and lateral branches, each of which grows separately in other Tristichoideae. © 2015 Botanical Society of America, Inc.

Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme.

PubMed

Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M

1999-07-01

The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.

Short-term increases in transient receptor potential vanilloid-1 mediate stress-induced enhancement of neuronal excitation.

PubMed

Weitlauf, Carl; Ward, Nicholas J; Lambert, Wendi S; Sidorova, Tatiana N; Ho, Karen W; Sappington, Rebecca M; Calkins, David J

2014-11-12

Progression of neurodegeneration in disease and injury is influenced by the response of individual neurons to stressful stimuli and whether this response includes mechanisms to counter declining function. Transient receptor potential (TRP) cation channels transduce a variety of disease-relevant stimuli and can mediate diverse stress-dependent changes in physiology, both presynaptic and postsynaptic. Recently, we demonstrated that knock-out or pharmacological inhibition of the TRP vanilloid-1 (TRPV1) capsaicin-sensitive subunit accelerates degeneration of retinal ganglion cell neurons and their axons with elevated ocular pressure, the critical stressor in the most common optic neuropathy, glaucoma. Here we probed the mechanism of the influence of TRPV1 on ganglion cell survival in mouse models of glaucoma. We found that induced elevations of ocular pressure increased TRPV1 in ganglion cells and its colocalization at excitatory synapses to their dendrites, whereas chronic elevation progressively increased ganglion cell Trpv1 mRNA. Enhanced TRPV1 expression in ganglion cells was transient and supported a reversal of the effect of TRPV1 on ganglion cells from hyperpolarizing to depolarizing, which was also transient. Short-term enhancement of TRPV1-mediated activity led to a delayed increase in axonal spontaneous excitation that was absent in ganglion cells from Trpv1(-/-) retina. In isolated ganglion cells, pharmacologically activated TRPV1 mobilized to discrete nodes along ganglion cell dendrites that corresponded to sites of elevated Ca(2+). These results suggest that TRPV1 may promote retinal ganglion cell survival through transient enhancement of local excitation and axonal activity in response to ocular stress. Copyright © 2014 the authors 0270-6474/14/3415369-13$15.00/0.

Forsythoside A exerts antipyretic effect on yeast-induced pyrexia mice via inhibiting transient receptor potential vanilloid 1 function

PubMed Central

Liu, Cuiling; Su, Hongchang; Wan, Hongye; Qin, Qingxia; Wu, Xuan; Kong, Xiangying; Lin, Na

2017-01-01

Transient receptor potential vanilloid 1 (TRPV1) is a non-selective cation channel gated by noxious heat, playing major roles in thermoregulation. Forsythoside A (FT-A) is the most abundant phenylethanoid glycosides in Fructus Forsythiae, which has been prescribed as a medicinal herb for treating fever in China for a long history. However, how FT-A affects pyrexia and what is the underlying molecular mechanism remain largely unknown. Here we found that FT-A exerted apparent antipyretic effect through decreasing the levels of prostaglandin E2 (PGE2) and interleukin 8 (IL-8) in a dose-dependent fashion on the yeast induced pyrexia mice. Interestingly, FT-A significantly downregulated TRPV1 expression in the hypothalamus and dorsal root ganglion (DRG) of the yeast induced pyrexia mice. Moreover, FT-A inhibited IL-8 and PGE2 secretions, and calcium influx in the HEK 293T-TRPV1 cells after stimulated with capsaicin, the specific TRPV1 agonist. Further investigation of the molecular mechanisms revealed that FT-A treatment rapidly inhibited phosphorylation of extracellular signal-regulated kinase (ERK), Jun N-terminal kinase (JNK) and p38 in both yeast induced pyrexia mice and HEK 293T-TRPV1 cells. These results suggest that FT-A may serve as a potential antipyretic agent and the therapeutic action of Fructus Forsythiae on pyretic related disease is, in part, due to the FT-A activities. PMID:28123347

Alateen Members' and Non-Members' Understanding of Alcoholism.

ERIC Educational Resources Information Center

Weber, Joseph A.; McCormick, Peggy

1992-01-01

Alateen (n=49) and non-Alateen (n=52) members were compared on knowledge and understanding of alcoholism. Results indicated Alateen members understood alcoholism as family disease and alcoholism as treatable. Alateen members suggested educational curriculum with message of successful treatment for alcoholic, whereas non-Alateen members stressed…

Nerve Growth Factor Regulates Transient Receptor Potential Vanilloid 2 via Extracellular Signal-Regulated Kinase Signaling To Enhance Neurite Outgrowth in Developing Neurons

PubMed Central

Cohen, Matthew R.; Johnson, William M.; Pilat, Jennifer M.; Kiselar, Janna; DeFrancesco-Lisowitz, Alicia; Zigmond, Richard E.

2015-01-01

Neurite outgrowth is key to the formation of functional circuits during neuronal development. Neurotrophins, including nerve growth factor (NGF), increase neurite outgrowth in part by altering the function and expression of Ca2+-permeable cation channels. Here we report that transient receptor potential vanilloid 2 (TRPV2) is an intracellular Ca2+-permeable TRPV channel upregulated by NGF via the mitogen-activated protein kinase (MAPK) signaling pathway to augment neurite outgrowth. TRPV2 colocalized with Rab7, a late endosome protein, in addition to TrkA and activated extracellular signal-regulated kinase (ERK) in neurites, indicating that the channel is closely associated with signaling endosomes. In line with these results, we showed that TRPV2 acts as an ERK substrate and identified the motifs necessary for phosphorylation of TRPV2 by ERK. Furthermore, neurite length, TRPV2 expression, and TRPV2-mediated Ca2+ signals were reduced by mutagenesis of these key ERK phosphorylation sites. Based on these findings, we identified a previously uncharacterized mechanism by which ERK controls TRPV2-mediated Ca2+ signals in developing neurons and further establish TRPV2 as a critical intracellular ion channel in neuronal function. PMID:26416880

Sensory fibers containing vanilloid receptor-1 (VR-1) mediate spinal cord stimulation-induced vasodilation.

PubMed

Wu, Mingyuan; Komori, Naoka; Qin, Chao; Farber, Jay P; Linderoth, Bengt; Foreman, Robert D

2006-08-30

Spinal cord stimulation (SCS) is used to improve peripheral blood flow in selected populations of patients with ischemia of the extremities. Previous studies show that antidromic activation of sensory fibers is an important mechanism that contributes to SCS-induced vasodilation. However, the characteristics of sensory fibers involved in vasodilation are not fully known. This study investigated the contribution of vanilloid receptor type 1 (VR-1) containing fibers to SCS-induced vasodilation. A unipolar ball electrode was placed on the left dorsal column at the lumbar 2-3 spinal cord segments (L2-L3) in sodium pentobarbital anesthetized, paralyzed and ventilated rats. Cutaneous blood flows from both ipsilateral (left) and contralateral (right) hind foot pads were recorded with laser Doppler flow perfusion monitors. SCS (50 Hz; 0.2 ms) was applied through the ball electrode at 30%, 60%, 90% and 300% of motor threshold (MT). Resiniferatoxin (RTX), an ultra potent analog of capsaicin and VR-1 receptor agonist, was used to suppress the activities of VR-1 containing sensory fibers. SCS at 30%, 60%, 90% and also at 300% of MT significantly increased cutaneous blood flow in the ipsilateral foot pad compared to that in the contralateral side. RTX (2 microg/kg, i.v.) significantly attenuated SCS-induced vasodilation of the ipsilateral side (P<0.05, n=7) compared with responses prior to RTX administration. A pledget of cotton soaked with RTX (2 microg/ml) placed on L2-L3 spinal cord significantly decreased SCS-induced vasodilation of the ipsilateral side at 30%, 60%, 90% and 300% of MT (P<0.05, n=7) compared with responses prior to RTX administration. Additionally, topical application of a pledget of cotton soaked with RTX (2 microg/ml) on the sciatic nerve at the middle level of the thigh or on the tibial nerve at the lower level of the lower hindlimb also decreased SCS-induced vasodilation (n=5). SCS-induced vasodilation is predominantly mediated via VR-1 containing sensory

iNR-PhysChem: A Sequence-Based Predictor for Identifying Nuclear Receptors and Their Subfamilies via Physical-Chemical Property Matrix

PubMed Central

Xiao, Xuan; Wang, Pu; Chou, Kuo-Chen

2012-01-01

Nuclear receptors (NRs) form a family of ligand-activated transcription factors that regulate a wide variety of biological processes, such as homeostasis, reproduction, development, and metabolism. Human genome contains 48 genes encoding NRs. These receptors have become one of the most important targets for therapeutic drug development. According to their different action mechanisms or functions, NRs have been classified into seven subfamilies. With the avalanche of protein sequences generated in the postgenomic age, we are facing the following challenging problems. Given an uncharacterized protein sequence, how can we identify whether it is a nuclear receptor? If it is, what subfamily it belongs to? To address these problems, we developed a predictor called iNR-PhysChem in which the protein samples were expressed by a novel mode of pseudo amino acid composition (PseAAC) whose components were derived from a physical-chemical matrix via a series of auto-covariance and cross-covariance transformations. It was observed that the overall success rate achieved by iNR-PhysChem was over 98% in identifying NRs or non-NRs, and over 92% in identifying NRs among the following seven subfamilies: NR1thyroid hormone like, NR2HNF4-like, NR3estrogen like, NR4nerve growth factor IB-like, NR5fushi tarazu-F1 like, NR6germ cell nuclear factor like, and NR0knirps like. These rates were derived by the jackknife tests on a stringent benchmark dataset in which none of protein sequences included has pairwise sequence identity to any other in a same subset. As a user-friendly web-server, iNR-PhysChem is freely accessible to the public at either http://www.jci-bioinfo.cn/iNR-PhysChem or http://icpr.jci.edu.cn/bioinfo/iNR-PhysChem. Also a step-by-step guide is provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics involved in developing the predictor. It is anticipated that iNR-PhysChem may become a useful high throughput tool

Measurement of Basal and Forskolin-stimulated Lipolysis in Inguinal Adipose Fat Pads.

PubMed

Baskaran, Padmamalini; Thyagarajan, Baskaran

2017-07-21

Lipolysis is a process by which the lipid stored as triglycerides in adipose tissues are hydrolyzed into glycerol and fatty acids. This article describes the method for the measurement of basal and forskolin (FSK)-stimulated lipolysis in the inguinal fat pads isolated from wild type mice fed either normal chow diet (NCD), high fat diet (HFD) or a high fat diet containing 0.01% of capsaicin (CAP; transient receptor potential vanilloid subfamily 1 (TRPV1) agonist) for 32 weeks. The method described here for performing ex vivo lipolysis is adopted from Schweiger et al. 1 We present a detailed protocol for measuring glycerol levels by UV-Visible (UV/VIS) spectrophotometry. The method described here can be used to successfully isolate inguinal fat pads for lipolysis measurements to obtain consistent results. The protocol described for inguinal fat pads can readily be extended to measure lipolysis in other tissues.

pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families

PubMed Central

Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Švedas, Vytas

2014-01-01

The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure–function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. PMID:24852248

A single amino acid substitution in IIIf subfamily of basic helix-loop-helix transcription factor AtMYC1 leads to trichome and root hair patterning defects by abolishing its interaction with partner proteins in Arabidopsis.

PubMed

Zhao, Hongtao; Wang, Xiaoxue; Zhu, Dandan; Cui, Sujuan; Li, Xia; Cao, Ying; Ma, Ligeng

2012-04-20

Plant trichomes and root hairs are powerful models for the study of cell fate determination. In Arabidopsis thaliana, trichome and root hair initiation requires a combination of three groups of proteins, including the WD40 repeat protein transparent TESTA GLABRA1 (TTG1), R2R3 repeat MYB protein GLABRA1 (GL1), or werewolf (WER) and the IIIf subfamily of basic helix-loop-helix (bHLH) protein GLABRA3 (GL3) or enhancer of GLABRA3 (EGL3). The bHLH component acts as a docking site for TTG1 and MYB proteins. Here, we isolated a mutant showing defects in trichome and root hair patterning that carried a point mutation (R173H) in AtMYC1 that encodes the fourth member of IIIf bHLH family protein. Genetic analysis revealed partial redundant yet distinct function between AtMYC1 and GL3/EGL3. GLABRA2 (GL2), an important transcription factor involved in trichome and root hair control, was down-regulated in Atmyc1 plants, suggesting the requirement of AtMYC1 for appropriate GL2 transcription. Like its homologs, AtMYC1 formed a complex with TTG1 and MYB proteins but did not dimerized. In addition, the interaction of AtMYC1 with MYB proteins and TTG1 was abrogated by the R173H substitution in Atmyc1-1. We found that this amino acid (Arg) is conserved in the AtMYC1 homologs GL3/EGL3 and that it is essential for their interaction with MYB proteins and for their proper functions. Our findings indicate that AtMYC1 is an important regulator of trichome and root hair initiation, and they reveal a novel amino acid necessary for protein-protein interactions and gene function in IIIf subfamily bHLH transcription factors.

A Single Amino Acid Substitution in IIIf Subfamily of Basic Helix-Loop-Helix Transcription Factor AtMYC1 Leads to Trichome and Root Hair Patterning Defects by Abolishing Its Interaction with Partner Proteins in Arabidopsis*

PubMed Central

Zhao, Hongtao; Wang, Xiaoxue; Zhu, Dandan; Cui, Sujuan; Li, Xia; Cao, Ying; Ma, Ligeng

2012-01-01

Plant trichomes and root hairs are powerful models for the study of cell fate determination. In Arabidopsis thaliana, trichome and root hair initiation requires a combination of three groups of proteins, including the WD40 repeat protein TRANSPARENT TESTA GLABRA1 (TTG1), R2R3 repeat MYB protein GLABRA1 (GL1), or WEREWOLF (WER) and the IIIf subfamily of basic helix-loop-helix (bHLH) protein GLABRA3 (GL3) or ENHANCER OF GLABRA3 (EGL3). The bHLH component acts as a docking site for TTG1 and MYB proteins. Here, we isolated a mutant showing defects in trichome and root hair patterning that carried a point mutation (R173H) in AtMYC1 that encodes the fourth member of IIIf bHLH family protein. Genetic analysis revealed partial redundant yet distinct function between AtMYC1 and GL3/EGL3. GLABRA2 (GL2), an important transcription factor involved in trichome and root hair control, was down-regulated in Atmyc1 plants, suggesting the requirement of AtMYC1 for appropriate GL2 transcription. Like its homologs, AtMYC1 formed a complex with TTG1 and MYB proteins but did not dimerized. In addition, the interaction of AtMYC1 with MYB proteins and TTG1 was abrogated by the R173H substitution in Atmyc1-1. We found that this amino acid (Arg) is conserved in the AtMYC1 homologs GL3/EGL3 and that it is essential for their interaction with MYB proteins and for their proper functions. Our findings indicate that AtMYC1 is an important regulator of trichome and root hair initiation, and they reveal a novel amino acid necessary for protein-protein interactions and gene function in IIIf subfamily bHLH transcription factors. PMID:22334670

The Search for Therapeutic Bacteriophages Uncovers One New Subfamily and Two New Genera of Pseudomonas-Infecting Myoviridae

PubMed Central

Henry, Marine; Bobay, Louis-Marie; Chevallereau, Anne; Saussereau, Emilie; Ceyssens, Pieter-Jan; Debarbieux, Laurent

2015-01-01

In a previous study, six virulent bacteriophages PAK_P1, PAK_P2, PAK_P3, PAK_P4, PAK_P5 and CHA_P1 were evaluated for their in vivo efficacy in treating Pseudomonas aeruginosa infections using a mouse model of lung infection. Here, we show that their genomes are closely related to five other Pseudomonas phages and allow a subdivision into two clades, PAK_P1-like and KPP10-like viruses, based on differences in genome size, %GC and genomic contents, as well as number of tRNAs. These two clades are well delineated, with a mean of 86% and 92% of proteins considered homologous within individual clades, and 25% proteins considered homologous between the two clades. By ESI-MS/MS analysis we determined that their virions are composed of at least 25 different proteins and electron microscopy revealed a morphology identical to the hallmark Salmonella phage Felix O1. A search for additional bacteriophage homologs, using profiles of protein families defined from the analysis of the 11 genomes, identified 10 additional candidates infecting hosts from different species. By carrying out a phylogenetic analysis using these 21 genomes we were able to define a new subfamily of viruses, the Felixounavirinae within the Myoviridae family. The new Felixounavirinae subfamily includes three genera: Felixounalikevirus, PAK_P1likevirus and KPP10likevirus. Sequencing genomes of bacteriophages with therapeutic potential increases the quantity of genomic data on closely related bacteriophages, leading to establishment of new taxonomic clades and the development of strategies for analyzing viral genomes as presented in this article. PMID:25629728

Prevalence of LuxR- and LuxI-type quorum sensing circuits in members of the Populus deltoides microbiome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schaefer, Amy L; Lappala, Colin; Morlen, Ryan

2013-01-01

We are interested in the root microbiome of the fast-growing Eastern cottonwood tree, Populus 25 deltoides. There is a large bank of bacterial isolates from P. deltoides and there are 44 draft 26 genomes of bacterial endophyte and rhizosphere isolates. As a first step in efforts to understand 27 the roles of bacterial communication and plant-bacterial signaling in P. deltoides we focused on 28 the prevalence of acyl-homoserine lactone (AHL) quorum sensing signal production and 29 reception in members of the P. deltoides microbiome. We screened 129 bacterial isolates for 30 AHL production using a broad-spectrum bioassay that responds tomore » many but not all AHLs, and 31 we queried the available genome sequences of microbiome isolates for homologs of AHL 32 synthase and receptor genes. AHL signal production was detected in 40% of 129 strains tested. 33 Positive isolates included -, - and -Proteobacteria. Members of the luxI family of AHL 34 synthases were identified in 18 of 39 Proteobacteria genomes including genomes of some 35 isolates that tested negative in the bioassay. Members of the luxR family of transcription factors, 36 that include AHL-responsive factors, were more abundant than luxI homologs. There were 72 in 37 the 39 Proteobacteria genomes. Some of the luxR homologs appear to be members of a 38 subfamily of LuxRs that respond to as yet unknown plant signals rather than bacterial AHLs. 39 Apparently, there is a substantial capacity for AHL cell-to-cell communication in Proteobacteria 40 of the P. deltoides microbiota and there are also Proteobacteria with LuxR homologs of the type 41 hypothesized to respond to plant signals or cues.« less

Structure and Activity Analyses of Escherichia coli K-12 NagD Provide Insight into the Evolution of Biochemical Function in the Haloakanoic Acid Dehlogenase Superfamily

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay,L.; Dunaway-Mariano, D.; Allen, K.

2006-01-01

The HAD superfamily is a large superfamily of proteins which share a conserved core domain that provides those active site residues responsible for the chemistry common to all family members. The superfamily is further divided into the four subfamilies I, IIA, IIB, and III, based on the topology and insertion site of a cap domain that provides substrate specificity. This structural and functional division implies that members of a given HAD structural subclass may target substrates that have similar structural characteristics. To understand the structure/function relationships in all of the subfamilies, a type IIA subfamily member, NagD from Escherichia colimore » K-12, was selected (type I, IIB, and III members have been more extensively studied). The structure of the NagD protein was solved to 1.80 Angstroms with R{sub work} = 19.8% and R{sub free} = 21.8%. Substrate screening and kinetic analysis showed NagD to have high specificity for nucleotide monophosphates with kcat/Km = 3.12 x 10{sup 4} and 1.28 x 10{sup 4} {micro}M{sup -1} s{sup -1} for UMP and GMP, respectively. This specificity is consistent with the presence of analogues of NagD that exist as fusion proteins with a nucleotide pyrophosphatase from the Nudix family. Docking of the nucleoside substrate in the active site brings it in contact with conserved residues from the cap domain that can act as a substrate specificity loop (NagD residues 144-149) in the type IIA subfamily. NagD and other subfamily IIA and IIB members show the common trait that substrate specificity and catalytic efficiencies (k{sub cat}/K{sub m}) are low (1 x 10{sup 4} M{sup -1} s{sup -1}) and the boundaries defining physiological substrates are somewhat overlapping. The ability to catabolize other related secondary metabolites indicates that there is regulation at the genetic level.« less

Sea snakes in Australian waters (Serpentes: subfamilies Hydrophiinae and Laticaudinae)--a review with an updated identification key.

PubMed

Rasmussen, Arne Redsted; Sanders, Kate Laura; Guinea, Michael L; Amey, Andrew P

2014-10-02

Sea snakes (Elapidae, subfamilies Hydrophiinae and Laticaudinae) reach high species richness in the South China Sea and in the Australian region; however, most countries in the two regions still lack up-to-date checklists and identification tools for these snakes. We present an updated reviewed checklist and a new complete identification key to sea snakes in Australian waters. The identification key includes 29 species documented and 4 possibly occurring taxa and is based mostly on easy-to-use external characters. We find no evidence for breeding populations of Laticauda in Australian waters, but include the genus on the list of possibly occurring taxa. 

The Compromised Recognition of Turnip Crinkle Virus1 Subfamily of Microrchidia ATPases Regulates Disease Resistance in Barley to Biotrophic and Necrotrophic Pathogens1[C][W][OPEN

PubMed Central

Langen, Gregor; von Einem, Sabrina; Koch, Aline; Imani, Jafargholi; Pai, Subhash B.; Manohar, Murli; Ehlers, Katrin; Choi, Hyong Woo; Claar, Martina; Schmidt, Rebekka; Mang, Hyung-Gon; Bordiya, Yogendra; Kang, Hong-Gu; Klessig, Daniel F.; Kogel, Karl-Heinz

2014-01-01

MORC1 and MORC2, two of the seven members of the Arabidopsis (Arabidopsis thaliana) Compromised Recognition of Turnip Crinkle Virus1 subfamily of microrchidia Gyrase, Heat Shock Protein90, Histidine Kinase, MutL (GHKL) ATPases, were previously shown to be required in multiple layers of plant immunity. Here, we show that the barley (Hordeum vulgare) MORCs also are involved in disease resistance. Genome-wide analyses identified five MORCs that are 37% to 48% identical on the protein level to AtMORC1. Unexpectedly, and in clear contrast to Arabidopsis, RNA interference-mediated knockdown of MORC in barley resulted in enhanced basal resistance and effector-triggered, powdery mildew resistance locus A12-mediated resistance against the biotrophic powdery mildew fungus (Blumeria graminis f. sp. hordei), while MORC overexpression decreased resistance. Moreover, barley knockdown mutants also showed higher resistance to Fusarium graminearum. Barley MORCs, like their Arabidopsis homologs, contain the highly conserved GHKL ATPase and S5 domains, which identify them as members of the MORC superfamily. Like AtMORC1, barley MORC1 (HvMORC1) binds DNA and has Mn2+-dependent endonuclease activities, suggesting that the contrasting function of MORC1 homologs in barley versus Arabidopsis is not due to differences in their enzyme activities. In contrast to AtMORCs, which are involved in silencing of transposons that are largely restricted to pericentromeric regions, barley MORC mutants did not show a loss-of-transposon silencing regardless of their genomic location. Reciprocal overexpression of MORC1 homologs in barley and Arabidopsis showed that AtMORC1 and HvMORC1 could not restore each other’s function. Together, these results suggest that MORC proteins function as modulators of immunity, which can act negatively (barley) or positively (Arabidopsis) dependent on the species. PMID:24390392

A new subfamily LIP of the major intrinsic proteins.

PubMed

Khabudaev, Kirill Vladimirovich; Petrova, Darya Petrovna; Grachev, Mikhail Aleksandrovich; Likhoshway, Yelena Valentinovna

2014-03-04

Proteins of the major intrinsic protein (MIP) family, or aquaporins, have been detected in almost all organisms. These proteins are important in cells and organisms because they allow for passive transmembrane transport of water and other small, uncharged polar molecules. We compared the predicted amino acid sequences of 20 MIPs from several algae species of the phylum Heterokontophyta (Kingdom Chromista) with the sequences of MIPs from other organisms. Multiple sequence alignments revealed motifs that were homologous to functionally important NPA motifs and the so-called ar/R-selective filter of glyceroporins and aquaporins. The MIP sequences of the studied chromists fell into several clusters that belonged to different groups of MIPs from a wide variety of organisms from different Kingdoms. Two of these proteins belong to Plasma membrane intrinsic proteins (PIPs), four of them belong to GlpF-like intrinsic proteins (GIPs), and one of them belongs to a specific MIPE subfamily from green algae. Three proteins belong to the unclassified MIPs, two of which are of bacterial origin. Eight of the studied MIPs contain an NPM-motif in place of the second conserved NPA-motif typical of the majority of MIPs. The MIPs of heterokonts within all detected clusters can differ from other MIPs in the same cluster regarding the structure of the ar/R-selective filter and other generally conserved motifs. We proposed placing nine MIPs from heterokonts into a new group, which we have named the LIPs (large intrinsic proteins). The possible substrate specificities of the studied MIPs are discussed.

A framework for classification of prokaryotic protein kinases.

PubMed

Tyagi, Nidhi; Anamika, Krishanpal; Srinivasan, Narayanaswamy

2010-05-26

Overwhelming majority of the Serine/Threonine protein kinases identified by gleaning archaeal and eubacterial genomes could not be classified into any of the well known Hanks and Hunter subfamilies of protein kinases. This is owing to the development of Hanks and Hunter classification scheme based on eukaryotic protein kinases which are highly divergent from their prokaryotic homologues. A large dataset of prokaryotic Serine/Threonine protein kinases recognized from genomes of prokaryotes have been used to develop a classification framework for prokaryotic Ser/Thr protein kinases. We have used traditional sequence alignment and phylogenetic approaches and clustered the prokaryotic kinases which represent 72 subfamilies with at least 4 members in each. Such a clustering enables classification of prokaryotic Ser/Thr kinases and it can be used as a framework to classify newly identified prokaryotic Ser/Thr kinases. After series of searches in a comprehensive sequence database we recognized that 38 subfamilies of prokaryotic protein kinases are associated to a specific taxonomic level. For example 4, 6 and 3 subfamilies have been identified that are currently specific to phylum proteobacteria, cyanobacteria and actinobacteria respectively. Similarly subfamilies which are specific to an order, sub-order, class, family and genus have also been identified. In addition to these, we also identify organism-diverse subfamilies. Members of these clusters are from organisms of different taxonomic levels, such as archaea, bacteria, eukaryotes and viruses. Interestingly, occurrence of several taxonomic level specific subfamilies of prokaryotic kinases contrasts with classification of eukaryotic protein kinases in which most of the popular subfamilies of eukaryotic protein kinases occur diversely in several eukaryotes. Many prokaryotic Ser/Thr kinases exhibit a wide variety of modular organization which indicates a degree of complexity and protein-protein interactions in the

Effects of piperine, the pungent component of black pepper, at the human vanilloid receptor (TRPV1)

PubMed Central

McNamara, Fergal N; Randall, Andrew; Gunthorpe, Martin J

2005-01-01

We have characterised the effects of piperine, a pungent alkaloid found in black pepper, on the human vanilloid receptor TRPV1 using whole-cell patch-clamp electrophysiology. Piperine produced a clear agonist activity at the human TRPV1 receptor yielding rapidly activating whole-cell currents that were antagonised by the competitive TRPV1 antagonist capsazepine and the non-competitive TRPV1 blocker ruthenium red. The current–voltage relationship of piperine-activated currents showed pronounced outward rectification (25±4-fold between −70 and +70 mV) and a reversal potential of 0.0±0.4 mV, which was indistinguishable from that of the prototypical TRPV1 agonist capsaicin. Although piperine was a less potent agonist (EC50=37.9±1.9 μM) than capsaicin (EC50=0.29±0.05 μM), it demonstrated a much greater efficacy (approximately two-fold) at TRPV1. This difference in efficacy did not appear to be related to the proton-mediated regulation of the receptor since a similar degree of potentiation was observed for responses evoked by piperine (230±20%, n=11) or capsaicin (284±32%, n=8) upon acidification to pH 6.5. The effects of piperine upon receptor desensitisation were also unable to explain this effect since piperine resulted in more pronounced macroscopic desensitisation (t1/2=9.9±0.7 s) than capsaicin (t1/2>20 s) and also caused greater tachyphylaxis in response to repetitive agonist applications. Overall, our data suggest that the effects of piperine at human TRPV1 are similar to those of capsaicin except for its propensity to induce greater receptor desensitisation and, rather remarkably, exhibit a greater efficacy than capsaicin itself. These results may provide insight into the TRPV1-mediated effects of piperine on gastrointestinal function. PMID:15685214

Molecular Evolution and Expansion Analysis of the NAC Transcription Factor in Zea mays

PubMed Central

Fan, Kai; Wang, Ming; Miao, Ying; Ni, Mi; Bibi, Noreen; Yuan, Shuna; Li, Feng; Wang, Xuede

2014-01-01

NAC (NAM, ATAF1, 2 and CUC2) family is a plant-specific transcription factor and it controls various plant developmental processes. In the current study, 124 NAC members were identified in Zea mays and were phylogenetically clustered into 13 distinct subfamilies. The whole genome duplication (WGD), especially an additional WGD event, may lead to expanding ZmNAC members. Different subfamily has different expansion rate, and NAC subfamily preference was found during the expansion in maize. Moreover, the duplication events might occur after the divergence of the lineages of Z. mays and S. italica, and segmental duplication seemed to be the dominant pattern for the gene duplication in maize. Furthermore, the expansion of ZmNAC members may be also related to gain and loss of introns. Besides, the restriction of functional divergence was discovered after most of the gene duplication events. These results could provide novel insights into molecular evolution and expansion analysis of NAC family in maize, and advance the NAC researches in other plants, especially polyploid plants. PMID:25369196

Expression of transient receptor potential vanilloid 1 (TRPV1) and 2 (TRPV2) in human peripheral blood.

PubMed

Saunders, Cassandra Im; Kunde, Dale A; Crawford, Amanda; Geraghty, Dominic P

2007-02-01

The vanilloid receptor family of cation channels includes the capsaicin-sensitive, proton- and heat-activated TRPV1 and noxious heat-activated TRPV2. The present study demonstrates both gene and protein expression of TRPV1 and TRPV2 in human peripheral blood cells (PBCs) using molecular and immunocytochemical techniques. Using reverse-transcription polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR (qRT-PCR), TRPV1 and TRPV2 mRNA was detected in mRNA isolated from human whole peripheral blood. Using qRT-PCR, TRPV2 mRNA was highly expressed in human whole blood isolates (9.33+/-1.19 x 10(4)copies per 10(6)copies of the housekeeping gene GAPDH), whereas TRPV1 message was detected at approximately 150-fold lower levels (638+/-121 copies per 10(6)copies GAPDH). At the protein level, TRPV1 and TRPV2 activity was determined immunocytochemically in a lymphocyte-enriched mononuclear cell preparation (83+/-2% lymphocytes). Cells were labelled with rabbit anti-TRPV1 or goat anti-TRPV2 (1:500) and subsequently labelled with goat Texas red- (TRPV1) or FITC-(TRPV2) conjugated secondary antibodies (1:1000). All cells demonstrated punctate TRPV1-immunoreactivity, which appeared to be on the plasma membrane and in the cytoplasm. In contrast, cells within subjects appeared to express the TRPV1 protein at varying intensities. TRPV2-immunoreactivity appeared diffuse. This is the first study to demonstrate the presence of both TRPV1 and TRPV2 in human peripheral lymphocytes. Further studies need to be undertaken in order to determine the role of TRPV channels in these cells.

pocketZebra: a web-server for automated selection and classification of subfamily-specific binding sites by bioinformatic analysis of diverse protein families.

PubMed

Suplatov, Dmitry; Kirilin, Eugeny; Arbatsky, Mikhail; Takhaveev, Vakil; Svedas, Vytas

2014-07-01

The new web-server pocketZebra implements the power of bioinformatics and geometry-based structural approaches to identify and rank subfamily-specific binding sites in proteins by functional significance, and select particular positions in the structure that determine selective accommodation of ligands. A new scoring function has been developed to annotate binding sites by the presence of the subfamily-specific positions in diverse protein families. pocketZebra web-server has multiple input modes to meet the needs of users with different experience in bioinformatics. The server provides on-site visualization of the results as well as off-line version of the output in annotated text format and as PyMol sessions ready for structural analysis. pocketZebra can be used to study structure-function relationship and regulation in large protein superfamilies, classify functionally important binding sites and annotate proteins with unknown function. The server can be used to engineer ligand-binding sites and allosteric regulation of enzymes, or implemented in a drug discovery process to search for potential molecular targets and novel selective inhibitors/effectors. The server, documentation and examples are freely available at http://biokinet.belozersky.msu.ru/pocketzebra and there are no login requirements. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Characterization of human ATP-binding cassette protein subfamily D reconstituted into proteoliposomes.

PubMed

Okamoto, Takumi; Kawaguchi, Kosuke; Watanabe, Shiro; Agustina, Rina; Ikejima, Toshiki; Ikeda, Keisuke; Nakano, Minoru; Morita, Masashi; Imanaka, Tsuneo

2018-02-19

In mammals, four ATP-binding cassette (ABC) proteins belonging to subfamily D have been identified. ABCD1‒3 are located on peroxisomal membrane and play an important role in the transportation of various fatty acid-CoA derivatives, including very long chain fatty acid-CoA, into peroxisomes. ABCD4 is located on lysosomal membrane and is suggested to be involved in the transport of vitamin B 12 from lysosomes to the cytosol. However, the precise transport mechanism by which these ABC transporters facilitate the import or export of substrate has yet to be well elucidated. In this study, the overexpression of human ABCD1‒4 in the methylotrophic yeast Pichia pastoris and a purification procedure were developed. The detergent-solubilized proteins were reconstituted into liposomes. ABCD1‒4 displayed stable ATPase activity, which was inhibited by AlF 3 . Furthermore, ABCD1‒4 were found to possess an equal levels of acyl-CoA thioesterase activity. Proteoliposomes is expected to be an aid in the further biochemical characterization of ABCD transporters. Copyright © 2018 Elsevier Inc. All rights reserved.

Subfamily-Specific Fluorescent Probes for Cysteine Proteases Display Dynamic Protease Activities during Seed Germination.

PubMed

Lu, Haibin; Chandrasekar, Balakumaran; Oeljeklaus, Julian; Misas-Villamil, Johana C; Wang, Zheming; Shindo, Takayuki; Bogyo, Matthew; Kaiser, Markus; van der Hoorn, Renier A L

2015-08-01

Cysteine proteases are an important class of enzymes implicated in both developmental and defense-related programmed cell death and other biological processes in plants. Because there are dozens of cysteine proteases that are posttranslationally regulated by processing, environmental conditions, and inhibitors, new methodologies are required to study these pivotal enzymes individually. Here, we introduce fluorescence activity-based probes that specifically target three distinct cysteine protease subfamilies: aleurain-like proteases, cathepsin B-like proteases, and vacuolar processing enzymes. We applied protease activity profiling with these new probes on Arabidopsis (Arabidopsis thaliana) protease knockout lines and agroinfiltrated leaves to identify the probe targets and on other plant species to demonstrate their broad applicability. These probes revealed that most commercially available protease inhibitors target unexpected proteases in plants. When applied on germinating seeds, these probes reveal dynamic activities of aleurain-like proteases, cathepsin B-like proteases, and vacuolar processing enzymes, coinciding with the remobilization of seed storage proteins. © 2015 American Society of Plant Biologists. All Rights Reserved.

Chemotypes and Biomarkers of Seven Species of New Caledonian Liverworts from the Bazzanioideae Subfamily.

PubMed

Métoyer, Benjamin; Lebouvier, Nicolas; Hnawia, Edouard; Herbette, Gaëtan; Thouvenot, Louis; Asakawa, Yoshinori; Nour, Mohammed; Raharivelomanana, Phila

2018-06-05

Volatile components of seven species of the Bazzanioideae sub-family (Lepidoziaceae) native to New Caledonia, including three endemic species ( Bazzania marginata , Acromastigum caledonicum and A. tenax ), were analyzed by GC-FID-MS in order to index these plants to known or new chemotypes. Detected volatile constituents in studied species were constituted mainly by sesquiterpene, as well as diterpene compounds. All so-established compositions cannot successfully index some of them to known chemotypes but afforded the discovery of new chemotypes such as cuparane/fusicoccane. The major component of B. francana was isolated and characterized as a new zierane-type sesquiterpene called ziera-12(13),10(14)-dien-5-ol ( 23 ). In addition, qualitative intraspecies variations of chemical composition were very important particularly for B. francana which possessed three clearly defined different compositions. We report here also the first phytochemical investigation of Acromastigum species. Moreover, crude diethyl ether extract of B. vitatta afforded a new bis(bibenzyl) called vittatin ( 51 ), for which a putative biosynthesis was suggested.

Are tender point injections beneficial: the role of tonic nociception in fibromyalgia.

PubMed

Staud, Roland

2006-01-01

Characteristic symptoms of fibromyalgia syndrome (FM) include widespread pain, fatigue, sleep abnormalities, and distress. FM patients show psychophysical evidence for mechanical, thermal, and electrical hyperalgesia. To fulfill FM criteria, the mechanical hyperalgesia needs to be widespread and present in at least 11 out of 18 well-defined body areas (tender points). Peripheral and central abnormalities of nociception have been described in FM and these changes may be relevant for the increased pain experienced by these patients. Important nociceptor systems in the skin and muscle seem to undergo profound changes in FM patients by yet unknown mechanisms. These changes may result from the release of algesic substances after muscle or other soft tissue injury. These pain mediators can sensitize important nociceptor systems, including the transient receptor potential channel, vanilloid subfamily member 1 (TRPV1), acid sensing ion channel (ASIC) receptors, and purino-receptors (P2X3). Subsequently, tissue mediators of inflammation and nerve growth factors can excite these receptors and cause substantial changes in pain sensitivity. FM pain is widespread and does not seem to be restricted to tender points (TP). It frequently comprises multiple areas of deep tissue pain (trigger points) with adjacent much larger areas of referred pain. Analgesia of areas of extensive nociceptive input has been found to provide often long lasting local as well as general pain relief. Thus interventions aimed at reducing local FM pain seem to be effective but need to focus less on tender points but more on trigger points (TrP) and other body areas of heightened pain and inflammation.

Altered profile of mRNA expression in atrioventricular node of streptozotocin-induced diabetic rats

PubMed Central

Howarth, Frank Christopher; Parekh, Khatija; Jayaprakash, Petrilla; Inbaraj, Edward Samuel; Oz, Murat; Dobrzynski, Halina; Adrian, Thomas Edward

2017-01-01

Prolonged action potential duration, reduced action potential firing rate, upstroke velocity and rate of diastolic depolarization have been demonstrated in atrioventricular node (AVN) cells from streptozotocin (STZ)-induced diabetic rats. To further clarify the molecular basis of these electrical disturbances, the mRNA profiles encoding a variety of proteins associated with the generation and conduction of electrical activity in the AVN, were evaluated in the STZ-induced diabetic rat heart. Expression of mRNA was measured in AVN biopsies using reverse transcription-quantitative polymerase chain reaction techniques. Notable differences in mRNA expression included upregulation of genes encoding membrane and intracellular Ca2+ transport, including solute carrier family 8 member A1, transient receptor potential channel 1, ryanodine receptor 2/3, hyperpolarization-activated cyclic-nucleotide 2 and 3, calcium channel voltage-dependent, β2 subunit and sodium channels 3a, 4a, 7a and 3b. In addition to this, potassium channels potassium voltage-gated channel subfamily A member 4, potassium channel calcium activated intermediate/small conductance subfamily N α member 2, potassium voltage-gated channel subfamily J members 3, 5, and 11, potassium channel subfamily K members 1, 2, 3 and natriuretic peptide B (BNP) were upregulated in AVN of STZ heart, compared with controls. Alterations in gene expression were associated with upregulation of various proteins including the inwardly rectifying, potassium channel Kir3.4, NCX1 and BNP. The present study demonstrated notable differences in the profile of mRNA encoding proteins associated with the generation, conduction and regulation of electrical signals in the AVN of the STZ-induced diabetic rat heart. These data will provide a basis for a substantial range of future studies to investigate whether variations in mRNA translate into alterations in electrophysiological function. PMID:28731153

The potentiating effect of calcitonin gene-related peptide on transient receptor potential vanilloid-1 activity and the electrophysiological responses of rat trigeminal neurons to nociceptive stimuli.

PubMed

Chatchaisak, Duangthip; Connor, Mark; Srikiatkhachorn, Anan; Chetsawang, Banthit

2018-05-01

Growing evidence suggests that calcitonin gene-related peptide (CGRP) participates in trigeminal nociceptive responses. However, the role of CGRP in sensitization or desensitization of nociceptive transduction remains poorly understood. In this study, we sought to further investigate the CGRP-induced up-regulation of transient receptor potential vanilloid-1 (TRPV1) and the responses of trigeminal neurons to nociceptive stimuli. Rat trigeminal ganglion (TG) organ cultures and isolated trigeminal neurons were incubated with CGRP. An increase in TRPV1 levels was observed in CGRP-incubated TG organ cultures. CGRP potentiated capsaicin-induced increase in phosphorylated CaMKII levels in the TG organ cultures. The incubation of the trigeminal neurons with CGRP significantly increased the inward currents in response to capsaicin challenge, and this effect was inhibited by co-incubation with the CGRP receptor antagonist, BIBN4068BS or the inhibitor of protein kinase A, H-89. These findings reveal that CGRP acting on trigeminal neurons may play a significant role in facilitating cellular events that contribute to the peripheral sensitization of the TG in nociceptive transmission.

Dopamine modulation of transient receptor potential vanilloid type 1 (TRPV1) receptor in dorsal root ganglia neurons.

PubMed

Chakraborty, Saikat; Rebecchi, Mario; Kaczocha, Martin; Puopolo, Michelino

2016-03-15

The transient receptor potential vanilloid type 1 (TRPV1) receptor plays a key role in the modulation of nociceptor excitability. To address whether dopamine can modulate the activity of TRPV1 channels in nociceptive neurons, the effects of dopamine and dopamine receptor agonists were tested on the capsaicin-activated current recorded from acutely dissociated small diameter (<27 μm) dorsal root ganglia (DRG) neurons. Dopamine or SKF 81297 (an agonist at D1/D5 receptors), caused inhibition of both inward and outward currents by ∼60% and ∼48%, respectively. The effect of SKF 81297 was reversed by SCH 23390 (an antagonist at D1/D5 receptors), confirming that it was mediated by activation of D1/D5 dopamine receptors. In contrast, quinpirole (an agonist at D2 receptors) had no significant effect on the capsaicin-activated current. Inhibition of the capsaicin-activated current by SKF 81297 was mediated by G protein coupled receptors (GPCRs), and highly dependent on external calcium. The inhibitory effect of SKF 81297 on the capsaicin-activated current was not affected when the protein kinase A (PKA) activity was blocked with H89, or when the protein kinase C (PKC) activity was blocked with bisindolylmaleimide II (BIM). In contrast, when the calcium-calmodulin-dependent protein kinase II (CaMKII) was blocked with KN-93, the inhibitory effect of SKF 81297 on the capsaicin-activated current was greatly reduced, suggesting that activation of D1/D5 dopamine receptors may be preferentially linked to CaMKII activity. We suggest that modulation of TRPV1 channels by dopamine in nociceptive neurons may represent a way for dopamine to modulate incoming noxious stimuli. © 2015 The Authors. The Journal of Physiology © 2015 The Physiological Society.

Ca2+ and calpain mediate capsaicin-induced ablation of axonal terminals expressing transient receptor potential vanilloid 1.

PubMed

Wang, Sheng; Wang, Sen; Asgar, Jamila; Joseph, John; Ro, Jin Y; Wei, Feng; Campbell, James N; Chung, Man-Kyo

2017-05-19

Capsaicin is an ingredient in spicy peppers that produces burning pain by activating transient receptor potential vanilloid 1 (TRPV1), a Ca 2+ -permeable ion channel in nociceptors. Capsaicin has also been used as an analgesic, and its topical administration is approved for the treatment of certain pain conditions. The mechanisms underlying capsaicin-induced analgesia likely involve reversible ablation of nociceptor terminals. However, the mechanisms underlying these effects are not well understood. To visualize TRPV1-lineage axons, a genetically engineered mouse model was used in which a fluorophore is expressed under the TRPV1 promoter. Using a combination of these TRPV1-lineage reporter mice and primary afferent cultures, we monitored capsaicin-induced effects on afferent terminals in real time. We found that Ca 2+ influx through TRPV1 is necessary for capsaicin-induced ablation of nociceptive terminals. Although capsaicin-induced mitochondrial Ca 2+ uptake was TRPV1-dependent, dissipation of the mitochondrial membrane potential, inhibition of the mitochondrial transition permeability pore, and scavengers of reactive oxygen species did not attenuate capsaicin-induced ablation. In contrast, MDL28170, an inhibitor of the Ca 2+ -dependent protease calpain, diminished ablation. Furthermore, overexpression of calpastatin, an endogenous inhibitor of calpain, or knockdown of calpain 2 also decreased ablation. Quantitative assessment of TRPV1-lineage afferents in the epidermis of the hind paws of the reporter mice showed that EGTA and MDL28170 diminished capsaicin-induced ablation. Moreover, MDL28170 prevented capsaicin-induced thermal hypoalgesia. These results suggest that TRPV1/Ca 2+ /calpain-dependent signaling plays a dominant role in capsaicin-induced ablation of nociceptive terminals and further our understanding of the molecular mechanisms underlying the effects of capsaicin on nociceptors. © 2017 by The American Society for Biochemistry and Molecular Biology

A possible participation of transient receptor potential vanilloid type 1 channels in the antidepressant effect of fluoxetine.

PubMed

Manna, Shyamshree S S; Umathe, Sudhir N

2012-06-15

The present study investigated the influence of transient receptor vanilloid type 1 (TRPV1) channel agonist (capsaicin) and antagonist (capsazepine) either alone or in combination with traditional antidepressant drug, fluoxetine; or a serotonin hydroxylase inhibitor, para-chlorophenylalanine; or a glutamate N-methyl-D-aspartate (NMDA) receptor agonist, NMDA on the forced swim test and tail suspension test using male Swiss mice. Results revealed that intracerebroventricular injections of capsaicin (200 and 300 μg/mouse) and capsazepine (100 and 200 μg/mouse) reduced the immobility time, exhibiting antidepressant-like activity that was comparable to the effects of fluoxetine (2.5-10 μg/mouse) in both the tests. However, in the presence of inactive dose (10 μg/mouse) of capsazepine, capsaicin (300 μg/mouse) had no influence on the indices of both tests, signifying that the effects are TRPV1-mediated. Further, the antidepressant-like effects of both the TRPV1 ligands were neutralized in mice-pretreated with NMDA (0.1 μg/mouse), suggestive of the fact that decreased glutamatergic transmission might contribute to the antidepressant-like activity. In addition, co-administration of sub-threshold dose of capsazepine (10 μg/mouse) and fluoxetine (1.75 μg/mouse) produced a synergistic effect in both the tests. In contrast, inactive doses of capsaicin (10 and 100 μg/mouse) partially abolished the antidepressant effect of fluoxetine (10 μg/mouse), while its effect was potentiated by active dose of capsaicin (200 μg/mouse). Moreover, pretreatment of mice with para-chlorophenylalanine (300 mg/kg/day × 3 days, i.p.) attenuated the effects of capsaicin and capsazepine, demonstrating a probable interplay between serotonin and TRPV1, at least in parts. Thus, our data indicate a possible role of TRPV1 in depressive-like symptoms. Copyright © 2012 Elsevier B.V. All rights reserved.

Participation of transient receptor potential vanilloid 1 in paclitaxel-induced acute visceral and peripheral nociception in rodents.

PubMed

Rossato, Mateus Fortes; Rigo, Flavia Karine; Oliveira, Sara Marchesan; Guerra, Gustavo Petri; Silva, Cássia Regina; Cunha, Thiago Mattar; Gomez, Marcus Vinícius; Ferreira, Juliano; Trevisan, Gabriela

2018-06-05

The clinical use of paclitaxel as a chemotherapeutic agent is limited by the severe acute and chronic hypersensitivity caused when it is administered via intraperitoneal or intravenous routes. Thus far, evidence has suggested that transient receptor potential vanilloid-1 (TRPV1) has a key role in the chronic neuropathy induced by paclitaxel. Despite this, the role of TRPV1 in paclitaxel -related acute nociception, especially the development of visceral nociception, has not been evaluated. Thus, the goal of this study was to evaluate the participation of TRPV1 in a model of acute nociception induced by paclitaxel in rats and mice. A single intraperitoneal (i.p.) paclitaxel administration (1 mg/kg, i.p.) produced an immediate visceral nociception response 1 h after administration, caused mechanical and heat hypersensitivity, and diminished burrowing behaviour 24 h after administration. These nociceptive responses were reduced by SB-366791 treatment (0.5 mg/kg, i.p., a TRPV1 antagonist). In addition, TRPV1-positive sensory fibre ablation (using resiniferatoxin, 200 µg/kg, s.c.) reduced visceral nociception and mechanical or heat hypersensitivity caused by paclitaxel injection. Similarly, TRPV1 deficient mice showed a pronounced reduction in mechanical allodynia to paclitaxel acute injection and did not develop heat hypersensitivity. Moreover, 24 h after its injection, paclitaxel induced chemical hypersensitivity to capsaicin (a TRPV1 agonist, 0.01 nmol/site) and increased TRPV1 immunoreactivity in the dorsal root ganglion and sciatic nerve. In conclusion, TRPV1 is involved in mechanical and heat hypersensitivity and spontaneous-pain behaviour induced 24 h after a single paclitaxel injection. This receptor is also involved in visceral nociception induced immediately after paclitaxel administration. Copyright © 2018 Elsevier B.V. All rights reserved.

Elevated expression of transient receptor potential vanilloid type 1 in dorsal root ganglia of rats with endometriosis

PubMed Central

Lian, Yu-Ling; Cheng, Ming-Jun; Zhang, Xian-Xia; Wang, Li

2017-01-01

Pain is the most pronounced complaint of women with endometriosis, however the underlying mechanism is still poorly understood. In the present study, the authors evaluate the effect of transient receptor potential vanilloid type 1 (TRPV1) of dorsal root ganglia (DRG) on endometriosis-associated pain. A total of 36 SD rats were randomly divided into a sham group (n=9) and a Model group (n=27), accepted auto-transplanted pieces of fat or uterus to the pelvic cavity. At 4 weeks, the Model group was randomly subdivided into the following groups: ENDO group (no treatment, n=9), BCTC group (Model + BCTC, an antagonist of TRPV1, n=9), Vehicle group (Model + cyclodextrin, the vehicle of BCTC, n=9). Tail-flick test was performed prior to surgery, 1 h prior to and following treatment of BCTC or cyclodextrin. The expression of TRPV1, substance P (SP), calcitonin gene-related peptide (CGRP) in L1-L6 DRG was measured via immunohistochemistry, western blotting and RT-qPCR. The results indicated that the Model group exhibited a significant decrease in tail flick latency compared to pre-surgical baseline, and the expression of TRPV1, SP, CGRP protein and mRNA in L1-L6 DRG significantly increased compared to the sham group. BCTC significantly improved tail flick latency, and downregulated the expression of TRPV1, SP and CGRP protein and mRNA levels in L1-L6 DRG compared to ENDO group. However, there were no significant differences of those in Vehicle group compared with the ENDO group. Taken together, the current study provides evidence that TRPV1 expressed in DRG may serve an important role in endometriosis-associated pain. PMID:28627595

Low-Level Blast Exposure Increases Transient Receptor Potential Vanilloid 1 (TRPV1) Expression in the Rat Cornea

PubMed Central

Por, Elaine D.; Choi, Jae-Hyek; Lund, Brian J.

2016-01-01

ABSTRACT Background: Blast-related ocular injuries sustained by military personnel have led to rigorous efforts to elucidate the effects of blast exposure on neurosensory function. Recent studies have provided some insight into cognitive and visual deficits sustained following blast exposure; however, limited data are available on the effects of blast on pain and inflammatory processes. Investigation of these secondary effects of blast exposure is necessary to fully comprehend the complex pathophysiology of blast-related injuries. The overall purpose of this study is to determine the effects of single and repeated blast exposure on pain and inflammatory mediators in ocular tissues. Methods: A compressed air shock tube was used to deliver a single or repeated blast (68.0 ± 2.7 kPa) to anesthetized rats daily for 5 days. Immunohistochemistry was performed on ocular tissues to determine the expression of the transient receptor potential vanilloid 1 (TRPV1) channel, calcitonin gene-related peptide (CGRP), substance P (SP), and endothelin-1 (ET-1) following single and repeated blast exposure. Neutrophil infiltration and myeloperoxidase (MPO) expression were also assessed in blast tissues via immunohistochemistry and enzyme-linked immunosorbent assay (ELISA) analysis, respectively. Results: TRPV1 expression was increased in rat corneas exposed to both single and repeated blast. Increased secretion of CGRP, SP, and ET-1 was also detected in rat corneas as compared to control. Moreover, repeated blast exposure resulted in neutrophil infiltration in the cornea and stromal layer as compared to control animals. Conclusion: Single and repeated blast exposure resulted in increased expression of TRPV1, CGRP, SP, and ET-1 as well as neutrophil infiltration. Collectively, these findings provide novel insight into the activation of pain and inflammation signaling mediators following blast exposure. PMID:27049881

Role of the Outer Pore Domain in Transient Receptor Potential Vanilloid 1 Dynamic Permeability to Large Cations*

PubMed Central

Munns, Clare H.; Chung, Man-Kyo; Sanchez, Yuly E.; Amzel, L. Mario; Caterina, Michael J.

2015-01-01

Transient receptor potential vanilloid 1 (TRPV1) has been shown to alter its ionic selectivity profile in a time- and agonist-dependent manner. One hallmark of this dynamic process is an increased permeability to large cations such as N-methyl-d-glucamine (NMDG). In this study, we mutated residues throughout the TRPV1 pore domain to identify loci that contribute to dynamic large cation permeability. Using resiniferatoxin (RTX) as the agonist, we identified multiple gain-of-function substitutions within the TRPV1 pore turret (N628P and S629A), pore helix (F638A), and selectivity filter (M644A) domains. In all of these mutants, maximum NMDG permeability was substantially greater than that recorded in wild type TRPV1, despite similar or even reduced sodium current density. Two additional mutants, located in the pore turret (G618W) and selectivity filter (M644I), resulted in significantly reduced maximum NMDG permeability. M644A and M644I also showed increased and decreased minimum NMDG permeability, respectively. The phenotypes of this panel of mutants were confirmed by imaging the RTX-evoked uptake of the large cationic fluorescent dye YO-PRO1. Whereas none of the mutations selectively altered capsaicin-induced changes in NMDG permeability, the loss-of-function phenotypes seen with RTX stimulation of G618W and M644I were recapitulated in the capsaicin-evoked YO-PRO1 uptake assay. Curiously, the M644A substitution resulted in a loss, rather than a gain, in capsaicin-evoked YO-PRO1 uptake. Modeling of our mutations onto the recently determined TRPV1 structure revealed several plausible mechanisms for the phenotypes observed. We conclude that side chain interactions at a few specific loci within the TRPV1 pore contribute to the dynamic process of ionic selectivity. PMID:25568328

Role of the outer pore domain in transient receptor potential vanilloid 1 dynamic permeability to large cations.

PubMed

Munns, Clare H; Chung, Man-Kyo; Sanchez, Yuly E; Amzel, L Mario; Caterina, Michael J

2015-02-27

Transient receptor potential vanilloid 1 (TRPV1) has been shown to alter its ionic selectivity profile in a time- and agonist-dependent manner. One hallmark of this dynamic process is an increased permeability to large cations such as N-methyl-D-glucamine (NMDG). In this study, we mutated residues throughout the TRPV1 pore domain to identify loci that contribute to dynamic large cation permeability. Using resiniferatoxin (RTX) as the agonist, we identified multiple gain-of-function substitutions within the TRPV1 pore turret (N628P and S629A), pore helix (F638A), and selectivity filter (M644A) domains. In all of these mutants, maximum NMDG permeability was substantially greater than that recorded in wild type TRPV1, despite similar or even reduced sodium current density. Two additional mutants, located in the pore turret (G618W) and selectivity filter (M644I), resulted in significantly reduced maximum NMDG permeability. M644A and M644I also showed increased and decreased minimum NMDG permeability, respectively. The phenotypes of this panel of mutants were confirmed by imaging the RTX-evoked uptake of the large cationic fluorescent dye YO-PRO1. Whereas none of the mutations selectively altered capsaicin-induced changes in NMDG permeability, the loss-of-function phenotypes seen with RTX stimulation of G618W and M644I were recapitulated in the capsaicin-evoked YO-PRO1 uptake assay. Curiously, the M644A substitution resulted in a loss, rather than a gain, in capsaicin-evoked YO-PRO1 uptake. Modeling of our mutations onto the recently determined TRPV1 structure revealed several plausible mechanisms for the phenotypes observed. We conclude that side chain interactions at a few specific loci within the TRPV1 pore contribute to the dynamic process of ionic selectivity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Drug-induced mild therapeutic hypothermia obtained by administration of a transient receptor potential vanilloid type 1 agonist.

PubMed

Fosgerau, Keld; Weber, Uno J; Gotfredsen, Jacob W; Jayatissa, Magdalena; Buus, Carsten; Kristensen, Niels B; Vestergaard, Mogens; Teschendorf, Peter; Schneider, Andreas; Hansen, Philip; Raunsø, Jakob; Køber, Lars; Torp-Pedersen, Christian; Videbaek, Charlotte

2010-10-09

The use of mechanical/physical devices for applying mild therapeutic hypothermia is the only proven neuroprotective treatment for survivors of out of hospital cardiac arrest. However, this type of therapy is cumbersome and associated with several side-effects. We investigated the feasibility of using a transient receptor potential vanilloid type 1 (TRPV1) agonist for obtaining drug-induced sustainable mild hypothermia. First, we screened a heterogeneous group of TRPV1 agonists and secondly we tested the hypothermic properties of a selected candidate by dose-response studies. Finally we tested the hypothermic properties in a large animal. The screening was in conscious rats, the dose-response experiments in conscious rats and in cynomologus monkeys, and the finally we tested the hypothermic properties in conscious young cattle (calves with a body weight as an adult human). The investigated TRPV1 agonists were administered by continuous intravenous infusion. Screening: Dihydrocapsaicin (DHC), a component of chili pepper, displayed a desirable hypothermic profile with regards to the duration, depth and control in conscious rats. Dose-response experiments: In both rats and cynomologus monkeys DHC caused a dose-dependent and immediate decrease in body temperature. Thus in rats, infusion of DHC at doses of 0.125, 0.25, 0.50, and 0.75 mg/kg/h caused a maximal ΔT (°C) as compared to vehicle control of -0.9, -1.5, -2.0, and -4.2 within approximately 1 hour until the 6 hour infusion was stopped. Finally, in calves the intravenous infusion of DHC was able to maintain mild hypothermia with ΔT > -3°C for more than 12 hours. Our data support the hypothesis that infusion of dihydrocapsaicin is a candidate for testing as a primary or adjunct method of inducing and maintaining therapeutic hypothermia.

DNA barcoding of morphologically characterized mosquitoes belonging to the subfamily Culicinae from Sri Lanka.

PubMed

Weeraratne, Thilini Chathurika; Surendran, Sinnathamby Noble; Parakrama Karunaratne, S H P

2018-04-25

Vectors of mosquito-borne diseases in Sri Lanka, except for malaria, belong to the subfamily Culicinae, which includes nearly 84% of the mosquito fauna of the country. Hence, accurate and precise species identification of culicine mosquitoes is a crucial factor in implementing effective vector control strategies. During the present study, a combined effort using morphology and DNA barcoding was made to characterize mosquitoes of the subfamily Culicinae for the first time from nine districts of Sri Lanka. Cytochrome c oxidase subunit 1 (cox1) gene from the mitochondrial genome and the internal transcribed spacer 2 (ITS2) region from the nuclear ribosomal DNA were used for molecular characterization. According to morphological identification, the field collected adult mosquitoes belonged to 5 genera and 14 species, i.e. Aedes aegypti, Ae. albopictus, Ae. pallidostriatus, Aedes sp. 1, Armigeres sp. 1, Culex bitaeniorhynchus, Cx. fuscocephala, Cx. gelidus, Cx. pseudovishnui, Cx. quinquefasciatus, Cx. tritaeniorhynchus, Cx. whitmorei, Mansonia uniformis and Mimomyia chamberlaini. Molecular analyses of 62 cox1 and 36 ITS2 sequences were exclusively comparable with the morphological identifications of all the species except for Ae. pallidostriatus and Aedes sp. 1. Although the species identification of Armigeres sp. 1 specimens using morphological features was not possible during this study, DNA barcodes of the specimens matched 100% with the publicly available Ar. subalbatus sequences, giving their species status. Analysis of all the cox1 sequences (14 clades supported by strong bootstrap value in the Neighbor-Joining tree and interspecific distances of > 3%) showed the presence of 14 different species. This is the first available DNA sequence in the GenBank records for morphologically identified Ae. pallidostriatus. Aedes sp. 1 could not be identified morphologically or by publicly available sequences. Aedes aegypti, Ae. albopictus and all Culex species reported during

Cancer cachexia causes skeletal muscle damage via transient receptor potential vanilloid 2‐independent mechanisms, unlike muscular dystrophy

PubMed Central

Suzuki, Nobuyuki; Ohtake, Hitomi; Kamauchi, Shinya; Hashimoto, Naohiro; Kiyono, Tohru; Wakabayashi, Shigeo

2015-01-01

Abstract Background Muscle wasting during cancer cachexia contributes to patient morbidity. Cachexia‐induced muscle damage may be understood by comparing its symptoms with those of other skeletal muscle diseases, but currently available data are limited. Methods We modelled cancer cachexia in mice bearing Lewis lung carcinoma/colon adenocarcinoma and compared the associated muscle damage with that in a murine muscular dystrophy model (mdx mice). We measured biochemical and immunochemical parameters: amounts/localization of cytoskeletal proteins and/or Ca2+ signalling proteins related to muscle function and abnormality. We analysed intracellular Ca2+ mobilization and compared results between the two models. Involvement of Ca2+‐permeable channel transient receptor potential vanilloid 2 (TRPV2) was examined by inoculating Lewis lung carcinoma cells into transgenic mice expressing dominant‐negative TRPV2. Results Tumourigenesis caused loss of body and skeletal muscle weight and reduced muscle force and locomotor activity. Similar to mdx mice, cachexia muscles exhibited myolysis, reduced sarcolemmal sialic acid content, and enhanced lysosomal exocytosis and sarcolemmal localization of phosphorylated Ca2+/CaMKII. Abnormal autophagy and degradation of dystrophin also occurred. Unlike mdx muscles, cachexia muscles did not exhibit regeneration markers (centrally nucleated fibres), and levels of autophagic proteolytic pathway markers increased. While a slight accumulation of TRPV2 was observed in cachexia muscles, Ca2+ influx via TRPV2 was not elevated in cachexia‐associated myotubes, and the course of cachexia pathology was not ameliorated by dominant‐negative inhibition of TRPV2. Conclusions Thus, cancer cachexia may induce muscle damage through TRPV2‐independent mechanisms distinct from those in muscular dystrophy; this may help treat patients with tumour‐induced muscle wasting. PMID:27239414

Cryo-EM structure of the cytoplasmic domain of murine transient receptor potential cation channel subfamily C member 6 (TRPC6).

PubMed

Azumaya, Caleigh M; Sierra-Valdez, Francisco; Cordero-Morales, Julio F; Nakagawa, Terunaga

2018-05-11

The kidney maintains the internal milieu by regulating the retention and excretion of proteins, ions, and small molecules. The glomerular podocyte forms the slit diaphragm of the ultrafiltration filter, whose damage leads to progressive kidney failure and focal segmental glomerulosclerosis (FSGS). The canonical transient receptor potential 6 (TRPC6) ion channel is expressed in the podocyte and mutations in its cytoplasmic domain cause FSGS in humans. In vitro evaluation of disease-causing mutations in TRPC6 has revealed that these genetic alterations result in abnormal ion channel gating. However, the mechanism whereby the cytoplasmic domain modulates TRPC6 function is largely unknown. Here we report a cryoEM structure of the cytoplasmic domain of murine TRPC6 at 3.8Å resolution. The cytoplasmic fold of TRPC6 is characterized by an inverted dome-like chamber pierced by four radial horizontal helices that converge into a vertical coiled-coil at the central axis. Unlike in other TRP channels, TRPC6 displays a unique domain swap that occurs at the junction of the horizontal helices and coiled-coil. Multiple FSGS mutations converge at the buried interface between the vertical coiled-coil and the ankyrin repeats, which form the dome, suggesting these regions are critical for allosteric gating modulation. This functionally critical interface is a potential target for drug design. Importantly, dysfunction in other family members leads to learning deficits (TRPC1/4/5) and ataxia (TRPC3). Our data provide a structural framework for the mechanistic investigation of the TRPC family. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

How minority members' perceptions of majority members' acculturation preferences shape minority members' own acculturation preferences: evidence from Chile.

PubMed

Zagefka, Hanna; González, Roberto; Brown, Rupert

2011-06-01

Two survey studies were conducted in Chile with members of the indigenous minority group Mapuche (Ns = 566; 394). The aim was to find predictors of minority members' acculturation preferences, especially integration. It was hypothesized that minority members' preferences would depend on their perceptions of what majority members want. Specifically, it was predicted that a perception that majority members want minority members to maintain their original culture would be associated with a greater desire for culture maintenance among minority participants. Further, it was predicted that a perception that majority members want intergroup contact would be associated with a greater desire for contact among minority participants. Finally, it was predicted that a perception that majority members are in favour of both culture maintenance and contact (i.e., integration) would be associated with more support for integration among minority participants. Results bore out these predictions. Theoretical and policy implications are discussed. ©2010 The British Psychological Society.

Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily.

PubMed

Martin, Diane M; Fäldt, Jenny; Bohlmann, Jörg

2004-08-01

Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (-)-limonene synthase, (-)-alpha/beta-pinene synthase, and (-)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-alpha-farnesene synthase, and E-alpha-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed.

Sonorensin: an Antimicrobial Peptide, Belonging to the Heterocycloanthracin Subfamily of Bacteriocins, from a New Marine Isolate, Bacillus sonorensis MT93

PubMed Central

Chopra, Lipsy; Singh, Gurdeep; Choudhary, Vikas

2014-01-01

Marine environments are the greatest fronts of biodiversity, representing a resource of unexploited or unknown microorganisms and new substances having potential applications. Among microbial products, antimicrobial peptides (AMPs) have received great attention recently due to their applications as food preservatives and therapeutic agents. A new marine soil isolate producing an AMP was identified as Bacillus sonorensis based on 16S rRNA gene sequence analysis. It produced an AMP that showed a broad spectrum of activity against both Gram-positive and Gram-negative bacteria. The peptide, named sonorensin, was purified to homogeneity using a combination of chromatographic techniques. The intact molecular mass of the purified peptide, 6,274 Da, as revealed by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF), was in agreement with Tricine-SDS-PAGE analysis. A PCR array of primers was used to identify AMP structural genes, which allowed the successful amplification of the related genes from strain MT93. The putative open reading frame of sonorensin was amplified, cloned into the pET-32a(+) vector, expressed as a thioredoxin (Trx) fusion protein in Escherichia coli, and then purified. Sequence alignment analysis revealed that the bacteriocin being reported could belong to new subfamily of bacteriocins, heterocycloanthracin. The peptide indicated its potential as a biocontrol agent or food antimicrobial agent, due to its antimicrobial activity against bacteria such as Listeria monocytogenes and Staphylococcus aureus. This is the first report of the production, purification, and characterization of wild-type and recombinant bacteriocin by B. sonorensis and the first bacteriocin of the heterocycloanthracin subfamily to be characterized. PMID:24610839

Sonorensin: an antimicrobial peptide, belonging to the heterocycloanthracin subfamily of bacteriocins, from a new marine isolate, Bacillus sonorensis MT93.

PubMed

Chopra, Lipsy; Singh, Gurdeep; Choudhary, Vikas; Sahoo, Debendra K

2014-05-01

Marine environments are the greatest fronts of biodiversity, representing a resource of unexploited or unknown microorganisms and new substances having potential applications. Among microbial products, antimicrobial peptides (AMPs) have received great attention recently due to their applications as food preservatives and therapeutic agents. A new marine soil isolate producing an AMP was identified as Bacillus sonorensis based on 16S rRNA gene sequence analysis. It produced an AMP that showed a broad spectrum of activity against both Gram-positive and Gram-negative bacteria. The peptide, named sonorensin, was purified to homogeneity using a combination of chromatographic techniques. The intact molecular mass of the purified peptide, 6,274 Da, as revealed by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF), was in agreement with Tricine-SDS-PAGE analysis. A PCR array of primers was used to identify AMP structural genes, which allowed the successful amplification of the related genes from strain MT93. The putative open reading frame of sonorensin was amplified, cloned into the pET-32a(+) vector, expressed as a thioredoxin (Trx) fusion protein in Escherichia coli, and then purified. Sequence alignment analysis revealed that the bacteriocin being reported could belong to new subfamily of bacteriocins, heterocycloanthracin. The peptide indicated its potential as a biocontrol agent or food antimicrobial agent, due to its antimicrobial activity against bacteria such as Listeria monocytogenes and Staphylococcus aureus. This is the first report of the production, purification, and characterization of wild-type and recombinant bacteriocin by B. sonorensis and the first bacteriocin of the heterocycloanthracin subfamily to be characterized.

Structure of the Regulator of G Protein Signaling 8 (RGS8)-Gαq Complex: MOLECULAR BASIS FOR Gα SELECTIVITY.

PubMed

Taylor, Veronica G; Bommarito, Paige A; Tesmer, John J G

2016-03-04

Regulator of G protein signaling (RGS) proteins interact with activated Gα subunits via their RGS domains and accelerate the hydrolysis of GTP. Although the R4 subfamily of RGS proteins generally accepts both Gαi/o and Gαq/11 subunits as substrates, the R7 and R12 subfamilies select against Gαq/11. In contrast, only one RGS protein, RGS2, is known to be selective for Gαq/11. The molecular basis for this selectivity is not clear. Previously, the crystal structure of RGS2 in complex with Gαq revealed a non-canonical interaction that could be due to interfacial differences imposed by RGS2, the Gα subunit, or both. To resolve this ambiguity, the 2.6 Å crystal structure of RGS8, an R4 subfamily member, was determined in complex with Gαq. RGS8 adopts the same pose on Gαq as it does when bound to Gαi3, indicating that the non-canonical interaction of RGS2 with Gαq is due to unique features of RGS2. Based on the RGS8-Gαq structure, residues in RGS8 that contact a unique α-helical domain loop of Gαq were converted to those typically found in R12 subfamily members, and the reverse substitutions were introduced into RGS10, an R12 subfamily member. Although these substitutions perturbed their ability to stimulate GTP hydrolysis, they did not reverse selectivity. Instead, selectivity for Gαq seems more likely determined by whether strong contacts can be maintained between α6 of the RGS domain and Switch III of Gαq, regions of high sequence and conformational diversity in both protein families. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

[6]-Gingerol induces bone loss in ovary intact adult mice and augments osteoclast function via the transient receptor potential vanilloid 1 channel.

PubMed

Khan, Kainat; Singh, Akanksha; Mittal, Monika; Sharan, Kunal; Singh, Nidhi; Dixit, Preety; Sanyal, Sabyasachi; Maurya, Rakesh; Chattopadhyay, Naibedya

2012-12-01

[6]-Gingerol, a major constituent of ginger, is considered to have several health beneficial effects. The effect of 6-gingerol on bone cells and skeleton of mice was investigated. The effects of 6-gingerol on mouse bone marrow macrophages and osteoblasts were studied. 6-Gingerol-stimulated osteoclast differentiation of bone marrow macrophages but had no effect on osteoblasts. Capsazepine, an inhibitor of TRPV1 (transient receptor potential vanilloid 1) channel, attenuated the pro-osteoclastogenic effect of 6-gingerol or capsaicin (an agonist of TRPV1). Similar to capsaicin, 6-gingerol stimulated Ca(2) + influx in osteoclasts. The effect of daily feeding of 6-gingerol for 5 wk on the skeleton of adult female Balb/cByJ mice was investigated. Mice treated with capsaicin and ovariectomized (OVx) mice served as controls for osteopenia. 6-Gingerol caused increase in trabecular osteoclast number, microarchitectural erosion at all trabecular sites and loss of vertebral stiffness, and these effects were comparable to capsaicin or OVx group. Osteoclast-specific serum and gene markers of 6-gingerol-treated mice were higher than the OVx group. Bone formation was unaffected by 6-gingerol. Daily feeding of 6-gingerol to skeletally mature female mice caused trabecular osteopenia, and the mechanism appeared to be activation of osteoclast formation via the TRPV1 channel. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification of the divergent calmodulin binding motif in yeast Ssb1/Hsp75 protein and in other HSP70 family members.

PubMed

Heinen, R C; Diniz-Mendes, L; Silva, J T; Paschoalin, V M F

2006-11-01

Yeast soluble proteins were fractionated by calmodulin-agarose affinity chromatography and the Ca2+/calmodulin-binding proteins were analyzed by SDS-PAGE. One prominent protein of 66 kDa was excised from the gel, digested with trypsin and the masses of the resultant fragments were determined by MALDI/MS. Twenty-one of 38 monoisotopic peptide masses obtained after tryptic digestion were matched to the heat shock protein Ssb1/Hsp75, covering 37% of its sequence. Computational analysis of the primary structure of Ssb1/Hsp75 identified a unique potential amphipathic alpha-helix in its N-terminal ATPase domain with features of target regions for Ca2+/calmodulin binding. This region, which shares 89% similarity to the experimentally determined calmodulin-binding domain from mouse, Hsc70, is conserved in near half of the 113 members of the HSP70 family investigated, from yeast to plant and animals. Based on the sequence of this region, phylogenetic analysis grouped the HSP70s in three distinct branches. Two of them comprise the non-calmodulin binding Hsp70s BIP/GR78, a subfamily of eukaryotic HSP70 localized in the endoplasmic reticulum, and DnaK, a subfamily of prokaryotic HSP70. A third heterogeneous group is formed by eukaryotic cytosolic HSP70s containing the new calmodulin-binding motif and other cytosolic HSP70s whose sequences do not conform to those conserved motif, indicating that not all eukaryotic cytosolic Hsp70s are target for calmodulin regulation. Furthermore, the calmodulin-binding domain found in eukaryotic HSP70s is also the target for binding of Bag-1 - an enhancer of ADP/ATP exchange activity of Hsp70s. A model in which calmodulin displaces Bag-1 and modulates Ssb1/Hsp75 chaperone activity is discussed.

The Evolutionary Landscape of Dbl-Like RhoGEF Families: Adapting Eukaryotic Cells to Environmental Signals

PubMed Central

Blangy, Anne

2017-01-01

Abstract The dynamics of cell morphology in eukaryotes is largely controlled by small GTPases of the Rho family. Rho GTPases are activated by guanine nucleotide exchange factors (RhoGEFs), of which diffuse B-cell lymphoma (Dbl)-like members form the largest family. Here, we surveyed Dbl-like sequences from 175 eukaryotic genomes and illuminate how the Dbl family evolved in all eukaryotic supergroups. By combining probabilistic phylogenetic approaches and functional domain analysis, we show that the human Dbl-like family is made of 71 members, structured into 20 subfamilies. The 71 members were already present in ancestral jawed vertebrates, but several members were subsequently lost in specific clades, up to 12% in birds. The jawed vertebrate repertoire was established from two rounds of duplications that occurred between tunicates, cyclostomes, and jawed vertebrates. Duplicated members showed distinct tissue distributions, conserved at least in Amniotes. All 20 subfamilies have members in Deuterostomes and Protostomes. Nineteen subfamilies are present in Porifera, the first phylum that diverged in Metazoa, 14 in Choanoflagellida and Filasterea, single-celled organisms closely related to Metazoa and three in Fungi, the sister clade to Metazoa. Other eukaryotic supergroups show an extraordinary variability of Dbl-like repertoires as a result of repeated and independent gain and loss events. Last, we observed that in Metazoa, the number of Dbl-like RhoGEFs varies in proportion of cell signaling complexity. Overall, our analysis supports the conclusion that Dbl-like RhoGEFs were present at the origin of eukaryotes and evolved as highly adaptive cell signaling mediators. PMID:28541439

Genome-wide identification of nuclear receptor (NR) genes and the evolutionary significance of the NR1O subfamily in the monogonont rotifer Brachionus spp.

PubMed

Kim, Duck-Hyun; Kim, Hui-Su; Hwang, Dae-Sik; Kim, Hee-Jin; Hagiwara, Atsushi; Lee, Jae-Seong; Jeong, Chang-Bum

2017-10-01

Nuclear receptors (NRs) are a large family of transcription factors that are involved in many fundamental biological processes. NRs are considered to have originated from a common ancestor, and are highly conserved throughout the whole animal taxa. Therefore, the genome-wide identification of NR genes in an animal taxon can provide insight into the evolutionary tendencies of NRs. Here, we identified all the NR genes in the monogonont rotifer Brachionus spp., which are considered an ecologically key species due to their abundance and world-wide distribution. The NR family was composed of 40, 32, 29, and 32 genes in the genomes of the rotifers B. calyciflorus, B. koreanus, B. plicatilis, and B. rotundiformis, respectively, which were classified into seven distinct subfamilies. The composition of each subfamily was highly conserved between species, except for NR1O genes, suggesting that they have undergone sporadic evolutionary processes for adaptation to their different environmental pressures. In addition, despite the dynamics of NR evolution, the significance of the conserved endocrine system, particularly for estrogen receptor (ER)-signaling, in rotifers was discussed on the basis of phylogenetic analyses. The results of this study may help provide a better understanding the evolution of NRs, and expand our knowledge of rotifer endocrine systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Rapid Identification of OXA-48 and OXA-163 Subfamilies in Carbapenem-Resistant Gram-Negative Bacilli with a Novel Immunochromatographic Lateral Flow Assay.

PubMed

Pasteran, Fernando; Denorme, Laurence; Ote, Isabelle; Gomez, Sonia; De Belder, Denise; Glupczynski, Youri; Bogaerts, Pierre; Ghiglione, Barbara; Power, Pablo; Mertens, Pascal; Corso, Alejandra

2016-11-01

We assessed a novel immunochromatographic lateral flow assay for direct identification of OXA-48-like carbapenemases and accurate differentiation of allele variants with distinct substrate profiles (OXA-48 or OXA-163 subfamilies). The assay allowed rapid (less than 4 min) and reliable direct confirmation of OXA-163- and/or OXA-48-like enzymes (with 100% sensitivity and 100% specificity) from cultured colonies that were recovered from both solid medium and spiked blood culture bottles. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

In Silico/In Vivo Insights into the Functional and Evolutionary Pathway of Pseudomonas aeruginosa Oleate-Diol Synthase. Discovery of a New Bacterial Di-Heme Cytochrome C Peroxidase Subfamily

PubMed Central

Estupiñán, Mónica; Álvarez-García, Daniel; Barril, Xavier; Diaz, Pilar; Manresa, Angeles

2015-01-01

As previously reported, P. aeruginosa genes PA2077 and PA2078 code for 10S-DOX (10S-Dioxygenase) and 7,10-DS (7,10-Diol Synthase) enzymes involved in long-chain fatty acid oxygenation through the recently described oleate-diol synthase pathway. Analysis of the amino acid sequence of both enzymes revealed the presence of two heme-binding motifs (CXXCH) on each protein. Phylogenetic analysis showed the relation of both proteins to bacterial di-heme cytochrome c peroxidases (Ccps), similar to Xanthomonas sp. 35Y rubber oxidase RoxA. Structural homology modelling of PA2077 and PA2078 was achieved using RoxA (pdb 4b2n) as a template. From the 3D model obtained, presence of significant amino acid variations in the predicted heme-environment was found. Moreover, the presence of palindromic repeats located in enzyme-coding regions, acting as protein evolution elements, is reported here for the first time in P. aeruginosa genome. These observations and the constructed phylogenetic tree of the two proteins, allow the proposal of an evolutionary pathway for P. aeruginosa oleate-diol synthase operon. Taking together the in silico and in vivo results obtained we conclude that enzymes PA2077 and PA2078 are the first described members of a new subfamily of bacterial peroxidases, designated as Fatty acid-di-heme Cytochrome c peroxidases (FadCcp). PMID:26154497

Elevated expression of transient receptor potential vanilloid type 1 in dorsal root ganglia of rats with endometriosis.

PubMed

Lian, Yu-Ling; Cheng, Ming-Jun; Zhang, Xian-Xia; Wang, Li

2017-08-01

Pain is the most pronounced complaint of women with endometriosis, however the underlying mechanism is still poorly understood. In the present study, the authors evaluate the effect of transient receptor potential vanilloid type 1 (TRPV1) of dorsal root ganglia (DRG) on endometriosis-associated pain. A total of 36 SD rats were randomly divided into a sham group (n=9) and a Model group (n=27), accepted auto‑transplanted pieces of fat or uterus to the pelvic cavity. At 4 weeks, the Model group was randomly subdivided into the following groups: ENDO group (no treatment, n=9), BCTC group (Model + BCTC, an antagonist of TRPV1, n=9), Vehicle group (Model + cyclodextrin, the vehicle of BCTC, n=9). Tail‑flick test was performed prior to surgery, 1 h prior to and following treatment of BCTC or cyclodextrin. The expression of TRPV1, substance P (SP), calcitonin gene‑related peptide (CGRP) in L1‑L6 DRG was measured via immunohistochemistry, western blotting and RT‑qPCR. The results indicated that the Model group exhibited a significant decrease in tail flick latency compared to pre‑surgical baseline, and the expression of TRPV1, SP, CGRP protein and mRNA in L1‑L6 DRG significantly increased compared to the sham group. BCTC significantly improved tail flick latency, and downregulated the expression of TRPV1, SP and CGRP protein and mRNA levels in L1‑L6 DRG compared to ENDO group. However, there were no significant differences of those in Vehicle group compared with the ENDO group. Taken together, the current study provides evidence that TRPV1 expressed in DRG may serve an important role in endometriosis-associated pain.

Functionally important amino acid residues in the transient receptor potential vanilloid 1 (TRPV1) ion channel – an overview of the current mutational data

PubMed Central

2013-01-01

This review aims to create an overview of the currently available results of site-directed mutagenesis studies on transient receptor potential vanilloid type 1 (TRPV1) receptor. Systematization of the vast number of data on the functionally important amino acid mutations of TRPV1 may provide a clearer picture of this field, and may promote a better understanding of the relationship between the structure and function of TRPV1. The review summarizes information on 112 unique mutated sites along the TRPV1, exchanged to multiple different residues in many cases. These mutations influence the effect or binding of different agonists, antagonists, and channel blockers, alter the responsiveness to heat, acid, and voltage dependence, affect the channel pore characteristics, and influence the regulation of the receptor function by phosphorylation, glycosylation, calmodulin, PIP2, ATP, and lipid binding. The main goal of this paper is to publish the above mentioned data in a form that facilitates in silico molecular modelling of the receptor by promoting easier establishment of boundary conditions. The better understanding of the structure-function relationship of TRPV1 may promote discovery of new, promising, more effective and safe drugs for treatment of neurogenic inflammation and pain-related diseases and may offer new opportunities for therapeutic interventions. PMID:23800232

CO-LOCALIZATION OF THE VANILLOID CAPSAICIN RECEPTOR AND SUBSTANCE P IN SENSORY NERVE FIBERS INNERVATING COCHLEAR AND VERTEBRO-BASILAR ARTERIES

PubMed Central

VASS, Z.; DAI, C. F.; STEYGER, P. S.; JANCSÓ, G.; TRUNE, D. R.; NUTTALL, A. L.

2014-01-01

Evidence suggests that capsaicin-sensitive substance P (SP)-containing trigeminal ganglion neurons innervate the spiral modiolar artery (SMA), radiating arterioles, and the stria vascularis of the cochlea. Antidromic electrical or chemical stimulation of trigeminal sensory nerves results in neurogenic plasma extravasation in inner ear tissues. The primary aim of this study was to reveal the possible morphological basis of cochlear vascular changes mediated by capsaicin-sensitive sensory nerves. Therefore, the distribution of SP and capsaicin receptor (transient receptor potential vanilloid type 1—TRPV1) was investigated by double immunolabeling to demonstrate the anatomical relationships between the cochlear and vertebro-basilar blood vessels and the trigeminal sensory fiber system. Extensive TRPV1 and SP expression and co-localization were observed in axons within the adventitial layer of the basilar artery, the anterior inferior cerebellar artery, the SMA, and the radiating arterioles of the cochlea. There appears to be a functional relationship between the trigeminal ganglion and the cochlear blood vessels since electrical stimulation of the trigeminal ganglion induced significant plasma extravasation from the SMA and the radiating arterioles. The findings suggest that stimulation of paravascular afferent nerves may result in permeability changes in the basilar and cochlear vascular bed and may contribute to the mechanisms of vertebro-basilar type of headache through the release of SP and stimulation of TPVR1, respectively. We propose that vertigo, tinnitus, and hearing deficits associated with migraine may arise from perturbations of capsaicin-sensitive trigeminal sensory ganglion neurons projecting to the cochlea. PMID:15026132

Lysophosphatidylcholine-induced cytotoxicity in osteoblast-like MG-63 cells: involvement of transient receptor potential vanilloid 2 (TRPV2) channels.

PubMed

Fallah, Abdallah; Pierre, Rachel; Abed, Elie; Moreau, Robert

2013-01-01

Epidemiological studies indicate that patients suffering from atherosclerosis are predisposed to develop osteoporosis. Accordingly, atherogenic determinants such as oxidized low density lipoprotein (OxLDL) particles have been shown to alter bone cell functions. In this work, we investigated the cytotoxicity of lysophosphatidylcholine (lysoPC), a major phospholipid component generated upon LDL oxidation, on bone-forming MG-63 osteoblast-like cells. Cell viability was reduced by lysoPC in a concentration-dependent manner with a LC50 of 18.7±0.7 μM. LysoPC-induced cell death was attributed to induction of both apoptosis and necrosis. Since impairment of intracellular calcium homeostasis is often involved in mechanism of cell death, we determined the involvement of calcium in lysoPC-induced cytotoxicity. LysoPC promoted a rapid and transient increase in intracellular calcium attributed to mobilization from calcium stores, followed by a sustained influx. Intracellular calcium mobilization was associated to phospholipase C (PLC)-dependent mobilization of calcium from the endoplasmic reticulum since inhibition of PLC or calcium depletion of reticulum endoplasmic with thapsigargin prevented the calcium mobilization. The calcium influx induced by lysoPC was abolished by inhibition of transient receptor potential vanilloid (TRPV) channels with ruthenium red whereas gadolinium, which inhibits canonical TRP (TRPC) channels, was without effect. Accordingly, expression of TRPV2 and TRPV4 were shown in MG-63 cells. The addition of TRPV2 inhibitor Tranilast in the incubation medium prevent the calcium influx triggered by lysoPC and reduced lysoPC-induced cytotoxicity whereas TRPV4 inhibitor RN 1734 was without effect, which confirms the involvement of TRPV2 activation in lysoPC-induced cell death.

Phylogeny and biogeography of African Murinae based on mitochondrial and nuclear gene sequences, with a new tribal classification of the subfamily

PubMed Central

2008-01-01

Background Within the subfamily Murinae, African murines represent 25% of species biodiversity, making this group ideal for detailed studies of the patterns and timing of diversification of the African endemic fauna and its relationships with Asia. Here we report the results of phylogenetic analyses of the endemic African murines through a broad sampling of murine diversity from all their distribution area, based on the mitochondrial cytochrome b gene and the two nuclear gene fragments (IRBP exon 1 and GHR). Results A combined analysis of one mitochondrial and two nuclear gene sequences consistently identified and robustly supported ten primary lineages within Murinae. We propose to formalize a new tribal arrangement within the Murinae that reflects this phylogeny. The diverse African murine assemblage includes members of five of the ten tribes and clearly derives from multiple faunal exchanges between Africa and Eurasia. Molecular dating analyses using a relaxed Bayesian molecular clock put the first colonization of Africa around 11 Mya, which is consistent with the fossil record. The main period of African murine diversification occurred later following disruption of the migration route between Africa and Asia about 7–9 Mya. A second period of interchange, dating to around 5–6.5 Mya, saw the arrival in Africa of Mus (leading to the speciose endemic Nannomys), and explains the appearance of several distinctive African lineages in the late Miocene and Pliocene fossil record of Eurasia. Conclusion Our molecular survey of Murinae, which includes the most complete sampling so far of African taxa, indicates that there were at least four separate radiations within the African region, as well as several phases of dispersal between Asia and Africa during the last 12 My. We also reconstruct the phylogenetic structure of the Murinae, and propose a new classification at tribal level for this traditionally problematic group. PMID:18616808

Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

PubMed

Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter

2013-01-01

As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

Evolutionary conservation and regulation of particular alternative splicing events in plant SR proteins

PubMed Central

Kalyna, Maria; Lopato, Sergiy; Voronin, Viktor; Barta, Andrea

2006-01-01

Alternative splicing is an important mechanism for fine tuning of gene expression at the post-transcriptional level. SR proteins govern splice site selection and spliceosome assembly. The Arabidopsis genome encodes 19 SR proteins, several of which have no orthologues in metazoan. Three of the plant specific subfamilies are characterized by the presence of a relatively long alternatively spliced intron located in their first RNA recognition motif, which potentially results in an extremely truncated protein. In atRSZ33, a member of the RS2Z subfamily, this alternative splicing event was shown to be autoregulated. Here we show that atRSp31, a member of the RS subfamily, does not autoregulate alternative splicing of its similarily positioned intron. Interestingly, this alternative splicing event is regulated by atRSZ33. We demonstrate that the positions of these long introns and their capability for alternative splicing are conserved from green algae to flowering plants. Moreover, in particular alternative splicing events the splicing signals are embedded into highly conserved sequences. In different taxa, these conserved sequences occur in at least one gene within a subfamily. The evolutionary preservation of alternative splice forms together with highly conserved intron features argues for additional functions hidden in the genes of these plant-specific SR proteins. PMID:16936312

ß-catenin, a transcription factor activated by canonical Wnt signaling, is expressed in sensory neurons of calves latently infected with bovine herpesvirus 1

USDA-ARS?s Scientific Manuscript database

Like many a-herpesvirinae subfamily members, bovine herpes virus 1 (BoHV-1) expresses an abundant transcript in latently infected sensory neurons: the latency-related (LR) RNA. LR-RNA encodes a protein (ORF2) that inhibits apoptosis, interacts with Notch family members, interferes with Notch mediate...

Transient Receptor Potential Vanilloid 4 Activation-Induced Increase in Glycine-Activated Current in Mouse Hippocampal Pyramidal Neurons.

PubMed

Qi, Mengwen; Wu, Chunfeng; Wang, Zhouqing; Zhou, Li; Men, Chen; Du, Yimei; Huang, Songming; Chen, Lei; Chen, Ling

2018-01-01

Glycine plays an important role in regulating hippocampal inhibitory/ excitatory neurotransmission through activating glycine receptors (GlyRs) and acting as a co-agonist of N-methyl-d-aspartate-type glutamate receptors. Activation of transient receptor potential vanilloid 4 (TRPV4) is reported to inhibit hippocampal A-type γ-aminobutyric acid receptor, a ligand-gated chloride ion channel. GlyRs are also ligand-gated chloride ion channels and this paper aimed to explore whether activation of TRPV4 could modulate GlyRs. Whole-cell patch clamp recording was employed to record glycine-activated current (IGly) and Western blot was conducted to assess GlyRs subunits protein expression. Application of TRPV4 agonist (GSK1016790A or 5,6-EET) increased IGly in mouse hippocampal CA1 pyramidal neurons. This action was blocked by specific antagonists of TRPV4 (RN-1734 or HC-067047) and GlyR (strychnine), indicating that activation of TRPV4 increases strychnine-sensitive GlyR function in mouse hippocampal pyramidal neurons. GSK1016790A-induced increase in IGly was significantly attenuated by protein kinase C (PKC) (BIM II or D-sphingosine) or calcium/calmodulin-dependent protein kinase II (CaMKII) (KN-62 or KN-93) antagonists but was unaffected by protein kinase A or protein tyrosine kinase antagonists. Finally, hippocampal protein levels of GlyR α1 α2, α3 and β subunits were not changed by treatment with GSK1016790A for 30 min or 1 h, but GlyR α2, α3 and β subunits protein levels increased in mice that were intracerebroventricularly (icv.) injected with GSK1016790A for 5 d. Activation of TRPV4 increases GlyR function and expression, and PKC and CaMKII signaling pathways are involved in TRPV4 activation-induced increase in IGly. This study indicates that GlyRs may be effective targets for TRPV4-induced modulation of hippocampal inhibitory neurotransmission. © 2018 The Author(s). Published by S. Karger AG, Basel.

Structural and Functional Characterization of a Ruminal β-Glycosidase Defines a Novel Subfamily of Glycoside Hydrolase Family 3 with Permuted Domain Topology*

PubMed Central

Ramírez-Escudero, Mercedes; del Pozo, Mercedes V.; Marín-Navarro, Julia; González, Beatriz; Golyshin, Peter N.; Polaina, Julio; Ferrer, Manuel; Sanz-Aparicio, Julia

2016-01-01

Metagenomics has opened up a vast pool of genes for putative, yet uncharacterized, enzymes. It widens our knowledge on the enzyme diversity world and discloses new families for which a clear classification is still needed, as is exemplified by glycoside hydrolase family-3 (GH3) proteins. Herein, we describe a GH3 enzyme (GlyA1) from resident microbial communities in strained ruminal fluid. The enzyme is a β-glucosidase/β-xylosidase that also shows β-galactosidase, β-fucosidase, α-arabinofuranosidase, and α-arabinopyranosidase activities. Short cello- and xylo-oligosaccharides, sophorose and gentibiose, are among the preferred substrates, with the large polysaccharide lichenan also being hydrolyzed by GlyA1. The determination of the crystal structure of the enzyme in combination with deletion and site-directed mutagenesis allowed identification of its unusual domain composition and the active site architecture. Complexes of GlyA1 with glucose, galactose, and xylose allowed picturing the catalytic pocket and illustrated the molecular basis of the substrate specificity. A hydrophobic platform defined by residues Trp-711 and Trp-106, located in a highly mobile loop, appears able to allocate differently β-linked bioses. GlyA1 includes an additional C-terminal domain previously unobserved in GH3 members, but crystallization of the full-length enzyme was unsuccessful. Therefore, small angle x-ray experiments have been performed to investigate the molecular flexibility and overall putative shape. This study provided evidence that GlyA1 defines a new subfamily of GH3 proteins with a novel permuted domain topology. Phylogenetic analysis indicates that this topology is associated with microbes inhabiting the digestive tracts of ruminants and other animals, feeding on chemically diverse plant polymeric materials. PMID:27679487

Prospecting Metagenomic Enzyme Subfamily Genes for DNA Family Shuffling by a Novel PCR-based Approach*

PubMed Central

Wang, Qiuyan; Wu, Huili; Wang, Anming; Du, Pengfei; Pei, Xiaolin; Li, Haifeng; Yin, Xiaopu; Huang, Lifeng; Xiong, Xiaolong

2010-01-01

DNA family shuffling is a powerful method for enzyme engineering, which utilizes recombination of naturally occurring functional diversity to accelerate laboratory-directed evolution. However, the use of this technique has been hindered by the scarcity of family genes with the required level of sequence identity in the genome database. We describe here a strategy for collecting metagenomic homologous genes for DNA shuffling from environmental samples by truncated metagenomic gene-specific PCR (TMGS-PCR). Using identified metagenomic gene-specific primers, twenty-three 921-bp truncated lipase gene fragments, which shared 64–99% identity with each other and formed a distinct subfamily of lipases, were retrieved from 60 metagenomic samples. These lipase genes were shuffled, and selected active clones were characterized. The chimeric clones show extensive functional and genetic diversity, as demonstrated by functional characterization and sequence analysis. Our results indicate that homologous sequences of genes captured by TMGS-PCR can be used as suitable genetic material for DNA family shuffling with broad applications in enzyme engineering. PMID:20962349

Impact of a folic acid-enriched diet on urinary tract function in mice treated with testosterone and estradiol

PubMed Central

Keil, Kimberly P.; Abler, Lisa L.; Altmann, Helene M.; Wang, Zunyi; Wang, Peiqing; Ricke, William A.; Bjorling, Dale E.

2015-01-01

Aging men are susceptible to developing lower urinary tract symptoms, but the underlying etiology is unknown and the influence of dietary and environmental factors on them is unclear. We tested whether a folic acid-enriched diet changed urinary tract physiology and biology in control male mice and male mice with urinary dysfunction induced by exogenous testosterone and estradiol (T+E2), which mimics changing hormone levels in aging humans. T+E2 treatment increased mouse urine output, time between voiding events, and bladder capacity and compliance. Consumption of a folic acid-enriched diet moderated these changes without decreasing prostate wet weight or threshold voiding pressure. One potential mechanism for these changes involves water balance. T+E2 treatment increases plasma concentrations of anti-diuretic hormone, which is offset at least in part by a folic acid-enriched diet. Another potential mechanism involves neural control of micturition. The folic acid-enriched diet, fed to T+E2-treated mice, increased voiding frequency in response to intravesicular capsaicin infusion and increased mRNA abundance of the capsaicin-sensitive cation channel transient receptor potential vanilloid subfamily member 1 (Trpv1) in L6 and S1 dorsal root ganglia (DRG) neurons. T+E2 treatment and a folic acid-enriched diet also modified DNA methylation, which is capable of altering gene expression. We found the enriched diet increased global DNA methylation in dorsal and ventral prostate and L6 and S1 DRG. Our results are consistent with folic acid acting to slow or reverse T+E2-mediated alteration in urinary function in part by normalizing water balance and enhancing or preserving afferent neuronal function. PMID:25855514

Implementation of a Fluorescence-Based Screening Assay Identifies Histamine H3 Receptor Antagonists Clobenpropit and Iodophenpropit as Subunit-Selective N-Methyl-d-Aspartate Receptor Antagonists

PubMed Central

Hansen, Kasper B.; Mullasseril, Praseeda; Dawit, Sara; Kurtkaya, Natalie L.; Yuan, Hongjie; Vance, Katie M.; Orr, Anna G.; Kvist, Trine; Ogden, Kevin K.; Le, Phuong; Vellano, Kimberly M.; Lewis, Iestyn; Kurtkaya, Serdar; Du, Yuhong; Qui, Min; Murphy, T. J.; Snyder, James P.; Bräuner-Osborne, Hans

2010-01-01

N-Methyl-d-aspartate (NMDA) receptors are ligand-gated ion channels that mediate a slow, Ca2+-permeable component of excitatory synaptic transmission in the central nervous system and play a pivotal role in synaptic plasticity, neuronal development, and several neurological diseases. We describe a fluorescence-based assay that measures NMDA receptor-mediated changes in intracellular calcium in a BHK-21 cell line stably expressing NMDA receptor NR2D with NR1 under the control of a tetracycline-inducible promoter (Tet-On). The assay selectively identifies allosteric modulators by using supramaximal concentrations of glutamate and glycine to minimize detection of competitive antagonists. The assay is validated by successfully identifying known noncompetitive, but not competitive NMDA receptor antagonists among 1800 screened compounds from two small focused libraries, including the commercially available library of pharmacologically active compounds. Hits from the primary screen are validated through a secondary screen that used two-electrode voltage-clamp recordings on recombinant NMDA receptors expressed in Xenopus laevis oocytes. This strategy identified several novel modulators of NMDA receptor function, including the histamine H3 receptor antagonists clobenpropit and iodophenpropit, as well as the vanilloid receptor transient receptor potential cation channel, subfamily V, member 1 (TRPV1) antagonist capsazepine. These compounds are noncompetitive antagonists and the histamine H3 receptor ligand showed submicromolar potency at NR1/NR2B NMDA receptors, which raises the possibility that compounds can be developed that act with high potency on both glutamate and histamine receptor systems simultaneously. Furthermore, it is possible that some actions attributed to histamine H3 receptor inhibition in vivo may also involve NMDA receptor antagonism. PMID:20197375

Transient Receptor Potential Vanilloid-1 (TRPV1) Is a Mediator of Lung Toxicity for Coal Fly Ash Particulate Material

PubMed Central

Deering-Rice, Cassandra E.; Johansen, Mark E.; Roberts, Jessica K.; Thomas, Karen C.; Romero, Erin G.; Lee, Jeewoo; Yost, Garold S.; Veranth, John M.

2012-01-01

Environmental particulate matter (PM) pollutants adversely affect human health, but the molecular basis is poorly understood. The ion channel transient receptor potential vanilloid-1 (TRPV1) has been implicated as a sensor for environmental PM and a mediator of adverse events in the respiratory tract. The objectives of this study were to determine whether TRPV1 can distinguish chemically and physically unique PM that represents important sources of air pollution; to elucidate the molecular basis of TRPV1 activation by PM; and to ascertain the contributions of TRPV1 to human lung cell and mouse lung tissue responses exposed to an insoluble PM agonist, coal fly ash (CFA1). The major findings of this study are that TRPV1 is activated by some, but not all of the prototype PM materials evaluated, with rank-ordered responses of CFA1 > diesel exhaust PM > crystalline silica; TRP melastatin-8 is also robustly activated by CFA1, whereas other TRP channels expressed by airway sensory neurons and lung epithelial cells that may also be activated by CFA1, including TRPs ankyrin 1 (A1), canonical 4α (C4α), M2, V2, V3, and V4, were either slightly (TRPA1) or not activated by CFA1; activation of TRPV1 by CFA1 occurs via cell surface interactions between the solid components of CFA1 and specific amino acid residues of TRPV1 that are localized in the putative pore-loop region; and activation of TRPV1 by CFA1 is not exclusive in mouse lungs but represents a pathway by which CFA1 affects the expression of selected genes in lung epithelial cells and airway tissue. PMID:22155782

Randomised clinical trial: the efficacy of a transient receptor potential vanilloid 1 antagonist AZD1386 in human oesophageal pain.

PubMed

Krarup, A L; Ny, L; Astrand, M; Bajor, A; Hvid-Jensen, F; Hansen, M B; Simrén, M; Funch-Jensen, P; Drewes, A M

2011-05-01

Many patients with gastro-oesophageal reflux disease (GERD) are hypersensitive to heat and acid and may respond insufficiently to standard treatment. Antagonists of the heat and acid receptor 'transient receptor potential vanilloid 1'(TRPV1) are a potential drug class for GERD treatment. To investigate the effect of a TRPV1 antagonist (AZD1386) on experimentally induced oesophageal pain. Twenty-two healthy men (20-31 years) participated in this randomised, placebo-controlled, double-blinded, crossover study examining the effects of a single-dose oral AZD1386 (30 and 95 mg). Subjects were block-randomised. On treatment days, participants were stimulated with painful heat, distension, electrical current and acid in the oesophagus. Heat and pressure pain on the forearm were somatic control stimuli. intention-to-treat. A total of 21 participants completed the protocol and 1 voluntarily discontinued. In the oesophagus, both 30 and 95 mg of AZD1386 increased pain thresholds to heat stimuli 23% [95% confidence interval (CI): 10-38%] and 28%, respectively (CI: 14-43%). The skin heat tolerance was increased 2.1 °C (CI: 1.1-3.2 °C) after 30 mg AZD1386 and 4.0 °C (CI: 3.0-5.0 °C) after 95 mg. Heat analgesia persisted for 2.5 h. Pain thresholds to the other stimuli were unaffected by AZD1386. 50% reported 'feeling cold' and body temperature increased in all subjects exposed to 30 and 95 mg AZD1386 (mean increase 0.4±0.3 °C and 0.7±0.3 °C, respectively, P<0.05). AZD1386 increased oesophageal and skin heat pain thresholds and had a safe adverse-event profile. This drug class may have a potential for treatment of GERD. © 2011 Blackwell Publishing Ltd.

Carboxyl-terminal Domain of Transient Receptor Potential Vanilloid 1 Contains Distinct Segments Differentially Involved in Capsaicin- and Heat-induced Desensitization*

PubMed Central

Joseph, John; Wang, Sen; Lee, Jongseok; Ro, Jin Y.; Chung, Man-Kyo

2013-01-01

Multiple Ca2+-dependent processes are involved in capsaicin-induced desensitization of transient receptor potential vanilloid 1 (TRPV1), but desensitization of TRPV1 by heat occurs even in the absence of extracellular Ca2+, although the mechanisms are unknown. In this study, we tested the hypothesis that capsaicin and heat desensitize TRPV1 through distinct mechanisms involving distinct structural segments of TRPV1. In HEK293 cells that heterologously express TRPV1, we found that heat-induced desensitization was not affected by the inclusion of intracellular ATP or alanine mutation of Lys155, both of which attenuate capsaicin-induced desensitization, suggesting that heat-induced desensitization occurs through mechanisms distinct from capsaicin-induced desensitization. To determine protein domains involved in heat-induced desensitization, we generated chimeric proteins between TRPV1 and TRPV3, a heat-gated channel lacking heat-induced desensitization. We found that TRPV1 with the carboxyl-terminal domain (CTD) of TRPV3 retained heat activation but was impaired in heat-induced desensitization. Further experiments using chimeric or deletion mutants within TRPV1 CTD indicated that the distal half of CTD regulates the activation and desensitization of TRPV1 in modality-specific manners. Within the distal CTD, we identified two segments that distinctly regulated capsaicin- and heat-induced desensitization. The results suggest that the activation and desensitization of TRPV1 by capsaicin and heat can be modulated differentially and disproportionally through different regions of TRPV1 CTD. Identifying the domains involved in thermal regulation of TRPV1 may facilitate the development of novel anti-hyperalgesic approaches aimed at attenuating activation and enhancing desensitization of TRPV1 by thermal stimuli. PMID:24174527

Cymapamphantus valentineorum, a new genus and species of Pamphantinae (Heteroptera: Lygaeoidea: Geocoridae) from the British Virgin Islands, with a checklist of the species and keys to the tribes and genera of the subfamily

USDA-ARS?s Scientific Manuscript database

The new genus and new species Cymapamphantus valentineorum, belonging to the geocorid subfamily Pamphantinae, is described from one brachypterous male and six brachypterous females taken on Guana Island, British Virgin Islands. A dorsal habitus illustration, dorsal and lateral photographs of the ma...

Transient receptor potential vanilloid type 2 (TRPV2) expression in normal urothelium and in urothelial carcinoma of human bladder: correlation with the pathologic stage.

PubMed

Caprodossi, Sara; Lucciarini, Roberta; Amantini, Consuelo; Nabissi, Massimo; Canesin, Giacomo; Ballarini, Patrizia; Di Spilimbergo, Adriana; Cardarelli, Marco Andrea; Servi, Lucilla; Mammana, Gabriele; Santoni, Giorgio

2008-09-01

To evaluate the expression of transient receptor potential vanilloid type 2 (TRPV2) in normal human bladder and urothelial carcinoma (UC) tissues. Bladder specimens were obtained by transurethral resection or radical cystectomy. TRPV2 mRNA expression in normal human urothelial cells (NHUCs), UC cell lines, and formalin-fixed paraffin-embedded normal (n=6) and cancer bladder tissues (n=58) was evaluated by polymerase chain reaction (PCR) and quantitative real-time PCR (RT-PCR). TRPV2 protein expression was assessed by cytofluorimetric and confocal microscopy analyses in NHUCs and UC cells and by Western blotting and immunohistochemistry in normal and UC tissues. Enhanced TRPV2 mRNA and protein expression was found in high-grade and -stage UC specimens and UC cell lines. Both the full-length TRPV2 (hTRPV2) and a short splice-variant (s-TRPV2) were detected in NHUC and normal bladder specimens, whereas a progressive decline of s-TRPV2 in pTa, pT1, and pT2 stages was observed, up to a complete loss in pT3 and pT4 UC specimens. Normal human urothelial cells and bladder tissue specimens express TRPV2 at both the mRNA and protein levels. A progressive loss of s-TRPV2 accompanied by a marked increase of hTRPV2 expression was found in high-grade and -stage UC tissues.

Biosynthesis of Diterpenoids in Tripterygium Adventitious Root Cultures1[OPEN

PubMed Central

Inabuy, Fainmarinat S.; Fischedick, Justin T.; Lange, Iris; Xu, Meimei

2017-01-01

Adventitious root cultures were developed from Tripterygium regelii, and growth conditions were optimized for the abundant production of diterpenoids, which can be collected directly from the medium. An analysis of publicly available transcriptome data sets collected with T. regelii roots and root cultures indicated the presence of a large gene family (with 20 members) for terpene synthases (TPSs). Nine candidate diterpene synthase genes were selected for follow-up functional evaluation, of which two belonged to the TPS-c, three to the TPS-e/f, and four to the TPS-b subfamilies. These genes were characterized by heterologous expression in a modular metabolic engineering system in Escherichia coli. Members of the TPS-c subfamily were characterized as copalyl diphosphate (diterpene) synthases, and those belonging to the TPS-e/f subfamily catalyzed the formation of precursors of kaurane diterpenoids. The TPS-b subfamily encompassed genes coding for enzymes involved in abietane diterpenoid biosynthesis and others with activities as monoterpene synthases. The structural characterization of diterpenoids accumulating in the medium of T. regelii adventitious root cultures, facilitated by searching the Spektraris online spectral database, enabled us to formulate a biosynthetic pathway for the biosynthesis of triptolide, a diterpenoid with pharmaceutical potential. Considering the significant enrichment of diterpenoids in the culture medium, fast-growing adventitious root cultures may hold promise as a sustainable resource for the large-scale production of triptolide. PMID:28751314

Retrotransposons of the Tnt1B family are mobile in Nicotiana plumbaginifolia and can induce alternative splicing of the host gene upon insertion.

PubMed

Leprinc, A S; Grandbastien, M A; Christian, M

2001-11-01

Active retrotransposons have been identified in Nicotiana plumbaginifolia by their ability to disrupt the nitrate reductase gene in chlorate-resistant mutants selected from protoplast-derived cultures. In mutants E23 and F97, two independent insertions of Tnp2, a new retrotransposon closely related to the tobacco Tnt1 elements, were detected in the nitrate reductase gene. These two Tnp2 elements are members of the Tnt1B subfamily which shows that Tnt1B elements can be active and mutagenic in the N. plumbaginifolia genome. Furthermore, these results suggest that Tnt1B is the most active family of Tntl elements in N. plumbaginifolia, whereas in tobacco only members of the Tnt1A subfamily were found inserted in the nitrate reductase gene. The transcriptional regulations of Tnp2 and Tnt1A elements are most probably different due to non-conserved U3 regions. Our results thus support the hypothesis that different Nicotiana species contain different active Tntl subfamilies and that only one active Tntl subfamily might be maintained in each of these species. The Tnp2 insertion found in the F97 mutant was found to be spliced out of the nitrate reductase mRNA by activation of cryptic donor and acceptor sites in the nitrate reductase and the Tnp2 sequences respectively.

Diversity of ABC transporter genes across the plant kingdom and their potential utility in biotechnology.

PubMed

Lane, Thomas S; Rempe, Caroline S; Davitt, Jack; Staton, Margaret E; Peng, Yanhui; Soltis, Douglas Edward; Melkonian, Michael; Deyholos, Michael; Leebens-Mack, James H; Chase, Mark; Rothfels, Carl J; Stevenson, Dennis; Graham, Sean W; Yu, Jun; Liu, Tao; Pires, J Chris; Edger, Patrick P; Zhang, Yong; Xie, Yinlong; Zhu, Ying; Carpenter, Eric; Wong, Gane Ka-Shu; Stewart, C Neal

2016-05-31

The ATP-binding cassette (ABC) transporter gene superfamily is ubiquitous among extant organisms and prominently represented in plants. ABC transporters act to transport compounds across cellular membranes and are involved in a diverse range of biological processes. Thus, the applicability to biotechnology is vast, including cancer resistance in humans, drug resistance among vertebrates, and herbicide and other xenobiotic resistance in plants. In addition, plants appear to harbor the highest diversity of ABC transporter genes compared with any other group of organisms. This study applied transcriptome analysis to survey the kingdom-wide ABC transporter diversity in plants and suggest biotechnology applications of this diversity. We utilized sequence similarity-based informatics techniques to infer the identity of ABC transporter gene candidates from 1295 phylogenetically-diverse plant transcriptomes. A total of 97,149 putative (approximately 25 % were full-length) ABC transporter gene members were identified; each RNA-Seq library (plant sample) had 88 ± 30 gene members. As expected, simpler organisms, such as algae, had fewer unique members than vascular land plants. Differences were also noted in the richness of certain ABC transporter subfamilies. Land plants had more unique ABCB, ABCC, and ABCG transporter gene members on average (p < 0.005), and green algae, red algae, and bryophytes had significantly more ABCF transporter gene members (p < 0.005). Ferns had significantly fewer ABCA transporter gene members than all other plant groups (p < 0.005). We present a transcriptomic overview of ABC transporter gene members across all major plant groups. An increase in the number of gene family members present in the ABCB, ABCC, and ABCD transporter subfamilies may indicate an expansion of the ABC transporter superfamily among green land plants, which include all crop species. The striking difference between the number of ABCA subfamily transporter

Elastomeric member

DOEpatents

Hoppie, L.O.

1985-07-30

An energy storage device is disclosed consisting of a stretched elongated elastomeric member disposed within a tubular housing, which elastomeric member is adapted to be torsionally stressed to store energy. The elastomeric member is configured in the relaxed state with a uniform diameter body section, and transition end sections, attached to rigid end piece assemblies of a lesser diameter. The profile and deflection characteristic of the transition sections are such that upon stretching of the elastomeric member, a substantially uniform diameter assembly results, to minimize the required volume of the surrounding housing. Each of the transition sections are received within and bonded to a woven wire mesh sleeve having helical windings at a particular helix angle to control the deflection of the transition section. Each sleeve also contracts with the contraction of the associated transition section to maintain the bond there between. During manufacture, the sleeves are forced against a forming surface and bonded to the associated transition section to provide the correct profile and helix angle. 12 figs.

Does formal mentoring for faculty members matter? A survey of clinical faculty members.

PubMed

Mylona, Elza; Brubaker, Linda; Williams, Valerie N; Novielli, Karen D; Lyness, Jeffrey M; Pollart, Susan M; Dandar, Valerie; Bunton, Sarah A

2016-06-01

Mentoring relationships, for all medical school faculty members, are an important component of lifelong development and education, yet an understanding of mentoring among medical school clinical faculty members is incomplete. This study examined associations between formal mentoring relationships and aspects of faculty members' engagement and satisfaction. It then explored the variability of these associations across subgroups of clinical faculty members to understand the status of mentoring and outcomes of mentoring relationships. The authors hypothesised that academic clinical faculty members currently in formal mentoring relationships experience enhanced employee engagement and satisfaction with their department and institution. Medical school faculty members at 26 self-selected USA institutions participated in the 2011-2014 Faculty Forward Engagement Survey. Responses from clinical faculty members were analysed for relationships between mentoring status and perceptions of engagement by faculty members. Of the 11 953 clinical faculty respondents, almost one-third reported having a formal mentoring relationship (30%; 3529). Most mentored faculty indicated the relationship was important (86%; n = 3027), and over three-fourths were satisfied with their mentoring experience (77%; n = 2722). Mentored faculty members across ranks reported significantly higher levels of satisfaction and more positive perceptions of their roles in the organisation. Faculty members who were not receiving mentoring reported significantly less satisfaction with their workplace environment and lower overall satisfaction. Mentored clinical faculty members have significantly greater satisfaction with their department and institution. This multi-institutional study provides evidence that fostering mentoring opportunities may facilitate faculty members' satisfaction and engagement, which, in turn, may help medical schools retain high-quality faculty staff committed to the multidimensional

MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells.

PubMed

Chen, Dan; Chen, Zujian; Jin, Yi; Dragas, Dragan; Zhang, Leitao; Adjei, Barima S; Wang, Anxun; Dai, Yang; Zhou, Xiaofeng

2013-01-01

The miR-99 family is one of the evolutionarily most ancient microRNA families, and it plays a critical role in developmental timing and the maintenance of tissue identity. Recent studies, including reports from our group, suggested that the miR-99 family regulates various physiological processes in adult tissues, such as dermal wound healing, and a number of disease processes, including cancer. By combining 5 independent genome-wide expression profiling experiments, we identified a panel of 266 unique transcripts that were down-regulated in epithelial cells transfected with miR-99 family members. A comprehensive bioinformatics analysis using 12 different sequence-based microRNA target prediction algorithms revealed that 81 out of these 266 down-regulated transcripts are potential direct targets for the miR-99 family. Confirmation experiments and functional analyses were performed to further assess 6 selected miR-99 target genes, including mammalian Target of rapamycin (mTOR), Homeobox A1 (HOXA1), CTD small phosphatase-like (CTDSPL), N-myristoyltransferase 1 (NMT1), Transmembrane protein 30A (TMEM30A), and SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 (SMARCA5). HOXA1 is a known proto-oncogene, and it also plays an important role in embryonic development. The direct targeting of the miR-99 family to two candidate binding sequences located in the HOXA1 mRNA was confirmed using a luciferase reporter gene assay and a ribonucleoprotein-immunoprecipitation (RIP-IP) assay. Ectopic transfection of miR-99 family reduced the expression of HOXA1, which, in consequence, down-regulated the expression of its downstream gene (i.e., Bcl-2) and led to reduced proliferation and cell migration, as well as enhanced apoptosis. In summary, we identified a number of high-confidence miR-99 family target genes, including proto-oncogene HOXA1, which may play an important role in regulating epithelial cell proliferation and migration during

Submission to GenBank of the Plasma membrane intrinsic protein (PIP) Subfamily in Cotton – GenBank Accession No. GU998827-GU998830 and GenBank Accession TPA;inferential No. BK007045-BK007052

USDA-ARS?s Scientific Manuscript database

The plasma membrane intrinsic proteins (PIP) are one of the five aquaporin protein subfamilies. Aquaporin proteins are known to facilitate water transport through biological membranes. In order to identify NIP aquaporin gene candidates in cotton (Gossypium hirsutum L.), in silico and molecular clon...

The distribution of glutathione and homoglutathione in leaf, root and seed tissue of 73 species across the three sub-families of the Leguminosae.

PubMed

Colville, Louise; Sáez, Clara M Blanco; Lewis, Gwilym P; Kranner, Ilse

2015-07-01

Homoglutathione (γ-glutamyl-cysteinyl-β-alanine) is a homologue of glutathione (γ-glutamyl-cysteinyl-glycine), which is a ubiquitous and indispensable tripeptide in eukaryotes with multi-facetted functions, many of which relate to cellular redox regulation. Homoglutathione is unique to the Leguminosae family, but studies of its occurrence have been restricted to the Papilionoideae subfamily, and almost exclusively to crop species. To determine whether the distribution of homoglutathione in the Leguminosae has a phylogenetic basis the occurrence of homoglutathione was investigated in the leaves, roots and seeds of 73 wild species of Leguminosae, representing 30 tribes across the Caesalpinioideae, Mimosoideae and Papilionoideae subfamilies. Homoglutathione was found only in the Papilionoideae, and was generally restricted to the 'Old World Clade'. It is proposed that homoglutathione may have arisen following a whole genome duplication event after the divergence of the Old World Clade. Homoglutathione is believed to fulfil the same functional roles as glutathione, but this study showed that homoglutathione and glutathione have different tissue-specific distribution patterns. Homoglutathione tended to occur more frequently in root tissue, and higher concentrations were found in leaves and roots, whereas glutathione tended to be present at the highest concentrations in seeds. This may reflect a distinct role for homoglutathione, particularly in roots, or an inability of homoglutathione to functionally replace glutathione in reproductive tissues. However, no relationships with environmental factors or nodulation were observed. Greater understanding of the factors that influence homoglutathione distribution may help to elucidate its unique function in some legume species. Copyright © 2015 Elsevier Ltd. All rights reserved.

[Effect of high-fat diet on expression of transient receptor potential vanilloid 1 in respiratory tract and dorsal root ganglion of mice].

PubMed

Zhu, Lian; Xu, Zhi-Liang

2017-07-01

To investigate the effect of high-fat diet on the expression of transient receptor potential vanilloid 1 (TRPV1) in the respiratory system and the dorsal root ganglion (DRG) of mice, as well as its effect on the excitability of sensory neurons. A total of 20 C57BL/6 mice were randomly divided into normal-diet (ND) group and high-fat diet (HFD) group, with 10 mice in each group. The mice were given corresponding diets and body weights were monitored. After 7 weeks of feeding, lung tissue, bronchial tissue, and DRG at thoracic segments 3-4 were collected and immunohistochemical staining was performed. A patch clamp was used to measure the number of action potentials and TRPV1 current intensity in the DRG. After 7 weeks of feeding, the HFD group had significantly greater mean weight gain than the ND group (6.4±2.6 g vs 2.3±0.5 g; P<0.001). The HFD group had significantly higher expression of TRPV1 in the bronchus, pulmonary alveoli, and DRG than the ND group (P<0.05). Compared with the ND group, the HFD group had significant increases in the TRPV1 current intensity and number of action potentials in the DRG (P<0.05). High-fat diet induces a significant increase in body weight and leads to high expression of TRPV1 and high excitability in the respiratory system and the peripheral sensory neurons. This suggests that TRPV1 may be an important factor in the physiopathological mechanisms of bronchial hyperresponsiveness.

Elastomeric member

DOEpatents

Hoppie, Lyle O.

1985-01-01

An energy storage device (10) is disclosed consisting of a stretched elongated elastomeric member (16) disposed within a tubular housing (14), which elastomeric member (16) is adapted to be torsionally stressed to store energy. The elastomeric member (16) is configured in the relaxed state with a uniform diameter body section (74), and transition end sections (76, 78), attached to rigid end piece assemblies (22, 24) of a lesser diameter. The profile and deflection characteristic of the transition sections (76, 78) are such that upon stretching of the elastomeric member (16), a substantially uniform diameter assembly results, to minimize the required volume of the surrounding housing (14). Each of the transition sections (76, 78) are received within and bonded to a woven wire mesh sleeve (26, 28) having helical windings at a particular helix angle to control the deflection of the transition section. Each sleeve (26, 28) also contracts with the contraction of the associated transition section to maintain the bond therebetween. During manufacture, the sleeves (26, 28) are forced against a forming surface and bonded to the associated transition section (76, 78) to provide the correct profile and helix angle.

Ameliorating Endothelial Mitochondrial Dysfunction Restores Coronary Function via Transient Receptor Potential Vanilloid 1-Mediated Protein Kinase A/Uncoupling Protein 2 Pathway.

PubMed

Xiong, Shiqiang; Wang, Peijian; Ma, Liqun; Gao, Peng; Gong, Liuping; Li, Li; Li, Qiang; Sun, Fang; Zhou, Xunmei; He, Hongbo; Chen, Jing; Yan, Zhencheng; Liu, Daoyan; Zhu, Zhiming

2016-02-01

Coronary heart disease arising from atherosclerosis is a leading cause of cardiogenic death worldwide. Mitochondria are the principal source of reactive oxygen species (ROS), and defective oxidative phosphorylation by the mitochondrial respiratory chain contributes to ROS generation. Uncoupling protein 2 (UCP2), an adaptive antioxidant defense factor, protects against mitochondrial ROS-induced endothelial dysfunction in atherosclerosis. The activation of transient receptor potential vanilloid 1 (TRPV1) attenuates vascular dysfunction. Therefore, whether TRPV1 activation antagonizes coronary lesions by alleviating endothelial mitochondrial dysfunction and enhancing the activity of the protein kinase A/UCP2 pathway warrants examination. ApoE(-/-), ApoE(-/-)/TRPV1(-/-), and ApoE(-/-)/UCP2(-/-) mice were fed standard chow, a high-fat diet (HFD), or the HFD plus 0.01% capsaicin. HFD intake profoundly impaired coronary vasodilatation and myocardial perfusion and shortened the survival duration of ApoE(-/-) mice. TRPV1 or UCP2 deficiency exacerbated HFD-induced coronary dysfunction and was associated with increased ROS generation and reduced nitric oxide production in the endothelium. The activation of TRPV1 by capsaicin upregulated UCP2 expression via protein kinase A phosphorylation, thereby alleviating endothelial mitochondrial dysfunction and inhibiting mitochondrial ROS generation. In vivo, dietary capsaicin supplementation enhanced coronary relaxation and prolonged the survival duration of HFD-fed ApoE(-/-) mice. These effects were not observed in ApoE(-/-) mice lacking the TRPV1 or UCP2 gene. The upregulation of protein kinase A /UCP2 via TRPV1 activation ameliorates coronary dysfunction and prolongs the lifespan of atherosclerotic mice by ameliorating endothelial mitochondrial dysfunction. Dietary capsaicin supplementation may represent a promising intervention for the primary prevention of coronary heart disease. © 2015 American Heart Association, Inc.

The SIDER2 elements, interspersed repeated sequences that populate the Leishmania genomes, constitute subfamilies showing chromosomal proximity relationship.

PubMed

Requena, Jose M; Folgueira, Cristina; López, Manuel C; Thomas, M Carmen

2008-06-02

Protozoan parasites of the genus Leishmania are causative agents of a diverse spectrum of human diseases collectively known as leishmaniasis. These eukaryotic pathogens that diverged early from the main eukaryotic lineage possess a number of unusual genomic, molecular and biochemical features. The completion of the genome projects for three Leishmania species has generated invaluable information enabling a direct analysis of genome structure and organization. By using DNA macroarrays, made with Leishmania infantum genomic clones and hybridized with total DNA from the parasite, we identified a clone containing a repeated sequence. An analysis of the recently completed genome sequence of L. infantum, using this repeated sequence as bait, led to the identification of a new class of repeated elements that are interspersed along the different L. infantum chromosomes. These elements turned out to be homologues of SIDER2 sequences, which were recently identified in the Leishmania major genome; thus, we adopted this nomenclature for the Leishmania elements described herein. Since SIDER2 elements are very heterogeneous in sequence, their precise identification is rather laborious. We have characterized 54 LiSIDER2 elements in chromosome 32 and 27 ones in chromosome 20. The mean size for these elements is 550 bp and their sequence is G+C rich (mean value of 66.5%). On the basis of sequence similarity, these elements can be grouped in subfamilies that show a remarkable relationship of proximity, i.e. SIDER2s of a given subfamily locate close in a chromosomal region without intercalating elements. For comparative purposes, we have identified the SIDER2 elements existing in L. major and Leishmania braziliensis chromosomes 32. While SIDER2 elements are highly conserved both in number and location between L. infantum and L. major, no such conservation exists when comparing with SIDER2s in L. braziliensis chromosome 32. SIDER2 elements constitute a relevant piece in the Leishmania

Possible involvement of the transient receptor potential vanilloid type 1 channel in postoperative adhesive obstruction and its prevention by a kampo (traditional Japanese) medicine, daikenchuto.

PubMed

Tokita, Yohei; Yamamoto, Masahiro; Satoh, Kazuko; Nishiyama, Mitsue; Iizuka, Seiichi; Imamura, Sachiko; Kase, Yoshio

2011-01-01

This study focused on the localization of transient receptor potential vanilloid type 1 (TRPV1) in the intestines in postoperative adhesion model rats and investigated the underlying mechanism for the anti-adhesion action of daikenchuto (DKT), especially in relation to TRPV1. Postoperative intestinal adhesion was induced by sprinkling talc in the small intestine. The expression of TRPV1 mRNA was examined by in situ hybridization and real-time RT-PCR. The effects of DKT and its major ingredient, hydroxy sanshool, with or without ruthenium red, a TRP-channel antagonist, on talc-induced intestinal adhesions were evaluated. The level of TRPV1 mRNA was higher in the adhesion regions of talc-treated rats than in normal small intestine of sham-operated rats. Localization of TRPV1 mRNA expression was identified in the submucosal plexus of both sham-operated and talc-treated rats; and in talc-treated rats, it was observed also in the myenteric plexus and regions of adhesion. Capsaicin, DKT, and hydroxy sanshool significantly prevented formation of intestinal adhesions. The effects of DKT and hydroxy sanshool were abrogated by subcutaneous injection of ruthenium red. These results suggest that pharmacological modulation of TRPV1 might be a possible therapeutic option in postoperative intestinal adhesion, which might be relevant to the prevention of postoperative adhesive obstruction by DKT.

Current BIP members

Science.gov Websites

PEER logo Pacific Earthquake Engineering Research Center home about peer news events research products laboratories publications nisee b.i.p. members education FAQs links bip members PEER Business and

Metal Binding Properties of Escherichia coli YjiA, a Member of the Metal Homeostasis-Associated COG0523 Family of GTPases

PubMed Central

2013-01-01

GTPases are critical molecular switches involved in a wide range of biological functions. Recent phylogenetic and genomic analyses of the large, mostly uncharacterized COG0523 subfamily of GTPases revealed a link between some COG0523 proteins and metal homeostasis pathways. In this report, we detail the bioinorganic characterization of YjiA, a representative member of COG0523 subgroup 9 and the only COG0523 protein to date with high-resolution structural information. We find that YjiA is capable of binding several types of transition metals with dissociation constants in the low micromolar range and that metal binding affects both the oligomeric structure and GTPase activity of the enzyme. Using a combination of X-ray crystallography and site-directed mutagenesis, we identify, among others, a metal-binding site adjacent to the nucleotide-binding site in the GTPase domain that involves a conserved cysteine and several glutamate residues. Mutations of the coordinating residues decrease the impact of metal, suggesting that metal binding to this site is responsible for modulating the GTPase activity of the protein. These findings point toward a regulatory function for these COG0523 GTPases that is responsive to their metal-bound state. PMID:24449932

Modulation of transient receptor potential vanilloid 4-mediated membrane currents and synaptic transmission by protein kinase C

PubMed Central

Cao, De-Shou; Yu, Shuang-Quan; Premkumar, Louis S

2009-01-01

Background Transient receptor potential Vanilloid (TRPV) receptors are involved in nociception and are expressed predominantly in sensory neurons. TRPV1, a non-selective cation channel has been extensively studied and is responsible for inflammatory thermal hypersensitivity. In this study, the expression and function of TRPV4 have been characterized and compared with those of TRPV1. Results Immunohistochemical studies revealed that both TRPV1 and TRPV4 were co-expressed in dorsal root ganglion (DRG) neuronal cell bodies and in the central terminals of laminae I and II of the spinal dorsal horn (DH). In Ca2+ fluorescence imaging and whole-cell patch-clamp experiments, TRPV1- and TRPV4-mediated responses were observed in a population of the same DRG neurons. Sensitization of TRPV1 has been shown to be involved in inflammatory pain conditions. Incubation with phorbol 12, 13-dibutyrate (PDBu), a PKC activator, resulted in a significant potentiation of TRPV4 currents in DRG neurons. In TRPV4 expressing HEK 293T cells, PDBu increased 4α-phorbol 12, 13-didecanoate (4α-PDD)-induced single-channel activity in cell-attached patches, which was abrogated by bisindolylmaleimide (BIM), a selective PKC inhibitor. TRPV4 is also expressed at the central terminals of sensory neurons. Activation of TRPV4 by 4α-PDD increased the frequency of miniature excitatory post synaptic currents (mEPSCs) in DRG-DH neuronal co-cultures. 4α-PDD-induced increase in the frequency of mEPSCs was further enhanced by PDBu. The expression of TRP channels has been shown in other areas of the CNS; application of 4α-PDD significantly increased the mEPSC frequency in cultured hippocampal neurons, which was further potentiated by PDBu, whereas, TRPV1 agonist capsaicin did not modulate synaptic transmission. Conclusion These results indicate that TRPV4 and TRPV1 are co-expressed in certain DRG neurons and TRPV4 can be sensitized by PKC not only in DRG neuronal cell bodies, but also in the central sensory

Evolutionary conservation and changes in insect TRP channels.

PubMed

Matsuura, Hironori; Sokabe, Takaaki; Kohno, Keigo; Tominaga, Makoto; Kadowaki, Tatsuhiko

2009-09-10

TRP (Transient Receptor Potential) channels respond to diverse stimuli and thus function as the primary integrators of varied sensory information. They are also activated by various compounds and secondary messengers to mediate cell-cell interactions as well as to detect changes in the local environment. Their physiological roles have been primarily characterized only in mice and fruit flies, and evolutionary studies are limited. To understand the evolution of insect TRP channels and the mechanisms of integrating sensory inputs in insects, we have identified and compared TRP channel genes in Drosophila melanogaster, Bombyx mori, Tribolium castaneum, Apis mellifera, Nasonia vitripennis, and Pediculus humanus genomes as part of genome sequencing efforts. All the insects examined have 2 TRPV, 1 TRPN, 1 TRPM, 3 TRPC, and 1 TRPML subfamily members, demonstrating that these channels have the ancient origins in insects. The common pattern also suggests that the mechanisms for detecting mechanical and visual stimuli and maintaining lysosomal functions may be evolutionarily well conserved in insects. However, a TRPP channel, the most ancient TRP channel, is missing in B. mori, A. mellifera, and N. vitripennis. Although P. humanus and D. melanogaster contain 4 TRPA subfamily members, the other insects have 5 TRPA subfamily members. T. castaneum, A. mellifera, and N. vitripennis contain TRPA5 channels, which have been specifically retained or gained in Coleoptera and Hymenoptera. Furthermore, TRPA1, which functions for thermotaxis in Drosophila, is missing in A. mellifera and N. vitripennis; however, they have other Hymenoptera-specific TRPA channels (AmHsTRPA and NvHsTRPA). NvHsTRPA expressed in HEK293 cells is activated by temperature increase, demonstrating that HsTRPAs function as novel thermal sensors in Hymenoptera. The total number of insect TRP family members is 13-14, approximately half that of mammalian TRP family members. As shown for mammalian TRP channels, this

Collapsable seal member

DOEpatents

Sherrell, Dennis L.

1990-01-01

A hollow, collapsable seal member normally disposed in a natural expanded state offering fail-safe pressure sealing against a seating surface and adapted to be evacuated by a vacuum force for collapsing the seal member to disengage the same from said seating surface.

Collapsable seal member

DOEpatents

Sherrell, D.L.

1983-12-08

A hollow, collapsable seal member normally disposed in a natural expanded state offering fail-safe pressure sealing against a seating surface and adapted to be evacuated by a vacuum force for collapsing the seal member to disengage the same from said seating surface.

Modulation of the Rat Hepatic Cytochrome P4501A Subfamily Using Biotin Supplementation

PubMed Central

Ronquillo-Sánchez, M. D.; Camacho-Carranza, R.; Fernandez-Mejia, C.; Hernández-Ojeda, S.; Elinos-Baez, M.; Espinosa-Aguirre, J. J.

2013-01-01

Studies have found that biotin favors glucose and lipid metabolism, and medications containing biotin have been developed. Despite the use of biotin as a pharmacological agent, few studies have addressed toxicity aspects including the possible interaction with cytochrome P450 enzyme family. This study analyzed the effects of pharmacological doses of biotin on the expression and activity of the cytochrome P4501A subfamily involved in the metabolism of xenobiotics. Wistar rats were treated daily with biotin (2 mg/kg, i.p.), while the control groups were treated with saline. All of the rats were sacrificed by cervical dislocation after 1, 3, 5, or 7 days of treatment. CYP1A1 and CYP1A2 mRNAs were modified by biotin while enzyme activity and protein concentration were not affected. The lack of an effect of biotin on CYP1A activity was confirmed using other experimental strategies, including (i) cotreatment of the animals with biotin and a known CYP1A inducer; (ii) the addition of biotin to the reaction mixtures for the measurement of CYP1A1 and CYP1A2 activities; and (iii) the use of an S9 mixture that was prepared from control and biotin-treated rats to analyze the activation of benzo[a]pyrene (BaP) into mutagenic metabolites using the Ames test. The results suggest that biotin does not influence the CYP1A-mediated metabolism of xenobiotics. PMID:23984390

Discopersicus n. gen., a New Member of the Family Tylenchidae Örley, 1880 with Detailed SEM Study on Two Known Species of the Genus Discotylenchus Siddiqi, 1980 (Nematoda; Tylenchidae) from Iran.

PubMed

Yaghoubi, Ali; Pourjam, Ebrahim; Álvarez-Ortega, Sergio; Liébanas, Gracia; Atighi, Mohammad Reza; Pedram, Majid

2016-09-01

Discopersicus iranicus n. gen., n. comb., previously described from Iran as a new species under the genus Discotylenchus , is illustrated using light microscope and scanning electron microscope (SEM) observations and further studied using molecular characters. SEM studies revealed the newly proposed genus has oblique amphidial apertures on the lateral sides of the lip region. SEM images are also provided for two species of Discotylenchus , namely D. discretus and D. brevicaudatus , as the first SEM study of the genus . These results confirmed longitudinal amphidial aperture type on lateral sides of the lip region in genus Discotylenchus , as noted by Siddiqi while erecting the genus with D. discretus as the type species . Molecular phylogenetic analyses using partial small subunit (SSU) and large subunit (LSU) rDNA sequences revealed the affinity of the genus Discopersicus n. gen. with members of the subfamily Boleodorinae, as supported by morphological characters (mainly, the oblique amphidial opening).

Personality characteristics of Wikipedia members.

PubMed

Amichai-Hamburger, Yair; Lamdan, Naama; Madiel, Rinat; Hayat, Tsahi

2008-12-01

Wikipedia is an online, free access, volunteer-contributed encyclopedia. This article focuses on the Wikipedians' (Wikipedia users) personality characteristics, studying Wikipedians' conceptions of Real-Me and BFI dimensions. To survey these aspects, we posted links to two online web questionnaires; one was targeted at Wikipedians and the second to non-Wikipedia users. One hundred and thirty-nine subjects participated in the study, of which 69 were active Wikipedia members. It was found that Wikipedia members locate their real me on the Internet more frequently as compared to non-Wikipedia members. Variance analysis revealed significant differences between Wikipedia members and non-Wikipedia members in agreeableness, openness, and conscientiousness, which were lower for the Wikipedia members. An interaction was found between Wikipedia membership and gender: introverted women were more likely to be Wikipedia members as compared with extroverted women. The results of this study are discussed with special emphasis on the understanding of the motivators of Wikipedia members.

Transient receptor potential vanilloid-3 (TRPV3) activation plays a central role in cardiac fibrosis induced by pressure overload in rats via TGF-β1 pathway.

PubMed

Liu, Yan; Qi, Hanping; E, Mingyao; Shi, Pilong; Zhang, Qianhui; Li, Shuzhi; Wang, Ye; Cao, Yonggang; Chen, Yunping; Ba, Lina; Gao, Jingquan; Huang, Wei; Sun, Hongli

2018-02-01

Cardiac fibrosis is a common pathologic change along with pressure overload. Recent studies indicated that transient receptor potential (TRP) channels played multiple roles in heart. However, the functional role of transient receptor potential vanilloid-3 (TRPV3) in cardiac fibrosis remained unclear. The present study was designed to investigate the relationship between TRPV3 activation and pressure overload-induced cardiac fibrosis. Pressure overload rats were successfully established by abdominal aortic constriction (AAC), and cardiac fibrosis was simulated by 100 nM angiotensin II (Ang II) in neonatal cardiac fibroblasts. Echocardiographic parameters, cardiac fibroblast proliferation, cell cycle, intracellular calcium concentration ([Ca 2+ ] i ), and the protein expressions of collagen I, collagen III, transforming growth factor beta 1 (TGF-β 1 ), cyclin E, and cyclin-dependent kinase 2 (CDK2) were measured. Echocardiographic and histological measurements suggested that the activation of TRPV3 exacerbated the cardiac dysfunction and increased interstitial fibrosis in pressure overload rats. Further results showed that TRPV3 activation upregulated the expressions of collagen I, collagen III, TGF-β 1 , cyclin E, and CDK2 in vivo and in vitro. At the same time, blocking TGF-β 1 pathway could partially reverse the effect of TRPV3 activation. These results suggested that TRPV3 activation exacerbated cardiac fibrosis by promoting cardiac fibroblast proliferation through TGF-β 1 /CDK2/cyclin E pathway in the pressure-overloaded rat hearts.

Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kass, D.H.; Batzer, M.A.; Deininger, P.L.

The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome.more » However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.« less

Phylogenomics and comparative genomic studies delineate six main clades within the family Enterobacteriaceae and support the reclassification of several polyphyletic members of the family.

PubMed

Alnajar, Seema; Gupta, Radhey S

2017-10-01

The family Enterobacteriaceae harbors many important pathogens, however it has proven difficult to reliably distinguish different members of this family or discern their interrelationships. To understand the interrelationships among the Enterobacteriaceae species, we have constructed two comprehensive phylogenetic trees for 78 genome-sequenced Enterobacteriaceae species based on 2487 core genome proteins, and another set of 118 conserved proteins. The genome sequences of Enterobacteriaceae species were also analyzed for genetic relatedness based on average amino acid identity and 16S rRNA sequence similarity. In parallel, comparative genomic studies on protein sequences from the Enterobacteriaceae have identified 88 molecular markers in the form of conserved signature indels (CSIs) that are uniquely shared by specific members of the family. All of these multiple lines of investigations provide consistent evidence that most of the species/genera within the family can be assigned to 6 different subfamily level clades which are designated as the "Escherichia clade", "Klebsiella clade", "Enterobacter clade", "Kosakonia clade", "Cronobacter clade" and "Cedecea clade". The members of the six described clades, in addition to their distinct branching in phylogenetic trees, can now be reliably demarcated in molecular terms on the basis of multiple identified CSIs that are exclusively shared by the group members. Several additional CSIs identified in this work that are either specific for individual genera (viz. Kosakonia, Kluyvera and Escherichia-Shigella), or are present at various taxonomic depths, offer information regarding the interrelationships among the different clades. The described molecular markers provide novel means for diagnostic as well as genetic and biochemical studies on the Enterobacteriaceae species and for resolving the polyphyly of its several genera viz. Escherichia, Enterobacter and Kluyvera. On the bases of our results, we are proposing the

Identification and characterization of a member of Rab subfamily, Rab8, from Clonorchis sinensis.

PubMed

Liang, Pei; He, Lei; Yu, Jinyun; Xie, Zhizhi; Chen, Xueqing; Mao, Qiang; Liang, Chi; Huang, Yan; Lu, Gang; Yu, Xinbing

2015-05-01

The Rabs act as a binary molecular switch that utilizes the conformational changes associated with the GTP/GDP cycle to elicit responses from target proteins. It regulates a broad spectrum of cellular processes including cell proliferation, cytoskeletal assembly, and intracellular membrane trafficking in eukaryotes. The Rab8 from Clonorchis sinensis (CsRab8) was composed of 199 amino acids. The deduced amino acid sequence shared above 50% identities with other species from trematode, tapeworm, mammal, insecta, nematode, and reptile, respectively. The homologous analysis of sequences showed the conservative domains: G1 box (GDSGVGKS), G2 box (T), G3 box (DTAG), G4 box (GNKCDL), and G5 box. In addition, the structure modeling had also shown other functional domains: GTP/Mg(2+) binding sites, switch I region, and switch II region. A phylogenic tree analysis indicated that the CsRab8 was clustered with the Rab from Schistosoma japonicum, and trematode and tapeworm came from the same branch, which was different from an evolutional branch built by other species, such as mammal animal, insecta, nematode, and reptile. The recombinant CsRab8 protein was expressed in Escherichia coli and the purified protein was a soluble molecule by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis. CsRab8 was identified as a component of excretory/secretory products of C. sinensis by western blot analysis. The transcriptional level of CsRab8 at metacercaria stage was the highest at the four stages and higher by 56.49-folds than that at adult worm, 1.23-folds than that at excysted metacercaria, and 2.69-folds than that at egg stage. Immunohistochemical localization analysis showed that CsRab8 was specifically distributed in the tegument, vitellarium, eggs, and testicle of adult worms, and detected on the vitellarium and tegument of metacercaria. Combined with the results, CsRab8 is indispensable for survival and development of parasites, especially for regulating excretory/secretory products secretion.

Establishing a Mouse Model of a Pure Small Fiber Neuropathy with the Ultrapotent Agonist of Transient Receptor Potential Vanilloid Type 1.

PubMed

Lee, Yi-Chen; Lu, Shui-Chin; Hsieh, Yu-Lin

2018-02-13

Patients with diabetes mellitus (DM) or those experiencing the neurotoxic effects of chemotherapeutic agents may develop sensation disorders due to degeneration and injury of small-diameter sensory neurons, referred to as small fiber neuropathy. Present animal models of small fiber neuropathy affect both large- and small-diameter sensory fibers and thus create a neuropathology too complex to properly assess the effects of injured small-diameter sensory fibers. Therefore, it is necessary to develop an experimental model of pure small fiber neuropathy to adequately examine these issues. This protocol describes an experimental model of small fiber neuropathy specifically affecting small-diameter sensory nerves with resiniferatoxin (RTX), an ultrapotent agonist of transient receptor potential vanilloid type 1 (TRPV1), through a single dose of intraperitoneal injection, referred to as RTX neuropathy. This RTX neuropathy showed pathological manifestations and behavioral abnormalities that mimic the clinical characteristics of patients with small fiber neuropathy, including intraepidermal nerve fiber (IENF) degeneration, specifically injury in small-diameter neurons, and induction of thermal hypoalgesia and mechanical allodynia. This protocol tested three doses of RTX (200, 50, and 10 µg/kg, respectively) and concluded that a critical dose of RTX (50 µg/kg) is required for the development of typical small fiber neuropathy manifestations, and prepared a modified immunostaining procedure to investigate IENF degeneration and neuronal soma injury. The modified procedure is fast, systematic, and economic. Behavioral evaluation of neuropathic pain is critical to reveal the function of small-diameter sensory nerves. The evaluation of mechanical thresholds in experimental rodents is particularly challenging and this protocol describes a customized metal mesh that is suitable for this type of assessment in rodents. In summary, RTX neuropathy is a new and easily established

A novel subfamily of monomeric inorganic pyrophosphatases in photosynthetic eukaryotes

PubMed Central

Gómez-García, María R.; Losada, Manuel; Serrano, Aurelio

2005-01-01

Two sPPases (soluble inorganic pyrophosphatases, EC 3.6.1.1) have been isolated from the microalga Chlamydomonas reinhardtii. Both are monomeric proteins of organellar localization, the chloroplastic sPPase I [Cr (Ch. reinhardtii)-sPPase I, 30 kDa] is a major isoform and slightly larger protein than the mitochondrial sPPase II (Cr-sPPase II, 24 kDa). They are members of sPPase family I and are encoded by two different cDNAs, as demonstrated by peptide mass fingerprint analysis. Molecular phylogenetic analyses indicated that Cr-sPPase I is closely related to other eukaryotic sPPases, whereas Cr-sPPase II resembles its prokaryotic counterparts. Chloroplastic sPPase I may have replaced a cyanobacterial ancestor very early during plastid evolution. Cr-sPPase II orthologues are found in members of the green photosynthetic lineage, but not in animals or fungi. These two sPPases from photosynthetic eukaryotes are novel monomeric family I sPPases with different molecular phylogenies and cellular localizations. PMID:16313235

Tandem Duplication Events in the Expansion of the Small Heat Shock Protein Gene Family in Solanum lycopersicum (cv. Heinz 1706)

PubMed Central

Krsticevic, Flavia J.; Arce, Débora P.; Ezpeleta, Joaquín; Tapia, Elizabeth

2016-01-01

In plants, fruit maturation and oxidative stress can induce small heat shock protein (sHSP) synthesis to maintain cellular homeostasis. Although the tomato reference genome was published in 2012, the actual number and functionality of sHSP genes remain unknown. Using a transcriptomic (RNA-seq) and evolutionary genomic approach, putative sHSP genes in the Solanum lycopersicum (cv. Heinz 1706) genome were investigated. A sHSP gene family of 33 members was established. Remarkably, roughly half of the members of this family can be explained by nine independent tandem duplication events that determined, evolutionarily, their functional fates. Within a mitochondrial class subfamily, only one duplicated member, Solyc08g078700, retained its ancestral chaperone function, while the others, Solyc08g078710 and Solyc08g078720, likely degenerated under neutrality and lack ancestral chaperone function. Functional conservation occurred within a cytosolic class I subfamily, whose four members, Solyc06g076570, Solyc06g076560, Solyc06g076540, and Solyc06g076520, support ∼57% of the total sHSP RNAm in the red ripe fruit. Subfunctionalization occurred within a new subfamily, whose two members, Solyc04g082720 and Solyc04g082740, show heterogeneous differential expression profiles during fruit ripening. These findings, involving the birth/death of some genes or the preferential/plastic expression of some others during fruit ripening, highlight the importance of tandem duplication events in the expansion of the sHSP gene family in the tomato genome. Despite its evolutionary diversity, the sHSP gene family in the tomato genome seems to be endowed with a core set of four homeostasis genes: Solyc05g014280, Solyc03g082420, Solyc11g020330, and Solyc06g076560, which appear to provide a baseline protection during both fruit ripening and heat shock stress in different tomato tissues. PMID:27565886

Cannabinoid hyperemesis syndrome: potential mechanisms for the benefit of capsaicin and hot water hydrotherapy in treatment.

PubMed

Richards, John R; Lapoint, Jeff M; Burillo-Putze, Guillermo

2018-01-01

Cannabinoid hyperemesis syndrome is a clinical disorder that has become more prevalent with increasing use of cannabis and synthetic cannabinoids, and which is difficult to treat. Standard antiemetics commonly fail to alleviate the severe nausea and vomiting characteristic of the syndrome. Curiously, cannabinoid hyperemesis syndrome patients often report dramatic relief of symptoms with hot showers and baths, and topical capsaicin. In this review, we detail the pharmacokinetics and pharmacodynamics of capsaicin and explore possible mechanisms for its beneficial effect, including activation of transient receptor potential vanilloid 1 and neurohumoral regulation. Putative mechanisms responsible for the benefit of hot water hydrotherapy are also investigated. An extensive search of PubMed, OpenGrey, and Google Scholar from inception to April 2017 was performed to identify known and theoretical thermoregulatory mechanisms associated with the endocannabinoid system. The searches resulted in 2417 articles. These articles were screened for relevant mechanisms behind capsaicin and heat activation having potential antiemetic effects. References from the selected articles were also hand-searched. A total of 137 articles were considered relevant and included. Capsaicin: Topical capsaicin is primarily used for treatment of neuropathic pain, but it has also been used successfully in some 20 cases of cannabinoid hyperemesis syndrome. The pharmacokinetics and pharmacodynamics of capsaicin as a transient receptor potential vanilloid 1 agonist may explain this effect. Topical capsaicin has a longer half-life than oral administration, thus its potential duration of benefit is longer. Capsaicin and transient receptor potential vanilloid 1: Topical capsaicin binds and activates the transient receptor potential vanilloid 1 receptor, triggering influx of calcium and sodium, as well as release of inflammatory neuropeptides leading to transient burning, stinging, and itching. This elicits

Evolution of the Karyopherin-β Family of Nucleocytoplasmic Transport Factors; Ancient Origins and Continued Specialization

PubMed Central

O'Reilly, Amanda J.; Dacks, Joel B.; Field, Mark C.

2011-01-01

Background Macromolecular transport across the nuclear envelope (NE) is achieved through nuclear pore complexes (NPCs) and requires karyopherin-βs (KAP-βs), a family of soluble receptors, for recognition of embedded transport signals within cargo. We recently demonstrated, through proteomic analysis of trypanosomes, that NPC architecture is likely highly conserved across the Eukaryota, which in turn suggests conservation of the transport mechanisms. To determine if KAP-β diversity was similarly established early in eukaryotic evolution or if it was subsequently layered onto a conserved NPC, we chose to identify KAP-β sequences in a diverse range of eukaryotes and to investigate their evolutionary history. Results Thirty six predicted proteomes were scanned for candidate KAP-β family members. These resulting sequences were resolved into fifteen KAP-β subfamilies which, due to broad supergroup representation, were most likely represented in the last eukaryotic common ancestor (LECA). Candidate members of each KAP-β subfamily were found in all eukaryotic supergroups, except XPO6, which is absent from Archaeplastida. Phylogenetic reconstruction revealed the likely evolutionary relationships between these different subfamilies. Many species contain more than one representative of each KAP-β subfamily; many duplications are apparently taxon-specific but others result from duplications occurring earlier in eukaryotic history. Conclusions At least fifteen KAP-β subfamilies were established early in eukaryote evolution and likely before the LECA. In addition we identified expansions at multiple stages within eukaryote evolution, including a multicellular plant-specific KAP-β, together with frequent secondary losses. Taken with evidence for early establishment of NPC architecture, these data demonstrate that multiple pathways for nucleocytoplasmic transport were established prior to the radiation of modern eukaryotes but that selective pressure continues to sculpt

The role of calbindin-D28k on renal calcium and magnesium handling during treatment with loop and thiazide diuretics

PubMed Central

Lee, Chien-Te; Ng, Hwee-Yeong; Lee, Yueh-Ting; Lai, Li-Wen

2015-01-01

Calbindin-D28k (CBD-28k) is a calcium binding protein located in the distal convoluted tubule (DCT) and plays an important role in active calcium transport in the kidney. Loop and thiazide diuretics affect renal Ca and Mg handling: both cause Mg wasting, but have opposite effects on Ca excretion as loop diuretics increase, but thiazides decrease, Ca excretion. To understand the role of CBD-28k in renal Ca and Mg handling in response to diuretics treatment, we investigated renal Ca and Mg excretion and gene expression of DCT Ca and Mg transport molecules in wild-type (WT) and CBD-28k knockout (KO) mice. Mice were treated with chlorothiazide (CTZ; 50 mg·kg−1·day−1) or furosemide (FSM; 30 mg·kg−1·day−1) for 3 days. To avoid volume depletion, salt was supplemented in the drinking water. Urine Ca excretion was reduced in WT, but not in KO mice, by CTZ. FSM induced similar hypercalciuria in both groups. DCT Ca transport molecules, including transient receptor potential vanilloid 5 (TRPV5), TRPV6, and CBD-9k, were upregulated by CTZ and FSM in WT, but not in KO mice. Urine Mg excretion was increased and transient receptor potential subfamily M, member 6 (TRPM6) was upregulated by both CTZ and FSM in WT and KO mice. In conclusion, CBD-28k plays an important role in gene expression of DCT Ca, but not Mg, transport molecules, which may be related to its being a Ca, but not a Mg, intracellular sensor. The lack of upregulation of DCT Ca transport molecules by thiazides in the KO mice indicates that the DCT Ca transport system is critical for Ca conservation by thiazides. PMID:26582761

Trigeminal Ganglion Neurons of Mice Show Intracellular Chloride Accumulation and Chloride-Dependent Amplification of Capsaicin-Induced Responses

PubMed Central

Schöbel, Nicole; Radtke, Debbie; Lübbert, Matthias; Gisselmann, Günter; Lehmann, Ramona; Cichy, Annika; Schreiner, Benjamin S. P.; Altmüller, Janine; Spector, Alan C.; Spehr, Jennifer; Hatt, Hanns; Wetzel, Christian H.

2012-01-01

Intracellular Cl− concentrations ([Cl−]i) of sensory neurons regulate signal transmission and signal amplification. In dorsal root ganglion (DRG) and olfactory sensory neurons (OSNs), Cl− is accumulated by the Na+-K+-2Cl− cotransporter 1 (NKCC1), resulting in a [Cl−]i above electrochemical equilibrium and a depolarizing Cl− efflux upon Cl− channel opening. Here, we investigate the [Cl−]i and function of Cl− in primary sensory neurons of trigeminal ganglia (TG) of wild type (WT) and NKCC1−/− mice using pharmacological and imaging approaches, patch-clamping, as well as behavioral testing. The [Cl−]i of WT TG neurons indicated active NKCC1-dependent Cl− accumulation. Gamma-aminobutyric acid (GABA)A receptor activation induced a reduction of [Cl−]i as well as Ca2+ transients in a corresponding fraction of TG neurons. Ca2+ transients were sensitive to inhibition of NKCC1 and voltage-gated Ca2+ channels (VGCCs). Ca2+ responses induced by capsaicin, a prototypical stimulus of transient receptor potential vanilloid subfamily member-1 (TRPV1) were diminished in NKCC1−/− TG neurons, but elevated under conditions of a lowered [Cl−]o suggesting a Cl−-dependent amplification of capsaicin-induced responses. Using next generation sequencing (NGS), we found expression of different Ca2+-activated Cl− channels (CaCCs) in TGs of mice. Pharmacological inhibition of CaCCs reduced the amplitude of capsaicin-induced responses of TG neurons in Ca2+ imaging and electrophysiological recordings. In a behavioral paradigm, NKCC1−/− mice showed less avoidance of the aversive stimulus capsaicin. In summary, our results strongly argue for a Ca2+-activated Cl−-dependent signal amplification mechanism in TG neurons that requires intracellular Cl− accumulation by NKCC1 and the activation of CaCCs. PMID:23144843

Primary sensory neuron-specific interference of TRPV1 signaling by adeno-associated virus-encoded TRPV1 peptide aptamer attenuates neuropathic pain

PubMed Central

Xiang, Hongfei; Liu, Zhen; Wang, Fei; Xu, Hao; Roberts, Christopher; Fischer, Gregory; Stucky, Cheryl L; Dean, Caron; Pan, Bin; Hogan, Quinn H; Yu, Hongwei

2017-01-01

Background TRPV1 (transient receptor potential vanilloid subfamily member 1) is a pain signaling channel highly expressed in primary sensory neurons. Attempts for analgesia by systemic TRPV1 blockade produce undesirable side effects, such as hyperthermia and impaired heat pain sensation. One approach for TRPV1 analgesia is to target TRPV1 along the peripheral sensory pathway. Results For functional blockade of TRPV1 signaling, we constructed an adeno-associated virus (AAV) vector expressing a recombinant TRPV1 interfering peptide aptamer, derived from a 38mer tetrameric assembly domain (TAD), encompassing residues 735 to 772 of rat TRPV1, fused to the C-terminus of enhanced green fluorescent protein (EGFP). AAV-targeted sensory neurons expressing EGFP-TAD after vector injection into the dorsal root ganglia (DRG) revealed decreased inward calcium current and diminished intracellular calcium accumulation in response to capsaicin, compared to neurons of naïve or expressing EGFP alone. To examine the potential for treating neuropathic pain, AAV-EGFP-TAD was injected into fourth and fifth lumbar (L) DRGs of rats subjected to neuropathic pain by tibial nerve injury (TNI). Results showed that AAV-directed selective expression of EGFP-TAD in L4/L5 DRG neuron somata, and their peripheral and central axonal projections can limit TNI-induced neuropathic pain behavior, including hypersensitivity to heat and, to a less extent, mechanical stimulation. Conclusion Selective inhibition of TRPV1 activity in primary sensory neurons by DRG delivery of AAV-encoded analgesic interfering peptide aptamers is efficacious in attenuation of neuropathic pain. With further improvements of vector constructs and in vivo application, this approach might have the potential to develop as an alternative gene therapy strategy to treat chronic pain, especially heat hypersensitivity, without complications due to systemic TRPV1 blockade. PMID:28604222

Structural insights into the difference in substrate recognition of two mannoside phosphorylases from two GH130 subfamilies.

PubMed

Ye, Yuxin; Saburi, Wataru; Odaka, Rei; Kato, Koji; Sakurai, Naofumi; Komoda, Keisuke; Nishimoto, Mamoru; Kitaoka, Motomitsu; Mori, Haruhide; Yao, Min

2016-03-01

In Ruminococcus albus, 4-O-β-D-mannosyl-D-glucose phosphorylase (RaMP1) and β-(1,4)-mannooligosaccharide phosphorylase (RaMP2) belong to two subfamilies of glycoside hydrolase family 130. The two enzymes phosphorolyze β-mannosidic linkages at the nonreducing ends of their substrates, and have substantially diverse substrate specificity. The differences in their mechanism of substrate binding have not yet been fully clarified. In the present study, we report the crystal structures of RaMP1 with/without 4-O-β-D-mannosyl-d-glucose and RaMP2 with/without β-(1→4)-mannobiose. The structures of the two enzymes differ at the +1 subsite of the substrate-binding pocket. Three loops are proposed to determine the different substrate specificities. One of these loops is contributed from the adjacent molecule of the oligomer structure. In RaMP1, His245 of loop 3 forms a hydrogen-bond network with the substrate through a water molecule, and is indispensible for substrate binding. © 2016 Federation of European Biochemical Societies.

A multi-locus analysis of phylogenetic relationships within grass subfamily Pooideae (Poaceae) inferred from sequences of nuclear single copy gene regions compared with plastid DNA.

PubMed

Hochbach, Anne; Schneider, Julia; Röser, Martin

2015-06-01

To investigate phylogenetic relationships within the grass subfamily Pooideae we studied about 50 taxa covering all recognized tribes, using one plastid DNA (cpDNA) marker (matK gene-3'trnK exon) and for the first time four nuclear single copy gene loci. DNA sequence information from two parts of the nuclear genes topoisomerase 6 (Topo6) spanning the exons 8-13 and 17-19, the exons 9-13 encoding plastid acetyl-CoA-carboxylase (Acc1) and the partial exon 1 of phytochrome B (PhyB) were generated. Individual and nuclear combined data were evaluated using maximum parsimony, maximum likelihood and Bayesian methods. All of the phylogenetic results show Brachyelytrum and the tribe Nardeae as earliest diverging lineages within the subfamily. The 'core' Pooideae (Hordeeae and the Aveneae/Poeae tribe complex) are also strongly supported, as well as the monophyly of the tribes Brachypodieae, Meliceae and Stipeae (except PhyB). The beak grass tribe Diarrheneae and the tribe Duthieeae are not monophyletic in some of the analyses. However, the combined nuclear DNA (nDNA) tree yields the highest resolution and the best delimitation of the tribes, and provides the following evolutionary hypothesis for the tribes: Brachyelytrum, Nardeae, Duthieeae, Meliceae, Stipeae, Diarrheneae, Brachypodieae and the 'core' Pooideae. Within the individual datasets, the phylogenetic trees obtained from Topo6 exon 8-13 shows the most interesting results. The divergent positions of some clone sequences of Ampelodesmos mauritanicus and Trikeraia pappiformis, for instance, may indicate a hybrid origin of these stipoid taxa. Copyright © 2015 Elsevier Inc. All rights reserved.

PSI Member Profile.

ERIC Educational Resources Information Center

Professional Secretaries International, Kansas City, MO.

A survey of 2,700 of the 27,000 members of Professional Secretaries International received 755 responses yielding the following profile of secretarial workers: (1) the average member is female, about 45 years old, married with no dependents living at home, and owns a single-family home in the suburbs; (2) most respondents have worked in office or…

VizieR Online Data Catalog: NGC 6802 dwarf cluster members and non-members (Tang+, 2017)

NASA Astrophysics Data System (ADS)

Tang, B.; Geisler, D.; Friel, E.; Villanova, S.; Smiljanic, R.; Casey, A. R.; Randich, S.; Magrini, L.; San, Roman I.; Munoz, C.; Cohen, R. E.; Mauro, F.; Bragaglia, A.; Donati, P.; Tautvaisiene, G.; Drazdauskas, A.; Zenoviene, R.; Snaith, O.; Sousa, S.; Adibekyan, V.; Costado, M. T.; Blanco-Cuaresma, S.; Jimenez-Esteban, F.; Carraro, G.; Zwitter, T.; Francois, P.; Jofre, P.; Sordo, R.; Gilmore, G.; Flaccomio, E.; Koposov, S.; Korn, A. J.; Lanzafame, A. C.; Pancino, E.; Bayo, A.; Damiani, F.; Franciosini, E.; Hourihane, A.; Lardo, C.; Lewis, J.; Monaco, L.; Morbidelli, L.; Prisinzano, L.; Sacco, G.; Worley, C. C.; Zaggia, S.

2016-11-01

The dwarf stars in NGC 6802 observed by GIRAFFE spectrograph are separated into four tables: 1. cluster members in the lower main sequence; 2. cluster members in the upper main sequence; 3. non-member dwarfs in the lower main sequence; 4. non-member dwarfs in the upper main sequence. The star coordinates, V band magnitude, V-I color, and radial velocity are given. (4 data files).

Transient receptor potential channel superfamily: Role in lower urinary tract function.

PubMed

Ogawa, Teruyuki; Imamura, Tetsuya; Nakazawa, Masaki; Hiragata, Shiro; Nagai, Takashi; Minagawa, Tomonori; Yokoyama, Hitoshi; Ishikawa, Masakuni; Domen, Takahisa; Ishizuka, Osamu

2015-11-01

Lower urinary tract symptoms associated with neurogenic bladder and overactive bladder syndrome are mediated in part by members of the transient receptor potential channel superfamily. The best studied member of this superfamily is the vanilloid receptor. Other transient receptor potential channels, such as the melastatin receptor and the ankyrin receptor, are also active in the pathogenesis of lower urinary tract dysfunction. However, the detailed mechanisms by which the transient receptor potential channels contribute to lower urinary tract symptoms are still not clear, and the therapeutic benefits of modulating transient receptor potential channel activity have not been proved in the clinical setting. In the present review, to better understand the pathophysiology and therapeutic potential for lower urinary tract symptoms, we summarize the presence and role of different members of the transient receptor potential channel superfamily in the lower urinary tract. © 2015 The Japanese Urological Association.

Direct enzyme assay evidence confirms aldehyde reductase function of Ydr541cp and Ygl039wp from Saccharomyces cerevisiae

USDA-ARS?s Scientific Manuscript database

Aldehyde reductase gene ARI1 is a recently characterized member of intermediate subfamily under SDR (short-chain dehydrogenase/reductase) superfamily that revealed mechanisms of in situ detoxification of furfural and HMF for tolerance of Saccharomyces cerevisiae. Uncharacterized open reading frames ...

XEN-D0501, a Novel Transient Receptor Potential Vanilloid 1 Antagonist, Does Not Reduce Cough in Patients with Refractory Cough.

PubMed

Belvisi, Maria G; Birrell, Mark A; Wortley, Michael A; Maher, Sarah A; Satia, Imran; Badri, Huda; Holt, Kimberley; Round, Patrick; McGarvey, Lorcan; Ford, John; Smith, Jaclyn A

2017-11-15

Heightened cough responses to inhaled capsaicin, a transient receptor potential vanilloid 1 (TRPV1) agonist, are characteristic of patients with chronic cough. However, previously, a TRPV1 antagonist (SB-705498) failed to improve spontaneous cough frequency in these patients, despite small reductions in capsaicin-evoked cough. XEN-D0501 (a potent TRPV1 antagonist) was compared with SB-705498 in preclinical studies to establish whether an improved efficacy profile would support a further clinical trial of XEN-D0501 in refractory chronic cough. XEN-D0501 and SB-705498 were profiled against capsaicin in a sensory nerve activation assay and in vivo potency established against capsaicin-induced cough in the guinea pig. Twenty patients with refractory chronic cough participated in a double-blind, randomized, placebo-controlled crossover study evaluating the effect of 14 days of XEN-D0501 (oral, 4 mg twice daily) versus placebo on awake cough frequency (primary outcome), capsaicin-evoked cough, and patient-reported outcomes. XEN-D0501 was more efficacious and 1,000-fold more potent than SB-705498 at inhibiting capsaicin-induced depolarization of guinea pig and human isolated vagus nerve. In vivo XEN-D0501 completely inhibited capsaicin-induced cough, whereas 100 times more SB-705498 was required to achieve the same effect. In patients, XEN-D0501 substantially reduced maximal cough responses to capsaicin (mean change from baseline, XEN-D0501, -19.3 ± 16.4) coughs; placebo, -1.8 ± 5.8 coughs; P < 0.0001), but not spontaneous awake cough frequency (mean change from baseline, XEN-D0501, 6.7  ± 16.9 coughs/h; placebo, 0.4 ± 13.7 coughs/h; P = 0.41). XEN-D0501 demonstrated superior efficacy and potency in preclinical and clinical capsaicin challenge studies; despite this improved pharmacodynamic profile, spontaneous cough frequency did not improve, ruling out TRPV1 as an effective therapeutic target for refractory cough. Clinical trial registered

Preclinical characterization of three transient receptor potential vanilloid receptor 1 antagonists for early use in human intradermal microdose analgesic studies.

PubMed

Sjögren, E; Halldin, M M; Stålberg, O; Sundgren-Andersson, A K

2018-05-01

The transient receptor potential vanilloid receptor 1 (TRPV1) is a nonselective cation channel involved in the mediation of peripheral pain to the central nervous system. As such, the TRPV1 is an accessible molecular target that lends itself well to the understanding of nociceptive signalling. This study encompasses preclinical investigations of three molecules with the prospect to establish them as suitable analgesic model compounds in human intradermal pain relief studies. The inhibitory effectiveness was evaluated by means of in vitro assays, TRPV1 expressing Chinese hamster ovary cells (CHO-K1) and rat dorsal root ganglion cultures in fluorescent imaging plate reader and whole cell patch clamp systems, as well as in vivo by capsaicin-evoked pain-related behavioural response studies in rat. Secondary pharmacology, pharmacokinetics and preclinical safety were also assessed. In vitro, all three compounds were effective at inhibiting capsaicin-activated TRPV1. The concentration producing 50% inhibition (IC 50 ) determined was in the range of 3-32 nmol/L and 10-501 nmol/L using CHO-K1 and dorsal root ganglion cultures, respectively. In vivo, all compounds showed dose-dependent reduction in capsaicin-evoked pain-related behavioural responses in rat. None of the three compounds displayed any significant activity on any of the secondary targets tested. The compounds were also shown to be safe from a toxicological, drug metabolism and pharmacokinetic perspective, for usage in microgram doses in the human skin. The investigated model compounds displayed ideal compound characteristics as pharmacological and translational tools to address efficacy on the human native TRPV1 target in human skin in situ. This work details the pharmaceutical work-up of three TRPV1-active investigational compounds, to obtain regulatory approval, for subsequent use in humans. This fast and cost-effective preclinical development path may impact research beyond the pain management area, as

The TOC complex: preprotein gateway to the chloroplast.

PubMed

Andrès, Charles; Agne, Birgit; Kessler, Felix

2010-06-01

Photosynthetic eukaryotes strongly depend on chloroplast metabolic pathways. Most if not all involve nuclear encoded proteins. These are synthesized as cytosolic preproteins with N-terminal, cleavable targeting sequences (transit peptide). Preproteins are imported by a major pathway composed of two proteins complexes: TOC and TIC (Translocon of the Outer and Inner membranes of the Chloroplasts, respectively). These selectively recognize the preproteins and facilitate their transport across the chloroplast envelope. The TOC core complex consists of three types of components, each belonging to a small family: Toc34, Toc75 and Toc159. Toc34 and Toc159 isoforms represent a subfamily of the GTPase superfamily. The members of the Toc34 and Toc159 subfamily act as GTP-dependent receptors at the chloroplast surface and distinct members of each occur in defined, substrate-specific TOC complexes. Toc75, a member of the Omp85 family, is conserved from prokaryotes and functions as the unique protein-conducting channel at the outer membrane. In this review we will describe the current state of knowledge regarding the composition and function of the TOC complex.

Trypsin induces biphasic muscle contraction and relaxation via transient receptor potential vanilloid 1 and neurokinin receptors 1/2 in porcine esophageal body.

PubMed

Xiaopeng, Bai; Tanaka, Yoshimasa; Ihara, Eikichi; Hirano, Katsuya; Nakano, Kayoko; Hirano, Mayumi; Oda, Yoshinao; Nakamura, Kazuhiko

2017-02-15

Duodenal reflux of fluids containing trypsin relates to refractory gastroesophageal reflux disease (GERD). Esophageal peristalsis and clearance are important factors in GERD pathogenesis. However, the function of trypsin in esophageal body contractility is not fully understood. In this study, effects of trypsin on circular smooth muscle (CSM) and longitudinal smooth muscle (LSM) of the porcine esophageal body were examined. Trypsin elicited a concentration dependent biphasic response, a major contraction and a subsequent relaxation only in CSM. In CSM, contraction occurred at trypsin concentrations of 100nM and relaxation at 1μM. A proteinase-activated receptor (PAR)2 activating peptide, SLIGKV-NH 2 (1mM), induced a monophasic contraction. Those responses were unaffected by tetrodotoxin though abolished by the gap junction uncouplers carbenoxolone and octanol. They were also partially inhibited by a transient receptor potential vanilloid type 1 (TRPV1) antagonist and abolished by combination of neurokinin receptor 1 (NK 1 ) and NK 2 antagonists, but not by an NK 3 antagonist, suggesting a PAR2-TRPV1-substance P pathway in sensory neurons. Substance P (100nM), an agonist for various NK receptors (NK 1 , NK 2 and NK 3 ) with differing affinities, induced significant contraction in CSM, but not in LSM. The contraction was also blocked by the combination of NK 1 and NK 2 antagonists, but not by the NK 3 antagonist. Moreover, substance P-induced contractions were unaffected by the TRPV1 antagonist, but inhibited by a gap junction uncoupler. In conclusion, trypsin induced a biphasic response only in CSM and this was mediated by PAR2, TRPV1 and NK 1/2 . Gap junctions were indispensable in this tachykinin-induced response. Copyright © 2017 Elsevier B.V. All rights reserved.

Efficacy of ABT-116, an antagonist of transient receptor potential vanilloid type 1, in providing analgesia for dogs with chemically induced synovitis.

PubMed

Cathcart, Curtis J; Johnston, Spencer A; Reynolds, Lisa R; Al-Nadaf, Sami; Budsberg, Steven C

2012-01-01

To investigate the ability of ABT-116 (a proprietary antagonist of transient receptor potential vanilloid type 1) administered at 2 doses to attenuate lameness in dogs with experimentally induced urate synovitis. 8 purpose-bred mixed-breed dogs. In a 4-way crossover study, dogs orally received each of low-dose ABT-116 treatment (LDA; 10 mg/kg), high-dose ABT-116 treatment (HDA; 30 mg/kg), firocoxib (5 mg/kg), and no treatment (nontreatment) once a day for 2 days, in a randomly assigned order. Synovitis was induced on the second day of each treatment period by intra-articular injection of either stifle joint with sodium urate, alternating between joints for each treatment period, beginning with the left stifle joint. Ground reaction forces, clinical lameness scores, and rectal temperature were assessed before the injection (baseline) and at various points afterward. Lameness scores at the 2-, 6-, and 12-hour assessment points were higher than baseline scores for HDA and nontreatment, whereas scores at the 2- and 6-hour points were higher than baseline scores for LDA. For firocoxib, there was no difference from baseline scores in lameness scores at any point. Compared with baseline values, peak vertical force and vertical impulse were lower at 2 and 6 hours for HDA and nontreatment and at 2 hours for LDA. No changes in these values were evident for firocoxib. The HDA or LDA resulted in higher rectal temperatures than did treatment with firocoxib or nothing, but those temperatures did not differ among treatments. HDA had no apparent effect on sodium urate-induced lameness; LDA did attenuate the lameness but not as completely as firocoxib treatment. High rectal temperature is an adverse effect of oral ABT-116 administration that may be of clinical concern.

Effect of Habitat Conditions and Plant Traits on Leaf Damage in the Carduoideae Subfamily

PubMed Central

Münzbergová, Zuzana; Skuhrovec, Jiří

2013-01-01

Plant traits are the key factors that determine herbivore foraging selection. The traits serving as defense traits against herbivores represent a wide range of traits, such as chemical, physiological, morphological and life-history traits. While many studies considered plant defense traits at the within-species scale, much less is known from comparisons of a wide range of closely related species. The aim of this study was to identify factors responsible for the intensity of leaf damage in the Carduoideae subfamily of Asteraceae, which hosts many invasive species and thus is potential candidate plant species that could be controlled by biological control. Specifically, we wanted to see the relative importance of habitat characteristics, plant size and plants traits in determining the degree of folivory. The study identified several defense traits able to explain differences in herbivory between species after accounting for differences in the habitats in which the species occur and the plant size. Specifically, the most important traits were traits related to the quality of the leaf tissue expressed as the content of phosphorus, water and specific leaf area, which suggests that the leaf quality had a more important effect on the degree of herbivory than the presence of specific defense mechanisms such as spines and hair. Leaf quality is thus a candidate factor that drives herbivore choice when selecting which plant to feed on and should be considered when assessing the danger that a herbivore will switch hosts when introduced to a new range. PMID:23717643

Moxibustion relieves visceral hyperalgesia via inhibition of transient receptor potential vanilloid 1 (TRPV1) and heat shock protein (HSP) 70 expression in rat bone marrow cells.

PubMed

Zou, Weiying; Lin, Hua; Liu, Wenwen; Yang, Bei; Wu, Lei; Duan, Limin; Ling, Ping; Zhu, Lingyan; Dai, Qun; Zhao, Lintong; Zou, Ting; Zhang, Dalei

2016-04-01

To investigate the effects of moxibustion on visceral hyperalgesia (VH) and bone marrow cell transient receptor potential vanilloid type 1 (TRPV1) and heat shock protein (HSP) 70 expression in a rat model of VH. Mechanical colorectal distension was performed to induce VH in neonatal Sprague-Dawley rats. Eight-week-old VH rats were treated with moxibustion at acupuncture point BL25 or an ipsilateral non-acupuncture point. Abdominal withdrawal reflex (AWR) scoring and pain threshold pressure assessment were performed before and after moxibustion treatment for 7 consecutive days. The expression of TRPV1 and HSP70 in bone marrow cells was quantified by real-time quantitative PCR. The expression of TRPV1 and HSP70 in bone marrow cells was increased in rats with VH. Moxibustion at BL25 significantly decreased AWR scores and increased pain threshold pressure in rats with VH. Furthermore, moxibustion at BL25 significantly inhibited the VH-induced increase in the expression of TRPV1 and HSP70 in bone marrow cells. The up-regulation of TRPV1 and HSP70 expression in bone marrow cells may be involved in visceral pain development and the analgesic effect of moxibustion on VH may be mediated through down-regulation of TRPV1 and HSP70 expression in bone marrow cells. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Genome-wide comparative analysis of papain-like cysteine protease family genes in castor bean and physic nut.

PubMed

Zou, Zhi; Huang, Qixing; Xie, Guishui; Yang, Lifu

2018-01-10

Papain-like cysteine proteases (PLCPs) are a class of proteolytic enzymes involved in many plant processes. Compared with the extensive research in Arabidopsis thaliana, little is known in castor bean (Ricinus communis) and physic nut (Jatropha curcas), two Euphorbiaceous plants without any recent whole-genome duplication. In this study, a total of 26 or 23 PLCP genes were identified from the genomes of castor bean and physic nut respectively, which can be divided into nine subfamilies based on the phylogenetic analysis: RD21, CEP, XCP, XBCP3, THI, SAG12, RD19, ALP and CTB. Although most of them harbor orthologs in Arabidopsis, several members in subfamilies RD21, CEP, XBCP3 and SAG12 form new groups or subgroups as observed in other species, suggesting specific gene loss occurred in Arabidopsis. Recent gene duplicates were also identified in these two species, but they are limited to the SAG12 subfamily and were all derived from local duplication. Expression profiling revealed diverse patterns of different family members over various tissues. Furthermore, the evolution characteristics of PLCP genes were also compared and discussed. Our findings provide a useful reference to characterize PLCP genes and investigate the family evolution in Euphorbiaceae and species beyond.

Genome-wide identification, expansion, and evolution analysis of homeobox genes and their expression profiles during root development in carrot.

PubMed

Que, Feng; Wang, Guang-Long; Li, Tong; Wang, Ya-Hui; Xu, Zhi-Sheng; Xiong, Ai-Sheng

2018-06-16

The homeobox gene family, a large family represented by transcription factors, has been implicated in secondary growth, early embryo patterning, and hormone response pathways in plants. However, reports about the information and evolutionary history of the homeobox gene family in carrot are limited. In the present study, a total of 130 homeobox family genes were identified in the carrot genome. Specific codomain and phylogenetic analyses revealed that the genes were classified into 14 subgroups. Whole genome and proximal duplication participated in the homeobox gene family expansion in carrot. Purifying selection also contributed to the evolution of carrot homeobox genes. In Gene Ontology (GO) analysis, most members of the HD-ZIP III and IV subfamilies were found to have a lipid binding (GO:0008289) term. Most HD-ZIP III and IV genes also harbored a steroidogenic acute regulatory protein-related lipid transfer (START) domain. These results suggested that the HD-ZIP III and IV subfamilies might be related to lipid transfer. Transcriptome and quantitative real-time PCR (RT-qPCR) data indicated that members of the WOX and KNOX subfamilies were likely implicated in carrot root development. Our study provided a useful basis for further studies on the complexity and function of the homeobox gene family in carrot.

17 CFR 240.11a2-2(T) - Transactions effected by exchange members through other members.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Transactions effected by exchange members through other members. 240.11a2-2(T) Section 240.11a2-2(T) Commodity and Securities... Regulation (rule 11a-1) § 240.11a2-2(T) Transactions effected by exchange members through other members. (a...

17 CFR 240.11a2-2(T) - Transactions effected by exchange members through other members.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 17 Commodity and Securities Exchanges 3 2011-04-01 2011-04-01 false Transactions effected by exchange members through other members. 240.11a2-2(T) Section 240.11a2-2(T) Commodity and Securities... Regulation (rule 11a-1) § 240.11a2-2(T) Transactions effected by exchange members through other members. (a...

User Working Group Members

Atmospheric Science Data Center

2014-04-29

... the entire group may be directed to:  larc-asdc-uwg@lists.nasa.gov   Member Status Affiliation E-mail ... NASA Langley Research Center (NASA LaRC) takmeng.wong@nasa.gov Amy Braverman Member Jet Propulsion Laboratory (JPL) ...

Avoiding the ensemble decorrelation problem using member-by-member post-processing

NASA Astrophysics Data System (ADS)

Van Schaeybroeck, Bert; Vannitsem, Stéphane

2014-05-01

Forecast calibration or post-processing has become a standard tool in atmospheric and climatological science due to the presence of systematic initial condition and model errors. For ensemble forecasts the most competitive methods derive from the assumption of a fixed ensemble distribution. However, when independently applying such 'statistical' methods at different locations, lead times or for multiple variables the correlation structure for individual ensemble members is destroyed. Instead of reastablishing the correlation structure as in Schefzik et al. (2013) we instead propose a calibration method that avoids such problem by correcting each ensemble member individually. Moreover, we analyse the fundamental mechanisms by which the probabilistic ensemble skill can be enhanced. In terms of continuous ranked probability score, our member-by-member approach amounts to skill gain that extends for lead times far beyond the error doubling time and which is as good as the one of the most competitive statistical approach, non-homogeneous Gaussian regression (Gneiting et al. 2005). Besides the conservation of correlation structure, additional benefits arise including the fact that higher-order ensemble moments like kurtosis and skewness are inherited from the uncorrected forecasts. Our detailed analysis is performed in the context of the Kuramoto-Sivashinsky equation and different simple models but the results extent succesfully to the ensemble forecast of the European Centre for Medium-Range Weather Forecasts (Van Schaeybroeck and Vannitsem, 2013, 2014) . References [1] Gneiting, T., Raftery, A. E., Westveld, A., Goldman, T., 2005: Calibrated probabilistic forecasting using ensemble model output statistics and minimum CRPS estimation. Mon. Weather Rev. 133, 1098-1118. [2] Schefzik, R., T.L. Thorarinsdottir, and T. Gneiting, 2013: Uncertainty Quantification in Complex Simulation Models Using Ensemble Copula Coupling. To appear in Statistical Science 28. [3] Van

Low dose trichloroethylene alters cytochrome P450 - 2C subfamily expression in the developing chick heart

PubMed Central

Makwana, Om; Ahles, Lauren; Lencinas, Alejandro; Selmin, Ornella I.; Runyan, Raymond B.

2013-01-01

Trichloroethylene (TCE) is an organic solvent and common environmental contaminant. TCE exposure is associated with heart defects in humans and animal models. Primary metabolism of TCE in adult rodent models is by specific hepatic cytochrome P450 enzymes (Lash et al., 2000). As association of TCE exposure with cardiac defects is in exposed embryos prior to normal liver development, we investigated metabolism of TCE in the early embryo. Developing chick embryos were dosed in ovo with environmentally relevant doses of TCE (8 ppb and 800 ppb) and RNA was extracted from cardiac and extra-cardiac tissue (whole embryo without heart). Real time PCR showed upregulation of CYP2H1 transcripts in response to TCE exposure in the heart. No detectable cytochrome expression was found in extra-cardiac tissue. As seen previously, the dose response was non-monotonic and 8ppb elicited stronger upregulation than 800 ppb. Immunostaining for CYP2C subfamily expression confirmed protein expression and showed localization in both myocardium and endothelium. TCE exposure increased protein expression in both tissues. These data demonstrate that the earliest embryonic expression of phase I detoxification enzymes is in the developing heart. Expression of these CYPs is likely to be relevant to the susceptibility of the developing heart to environmental teratogens. PMID:22855351

Enteric parvovirus infections of chickens and turkeys

USDA-ARS?s Scientific Manuscript database

Chicken and turkey parvoviruses are members of the Parvovirus family. Comparative sequence analysis of their genome structure revealed that they should form a new genus within the vertebrate Parvovirinae subfamily. The first chicken and turkey parvoviruses were identified by electron microscopy duri...

7 CFR 1400.208 - Family members.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 10 2011-01-01 2011-01-01 false Family members. 1400.208 Section 1400.208 Agriculture... SUBSEQUENT CROP, PROGRAM, OR FISCAL YEARS Payment Eligibility § 1400.208 Family members. (a) Notwithstanding... persons, a majority of whom are family members, an adult family member who makes a significant...

7 CFR 1425.19 - Member cooperatives.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Member cooperatives. 1425.19 Section 1425.19... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COOPERATIVE MARKETING ASSOCIATIONS § 1425.19 Member cooperatives. A CMA may obtain loans or LDP's on behalf of a member cooperative when the member...

7 CFR 1400.208 - Family members.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Family members. 1400.208 Section 1400.208 Agriculture... SUBSEQUENT CROP, PROGRAM, OR FISCAL YEARS Payment Eligibility § 1400.208 Family members. (a) Notwithstanding... persons, a majority of whom are family members, an adult family member who makes a significant...

7 CFR 1205.328 - Alternate members.

Code of Federal Regulations, 2014 CFR

2014-01-01

... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Cotton Board § 1205.328 Alternate members. An alternate member of the... member from the same cotton-producing state or region to serve in such member's place and stead of such...

7 CFR 1205.328 - Alternate members.

Code of Federal Regulations, 2013 CFR

2013-01-01

... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Cotton Board § 1205.328 Alternate members. An alternate member of the... member from the same cotton-producing state or region to serve in such member's place and stead of such...

7 CFR 1205.328 - Alternate members.

Code of Federal Regulations, 2011 CFR

2011-01-01

... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Cotton Board § 1205.328 Alternate members. An alternate member of the... member from the same cotton-producing state or region to serve in such member's place and stead of such...

Comparative anatomy of the cheek muscles within the Centromochlinae subfamily (Ostariophysi, Siluriformes, Auchenipteridae).

PubMed

Sarmento-Soares, Luisa Maria; Porto, Marcovan

2006-02-01

Glanidium melanopterum Miranda Ribeiro, a typical representative of the subfamily Centromochlinae (Siluriformes: Auchenipteridae), is herein described myologically and compared to other representative species within the group, Glanidium ribeiroi, G. leopardum, Tatia neivai, T. intermedia, T. creutzbergi, Centromochlus heckelii, and C. existimatus. The structure of seven pairs of striated cephalic muscles was compared anatomically: adductor mandibulae, levator arcus palatini, dilatator operculi, adductor arcus palatini, extensor tentaculi, retractor tentaculi, and levator operculi. We observed broad adductor mandibulae muscles in both Glanidium and Tatia, catfishes with depressed heads and smaller eyes. Similarities between muscles were observed: the presence of a large aponeurotic insertion for the levator arcus palatini muscle; an adductor arcus palatini muscle whose origin spread over the orbitosphenoid, pterosphenoid, and parasphenoid; and the extensor tentaculi muscle broadly attached to the autopalatine. There is no retractor tentaculi muscle in either the Glanidium or Tatia species. On the other hand, in Centromochlus, with forms having large eyes and the tallest head, the adductor mandibulae muscles are slim; there is a thin aponeurotic or muscular insertion for the levator arcus palatini muscle; the adductor arcus palatini muscle originates from a single osseous process, forming a keel on the parasphenoid; the extensor tentaculi muscle is loosely attached to the autopalatine, permitting exclusive rotating and sliding movements between this bone and the maxillary. The retractor tentaculi muscle is connected to the maxilla through a single tendon, so that both extensor and retractor tentaculi muscles contribute to a wide array of movements of the maxillary barbels. A discussion on the differences in autopalatine-maxillary movements among the analyzed groups is given. (c) 2005 Wiley-Liss, Inc.

Recent horizontal transfer of mellifera subfamily mariner transposons into insect lineages representing four different orders shows that selection acts only during horizontal transfer.

PubMed

Lampe, David J; Witherspoon, David J; Soto-Adames, Felipe N; Robertson, Hugh M

2003-04-01

We report the isolation and sequencing of genomic copies of mariner transposons involved in recent horizontal transfers into the genomes of the European earwig, Forficula auricularia; the European honey bee, Apis mellifera; the Mediterranean fruit fly, Ceratitis capitata; and a blister beetle, Epicauta funebris, insects from four different orders. These elements are in the mellifera subfamily and are the second documented example of full-length mariner elements involved in this kind of phenomenon. We applied maximum likelihood methods to the coding sequences and determined that the copies in each genome were evolving neutrally, whereas reconstructed ancestral coding sequences appeared to be under selection, which strengthens our previous hypothesis that the primary selective constraint on mariner sequence evolution is the act of horizontal transfer between genomes.

Expansion of the receptor-like kinase/Pelle gene family and receptor-like proteins in Arabidopsis.

PubMed

Shiu, Shin Han; Bleecker, Anthony B

2003-06-01

Receptor-like kinases (RLKs) are a family of transmembrane proteins with versatile N-terminal extracellular domains and C-terminal intracellular kinases. They control a wide range of physiological responses in plants and belong to one of the largest gene families in the Arabidopsis genome with more than 600 members. Interestingly, this gene family constitutes 60% of all kinases in Arabidopsis and accounts for nearly all transmembrane kinases in Arabidopsis. Analysis of four fungal, six metazoan, and two Plasmodium sp. genomes indicates that the family was represented in all but fungal genomes, indicating an ancient origin for the family with a more recent expansion only in the plant lineages. The RLK/Pelle family can be divided into several subfamilies based on three independent criteria: the phylogeny based on kinase domain sequences, the extracellular domain identities, and intron locations and phases. A large number of receptor-like proteins (RLPs) resembling the extracellular domains of RLKs are also found in the Arabidopsis genome. However, not all RLK subfamilies have corresponding RLPs. Several RLK/Pelle subfamilies have undergone differential expansions. More than 33% of the RLK/Pelle members are found in tandem clusters, substantially higher than the genome average. In addition, 470 of the RLK/Pelle family members are located within the segmentally duplicated regions in the Arabidopsis genome and 268 of them have a close relative in the corresponding regions. Therefore, tandem duplications and segmental/whole-genome duplications represent two of the major mechanisms for the expansion of the RLK/Pelle family in Arabidopsis.

Differential evolution of members of the rhomboid gene family with conservative and divergent patterns.

PubMed

Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong

2015-04-01

Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

Freyinae, a major new subfamily of Neotropical jumping spiders (Araneae: Salticidae).

PubMed

Edwards, G B

2015-11-02

Freyinae, new subfamily, is described for a group of genera of Neotropical jumping spiders that can be distinguished from other non-ant mimic salticoid Neotropical salticids by having the following three morphological features: a slightly more elongate carapace, a distinctive prolateral tibial macrosetae arrangement (medially placed subdistal and subproximal macrosetae, with a subdorsal medial macroseta in some males), and an unusual dorsoventrally thick tegulum basal division (although one or two of these features are sometimes lost). It includes 20 genera previously considered valid, of which 19 are retained: Akela Peckham & Peckham, 1896, Aphirape C.L. Koch, 1850, Asaracus C.L. Koch, 1846, Capidava Simon, 1902, Chira Peckham & Peckham, 1896, Edilemma Ruiz & Brescovit, 2006, Eustiromastix Simon, 1902, Freya C.L. Koch, 1850, Frigga C.L. Koch, 1850, Kalcerrytus Galiano, 2000, Nycerella Galiano, 1982, Onofre Ruiz & Brescovit, 2007, Pachomius Peckham & Peckham, 1896, Phiale C.L. Koch, 1846, Rishaschia Makhan, 2006, Sumampattus Galiano, 1983, Trydarssus Galiano, 1995, Tullgrenella Mello‑Leitão, 1941, and Wedoquella Galiano, 1984. Romitia Caporiacco, 1947 (and its synonym Uspachus Galiano, 1995) is synonymized with Pachomius, new synonymy. New genera described in the subfamily are: Drizztius, Leptofreya, Megafreya, Philira, Tarkas, Triggella, and Xanthofreya. The following nomenclatorial changes are made: New synonyms: Freya demarcata Chamberlin & Ivie, 1936 = Freya (sub Cyrene) albosignata (F.O.P.-Cambridge, 1901); Freya (sub Cyrene) grisea (F.O.P.-Cambridge, 1901) = Freya (sub Cyrene) infuscata (F.O.P.-Cambridge, 1901); Freya (sub Cyrene) emarginata (F.O.P.-Cambridge, 1901) and Nycerella (sub Heraclea) sanguinea paradoxa (Peckham & Peckham, 1896) = Nycerella (sub Heraclea) sanguinea (Peckham & Peckham, 1896); Pachomius (sub Phiale) maculosus (Chickering, 1946) = Phiale (sub Cyrene) bilobata (F.O.P.-Cambridge, 1901); Phiale (sub Cyrene) mediocava (F

Transient Receptor Potential Vanilloid Type 1–Dependent Regulation of Liver-Related Neurons in the Paraventricular Nucleus of the Hypothalamus Diminished in the Type 1 Diabetic Mouse

PubMed Central

Gao, Hong; Miyata, Kayoko; Bhaskaran, Muthu D.; Derbenev, Andrei V.; Zsombok, Andrea

2012-01-01

The paraventricular nucleus (PVN) of the hypothalamus controls the autonomic neural output to the liver, thereby participating in the regulation of hepatic glucose production (HGP); nevertheless, mechanisms controlling the activity of liver-related PVN neurons are not known. Transient receptor potential vanilloid type 1 (TRPV1) is involved in glucose homeostasis and colocalizes with liver-related PVN neurons; however, the functional role of TRPV1 regarding liver-related PVN neurons has to be elucidated. A retrograde viral tracer was used to identify liver-related neurons within the brain-liver circuit in control, type 1 diabetic, and insulin-treated mice. Our data indicate that TRPV1 regulates liver-related PVN neurons. This TRPV1-dependent excitation diminished in type 1 diabetic mice. In vivo and in vitro insulin restored TRPV1 activity in a phosphatidylinositol 3-kinase/protein kinase C–dependent manner and stimulated TRPV1 receptor trafficking to the plasma membrane. There was no difference in total TRPV1 protein expression; however, increased phosphorylation of TRPV1 receptors was observed in type 1 diabetic mice. Our data demonstrate that TRPV1 plays a pivotal role in the regulation of liver-related PVN neurons. Moreover, TRPV1-dependent excitation of liver-related PVN neurons diminishes in type 1 diabetes, thus indicating that the brain-liver autonomic circuitry is altered in type 1 diabetes and may contribute to the autonomic dysfunction of HGP. PMID:22492526

Inhibition of transient receptor potential vanilloid-1 confers neuroprotection, reduces tumor necrosis factor-alpha, and increases IL-10 in a rat stroke model.

PubMed

Hakimizadeh, Elham; Shamsizadeh, Ali; Roohbakhsh, Ali; Arababadi, Mohammad Kazemi; Hajizadeh, Mohammad R; Shariati, Mehdi; Rahmani, Mohammad R; Allahtavakoli, Mohammad

2017-08-01

Stroke is a major cause of mortality and long-term disability in adults. Transient receptor potential vanilloid-1 (TRPV1) plays a crucial role in neuroinflammation. In this study, the effects of TRPV1 agonist (capsaicin) and antagonist (AMG9810) on cerebral ischemia were investigated. Forty male Wistar rats were assigned to the following experimental groups: sham, vehicle) ischemic), AMG9810 (selective TRPV1 antagonist, 0.5 mg/kg; 3 h after stroke), and capsaicin (1 mg/kg; 3 h after stroke). Stroke was induced by permanent middle cerebral artery occlusion and neurological deficits were evaluated 1, 3, and 7 days after stroke. Then, infarct volume, brain edema, body temperature, mRNA expression of TRPV1, and serum concentrations of tumor necrosis factor-alpha (TNF-α) and IL-10 were measured. Compared to the vehicle group, AMG9810 significantly decreased the infarct volume (P < 0.01). Latency for the removal of sticky labels from the forepaw and the hanging time were significantly decreased and increased, respectively, following administration of AMG9810 (P < 0.01 and P < 0.001 vs. vehicle) 3 and 7 days after stroke. Compared to the sham group, the mRNA expression of TRPV1 was significantly increased in vehicle group (P < 0.01). Administration of AMG9810 significantly increased the anti-inflammatory cytokine IL-10 and decreased the inflammatory cytokine TNF-α (P < 0.05). Moreover, our results indicate that AMG9810 might a promising candidate for the hypothermic treatment of stroke. The findings also suggest a key role for AMG9810 in reducing inflammation after stroke and imply that TRPV1 could be a potential target for the treatment of ischemic stroke. © 2017 Société Française de Pharmacologie et de Thérapeutique.

Advanced oxidation protein products sensitized the transient receptor potential vanilloid 1 via NADPH oxidase 1 and 4 to cause mechanical hyperalgesia.

PubMed

Ding, Ruoting; Jiang, Hui; Sun, Baihui; Wu, Xiaoliang; Li, Wei; Zhu, Siyuan; Liao, Congrui; Zhong, Zhaoming; Chen, Jianting

2016-12-01

Oxidative stress is a possible pathogenesis of hyperalgesia. Advanced oxidation protein products (AOPPs), a new family of oxidized protein compounds, have been considered as a novel marker of oxidative stress. However, the role of AOPPs in the mechanism of hyperalgesia remains unknown. Our study aims to investigate whether AOPPs have an effect on hyperalgesia and the possible underlying mechanisms. To identify the AOPPs involved, we induced hyperalgesia in rats by injecting complete Freund's adjuvant (CFA) in hindpaw. The level of plasma AOPPs in CFA-induced rats was 1.6-fold in comparison with what in normal rats (P<0.05). After intravenous injection of AOPPs-modified rat serum albumin (AOPPs-RSA) in Sprague-Dawley rats, the paw mechanical thresholds, measured by the electronic von Frey system, significantly declined. Immunofluorescence staining indicated that AOPPs increased expressions of NADPH oxidase 1 (Nox1), NADPH oxidase 4 (Nox4), transient receptor potential vanilloid 1 (TRPV1) and calcitonin gene-related peptide (CGRP) in the dorsal root ganglia (DRG) tissues. In-vitro studies were performed on primary DRG neurons which were obtained from both thoracic and lumbar DRG of rats. Results indicated that AOPPs triggered reactive oxygen species (ROS) production in DRG neurons, which were significantly abolished by ROS scavenger N-acetyl-l-cysteine (NAC) and small-interfering RNA (siRNA) silencing of Nox1 or Nox4. The expressions of Nox1, Nox4, TRPV1 and CGRP were significantly increased in AOPPs-induced DRG neurons. And relevant siRNA or inhibitors notably suppressed the expressions of these proteins and the calcium influxes in AOPPs-induced DRG neurons. In conclusion, AOPPs increased significantly in CFA-induced hyperalgesia rats and they activated Nox1/Nox4-ROS to sensitize TRPV1-dependent Ca2+ influx and CGRP release which led to inducing mechanical hyperalgesia. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Local upregulation of transient receptor potential ankyrin 1 and transient receptor potential vanilloid 1 ion channels in rectosigmoid deep infiltrating endometriosis

PubMed Central

Bohonyi, Noémi; Pohóczky, Krisztina; Szalontai, Bálint; Perkecz, Anikó; Kovács, Krisztina; Kajtár, Béla; Orbán, Lajos; Varga, Tamás; Szegedi, Sarolta; Bódis, József; Koppán, Miklós

2017-01-01

Transient Receptor Potential Vanilloid 1 (TRPV1) and Transient Receptor Potential Ankyrin 1 (TRPA1) expressed mainly by primary sensory neurons function as major nociceptive integrators. They are also present on the rat endometrium in an oestrogen-regulated manner. TRPV1 is upregulated in peritoneal and ovarian endometriosis patients, but there is no information about TRPA1 and their pathophysiological significances. In this study, patients undergoing laparoscopic surgery were investigated: severe dysmenorrhoea due to rectosigmoid deep infiltrating endometriosis (n = 15), uterine fibroid-induced moderate dysmenorrhoea (n = 7) and tubal infertility with no pain (n = 6). TRPA1 and TRPV1 mRNA and protein expressions were determined by quantitative polymerase chain reaction and semi-quantitative immunohistochemistry from the endometrium samples taken by curettage. Results were correlated with the clinical characteristics including pain intensity. TRPA1 and TRPV1 receptors were expressed in the healthy human endometrium at mRNA and protein levels. Sparse, scattered cytoplasmic TRPA1 and TRPV1 immunopositivities were found in the stroma and epithelial layers. We detected upregulated mRNA levels in deep infiltrating endometriosis lesions, and TRPV1 gene expression was also elevated in autocontrol endometrium of deep infiltrating endometriosis patients. Histological scoring revealed significant TRPA1 and TRPV1 difference between deep infiltrating endometriosis stroma and epithelium, and in deep infiltrating endometriosis epithelium compared to control samples. Besides, we measured elevated stromal TRPV1 immunopositivity in deep infiltrating endometriosis. Stromal TRPA1 and TRPV1 immunoreactivities strongly correlated with dysmenorrhoea severity, as well TRPV1 expression on ectopic epithelial cells and macrophages with dyspareunia. Epithelial TRPA1 and stromal TRPV1 immunopositivity also positively correlated with dyschezia severity. We provide the first

Local upregulation of transient receptor potential ankyrin 1 and transient receptor potential vanilloid 1 ion channels in rectosigmoid deep infiltrating endometriosis.

PubMed

Bohonyi, Noémi; Pohóczky, Krisztina; Szalontai, Bálint; Perkecz, Anikó; Kovács, Krisztina; Kajtár, Béla; Orbán, Lajos; Varga, Tamás; Szegedi, Sarolta; Bódis, József; Helyes, Zsuzsanna; Koppán, Miklós

2017-01-01

Transient Receptor Potential Vanilloid 1 (TRPV1) and Transient Receptor Potential Ankyrin 1 (TRPA1) expressed mainly by primary sensory neurons function as major nociceptive integrators. They are also present on the rat endometrium in an oestrogen-regulated manner. TRPV1 is upregulated in peritoneal and ovarian endometriosis patients, but there is no information about TRPA1 and their pathophysiological significances. In this study, patients undergoing laparoscopic surgery were investigated: severe dysmenorrhoea due to rectosigmoid deep infiltrating endometriosis ( n = 15), uterine fibroid-induced moderate dysmenorrhoea ( n = 7) and tubal infertility with no pain ( n = 6). TRPA1 and TRPV1 mRNA and protein expressions were determined by quantitative polymerase chain reaction and semi-quantitative immunohistochemistry from the endometrium samples taken by curettage. Results were correlated with the clinical characteristics including pain intensity. TRPA1 and TRPV1 receptors were expressed in the healthy human endometrium at mRNA and protein levels. Sparse, scattered cytoplasmic TRPA1 and TRPV1 immunopositivities were found in the stroma and epithelial layers. We detected upregulated mRNA levels in deep infiltrating endometriosis lesions, and TRPV1 gene expression was also elevated in autocontrol endometrium of deep infiltrating endometriosis patients. Histological scoring revealed significant TRPA1 and TRPV1 difference between deep infiltrating endometriosis stroma and epithelium, and in deep infiltrating endometriosis epithelium compared to control samples. Besides, we measured elevated stromal TRPV1 immunopositivity in deep infiltrating endometriosis. Stromal TRPA1 and TRPV1 immunoreactivities strongly correlated with dysmenorrhoea severity, as well TRPV1 expression on ectopic epithelial cells and macrophages with dyspareunia. Epithelial TRPA1 and stromal TRPV1 immunopositivity also positively correlated with dyschezia severity. We provide the first

Protein kinase C activation potentiates gating of the vanilloid receptor VR1 by capsaicin, protons, heat and anandamide

PubMed Central

Vellani, Vittorio; Mapplebeck, Sarah; Moriondo, Andrea; Davis, John B; McNaughton, Peter A

2001-01-01

The effects of activation of protein kinase C (PKC) on membrane currents gated by capsaicin, protons, heat and anandamide were investigated in primary sensory neurones from neonatal rat dorsal root ganglia (DRG) and in HEK293 cells (human embryonic kidney cell line) transiently or stably expressing the human vanilloid receptor hVR1. Maximal activation of PKC by a brief application of phorbol 12-myristate 13-acetate (PMA) increased the mean membrane current activated by a low concentration of capsaicin by 1.65-fold in DRG neurones and 2.18-fold in stably transfected HEK293 cells. Bradykinin, which activates PKC, also enhanced the response to capsaicin in DRG neurones. The specific PKC inhibitor RO31-8220 prevented the enhancement caused by PMA. Activation of PKC did not enhance the membrane current at high concentrations of capsaicin, showing that PKC activation increases the probability of channel opening rather than unmasking channels. Application of PMA alone activated an inward current in HEK293 cells transiently transfected with VR1. The current was suppressed by the VR1 antagonist capsazepine. PMA did not, however, activate a current in the large majority of DRG neurones nor in HEK293 cells stably transfected with VR1. Removing external Ca2+ enhanced the response to a low concentration of capsaicin 2.40-fold in DRG neurones and 3.42-fold in HEK293 cells. Activation of PKC in zero Ca2+ produced no further enhancement of the response to capsaicin in either DRG neurones or HEK293 cells stably transfected with VR1. The effects of PKC activation on the membrane current gated by heat, anandamide and low pH were qualitatively similar to those on the capsaicin-gated current. The absence of a current activated by PMA in most DRG neurones or in stably transfected HEK293 cells suggests that activation of PKC does not directly open VR1 channels, but instead increases the probability that they will be activated by capsaicin, heat, low pH or anandamide. Removal of calcium

Does Sex of Dyad Members Really Matter? A Review of Leader-Member Exchange

ERIC Educational Resources Information Center

Goertzen, Brent J.; Fritz, Susan M.

2004-01-01

Leader-member exchange (LMX) generally refers to the leadership process centered on the interactions between leaders and direct reports. The basic premise of high quality leader-member exchange relationships holds that direct reports gain tremendous benefits through these partnerships. LMX is perhaps the most commonly researched theory of…

42 CFR 435.119 - Qualified family members.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 4 2011-10-01 2011-10-01 false Qualified family members. 435.119 Section 435.119... Family Members § 435.119 Qualified family members. (a) Definition. A qualified family member is any member of a family, including pregnant women and children eligible for Medicaid under § 435.116 of this...

42 CFR 435.119 - Qualified family members.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Qualified family members. 435.119 Section 435.119... Family Members § 435.119 Qualified family members. (a) Definition. A qualified family member is any member of a family, including pregnant women and children eligible for Medicaid under § 435.116 of this...

Tandem Duplication Events in the Expansion of the Small Heat Shock Protein Gene Family in Solanum lycopersicum (cv. Heinz 1706).

PubMed

Krsticevic, Flavia J; Arce, Débora P; Ezpeleta, Joaquín; Tapia, Elizabeth

2016-10-13

In plants, fruit maturation and oxidative stress can induce small heat shock protein (sHSP) synthesis to maintain cellular homeostasis. Although the tomato reference genome was published in 2012, the actual number and functionality of sHSP genes remain unknown. Using a transcriptomic (RNA-seq) and evolutionary genomic approach, putative sHSP genes in the Solanum lycopersicum (cv. Heinz 1706) genome were investigated. A sHSP gene family of 33 members was established. Remarkably, roughly half of the members of this family can be explained by nine independent tandem duplication events that determined, evolutionarily, their functional fates. Within a mitochondrial class subfamily, only one duplicated member, Solyc08g078700, retained its ancestral chaperone function, while the others, Solyc08g078710 and Solyc08g078720, likely degenerated under neutrality and lack ancestral chaperone function. Functional conservation occurred within a cytosolic class I subfamily, whose four members, Solyc06g076570, Solyc06g076560, Solyc06g076540, and Solyc06g076520, support ∼57% of the total sHSP RNAm in the red ripe fruit. Subfunctionalization occurred within a new subfamily, whose two members, Solyc04g082720 and Solyc04g082740, show heterogeneous differential expression profiles during fruit ripening. These findings, involving the birth/death of some genes or the preferential/plastic expression of some others during fruit ripening, highlight the importance of tandem duplication events in the expansion of the sHSP gene family in the tomato genome. Despite its evolutionary diversity, the sHSP gene family in the tomato genome seems to be endowed with a core set of four homeostasis genes: Solyc05g014280, Solyc03g082420, Solyc11g020330, and Solyc06g076560, which appear to provide a baseline protection during both fruit ripening and heat shock stress in different tomato tissues. Copyright © 2016 Krsticevic et al.

Molecular phylogenetics of the family Cyprinidae (Actinopterygii: Cypriniformes) as evidenced by sequence variation in the first intron of S7 ribosomal protein-coding gene: further evidence from a nuclear gene of the systematic chaos in the family.

PubMed

He, Shunping; Mayden, Richard L; Wang, Xuzheng; Wang, Wei; Tang, Kevin L; Chen, Wei-Jen; Chen, Yiyu

2008-03-01

The family Cyprinidae is the largest freshwater fish group in the world, including over 200 genera and 2100 species. The phylogenetic relationships of major clades within this family are simply poorly understood, largely because of the overwhelming diversity of the group; however, several investigators have advanced different hypotheses of relationships that pre- and post-date the use of shared-derived characters as advocated through phylogenetic systematics. As expected, most previous investigations used morphological characters. Recently, mitochondrial DNA (mtDNA) sequences and combined morphological and mtDNA investigations have been used to explore and advance our understanding of species relationships and test monophyletic groupings. Limitations of these studies include limited taxon sampling and a strict reliance upon maternally inherited mtDNA variation. The present study is the first endeavor to recover the phylogenetic relationships of the 12 previously recognized monophyletic subfamilies within the Cyprinidae using newly sequenced nuclear DNA (nDNA) for over 50 species representing members of the different previously hypothesized subfamily and family groupings within the Cyprinidae and from other cypriniform families as outgroup taxa. Hypothesized phylogenetic relationships are constructed using maximum parsimony and Basyesian analyses of 1042 sites, of which 971 sites were variable and 790 were phylogenetically informative. Using other appropriate cypriniform taxa of the families Catostomidae (Myxocyprinus asiaticus), Gyrinocheilidae (Gyrinocheilus aymonieri), and Balitoridae (Nemacheilus sp. and Beaufortia kweichowensis) as outgroups, the Cyprinidae is resolved as a monophyletic group. Within the family the genera Raiamas, Barilius, Danio, and Rasbora, representing many of the tropical cyprinids, represent basal members of the family. All other species can be classified into variably supported and resolved monophyletic lineages, depending upon analysis

SEALING MEANS FOR RELATIVELY ROTATABLE MEMBERS

DOEpatents

Skarstrom, C.S.

1960-10-25

A sealing means is offered for maintaining a seal between a pair of relatively rotatable members, panticularly between a rotating shaft and a stationary member surrounding the shaft. The sealing is accomplished by means of a flange extending outward radially on each of a plurality of sealing rings mounted on the rotating member which fit into annular grooves in the stationary member and are held in sealing relation therewith by means of spring rings. In addition, means are provided for passing a sealing gas through the seal sunfaces to prevent accumulation of lubricant and for scavenging any gas which may have leaked from the internal member into the seal area.

Upregulated Expression of Transient Receptor Potential Cation Channel Subfamily V Receptors in Mucosae of Patients with Oral Squamous Cell Carcinoma and Patients with a History of Alcohol Consumption or Smoking.

PubMed

Sakakibara, Akiko; Sakakibara, Shunsuke; Kusumoto, Junya; Takeda, Daisuke; Hasegawa, Takumi; Akashi, Masaya; Minamikawa, Tsutomu; Hashikawa, Kazunobu; Terashi, Hiroto; Komori, Takahide

2017-01-01

Transient receptor potential cation channel (subfamily V, members 1-4) (TRPV1-4) are expressed in skin and neurons and activated by external stimuli in normal mucosae of all oral cavity sites. The oral cavity is exposed to various stimuli, including temperature, mechanical stimuli, chemical substances, and changes in pH, and, notably, the risk factors for oncogenic transformation in oral squamous epithelium are the same as the external stimuli received by TRPV1-4 receptors. Hence, we examined the relationship between oral squamous cell carcinoma (SCC) and TRPV1-4 expression. Oral SCC patients (n = 37) who underwent surgical resection were included in this study. We investigated the expression of TRPV1-4 by immunohistochemical staining and quantification of TRPV1-4 mRNA in human oral mucosa. In addition, we compared the TRPV1-4 levels in mucosa from patients with SCC to those in normal oral mucosa. The receptors were expressed in oral mucosa at all sites (tongue, buccal mucosa, gingiva, and oral floor) and the expression was stronger in epithelia from patients with SCC than in normal epithelia. Furthermore, alcohol consumption and tobacco use were strongly associated with the occurrence of oral cancer and were found to have a remarkable influence on TRPV1-4 receptor expression in normal oral mucosa. In particular, patients with a history of alcohol consumption demonstrated significantly higher expression levels. Various external stimuli may influence the behavior of cancer cells. Overexpression of TRPV1-4 is likely to be a factor in enhanced sensitivity to external stimuli. These findings could contribute to the establishment of novel strategies for cancer therapy or prevention.

How Not to Be a Terrible School Board Member: Lessons for School Administrators and Board Members

ERIC Educational Resources Information Center

Mayer, Richard E.

2011-01-01

Veteran school board member, Richard E. Mayer, takes a humorous but substantive approach to the serious relationship between school administrators and board members. While the overwhelming majority of school board members have good motives, even people who mean well can make bad moves. This book shows how to prevent good intentions from creating…

Transferability of SSR and RGA markers developed in Cynodon spp. to Zoysia spp.

USDA-ARS?s Scientific Manuscript database

Bermudagrass (Cynodon spp.) and zoysiagrass (Zoysia spp.), which are both used as warm-season turfgrasses in the United States, are members of subfamily Chloridoideae and are reported to be at least 55% genetically similar. To assess if molecular tools between the two species can be interchanged, 93...

Cloning and characterization of prunus serotina AGAMOUS, a putative flower homeotic gene

Treesearch

Xiaomei Liu; Joseph Anderson; Paula Pijut

2010-01-01

Members of the AGAMOUS subfamily of MADS-box transcription factors play an important role in regulating the development of reproductive organs in flowering plants. To help understand the mechanism of floral development in black cherry (Prunus serotina), PsAG (a putative flower homeotic identity gene) was isolated...

G Protein-coupled Receptor Kinases of the GRK4 Protein Subfamily Phosphorylate Inactive G Protein-coupled Receptors (GPCRs).

PubMed

Li, Lingyong; Homan, Kristoff T; Vishnivetskiy, Sergey A; Manglik, Aashish; Tesmer, John J G; Gurevich, Vsevolod V; Gurevich, Eugenia V

2015-04-24

G protein-coupled receptor (GPCR) kinases (GRKs) play a key role in homologous desensitization of GPCRs. It is widely assumed that most GRKs selectively phosphorylate only active GPCRs. Here, we show that although this seems to be the case for the GRK2/3 subfamily, GRK5/6 effectively phosphorylate inactive forms of several GPCRs, including β2-adrenergic and M2 muscarinic receptors, which are commonly used as representative models for GPCRs. Agonist-independent GPCR phosphorylation cannot be explained by constitutive activity of the receptor or membrane association of the GRK, suggesting that it is an inherent ability of GRK5/6. Importantly, phosphorylation of the inactive β2-adrenergic receptor enhanced its interactions with arrestins. Arrestin-3 was able to discriminate between phosphorylation of the same receptor by GRK2 and GRK5, demonstrating preference for the latter. Arrestin recruitment to inactive phosphorylated GPCRs suggests that not only agonist activation but also the complement of GRKs in the cell regulate formation of the arrestin-receptor complex and thereby G protein-independent signaling. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Hydrophobic Residues near the Bilin Chromophore-Binding Pocket Modulate Spectral Tuning of Insert-Cys Subfamily Cyanobacteriochromes

PubMed Central

Cho, Sung Mi; Jeoung, Sae Chae; Song, Ji-Young; Song, Ji-Joon; Park, Youn-Il

2017-01-01

Cyanobacteriochromes (CBCRs) are a subfamily of phytochrome photoreceptors found exclusively in photosynthetic cyanobacteria. Four CBCRs containing a second Cys in the insert region (insert-Cys) have been identified from the nonheterocystous cyanobacterium Microcoleus B353 (Mbr3854g4 and Mbl3738g2) and the nitrogen fixing, heterocystous cyanobacterium Nostoc punctiforme (NpF2164g3 and NpR1597g2). These insert-Cys CBCRs can sense light in the near-UV to orange range, but key residues responsible for tuning their colour sensitivity have not been reported. In the present study, near-UV/Green (UG) photosensors Mbr3854g4 (UG1) and Mbl3738g2 (UG2) were chosen for further spectroscopic analysis of their spectral sensitivity and tuning. Consistent with most dual-Cys CBCRs, both UGs formed a second thioether linkage to the phycocyanobilin (PCB) chromophore via the insert-Cys. This bond is subject to breakage and relinkage during forward and reverse photoconversions. Variations in residues equivalent to Phe that are in close contact with the PCB chromophore D-ring in canonical red/green CBCRs are responsible for tuning the light absorption peaks of both dark and photoproducts. This is the first time these key residues that govern light absorption in insert-Cys family CBCRs have been identified and characterised. PMID:28094296

A taxonomic revision of the subfamily Tillinae Leach sensu lato (Coleoptera, Cleridae) in the New World

PubMed Central

Burke, Alan; Zolnerowich, Gregory

2017-01-01

Abstract The subfamily Tillinae Leach is represented by 12 genera in the New World. In this study, eight of these genera are revised. A diagnosis and redescription of the species of Araeodontia Barr, Barrotillus Rifkind, Bogcia Barr, Cylidrus Latreille, Cymatoderella Barr, Lecontella Wolcott & Chapin, Monophylla Spinola, and Onychotillus Chapin are presented. Bogcia oaxacae Barr is designated as a junior synonym of Bogcia disjuncta Barr. One species, Cymatodera striatopunctata Chevrolat, is transferred to Lecontella. The following species are redescribed: Araeodontia isabellae (Wolcott), A. marginalis Barr, A. peninsularis (Schaeffer), Barrotillus kropotkini Rifkind, Bogcia disjuncta Barr, Cylidrus abdominalis Klug, Cymatoderella collaris (Spinola), C. morula Rifkind, C. patagoniae (Knull), Lecontella brunnea (Spinola), L. gnara Wolcott, L. striatopunctata (Chevrolat), Monophylla californica (Fall), M. pallipes Schaeffer, M. terminata (Say), Onychotillus vittatus Chapin, and O. cubana De Zayas. Transcriptions of the original descriptions of Araeodontia picipennis Barr, Bostrichoclerus bicornis Van Dyke and Monophylla cinctipennis (Chevrolat) are given. Cymatodera Gray, with approximately 130 described species, is excluded from this study due to the number of species involved. The genera Neocallotillus Burke and Callotillus Wolcott are also excluded here since these groups have been recently revised elsewhere. Collection data are provided for all species revised. Updated distribution maps are presented. Keys to New World genera and species are given and taxonomic characters of relevant importance are provided and discussed. PMID:29290697

Conservation of Dynamics Associated with Biological Function in an Enzyme Superfamily.

PubMed

Narayanan, Chitra; Bernard, David N; Bafna, Khushboo; Gagné, Donald; Chennubhotla, Chakra S; Doucet, Nicolas; Agarwal, Pratul K

2018-03-06

Enzyme superfamily members that share common chemical and/or biological functions also share common features. While the role of structure is well characterized, the link between enzyme function and dynamics is not well understood. We present a systematic characterization of intrinsic dynamics of over 20 members of the pancreatic-type RNase superfamily, which share a common structural fold. This study is motivated by the fact that the range of chemical activity as well as molecular motions of RNase homologs spans over 10 5 folds. Dynamics was characterized using a combination of nuclear magnetic resonance experiments and computer simulations. Phylogenetic clustering led to the grouping of sequences into functionally distinct subfamilies. Detailed characterization of the diverse RNases showed conserved dynamical traits for enzymes within subfamilies. These results suggest that selective pressure for the conservation of dynamical behavior, among other factors, may be linked to the distinct chemical and biological functions in an enzyme superfamily. Copyright © 2018 Elsevier Ltd. All rights reserved.

Silurian gastropoda from southeastern and west-central Alaska

USGS Publications Warehouse

Rohr, D.M.; Blodgett, R.B.; Fryda, J.

2008-01-01

Additional Silurian (Ludlovian) gastropods are described from the Heceta Formation in the Alexander terrane on Prince of Wales Island, southeastern Alaska. Species include Spinicharybdis krizi n. sp., Spinicharybdis boucoti n. sp., Morania wagneri n. sp., Haplospira craigi n. sp., Australonema sp., Pachystrophia cf. gotlandica (Lindstro??m, 1884), and Medfrazyga gilmulli n. sp. An additional new Silurian species, Morania nixonforkensis n. sp., is described from the Nixon Fork subterrane of the Farewell terrane of west-central Alaska. The spine-bearing Spinicharybdis is placed into a new subfamily Spinicharybdiinae together with Hystricoceras Jahn, 1894. Joint occurrences of genera Beraunia, Coelocaulus, and Morania, as well as members of subfamily Spinicharybdiinae in the gastropod fauna from the Heceta Formation, support its close relationship with gastropod fauna of Bohemia. Additionally, the occurrence of the genus Medfrazyga suggests a faunal link between the Alexander and Farewell terranes of Alaska. Medfrazyga gilmulli n. sp. is the oldest known and the only early Paleozoic member of the family Palaeozygopleuridae. Copyright ?? 2008, The Paleontological Society.

A G-protein-activated inwardly rectifying K+ channel (GIRK4) from human hippocampus associates with other GIRK channels.

PubMed

Spauschus, A; Lentes, K U; Wischmeyer, E; Dissmann, E; Karschin, C; Karschin, A

1996-02-01

Transcripts of a gene, GIRK4, that encodes for a 419-amino-acid protein and shows high structural similarity to other subfamily members of G-protein-activated inwardly rectifying K+ channels (GIRK) have been identified in the human hippocampus. When expressed in Xenopus oocytes, GIRK4 yielded functional GIRK channels with activity that was enhanced by the stimulation of coexpressed serotonin 1A receptors. GIRK4 potentiated basal and agonist-induced currents mediated by other GIRK channels, possibly because of channel heteromerization. Despite the structural similarity to a putative rat KATP channel, no ATP sensitivity or KATP-typical pharmacology was observed for GIRK4 alone or GIRK4 transfected in conjunction with other GIRK channels in COS-7 cells. In rat brain, GIRK4 is expressed together with three other subfamily members, GIRK1-3, most likely in identical hippocampal neurons. Thus, heteromerization or an unknown molecular interaction may cause the physiological diversity observed within this class of K+ channels.

Cyanide-insensitive quinol oxidase (CIO) from Gluconobacter oxydans is a unique terminal oxidase subfamily of cytochrome bd.

PubMed

Miura, Hiroshi; Mogi, Tatsushi; Ano, Yoshitaka; Migita, Catharina T; Matsutani, Minenosuke; Yakushi, Toshiharu; Kita, Kiyoshi; Matsushita, Kazunobu

2013-06-01

Cyanide-insensitive terminal quinol oxidase (CIO) is a subfamily of cytochrome bd present in bacterial respiratory chain. We purified CIO from the Gluconobacter oxydans membranes and characterized its properties. The air-oxidized CIO showed some or weak peaks of reduced haemes b and of oxygenated and ferric haeme d, differing from cytochrome bd. CO- and NO-binding difference spectra suggested that haeme d serves as the ligand-binding site of CIO. Notably, the purified CIO showed an extraordinary high ubiquinol-1 oxidase activity with the pH optimum of pH 5-6. The apparent Vmax value of CIO was 17-fold higher than that of G. oxydans cytochrome bo3. In addition, compared with Escherichia coli cytochrome bd, the quinol oxidase activity of CIO was much more resistant to cyanide, but sensitive to azide. The Km value for O2 of CIO was 7- to 10-fold larger than that of G. oxydans cytochrome bo3 or E. coli cytochrome bd. Our results suggest that CIO has unique features attributable to the structure and properties of the O2-binding site, and thus forms a new sub-group distinct from cytochrome bd. Furthermore, CIO of acetic acid bacteria may play some specific role for rapid oxidation of substrates under acidic growth conditions.

12 CFR 701.21 - Loans to members and lines of credit to members.

Code of Federal Regulations, 2010 CFR

2010-01-01

... credit. A credit union may advance money to a member to cover an account deficit without having a credit... exceeding the 15 percent per year rate, if it determines money market interest rates have risen over the... loan to finance the purchase of a mobile home if the mobile home will be used as the member-borrower's...

12 CFR 701.21 - Loans to members and lines of credit to members.

Code of Federal Regulations, 2011 CFR

2011-01-01

... credit. A credit union may advance money to a member to cover an account deficit without having a credit... exceeding the 15 percent per year rate, if it determines money market interest rates have risen over the... loan to finance the purchase of a mobile home if the mobile home will be used as the member-borrower's...

12 CFR 701.21 - Loans to members and lines of credit to members.

Code of Federal Regulations, 2012 CFR

2012-01-01

... credit. A credit union may advance money to a member to cover an account deficit without having a credit... exceeding the 15 percent per year rate, if it determines money market interest rates have risen over the... loan to finance the purchase of a mobile home if the mobile home will be used as the member-borrower's...

7 CFR 1216.45 - Alternate members.

Code of Federal Regulations, 2010 CFR

2010-01-01

... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order National Peanut Board § 1216.45 Alternate members. An alternate member of the Board, during the absence of the member for the primary peanut...

7 CFR 1216.45 - Alternate members.

Code of Federal Regulations, 2011 CFR

2011-01-01

... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order National Peanut Board § 1216.45 Alternate members. An alternate member of the Board, during the absence of the member for the primary peanut...

Amphibious Shelter-Builder Oniscidea Species from the New World with Description of a New Subfamily, a New Genus and a New Species from Brazilian Cave (Isopoda, Synocheta, Styloniscidae)

PubMed Central

2015-01-01

The new subfamily Iuiuniscinae, Styloniscidae, is erected for the new genus Iuiuniscus and the new species I. iuiuensis, which is described from cave of the State of Bahia, Northeastern Brazil. A special ecological character is shown here for the first time for a New World Oniscidea: the construction of mud shelters. An introduction addressing the systematics of Synocheta with emphasis on Styloniscidae Vandel, 1952 is provided, as well as general comments about the dependence of water in some Oniscidea and ecological traits of amphibious Synocheta. The problems referring to nomenclature, taxonomy and the interrelationships in Styloniscidae are discussed. PMID:25992909

Amphibious shelter-builder Oniscidea species from the New World with description of a new subfamily, a new genus and a new species from Brazilian cave (Isopoda, Synocheta, Styloniscidae).

PubMed

Souza, Leila A; Ferreira, Rodrigo L; Senna, André R

2015-01-01

The new subfamily Iuiuniscinae, Styloniscidae, is erected for the new genus Iuiuniscus and the new species I. iuiuensis, which is described from cave of the State of Bahia, Northeastern Brazil. A special ecological character is shown here for the first time for a New World Oniscidea: the construction of mud shelters. An introduction addressing the systematics of Synocheta with emphasis on Styloniscidae Vandel, 1952 is provided, as well as general comments about the dependence of water in some Oniscidea and ecological traits of amphibious Synocheta. The problems referring to nomenclature, taxonomy and the interrelationships in Styloniscidae are discussed.

Characterization of a feruloyl esterase from Aspergillus terreus facilitates the division of fungal enzymes from Carbohydrate Esterase family 1 of the carbohydrate-active enzymes (CAZy) database.

PubMed

Mäkelä, Miia R; Dilokpimol, Adiphol; Koskela, Salla M; Kuuskeri, Jaana; de Vries, Ronald P; Hildén, Kristiina

2018-04-26

Feruloyl esterases (FAEs) are accessory enzymes for plant biomass degradation, which catalyse hydrolysis of carboxylic ester linkages between hydroxycinnamic acids and plant cell-wall carbohydrates. They are a diverse group of enzymes evolved from, e.g. acetyl xylan esterases (AXEs), lipases and tannases, thus complicating their classification and prediction of function by sequence similarity. Recently, an increasing number of fungal FAEs have been biochemically characterized, owing to their potential in various biotechnological applications and multitude of candidate FAEs in fungal genomes. However, only part of the fungal FAEs are included in Carbohydrate Esterase family 1 (CE1) of the carbohydrate-active enzymes (CAZy) database. In this work, we performed a phylogenetic analysis that divided the fungal members of CE1 into five subfamilies of which three contained characterized enzymes with conserved activities. Conservation within one of the subfamilies was confirmed by characterization of an additional CE1 enzyme from Aspergillus terreus. Recombinant A. terreus FaeD (AtFaeD) showed broad specificity towards synthetic methyl and ethyl esters, and released ferulic acid from plant biomass substrates, demonstrating its true FAE activity and interesting features as potential biocatalyst. The subfamily division of the fungal CE1 members enables more efficient selection of candidate enzymes for biotechnological processes. © 2018 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

The Plasmodium serine-type SERA proteases display distinct expression patterns and non-essential in vivo roles during life cycle progression of the malaria parasite.

PubMed

Putrianti, Elyzana D; Schmidt-Christensen, Anja; Arnold, Iris; Heussler, Volker T; Matuschewski, Kai; Silvie, Olivier

2010-06-01

Parasite proteases play key roles in several fundamental steps of the Plasmodium life cycle, including haemoglobin degradation, host cell invasion and parasite egress. Plasmodium exit from infected host cells appears to be mediated by a class of papain-like cysteine proteases called 'serine repeat antigens' (SERAs). A SERA subfamily, represented by Plasmodium falciparum SERA5, contains an atypical active site serine residue instead of a catalytic cysteine. Members of this SERAser subfamily are abundantly expressed in asexual blood stages, rendering them attractive drug and vaccine targets. In this study, we show by antibody localization and in vivo fluorescent tagging with the red fluorescent protein mCherry that the two P. berghei serine-type family members, PbSERA1 and PbSERA2, display differential expression towards the final stages of merozoite formation. Via targeted gene replacement, we generated single and double gene knockouts of the P. berghei SERAser genes. These loss-of-function lines progressed normally through the parasite life cycle, suggesting a specialized, non-vital role for serine-type SERAs in vivo. Parasites lacking PbSERAser showed increased expression of the cysteine-type PbSERA3. Compensatory mechanisms between distinct SERA subfamilies may thus explain the absence of phenotypical defect in SERAser disruptants, and challenge the suitability to develop potent antimalarial drugs based on specific inhibitors of Plasmodium serine-type SERAs.

The effects of cannabinoid CB1, CB2 and vanilloid TRPV1 receptor antagonists on cocaine addictive behavior in rats.

PubMed

Adamczyk, Przemysław; Miszkiel, Joanna; McCreary, Andrew C; Filip, Małgorzata; Papp, Mariusz; Przegaliński, Edmund

2012-03-20

There is evidence that indicates that tonic activation of cannabinoid CB1 receptors plays a role in extinction/reinstatement of cocaine seeking-behavior but is not involved in the maintenance of cocaine self-administration. To further explore the importance of other endocannabinoid-related receptors in an animal model of cocaine addiction, the present paper examines cannabinoid CB2 receptor antagonist N-((1S)-endo-1,3,3-trimethylbicyclo(2.2.1)heptan-2-yl)-5-(4-chloro-3-methylphenyl)-1-(4-methylbenzyl)-pyrazole-3-carboxamide (SR144528) and the transient receptor potential vanilloid type-1 (TRPV1) receptor antagonist N-(3-methoxyphenyl)-4-chlorocinnamide (SB366791) on intravenous (i.v.) cocaine self-administration and extinction/reinstatement of cocaine-seeking behavior in rats. For comparison and reference purposes, the effect of the cannabinoid CB1 receptor antagonist N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251) was also examined. Moreover, for comparison effects of those drugs on operant lever responding for artificial (cocaine) vs. natural (food) reward, food self-administration was also evaluated. Our findings show that AM251 (1-3mg/kg), SR144528 (0.1-1mg/kg) and SB366791 (0.3-1mg/kg) did not affect cocaine self-administration. However, AM251 (0.1-1mg/kg), SR144528 (0.1-1mg/kg) and SB366791 (0.1-1mg/kg) decreased cocaine-induced reinstatement of cocaine-seeking behavior, and AM251 (0.3-1mg/kg) decreased cue-induced reinstatement. Moreover, AM251 (3mg/kg), SR144528 (0.1-1mg/kg) and SB366791 (0.1-1mg/kg) slightly decreased food self-administration behavior, but only AM251 (3mg/kg) reduced food reward. In conclusion, our results indicate for the first time, that tonic activation of CB2 or TRPV1 receptors is involved in cocaine-induced reinstatement of cocaine-seeking behavior, but their activity is not necessary for the rewarding effect of this psychostimulant. In contrast to CB1 receptors, neither CB2 nor

Disruption of the potassium channel regulatory subunit KCNE2 causes iron-deficient anemia

PubMed Central

Salsbury, Grace; Cambridge, Emma L.; McIntyre, Zoe; Arends, Mark J.; Karp, Natasha A.; Isherwood, Christopher; Shannon, Carl; Hooks, Yvette; Ramirez-Solis, Ramiro; Adams, David J.; White, Jacqueline K.; Speak, Anneliese O.

2014-01-01

Iron homeostasis is a dynamic process that is tightly controlled to balance iron uptake, storage, and export. Reduction of dietary iron from the ferric to the ferrous form is required for uptake by solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 (Slc11a2) into the enterocytes. Both processes are proton dependent and have led to the suggestion of the importance of acidic gastric pH for the absorption of dietary iron. Potassium voltage-gated channel subfamily E, member 2 (KCNE2), in combination with potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1), form a gastric potassium channel essential for gastric acidification. Deficiency of either Kcne2 or Kcnq1 results in achlorhydia, gastric hyperplasia, and neoplasia, but the impact on iron absorption has not, to our knowledge, been investigated. Here we report that Kcne2-deficient mice, in addition to the previously reported phenotypes, also present with iron-deficient anemia. Interestingly, impaired function of KCNQ1 results in iron-deficient anemia in Jervell and Lange-Nielsen syndrome patients. We speculate that impaired function of KCNE2 could result in the same clinical phenotype. PMID:25127743

Finding Street Gang Members on Twitter.

PubMed

Balasuriya, Lakshika; Wijeratne, Sanjaya; Doran, Derek; Sheth, Amit

2016-08-01

Most street gang members use Twitter to intimidate others, to present outrageous images and statements to the world, and to share recent illegal activities. Their tweets may thus be useful to law enforcement agencies to discover clues about recent crimes or to anticipate ones that may occur. Finding these posts, however, requires a method to discover gang member Twitter profiles. This is a challenging task since gang members represent a very small population of the 320 million Twitter users. This paper studies the problem of automatically finding gang members on Twitter. It outlines a process to curate one of the largest sets of verifiable gang member profiles that have ever been studied. A review of these profiles establishes differences in the language, images, YouTube links, and emojis gang members use compared to the rest of the Twitter population. Features from this review are used to train a series of supervised classifiers. Our classifier achieves a promising F 1 score with a low false positive rate.

Molecular evolution and functional divergence of the cytochrome P450 3 (CYP3) Family in Actinopterygii (ray-finned fish).

PubMed

Yan, Jun; Cai, Zhonghua

2010-12-10

The cytochrome P450 (CYP) superfamily is a multifunctional hemethiolate enzyme that is widely distributed from Bacteria to Eukarya. The CYP3 family contains mainly the four subfamilies CYP3A, CYP3B, CYP3C and CYP3D in vertebrates; however, only the Actinopterygii (ray-finned fish) have all four subfamilies and detailed understanding of the evolutionary relationship of Actinopterygii CYP3 family members would be valuable. Phylogenetic relationships were constructed to trace the evolutionary history of the Actinopterygii CYP3 family genes. Selection analysis, relative rate tests and functional divergence analysis were combined to interpret the relationship of the site-specific evolution and functional divergence in the Actinopterygii CYP3 family. The results showed that the four CYP3 subfamilies in Actinopterygii might be formed by gene duplication. The first gene duplication event was responsible for divergence of the CYP3B/C clusters from ancient CYP3 before the origin of the Actinopterygii, which corresponded to the fish-specific whole genome duplication (WGD). Tandem repeat duplication in each of the homologue clusters produced stable CYP3B, CYP3C, CYP3A and CYP3D subfamilies. Acceleration of asymmetric evolutionary rates and purifying selection together were the main force for the production of new subfamilies and functional divergence in the new subset after gene duplication, whereas positive selection was detected only in the retained CYP3A subfamily. Furthermore, nearly half of the functional divergence sites appear to be related to substrate recognition, which suggests that site-specific evolution is closely related with functional divergence in the Actinopterygii CYP3 family. The split of fish-specific CYP3 subfamilies was related to the fish-specific WGD, and site-specific acceleration of asymmetric evolutionary rates and purifying selection was the main force for the origin of the new subfamilies and functional divergence in the new subset after gene

Genome-Wide Analysis of the NADK Gene Family in Plants

PubMed Central

Li, Wen-Yan; Wang, Xiang; Li, Ri; Li, Wen-Qiang; Chen, Kun-Ming

2014-01-01

Background NAD(H) kinase (NADK) is the key enzyme that catalyzes de novo synthesis of NADP(H) from NAD(H) for NADP(H)-based metabolic pathways. In plants, NADKs form functional subfamilies. Studies of these families in Arabidopsis thaliana indicate that they have undergone considerable evolutionary selection; however, the detailed evolutionary history and functions of the various NADKs in plants are not clearly understood. Principal Findings We performed a comparative genomic analysis that identified 74 NADK gene homologs from 24 species representing the eight major plant lineages within the supergroup Plantae: glaucophytes, rhodophytes, chlorophytes, bryophytes, lycophytes, gymnosperms, monocots and eudicots. Phylogenetic and structural analysis classified these NADK genes into four well-conserved subfamilies with considerable variety in the domain organization and gene structure among subfamily members. In addition to the typical NAD_kinase domain, additional domains, such as adenylate kinase, dual-specificity phosphatase, and protein tyrosine phosphatase catalytic domains, were found in subfamily II. Interestingly, NADKs in subfamily III exhibited low sequence similarity (∼30%) in the kinase domain within the subfamily and with the other subfamilies. These observations suggest that gene fusion and exon shuffling may have occurred after gene duplication, leading to specific domain organization seen in subfamilies II and III, respectively. Further analysis of the exon/intron structures showed that single intron loss and gain had occurred, yielding the diversified gene structures, during the process of structural evolution of NADK family genes. Finally, both available global microarray data analysis and qRT-RCR experiments revealed that the NADK genes in Arabidopsis and Oryza sativa show different expression patterns in different developmental stages and under several different abiotic/biotic stresses and hormone treatments, underscoring the functional diversity

Checklist of Recent thecideoid brachiopods from the Indian Ocean and Red Sea, with a description of a new species of Thecidellina from Europa Island and a re-description of T. blochmanni Dall from Christmas Island.

PubMed

Logan, Alan; Hoffmann, Jana; Lüter, Carsten

2015-09-08

Compilation of a checklist of Recent thecideoid brachiopods from the Indian Ocean and Red Sea indicates that members of this superfamily are represented by a small number of species. The subfamily Lacazellinae is represented by Ospreyella maldiviana from the Maldive Islands but the presence of Lacazella cannot yet be confirmed in the Indian Ocean as the holotype of Lacazella mauritiana from Mauritius is lost. The subfamily Thecidellininae is represented by Thecidellina blochmanni from Christmas Island in the eastern Indian Ocean and the Red Sea while a new species T. europa is here described from Europa Island in the Mozambique Channel. The subfamily Minutellinae is represented by Minutella minuta from Samper Bank and Walters Bank in the south-western Indian Ocean and in the Red Sea. Since the holotype of Thecidellina blochmanni from Flying Fish Cove, Christmas Island is also lost, this species is re-described and illustrated mainly from topotypes in the Museum für Naturkunde, Berlin, from which a suggested neotype has been selected.

Identification and Structure-Function Analysis of Subfamily Selective G Protein-Coupled Receptor Kinase Inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Homan, Kristoff T.; Larimore, Kelly M.; Elkins, Jonathan M.

2015-02-13

Selective inhibitors of individual subfamilies of G protein-coupled receptor kinases (GRKs) would serve as useful chemical probes as well as leads for therapeutic applications ranging from heart failure to Parkinson’s disease. To identify such inhibitors, differential scanning fluorimetry was used to screen a collection of known protein kinase inhibitors that could increase the melting points of the two most ubiquitously expressed GRKs: GRK2 and GRK5. Enzymatic assays on 14 of the most stabilizing hits revealed that three exhibit nanomolar potency of inhibition for individual GRKs, some of which exhibiting orders of magnitude selectivity. Most of the identified compounds can bemore » clustered into two chemical classes: indazole/dihydropyrimidine-containing compounds that are selective for GRK2 and pyrrolopyrimidine-containing compounds that potently inhibit GRK1 and GRK5 but with more modest selectivity. The two most potent inhibitors representing each class, GSK180736A and GSK2163632A, were cocrystallized with GRK2 and GRK1, and their atomic structures were determined to 2.6 and 1.85 Å spacings, respectively. GSK180736A, developed as a Rho-associated, coiled-coil-containing protein kinase inhibitor, binds to GRK2 in a manner analogous to that of paroxetine, whereas GSK2163632A, developed as an insulin-like growth factor 1 receptor inhibitor, occupies a novel region of the GRK active site cleft that could likely be exploited to achieve more selectivity. However, neither compound inhibits GRKs more potently than their initial targets. This data provides the foundation for future efforts to rationally design even more potent and selective GRK inhibitors.« less

Brianmyia stuckenbergi, a new genus and species of Prosopochrysini from South Africa (Diptera: Stratiomyidae)

USDA-ARS?s Scientific Manuscript database

A new genus and species of Stratiomyidae, Brianmyia stuckenbergi, gen. n., sp. n. is described from the Drakensberg Range, KwaZulu-Natal, South Africa. The new genus is placed in the tribe Prosopochrysini of the subfamily Stratiomyinae, and is the first member of this tribe known from southern Afri...

Rotavirus Infections

USDA-ARS?s Scientific Manuscript database

The avian rotaviruses are members of the Reoviridae family, which is characterized by virions that contain 10-12 linear double-stranded RNA (dsRNA) segments. The Reoviridae consists of 15 genera which can be placed into two recognized subfamilies based upon the presence or absence of structural “tur...

Simple sequence repeat markers that identify Claviceps species and strains

USDA-ARS?s Scientific Manuscript database

Claviceps purpurea is a pathogen that infects most members of the Pooideae subfamily and causes ergot, a floral disease in which the ovary is replaced with a sclerotium. This study was initiated to develop Simple Sequence Repeat (SSRs) markers for rapid identification of C. purpurea. SSRs were desi...

Conformations of eight-membered cyclosiloxanes

NASA Astrophysics Data System (ADS)

Palyulin, V. A.; Zefirov, N. S.; Shklover, V. E.; Struchkov, Yu. T.

1981-01-01

Using the Cremer—Pople approach the classification and quantitative description of the conformations of eight-membered rings has been accomplished. The conformations of eight-membered cyclosiloxanes are considered and classified on the basis of available X-ray structural data.

cDNA cloning, molecular modeling and docking calculations of L-type lectins from Swartzia simplex var. grandiflora (Leguminosae, Papilionoideae), a member of the tribe Swartzieae.

PubMed

Maranhão, Paulo A C; Teixeira, Claudener S; Sousa, Bruno L; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Fernandes, Andreia V; Ramos, Marcio V; Vasconcelos, Ilka M; Gonçalves, José F C; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B

2017-07-01

The genus Swartzia is a member of the tribe Swartzieae, whose genera constitute the living descendants of one of the early branches of the papilionoid legumes. Legume lectins comprise one of the main families of structurally and evolutionarily related carbohydrate-binding proteins of plant origin. However, these proteins have been poorly investigated in Swartzia and to date, only the lectin from S. laevicarpa seeds (SLL) has been purified. Moreover, no sequence information is known from lectins of any member of the tribe Swartzieae. In the present study, partial cDNA sequences encoding L-type lectins were obtained from developing seeds of S. simplex var. grandiflora. The amino acid sequences of the S. simplex grandiflora lectins (SSGLs) were only averagely related to the known primary structures of legume lectins, with sequence identities not greater than 50-52%. The SSGL sequences were more related to amino acid sequences of papilionoid lectins from members of the tribes Sophoreae and Dalbergieae and from the Cladratis and Vataireoid clades, which constitute with other taxa, the first branching lineages of the subfamily Papilionoideae. The three-dimensional structures of 2 representative SSGLs (SSGL-A and SSGL-E) were predicted by homology modeling using templates that exhibit the characteristic β-sandwich fold of the L-type lectins. Molecular docking calculations predicted that SSGL-A is able to interact with D-galactose, N-acetyl-D-galactosamine and α-lactose, whereas SSGL-E is probably a non-functional lectin due to 2 mutations in the carbohydrate-binding site. Using molecular dynamics simulations followed by density functional theory calculations, the binding free energies of the interaction of SSGL-A with GalNAc and α-lactose were estimated as -31.7 and -47.5 kcal/mol, respectively. These findings gave insights about the carbohydrate-binding specificity of SLL, which binds to immobilized lactose but is not retained in a matrix containing D-GalNAc as

41 CFR 302-3.511 - What must we consider when determining return travel for immediate family member(s) for...

Code of Federal Regulations, 2012 CFR

2012-07-01

... when determining return travel for immediate family member(s) for compassionate reasons prior to... determining return travel for immediate family member(s) for compassionate reasons prior to completion of the service agreement? You must determine that the public interest requires the return of the immediate family...

41 CFR 302-3.511 - What must we consider when determining return travel for immediate family member(s) for...

Code of Federal Regulations, 2014 CFR

2014-07-01

... when determining return travel for immediate family member(s) for compassionate reasons prior to... determining return travel for immediate family member(s) for compassionate reasons prior to completion of the service agreement? You must determine that the public interest requires the return of the immediate family...

41 CFR 302-3.511 - What must we consider when determining return travel for immediate family member(s) for...

Code of Federal Regulations, 2013 CFR

2013-07-01

... when determining return travel for immediate family member(s) for compassionate reasons prior to... determining return travel for immediate family member(s) for compassionate reasons prior to completion of the service agreement? You must determine that the public interest requires the return of the immediate family...

41 CFR 302-3.511 - What must we consider when determining return travel for immediate family member(s) for...

Code of Federal Regulations, 2011 CFR

2011-07-01

... when determining return travel for immediate family member(s) for compassionate reasons prior to... determining return travel for immediate family member(s) for compassionate reasons prior to completion of the service agreement? You must determine that the public interest requires the return of the immediate family...

International Focus: Highlighting APPA Members Worldwide

ERIC Educational Resources Information Center

Glazner, Steve, Comp.

2011-01-01

While most APPA member institutions are located in the United States and Canada, there are also 45 of member institutions located internationally--from Australia and New Zealand to Southeast Asia to the Middle East to Europe. This article focuses on four of its international members: (1) American University of Kuwait (AUK); (2) American University…

42 CFR 436.121 - Qualified family members.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 4 2011-10-01 2011-10-01 false Qualified family members. 436.121 Section 436.121... Coverage of the Categorically Needy § 436.121 Qualified family members. (a) Definition. A qualified family member is any member of a family, including pregnant women and children eligible for Medicaid under § 436...

42 CFR 436.121 - Qualified family members.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Qualified family members. 436.121 Section 436.121... Coverage of the Categorically Needy § 436.121 Qualified family members. (a) Definition. A qualified family member is any member of a family, including pregnant women and children eligible for Medicaid under § 436...

Finding Street Gang Members on Twitter

PubMed Central

Balasuriya, Lakshika; Wijeratne, Sanjaya; Doran, Derek; Sheth, Amit

2017-01-01

Most street gang members use Twitter to intimidate others, to present outrageous images and statements to the world, and to share recent illegal activities. Their tweets may thus be useful to law enforcement agencies to discover clues about recent crimes or to anticipate ones that may occur. Finding these posts, however, requires a method to discover gang member Twitter profiles. This is a challenging task since gang members represent a very small population of the 320 million Twitter users. This paper studies the problem of automatically finding gang members on Twitter. It outlines a process to curate one of the largest sets of verifiable gang member profiles that have ever been studied. A review of these profiles establishes differences in the language, images, YouTube links, and emojis gang members use compared to the rest of the Twitter population. Features from this review are used to train a series of supervised classifiers. Our classifier achieves a promising F1 score with a low false positive rate. PMID:28713880

Taxonomic review of the plant bug subfamily Isometopinae for Taiwan and Japanese Southwest Islands, with descriptions of new taxa (Hemiptera: Heteroptera: Miridae: Isometopinae).

PubMed

Yasunaga, Tomohide; Yamada, Kazutaka; Tsai, Jing-Fu

2017-12-19

The fauna of plant bug subfamily Isometopinae in Taiwan and Japanese Southwest (Nansei) Islands is reviewed. Twenty-five species are recognized, including two new species of Myiomma Puton, M. austroccidens sp. nov. and M. kentingense sp. nov., which are herein diagnosed and described. In addition, Isometopus yehi Lin, 2004 is synonymized with I. bipunctatus Lin; Isometopidea yangi Lin is transferred to Kohnometopus; and a substitute name, Alcecoris linyangorum, is proposed for A. formosanus (Lin Yang) (= a junior secondary homonym of Alcecoris formosanus Lin). An annotated checklist, with updated distributional record and biological information, is provided for all treated taxa. A new tribe Sophianini is proposed for two genera, Alcecoris and Sophianus, characterized principally by the conspicuously modified antennal structures. An additional new species, Alcecoris cochlearatus sp. nov., found during examination of related Oriental specimens, is described from the Malay Peninsula.

7 CFR 795.4 - Family members.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 7 2011-01-01 2011-01-01 false Family members. 795.4 Section 795.4 Agriculture... PROVISIONS COMMON TO MORE THAN ONE PROGRAM PAYMENT LIMITATION General § 795.4 Family members. Effective for... was a “person” solely on the basis that: (a) A family member cosigns for, or makes a loan to, such...

7 CFR 795.4 - Family members.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 7 2010-01-01 2010-01-01 false Family members. 795.4 Section 795.4 Agriculture... PROVISIONS COMMON TO MORE THAN ONE PROGRAM PAYMENT LIMITATION General § 795.4 Family members. Effective for... was a “person” solely on the basis that: (a) A family member cosigns for, or makes a loan to, such...

Post-fire assessment of structural wood members

Treesearch

Robert J. Ross; Brian K. Brashaw; Xiping Wang; Robert H. White; Roy F. Pellerin

2005-01-01

Since the interior of a charred wood member normally retains its structural integrity, large structural wood members often do not need to be replaced after a fire. Engineering judgement is required to determine which members can remain and which members need to be replaced or repaired. Due to the lack of established methods to directly determine the residual capacity...

Method for electrically isolating an electrically conductive member from another such member

DOEpatents

Tsang, K.L.; Chen, Y.

1984-02-09

The invention relates to methods for electrically isolating a first electrically conductive member from another such member by means of an electrically insulating medium. In accordance with the invention, the insulating medium is provided in the form of MgO which contains a dopant selected from lithium, copper, cobalt, sodium, silver, gold and hydrogen. The dopant is present in the MgO in an amount effective to suppress dielectric breakdown of the MgO, even at elevated temperatures and in the presence of electrical fields.

Molecular phylogeny and evolutionary timescale for the family of mammalian herpesviruses.

PubMed

McGeoch, D J; Cook, S; Dolan, A; Jamieson, F E; Telford, E A

1995-03-31

A detailed phylogenetic analysis for mammalian members of the family Herpesviridae, based on molecular sequences is reported. Sets of encoded amino acid sequences were collected for eight well conserved genes that are common to mammalian herpesviruses. Phylogenetic trees were inferred from alignments of these sequence sets using both maximum parsimony and distance methods, and evaluated by bootstrap analysis. In all cases the three recognised subfamilies (Alpha-, Beta- and Gammaherpesvirinae), and major sublineages in each subfamily, were clearly distinguished, but within sublineages some finer details of branching were incompletely resolved. Multiple-gene sets were assembled to give a broadly based tree. The root position of the tree was estimated by assuming a constant molecular clock and also by analysis of one herpesviral gene set (that encoding uracil-DNA glycosylase) using cellular homologues as outgroups. Both procedures placed the root between the Alphaherpesvirinae and the other two subfamilies. Substitution rates were calculated for the combined gene sets based on a previous estimate for alphaherpesviral UL27 genes, where the time base had been obtained according to the hypothesis of cospeciation of virus and host lineages. Assuming a constant molecular clock, it was then estimated that the three subfamilies arose approximately 180 to 220 million years ago, that major sublineages within subfamilies were probably generated before the mammalian radiation of 80 to 60 million years ago, and that speciations within sublineages took place in the last 80 million years, probably with a major component of cospeciation with host lineages.

17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

Code of Federal Regulations, 2012 CFR

2012-04-01

... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in Commission regulation... governors of a self-regulatory organization. (3) Committee member means a member, or functional equivalent...

17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

Code of Federal Regulations, 2011 CFR

2011-04-01

... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in Commission regulation... governors of a self-regulatory organization. (3) Committee member means a member, or functional equivalent...

17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

Code of Federal Regulations, 2010 CFR

2010-04-01

... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in Commission regulation... governors of a self-regulatory organization. (3) Committee member means a member, or functional equivalent...

Apparatus for fabricating composite ceramic members

DOEpatents

Roy, P.; Simpson, J.L.; Aitken, E.A.

1975-10-28

Methods and apparatus for fabrication of composite ceramic members having particular application for measuring oxygen activities in liquid sodium are described. The method involves the simultaneous deposition of ThO$sub 2$: 15 percent Y$sub 2$O$sub 3$ on a sintered stabilized zirconia member by decomposition of gaseous ThCl$sub 4$ and YCl$sub 3$ and by reacting with oxygen gas. Means are provided for establishing an electrical potential gradient across the zirconia member whereby oxygen ions, from a source on one side of the member portion to be coated, are migrated to the opposite side where a reaction and said decomposition and deposition are effected.

Piperine: researchers discover new flavor in an ancient spice.

PubMed

Szallasi, Arpad

2005-09-01

Studies with animals that are deficient in the vanilloid (capsaicin) receptor TRPV1 have confirmed the pivotal role that TRPV1 has in the development of post-inflammatory hyperalgesia, and enhanced TRPV1 expression has been described in various human disorders. Natural products have provided several lead structures for the development of vanilloid ligands. A recent study shows that piperine, the irritant principle in black pepper, is more efficient than capsaicin in the desensitization of human TRPV1, which suggests that this pharmacological aspect of vanilloids can be dissociated from its potency. This finding raises the intriguing possibility that piperine can be used as a chemical template for the design of improved TRPV1 agonists.

Upregulated Expression of Transient Receptor Potential Cation Channel Subfamily V Receptors in Mucosae of Patients with Oral Squamous Cell Carcinoma and Patients with a History of Alcohol Consumption or Smoking

PubMed Central

Sakakibara, Akiko; Sakakibara, Shunsuke; Kusumoto, Junya; Takeda, Daisuke; Hasegawa, Takumi; Akashi, Masaya; Minamikawa, Tsutomu; Hashikawa, Kazunobu; Terashi, Hiroto; Komori, Takahide

2017-01-01

Objectives Transient receptor potential cation channel (subfamily V, members 1–4) (TRPV1–4) are expressed in skin and neurons and activated by external stimuli in normal mucosae of all oral cavity sites. The oral cavity is exposed to various stimuli, including temperature, mechanical stimuli, chemical substances, and changes in pH, and, notably, the risk factors for oncogenic transformation in oral squamous epithelium are the same as the external stimuli received by TRPV1–4 receptors. Hence, we examined the relationship between oral squamous cell carcinoma (SCC) and TRPV1–4 expression. Materials and Methods Oral SCC patients (n = 37) who underwent surgical resection were included in this study. We investigated the expression of TRPV1–4 by immunohistochemical staining and quantification of TRPV1–4 mRNA in human oral mucosa. In addition, we compared the TRPV1–4 levels in mucosa from patients with SCC to those in normal oral mucosa. Results The receptors were expressed in oral mucosa at all sites (tongue, buccal mucosa, gingiva, and oral floor) and the expression was stronger in epithelia from patients with SCC than in normal epithelia. Furthermore, alcohol consumption and tobacco use were strongly associated with the occurrence of oral cancer and were found to have a remarkable influence on TRPV1–4 receptor expression in normal oral mucosa. In particular, patients with a history of alcohol consumption demonstrated significantly higher expression levels. Conclusion Various external stimuli may influence the behavior of cancer cells. Overexpression of TRPV1-4 is likely to be a factor in enhanced sensitivity to external stimuli. These findings could contribute to the establishment of novel strategies for cancer therapy or prevention. PMID:28081185

20 CFR 653.104 - Services to MSFW family members, farm labor contractors, and crew members.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Services to MSFW family members, farm labor contractors, and crew members. 653.104 Section 653.104 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR SERVICES OF THE EMPLOYMENT SERVICE SYSTEM Services for Migrant and Seasonal...

[Effect of hydrostatic pressure on intracellular free calcium concentration and transient receptor potential vanilloid expression in human bladder smooth muscle cells].

PubMed

Han, Zhenwei; Wang, Kunjie; Chen, Lin; Wei, Tangqiang; Luo, Deyi; Li, Shengfu

2012-04-01

To explore the effect of hydrostatic pressure on intracellular free calcium concentration ([Ca2+]i) and the gene expression of transient receptor potential vanilloid (TRPV) in cultured human bladder smooth muscle cells (hb-SMCs), and to preliminarily probe into the possible molecular mechanism of hb-SMCs proliferation stimulated by hydrostatic pressure. The passage 6-7 hb-SMCs were loaded with Ca2+ indicator Fluo-3/AM. When the hb-SMCs were under 0 cm H2O (1cm H2O = 0.098 kPa) (group A) or 200 cm H2O hydrostatic pressure for 30 minutes (group B) and then removing the 200 cm H2O hydrostatic pressure (group C), the [Ca2+]i was measured respectively by inverted laser scanning confocal microscope. When the hb-SMCs were given the 200 cm H2O hydrostatic pressure for 0 hour, 2 hours, 6 hours, 12 hours, and 24 hours, the mRNA expressions of TRPV1, TRPV2, and TRPV4 were detected by RT-PCR technique. The [Ca2+]i of group A, group B, and group C were (100.808 +/- 1.724), (122.008 +/- 1.575), and (99.918 +/- 0.887) U, respectively; group B was significantly higher than groups A and C (P < 0.001). The [Ca2+]i of group C decreased to the base line level of group A after removing the pressure (t = 0.919, P = 0.394). The TRPV1, TRPV2, and TRPV4 genes expressed in hb-SMCs under 200 cm H2O hydrostatic pressure at 0 hour, 2 hours, 6 hours, 12 hours, and 24 hours, but the expressions had no obvious changes with time. There was no significant difference in the expressions of TRPV1, TRPV2, and TRPV4 among 3 groups (P > 0.05). The [Ca2+]i of hb-SMCs increases significantly under high hydrostatic pressure. As possible genes in stretch-activated cation channel, the TRPV1, TRPV2, and TRPV4 express in hb-SMCs under 200 cm H2O hydrostatic pressure. It is possible that the mechanical pressure regulates the [Ca2+]i of hb-SMCs by opening the stretch-activated cation channel rather than up-regulating its expression.

An interesting new genus of Berothinae (Neuroptera: Berothidae) from the early Eocene Green River Formation, Colorado.

PubMed

Makarkin, Vladimir N

2017-01-30

Xenoberotha angustialata gen. et sp. nov. (Neuroptera: Berothidae) is described from the early Eocene of the Parachute Creek Member of the Green River Formation (U.S.A., Colorado). It is assigned to Berothinae as an oldest known member of the subfamily based on the presence of scale-like setae on the foreleg coxae. Distal crossveins of the fourth (outer) gradate series which are located very close to the wing margin in Xenoberotha gen. nov. is a character state previously unknown in Berothinae.

APPARATUS FOR NON-DESTRUCTIVE INSPECTION OF CANTILEVERED MEMBERS

DOEpatents

Taylor, E.R.; Mahoney, C.H.; Lay, C.R.

1961-10-24

An apparatus for non-destructive inspection of cantilevered members, such as compressor blades, is described. The member under inspection is vibrated with a regulated source of air under pressure. The amplitude of vibration of the member is maintained at its natural frequency. The frequency of vibration of the member is measured. An indication of an excessive decay or erratic shifting in the measured frequency above an allowable hysteretic decay is provided as an indication of a fault in the member. The member is vibrated for a selected test period. (AEC)

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

PubMed

Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J

2017-11-01

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1

The C. elegans rab family: identification, classification and toolkit construction.

PubMed

Gallegos, Maria E; Balakrishnan, Sanjeev; Chandramouli, Priya; Arora, Shaily; Azameera, Aruna; Babushekar, Anitha; Bargoma, Emilee; Bokhari, Abdulmalik; Chava, Siva Kumari; Das, Pranti; Desai, Meetali; Decena, Darlene; Saramma, Sonia Dev Devadas; Dey, Bodhidipra; Doss, Anna-Louise; Gor, Nilang; Gudiputi, Lakshmi; Guo, Chunyuan; Hande, Sonali; Jensen, Megan; Jones, Samantha; Jones, Norman; Jorgens, Danielle; Karamchedu, Padma; Kamrani, Kambiz; Kolora, Lakshmi Divya; Kristensen, Line; Kwan, Kelly; Lau, Henry; Maharaj, Pranesh; Mander, Navneet; Mangipudi, Kalyani; Menakuru, Himabindu; Mody, Vaishali; Mohanty, Sandeepa; Mukkamala, Sridevi; Mundra, Sheena A; Nagaraju, Sudharani; Narayanaswamy, Rajhalutshimi; Ndungu-Case, Catherine; Noorbakhsh, Mersedeh; Patel, Jigna; Patel, Puja; Pendem, Swetha Vandana; Ponakala, Anusha; Rath, Madhusikta; Robles, Michael C; Rokkam, Deepti; Roth, Caroline; Sasidharan, Preeti; Shah, Sapana; Tandon, Shweta; Suprai, Jagdip; Truong, Tina Quynh Nhu; Uthayaruban, Rubatharshini; Varma, Ajitha; Ved, Urvi; Wang, Zeran; Yu, Zhe

2012-01-01

Rab monomeric GTPases regulate specific aspects of vesicle transport in eukaryotes including coat recruitment, uncoating, fission, motility, target selection and fusion. Moreover, individual Rab proteins function at specific sites within the cell, for example the ER, golgi and early endosome. Importantly, the localization and function of individual Rab subfamily members are often conserved underscoring the significant contributions that model organisms such as Caenorhabditis elegans can make towards a better understanding of human disease caused by Rab and vesicle trafficking malfunction. With this in mind, a bioinformatics approach was first taken to identify and classify the complete C. elegans Rab family placing individual Rabs into specific subfamilies based on molecular phylogenetics. For genes that were difficult to classify by sequence similarity alone, we did a comparative analysis of intron position among specific subfamilies from yeast to humans. This two-pronged approach allowed the classification of 30 out of 31 C. elegans Rab proteins identified here including Rab31/Rab50, a likely member of the last eukaryotic common ancestor (LECA). Second, a molecular toolset was created to facilitate research on biological processes that involve Rab proteins. Specifically, we used Gateway-compatible C. elegans ORFeome clones as starting material to create 44 full-length, sequence-verified, dominant-negative (DN) and constitutive active (CA) rab open reading frames (ORFs). Development of this toolset provided independent research projects for students enrolled in a research-based molecular techniques course at California State University, East Bay (CSUEB).

The C. elegans Rab Family: Identification, Classification and Toolkit Construction

PubMed Central

Gallegos, Maria E.; Balakrishnan, Sanjeev; Chandramouli, Priya

2012-01-01

Rab monomeric GTPases regulate specific aspects of vesicle transport in eukaryotes including coat recruitment, uncoating, fission, motility, target selection and fusion. Moreover, individual Rab proteins function at specific sites within the cell, for example the ER, golgi and early endosome. Importantly, the localization and function of individual Rab subfamily members are often conserved underscoring the significant contributions that model organisms such as Caenorhabditis elegans can make towards a better understanding of human disease caused by Rab and vesicle trafficking malfunction. With this in mind, a bioinformatics approach was first taken to identify and classify the complete C. elegans Rab family placing individual Rabs into specific subfamilies based on molecular phylogenetics. For genes that were difficult to classify by sequence similarity alone, we did a comparative analysis of intron position among specific subfamilies from yeast to humans. This two-pronged approach allowed the classification of 30 out of 31 C. elegans Rab proteins identified here including Rab31/Rab50, a likely member of the last eukaryotic common ancestor (LECA). Second, a molecular toolset was created to facilitate research on biological processes that involve Rab proteins. Specifically, we used Gateway-compatible C. elegans ORFeome clones as starting material to create 44 full-length, sequence-verified, dominant-negative (DN) and constitutive active (CA) rab open reading frames (ORFs). Development of this toolset provided independent research projects for students enrolled in a research-based molecular techniques course at California State University, East Bay (CSUEB). PMID:23185324

Round and pointed-head grenadier fishes (Actinopterygii: Gadiformes) represent a single sister group: evidence from the complete mitochondrial genome sequences.

PubMed

Satoh, Takashi P; Miya, Masaki; Endo, Hiromitsu; Nishida, Mutsumi

2006-07-01

The gene order of mitochondrial genomes (mitogenomes) has been employed as a useful phylogenetic marker in various metazoan animals, because it may represent uniquely derived characters shared by members of monophyletic groups. During the course of molecular phylogenetic studies of the order Gadiformes (cods and their relatives) based on whole mitogenome sequences, we found that two deep-sea grenadiers (Squalogadus modificatus and Trachyrincus murrayi: family Macrouridae) revealed a unusually identical gene order (translocation of the tRNA(Leu (UUR))). Both are members of the same family, although their external morphologies differed so greatly (e.g., round vs. pointed head) that they have been placed in different subfamilies Macrouroidinae and Trachyrincinae, respectively. Additionally, we determined the whole mitogenome sequences of two other species, Bathygadus antrodes and Ventrifossa garmani, representing a total of four subfamilies currently recognized within Macrouridae. The latter two species also exhibited gene rearrangements, resulting in a total of three different patterns of unique gene order being observed in the four subfamilies. Partitioned Bayesian analysis was conducted using available whole mitogenome sequences from five macrourids plus five outgroups. The resultant trees clearly indicated that S. modificatus and T. murrayi formed a monophyletic group, having a sister relationship to other macrourids. Thus, monophyly of the two species with disparate head morphologies was corroborated by two different lines of evidence (nucleotide sequences and gene order). The overall topology of the present tree differed from any of the previously proposed, morphology-based phylogenetic hypotheses.

Novel Podoviridae Family Bacteriophage Infecting Weissella cibaria Isolated from Kimchi

PubMed Central

Holo, Helge; Jeon, Sang-Rok; Nes, Ingolf F.; Yoon, Sung-Sik

2012-01-01

The first complete genome sequence of a phage infecting Weissella cibaria (Weissella kimchii) is presented. The bacteriophage ϕYS61 was isolated from kimchi, a Korean fermented vegetable dish. Bacteriophages are recognized as a serious problem in industrial fermentations; however, ϕYS61 differed from many virulent phages associated with food fermentations since it was difficult to propagate and was very susceptible to resistance development. Sequence analysis revealed that ϕYS61 resembles Podoviridae of the subfamily Picovirinae. Within the subfamily Picovirinae, the ϕ29-like phages have been extensively studied, and their terminal protein-primed DNA replication is well characterized. Our data strongly suggest that ϕYS61 also replicates by a protein-primed mechanism. Weissella phage ϕYS61 is, however, markedly different from members of the Picovirinae with respect to genome size and morphology. Picovirinae are characterized by small (approximately 20-kb) genomes which contrasts with the 33,594-bp genome of ϕYS61. Based on electron microscopy analysis, ϕYS61 was classified as a member of the Podoviridae of morphotype C2, similar to the ϕ29-like phages, but its capsid dimensions are significantly larger than those reported for these phages. The novelty of ϕYS61 was also emphasized by the low number of open reading frames (ORFs) showing significant similarity to database sequences. We propose that the bacteriophage ϕYS61 should represent a new subfamily within the family Podoviridae. PMID:22885743

Identification of two novel mammalian genes establishes a subfamily of KH-domain RNA-binding proteins.

PubMed

Makeyev, A V; Liebhaber, S A

2000-08-01

We have identified two novel human genes encoding proteins with a high level of sequence identity to two previously characterized RNA-binding proteins, alphaCP-1 and alphaCP-2. Both of these novel genes, alphaCP-3 and alphaCP-4, are predicted to encode proteins with triplicated KH domains. The number and organization of the KH domains, their sequences, and the sequences of the contiguous regions are conserved among all four alphaCP proteins. The common evolutionary origin of these proteins is substantiated by conservation of exon-intron organization in the corresponding genes. The map positions of alphaCP-1 and alphaCP-2 (previously reported) and those of alphaCP-3 and alphaCP-4 (present report) reveal that the four alphaCP loci are dispersed in the human genome; alphaCP-3 and alphaCP-4 mapped to 21q22.3 and 3p21, and the respective mouse orthologues mapped to syntenic regions of the mouse genome, 10B5 and 9F1-F2, respectively. Two additional loci in the human genome were identified as alphaCP-2 processed pseudogenes (PCBP2P1, 21q22.3, and PCBP2P2, 8q21-q22). Although the overall levels of alphaCP-3 and alphaCP-4 mRNAs are substantially lower than those of alphaCP-1 and alphaCP-2, transcripts of alphaCP-3 and alphaCP-4 were found in all mouse tissues tested. These data establish a new subfamily of genes predicted to encode closely related KH-containing RNA-binding proteins with potential functions in posttranscriptional controls. Copyright 2000 Academic Press.

78 FR 69093 - Performance Review Board Members

Federal Register 2010, 2011, 2012, 2013, 2014

2013-11-18

... Review Board Members AGENCY: Centers for Disease Control and Prevention (CDC), Department of Health and... Performance Review Board Members who are reviewing performance for Fiscal Year 2013. FOR FURTHER INFORMATION... Performance Review Board Members be published in the Federal Register. The following persons will serve on the...

29 CFR 452.90 - Visiting members.

Code of Federal Regulations, 2010 CFR

2010-07-01

... OF 1959 Right To Vote § 452.90 Visiting members. A decision about the voting rights of visiting members is properly one for resolution by the union in accordance with the organization's constitution and...

Compression member response of double steel angles on truss structure with member length variation

NASA Astrophysics Data System (ADS)

Hasibuan, Purwandy; Panjaitan, Arief; Haiqal, Muhammad

2018-05-01

One type of structures that implements steel angles as its members is truss system of telecommunication tower. For this structure, reinforcements on tower legs are also needed when antennas and microwaves installation placed on the peak of tower increases in quantity. One type of reinforcement methods commonly used is by increasing areas section capacity, where tower leg consisted of single angle section will be reinforced to be double angle sections. Regarding this case, this research discussed behavior two types of double angle steel section 2L 30.30.3 that were designed identically in area section but vary in length: 103 cm and 83 cm. At the first step, compression member together with tension member was formed to be a truss system, where compression and tension member were met at the joint plate. Schematic loading was implemented by giving tension loading on the joint plate, and this loading was terminated when each specimen reached its failure. Research findings showed that implementing shorter double angle (83 cm) sections, increased compression strength of steel angle section up to 13 %. Significant deformation occurring only on the flange for both of specimens indicated that implementing double angle is effective to prevent lateral-torsional buckling.

Burnout in Female Faculty Members.

PubMed

Cassidy-Vu, Lisa; Beck, Keli; Moore, Justin B

2017-04-01

Despite approximately equal numbers of male and female medical school graduates, women are entering academic medicine at a lower rate than their male colleagues. Of those who do assume a faculty position, female faculty members report higher levels of burnout, often attributable to gender-specific difficulties in clinical expectations and maintenance of work-life balance. Many of these struggles are attributable to issues that are amenable to supportive policies, but these policies are inconsistent in their availability and practice. This commentary presents evidence for inconsistencies in the day-to-day experience of female faculty members, and proposes solutions for the mitigation of the challenges experienced more often by female faculty members with the goal of diversifying and strengthening academic medicine.

Burnout in Female Faculty Members

PubMed Central

Cassidy-Vu, Lisa; Beck, Keli; Moore, Justin B.

2016-01-01

Despite approximately equal numbers of male and female medical school graduates, women are entering academic medicine at a lower rate than their male colleagues. Of those who do assume a faculty position, female faculty members report higher levels of burnout, often attributable to gender-specific difficulties in clinical expectations and maintenance of work-life balance. Many of these struggles are attributable to issues that are amenable to supportive policies, but these policies are inconsistent in their availability and practice. This commentary presents evidence for inconsistencies in the day-to-day experience of female faculty members, and proposes solutions for the mitigation of the challenges experienced more often by female faculty members with the goal of diversifying and strengthening academic medicine. PMID:27650035

Synteny conservation between two distantly-related Rosaceae genomes: Prunus (the stone fruits) and Fragaria (the strawberry)

PubMed Central

Vilanova, Santiago; Sargent, Daniel J; Arús, Pere; Monfort, Amparo

2008-01-01

Background The Rosaceae encompass a large number of economically-important diploid and polyploid fruit and ornamental species in many different genera. The basic chromosome numbers of these genera are x = 7, 8 and 9 and all have compact and relatively similar genome sizes. Comparative mapping between distantly-related genera has been performed to a limited extent in the Rosaceae including a comparison between Malus (subfamily Maloideae) and Prunus (subfamily Prunoideae); however no data has been published to date comparing Malus or Prunus to a member of the subfamily Rosoideae. In this paper we compare the genome of Fragaria, a member of the Rosoideae, to Prunus, a member of the Prunoideae. Results The diploid genomes of Prunus (2n = 2x = 16) and Fragaria (2n = 2x = 14) were compared through the mapping of 71 anchor markers – 40 restriction fragment length polymorphisms (RFLPs), 29 indels or single nucleotide polymorphisms (SNPs) derived from expressed sequence tags (ESTs) and two simple-sequence repeats (SSRs) – on the reference maps of both genera. These markers provided good coverage of the Prunus (78%) and Fragaria (78%) genomes, with maximum gaps and average densities of 22 cM and 7.3 cM/marker in Prunus and 32 cM and 8.0 cM/marker in Fragaria. Conclusion Our results indicate a clear pattern of synteny, with most markers of each chromosome of one of these species mapping to one or two chromosomes of the other. A large number of rearrangements (36), most of which produced by inversions (27) and the rest (9) by translocations or fission/fusion events could also be inferred. We have provided the first framework for the comparison of the position of genes or DNA sequences of these two economically valuable and yet distantly-related genera of the Rosaceae. PMID:18564412

50 CFR 600.250 - Council member training.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Council member training. 600.250 Section... member training. (a) The Secretary shall provide a training course covering a variety of topics relevant to matters before the Councils and shall make the training course available to all Council members...

University Faculty Members' Perceptions of Their Teaching Efficacy

ERIC Educational Resources Information Center

Chang, Te-Sheng; Lin, Huei-Hsuan; Song, Mei-Mei

2011-01-01

The purpose of this study was to investigate faculty members' perceptions of teaching efficacy and their relation to faculty members' backgrounds. A questionnaire measuring six dimensions of teaching efficacy was distributed to faculty members at 17 universities in Taiwan, yielding 513 complete sets of responses. Faculty members felt efficacious,…

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, Mansi; Larroux, Claire; Lu, Daniel R

LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in themore » genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

PpHB22, a member of HD-Zip proteins, activates PpDAM1 to regulate bud dormancy transition in 'Suli' pear (Pyrus pyrifolia White Pear Group).

PubMed

Yang, Qinsong; Niu, Qingfeng; Li, Jianzhao; Zheng, Xiaoyan; Ma, Yunjing; Bai, Songling; Teng, Yuanwen

2018-06-01

Homeodomain-leucine zipper (HD-Zip) proteins, which form one of the largest and most diverse families, regulate many biological processes in plants, including differentiation, flowering, vascular development, and stress signaling. Abscisic acid (ABA) has been proved to be one of the key regulators of bud dormancy and to influence several HD-Zip genes expression. However, the role of HD-Zip genes in regulating bud dormancy remains unclear. We identified 47 pear (P. pyrifolia White Pear Group) HD-Zip genes, which were classified into four subfamilies (HD-Zip I-IV). We further revealed that gene expression levels of some HD-Zip members were closely related to ABA concentrations in flower buds during dormancy transition. Exogenous ABA treatment confirmed that PpHB22 and several other HD-Zip genes responded to ABA. Yeast one-hybrid and dual luciferase assay results combining subcellular localization showed that PpHB22 was present in nucleus and directly induced PpDAM1 (dormancy associated MADS-box 1) expression. Thus, PpHB22 is a negative regulator of plant growth associated with the ABA response pathway and functions upstream of PpDAM1. These findings enrich our understanding of the function of HD-Zip genes related to the bud dormancy transition. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Converting virtual community members into online buyers.

PubMed

Gupta, Sumeet; Kim, Hee-Woong; Shin, Seon-Jin

2010-10-01

Although many online vendors have sponsored virtual communities (VCs) in the hope of reaping commercial benefits from it, not many have been successful in reaping commercial benefits from their VC. Online vendors can benefit greatly from having a VC, if the VC members can be converted into online buyers. This study examines the conversion of a VC member into an online buyer. Using a classical-conditioning approach, this study finds that members' committed participation in the VC is the springboard for online vendors to convert VC members into online buyers.

The Molecular Mechanism and Neuroprotective Effect of Dihydrocapsaicin-Induced Mild Hypothermia After Cardiopulmonary Resuscitation in Rats.

PubMed

Zhong, Xiaopeng; Wang, Xiujuan; Fei, Fei; Zhang, ManCui; Ding, Po; Zhang, Shiwu

2018-06-01

To investigate the molecular mechanism of dihydrocapsaicin (DHC)-induced mild hypothermia in rats, and to compare its protective effect on the central nervous system with that of a conventional method of inducing hypothermia, 24 healthy male Sprague Dawley rats were randomly divided into four groups based on the following conditions: control group, cardiopulmonary resuscitation (CPR) group, body surface cooling group, and DHC group. Tracheal clipping was used to mimic asphyxia arrest. Rats were assessed for their neurological deficit scores. After sacrifice, immunohistochemical staining was used to examine caspase-3 expression in the cerebral cortex and TRPV1 (transient receptor potential vanilloid subfamily, member 1) expression in the hypothalamus. Terminal TdT-mediated dUTP-biotin nick end labeling (TUNEL) staining was used to evaluate cell apoptosis in the cerebral cortex. Furthermore, intracellular Ca 2+ concentration in the hypothalamus and arginine vasopressin (AVP) concentration in ventral septal tissues were also detected in these four groups. Results of our study showed that neurological deficit scores in the DHC group were significantly higher than those in the CPR and body surface cooling groups (p < 0.05). Caspase-3 expression in the cerebral cortex of control group rats was significantly lower than that in other three groups (p < 0.05). Hypothalamic TRPV1 expression, hypothalamic intracellular Ca 2+ concentration, and AVP concentration in the ventral septum in the DHC group were significantly higher than that in the other three groups (p < 0.05). Within these three groups, there were significantly fewer apoptotic cells in the DHC and body surface cooling group rats than in the CPR group rats (p < 0.05). DHC has the neuroprotective effect. DHC induced mild hypothermia and reduces apoptosis through a mechanism whereby DHC activates TRPV1 on hypothalamic cells to cause a large Ca 2+ influx, which alters corresponding physiological

27 CFR 46.237 - Controlled group member.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 27 Alcohol, Tobacco Products and Firearms 2 2014-04-01 2014-04-01 false Controlled group member... Tubes Held for Sale on April 1, 2009 Filing Requirements § 46.237 Controlled group member. If the dealer is a member of a controlled group, but has its own employer identification number, the dealer must...

27 CFR 46.237 - Controlled group member.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 27 Alcohol, Tobacco Products and Firearms 2 2013-04-01 2013-04-01 false Controlled group member... Tubes Held for Sale on April 1, 2009 Filing Requirements § 46.237 Controlled group member. If the dealer is a member of a controlled group, but has its own employer identification number, the dealer must...

The CYP88A cytochrome P450, ent-kaurenoic acid oxidase, catalyzes three steps of the gibberellin biosynthesis pathway

PubMed Central

Helliwell, Chris A.; Chandler, Peter M.; Poole, Andrew; Dennis, Elizabeth S.; Peacock, W. James

2001-01-01

We have shown that ent-kaurenoic acid oxidase, a member of the CYP88A subfamily of cytochrome P450 enzymes, catalyzes the three steps of the gibberellin biosynthetic pathway from ent-kaurenoic acid to GA12. A gibberellin-responsive barley mutant, grd5, accumulates ent-kaurenoic acid in developing grains. Three independent grd5 mutants contain mutations in a gene encoding a member of the CYP88A subfamily of cytochrome P450 enzymes, defined by the maize Dwarf3 protein. Mutation of the Dwarf3 gene gives rise to a gibberellin-responsive dwarf phenotype, but the lesion in the gibberellin biosynthesis pathway has not been identified. Arabidopsis thaliana has two CYP88A genes, both of which are expressed. Yeast strains expressing cDNAs encoding each of the two Arabidopsis and the barley CYP88A enzymes catalyze the three steps of the GA biosynthesis pathway from ent-kaurenoic acid to GA12. Sequence comparison suggests that the maize Dwarf3 locus also encodes ent-kaurenoic acid oxidase. PMID:11172076

Complete genome sequences of two novel autographiviruses infecting a bacterium from the Pseudomonas fluorescens group.

PubMed

Nowicki, Grzegorz; Walkowiak-Nowicka, Karolina; Zemleduch-Barylska, Agata; Mleczko, Anna; Frąckowiak, Patryk; Nowaczyk, Natalia; Kozdrowska, Emilia; Barylski, Jakub

2017-09-01

In this paper, we describe two independent isolates of a new member of the subfamily Autographivirinae, Pseudomonas phage KNP. The type strain (KNP) has a linear, 40,491-bp-long genome with GC content of 57.3%, and 50 coding DNA sequences (CDSs). The genome of the second strain (WRT) contains one CDS less, encodes a significantly different tail fiber protein and is shorter (40,214 bp; GC content, 57.4%). Phylogenetic analysis indicates that both KNP and WRT belong to the genus T7virus. Together with genetically similar Pseudomonas phages (gh-1, phiPSA2, phiPsa17, PPPL-1, shl2, phi15, PPpW-4, UNO-SLW4, phiIBB-PF7A, Pf-10, and Phi-S1), they form a divergent yet coherent group that stands apart from the T7-like viruses (sensu lato). Analysis of the diversity of this group and its relatedness to other members of the subfamily Autographivirinae led us to the conclusion that this group might be considered as a candidate for a new genus.

Multilocus molecular phylogeny of the suckermouth armored catfishes (Siluriformes: Loricariidae) with a focus on subfamily Hypostominae.

PubMed

Lujan, Nathan K; Armbruster, Jonathan W; Lovejoy, Nathan R; López-Fernández, Hernán

2015-01-01

The Neotropical catfish family Loricariidae is the fifth most species-rich vertebrate family on Earth, with over 800 valid species. The Hypostominae is its most species-rich, geographically widespread, and ecomorphologically diverse subfamily. Here, we provide a comprehensive molecular phylogenetic reappraisal of genus-level relationships in the Hypostominae based on our sequencing and analysis of two mitochondrial and three nuclear loci (4293bp total). Our most striking large-scale systematic discovery was that the tribe Hypostomini, which has traditionally been recognized as sister to tribe Ancistrini based on morphological data, was nested within Ancistrini. This required recognition of seven additional tribe-level clades: the Chaetostoma Clade, the Pseudancistrus Clade, the Lithoxus Clade, the 'Pseudancistrus' Clade, the Acanthicus Clade, the Hemiancistrus Clade, and the Peckoltia Clade. Results of our analysis, which included type- and non-type species for every valid genus in Hypostominae, support the reevaluation and restriction of several historically problematic genera, including Baryancistrus, Cordylancistrus, Hemiancistrus, and Peckoltia. Much of the deep lineage diversity in Hypostominae is restricted to Guiana Shield and northern Andean drainages, with three tribe-level clades still largely restricted to the Guiana Shield. Of the six geographically widespread clades, a paraphyletic assemblage of three contain lineages restricted to drainages west of the Andes Mountains, suggesting that early diversification of the Hypostominae predated the late Miocene surge in Andean uplift. Our results also highlight examples of trophic ecological diversification and convergence in the Loricariidae, including support for three independent origins of highly similar and globally unique morphological specializations for eating wood. Copyright © 2014 Elsevier Inc. All rights reserved.

27 CFR 46.237 - Controlled group member.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 27 Alcohol, Tobacco Products and Firearms 2 2012-04-01 2011-04-01 true Controlled group member. 46... Tubes Held for Sale on April 1, 2009 Filing Requirements § 46.237 Controlled group member. If the dealer is a member of a controlled group, but has its own employer identification number, the dealer must...

Functional Analyses of Resurrected and Contemporary Enzymes Illuminate an Evolutionary Path for the Emergence of Exolysis in Polysaccharide Lyase Family 2.

PubMed

McLean, Richard; Hobbs, Joanne K; Suits, Michael D; Tuomivaara, Sami T; Jones, Darryl R; Boraston, Alisdair B; Abbott, D Wade

2015-08-28

Family 2 polysaccharide lyases (PL2s) preferentially catalyze the β-elimination of homogalacturonan using transition metals as catalytic cofactors. PL2 is divided into two subfamilies that have been generally associated with secretion, Mg(2+) dependence, and endolysis (subfamily 1) and with intracellular localization, Mn(2+) dependence, and exolysis (subfamily 2). When present within a genome, PL2 genes are typically found as tandem copies, which suggests that they provide complementary activities at different stages along a catabolic cascade. This relationship most likely evolved by gene duplication and functional divergence (i.e. neofunctionalization). Although the molecular basis of subfamily 1 endolytic activity is understood, the adaptations within the active site of subfamily 2 enzymes that contribute to exolysis have not been determined. In order to investigate this relationship, we have conducted a comparative enzymatic analysis of enzymes dispersed within the PL2 phylogenetic tree and elucidated the structure of VvPL2 from Vibrio vulnificus YJ016, which represents a transitional member between subfamiles 1 and 2. In addition, we have used ancestral sequence reconstruction to functionally investigate the segregated evolutionary history of PL2 progenitor enzymes and illuminate the molecular evolution of exolysis. This study highlights that ancestral sequence reconstruction in combination with the comparative analysis of contemporary and resurrected enzymes holds promise for elucidating the origins and activities of other carbohydrate active enzyme families and the biological significance of cryptic metabolic pathways, such as pectinolysis within the zoonotic marine pathogen V. vulnificus. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Flame-Resistant Composite Materials For Structural Members

NASA Technical Reports Server (NTRS)

Spears, Richard K.

1995-01-01

Matrix-fiber composite materials developed for structural members occasionally exposed to hot, corrosive gases. Integral ceramic fabric surface layer essential for resistance to flames and chemicals. Endures high temperature, impedes flame from penetrating to interior, inhibits diffusion of oxygen to interior where it degrades matrix resin, resists attack by chemicals, helps resist erosion, and provides additional strength. In original intended application, composite members replace steel structural members of rocket-launching structures that deteriorate under combined influences of atmosphere, spilled propellants, and rocket exhaust. Composites also attractive for other applications in which corrosion- and fire-resistant structural members needed.

Managing patients whose family members are physicians.

PubMed

Bramstedt, K A; Popovich, M

2012-01-01

The ethical complexities involving physicians who treat their own family members are well known and it is generally accepted that such practice should not occur. We present three anonymous cases in which patient family members who worked as physicians complicated the medical care of their hospitalized relatives. When a health care worker's family member becomes a hospital patient, the situation can be emotionally charged due to the medical insight the multiple parties have, as well as the desire of relatives to be protective of their family members. Clinician-relatives need to allow the medical team to assume the role of caretaker when their family members are hospitalized. Teams may need to employ limit setting in order to ensure fair and consistent care for all patients on the ward, and to prevent escalation of emotionally charged situations.

Protease-activated receptor 2-mediated protection of myocardial ischemia-reperfusion injury: role of transient receptor potential vanilloid receptors

PubMed Central

Zhong, Beihua

2009-01-01

Activation of the protease-activated receptor 2 (PAR2) or the transient receptor potential vanilloid type 1 (TRPV1) channels expressed in cardiac sensory afferents containing calcitonin gene-related peptide (CGRP) and/or substance P (SP) has been proposed to play a protective role in myocardial ischemia-reperfusion (I/R) injury. However, the interaction between PAR2 and TRPV1 is largely unknown. Using gene-targeted TRPV1-null mutant (TRPV1−/−) or wild-type (WT) mice, we test the hypothesis that TRPV1 contributes to PAR2-mediated cardiac protection via increasing the release of CGRP and SP. Immunofluorescence labeling showed that TRPV1 coexpressed with PAR2, PKC-ε, or PKAc in cardiomyocytes, cardiac blood vessels, and perivascular nerves in WT but not TRPV1−/− hearts. WT or TRPV1−/− hearts were Langendorff perfused with the selective PAR2 agonist, SLIGRL, in the presence or absence of various antagonists, followed by 35 min of global ischemia and 40 min of reperfusion (I/R). The recovery rate of coronary flow, the maximum rate of left ventricular pressure development, left ventricular end-diastolic pressure, and left ventricular developed pressure were evaluated after I/R. SLIGRL improved the recovery of hemodynamic parameters, decreased lactate dehydrogenase release, and reduced the infarct size in both WT and TRPV1−/− hearts (P < 0.05). The protection of SLIGRL was significantly surpassed for WT compared with TRPV1−/− hearts (P < 0.05). CGRP8–37, a selective CGRP receptor antagonist, RP67580, a selective neurokinin-1 receptor antagonist, PKC-ε V1–2, a selective PKC-ε inhibitor, or H-89, a selective PKA inhibitor, abolished SLIGRL protection by inhibiting the recovery of the rate of coronary flow, maximum rate of left ventricular pressure development, and left ventricular developed pressure, and increasing left ventricular end-diastolic pressure in WT but not TRPV1−/− hearts. Radioimmunoassay showed that SLIGRL increased the release

Family Members' Experience With Hospice in Nursing Homes.

PubMed

Gage, L Ashley; Washington, Karla; Oliver, Debra Parker; Kruse, Robin; Lewis, Alexandra; Demiris, George

2016-05-01

Research has documented numerous benefits and challenges associated with receipt of hospice care in nursing homes; however, study of this partnership from the perspective of residents' family members has been limited. The purpose of this qualitative investigation was to explore family members' experience with hospice services received in the nursing home setting. Researchers conducted a secondary data analysis of 175 family member interviews using a thematic analytic approach. Findings highlighted the critical role of communication in supporting residents and their family members. Care coordination, support and oversight, and role confusion also impacted family members' experience of hospice care in the nursing home. Efforts directed at enhancing communication and more clearly articulating the roles of members of the health care team are indicated. © The Author(s) 2014.

Ras and relatives--job sharing and networking keep an old family together.

PubMed

Ehrhardt, Annette; Ehrhardt, Götz R A; Guo, Xuecui; Schrader, John W

2002-10-01

Many members of the Ras superfamily of GTPases have been implicated in the regulation of hematopoietic cells, with roles in growth, survival, differentiation, cytokine production, chemotaxis, vesicle-trafficking, and phagocytosis. The well-known p21 Ras proteins H-Ras, N-Ras, K-Ras 4A, and K-Ras 4B are also frequently mutated in human cancer and leukemia. Besides the four p21 Ras proteins, the Ras subfamily of the Ras superfamily includes R-Ras, TC21 (R-Ras2), M-Ras (R-Ras3), Rap1A, Rap1B, Rap2A, Rap2B, RalA, and RalB. They exhibit remarkable overall amino acid identities, especially in the regions interacting with the guanine nucleotide exchange factors that catalyze their activation. In addition, there is considerable sharing of various downstream effectors through which they transmit signals and of GTPase activating proteins that downregulate their activity, resulting in overlap in their regulation and effector function. Relatively little is known about the physiological functions of individual Ras family members, although the presence of well-conserved orthologs in Caenorhabditis elegans suggests that their individual roles are both specific and vital. The structural and functional similarities have meant that commonly used research tools fail to discriminate between the different family members, and functions previously attributed to one family member may be shared with other members of the Ras family. Here we discuss similarities and differences in activation, effector usage, and functions of different members of the Ras subfamily. We also review the possibility that the differential localization of Ras proteins in different parts of the cell membrane may govern their responses to activation of cell surface receptors.

Elastomeric member for energy storage device

DOEpatents

Hoppie, Lyle O.; Chute, Richard

1985-01-01

An energy storage device (10) is disclosed consisting of a stretched elongated elastomeric member (16), disposed within a tubular housing (14), which elastomeric member (16) is adapted to be torsionally stressed to store energy. The elastomeric member (16) is configured in the relaxed state with a uniform diameter body section, transition end sections, and is attached to rigid end piece assemblies (22, 24) of a lesser diameter. The profile and deflection characteristic of the transition sections (76, 78) are such that upon stretching of the member, a substantially uniform diameter assembly results to minimize the required volume of the surrounding housing (14). During manufacture, woven wire mesh sleeves (26, 28) are forced against a forming surface and bonded to the associated transition section (76, 78) to provide the correct profile and helix angle. Each sleeve (26, 28) contracts with the contraction of the associated transition section to maintain the bond therebetween.

Genome Sequence of an Alphaherpesvirus from a Beluga Whale (Delphinapterus leucas).

PubMed

Davison, Andrew J; Nielsen, Ole; Subramaniam, Kuttichantran; Jacob, Jessica M; Romero, Carlos H; Burek-Huntington, Kathy A; Waltzek, Thomas B

2017-10-19

Beluga whale alphaherpesvirus 1 was isolated from a blowhole swab taken from a juvenile beluga whale. The genome is 144,144 bp in size and contains 86 putative genes. The virus groups phylogenetically with members of the genus Varicellovirus in subfamily Alphaherpesvirinae and is the first alphaherpesvirus sequenced from a marine mammal. Copyright © 2017 Davison et al.