Purification, crystallization and preliminary X-ray diffraction analysis of GatD, a glutamine amidotransferase-like protein from Staphylococcus aureus peptidoglycan

PubMed Central

Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose

2014-01-01

Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726

Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya

2007-11-01

A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less

Crystallization and preliminary X-ray diffraction analysis of central structure domains from mumps virus F protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Yueyong; Xu, Yanhui; Zhu, Jieqing

2005-09-01

Single crystals of the central structure domains from mumps virus F protein have been obtained by the hanging-drop vapour-diffusion method. A diffraction data set has been collected to 2.2 Å resolution. Fusion of members of the Paramyxoviridae family involves two glycoproteins: the attachment protein and the fusion protein. Changes in the fusion-protein conformation were caused by binding of the attachment protein to the cellular receptor. In the membrane-fusion process, two highly conserved heptad-repeat (HR) regions, HR1 and HR2, are believed to form a stable six-helix coiled-coil bundle. However, no crystal structure has yet been determined for this state in themore » mumps virus (MuV, a member of the Paramyxoviridae family). In this study, a single-chain protein consisting of two HR regions connected by a flexible amino-acid linker (named 2-Helix) was expressed, purified and crystallized by the hanging-drop vapour-diffusion method. A complete X-ray data set was obtained in-house to 2.2 Å resolution from a single crystal. The crystal belongs to space group C2, with unit-cell parameters a = 161.2, b = 60.8, c = 40.1 Å, β = 98.4°. The crystal structure will help in understanding the molecular mechanism of Paramyxoviridae family membrane fusion.« less

Crystallization and X-ray diffraction analysis of 6-­aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72

PubMed Central

Ohki, Taku; Mizuno, Nobuhiro; Shibata, Naoki; Takeo, Masahiro; Negoro, Seiji; Higuchi, Yoshiki

2005-01-01

To investigate the structure–function relationship between 6-aminohexanoate-dimer hydrolase (EII) from Arthrobacter sp. and a cryptic protein (EII′) which shows 88% sequence identity to EII, a hybrid protein (named Hyb-24) of EII and EII′ was overexpressed, purified and crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant in MES buffer pH 6.5. The crystal belongs to space group P3121 or P3221, with unit-cell parameters a = b = 96.37, c = 113.09 Å. Diffraction data were collected from native and methylmercuric chloride derivative crystals to resolutions of 1.75 and 1.80 Å, respectively. PMID:16511198

Capillary microextraction: A new method for sampling methamphetamine vapour.

PubMed

Nair, M V; Miskelly, G M

2016-11-01

Clandestine laboratories pose a serious health risk to first responders, investigators, decontamination companies, and the public who may be inadvertently exposed to methamphetamine and other chemicals used in its manufacture. Therefore there is an urgent need for reliable methods to detect and measure methamphetamine at such sites. The most common method for determining methamphetamine contamination at former clandestine laboratory sites is selected surface wipe sampling, followed by analysis with gas chromatography-mass spectrometry (GC-MS). We are investigating the use of sampling for methamphetamine vapour to complement such wipe sampling. In this study, we report the use of capillary microextraction (CME) devices for sampling airborne methamphetamine, and compare their sampling efficiency with a previously reported dynamic SPME method. The CME devices consisted of PDMS-coated glass filter strips inside a glass tube. The devices were used to dynamically sample methamphetamine vapour in the range of 0.42-4.2μgm -3 , generated by a custom-built vapour dosing system, for 1-15min, and methamphetamine was analysed using a GC-MS fitted with a ChromatoProbe thermal desorption unit. The devices showed good reproducibility (RSD<15%), and a curvilinear pre-equilibrium relationship between sampling times and peak area, which can be utilised for calibration. Under identical sampling conditions, the CME devices were approximately 30 times more sensitive than the dynamic SPME method. The CME devices could be stored for up to 3days after sampling prior to analysis. Consecutive sampling of methamphetamine and its isotopic substitute, d-9 methamphetamine showed no competitive displacement. This suggests that CME devices, pre-loaded with an internal standard, could be a feasible method for sampling airborne methamphetamine at former clandestine laboratories. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Atomic origins of water-vapour-promoted alloy oxidation

NASA Astrophysics Data System (ADS)

Luo, Langli; Su, Mao; Yan, Pengfei; Zou, Lianfeng; Schreiber, Daniel K.; Baer, Donald R.; Zhu, Zihua; Zhou, Guangwen; Wang, Yanting; Bruemmer, Stephen M.; Xu, Zhijie; Wang, Chongmin

2018-06-01

The presence of water vapour, intentional or unavoidable, is crucial to many materials applications, such as in steam generators, turbine engines, fuel cells, catalysts and corrosion1-4. Phenomenologically, water vapour has been noted to accelerate oxidation of metals and alloys5,6. However, the atomistic mechanisms behind such oxidation remain elusive. Through direct in situ atomic-scale transmission electron microscopy observations and density functional theory calculations, we reveal that water-vapour-enhanced oxidation of a nickel-chromium alloy is associated with proton-dissolution-promoted formation, migration, and clustering of both cation and anion vacancies. Protons derived from water dissociation can occupy interstitial positions in the oxide lattice, consequently lowering vacancy formation energy and decreasing the diffusion barrier of both cations and anions, which leads to enhanced oxidation in moist environments at elevated temperatures. This work provides insights into water-vapour-enhanced alloy oxidation and has significant implications in other material and chemical processes involving water vapour, such as corrosion, heterogeneous catalysis and ionic conduction.

Atomic origins of water-vapour-promoted alloy oxidation.

PubMed

Luo, Langli; Su, Mao; Yan, Pengfei; Zou, Lianfeng; Schreiber, Daniel K; Baer, Donald R; Zhu, Zihua; Zhou, Guangwen; Wang, Yanting; Bruemmer, Stephen M; Xu, Zhijie; Wang, Chongmin

2018-06-01

The presence of water vapour, intentional or unavoidable, is crucial to many materials applications, such as in steam generators, turbine engines, fuel cells, catalysts and corrosion 1-4 . Phenomenologically, water vapour has been noted to accelerate oxidation of metals and alloys 5,6 . However, the atomistic mechanisms behind such oxidation remain elusive. Through direct in situ atomic-scale transmission electron microscopy observations and density functional theory calculations, we reveal that water-vapour-enhanced oxidation of a nickel-chromium alloy is associated with proton-dissolution-promoted formation, migration, and clustering of both cation and anion vacancies. Protons derived from water dissociation can occupy interstitial positions in the oxide lattice, consequently lowering vacancy formation energy and decreasing the diffusion barrier of both cations and anions, which leads to enhanced oxidation in moist environments at elevated temperatures. This work provides insights into water-vapour-enhanced alloy oxidation and has significant implications in other material and chemical processes involving water vapour, such as corrosion, heterogeneous catalysis and ionic conduction.

Purification, crystallization and preliminary X-ray diffraction studies of UDP-N-acetylglucosamine pyrophosphorylase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi

2006-12-01

UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less

Detecting diffusion-diffraction patterns in size distribution phantoms using double-pulsed field gradient NMR: Theory and experiments.

PubMed

Shemesh, Noam; Ozarslan, Evren; Basser, Peter J; Cohen, Yoram

2010-01-21

NMR observable nuclei undergoing restricted diffusion within confining pores are important reporters for microstructural features of porous media including, inter-alia, biological tissues, emulsions and rocks. Diffusion NMR, and especially the single-pulsed field gradient (s-PFG) methodology, is one of the most important noninvasive tools for studying such opaque samples, enabling extraction of important microstructural information from diffusion-diffraction phenomena. However, when the pores are not monodisperse and are characterized by a size distribution, the diffusion-diffraction patterns disappear from the signal decay, and the relevant microstructural information is mostly lost. A recent theoretical study predicted that the diffusion-diffraction patterns in double-PFG (d-PFG) experiments have unique characteristics, such as zero-crossings, that make them more robust with respect to size distributions. In this study, we theoretically compared the signal decay arising from diffusion in isolated cylindrical pores characterized by lognormal size distributions in both s-PFG and d-PFG methodologies using a recently presented general framework for treating diffusion in NMR experiments. We showed the gradual loss of diffusion-diffraction patterns in broadening size distributions in s-PFG and the robustness of the zero-crossings in d-PFG even for very large standard deviations of the size distribution. We then performed s-PFG and d-PFG experiments on well-controlled size distribution phantoms in which the ground-truth is well-known a priori. We showed that the microstructural information, as manifested in the diffusion-diffraction patterns, is lost in the s-PFG experiments, whereas in d-PFG experiments the zero-crossings of the signal persist from which relevant microstructural information can be extracted. This study provides a proof of concept that d-PFG may be useful in obtaining important microstructural features in samples characterized by size distributions.

Fine Structure of Diffuse Scattering Rings in Al-Li-Cu Quasicrystal: A Comparative X-ray and Electron Diffraction Study

NASA Astrophysics Data System (ADS)

Donnadieu, P.; Dénoyer, F.

1996-11-01

A comparative X-ray and electron diffraction study has been performed on Al-Li-Cu icosahedral quasicrystal in order to investigate the diffuse scattering rings revealed by a previous work. Electron diffraction confirms the existence of rings but shows that the rings have a fine structure. The diffuse aspect on the X-ray diffraction patterns is then due to an averaging effect. Recent simulations based on the model of canonical cells related to the icosahedral packing give diffractions patterns in agreement with this fine structure effect. Nous comparons les diagrammes de diffraction des rayon-X et des électrons obtenus sur les mêmes échantillons du quasicristal icosaèdrique Al-Li-Cu. Notre but est d'étudier les anneaux de diffusion diffuse mis en évidence par un travail précédent. Les diagrammes de diffraction électronique confirment la présence des anneaux mais ils montrent aussi que ces anneaux possèdent une structure fine. L'aspect diffus des anneaux révélés par la diffraction des rayons X est dû à un effet de moyenne. Des simulations récentes basées sur la décomposition en cellules canoniques de l'empilement icosaédrique produisent des diagrammes de diffraction en accord avec ces effects de structure fine.

Real-time fluorescence quenching-based detection of nitro-containing explosive vapours: what are the key processes?

PubMed

Shaw, P E; Burn, P L

2017-11-15

The detection of explosives continues to be a pressing global challenge with many potential technologies being pursued by the scientific research community. Luminescence-based detection of explosive vapours with an organic semiconductor has attracted much interest because of its potential for detectors that have high sensitivity, compact form factor, simple operation and low-cost. Despite the abundance of literature on novel sensor materials systems there are relatively few mechanistic studies targeted towards vapour-based sensing. In this Perspective, we will review the progress that has been made in understanding the processes that control the real-time luminescence quenching of thin films by analyte vapours. These are the non-radiative quenching process by which the sensor exciton decays, the analyte-sensor intermolecular binding interaction, and the diffusion process for the analyte vapours in the film. We comment on the contributions of each of these processes towards the sensing response and, in particular, the relative roles of analyte diffusion and exciton diffusion. While the latter has been historically judged to be one of, if not the primary, causes for the high sensitivity of many conjugated polymers to nitrated vapours, recent evidence suggests that long exciton diffusion lengths are unnecessary. The implications of these results on the development of sensor materials for real-time detection are discussed.

Alcohol vapours sensor based on thin polyaniline salt film and quartz crystal microbalance.

PubMed

Ayad, Mohamad M; Torad, Nagy L

2009-06-15

A sensor based on the quartz crystal microbalance (QCM) technique was developed for detection of a number of primary aliphatic alcohols such as ethanol, methanol, 1-propanol, and 2-propanol vapours. Detection was based on a sensitive and a thin film of polyaniline, emeraldine salt (ES), coated the QCM electrode. The frequency shifts (Delta f) of the QCM were increased due to the vapour absorption into the ES film. The values of Delta f were found to be linearly correlated with the concentrations of alcohols vapour in mg L(-1). The changes in frequency are due to the hydrophilic character of the ES and the electrostatic interaction as well as the type of the alcohol. The sensor shows a good reproducibility and reversibility. The diffusion and diffusion coefficient (D) of different alcohols vapour were determined. It was found that the sensor follows Fickian kinetics.

Purification, crystallization and preliminary X-ray diffraction of the C-terminal bromodomain from human BRD2

PubMed Central

Umehara, Takashi; Wakamori, Masatoshi; Tanaka, Akiko; Padmanabhan, Balasundaram; Yokoyama, Shigeyuki

2007-01-01

BRD2 is a bromodomain-containing BET-family protein that associates with acetylated histones throughout the cell cycle. Although the tertiary structures of the bromodomains involved in histone acetyl transfer are already known, the structures of the BET-type bromodomains, which are required for tight association with acetylated chromatin, are poorly understood. Here, the expression, purification and crystallization of the C-terminal bromodomain of human BRD2 are reported. The protein was crystallized by the sitting-drop vapour-diffusion method in the orthorhombic space group P21212, with unit-cell parameters a = 71.78, b = 52.60, c = 32.06 Å and one molecule per asymmetric unit. The crystal diffracted beyond 1.80 Å resolution using synchrotron radiation. PMID:17620725

Recombinant expression, purification, crystallization and preliminary X-ray diffraction analysis of the C-terminal DUF490(963-1138) domain of TamB from Escherichia coli.

PubMed

Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel

2014-09-01

TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.

Crystallization and preliminary X-ray diffraction analysis of mouse 3(17)α-hydroxysteroid dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin

2005-07-01

Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less

Preliminary X-ray diffraction analysis of a thermophilic β-1,3-1,4-glucanase from Clostridium thermocellum.

PubMed

Zhang, Lilan; Zhao, Puya; Chen, Chun-Chi; Huang, Chun-Hsiang; Ko, Tzu-Ping; Zheng, Yingying; Guo, Rey-Ting

2014-07-01

β-1,3-1,4-Glucanases catalyze the specific hydrolysis of internal β-1,4-glycosidic bonds adjacent to the 3-O-substituted glucose residues in mixed-linked β-glucans. The thermophilic glycoside hydrolase CtGlu16A from Clostridium thermocellum exhibits superior thermal profiles, high specific activity and broad pH adaptability. Here, the catalytic domain of CtGlu16A was expressed in Escherichia coli, purified and crystallized in the trigonal space group P3121, with unit-cell parameters a=b=74.5, c=182.9 Å, by the sitting-drop vapour-diffusion method and diffracted to 1.95 Å resolution. The crystal contains two protein molecules in an asymmetric unit. Further structural determination and refinement are in progress.

Measurement and Interpretation of Diffuse Scattering in X-Ray Diffraction for Macromolecular Crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wall, Michael E.

X-ray diffraction from macromolecular crystals includes both sharply peaked Bragg reflections and diffuse intensity between the peaks. The information in Bragg scattering reflects the mean electron density in the unit cells of the crystal. The diffuse scattering arises from correlations in the variations of electron density that may occur from one unit cell to another, and therefore contains information about collective motions in proteins.

A comparison between protein crystals grown with vapor diffusion methods in microgravity and protein crystals using a gel liquid-liquid diffusion ground-based method

NASA Technical Reports Server (NTRS)

Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.

1992-01-01

Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.

Spectral methods in edge-diffraction theories

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arnold, J.M.

Spectral methods for the construction of uniform asymptotic representations of the field diffracted by an aperture in a plane screen are reviewed. These are separated into contrasting approaches, roughly described as physical and geometrical. It is concluded that the geometrical methods provide a direct route to the construction of uniform representations that are formally identical to the equivalent-edge-current concept. Some interpretive and analytical difficulties that complicate the physical methods of obtaining uniform representations are analyzed. Spectral synthesis proceeds directly from the ray geometry and diffraction coefficients, without any intervening current representation, and the representation is uniform at shadow boundaries andmore » caustics of the diffracted field. The physical theory of diffraction postulates currents on the diffracting screen that give rise to the diffracted field. The difficulties encountered in evaluating the current integrals are throughly examined, and it is concluded that the additional data provided by the physical theory of diffraction (diffraction coefficients off the Keller diffraction cone) are not actually required for obtaining uniform asymptotics at the leading order. A new diffraction representation that generalizes to arbitrary plane-convex apertures a formula given by Knott and Senior [Proc. IEEE 62, 1468 (1974)] for circular apertures is deduced. 34 refs., 1 fig.« less

Crystallization and preliminary X-ray diffraction study of thermostable RNase HIII from Bacillus stearothermophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chon, Hyongi; Matsumura, Hiroyoshi; Koga, Yuichi

2005-03-01

A thermostable ribonuclease HIII from B. stearothermophilus (Bst RNase HIII) was crystallized and preliminary crystallographic studies were performed. Plate-like overlapping polycrystals were grown by the sitting-drop vapour-diffusion method at 283 K.

Prediction and validation of diffusion coefficients in a model drug delivery system using microsecond atomistic molecular dynamics simulation and vapour sorption analysis.

PubMed

Forrey, Christopher; Saylor, David M; Silverstein, Joshua S; Douglas, Jack F; Davis, Eric M; Elabd, Yossef A

2014-10-14

Diffusion of small to medium sized molecules in polymeric medical device materials underlies a broad range of public health concerns related to unintended leaching from or uptake into implantable medical devices. However, obtaining accurate diffusion coefficients for such systems at physiological temperature represents a formidable challenge, both experimentally and computationally. While molecular dynamics simulation has been used to accurately predict the diffusion coefficients, D, of a handful of gases in various polymers, this success has not been extended to molecules larger than gases, e.g., condensable vapours, liquids, and drugs. We present atomistic molecular dynamics simulation predictions of diffusion in a model drug eluting system that represent a dramatic improvement in accuracy compared to previous simulation predictions for comparable systems. We find that, for simulations of insufficient duration, sub-diffusive dynamics can lead to dramatic over-prediction of D. We present useful metrics for monitoring the extent of sub-diffusive dynamics and explore how these metrics correlate to error in D. We also identify a relationship between diffusion and fast dynamics in our system, which may serve as a means to more rapidly predict diffusion in slowly diffusing systems. Our work provides important precedent and essential insights for utilizing atomistic molecular dynamics simulations to predict diffusion coefficients of small to medium sized molecules in condensed soft matter systems.

Novel method for water vapour monitoring using wireless communication networks measurements

NASA Astrophysics Data System (ADS)

David, N.; Alpert, P.; Messer, H.

2009-04-01

We propose a new technique for monitoring near-surface water vapour, by estimating humidity from data collected through existing wireless communication networks. Water vapour plays a crucial part in a variety of atmospheric processes. As the most influential of greenhouse gases, it absorbs long-wave terrestrial radiation. The water vapour cycle of evaporation and recondensation is a major energy redistributing mechanism transferring heat energy from the Earth's surface to the atmosphere. Additionally, humidity has an important role in weather forecasting as a key variable required for initialization of atmospheric models and hazard warning techniques. However, current methods of monitoring humidity suffer from low spatial resolution, high cost or a lack of precision when measuring near ground levels. Weather conditions and atmospheric phenomena affect the electromagnetic channel, causing attenuations to the radio signals. Thus, wireless communication networks are in effect built-in environmental monitoring facilities. The wireless microwave links, used in these networks, are widely deployed by cellular providers for backhaul communication between base stations, a few tens of meters above ground level. As a result, the proposed method can provide moisture observations at high temporal and spatial resolution. Further, the implementation cost is minimal, since the data used is already collected and saved by the cellular operators. In addition - many of these links are installed in areas where access is difficult such as orographic terrain and complex topography. As such, our method enables measurements in places that have been hard to measure in the past, or have never been measured before. The technique is restricted to weather conditions which include absence of rain, fog or clouds along the propagation path. We present results from real-data measurements taken from microwave links used in a backhaul cellular network that show very good agreement with surface

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, from Sphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtained P3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding using P3 121/P3 2 21 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space group P2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c = 128.1 Å. The P2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing themore » cryoconditions. Phasing using the single anomalous diffraction method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Crystallization and preliminary X-ray diffraction analysis of the lectin from Dioclea rostrata Benth seeds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago

2006-02-01

D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less

A novel grating-imaging method to measure carrier diffusion coefficient in graphene

NASA Astrophysics Data System (ADS)

Chen, Ke; Wang, Yaguo; Akinwande, Deji; Bank, Seth; Lin, Jung-Fu

Similar to carrier mobility, carrier diffusion coefficient in graphene determines the response rate of future graphene-based electronics. Here we present a simple, sensitive and non-destructive technique integrated with ultrafast pump-probe spectroscopy to measure carrier diffusion in CVD-grown graphene. In the method, the pump and the probe beams pass through the same area of a photomask with metal strips i.e. a transmission amplitude grating, and get diffracted. The diffracted light is collected by an objective lens and focused onto the sample to generate carrier density grating. Relaxation of this carrier density grating is governed by both carrier recombination and carrier diffusion in the sample. Transient transmission change of the probe beams, which reflects this relaxation process, is recorded. The measured diffusion coefficients of multilayer and monolayer CVD-grown graphene are 2000cm2/s and 10000cm2/s, respectively, comparable with the reported values of epitaxial graphene and reduced graphene. This transmission grating technique can be used to measure carrier dynamics in versatile 2D materials.

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin.

PubMed

Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S

2014-11-01

Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

Crystallization and preliminary X-ray diffraction studies of the ferredoxin reductase component in the Rieske nonhaem iron oxygenase system carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui

2007-06-01

The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less

Crystallization and preliminary X-ray diffraction analysis of the arginine repressor of the hyperthermophile Thermotoga neapolitana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Massant, Jan, E-mail: jan.massant@vub.ac.be; Peeters, Eveline; Charlier, Daniel

2006-01-01

The arginine repressor of the hyperthermophile T. neapolitana was crystallized with and without its corepressor arginine. Both crystals diffracted to high resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with similar unit-cell parameters. The arginine repressor of Thermotoga neapolitana (ArgRTnp) is a member of the family of multifunctional bacterial arginine repressors involved in the regulation of arginine metabolism. This hyperthermophilic repressor shows unique DNA-binding features that distinguish it from its homologues. ArgRTnp exists as a homotrimeric protein that assembles into hexamers at higher protein concentrations and/or in the presence of arginine. ArgRTnp was crystallized with andmore » without its corepressor arginine using the hanging-drop vapour-diffusion method. Crystals of the aporepressor diffracted to a resolution of 2.1 Å and belong to the orthorhombic P2{sub 1}2{sub 1}2{sub 1} space group, with unit-cell parameters a = 117.73, b = 134.15, c = 139.31 Å. Crystals of the repressor in the presence of its corepressor arginine diffracted to a resolution of 2.4 Å and belong to the same space group, with similar unit-cell parameters.« less

Crystallization and preliminary X-ray diffraction studies of the glutaminyl cyclase from Carica papaya latex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azarkan, Mohamed; Clantin, Bernard; Bompard, Coralie

2005-01-01

The glutaminyl cyclase isolated from C. papaya latex has been crystallized using the hanging-drop method. Diffraction data have been collected at ESRF beamline BM14 and processed to 1.7 Å resolution. In living systems, the intramolecular cyclization of N-terminal glutamine residues is accomplished by glutaminyl cyclase enzymes (EC 2.3.2.5). While in mammals these enzymes are involved in the synthesis of hormonal and neurotransmitter peptides, the physiological role played by the corresponding plant enzymes still remains to be unravelled. Papaya glutaminyl cyclase (PQC), a 33 kDa enzyme found in the latex of the tropical tree Carica papaya, displays an exceptional resistance tomore » chemical and thermal denaturation as well as to proteolysis. In order to elucidate its enzymatic mechanism and to gain insights into the structural determinants underlying its remarkable stability, PQC was isolated from papaya latex, purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 62.82, b = 81.23, c = 108.17 Å and two molecules per asymmetric unit. Diffraction data have been collected at ESRF beamline BM14 and processed to a resolution of 1.7 Å.« less

Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1.

PubMed

Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

2010-07-01

The hyperthermophilic archaeal Rieske-type [2Fe-2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe-2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 A resolution and belonged to the tetragonal space group P4(3)2(1)2, with unit-cell parameters a = 60.72, c = 83.31 A. The asymmetric unit contains one protein molecule.

Purification, partial characterization, crystallization and preliminary X-ray diffraction of a novel cardiotoxin-like basic protein from Naja naja atra (South Anhui) venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rong, Hui; Li, Yan; Lou, Xiao-hua

2007-02-01

A novel cardiotoxin-like basic protein from Naja naja atra was crystallized and diffraction data were collected to 2.35 Å resolution. A novel cardiotoxin-like basic protein was isolated from the venom of the Chinese cobra (Naja naja atra) from the south of Anhui in China. The protein inhibits the expression of vascular endothelial growth factor and basic fibroblast growth factor in human lung cancer cell line H1299 and induces the haemolysis of rabbit erythrocytes under low-lecithin conditions. After a two-step chromatographic purification, the resultant 7 kDa protein was crystallized by the hanging-drop vapour-diffusion method at room temperature. A complete data setmore » was collected to 2.35 Å resolution using an in-house X-ray diffraction system. The crystal belongs to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 43.2, c = 147.9 Å. There are two molecules in the crystallographic asymmetric unit.« less

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny

2006-01-01

Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less

Fluorescence and diffusive wave diffraction tomographic probes in turbid media

NASA Astrophysics Data System (ADS)

Li, Xingde

1998-10-01

Light transport over long distances in tissue-like highly scattering media is well approximated as a diffusive process. Diffusing photons can be used to detect, localize and characterize non-invasively optical inhomogeneities such as tumors and hematomas embedded in thick biological tissue. Most of the contrast relies on the endogenous optical property differences between the inhomogeneities and the surrounding media. Recently exogenous fluorescent contrast agents have been considered as a means to enhance the sensitivity and specificity for tumor detection. In the first part of the thesis (Chapter 2 and 3), a theoretical basis is established for modeling the transport, of fluorescent photons in highly scattering media. Fluorescent Diffuse Photon Density Waves (FDPDW) are used to describe the transport of fluorescent photons. A detailed analysis based upon a practical signal-to-noise model was used to access the utility of the fluorescent method. The analysis reveals that a small heterogeneity, embedded in deep tissue-like turbid media with biologically relevant parameters, and with a practically achievable 5-fold fluorophore concentration contrast, can be detected and localized when its radius is greater than 0.2 cm, and can be characterized when its radius is greater than 0.7 cm. In vivo and preliminary clinical studies demonstrate the feasibility of using FDPDW's for tumor diagnosis. Optical imaging with diffusing photons is challenging. Many of the imaging algorithms developed so far are either fundamentally incorrect as in the case of back- projection approach, or require a huge amount of computational resources and CPU time. In the second part of the thesis (Chapter 4), a fast, K-space diffraction tomographic imaging algorithm based upon spatial angular spectrum analysis is derived and applied. Absolute optical properties of thin inhomogeneities and relative optical properties of spatially extended inhomogeneities are reconstructed within a sub-second time

Crystallization and preliminary X-ray diffraction analysis of P30, the transmembrane domain of pertactin, an autotransporter from Bordetella pertussis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Yanshi; Black, Isobel; Roszak, Aleksander W.

2007-07-01

P30, the transmembrane C-terminal domain of pertactin from B. pertussis has been crystallized after refolding in vitro. Preliminary X-ray crystallographic data are reported. P30, the 32 kDa transmembrane C-terminal domain of pertactin from Bordetella pertussis, is supposed to form a β-barrel inserted into the outer membrane for the translocation of the passenger domain. P30 was cloned and expressed in inclusion bodies in Escherichia coli. After refolding and purification, the protein was crystallized using the sitting-drop vapour-diffusion method at 292 K. The crystals diffract to a resolution limit of 3.5 Å using synchrotron radiation and belong to the hexagonal space groupmore » P6{sub 1}22, with unit-cell parameters a = b = 123.27, c = 134.43 Å.« less

Improving and assessing vapour pressure estimation methods for organic compounds of atmospheric relevance using a Knudsen Effusion Mass Spectrometer (KEMS)

NASA Astrophysics Data System (ADS)

Booth, A. M.; Topping, D. O.; McFiggans, G. B.; Garforth, A.; Percival, C. J.

2009-12-01

Aerosol particles influence climate directly through the scattering and absorbing radiation and indirectly through their role as cloud condensation nuclei (CCN). Traditionally, models aiming to capture the behaviour of aerosols in the atmosphere have concentrated on the role of inorganic compounds. However, organic components, covering a huge range of chemical and physical properties (Jacobson et.al., 2000), may constitute a significant fraction depending on location (Houghton et.al., 2001). Knowledge of pure component vapour pressures is essential for calculations of gas/particle partitioning. There are many methods of estimating vapour pressures but most of the experimental data collected to date has been for intermediate or high pressure compounds (and often measured at temperatures considerably above ambient) and the proportion of experimental data for low (less than 100Pa) vapour pressure compounds has been very small. Hence the datasets used for developing the estimation methods have reflected this bias in addition to the fact that components studied tend to have one or two functional groups at the most. Thus it is unsurprising that some of the estimation methods can give errors in vapour pressure of several orders of magnitude for multifunctional compounds at ambient temperatures. Knudsen Effusion Mass Spectrometer (KEMS) has been used to measure solid state vapour pressures for multifunctional organic compounds based on dicarboxylic acids (Booth et al 2009). In the atmosphere these compounds are likely to exist in the sub-cooled state so Differential Scanning Calorimetry (DSC) was used to obtain thermochemical data to effect a correction between solid and sub-cooled vapour pressures. The group contribution method of Nanoolal and co-workers (Nanoolal et al., 2008) is one of the best predictive methods in terms of reproducing available low volatility vapour pressure data (barley et al., 2009). The Nanoolal method relies on the use of primary and secondary

Relative contributions of scattering, diffraction and modal diffusion to focal ratio degradation in optical fibres

NASA Astrophysics Data System (ADS)

Haynes, D. M.; Withford, M. J.; Dawes, J. M.; Lawrence, J. S.; Haynes, R.

2011-06-01

Focal ratio degradation (FRD) is a major contributor to light loss in astronomical instruments employing multimode optical fibres. We present a powerful diagnostic model that uniquely quantifies the various sources of FRD in multimode fibres. There are three main phenomena that can contribute to FRD: scattering, diffraction and modal diffusion. We propose a Voigt FRD model where the diffraction and modal diffusion are modelled by the Gaussian component and the end-face scattering is modelled by the Lorentzian component. The Voigt FRD model can be deconvolved into its Gaussian and Lorentzian components and used to analyse the contribution of each of the three major components. We used the Voigt FRD model to analyse the FRD of modern astronomical grade fibre for variations in (i) end-face surface roughness, (ii) wavelength, (iii) fibre length and (iv) external fibre stress. The elevated FRD we observed was mostly due to external factors, i.e. fibre end effects such as surface roughness, subsurface damage and environmentally induced microbending caused by the epoxy, ferrules and fibre cable design. The Voigt FRD model has numerous applications such as a diagnostic tool for current fibre instrumentation that show elevated FRD, as a quality control method for fibre manufacture and fibre cable assembly and as a research and development tool for the characterization of new fibre technologies.

Expression, purification and crystallization of a human protein SH3BGRL at atomic resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yin, Lei; Zhu, De-Yu; Yang, Na

2005-04-01

The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The crystals diffract to 0.88 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 28.8886, b = 34.9676, c = 98.0016 Å. Preliminary analysis indicates that the asymmetric unit contains one molecule and has a solvent content of about 34%.

Crystallization and preliminary X-ray diffraction analysis of FabG from Yersinia pestis.

PubMed

Nanson, Jeffrey David; Forwood, Jade Kenneth

2014-01-01

The type II fatty-acid biosynthesis pathway of bacteria provides enormous potential for antibacterial drug development owing to the structural differences between this and the type I fatty-acid biosynthesis system found in mammals. β-Ketoacyl-ACP reductase (FabG) is responsible for the reduction of the β-ketoacyl group linked to acyl carrier protein (ACP), and is essential for the formation of fatty acids and bacterial survival. Here, the cloning, expression, purification, crystallization and diffraction of FabG from Yersinia pestis (ypFabG), the highly virulent causative agent of plague, are reported. Recombinant FabG was expressed, purified to homogeneity and crystallized via the hanging-drop vapour-diffusion technique. Diffraction data were collected at the Australian Synchrotron to 2.30 Å resolution. The crystal displayed P2(1)2(1)2(1) symmetry, with unit-cell parameters a = 68.22, b = 98.68, c = 169.84 Å, and four ypFabG molecules in the asymmetric unit.

Crystallization and X-ray diffraction analysis of an l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii and a d-xylonate dehydratase from Caulobacter crescentus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahman, Mohammad Mubinur; Andberg, Martina; Koivula, Anu

l-Arabinonate dehydratase and d-xylonate dehydratase from the IlvD/EDD family were crystallized by the vapour-diffusion method. Diffraction data sets were collected to resolutions of 2.40 and 2.66 Å from crystals of l-arabinonate dehydratase and d-xylonate dehydratase, respectively. l-Arabinonate dehydratase (EC 4.2.1.25) and d-xylonate dehydratase (EC 4.2.1.82) are two enzymes that are involved in a nonphosphorylative oxidation pathway of pentose sugars. l-Arabinonate dehydratase converts l-arabinonate into 2-dehydro-3-deoxy-l-arabinonate, and d-xylonate dehydratase catalyzes the dehydration of d-xylonate to 2-dehydro-3-deoxy-d-xylonate. l-Arabinonate and d-xylonate dehydratases belong to the IlvD/EDD family, together with 6-phosphogluconate dehydratases and dihydroxyacid dehydratases. No crystal structure of any l-arabinonate or d-xylonate dehydratasemore » is available in the PDB. In this study, recombinant l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii (RlArDHT) and d-xylonate dehydratase from Caulobacter crescentus (CcXyDHT) were heterologously expressed in Escherichia coli and purified by the use of affinity chromatography followed by gel-filtration chromatography. The purified proteins were crystallized using the hanging-drop vapour-diffusion method at 293 K. Crystals of RlArDHT that diffracted to 2.40 Å resolution were obtained using sodium formate as a precipitating agent. They belonged to space group P2{sub 1}, with unit-cell parameters a = 106.07, b = 208.61, c = 147.09 Å, β = 90.43°. Eight RlArDHT molecules (two tetramers) in the asymmetric unit give a V{sub M} value of 3.2 Å{sup 3} Da{sup −1} and a solvent content of 62%. Crystals of CcXyDHT that diffracted to 2.66 Å resolution were obtained using sodium formate and polyethylene glycol 3350. They belonged to space group C2, with unit-cell parameters a = 270.42, b = 236.13, c = 65.17 Å, β = 97.38°. Four CcXyDHT molecules (a tetramer) in the asymmetric unit give a V

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, fromSphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtainedP3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding usingP3 121/P3 221 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space groupP2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c= 128.1 Å. TheP2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing the cryoconditions. Phasing using the single anomalous diffractionmore » method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1

PubMed Central

Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

2010-01-01

The hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe–2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-­terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 60.72, c = 83.31 Å. The asymmetric unit contains one protein molecule. PMID:20606288

Open-tube diffusion techniques for InP/LnGaAs heterojunctior bipolar transistors

NASA Astrophysics Data System (ADS)

Schuitemaker, P.; Houston, P. A.

1986-11-01

Open-tube diffusion techniques used between 450 and 600° C are described which involve the supply of diffusant from a vapour source (via a solution) and a solid evaporated metal source. Investigations of Zn into InP and InGaAs(P) have been undertaken using both sources. SIMS profile analyses show that in the case of the vapour source the profiles indicate a concentration-dependent diffusion coefficient while the solid source diffusions can be well described by a Gaussian-type profile. The usefulness of the vapour source method has been demonstrated in the fabrication of bipolar transistors which exhibit good d.c. characteristics. The solid source method is limited by the slow diffusion velocity and more gradual profile. The InGaAs(P)/InP materials system has important applications in optical communications and future high speed microwave and switching devices. Useful technologies allied to the introduction of impurities into Si by diffusion, have gradually been emerging for use in the III-V semiconductor family. Closed tube systems1 have been used in order to contain the volatile group V species and prevent surface erosion. In addition, simpler open tube systems2,3 have been developed that maintain a sufficient overpressure of the group V element. Zn and Cd p-dopants have been studied extensively because of the volatility and relatively large diffusion rates in III-V semiconductors. Opentube diffusion into both InP and InGaAs2-6 has been studied but little detail has appeared concerning InGaAs and InGaAsP. In this paper we describe a comprehensive study of the diffusion of Zn into InP and InGaAs(P) using both open-tube vapour source and a Au/Zn/Au evaporated solid source with SiNx acting both as a mask and also an encapsulant to prevent loss of Zn and decomposition of the substrate material. The techniques have been successfully applied to the fabrication of InP/lnGaAs heterojunction bipolar transistors which show good dc characteristics. Reference to InGaAs in

Unambiguous detection of nitrated explosive vapours by fluorescence quenching of dendrimer films

NASA Astrophysics Data System (ADS)

Geng, Yan; Ali, Mohammad A.; Clulow, Andrew J.; Fan, Shengqiang; Burn, Paul L.; Gentle, Ian R.; Meredith, Paul; Shaw, Paul E.

2015-09-01

Unambiguous and selective standoff (non-contact) infield detection of nitro-containing explosives and taggants is an important goal but difficult to achieve with standard analytical techniques. Oxidative fluorescence quenching is emerging as a high sensitivity method for detecting such materials but is prone to false positives--everyday items such as perfumes elicit similar responses. Here we report thin films of light-emitting dendrimers that detect vapours of explosives and taggants selectively--fluorescence quenching is not observed for a range of common interferents. Using a combination of neutron reflectometry, quartz crystal microbalance and photophysical measurements we show that the origin of the selectivity is primarily electronic and not the diffusion kinetics of the analyte or its distribution in the film. The results are a major advance in the development of sensing materials for the standoff detection of nitro-based explosive vapours, and deliver significant insights into the physical processes that govern the sensing efficacy.

Unambiguous detection of nitrated explosive vapours by fluorescence quenching of dendrimer films.

PubMed

Geng, Yan; Ali, Mohammad A; Clulow, Andrew J; Fan, Shengqiang; Burn, Paul L; Gentle, Ian R; Meredith, Paul; Shaw, Paul E

2015-09-15

Unambiguous and selective standoff (non-contact) infield detection of nitro-containing explosives and taggants is an important goal but difficult to achieve with standard analytical techniques. Oxidative fluorescence quenching is emerging as a high sensitivity method for detecting such materials but is prone to false positives—everyday items such as perfumes elicit similar responses. Here we report thin films of light-emitting dendrimers that detect vapours of explosives and taggants selectively—fluorescence quenching is not observed for a range of common interferents. Using a combination of neutron reflectometry, quartz crystal microbalance and photophysical measurements we show that the origin of the selectivity is primarily electronic and not the diffusion kinetics of the analyte or its distribution in the film. The results are a major advance in the development of sensing materials for the standoff detection of nitro-based explosive vapours, and deliver significant insights into the physical processes that govern the sensing efficacy.

Unambiguous detection of nitrated explosive vapours by fluorescence quenching of dendrimer films

PubMed Central

Geng, Yan; Ali, Mohammad A.; Clulow, Andrew J.; Fan, Shengqiang; Burn, Paul L.; Gentle, Ian R.; Meredith, Paul; Shaw, Paul E.

2015-01-01

Unambiguous and selective standoff (non-contact) infield detection of nitro-containing explosives and taggants is an important goal but difficult to achieve with standard analytical techniques. Oxidative fluorescence quenching is emerging as a high sensitivity method for detecting such materials but is prone to false positives—everyday items such as perfumes elicit similar responses. Here we report thin films of light-emitting dendrimers that detect vapours of explosives and taggants selectively—fluorescence quenching is not observed for a range of common interferents. Using a combination of neutron reflectometry, quartz crystal microbalance and photophysical measurements we show that the origin of the selectivity is primarily electronic and not the diffusion kinetics of the analyte or its distribution in the film. The results are a major advance in the development of sensing materials for the standoff detection of nitro-based explosive vapours, and deliver significant insights into the physical processes that govern the sensing efficacy. PMID:26370931

The ESA DUE GlobVapour Project

NASA Astrophysics Data System (ADS)

Schröder, M.; ESA Due Globvapour Project Team

2010-12-01

DUE GlobVapour project is the preparation of recognised data sets and successful concepts that can be used to ensure a sustainable provision of such data from operational entities such as the European Organisation for the Exploitation of Meteorological Satellites (EUMETSAT) Satellite Application Facility (SAF) network. Key scientific questions which GlobVapour data can contribute to are climate monitoring and attribution, assimilation of different water vapour datasets to form a consistent analysis, model process studies, evaluation of in-situ water vapour measurements, validation of climate models and reanalyses, assessing the relationship between water vapour and dynamics, research and development for operational applications and input to atmospheric reanalyses. This presentation will introduce the GlobVapour project and concept as well as the products which are the global total column water vapour (TCWV) time series from a combination of MERIS and SSM/I as well as TCWV data sets derived from the GOME/SCIAMACHY/GOME-2 and the (A)ATSR instruments. A shorter time series of water vapour profiles will be derived from a combination of IASI and SEVIRI. The retrieval and combination methods as well as first validation results will also be discussed.

Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

2008-04-01

Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

Crystallization and preliminary X-ray diffraction analysis of hemextin A: a unique anticoagulant protein from Hemachatus haemachatus venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Yajnavalka; Kumar, Sundramurthy; Jobichen, Chacko

2007-08-01

Crystals of hemextin A, a three-finger toxin isolated and purified from African Ringhals cobra (H. haemachatus), are orthorhombic, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å, and diffract to 1.5 Å resolution. Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapour-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1more » M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å and two molecules in the asymmetric unit. They diffracted to 1.5 Å resolution at beamline X25 at BNL.« less

Studies on Aspirin Crystals Generated by a Modified Vapor Diffusion Method.

PubMed

Mittal, Amit; Malhotra, Deepak; Jain, Preeti; Kalia, Anupama; Shunmugaperumal, Tamilvanan

2016-08-01

The objectives of the current investigation were (1) to study the influence of selected two different non-solvents (diethylether and dichloromethane) on the drug crystal formation of a model drug, aspirin (ASP-I) by the modified vapor diffusion method and (2) to characterize and compare the generated crystals (ASP-II and ASP-III) using different analytical techniques with that of unprocessed ASP-I. When compared to the classical vapor diffusion method which consumes about 15 days to generate drug crystals, the modified method needs only 12 h to get the same. Fourier transform-infrared spectroscopy (FT-IR) reveals that the internal structures of ASP-II and ASP-III crystals were identical when compared with ASP-I. Although the drug crystals showed a close similarity in X-ray diffraction patterns, the difference in the relative intensities of some of the diffraction peaks (especially at 2θ values of around 7.7 and 15.5) could be attributed to the crystal habit or crystal size modification. Similarly, the differential scanning calorimetry (DSC) study speculates that only the crystal habit modifications might occur but without involving any change in internal structure of the generated drug polymorphic form I. This is further substantiated from the scanning electron microscopy (SEM) pictures that indicated the formation of platy shape for the ASP-II crystals and needle shape for the ASP-III crystals. In addition, the observed slow dissolution of ASP crystals should indicate polymorph form I formation. Thus, the modified vapor diffusion method could routinely be used to screen and legally secure all possible forms of other drug entities too.

Towards outperforming conventional sensor arrays with fabricated individual photonic vapour sensors inspired by Morpho butterflies

PubMed Central

Potyrailo, Radislav A.; Bonam, Ravi K.; Hartley, John G.; Starkey, Timothy A.; Vukusic, Peter; Vasudev, Milana; Bunning, Timothy; Naik, Rajesh R.; Tang, Zhexiong; Palacios, Manuel A.; Larsen, Michael; Le Tarte, Laurie A.; Grande, James C.; Zhong, Sheng; Deng, Tao

2015-01-01

Combining vapour sensors into arrays is an accepted compromise to mitigate poor selectivity of conventional sensors. Here we show individual nanofabricated sensors that not only selectively detect separate vapours in pristine conditions but also quantify these vapours in mixtures, and when blended with a variable moisture background. Our sensor design is inspired by the iridescent nanostructure and gradient surface chemistry of Morpho butterflies and involves physical and chemical design criteria. The physical design involves optical interference and diffraction on the fabricated periodic nanostructures and uses optical loss in the nanostructure to enhance the spectral diversity of reflectance. The chemical design uses spatially controlled nanostructure functionalization. Thus, while quantitation of analytes in the presence of variable backgrounds is challenging for most sensor arrays, we achieve this goal using individual multivariable sensors. These colorimetric sensors can be tuned for numerous vapour sensing scenarios in confined areas or as individual nodes for distributed monitoring. PMID:26324320

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jagadeesan, G.; Malathy, P.; Gunasekaran, K.

2014-10-25

The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less

Crystallization and preliminary X-ray diffraction analyses of the redox-controlled complex of terminal oxygenase and ferredoxin components in the Rieske nonhaem iron oxygenase carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsuzawa, Jun; Aikawa, Hiroki; Umeda, Takashi

2014-09-25

A crystal was obtained of the complex between reduced terminal oxygenase and oxidized ferredoxin components of carbazole 1,9a-dioxygenase. The crystal belonged to space group P2{sub 1} and diffracted to 2.25 Å resolution. The initial reaction in bacterial carbazole degradation is catalyzed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase (Oxy), ferredoxin (Fd) and ferredoxin reductase components. The electron-transfer complex between reduced Oxy and oxidized Fd was crystallized at 293 K using the hanging-drop vapour-diffusion method with PEG 3350 as the precipitant under anaerobic conditions. The crystal diffracted to a maximum resolution of 2.25 Å and belonged to space group P2{submore » 1}, with unit-cell parameters a = 97.3, b = 81.6, c = 116.2 Å, α = γ = 90, β = 100.1°. The V{sub M} value is 2.85 Å{sup 3} Da{sup −1}, indicating a solvent content of 56.8%.« less

Visible diffraction from quasi-crystalline arrays of carbon nanotubes

NASA Astrophysics Data System (ADS)

Butler, Timothy P.; Butt, Haider; Wilkinson, Timothy D.; Amaratunga, Gehan A. J.

2015-08-01

Large area arrays of vertically-aligned carbon nanotubes (VACNTs) are patterned in a quasi-crystalline Penrose tile arrangement through electron beam lithography definition of Ni catalyst dots and subsequent nanotube growth by plasma-enhanced chemical vapour deposition. When illuminated with a 532 nm laser beam high-quality and remarkable diffraction patterns are seen. The diffraction is well matched to theoretical calculations which assume apertures to be present at the location of the VACNTs for transmitted light. The results show that VACNTs act as diffractive elements in reflection and can be used as spatially phased arrays for producing tailored diffraction patterns.

Water Vapour Effects in Mass Measurement

NASA Astrophysics Data System (ADS)

Khélifa, N.

2008-01-01

Water vapour density inside the mass comparator enclosure is a critical parameter whose fluctuations during mass weighing can lead to errors in the determination of an unknown mass. To monitor them, a method using DFB laser diode in the near infrared has been proposed and tested. Preliminary results of our observation of water vapour sorption and de-sorption processes from the walls and the mass standard are reported.

Optical second-harmonic diffraction study of anisotropic surface diffusion: CO on Ni(110)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, X.; Zhu, X.D.; Daum, W.

We describe in detail a technique using optical second-harmonic (SH) diffraction from a one-dimensional laser-induced monolayer grating to probe surface diffusion of adsorbates and its anisotropy on a solid surface. The case of CO on Ni(110) is used as a demonstration. The two orthogonal and independent diffusion tensor components along (1{bar 1}0) and (001) are measured, exhibiting a strong anisotropy in both the activation energy {ital E}{sub diff} and the preexponential factor {ital D}{sub 0} in the diffusion coefficients. A compensation effect between {ital E}{sub diff} and {ital D}{sub 0} is observed. In comparison with CO/Ni(111) and CO/Ni(100), our resultmore » suggests that the Ni(110) surface seen by CO is much smoother than Ni(111) and Ni(100). Both advantages and limitations of the present technique are mentioned and possible complications in the data analysis are discussed.« less

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the pectin methylesterase from the sugar cane weevil Sphenophorus levis.

PubMed

Evangelista, Danilo Elton; Schutzer de Godoy, Andre; Fonseca Pereira de Paula, Fernando; Henrique-Silva, Flavio; Polikarpov, Igor

2014-03-01

Pectin methylesterase removes the methyl groups from the main chain of pectin, the major component of the middle lamella of the plant cell wall. The enzyme is involved in plant cell-wall development, is part of the enzymatic arsenal used by microorganisms to attack plants and also has a wide range of applications in the industrial sector. Therefore, there is a considerable interest in studies of the structure and function of this enzyme. In this work, the pectin methylesterase from Sphenophorus levis was produced in Pichia pastoris and purified. Crystals belonging to the monoclinic space group C2, with unit-cell parameters a = 122.181, b = 82.213, c = 41.176 Å, β = 97.48°, were obtained by the sitting-drop vapour-diffusion method and an X-ray diffraction data set was collected to 2.1 Å resolution. Structure refinement and model building are in progress.

Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

PubMed

Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

2009-09-01

Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

Room temperature deposition of gold onto the diffuse and sharp diffraction spot Si(111)-( 3 × 3) R30° Au surfaces

NASA Astrophysics Data System (ADS)

Plass, Richard; Marks, Laurence D.

1996-06-01

Room temperature gold depositions onto Si(111)-( 3 × 3) R30° Au surfaces with diffuse and sharp diffraction spots [Surf. Sci. 242 (1991) 73] (diffuse and sharp 3 × 3 Au hereafter) under UHV conditions has been monitored using transmission electron diffraction (TED). Both systems display an increase in surface structure diffraction spot intensities up to the completion of 1.0 monolayer (ML) after which the surface beams display an exponential decrease in intensity with coverage. The exponential decay rate decreases after roughly 1.33 ML. These results can be attributed to gold initially diffusing to and filling 3 × 3 Au gold trimer sites in vacancy type surface domain walls [Surf. Sci. 342 (1995) 233], then filling one of three possible sites on the 3 × 3 Au structure with essentially no surface diffusion, disrupting nearby gold trimers. Gold deposition onto the diffuse type structure caused the formation and expansion of satellite arcs around the strongest 3 × 3 beams similar to those seen by others [Surf. Sci. 242 (1991) 73; Jpn. J. Appl. Phys. 16 (1977) 891; J. Vac. Sci. Technol. A 10 (1992) 3486] at elevated temperatures while the sharp structure displayed only a modest shoulder formation near the strongest 3 × 3 beams.

Common arc method for diffraction pattern orientation.

PubMed

Bortel, Gábor; Tegze, Miklós

2011-11-01

Very short pulses of X-ray free-electron lasers opened the way to obtaining diffraction signal from single particles beyond the radiation dose limit. For three-dimensional structure reconstruction many patterns are recorded in the object's unknown orientation. A method is described for the orientation of continuous diffraction patterns of non-periodic objects, utilizing intensity correlations in the curved intersections of the corresponding Ewald spheres, and hence named the common arc orientation method. The present implementation of the algorithm optionally takes into account Friedel's law, handles missing data and is capable of determining the point group of symmetric objects. Its performance is demonstrated on simulated diffraction data sets and verification of the results indicates a high orientation accuracy even at low signal levels. The common arc method fills a gap in the wide palette of orientation methods. © 2011 International Union of Crystallography

Modelling the Effect of Fruit Growth on Surface Conductance to Water Vapour Diffusion

PubMed Central

GIBERT, CAROLINE; LESCOURRET, FRANÇOISE; GÉNARD, MICHEL; VERCAMBRE, GILLES; PÉREZ PASTOR, ALEJANDRO

2005-01-01

• Background and Aims A model of fruit surface conductance to water vapour diffusion driven by fruit growth is proposed. It computes the total fruit conductance by integrating each of its components: stomata, cuticle and cracks. • Methods The stomatal conductance is computed from the stomatal density per fruit and the specific stomatal conductance. The cuticular component is equal to the proportion of cuticle per fruit multiplied by its specific conductance. Cracks are assumed to be generated when pulp expansion rate exceeds cuticle expansion rate. A constant percentage of cracks is assumed to heal each day. The proportion of cracks to total fruit surface area multiplied by the specific crack conductance accounts for the crack component. The model was applied to peach fruit (Prunus persica) and its parameters were estimated from field experiments with various crop load and irrigation regimes. • Key Results The predictions were in good agreement with the experimental measurements and for the different conditions (irrigation and crop load). Total fruit surface conductance decreased during early growth as stomatal density, and hence the contribution of the stomatal conductance, decreased from 80 to 20 % with fruit expansion. Cracks were generated for fruits exhibiting high growth rates during late growth and the crack component could account for up to 60 % of the total conductance during the rapid fruit growth. The cuticular contribution was slightly variable (around 20 %). Sensitivity analysis revealed that simulated conductance was highly affected by stomatal parameters during the early period of growth and by both crack and stomatal parameters during the late period. Large fruit growth rate leads to earlier and greater increase of conductance due to higher crack occurrence. Conversely, low fruit growth rate accounts for a delayed and lower increase of conductance. • Conclusions By predicting crack occurrence during fruit growth, this model could be helpful

Crystallization and initial X-ray analysis of polyhydroxyalkanoate granule-associated protein from Aeromonas hydrophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Minglian; Li, Zhenguo; Zheng, Wei

The phasin PhaP{sub Ah} from A. hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Polyhydroxyalkanoate (PHA) granule-associated proteins (phasins) were discovered in PHA-accumulating bacteria. They play a crucial role as a structural protein during initial PHA-granule formation and granule growth and also serve as interfaces for granule stabilization in vivo. The phasin PhaP{sub Ah} from Aeromonas hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Single crystals were cryocooled for X-ray diffraction analysis. The phasin crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 80.8, b = 108.9, c = 134.4 Å.

Characterization of sorption properties of selected soils from Lublin region by using water vapour adsorption method

NASA Astrophysics Data System (ADS)

Skic, Kamil; Boguta, Patrycja; Sokołowska, Zofia

2016-04-01

*The studies were carried out within the framework of a research project. The project was financed from funds of National Science Center on the base of decision number DEC-2013/11/D/NZ9/02545 Among many methods proposed to study sorption properties of soils an analysis of adsorption/ desorption isotherm is probably the easiest and most convenient one. It characterizes both quantity and quality of mineral and organic components and also their physical and physicochemical properties. The main aim of this study is comparison of sorption properties of selected Polish soils by using water vapour adsorption method. Samples were taken from the depth of 0-20 cm, from the Lublin region, eastern Poland. Soils were selected on the basis of their different physicochemical properties and were classified as: Haplic Fluvisol, Haplic Chernozem, Mollic Gleysol, Rendzic Phaeozem, Stagnic Luvisol, Haplic Cambisol (WG WRB 2006). Data taken from experimental adsorption isotherms were used to determine parameters of monolayer capacity, specific surface area and the total amount of vapour adsorbed at relative pressure of 0.974. Obtained adsorption and desorption isotherms reviled that adsorbate molecules interacted with the soil particles in different extent. Similar monolayer capacity was observed for Haplic Fluvisol, Haplic Chernozem and Stagnic Luvisol, while for Mollic Gleysol was more than 4 times higher. Mollic Gleysol was also characterized by highest values of specific surface area as well as quantity of adsorbed vapour at relative pressure of 0.974. Higher sorption was caused by presence of soil colloids which contains functional groups of a polar nature (mainly hydroxyls, phenolic and carboxyls). These groups similarly to silicates, oxides, hydratable cations as well as electric charge form adsorption centres for water vapour molecules.

Controlled dehydration improves the diffraction quality of two RNA crystals.

PubMed

Park, HaJeung; Tran, Tuan; Lee, Jun Hyuck; Park, Hyun; Disney, Matthew D

2016-11-03

Post-crystallization dehydration methods, applying either vapor diffusion or humidity control devices, have been widely used to improve the diffraction quality of protein crystals. Despite the fact that RNA crystals tend to diffract poorly, there is a dearth of reports on the application of dehydration methods to improve the diffraction quality of RNA crystals. We use dehydration techniques with a Free Mounting System (FMS, a humidity control device) to recover the poor diffraction quality of RNA crystals. These approaches were applied to RNA constructs that model various RNA-mediated repeat expansion disorders. The method we describe herein could serve as a general tool to improve diffraction quality of RNA crystals to facilitate structure determinations.

A novel method of measuring the concentration of anaesthetic vapours using a dew-point hygrometer.

PubMed

Wilkes, A R; Mapleson, W W; Mecklenburgh, J S

1994-02-01

The Antoine equation relates the saturated vapour pressure of a volatile substance, such as an anaesthetic agent, to the temperature. The measurement of the 'dew-point' of a dry gas mixture containing a volatile anaesthetic agent by a dew-point hygrometer permits the determination of the partial pressure of the anaesthetic agent. The accuracy of this technique is limited only by the accuracy of the Antoine coefficients and of the temperature measurement. Comparing measurements by the dew-point method with measurements by refractometry showed systematic discrepancies up to 0.2% and random discrepancies with SDS up to 0.07% concentration in the 1% to 5% range for three volatile anaesthetics. The systematic discrepancies may be due to errors in available data for the vapour pressures and/or the refractive indices of the anaesthetics.

Purification, crystallization and preliminary X-ray diffraction analysis of a novel keto-deoxy-d-galactarate (KDG) dehydratase from Agrobacterium tumefaciens

PubMed Central

Taberman, Helena; Andberg, Martina; Parkkinen, Tarja; Richard, Peter; Hakulinen, Nina; Koivula, Anu; Rouvinen, Juha

2014-01-01

d-Galacturonic acid is the main component of pectin. It could be used to produce affordable renewable fuels, chemicals and materials through biotechnical conversion. Keto-deoxy-d-galactarate (KDG) dehydratase is an enzyme in the oxidative pathway of d-galacturonic acid in Agrobacterium tumefaciens (At). It converts 3-deoxy-2-keto-l-threo-hexarate to α-ketoglutaric semialdehyde. At KDG dehydratase was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 169.1, b = 117.8, c = 74.3 Å, β = 112.4° and an asymmetric unit of four monomers. X-ray diffraction data were collected to 1.9 Å resolution using synchrotron radiation. The three-dimensional structure of At KDG dehydratase will provide valuable information on the function of the enzyme and will allow it to be engineered for biorefinery-based applications. PMID:24419616

Crystallization and preliminary X-ray diffraction analysis of an endo-1,4-β-D-glucanase from Aspergillus aculeatus F-50.

PubMed

Chen, Yun; Huang, Jian Wen; Chen, Chun Chi; Lai, Hui Lin; Jin, Jian; Guo, Rey Ting

2015-04-01

Cellulose is the most abundant renewable biomass on earth, and its decomposition has proven to be very useful in a wide variety of industries. Endo-1,4-β-D-glucanase (EC 3.2.1.4; endoglucanase), which can catalyze the random hydrolysis of β-1,4-glycosidic bonds to cleave cellulose into smaller fragments, is a key cellulolytic enzyme. An endoglucanase isolated from Aspergillus aculeatus F-50 (FI-CMCase) that was classified into glycoside hydrolase family 12 has been found to be effectively expressed in the industrial strain Pichia pastoris. Here, recombinant FI-CMCase was crystallized. Crystals belonging to the orthorhombic space group C222₁, with unit-cell parameters a = 74.2, b = 75.1, c = 188.4 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.6 Å resolution. Initial phase determination by molecular replacement clearly shows that the crystal contains two protein molecules in the asymmetric unit. Further model building and structure refinement are in progress.

Crystallization and preliminary X-ray diffraction studies of delta-toxin from Clostridium perfringens.

PubMed

Huyet, Jessica; Gilbert, Maryse; Popoff, Michel R; Basak, Ajit

2011-03-01

Clostridium perfringens is a Gram-positive anaerobic bacterium that is responsible for a wide range of diseases in humans and both wild and domesticated animals, including birds. C. perfringens is notable for its ability to produce a plethora of toxins, e.g. phospholipases C (alpha-toxin), pore-forming toxins (epsilon-toxin, beta-toxin and enterotoxin) and binary toxins (iota-toxin). Based on alpha-, beta-, epsilon- and iota-toxin production, the bacterium is classified into five different toxinotypes (A-E). Delta-toxin, which is a 32.6 kDa protein with 290 amino acids, is one of three haemolysins released by type C and possibly by type B strains of C. perfringens. This toxin is immunogenic and lytic to erythrocytes from the even-toed ungulates sheep, goats and pigs, and is cytotoxic to other cell types such as rabbit macrophages, human monocytes and blood platelets from goats, rabbits, guinea pigs and humans. The recombinant delta-toxin has been cloned, expressed, purified and crystallized in two different crystal forms by the hanging-drop vapour-diffusion method. Of these two different crystal forms, only the form II crystal diffracted to atomic resolution (dmin=2.4 Å), while the form I crystal diffracted to only 15 Å resolution. The form II crystals belonged to space group P2(1)2(1)2, with one molecule in the crystallographic asymmetric unit and unit-cell parameters a=49.66, b=58.48, c=112.93 Å.

A modified method for diffusive monitoring of 3-ethenylpyridine as a specific marker of environmental tobacco smoke

NASA Astrophysics Data System (ADS)

Kuusimäki, Leea; Peltonen, Kimmo; Vainiotalo, Sinikka

A previously introduced method for monitoring environmental tobacco smoke (ETS) was further validated. The method is based on diffusive sampling of a vapour-phase marker, 3-ethenylpyridine (3-EP), with 3 M passive monitors (type 3500). Experiments were done in a dynamic chamber to assess diffusive sampling in comparison with active sampling in charcoal tubes or XAD-4 tubes. The sampling rate for 3-EP collected on the diffusive sampler was 23.1±0.6 mL min -1. The relative standard deviation for parallel samples ( n=6) ranged from 4% to 14% among experiments ( n=9). No marked reverse diffusion of 3-EP was detected nor any significant effect of relative humidity at 20%, 50% or 80%. The diffusive sampling of 3-EP was validated in field measurements in 15 restaurants in comparison with 3-EP and nicotine measurements using active sampling. The 3-EP concentration in restaurants ranged from 0.01 to 9.8 μg m -3, and the uptake rate for 3-EP based on 92 parallel samples was 24.0±0.4 mL min -1. A linear correlation ( r=0.98) was observed between 3-EP and nicotine concentrations, the average ratio of 3-EP to nicotine being 1:8. Active sampling of 3-EP and nicotine in charcoal tubes provided more reliable results than sampling in XAD-4 tubes. All samples were analysed using gas chromatography-mass spectrometry after elution with a 15% solution of pyridine in toluene. For nicotine, the limit of quantification of the charcoal tube method was 4 ng per sample, corresponding to 0.04 μg m -3 for an air sample of 96 L. For 3-EP, the limit of quantification of the diffusive method was 0.5-1.0 ng per sample, corresponding to 0.04-0.09 μg m -3 for 8 h sampling. The diffusive method proved suitable for ETS monitoring, even at low levels of ETS.

Crystallization and preliminary X-ray diffraction analysis of the P3 RNA domain of yeast ribonuclease MRP in a complex with RNase P/MRP protein components Pop6 and Pop7.

PubMed

Perederina, Anna; Esakova, Olga; Quan, Chao; Khanova, Elena; Krasilnikov, Andrey S

2010-01-01

Eukaryotic ribonucleases P and MRP are closely related RNA-based enzymes which contain a catalytic RNA component and several protein subunits. The roles of the protein subunits in the structure and function of eukaryotic ribonucleases P and MRP are not clear. Crystals of a complex that included a circularly permuted 46-nucleotide-long P3 domain of the RNA component of Saccharomyces cerevisiae ribonuclease MRP and selenomethionine derivatives of the shared ribonuclease P/MRP protein components Pop6 (18.2 kDa) and Pop7 (15.8 kDa) were obtained using the sitting-drop vapour-diffusion method. The crystals belonged to space group P4(2)22 (unit-cell parameters a = b = 127.2, c = 76.8 A, alpha = beta = gamma = 90 degrees ) and diffracted to 3.25 A resolution.

Crystallization and preliminary crystallographic analysis of the catechol 2,3-dioxygenase PheB from Bacillus stearothermophilus BR219

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki

2006-02-01

PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less

Improved expression, purification and crystallization of a putative N-acetyl-γ-glutamyl-phosphate reductase from rice (Oryza sativa)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miura-Ohnuma, Jun; Nonaka, Tsuyoshi; Katoh, Shizue

2005-12-01

Crystals of OsAGPR were obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å. N-Acetyl-γ-glutamyl-phosphate reductase (AGPR) catalyzes the third step in an eight-step arginine-biosynthetic pathway that starts with glutamate. This enzyme converts N-acetyl-γ-glutamyl phosphate to N-acetylglutamate-γ-semialdehyde by an NADPH-dependent reductive dephosphorylation. AGPR from Oryza sativa (OsAGPR) was expressed in Escherichia coli at 291 K as a soluble fusion protein with an upstream thioredoxin-hexahistidine [Trx-(His){sub 6}] extension. OsAGPR(Ala50–Pro366) was purified and crystals weremore » obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å.« less

Batch crystallization of rhodopsin for structural dynamics using an X-ray free-electron laser

DOE PAGES

Wu, Wenting; Nogly, Przemyslaw; Rheinberger, Jan; ...

2015-06-27

Rhodopsin is a membrane protein from the G protein-coupled receptor family. Together with its ligand retinal, it forms the visual pigment responsible for night vision. In order to perform ultrafast dynamics studies, a time-resolved serial femtosecond crystallography method is required owing to the nonreversible activation of rhodopsin. In such an approach, microcrystals in suspension are delivered into the X-ray pulses of an X-ray free-electron laser (XFEL) after a precise photoactivation delay. Here in this study, a millilitre batch production of high-density microcrystals was developed by four methodical conversion steps starting from known vapour-diffusion crystallization protocols: (i) screening the low-salt crystallizationmore » conditions preferred for serial crystallography by vapour diffusion, (ii) optimization of batch crystallization, (iii) testing the crystal size and quality using second-harmonic generation (SHG) imaging and X-ray powder diffraction and (iv) production of millilitres of rhodopsin crystal suspension in batches for serial crystallography tests; these crystals diffracted at an XFEL at the Linac Coherent Light Source using a liquid-jet setup.« less

UV-laser-based longitudinal illuminated diffuser (LID) incorporating diffractive and Lambertian reflectance for the disinfection of beverages

NASA Astrophysics Data System (ADS)

Lizotte, Todd

2010-08-01

A novel laser beam shaping system was designed to demonstrate the potential of using high power UV laser sources for large scale disinfection of liquids used in the production of food products, such as juices, beer, milk and other beverage types. The design incorporates a patented assembly of optical components including a diffractive beam splitting/shaping element and a faceted pyramidal or conically shaped Lambertian diffuser made from a compression molded PTFE compounds. When properly sintered to an appropriate density, as an example between 1.10 and 1.40 grams per cubic centimeter, the compressed PTFE compounds show a ~99% reflectance at wavelengths ranging from 300 nm to 1500 nm, and a ~98.5% refection of wavelengths from 250 nm to 2000 nm [1]. The unique diffuser configuration also benefits from the fact that the PTFE compounds do not degrade when exposed to ultraviolet radiation as do barium sulfate materials and silver or aluminized mirror coatings [2]. These components are contained within a hermetically sealed quartz tube. Once assembled a laser beam is directed through one end of the tube. This window takes the form of a computer generated diffractive splitter or other diffractive shaper element to split the laser beam into a series of spot beamlets, circular rings or other geometric shapes. As each of the split beamlets or rings cascade downward, they illuminate various points along the tapered PTFE cone or faceted pyramidal form. As they strike the surface they each diffuse in a Lambertian reflectance pattern creating a pseudo-uniform circumferential illuminator along the length of the quartz tube enclosing the assembly. The compact tubular structure termed Longitudinal Illuminated Diffuser (LID) provides a unique UV disinfection source that can be placed within a centrifugal reactor or a pipe based reactor chamber. This paper will review the overall design principle, key component design parameters, preliminary analytic and bench operational testing

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Liquid-liquid diffusion crystallization improves the X-ray diffraction of EndoS, an endo-β-N-acetylglucosaminidase from Streptococcus pyogenes with activity on human IgG.

PubMed

Trastoy, Beatriz; Lomino, Joseph V; Wang, Lai Xi; Sundberg, Eric J

2013-12-01

Endoglycosidase S (EndoS) is an enzyme secreted by Streptococcus pyogenes that specifically hydrolyzes the β-1,4-di-N-acetylchitobiose core glycan on immunoglobulin G (IgG) antibodies. One of the most common human pathogens and the cause of group A streptococcal infections, S. pyogenes secretes EndoS in order to evade the host immune system by rendering IgG effector mechanisms dysfunctional. On account of its specificity for IgG, EndoS has also been used extensively for chemoenzymatic synthesis of homogeneous IgG glycoprotein preparations and is being developed as a novel therapeutic for a wide range of autoimmune diseases. The structural basis of its enzymatic activity and substrate specificity, however, remains unknown. Here, the purification and crystallization of EndoS are reported. Using traditional hanging-drop and sitting-drop vapor-diffusion crystallization, crystals of EndoS were grown that diffracted to a maximum of 3.5 Å resolution but suffered from severe anisotropy, the data from which could only be reasonably processed to 7.5 Å resolution. When EndoS was crystallized by liquid-liquid diffusion, it was possible to grow crystals with a different space group to those obtained by vapor diffusion. Crystals of wild-type endoglycosidase and glycosynthase constructs of EndoS grown by liquid-liquid diffusion diffracted to 2.6 and 1.9 Å resolution, respectively, with a greatly diminished anisotropy. Despite extensive efforts, the failure to reproduce these liquid-liquid diffusion-grown crystals by vapor diffusion suggests that these crystallization methods each sample a distinct crystallization space.

Medical cannabis use in Canada: vapourization and modes of delivery.

PubMed

Shiplo, Samantha; Asbridge, Mark; Leatherdale, Scott T; Hammond, David

2016-10-29

The mode of medical cannabis delivery-whether cannabis is smoked, vapourized, or consumed orally-may have important implications for its therapeutic efficacy and health risks. However, there is very little evidence on current patterns of use among Canadian medical cannabis users, particularly with respect to modes of delivery. The current study examined modes of medical cannabis delivery following regulatory changes in 2014 governing how Canadians access medical cannabis. A total of 364 approved adult Canadian medical cannabis users completed an online cross-sectional survey between April and June 2015. The survey examined patterns of medical cannabis use, modes of delivery used, and reasons for use. Participants were recruited through a convenience sample from nine Health Canada licensed producers. Using a vapourizer was the most popular mode of delivery for medical cannabis (53 %), followed by smoking a joint (47 %). The main reason for using a vapourizer was to reduce negative health consequences associated with smoking. A majority of current vapourizer users reported using a portable vapourizer (67.2 %), followed by a stationary vapourizer (41.7 %), and an e-cigarette or vape pen (19.3 %). Current use of a vapourizer was associated with fewer respiratory symptoms (AOR = 1.28, 95 % CI 1.05-1.56, p = 0.01). The findings suggest an increase in the popularity of vapourizers as the primary mode of delivery among approved medical users. Using vapourizers has the potential to prevent some of the adverse respiratory health consequences associated with smoking and may serve as an effective harm reduction method. Monitoring implications of such current and future changes to medical cannabis regulations may be beneficial to policymakers.

A review of water recovery by vapour permeation through membranes.

PubMed

Bolto, Brian; Hoang, Manh; Xie, Zongli

2012-02-01

In vapour permeation the feed is a vapour, not a liquid as in pervaporation. The process employs a polymeric membrane as a semi-permeable barrier between the feed side under high pressure and the permeate side under low pressure. Separation is achieved by the different degrees to which components are dissolved in and diffuse through the membrane, the system working according to a solution-diffusion mechanism. The materials used in the membrane depend upon the types of compounds being separated, so water transport is favoured by hydrophilic material, whether organic or inorganic. The process is used for the dehydration of natural gas and various organic solvents, notably alcohol as biofuel, as well as the removal of water from air and its recovery from waste steam. Waste steam can be found in almost every plant/factory where steam is used. It is frequently contaminated and cannot be reused. Discharging the spent steam to the atmosphere is a serious energy loss and environmental issue. Recycling the steam can significantly improve the overall energy efficiency of an industry, which is responsible for massive CO(2) emissions. Steam separation at high fluxes and temperatures has been accomplished with a composite poly(vinyl alcohol) membrane containing silica nanoparticles, and also, less efficiently, with an inorganic zeolite membrane. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Sensing response of copper phthalocyanine salt dispersed glass with organic vapours

NASA Astrophysics Data System (ADS)

Ridhi, R.; Sachdeva, Sheenam; Saini, G. S. S.; Tripathi, S. K.

2016-05-01

Copper Phthalocyanine and other Metal Phthalocyanines are very flexible and tuned easily to modify their structural, spectroscopic, optical and electrical properties by either functionalizing them with various substituent groups or by replacing or adding a ligand to the central metal atom in the phthalocyanine ring and accordingly can be made sensitive and selective to various organic species or gaseous vapours. In the present work, we have dispersed Copper Phthalocyanine Salt (CuPcS) in sol-gel glass form using chemical route sol-gel method and studied its sensing mechanism with organic vapours like methanol and benzene and found that current increases onto their exposure with vapours. A variation in the activation energies was also observed with exposure of vapours.

Thermal stability of γ-Fe2O3 nanoparticles and their employment for sensing of acetone vapours

NASA Astrophysics Data System (ADS)

Luby, Š.; Ivančo, J.; Jergel, M.; Švec, P., Jr.; Kotlár, M.; Kostiuk, D.; Halahovets, J.; Kollár, J.; Mosnáček, J.; Majková, E.

2017-12-01

Stability of γ-Fe2O3 nanoparticles-based films upon an isochronal annealing in air was investigated by x-ray diffraction, differential scanning calorimetry, and thermogravimetry. The γ-α transformation temperature increased owing to the nanoscaling of Fe2O3; the higher stability of the γ phase was explained on the ground of the surface free energy of nanoparticles (with the size of about 6.4 nm). Further, chemiresistors based on the Fe2O3 nanoparticle bilayer prepared by the Langmuir-Schaefer method were fabricated and examined in terms of their sensitivity to acetone vapours down to 500 ppb concentration in air.

Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans

PubMed Central

Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

2013-01-01

YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (V M) of 2.05 Å3 Da−1 and a solvent content of 40.2%. PMID:23695570

Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans.

PubMed

Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

2013-05-01

YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (VM) of 2.05 Å(3) Da(-1) and a solvent content of 40.2%.

Methods to improve the PVD coatability of brass by using diffusion barriers

NASA Astrophysics Data System (ADS)

Langer, Bernd

Previous work involving PVD coatings on brass has used a combination of multilayers consisting of electroplated films like nickel or chromium and deposited decorative PVD coatings like TiN, TiAIN or ZrN systems. The disadvantages of these systems are the combination of wet electrochemistry and high tech vacuum processes. Furthermore the allergic reaction to nickel and the toxic nature of Cr(VI) must be considered.There is a need for intermediate layers to 'seal-off the brass in order to avoid the evaporation of zinc in vacuum using a diffusion barrier. Furthermore the intermediate layers are required to act as a corrosion barrier.This thesis reports on the development of PVD coatings on heat sensitive brass substrate materials utilising ABS technology with Al, CuAl8 and Nb targets as vapour sources.The brass pretreatment includes careful grinding, polishing and cleaning steps as well as steered arc metal ion etching using the above target materials. The coatings are produced at temperatures between 100 and 250°C in the unbalanced magnetron mode, including layers made from Al, Al-Nb, CuA18, CuAl8-Nb and Nb.Scratch adhesion and Rockwell indentation tests are found not to be directly applicable to the system of soft brass and ductile coating(s). Therefore a new classification for both scratch and indentation tests was defined. The best adhesion was shown by the CuA18 coatings on brass. Corrosion tests showed good results for the Al coatings and poor results for the pure Nb coatings directly applied on brass. The best corrosion result was obtained with a CuAl8-Nb layer system. This layer system also offers very good barrier behaviour concerning Zn diffusion.Other investigations like Glow Discharge Optical Emission Spectroscopy (GDOES), Scanning Electron Microscopy (SEM) imaging, Transmission Electron Microscopy (TEM) and X-ray Diffraction (XRD) were undertaken to characterise the new coating systems for brass.

Transport mechanisms through PE-CVD coatings: influence of temperature, coating properties and defects on permeation of water vapour

NASA Astrophysics Data System (ADS)

Kirchheim, Dennis; Jaritz, Montgomery; Mitschker, Felix; Gebhard, Maximilian; Brochhagen, Markus; Hopmann, Christian; Böke, Marc; Devi, Anjana; Awakowicz, Peter; Dahlmann, Rainer

2017-03-01

Gas transport mechanisms through plastics are usually described by the temperature-dependent Arrhenius-model and compositions of several plastic layers are represented by the CLT. When it comes to thin films such as plasma-enhanced chemical vapour deposition (PE-CVD) or plasma-enhanced atomic layer deposition (PE-ALD) coatings on substrates of polymeric material, a universal model is lacking. While existing models describe diffusion through defects, these models presume that permeation does not occur by other means of transport mechanisms. This paper correlates the existing transport models with data from water vapour transmission experiments.

Time-dependent calculations of molten pool formation and thermal plasma with metal vapour in gas tungsten arc welding

NASA Astrophysics Data System (ADS)

Tanaka, M.; Yamamoto, K.; Tashiro, S.; Nakata, K.; Yamamoto, E.; Yamazaki, K.; Suzuki, K.; Murphy, A. B.; Lowke, J. J.

2010-11-01

A gas tungsten arc (GTA) was modelled taking into account the contamination of the plasma by metal vapour from the molten anode. The whole region of GTA atmosphere including the tungsten cathode, the arc plasma and the anode was treated using a unified numerical model. A viscosity approximation was used to express the diffusion coefficient in terms of viscosity of the shielding gas and metal vapour. The transient two-dimensional distributions of temperature, velocity of plasma flow and iron vapour concentration were predicted, together with the molten pool as a function of time for a 150 A arc current at atmospheric pressure, both for helium and argon gases. It was shown that the thermal plasma in the GTA was influenced by iron vapour from the molten pool surface and that the concentration of iron vapour in the plasma was dependent on the temperature of the molten pool. GTA on high sulfur stainless steel was calculated to discuss the differences between a low sulfur and a high sulfur stainless steel anode. Helium was selected as the shielding gas because a helium GTA produces more metal vapour than an argon GTA. In the GTA on a high sulfur stainless steel anode, iron vapour and current path were constricted. Radiative emission density in the GTA on high sulfur stainless steel was also concentrated in the centre area of the arc plasma together with the iron vapour although the temperature distributions were almost the same as that in the case of a low sulfur stainless steel anode.

Thermal diffusivity study of aged Li-ion batteries using flash method

NASA Astrophysics Data System (ADS)

Nagpure, Shrikant C.; Dinwiddie, Ralph; Babu, S. S.; Rizzoni, Giorgio; Bhushan, Bharat; Frech, Tim

Advanced Li-ion batteries with high energy and power density are fast approaching compatibility with automotive demands. While the mechanism of operation of these batteries is well understood, the aging mechanisms are still under investigation. Investigation of aging mechanisms in Li-ion batteries becomes very challenging, as aging does not occur due to a single process, but because of multiple physical processes occurring at the same time in a cascading manner. As the current characterization techniques such as Raman spectroscopy, X-ray diffraction, and atomic force microscopy are used independent of each other they do not provide a comprehensive understanding of material degradation at different length (nm 2 to m 2) scales. Thus to relate the damage mechanisms of the cathode at mm length scale to micro/nanoscale, data at an intermediate length scale is needed. As such, we demonstrate here the use of thermal diffusivity analysis by flash method to bridge the gap between different length scales. In this paper we present the thermal diffusivity analysis of an unaged and aged cell. Thermal diffusivity analysis maps the damage to the cathode samples at millimeter scale lengths. Based on these maps we also propose a mechanism leading to the increase of the thermal diffusivity as the cells are aged.

Modelling and intepreting the isotopic composition of water vapour in convective updrafts

NASA Astrophysics Data System (ADS)

Bolot, M.; Legras, B.; Moyer, E. J.

2012-08-01

The isotopic compositions of water vapour and its condensates have long been used as tracers of the global hydrological cycle, but may also be useful for understanding processes within individual convective clouds. We review here the representation of processes that alter water isotopic compositions during processing of air in convective updrafts and present a unified model for water vapour isotopic evolution within undiluted deep convective cores, with a special focus on the out-of-equilibrium conditions of mixed phase zones where metastable liquid water and ice coexist. We use our model to show that a combination of water isotopologue measurements can constrain critical convective parameters including degree of supersaturation, supercooled water content and glaciation temperature. Important isotopic processes in updrafts include kinetic effects that are a consequence of diffusive growth or decay of cloud particles within a supersaturated or subsaturated environment; isotopic re-equilibration between vapour and supercooled droplets, which buffers isotopic distillation; and differing mechanisms of glaciation (droplet freezing vs. the Wegener-Bergeron-Findeisen process). As all of these processes are related to updraft strength, droplet size distribution and the retention of supercooled water, isotopic measurements can serve as a probe of in-cloud conditions of importance to convective processes. We study the sensitivity of the profile of water vapour isotopic composition to differing model assumptions and show how measurements of isotopic composition at cloud base and cloud top alone may be sufficient to retrieve key cloud parameters.

Modelling and interpreting the isotopic composition of water vapour in convective updrafts

NASA Astrophysics Data System (ADS)

Bolot, M.; Legras, B.; Moyer, E. J.

2013-08-01

The isotopic compositions of water vapour and its condensates have long been used as tracers of the global hydrological cycle, but may also be useful for understanding processes within individual convective clouds. We review here the representation of processes that alter water isotopic compositions during processing of air in convective updrafts and present a unified model for water vapour isotopic evolution within undiluted deep convective cores, with a special focus on the out-of-equilibrium conditions of mixed-phase zones where metastable liquid water and ice coexist. We use our model to show that a combination of water isotopologue measurements can constrain critical convective parameters, including degree of supersaturation, supercooled water content and glaciation temperature. Important isotopic processes in updrafts include kinetic effects that are a consequence of diffusive growth or decay of cloud particles within a supersaturated or subsaturated environment; isotopic re-equilibration between vapour and supercooled droplets, which buffers isotopic distillation; and differing mechanisms of glaciation (droplet freezing vs. the Wegener-Bergeron-Findeisen process). As all of these processes are related to updraft strength, particle size distribution and the retention of supercooled water, isotopic measurements can serve as a probe of in-cloud conditions of importance to convective processes. We study the sensitivity of the profile of water vapour isotopic composition to differing model assumptions and show how measurements of isotopic composition at cloud base and cloud top alone may be sufficient to retrieve key cloud parameters.

Sensing response of copper phthalocyanine salt dispersed glass with organic vapours

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ridhi, R.; Sachdeva, Sheenam; Saini, G. S. S.

2016-05-06

Copper Phthalocyanine and other Metal Phthalocyanines are very flexible and tuned easily to modify their structural, spectroscopic, optical and electrical properties by either functionalizing them with various substituent groups or by replacing or adding a ligand to the central metal atom in the phthalocyanine ring and accordingly can be made sensitive and selective to various organic species or gaseous vapours. In the present work, we have dispersed Copper Phthalocyanine Salt (CuPcS) in sol-gel glass form using chemical route sol-gel method and studied its sensing mechanism with organic vapours like methanol and benzene and found that current increases onto their exposuremore » with vapours. A variation in the activation energies was also observed with exposure of vapours.« less

Purification and crystallization of Kokobera virus helicase

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Colibus, Luigi; Speroni, Silvia; Coutard, Bruno

2007-03-01

Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method and exhibit a diffraction limit of 2.3 Å. Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. The flavivirus genus is characterized by a positive-sense single-stranded RNA genome. The unique open reading frame of the viral RNA is transcribed and translated as a single polyprotein which is post-translationally cleaved to yield three structural and seven nonstructural proteins, one of which ismore » the NS3 gene that encodes a C-terminal helicase domain consisting of 431 amino acids. Helicase inhibitors are potential antiviral drugs as the helicase is essential to viral replication. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P3{sub 1}21 (or P3{sub 2}21), with unit-cell parameters a = 88.6, c = 138.6 Å, and exhibit a diffraction limit of 2.3 Å.« less

Purification, crystallization and preliminary X-ray diffraction analysis of the Escherichia coli common pilus chaperone EcpB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garnett, James A.; Diallo, Mamou; Matthews, Steve J., E-mail: s.j.matthews@imperial.ac.uk

In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological andmore » abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones

Vapour Intrusion into Buildings - A Literature Review

EPA Science Inventory

This chapter provides a review of recent research on vapour intrusion of volatile organic compounds (VOCs) into buildings. The chapter builds on a report from Tillman and Weaver (2005) which reviewed the literature on vapour intrusion through 2005. Firstly, the term ‘vapour intru...

Intercomparison of TCCON and MUSICA Water Vapour Products

NASA Astrophysics Data System (ADS)

Weaver, D.; Strong, K.; Deutscher, N. M.; Schneider, M.; Blumenstock, T.; Robinson, J.; Notholt, J.; Sherlock, V.; Griffith, D. W. T.; Barthlott, S.; García, O. E.; Smale, D.; Palm, M.; Jones, N. B.; Hase, F.; Kivi, R.; Ramos, Y. G.; Yoshimura, K.; Sepúlveda, E.; Gómez-Peláez, Á. J.; Gisi, M.; Kohlhepp, R.; Warneke, T.; Dohe, S.; Wiegele, A.; Christner, E.; Lejeune, B.; Demoulin, P.

2014-12-01

We present an intercomparison between the water vapour products from the Total Carbon Column Observing Network (TCCON) and the MUlti-platform remote Sensing of Isotopologues for investigating the Cycle of Atmospheric water (MUSICA), two datasets from ground-based Fourier Transform InfraRed (FTIR) spectrometers with good global representation. Where possible, comparisons to radiosondes are also included. The near-infrared TCCON measurements are optimized to provide precise monitoring of greenhouse gases for carbon cycle studies; however, TCCON's retrievals also produce water vapour products. The mid-infrared MUSICA products result from retrievals optimized to give precise and accurate information about H2O, HDO, and δD. The MUSICA water vapour products have been validated by extensive intercomparisons with H2O and δD in-situ measurements made from ground, radiosonde, and aircraft (Schneider et al. 2012, 2014), as well as by intercomparisons with satellite-based H2O and δD remote sensing measurements (Wiegele et al., 2014). This dataset provides a valuable reference point for other measurements of water vapour. This study is motivated by the limited intercomparisons performed for TCCON water vapour products and limited characterisation of their uncertainties. We compare MUSICA and TCCON products to assess the potential for TCCON measurements to contribute to studies of the water cycle, water vapour's role in climate and use as a tracer for atmospheric dynamics, and to evaluate the performance of climate models. The TCCON and MUSICA products result from measurements taken using the same FTIR instruments, enabling a comparison with constant instrumentation. The retrieval techniques differ, however, in their method and a priori information. We assess the impact of these differences and characterize the comparability of the TCCON and MUSICA datasets.

Preparation, crystallization and preliminary crystallographic analysis of old yellow enzyme from Trypanosoma cruzi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugiyama, Shigeru; Tokuoka, Keiji; Uchiyama, Nahoko

2007-10-01

Old yellow enzyme from Trypanosoma cruzi, has been crystallized using the hanging-drop vapour-diffusion method. Old yellow enzyme (OYE) is an NADPH oxidoreductase that contains a flavin mononucleotide as a prosthetic group. The OYE from Trypanosoma cruzi, which produces prostaglandin F{sub 2α}, a potent mediator of various physiological and pathological processes, from prostaglandin H2. The protein was recombinantly expressed and purified from Escherichia coli and was crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 56.3, b = 78.8, c = 78.8 Å, β = 93.4° and two moleculesmore » per asymmetric unit. The crystals were suitable for X-ray crystallographic studies and diffracted to 1.70 Å resolution. A Patterson search method is in progress using the structure of OYE from Pseudomonas putida as a starting model.« less

Crystallization and preliminary crystallographic analysis of recombinant immunoglobulin G-binding protein from Streptococcus suis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khan, Abdul Hamid; Chu, Fuliang; Feng, Youjun

2008-08-01

Crystallization of recombinant IgG-binding protein expressed in Escherichia coli using the hanging-drop vapour-diffusion method is described. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c = 78.17 Å. Streptococcus suis, an important zoonotic pathogen, expresses immunoglobulin G-binding protein, which is thought to be helpful to the organism in eluding the host defence system. Recombinant IgG-binding protein expressed in Escherichia coli has been crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c =more » 78.17 Å and one molecule in the asymmetric unit. Diffraction data were collected to 2.60 Å resolution.« less

Crystallization and initial X-ray diffraction studies of scaffolding protein (gp7) of bacteriophage ϕ29

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badasso, Mohammed O., E-mail: badas001@umn.edu; Anderson, Dwight L.; Department of Oral Science, University of Minnesota, Minneapolis, MN 55455

2005-04-01

ϕ29 bacteriophage scaffolding protein (gp7) has been overproduced in E. coli, purified, crystallized and characterized by X-ray diffraction. Two distinct crystal forms were obtained and a diffraction data set was collected to 1.8 Å resolution. The Bacillus subtilis bacteriophage ϕ29 scaffolding protein (gp7) has been crystallized by the hanging-drop vapour-diffusion method at 293 K. Two new distinct crystal forms that both differed from a previously crystallized and solved scaffolding protein were grown under the same conditions. Form I belongs to the primitive tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 77.13, c = 37.12 Å.more » Form II crystals exhibit an orthorhombic crystal form, with space group C222 and unit-cell parameters a = 107.50, b = 107. 80, c = 37.34 Å. Complete data sets have been collected to 1.78 and 1.80 Å for forms I and II, respectively, at 100 K using Cu Kα X-rays from a rotating-anode generator. Calculation of a V{sub M} value of 2.46 Å{sup 3} Da{sup −1} for form I suggests the presence of one molecule in the asymmetric unit, corresponding to a solvent content of 50.90%, whereas form II has a V{sub M} of 4.80 Å{sup 3} Da{sup −1} with a solvent content of 48.76% and two molecules in the asymmetric unit. The structures of both crystal forms are being determined by the molecular-replacement method using the coordinates of the published crystal structure of gp7.« less

Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Feifei; Gao, Feng; Li, Honglin

The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

Crystallization and X-ray diffraction analysis of salicylate synthase, a chorismate-utilizing enyme involved in siderophore biosynthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parsons, James F., E-mail: parsonsj@umbi.umd.edu; Shi, Katherine; Calabrese, Kelly

2006-03-01

Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have beenmore » grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2{sub 1}) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase.« less

Oil mist and vapour concentrations from drilling fluids: inter- and intra-laboratory comparison of chemical analyses.

PubMed

Galea, Karen S; Searl, Alison; Sánchez-Jiménez, Araceli; Woldbæk, Torill; Halgard, Kristin; Thorud, Syvert; Steinsvåg, Kjersti; Krüger, Kirsti; Maccalman, Laura; Cherrie, John W; van Tongeren, Martie

2012-01-01

There are no recognized analytical methods for measuring oil mist and vapours arising from drilling fluids used in offshore petroleum drilling industry. To inform the future development of improved methods of analysis for oil mist and vapours this study assessed the inter- and intra-laboratory variability in oil mist and vapour analysis. In addition, sample losses during transportation and storage were assessed. Replicate samples for oil mist and vapour were collected using the 37-mm Millipore closed cassette and charcoal tube assembly. Sampling was conducted in a simulated shale shaker room, similar to that found offshore for processing drilling fluids. Samples were analysed at two different laboratories, one in Norway and one in the UK. Oil mist samples were analysed using Fourier transform infrared spectroscopy (FTIR), while oil vapour samples were analysed by gas chromatography (GC). The comparison of replicate samples showed substantial within- and between-laboratory variability in reported oil mist concentrations. The variability in oil vapour results was considerably reduced compared to oil mist, provided that a common method of calibration and quantification was adopted. The study also showed that losses can occur during transportation and storage of samples. There is a need to develop a harmonized method for the quantification of oil mist on filter and oil vapour on charcoal supported by a suitable proficiency testing scheme for laboratories involved in the analysis of occupational hygiene samples for the petroleum industry. The uncertainties in oil mist and vapour measurement have substantial implications in relation to compliance with occupational exposure limits and also in the reliability of any exposure-response information reported in epidemiological studies.

Crystallization and preliminary X-ray diffraction studies of two thermostable α-galactosidases from glycoside hydrolase family 36

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foucault, M.; Watzlawick, H.; Mattes, R.

2006-02-01

The α-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8 Å resolution, respectively. α-Galactosidases from thermophilic organisms have gained interest owing to their applications in the sugar industry. The α-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8 Å resolution,more » respectively. Crystals of AgaB belong to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 87.5, b = 113.3, c = 161.6 Å. Crystals of AgaA A355E belong to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 150.1, c = 233.2 Å.« less

Studies of copper and gold vapour lasers

NASA Astrophysics Data System (ADS)

Clark, Graeme Lawrence

The work described in this thesis covers various aspects of pulsed copper and gold vapour lasers. The work is divided into four main parts : a computer model of the kinetics of the copper vapour laser discharge; construction and characterization of a copper vapour laser and a gold vapour laser system (to be used for photodynamic cancer treatment); analysis of the thermal processes occurring in the various forms of thermal insulation used in these lasers; and studies of the use of metal walls to confine a discharge plasma. The results of this work were combined in the design of the first copper vapour laser to use metal rather than an electrically insulating ceramic material for confinement of the discharge plasma. Laser action in copper vapour has been achieved in a number of metal-walled designs, with continuous lengths of metal ranging from 30 mm, in a segmented design, to 400 mm, where the discharge plasma was confined by two molybdenum tubes of this length. A theoretical explanation of the behaviour of plasmas in metal-walled discharge vessels is described.

Aerosol assisted chemical vapour deposition of gas sensitive SnO2 and Au-functionalised SnO2 nanorods via a non-catalysed vapour solid (VS) mechanism

PubMed Central

Vallejos, Stella; Selina, Soultana; Annanouch, Fatima Ezahra; Gràcia, Isabel; Llobet, Eduard; Blackman, Chris

2016-01-01

Tin oxide nanorods (NRs) are vapour synthesised at relatively lower temperatures than previously reported and without the need for substrate pre-treatment, via a vapour-solid mechanism enabled using an aerosol-assisted chemical vapour deposition method. Results demonstrate that the growth of SnO2 NRs is promoted by a compression of the nucleation rate parallel to the substrate and a decrease of the energy barrier for growth perpendicular to the substrate, which are controlled via the deposition conditions. This method provides both single-step formation of the SnO2 NRs and their integration with silicon micromachined platforms, but also allows for in-situ functionalization of the NRs with gold nanoparticles via co-deposition with a gold precursor. The functional properties are demonstrated for gas sensing, with microsensors using functionalised NRs demonstrating enhanced sensing properties towards H2 compared to those based on non-functionalised NRs. PMID:27334232

Measurement of nanoscale three-dimensional diffusion in the interior of living cells by STED-FCS.

PubMed

Lanzanò, Luca; Scipioni, Lorenzo; Di Bona, Melody; Bianchini, Paolo; Bizzarri, Ranieri; Cardarelli, Francesco; Diaspro, Alberto; Vicidomini, Giuseppe

2017-07-06

The observation of molecular diffusion at different spatial scales, and in particular below the optical diffraction limit (<200 nm), can reveal details of the subcellular topology and its functional organization. Stimulated-emission depletion microscopy (STED) has been previously combined with fluorescence correlation spectroscopy (FCS) to investigate nanoscale diffusion (STED-FCS). However, stimulated-emission depletion fluorescence correlation spectroscopy has only been used successfully to reveal functional organization in two-dimensional space, such as the plasma membrane, while, an efficient implementation for measurements in three-dimensional space, such as the cellular interior, is still lacking. Here we integrate the STED-FCS method with two analytical approaches, the recent separation of photons by lifetime tuning and the fluorescence lifetime correlation spectroscopy, to simultaneously probe diffusion in three dimensions at different sub-diffraction scales. We demonstrate that this method efficiently provides measurement of the diffusion of EGFP at spatial scales tunable from the diffraction size down to ∼80 nm in the cytoplasm of living cells.The measurement of molecular diffusion at sub-diffraction scales has been achieved in 2D space using STED-FCS, but an implementation for 3D diffusion is lacking. Here the authors present an analytical approach to probe diffusion in 3D space using STED-FCS and measure the diffusion of EGFP at different spatial scales.

Purification, crystallization and preliminary X-ray diffraction studies on avian haemoglobin from pigeon (Columba livia).

PubMed

Sathya Moorthy, Pon; Neelagandan, K; Balasubramanian, M; Ponnuswamy, M N

2009-02-01

Haemoglobin is a physiologically significant metalloprotein that is involved in the exchange of gases for sustaining life. The respiratory system of birds is unique and complex compared with that of mammals. Many investigations of avian haemoglobins have revealed the presence of inositol pentaphosphate (IP5), a principal allosteric effector that is involved in regulation of their function. Structural investigations of avian haemoglobins are presently not adequate to explain their function. Efforts have been made in this direction in order to understand the oxygen-binding affinity involved in adapting to hypoxia in avian haemoglobins. Fresh whole blood was collected from pigeon (Columba livia) and purified using a DEAE cellulose anion-exchange chromatographic column. Crystallization of pigeon haemoglobin was accomplished using the hanging-drop vapour-diffusion method using PEG 3350 as a precipitant in 50 mM sodium acetate buffer pH 5.5 with 1 M NaCl. Data collection was carried out using a MAR345 image-plate detector system. The crystals diffracted to 2 A resolution. Pigeon haemoglobin crystallizes in a triclinic space group, with two whole biological molecules in the asymmetric unit and with unit-cell parameters a = 55.005, b = 65.528, c = 104.370 A, alpha = 78.742, beta = 89.819, gamma = 65.320 degrees .

Crystallization and preliminary X-ray diffraction analysis of the CRISPR-Cas RNA-silencing Cmr complex.

PubMed

Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki

2015-06-01

Clustered regularly interspaced short palindromic repeat (CRISPR)-derived RNA (crRNA) and CRISPR-associated (Cas) proteins constitute a prokaryotic adaptive immune system (CRISPR-Cas system) that targets and degrades invading genetic elements. The type III-B CRISPR-Cas Cmr complex, composed of the six Cas proteins (Cmr1-Cmr6) and a crRNA, captures and cleaves RNA complementary to the crRNA guide sequence. Here, a Cmr1-deficient functional Cmr (CmrΔ1) complex composed of Pyrococcus furiosus Cmr2-Cmr3, Archaeoglobus fulgidus Cmr4-Cmr5-Cmr6 and the 39-mer P. furiosus 7.01-crRNA was prepared. The CmrΔ1 complex was cocrystallized with single-stranded DNA (ssDNA) complementary to the crRNA guide by the vapour-diffusion method. The crystals diffracted to 2.1 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 75.5, b = 76.2, c = 139.2 Å, α = 90.3, β = 104.8, γ = 118.6°. The asymmetric unit of the crystals is expected to contain one CmrΔ1-ssDNA complex, with a Matthews coefficient of 2.03 Å(3) Da(-1) and a solvent content of 39.5%.

Binarization of apodizers by adapted one-dimensional error diffusion method

NASA Astrophysics Data System (ADS)

Kowalczyk, Marek; Cichocki, Tomasz; Martinez-Corral, Manuel; Andres, Pedro

1994-10-01

Two novel algorithms for the binarization of continuous rotationally symmetric real positive pupil filters are presented. Both algorithms are based on 1-D error diffusion concept. The original gray-tone apodizer is substituted by a set of transparent and opaque concentric annular zones. Depending on the algorithm the resulting binary mask consists of either equal width or equal area zones. The diffractive behavior of binary filters is evaluated. It is shown that the pupils with equal width zones give Fraunhofer diffraction pattern more similar to that of the original continuous-tone pupil than those with equal area zones, assuming in both cases the same resolution limit of printing device.

Experimental method for testing diffraction properties of reflection waveguide holograms.

PubMed

Xie, Yi; Kang, Ming-Wu; Wang, Bao-Ping

2014-07-01

Waveguide holograms' diffraction properties include peak wavelength and diffraction efficiency, which play an important role in determining their display performance. Based on the record and reconstruction theory of reflection waveguide holograms, a novel experimental method for testing diffraction properties is introduced and analyzed in this paper, which uses a plano-convex lens optically contacted to the surface of the substrate plate of the waveguide hologram, so that the diffracted light beam can be easily detected. Then an experiment is implemented. The designed reconstruction wavelength of the test sample is 530 nm, and its diffraction efficiency is 100%. The experimental results are a peak wavelength of 527.7 nm and a diffraction efficiency of 94.1%. It is shown that the tested value corresponds well with the designed value.

Vapour-Phase Processes Control Liquid-Phase Isotope Profiles in Unsaturated Sphagnum Moss

NASA Astrophysics Data System (ADS)

Edwards, T. W.; Yi, Y.; Price, J. S.; Whittington, P. N.

2009-05-01

Seminal work in the early 1980s clearly established the basis for predicting patterns of heavy-isotope enrichment of pore waters in soils undergoing evaporation. A key feature of the process under steady-state conditions is the development of stable, convex-upward profiles whose shape is controlled by the balance between downward-diffusing heavy isotopologues concentrated by evaporative enrichment at the surface and the upward capillary flow of bulk water that maintains the evaporative flux. We conducted an analogous experiment to probe evaporation processes within 20-cm columns of unsaturated, living and dead (but undecomposed) Sphagnum moss evaporating under controlled conditions, while maintaining a constant water table. The experiment provided striking evidence of the importance of vapour-liquid mass and isotope exchange in the air-filled pores of the Sphagnum columns, as evidenced by the rapid development of hydrologic and isotopic steady-state within hours, rather than days, i.e., an order of magnitude faster than possible by liquid-phase processes alone. This is consistent with the notion that vapour-phase processes effectively "short-circuit" mass and isotope fluxes within the Sphagnum columns, as proposed also in recent characterizations of water dynamics in transpiring leaves. Additionally, advection-diffusion modelling of our results supports independent estimates of the effective liquid-phase diffusivities of the respective heavy water isotopologues, 2.380 x 10-5 cm2 s-1 for 1H1H18O and 2.415 x 10-5 cm2 s-1 for 1H2H16O, which are in notably good agreement with the "default" values that are typically assumed in soil and plant water studies.

Vapour-phase method in the synthesis of polymer-ibuprofen sodium-silica gel composites.

PubMed

Kierys, Agnieszka; Krasucka, Patrycja; Grochowicz, Marta

2017-11-01

The study discusses the synthesis of polymer-silica composites comprising water soluble drug (ibuprofen sodium, IBS). The polymers selected for this study were poly(TRIM) and poly(HEMA- co -TRIM) produced in the form of permanently porous beads via the suspension-emulsion polymerization method. The acid and base set ternary composites were prepared by the saturation of the solid dispersions of drug (poly(TRIM)-IBS and/or poly(HEMA- co -TRIM)-IBS) with TEOS, and followed by their exposition to the vapour mixture of water and ammonia, or water and hydrochloric acid, at autogenous pressure. The conducted analyses reveal that the internal structure and total porosity of the resulting composites strongly depend on the catalyst which was used for silica precursor gelation. The parameters characterizing the porosity of both of the acid set composites are much lower than the parameters of the base set composites. Moreover, the basic catalyst supplied in the vapour phase does not affect the ibuprofen sodium molecules, whereas the acid one causes transformation of the ibuprofen sodium into the sodium chloride and a derivative of propanoic acid, which is poorly water soluble. The release profiles of ibuprofen sodium from composites demonstrate that there are differences in the rate and efficiency of drug desorption from them. They are mainly affected by the chemical character of the polymeric carrier but are also associated with the restricted swelling of the composites in the buffer solution after precipitation of silica gel.

A rapid method for the sampling of atmospheric water vapour for isotopic analysis.

PubMed

Peters, Leon I; Yakir, Dan

2010-01-01

Analysis of the stable isotopic composition of atmospheric moisture is widely applied in the environmental sciences. Traditional methods for obtaining isotopic compositional data from ambient moisture have required complicated sampling procedures, expensive and sophisticated distillation lines, hazardous consumables, and lengthy treatments prior to analysis. Newer laser-based techniques are expensive and usually not suitable for large-scale field campaigns, especially in cases where access to mains power is not feasible or high spatial coverage is required. Here we outline the construction and usage of a novel vapour-sampling system based on a battery-operated Stirling cycle cooler, which is simple to operate, does not require any consumables, or post-collection distillation, and is light-weight and highly portable. We demonstrate the ability of this system to reproduce delta(18)O isotopic compositions of ambient water vapour, with samples taken simultaneously by a traditional cryogenic collection technique. Samples were collected over 1 h directly into autosampler vials and were analysed by mass spectrometry after pyrolysis of 1 microL aliquots to CO. This yielded an average error of < +/-0.5 per thousand, approximately equal to the signal-to-noise ratio of traditional approaches. This new system provides a rapid and reliable alternative to conventional cryogenic techniques, particularly in cases requiring high sample throughput or where access to distillation lines, slurry maintenance or mains power is not feasible. Copyright 2009 John Wiley & Sons, Ltd.

Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp; Unno, Hideaki

2007-09-01

Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, cmore » = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.« less

The oxidative corrosion of carbide inclusions at the surface of uranium metal during exposure to water vapour.

PubMed

Scott, T B; Petherbridge, J R; Harker, N J; Ball, R J; Heard, P J; Glascott, J; Allen, G C

2011-11-15

The reaction between uranium and water vapour has been well investigated, however discrepancies exist between the described kinetic laws, pressure dependence of the reaction rate constant and activation energies. Here this problem is looked at by examining the influence of impurities in the form of carbide inclusions on the reaction. Samples of uranium containing 600 ppm carbon were analysed during and after exposure to water vapour at 19 mbar pressure, in an environmental scanning electron microscope (ESEM) system. After water exposure, samples were analysed using secondary ion mass spectrometry (SIMS), focused ion beam (FIB) imaging and sectioning and transmission electron microscopy (TEM) with X-ray diffraction (micro-XRD). The results of the current study indicate that carbide particles on the surface of uranium readily react with water vapour to form voluminous UO(3) · xH(2)O growths at rates significantly faster than that of the metal. The observation may also have implications for previous experimental studies of uranium-water interactions, where the presence of differing levels of undetected carbide may partly account for the discrepancies observed between datasets. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

Determination of diffusion and partition coefficients of model migrants by direct contact and vapour phase transfer from low-density polyethylene films into cake.

PubMed

Paseiro-Cerrato, Rafael; Rodríguez-Bernaldo de Quirós, Ana; Otero-Pazos, Pablo; Sendón, Raquel; Paseiro-Losada, Perfecto

2018-03-01

The aim of the present study was to determine the migration kinetics of one photoinitiator, benzophenone, and two optical brighteners, Uvitex OB and 1,4-diphenyl-1,3-butadiene (DPBD), from low-density polyethylene (LDPE) films into cake. Transfer was assessed by both direct contact and also the vapour phase. To perform the migration tests by direct contact, plastic films enriched with the additives were placed between two cake slices. To evaluate the migration through the gas phase, cake and the fortified LDPE film were placed with no direct contact in a glass container that was hermetically closed. Samples were stored at different time-temperature conditions. Target compounds were extracted from the films with ethanol (70°C, 24 h) and analysed by HPLC-DAD. Relevant parameters such as partition and diffusion coefficients between food and plastic film were calculated. The Arrhenius equation was applied to estimate the diffusion coefficient at any temperature. The data indicate that migration of benzophenone occurs in a significant extent into cake by both direct contact and through the gas phase (no direct contact). Conversely, very little migration occurred for Uvitex OB by direct contact and none through the gas phase. Results for benzophenone suggest that migration through the gas phase should be considered when evaluating migration from food packaging materials into food.

Expression, purification, crystallization and initial crystallographic characterization of the p-hydroxybenzoate hydroxylase from Corynebacterium glutamicum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwon, Soo-Young; Kang, Beom Sik; Kim, Ghyung-Hwa

2007-11-01

PHBH from Corynebacterium glutamicum was crystallized using the hanging-drop vapour-diffusion method in the presence of NaH{sub 2}PO{sub 4} and K{sub 2}HPO{sub 4} as precipitants. X-ray diffraction data were collected to a maximum resolution of 2.5 Å on a synchrotron beamline. p-Hydroxybenzoate hydroxylase (PHBH) is an FAD-dependent monooxygenase that catalyzes the hydroxylation of p-hydroxybenzoate (pOHB) to 3,4-dihydroxybenzoate in an NADPH-dependent reaction and plays an important role in the biodegradation of aromatic compounds. PHBH from Corynebacterium glutamicum was crystallized using the hanging-drop vapour-diffusion method in the presence of NaH{sub 2}PO{sub 4} and K{sub 2}HPO{sub 4} as precipitants. X-ray diffraction data were collectedmore » to a maximum resolution of 2.5 Å on a synchrotron beamline. The crystal belongs to the hexagonal space group P6{sub 3}22, with unit-cell parameters a = b = 94.72, c = 359.68 Å, γ = 120°. The asymmetric unit contains two molecules, corresponding to a packing density of 2.65 Å{sup 3} Da{sup −1}. The structure was solved by molecular replacement. Structure refinement is in progress.« less

Design of tracking and detecting lens system by diffractive optical method

NASA Astrophysics Data System (ADS)

Yang, Jiang; Qi, Bo; Ren, Ge; Zhou, Jianwei

2016-10-01

Many target-tracking applications require an optical system to acquire the target for tracking and identification. This paper describes a new detecting optical system that can provide automatic flying object detecting, tracking and measuring in visible band. The main feature of the detecting lens system is the combination of diffractive optics with traditional lens design by a technique was invented by Schupmann. Diffractive lens has great potential for developing the larger aperture and lightweight lens. First, the optical system scheme was described. Then the Schupmann achromatic principle with diffractive lens and corrective optics is introduced. According to the technical features and requirements of the optical imaging system for detecting and tracking, we designed a lens system with flat surface Fresnel lens and cancels the optical system chromatic aberration by another flat surface Fresnel lens with effective focal length of 1980mm, an F-Number of F/9.9 and a field of view of 2ωω = 14.2', spatial resolution of 46 lp/mm and a working wavelength range of 0.6 0.85um. At last, the system is compact and easy to fabricate and assembly, the diffuse spot size and MTF function and other analysis provide good performance.

Effects of copper vapour on thermophysical properties of CO2-N2 plasma

NASA Astrophysics Data System (ADS)

Zhong, Linlin; Wang, Xiaohua; Rong, Mingzhe; Cressault, Yann

2016-10-01

CO2-N2 mixtures are often used as arc quenching medium (to replace SF6) in circuit breakers and shielding gas in arc welding. In such applications, copper vapour resulting from electrode surfaces can modify characteristics of plasmas. This paper therefore presents an investigation of the effects of copper on thermophysical properties of CO2-N2 plasma. The equilibrium compositions, thermodynamic properties (including mass density, specific enthalpy, and specific heat), transport coefficients (including electrical conductivity, viscosity, and thermal conductivity), and four kinds of combined diffusion coefficients due to composition gradients, applied electric fields, temperature gradients, and pressure gradients respectively, were calculated and discussed for CO2-N2 (mixing ratio 7:3) plasma contaminated by different proportions of copper vapour. The significant influences of copper were observed on all the properties of CO2-N2-Cu mixtures. The better ionization ability and larger molar mass of copper and larger collision integrals related to copper, should be responsible for such influences.

The specific diffusion behaviour in paper and migration modelling from recycled board into dry foodstuffs.

PubMed

Hauder, J; Benz, H; Rüter, M; Piringer, O-G

2013-01-01

Recycled board plays an important role in food packaging, but the great variety of organic impurities must be considered as potential food contaminants. The diffusion behaviour of the impurities is significantly different from that in plastic materials. The two-layer concept for paper and board introduced recently is now treated in more detail. In the rate-determining surface region the diffusion coefficients of the n-alkanes in the homologous series with 15-35 carbon atoms decrease proportionally as their vapour pressures. This leads to a different equation of the diffusion coefficients in comparison with that for the core layer. Different polarities of the migrants have additional influences on the diffusion due to their interactions with the fibre matrix. A new analytical method for the quantification of aromatic impurities has previously been developed. Based on this method and on the described diffusion behaviour, a migration model for specific and global mass transfer of impurities from recycled board into dry food and food simulants is given.

Analysis of the sorption properties of different soils using water vapour adsorption and potentiometric titration methods

NASA Astrophysics Data System (ADS)

Skic, Kamil; Boguta, Patrycja; Sokołowska, Zofia

2016-07-01

Parameters of specific surface area as well as surface charge were used to determine and compare sorption properties of soils with different physicochemical characteristics. The gravimetric method was used to obtain water vapour isotherms and then specific surface areas, whereas surface charge was estimated from potentiometric titration curves. The specific surface area varied from 12.55 to 132.69 m2 g-1 for Haplic Cambisol and Mollic Gleysol soil, respectively, and generally decreased with pH (R=0.835; α = 0.05) and when bulk density (R=-0.736; α = 0.05) as well as ash content (R=-0.751; α = 0.05) increased. In the case of surface charge, the values ranged from 63.00 to 844.67 μmol g-1 Haplic Fluvisol and Mollic Gleysol, respecively. Organic matter gave significant contributions to the specific surface area and cation exchange capacity due to the large surface area and numerous surface functional groups, containing adsorption sites for water vapour molecules and for ions. The values of cation exchange capacity and specific surface area correlated linearly at the level of R=0.985; α = 0.05.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao

Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus.

PubMed

Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J

2008-06-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus

PubMed Central

Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.

2008-01-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065

Profiling pleural effusion cells by a diffraction imaging method

NASA Astrophysics Data System (ADS)

Al-Qaysi, Safaa; Hong, Heng; Wen, Yuhua; Lu, Jun Q.; Feng, Yuanming; Hu, Xin-Hua

2018-02-01

Assay of cells in pleural effusion (PE) is an important means of disease diagnosis. Conventional cytology of effusion samples, however, has low sensitivity and depends heavily on the expertise of cytopathologists. We applied a polarization diffraction imaging flow cytometry method on effusion cells to investigate their features. Diffraction imaging of the PE cell samples has been performed on 6000 to 12000 cells for each effusion cell sample of three patients. After prescreening to remove images by cellular debris and aggregated non-cellular particles, the image textures were extracted with a gray level co-occurrence matrix (GLCM) algorithm. The distribution of the imaged cells in the GLCM parameters space was analyzed by a Gaussian Mixture Model (GMM) to determine the number of clusters among the effusion cells. These results yield insight on textural features of diffraction images and related cellular morphology in effusion samples and can be used toward the development of a label-free method for effusion cells assay.

Crystallization and X-ray diffraction analysis of the CH domain of the cotton kinesin GhKCH2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qin, Xinghua; The Fourth Military Medical University, No. 169 Changlexi Road, Xincheng District, Xi’an 710032, People’s Republic of; Chen, Ziwei

The cloning, expression, purification and crystallization of the CH domain of the plant-specific kinesin GhKCH2 is reported. GhKCH2 belongs to a group of plant-specific kinesins (KCHs) containing an actin-binding calponin homology (CH) domain in the N-terminus. Previous studies revealed that the GhKCH2 CH domain (GhKCH2-CH) had a higher affinity for F-actin (K{sub d} = 0.42 ± 0.02 µM) than most other CH-domain-containing proteins. To understand the underlying mechanism, prokaryotically expressed GhKCH2-CH (amino acids 30–166) was purified and crystallized. Crystals were grown by the sitting-drop vapour-diffusion method using 0.1 M Tris–HCl pH 7.0, 20%(w/v) PEG 8000 as a precipitant. The crystalsmore » diffracted to a resolution of 2.5 Å and belonged to space group P2{sub 1}, with unit-cell parameters a = 41.57, b = 81.92, c = 83.00 Å, α = 90.00, β = 97.31, γ = 90.00°. Four molecules were found in the asymmetric unit with a Matthews coefficient of 2.22 Å{sup 3} Da{sup −1}, corresponding to a solvent content of 44.8%.« less

Crystallization, X-ray diffraction analysis and preliminary structure determination of the polygalacturonase PehA from Agrobacterium vitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vordtriede, Paul B.; Yoder, Marilyn D., E-mail: yoderm@umkc.edu

2008-07-01

The acidic polygalacturonase PehA from A. vitis has been crystallized. A molecular-replacement solution indicated a right-handed parallel β-helix fold. Polygalacturonases are pectate-degrading enzymes that belong to glycoside hydrolase family 28 and hydrolyze the α-1,4 glycosidic bond between neighboring galacturonasyl residues of the homogalacturonan substrate. The acidic polygalacturonase PehA from Agrobacterium vitis was overexpressed in Escherichia coli, where it accumulated in the periplasmic fraction. It was purified to homogeneity via a two-step chromatography procedure and crystallized using the hanging-drop vapour-diffusion technique. PehA crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 52.387, b = 62.738, c = 149.165more » Å, β = 89.98°. Crystals diffracted to 1.59 Å resolution and contained two molecules per asymmetric unit. An initial structure determination by molecular replacement indicated a right-handed parallel β-helix fold.« less

Acoustic radiosity for computation of sound fields in diffuse environments

NASA Astrophysics Data System (ADS)

Muehleisen, Ralph T.; Beamer, C. Walter

2002-05-01

The use of image and ray tracing methods (and variations thereof) for the computation of sound fields in rooms is relatively well developed. In their regime of validity, both methods work well for prediction in rooms with small amounts of diffraction and mostly specular reflection at the walls. While extensions to the method to include diffuse reflections and diffraction have been made, they are limited at best. In the fields of illumination and computer graphics the ray tracing and image methods are joined by another method called luminous radiative transfer or radiosity. In radiosity, an energy balance between surfaces is computed assuming diffuse reflection at the reflective surfaces. Because the interaction between surfaces is constant, much of the computation required for sound field prediction with multiple or moving source and receiver positions can be reduced. In acoustics the radiosity method has had little attention because of the problems of diffraction and specular reflection. The utility of radiosity in acoustics and an approach to a useful development of the method for acoustics will be presented. The method looks especially useful for sound level prediction in industrial and office environments. [Work supported by NSF.

Application of Discrete Huygens Method for Diffraction of Transient Ultrasonic Field

NASA Astrophysics Data System (ADS)

Alia, A.

2018-01-01

Several time-domain methods have been widely used to predict impulse response in acoustics. Despite its great potential, Discrete Huygens Method (DHM) has not been as widely used in the domain of ultrasonic diffraction as in other fields. In fact, little can be found in literature about the application of the DHM to diffraction phenomenon that can be described in terms of direct and edge waves, a concept suggested by Young since 1802. In this paper, a simple axisymmetric DHM-model has been used to simulate the transient ultrasonic field radiation of a baffled transducer and its diffraction by a target located on axis. The results are validated by impulse response based calculations. They indicate the capability of DHM to simulate diffraction occurring at transducer and target edges and to predict the complicated transient field in pulse mode.

Grazing-incidence X-ray diffraction from a crystal with subsurface defects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gaevskii, A. Yu., E-mail: transilv@mail.ru; Golentus, I. E.

2015-03-15

The diffraction of X rays incident on a crystal surface under grazing angles under conditions of total external reflection has been investigated. An approach is proposed in which exact solutions to the dynamic problem of grazing-incidence diffraction in an ideal crystal are used as initial functions to calculate the diffuse component of diffraction in a crystal with defects. The diffuse component of diffraction is calculated for a crystal with surface defects of a dilatation-center type. Exact formulas of the continuum theory which take into account the mirror-image forces are used for defect-induced atomic displacements. Scattering intensity maps near Bragg peaksmore » are constructed for different scan modes, and the conditions for detecting primarily the diffuse component are determined. The results of dynamic calculations of grazing-incidence diffraction in defect-containing crystals are compared with calculations in the kinematic approximation.« less

Levels of selected carcinogens and toxicants in vapour from electronic cigarettes.

PubMed

Goniewicz, Maciej Lukasz; Knysak, Jakub; Gawron, Michal; Kosmider, Leon; Sobczak, Andrzej; Kurek, Jolanta; Prokopowicz, Adam; Jablonska-Czapla, Magdalena; Rosik-Dulewska, Czeslawa; Havel, Christopher; Jacob, Peyton; Benowitz, Neal

2014-03-01

Electronic cigarettes, also known as e-cigarettes, are devices designed to imitate regular cigarettes and deliver nicotine via inhalation without combusting tobacco. They are purported to deliver nicotine without other toxicants and to be a safer alternative to regular cigarettes. However, little toxicity testing has been performed to evaluate the chemical nature of vapour generated from e-cigarettes. The aim of this study was to screen e-cigarette vapours for content of four groups of potentially toxic and carcinogenic compounds: carbonyls, volatile organic compounds, nitrosamines and heavy metals. Vapours were generated from 12 brands of e-cigarettes and the reference product, the medicinal nicotine inhaler, in controlled conditions using a modified smoking machine. The selected toxic compounds were extracted from vapours into a solid or liquid phase and analysed with chromatographic and spectroscopy methods. We found that the e-cigarette vapours contained some toxic substances. The levels of the toxicants were 9-450 times lower than in cigarette smoke and were, in many cases, comparable with trace amounts found in the reference product. Our findings are consistent with the idea that substituting tobacco cigarettes with e-cigarettes may substantially reduce exposure to selected tobacco-specific toxicants. E-cigarettes as a harm reduction strategy among smokers unwilling to quit, warrants further study. (To view this abstract in Polish and German, please see the supplementary files online.).

Purification, crystallization and preliminary X-ray diffraction analysis of saxthrombin, a thrombin-like enzyme from Gloydius saxatilis venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, Wenqing; Zhao, Wei; Key Laboratory of Structural Biology, Chinese Academy of Sciences, 96 Jinzhai Road, Hefei, Anhui 230027

2007-08-01

The thrombin-like enzyme saxthrombin has been purified from G. saxatilis snake venom. Crystallization conditions were found and a data set was obtained to 1.43 Å. The snake-venom thrombin-like enzymes (SVTLEs) are a class of serine proteinases that show fibrinogen-clotting and esterolytic activities. Most TLEs convert fibrinogen to fibrin by releasing either fibrinopeptide A or fibrinopeptide B and cannot activate factor XIII. The enzymes hydrolyze fibrinogen to produce non-cross-linked fibrins, which are susceptible to the lytic action of plasmin. Because of these physiological properties, TLEs have important medical applications in myocardial infarction, ischaemic stroke and thrombotic diseases. Here, a three-step chromatographymore » procedure was used to purify saxthrombin (AAP20638) from Gloydius saxatilis venom to homogeneity. Its molecular weight is about 30 kDa as estimated by SDS–PAGE. A saxthrombin crystal was obtained using the hanging-drop vapour-diffusion method and diffracted to a resolution limit of 1.43 Å. The crystal belongs to space group C2, with unit-cell parameters a = 97.23, b = 52.21, c = 50.10 Å, β = 96.72°, and the Matthews coefficient (V{sub M}) was calculated to be 2.13 Å{sup 3} Da{sup −1} with one molecule in the asymmetric unit.« less

Detecting vapour bubbles in simulations of metastable water

DOE Office of Scientific and Technical Information (OSTI.GOV)

González, Miguel A.; Abascal, Jose L. F.; Valeriani, Chantal, E-mail: christoph.dellago@univie.ac.at, E-mail: cvaleriani@quim.ucm.es

2014-11-14

The investigation of cavitation in metastable liquids with molecular simulations requires an appropriate definition of the volume of the vapour bubble forming within the metastable liquid phase. Commonly used approaches for bubble detection exhibit two significant flaws: first, when applied to water they often identify the voids within the hydrogen bond network as bubbles thus masking the signature of emerging bubbles and, second, they lack thermodynamic consistency. Here, we present two grid-based methods, the M-method and the V-method, to detect bubbles in metastable water specifically designed to address these shortcomings. The M-method incorporates information about neighbouring grid cells to distinguishmore » between liquid- and vapour-like cells, which allows for a very sensitive detection of small bubbles and high spatial resolution of the detected bubbles. The V-method is calibrated such that its estimates for the bubble volume correspond to the average change in system volume and are thus thermodynamically consistent. Both methods are computationally inexpensive such that they can be used in molecular dynamics and Monte Carlo simulations of cavitation. We illustrate them by computing the free energy barrier and the size of the critical bubble for cavitation in water at negative pressure.« less

Enhanced water vapour flow in silica microchannels and interdiffusive water vapour flow through anodic aluminium oxide (AAO) membranes

NASA Astrophysics Data System (ADS)

Lei, Wenwen; McKenzie, David R.

2015-12-01

Enhanced liquid water flows through carbon nanotubes reinvigorated the study of moisture permeation through membranes and micro- and nano-channels. The study of water vapour through micro-and nano-channels has been neglected even though water vapour is as important as liquid water for industry, especially for encapsulation of electronic devices. Here we measure moisture flow rates in silica microchannels and interdiffusive water vapour flows in anodic aluminium oxide (AAO) membrane channels for the first time. We construct theory for the flow rates of the dominant modes of water transport through four previously defined standard configurations and benchmark it against our new measurements. The findings show that measurements of leak behaviour made using other molecules, such as helium, are not reliable. Single phase water vapour flow is overestimated by a helium measurement, while Washburn or capillary flow is underestimated or for all channels when boundary slip applies, to an extent that depends on the slip length for the liquid phase flows.

Purification, crystallization and preliminary X-ray diffraction studies on avian haemoglobin from pigeon (Columba livia)

PubMed Central

Sathya Moorthy, Pon.; Neelagandan, K.; Balasubramanian, M.; Ponnuswamy, M. N.

2009-01-01

Haemoglobin is a physiologically significant metalloprotein that is involved in the exchange of gases for sustaining life. The respiratory system of birds is unique and complex compared with that of mammals. Many investigations of avian haemoglobins have revealed the presence of inositol pentaphosphate (IP5), a principal allosteric effector that is involved in regulation of their function. Structural investigations of avian haemoglobins are presently not adequate to explain their function. Efforts have been made in this direction in order to understand the oxygen-binding affinity involved in adapting to hypoxia in avian haemoglobins. Fresh whole blood was collected from pigeon (Columba livia) and purified using a DEAE cellulose anion-exchange chromatographic column. Crystallization of pigeon haemoglobin was accomplished using the hanging-drop vapour-diffusion method using PEG 3350 as a precipitant in 50 mM sodium acetate buffer pH 5.5 with 1 M NaCl. Data collection was carried out using a MAR345 image-plate detector system. The crystals diffracted to 2 Å resolution. Pigeon haemoglobin crystallizes in a triclinic space group, with two whole biological molecules in the asymmetric unit and with unit-cell parameters a = 55.005, b = 65.528, c = 104.370 Å, α = 78.742, β = 89.819, γ = 65.320°. PMID:19194000

The ignitability of petrol vapours and potential for vapour phase explosion by use of TASER® law enforcement electronic control device.

PubMed

Clarke, C; Andrews, S P

2014-12-01

An experimental study was made of the potential of the TASER-X26™ law enforcement electronic control device to ignite petrol vapours if used by an officer to incapacitate a person soaked in petrol, or within a flammable atmosphere containing petrol vapour. Bench scale tests have shown that a wooden mannequin with pig skin covering the chest was a suitable representation of a human target. Full scale tests using the mannequin have shown that the arc from a TASER-X26™ is capable of igniting petrol/air vapours on a petrol-soaked person. Further tests in a 1/5 scale and a full scale compartment have shown that if a TASER is used within a compartment, a petrol vapour explosion (deflagration) may be achieved. It is evident from this research that if used in a flammable vapour rich environment, the device could prove fatal not only to the target but the TASER® operator as well. Copyright © 2014 Forensic Science Society. Published by Elsevier Ireland Ltd. All rights reserved.

Quasi-parallel precession diffraction: Alignment method for scanning transmission electron microscopes.

PubMed

Plana-Ruiz, S; Portillo, J; Estradé, S; Peiró, F; Kolb, Ute; Nicolopoulos, S

2018-06-06

A general method to set illuminating conditions for selectable beam convergence and probe size is presented in this work for Transmission Electron Microscopes (TEM) fitted with µs/pixel fast beam scanning control, (S)TEM, and an annular dark field detector. The case of interest of beam convergence and probe size, which enables diffraction pattern indexation, is then used as a starting point in this work to add 100 Hz precession to the beam while imaging the specimen at a fast rate and keeping the projector system in diffraction mode. The described systematic alignment method for the adjustment of beam precession on the specimen plane while scanning at fast rates is mainly based on the sharpness of the precessed STEM image. The complete alignment method for parallel condition and precession, Quasi-Parallel PED-STEM, is presented in block diagram scheme, as it has been tested on a variety of instruments. The immediate application of this methodology is that it renders the TEM column ready for the acquisition of Precessed Electron Diffraction Tomographies (EDT) as well as for the acquisition of slow Precessed Scanning Nanometer Electron Diffraction (SNED). Examples of the quality of the Precessed Electron Diffraction (PED) patterns and PED-STEM alignment images are presented with corresponding probe sizes and convergence angles. Copyright © 2018. Published by Elsevier B.V.

Robust diffraction correction method for high-frequency ultrasonic tissue characterization

NASA Astrophysics Data System (ADS)

Raju, Balasundar

2004-05-01

The computation of quantitative ultrasonic parameters such as the attenuation or backscatter coefficient requires compensation for diffraction effects. In this work a simple and accurate diffraction correction method for skin characterization requiring only a single focal zone is developed. The advantage of this method is that the transducer need not be mechanically repositioned to collect data from several focal zones, thereby reducing the time of imaging and preventing motion artifacts. Data were first collected under controlled conditions from skin of volunteers using a high-frequency system (center frequency=33 MHz, BW=28 MHz) at 19 focal zones through axial translation. Using these data, mean backscatter power spectra were computed as a function of the distance between the transducer and the tissue, which then served as empirical diffraction correction curves for subsequent data. The method was demonstrated on patients patch-tested for contact dermatitis. The computed attenuation coefficient slope was significantly (p<0.05) lower at the affected site (0.13+/-0.02 dB/mm/MHz) compared to nearby normal skin (0.2+/-0.05 dB/mm/MHz). The mean backscatter level was also significantly lower at the affected site (6.7+/-2.1 in arbitrary units) compared to normal skin (11.3+/-3.2). These results show diffraction corrected ultrasonic parameters can differentiate normal from affected skin tissues.

Solvent vapour monitoring in work space by solid phase micro extraction.

PubMed

Li, K; Santilli, A; Goldthorp, M; Whiticar, S; Lambert, P; Fingas, M

2001-05-07

Solid phase micro extraction (SPME) is a fast, solvent-less alternative to conventional charcoal tube sampling/carbon disulfide extraction for volatile organic compounds (VOC). In this work, SPME was compared to the active sampling technique in a typical lab atmosphere. Two different types of fibre coatings were evaluated for solvent vapour at ambient concentration. A general purpose 100 microm film polydimethylsiloxane (PDMS) fibre was found to be unsuitable for VOC work, despite the thick coating. The mixed-phase carboxen/PDMS fibre was found to be suitable. Sensitivity of the SPME was far greater than charcoal sorbent tube method. Calibration studies using typical solvent such as dichloromethane (DCM), benzene (B) and toluene (T) showed an optimal exposure time of 5 min, with a repeatability of less than 20% for a broad spectrum of organic vapour. Minimum detectable amount for DCM is in the range of 0.01 microg/l (0.003 ppmv). Variation among different fibres was generally within 30% at a vapour concentration of 1 microg DCM/l, which was more than adequate for field monitoring purpose. Adsorption characteristics and calibration procedures were studied. An actual application of SPME was carried out to measure background level of solvent vapour at a bench where DCM was used extensively. Agreement between the SPME and the charcoal sampling method was generally within a factor of two. No DCM concentration was found to be above the regulatory limit of 50 ppmv.

An accurate computational method for the diffusion regime verification

NASA Astrophysics Data System (ADS)

Zhokh, Alexey A.; Strizhak, Peter E.

2018-04-01

The diffusion regime (sub-diffusive, standard, or super-diffusive) is defined by the order of the derivative in the corresponding transport equation. We develop an accurate computational method for the direct estimation of the diffusion regime. The method is based on the derivative order estimation using the asymptotic analytic solutions of the diffusion equation with the integer order and the time-fractional derivatives. The robustness and the computational cheapness of the proposed method are verified using the experimental methane and methyl alcohol transport kinetics through the catalyst pellet.

Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

NASA Astrophysics Data System (ADS)

Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

2016-11-01

Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P1211 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.

Reducing ingress of organic vapours into homes situated on contaminated land.

PubMed

Crump, D; Brown, V; Rowley, J; Squire, R

2004-04-01

The efficacy of current landfill gas and radon mitigation measures for the prevention of ingress of organic vapours was investigated by the study of four houses situated on contaminated land in North West England. The chemical present in the ground of greatest concern for health due to exposure to vapour in the indoor air was hexachlorobutadiene (HCBD) and the concentration of this compound was used to assess the effectiveness of the remedial measures. A two stage remediation was undertaken. For a house with a solid floor the top surface of the floor was sealed and then for the second stage a fan was used to pressurise the soil gas beneath the house. In a house with a suspended timber floor, extra air bricks were installed to increase ventilation of the floor void and then a fan to further increase air exchange in the void. HCBD in air was monitored by both pumped and diffusive sampling methods. Control houses were also monitored that were not subject to remediation. It is concluded that the remedial measures used for radon protection of a suspended floor have the potential to reduce indoor HCBD concentrations by about 80%, at least in downstairs rooms (where initial levels were highest). The two techniques used for properties with solid floors do not appear to be as effective, and no benefit at all was seen without making allowances for changes in concentration that occurred in the control house over the same period. Further work is required to test the efficacy of the techniques over a longer period and under different circumstances of type of contamination and building characteristics.

Prediction of the light scattering patterns from bacteria colonies by a time-resolved reaction-diffusion model and the scalar diffraction theory

NASA Astrophysics Data System (ADS)

Bae, Euiwon; Bai, Nan; Aroonnual, Amornrat; Bhunia, Arun K.; Robinson, J. Paul; Hirleman, E. Daniel

2009-05-01

In order to maximize the utility of the optical scattering technology in the area of bacterial colony identification, it is necessary to have a thorough understanding of how bacteria species grow into different morphological aggregation and subsequently function as distinctive optical amplitude and phase modulators to alter the incoming Gaussian laser beam. In this paper, a 2-dimentional reaction-diffusion (RD) model with nutrient concentration, diffusion coefficient, and agar hardness as variables is investigated to explain the correlation between the various environmental parameters and the distinctive morphological aggregations formed by different bacteria species. More importantly, the morphological change of the bacterial colony against time is demonstrated by this model, which is able to characterize the spatio-temporal patterns formed by the bacteria colonies over their entire growth curve. The bacteria population density information obtained from the RD model is mathematically converted to the amplitude/phase modulation factor used in the scalar diffraction theory which predicts the light scattering patterns for bacterial colonies. The conclusions drawn from the RD model combined with the scalar diffraction theory are useful in guiding the design of the optical scattering instrument aiming at bacteria colony detection and classification.

Diffraction as a Method of Critical Policy Analysis

ERIC Educational Resources Information Center

Ulmer, Jasmine B.

2016-01-01

Recent developments in critical policy analysis have occurred alongside the new materialisms in qualitative research. These lines of scholarship have unfolded along two separate, but related, tracks. In particular, the new materialist method of "diffraction" aligns with many elements of critical policy analysis. Both involve critical…

Combustion dynamics of low vapour pressure nanofuel droplets

NASA Astrophysics Data System (ADS)

Pandey, Khushboo; Chattopadhyay, Kamanio; Basu, Saptarshi

2017-07-01

Multiscale combustion dynamics, shape oscillations, secondary atomization, and precipitate formation have been elucidated for low vapour pressure nanofuel [n-dodecane seeded with alumina nanoparticles (NPs)] droplets. Dilute nanoparticle loading rates (0.1%-1%) have been considered. Contrary to our previous studies of ethanol-water blend (high vapour pressure fuel), pure dodecane droplets do not exhibit internal boiling after ignition. However, variation in surface tension due to temperature causes shape deformations for pure dodecane droplets. In the case of nanofuels, intense heat release from the enveloping flame leads to the formation of micron-size aggregates (of alumina NPS) which serve as nucleation sites promoting heterogeneous boiling. Three boiling regimes (A, B, and C) have been identified with varying bubble dynamics. We have deciphered key mechanisms responsible for the growth, transport, and rupture of the bubbles. Bubble rupture causes ejections of liquid droplets termed as secondary atomization. Ejection of small bubbles (mode 1) resembles the classical vapour bubble collapse mechanism near a flat free surface. However, large bubbles induce severe shape deformations as well as bulk oscillations. Rupture of large bubbles results in high speed liquid jet formation which undergoes Rayleigh-Plateau tip break-up. Both modes contribute towards direct fuel transfer from the droplet surface to flame envelope bypassing diffusion limitations. Combustion lifetime of nanofuel droplets consequently has two stages: stage I (where bubble dynamics are dominant) and stage II (formation of gelatinous mass due to continuous fuel depletion; NP agglomeration). In the present work, variation of flame dynamics and spatio-temporal heat release (HR) have been analysed using high speed OH* chemiluminescence imaging. Fluctuations in droplet shape and flame heat release are found to be well correlated. Droplet flame is bifurcated in two zones (I and II). Flame response is

Gaussian Finite Element Method for Description of Underwater Sound Diffraction

NASA Astrophysics Data System (ADS)

Huang, Dehua

A new method for solving diffraction problems is presented in this dissertation. It is based on the use of Gaussian diffraction theory. The Rayleigh integral is used to prove the core of Gaussian theory: the diffraction field of a Gaussian is described by a Gaussian function. The parabolic approximation used by previous authors is not necessary to this proof. Comparison of the Gaussian beam expansion and Fourier series expansion reveals that the Gaussian expansion is a more general and more powerful technique. The method combines the Gaussian beam superposition technique (Wen and Breazeale, J. Acoust. Soc. Am. 83, 1752-1756 (1988)) and the Finite element solution to the parabolic equation (Huang, J. Acoust. Soc. Am. 84, 1405-1413 (1988)). Computer modeling shows that the new method is capable of solving for the sound field even in an inhomogeneous medium, whether the source is a Gaussian source or a distributed source. It can be used for horizontally layered interfaces or irregular interfaces. Calculated results are compared with experimental results by use of a recently designed and improved Gaussian transducer in a laboratory water tank. In addition, the power of the Gaussian Finite element method is demonstrated by comparing numerical results with experimental results from use of a piston transducer in a water tank.

Optical-diffraction method for determining crystal orientation

DOEpatents

Sopori, B.L.

1982-05-07

Disclosed is an optical diffraction technique for characterizing the three-dimensional orientation of a crystal sample. An arbitrary surface of the crystal sample is texture etched so as to generate a pseudo-periodic diffraction grating on the surface. A laser light beam is then directed onto the etched surface, and the reflected light forms a farfield diffraction pattern in reflection. Parameters of the diffraction pattern, such as the geometry and angular dispersion of the diffracted beam are then related to grating shape of the etched surface which is in turn related to crystal orientation. This technique may be used for examining polycrystalline silicon for use in solar cells.

A mechanical-force-driven physical vapour deposition approach to fabricating complex hydride nanostructures.

PubMed

Pang, Yuepeng; Liu, Yongfeng; Gao, Mingxia; Ouyang, Liuzhang; Liu, Jiangwen; Wang, Hui; Zhu, Min; Pan, Hongge

2014-03-24

Nanoscale hydrides desorb and absorb hydrogen at faster rates and lower temperatures than bulk hydrides because of their high surface areas, abundant grain boundaries and short diffusion distances. No current methods exist for the direct fabrication of nanoscale complex hydrides (for example, alanates, borohydrides) with unique morphologies because of their extremely high reducibility, relatively low thermodynamic stability and complicated elemental composition. Here, we demonstrate a mechanical-force-driven physical vapour deposition procedure for preparing nanoscale complex hydrides without scaffolds or supports. Magnesium alanate nanorods measuring 20-40 nm in diameter and lithium borohydride nanobelts measuring 10-40 nm in width are successfully synthesised on the basis of the one-dimensional structure of the corresponding organic coordination polymers. The dehydrogenation kinetics of the magnesium alanate nanorods are improved, and the nanorod morphology persists through the dehydrogenation-hydrogenation process. Our findings may facilitate the fabrication of such hydrides with improved hydrogen storage properties for practical applications.

A mechanical-force-driven physical vapour deposition approach to fabricating complex hydride nanostructures

NASA Astrophysics Data System (ADS)

Pang, Yuepeng; Liu, Yongfeng; Gao, Mingxia; Ouyang, Liuzhang; Liu, Jiangwen; Wang, Hui; Zhu, Min; Pan, Hongge

2014-03-01

Nanoscale hydrides desorb and absorb hydrogen at faster rates and lower temperatures than bulk hydrides because of their high surface areas, abundant grain boundaries and short diffusion distances. No current methods exist for the direct fabrication of nanoscale complex hydrides (for example, alanates, borohydrides) with unique morphologies because of their extremely high reducibility, relatively low thermodynamic stability and complicated elemental composition. Here, we demonstrate a mechanical-force-driven physical vapour deposition procedure for preparing nanoscale complex hydrides without scaffolds or supports. Magnesium alanate nanorods measuring 20-40 nm in diameter and lithium borohydride nanobelts measuring 10-40 nm in width are successfully synthesised on the basis of the one-dimensional structure of the corresponding organic coordination polymers. The dehydrogenation kinetics of the magnesium alanate nanorods are improved, and the nanorod morphology persists through the dehydrogenation-hydrogenation process. Our findings may facilitate the fabrication of such hydrides with improved hydrogen storage properties for practical applications.

Multi-wavelength speckle reduction for laser pico-projectors using diffractive optics

NASA Astrophysics Data System (ADS)

Thomas, Weston H.

Personal electronic devices, such as cell phones and tablets, continue to decrease in size while the number of features and add-ons keep increasing. One particular feature of great interest is an integrated projector system. Laser pico-projectors have been considered, but the technology has not been developed enough to warrant integration. With new advancements in diode technology and MEMS devices, laser-based projection is currently being advanced for pico-projectors. A primary problem encountered when using a pico-projector is coherent interference known as speckle. Laser speckle can lead to eye irritation and headaches after prolonged viewing. Diffractive optical elements known as diffusers have been examined as a means to lower speckle contrast. Diffusers are often rotated to achieve temporal averaging of the spatial phase pattern provided by diffuser surface. While diffusers are unable to completely eliminate speckle, they can be utilized to decrease the resultant contrast to provide a more visually acceptable image. This dissertation measures the reduction in speckle contrast achievable through the use of diffractive diffusers. A theoretical Fourier optics model is used to provide the diffuser's stationary and in-motion performance in terms of the resultant contrast level. Contrast measurements of two diffractive diffusers are calculated theoretically and compared with experimental results. In addition, a novel binary diffuser design based on Hadamard matrices will be presented. Using two static in-line Hadamard diffusers eliminates the need for rotation or vibration of the diffuser for temporal averaging. Two Hadamard diffusers were fabricated and contrast values were subsequently measured, showing good agreement with theory and simulated values. Monochromatic speckle contrast values of 0.40 were achieved using the Hadamard diffusers. Finally, color laser projection devices require the use of red, green, and blue laser sources; therefore, using a

The speed of sound in a gas–vapour bubbly liquid

PubMed Central

Prosperetti, Andrea

2015-01-01

In addition to the vapour of the liquid, bubbles in cavitating flows usually contain also a certain amount of permanent gas that diffuses out of the liquid as they grow. This paper presents a simplified linear model for the propagation of monochromatic pressure waves in a bubbly liquid with these characteristics. Phase change effects are included in detail, while the gas is assumed to follow a polytropic law. It is shown that even a small amount of permanent gas can have a major effect on the behaviour of the system. Particular attention is paid to the low-frequency range, which is of special concern in flow cavitation. Numerical results for water and liquid oxygen illustrate the implications of the model. PMID:26442146

The speed of sound in a gas-vapour bubbly liquid.

PubMed

Prosperetti, Andrea

2015-10-06

In addition to the vapour of the liquid, bubbles in cavitating flows usually contain also a certain amount of permanent gas that diffuses out of the liquid as they grow. This paper presents a simplified linear model for the propagation of monochromatic pressure waves in a bubbly liquid with these characteristics. Phase change effects are included in detail, while the gas is assumed to follow a polytropic law. It is shown that even a small amount of permanent gas can have a major effect on the behaviour of the system. Particular attention is paid to the low-frequency range, which is of special concern in flow cavitation. Numerical results for water and liquid oxygen illustrate the implications of the model.

Spectral characteristics of multimode semiconductor lasers with a high-order surface diffraction grating

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zolotarev, V V; Leshko, A Yu; Pikhtin, N A

2014-10-31

We have studied the spectral characteristics of multimode semiconductor lasers with high-order surface diffraction gratings based on asymmetric separate-confinement heterostructures grown by metalorganic vapour phase epitaxy (λ = 1070 nm). Experimental data demonstrate that, in the temperature range ±50 °C, the laser emission spectrum is ∼5 Å in width and contains a fine structure of longitudinal and transverse modes. A high-order (m = 15) surface diffraction grating is shown to ensure a temperature stability of the lasing spectrum dλ/dT = 0.9 Å K{sup -1} in this temperature range. From analysis of the fine structure of the lasing spectrum, we havemore » evaluated the mode spacing and, thus, experimentally determined the effective length of the Bragg diffraction grating, which was ∼400 μm in our samples. (lasers)« less

Crystallization and preliminary X-ray diffraction studies of Seneca Valley Virus-001, a new member of the Picornaviridae family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venkataraman, Sangita; Reddy, Seshidhar P.; Loo, Jackie

2008-04-01

Seneca Valley Virus-001 of the Picornavirdae family was crystallized in the space group R3 and X-ray diffraction data was collected to a resolution of 2.3 Å. Rotation-function studies suggested the presence of two distict sets of 20 protomers that belong to two different virus particles in the crystallographic asymmetric unit. Seneca Valley Virus-001 (SVV-001) is a newly found species in the Picornaviridae family. SVV-001 is the first naturally occurring nonpathogenic picorna@@virus observed to mediate selective cytotoxicity towards tumor cells with neuroendocrine cancer features. The nonsegmented (+)ssRNA genome of SVV-001 shares closest sequence similarity to the genomes of the members ofmore » the Cardiovirus genus. However, based on the distinct characteristics of the genome organization and other biochemical properties, it has been suggested that SVV-001 represents a new genus, namely ‘Senecavirus’, in the Picornaviridae family. In order to understand the oncolytic properties of SVV-001, the native virus was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group R3, with unit-cell parameters (in the hexagonal setting) a = b = 311.5, c = 1526.4 Å. Although the SVV crystals diffracted to better than 2.3 Å resolution, the data quality is acceptable [I/σ(I) > 2.0] to 2.6 Å resolution. The unit-cell volume and the locked rotation-function analysis suggest that six particles could be accommodated in the unit cell, with two distinct sets of one third of a particle, each containing 20 protomers, occupying the crystallographic asymmetric unit.« less

2010 Diffraction Methods in Structural Biology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dr. Ana Gonzalez

2011-03-10

Advances in basic methodologies have played a major role in the dramatic progress in macromolecular crystallography over the past decade, both in terms of overall productivity and in the increasing complexity of the systems being successfully tackled. The 2010 Gordon Research Conference on Diffraction Methods in Structural Biology will, as in the past, focus on the most recent developments in methodology, covering all aspects of the process from crystallization to model building and refinement, complemented by examples of structural highlights and complementary methods. Extensive discussion will be encouraged and it is hoped that all attendees will participate by giving oralmore » or poster presentations, the latter using the excellent poster display area available at Bates College. The relatively small size and informal atmosphere of the meeting provides an excellent opportunity for all participants, especially younger scientists, to meet and exchange ideas with leading methods developers.« less

Chemical vapour deposition growth of carbon nanotube forests: kinetics, morphology, composition, and their mechanisms

NASA Astrophysics Data System (ADS)

Vinten, Phillip

This thesis analyzes the chemical vapour deposition (CVD) growth of vertically aligned carbon nanotube (CNT) forests in order to understand how CNT forests grow, why they stop growing, and how to control the properties of the synthesized CNTs. in situ kinetics data of the growth of CNT forests are gathered by in situ optical microscopy. The overall morphology of the forests and the characteristics of the individual CNTs in the forests are investigated using scanning electron microscopy and Raman spectroscopy. The in situ data show that forest growth and termination are activated processes (with activation energies on the order of 1 eV), suggesting a possible chemical origin. The activation energy changes at a critical temperature for ethanol CVD (approximately 870°C). These activation energies and critical temperature are also seen in the temperature dependence of several important characteristics of the CNTs, including the defect density as determined by Raman spectroscopy. This observation is seen across several CVD processes and suggests a mechanism of defect healing. The CNT diameter also depends on the growth temperature. In this thesis, a thermodynamic model is proposed. This model predicts a temperature and pressure dependence of the CNT diameter from the thermodynamics of the synthesis reaction and the effect of strain on the enthalpy of formation of CNTs. The forest morphology suggests significant interaction between the constituent CNTs. These interactions may play a role in termination. The morphology, in particular a microscale rippling feature that is capable of diffracting light, suggest a non-uniform growth rate across the forest. A gas phase diffusion model predicts a non-uniform distribution of the source gas. This gas phase diffusion is suggested as a possible explanation for the non-uniform growth rate. The gas phase diffusion is important because growth by acetylene CVD is found to be very efficient (approximately 30% of the acetylene is

Method and apparatus for reducing diffraction-induced damage in high power laser amplifier systems

DOEpatents

Campillo, Anthony J.; Newnam, Brian E.; Shapiro, Stanley L.; Terrell, Jr., N. James

1976-01-01

Self-focusing damage caused by diffraction in laser amplifier systems may be minimized by appropriately tailoring the input optical beam profile by passing the beam through an aperture having a uniform high optical transmission within a particular radius r.sub.o and a transmission which drops gradually to a low value at greater radii. Apertures having the desired transmission characteristics may readily be manufactured by exposing high resolution photographic films and plates to a diffuse, disk-shaped light source and mask arrangement.

Purification, crystallization and preliminary X-ray diffraction analysis of a soluble variant of the monoglyceride lipase Yju3p from the yeast Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rengachari, Srinivasan; Aschauer, Philipp; Sturm, Christian

A soluble variant of the monoglyceride lipase Yju3p was successfully expressed, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. The protein Yju3p is the orthologue of monoglyceride lipases in the yeast Saccharomyces cerevisiae. A soluble variant of this lipase termed s-Yju3p (38.3 kDa) was generated and purified to homogeneity by affinity and size-exclusion chromatography. s-Yju3p was crystallized in a vapour-diffusion setup at 293 K and a complete data set was collected to 2.4 Å resolution. The crystal form was orthorhombic (space group P2{sub 1}2{sub 1}2{sub 1}), with unit-cell parameters a = 77.2, b = 108.6, c =more » 167.7 Å. The asymmetric unit contained four molecules with a solvent content of 46.4%.« less

Crystallization and X-ray diffraction analysis of the HMG domain of the chondrogenesis master regulator Sox9 in complex with a ChIP-Seq-identified DNA element

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vivekanandan, Saravanan; Moovarkumudalvan, Balasubramanian; Lescar, Julien

Sox9 is a fundamental sex-determining gene and the master regulator of chondrogenesis, and is involved in the development of various vital organs such as testes, kidney, heart and brain, and in skeletal development. Similar to other known Sox transcription factors, Sox9 recognizes and binds DNA with the consensus sequence C(T/A)TTG(T/A)(T/A) through the highly conserved HMG domain. Nonetheless, the molecular basis of the functional specificity of Sox9 in key developmental processes is still unclear. As an initial step towards a mechanistic understanding of Sox9 transcriptional regulation, the current work describes the details of the purification of the mouse Sox9 HMG domainmore » (mSox9HMG), its crystallization in complex with a ChIP-Seq-identified FOXP2 promoter DNA element and the X-ray diffraction data analysis of this complex. The mSox9HMG–FOXP2 promoter DNA complex was crystallized by the hanging-drop vapour-diffusion method using 20% PEG 3350 in 200 mMsodium/potassium phosphate with 100 mMbis-tris propane at pH 8.5. The crystals diffracted to 2.7 Å resolution and the complex crystallized in the tetragonal space groupP4 12 12, with unit-cell parametersa=b= 99.49,c= 45.89 Å. Crystal-packing parameters revealed that asymmetric unit contained one mSox9HMG–FOXP2 promoter DNA complex with an estimated solvent content of 64%.« less

Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

2016-11-15

Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, βmore » = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.« less

No sodium in the vapour plumes of Enceladus.

PubMed

Schneider, Nicholas M; Burger, Matthew H; Schaller, Emily L; Brown, Michael E; Johnson, Robert E; Kargel, Jeffrey S; Dougherty, Michele K; Achilleos, Nicholas A

2009-06-25

The discovery of water vapour and ice particles erupting from Saturn's moon Enceladus fuelled speculation that an internal ocean was the source. Alternatively, the source might be ice warmed, melted or crushed by tectonic motions. Sodium chloride (that is, salt) is expected to be present in a long-lived ocean in contact with a rocky core. Here we report a ground-based spectroscopic search for atomic sodium near Enceladus that places an upper limit on the mixing ratio in the vapour plumes orders of magnitude below the expected ocean salinity. The low sodium content of escaping vapour, together with the small fraction of salt-bearing particles, argues against a situation in which a near-surface geyser is fuelled by a salty ocean through cracks in the crust. The lack of observable sodium in the vapour is consistent with a wide variety of alternative eruption sources, including a deep ocean, a freshwater reservoir, or ice. The existing data may be insufficient to distinguish between these hypotheses.

Prediction of vapour-liquid and vapour-liquid-liquid equilibria of nitrogen-hydrocarbon mixtures used in J-T refrigerators

NASA Astrophysics Data System (ADS)

Narayanan, Vineed; Venkatarathnam, G.

2018-03-01

Nitrogen-hydrocarbon mixtures are widely used as refrigerants in J-T refrigerators operating with mixtures, as well as in natural gas liquefiers. The Peng-Robinson equation of state has traditionally been used to simulate the above cryogenic process. Multi parameter Helmholtz energy equations are now preferred for determining the properties of natural gas. They have, however, been used only to predict vapour-liquid equilibria, and not vapour-liquid-liquid equilibria that can occur in mixtures used in cryogenic mixed refrigerant processes. In this paper the vapour-liquid equilibrium of binary mixtures of nitrogen-methane, nitrogen-ethane, nitrogen-propane, nitrogen-isobutane and three component mixtures of nitrogen-methane-ethane and nitrogen-methane-propane have been studied with the Peng-Robinson and the Helmholtz energy equations of state of NIST REFPROP and compared with experimental data available in the literature.

Characterization of aqueous interactions of copper-doped phosphate-based glasses by vapour sorption.

PubMed

Stähli, Christoph; Shah Mohammadi, Maziar; Waters, Kristian E; Nazhat, Showan N

2014-07-01

Owing to their adjustable dissolution properties, phosphate-based glasses (PGs) are promising materials for the controlled release of bioinorganics, such as copper ions. This study describes a vapour sorption method that allowed for the investigation of the kinetics and mechanisms of aqueous interactions of PGs of the formulation 50P2O5-30CaO-(20-x)Na2O-xCuO (x=0, 1, 5 and 10mol.%). Initial characterization was performed using (31)P magic angle spinning nuclear magnetic resonance and attenuated total reflectance-Fourier transform infrared spectroscopy. Increasing CuO content resulted in chemical shifts of the predominant Q(2) NMR peak and of the (POP)as and (PO(-)) Fourier transform infrared absorptions, owing to the higher strength of the POCu bond compared to PONa. Vapour sorption and desorption were gravimetrically measured in PG powders exposed to variable relative humidity (RH). Sorption was negligible below 70% RH and increased exponentially with RH from 70 to 90%, where it exhibited a negative correlation with CuO content. Vapour sorption in 0% and 1% CuO glasses resulted in phosphate chain hydration and hydrolysis, as evidenced by protonated Q(0)(1H) and Q(1)(1H) species. Dissolution rates in deionized water showed a linear correlation (R(2)>0.99) with vapour sorption. Furthermore, cation release rates could be predicted based on dissolution rates and PG composition. The release of orthophosphate and short polyphosphate species corroborates the action of hydrolysis and was correlated with pH changes. In conclusion, the agreement between vapour sorption and routine characterization techniques in water demonstrates the potential of this method for the study of PG aqueous reactions. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Hybrid finite element and Brownian dynamics method for diffusion-controlled reactions.

PubMed

Bauler, Patricia; Huber, Gary A; McCammon, J Andrew

2012-04-28

Diffusion is often the rate determining step in many biological processes. Currently, the two main computational methods for studying diffusion are stochastic methods, such as Brownian dynamics, and continuum methods, such as the finite element method. This paper proposes a new hybrid diffusion method that couples the strengths of each of these two methods. The method is derived for a general multidimensional system, and is presented using a basic test case for 1D linear and radially symmetric diffusion systems.

Magnesium isotope evidence that accretional vapour loss shapes planetary compositions

PubMed Central

Hin, Remco C.; Coath, Christopher D.; Carter, Philip J.; Nimmo, Francis; Lai, Yi-Jen; Pogge von Strandmann, Philip A.E.; Willbold, Matthias; Leinhardt, Zoë M.; Walter, Michael J.; Elliott, Tim

2017-01-01

It has long been recognised that Earth and other differentiated planetary bodies are chemically fractionated compared to primitive, chondritic meteorites and by inference the primordial disk from which they formed. An important question has been whether the notable volatile depletions of planetary bodies are a consequence of accretion1, or inherited from prior nebular fractionation2. The isotopic compositions of the main constituents of planetary bodies can contribute to this debate3–6. Using a new analytical approach to address key issues of accuracy inherent in conventional methods, we show that all differentiated bodies have isotopically heavier magnesium compositions than chondritic meteorites. We argue that possible magnesium isotope fractionation during condensation of the solar nebula, core formation and silicate differentiation cannot explain these observations. However, isotopic fractionation between liquid and vapour followed by vapour escape during accretionary growth of planetesimals generates appropriate residual compositions. Our modelling implies that the isotopic compositions of Mg, Si and Fe and the relative abundances of the major elements of Earth, and other planetary bodies, are a natural consequence of substantial (~40% by mass) vapour loss from growing planetesimals by this mechanism. PMID:28959965

Purification, crystallization and preliminary X-ray diffraction of SecDF, a translocon-associated membrane protein, from Thermus thermophilus

PubMed Central

Tsukazaki, Tomoya; Mori, Hiroyuki; Fukai, Shuya; Numata, Tomoyuki; Perederina, Anna; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo; Vassylyev, Dmitry G.; Nureki, Osamu; Ito, Koreaki

2006-01-01

Thermus thermophilus has a multi-path membrane protein, TSecDF, as a single-chain homologue of Escherichia coli SecD and SecF, which form a translocon-associated complex required for efficient preprotein translocation and membrane-protein integration. Here, the cloning, expression in E. coli, purification and crystallization of TSecDF are reported. Overproduced TSecDF was solubilized with dodecylmaltoside, chromatographically purified and crystallized by vapour diffusion in the presence of polyethylene glycol. The crystals yielded a maximum resolution of 4.2 Å upon X-ray irradiation, revealing that they belonged to space group P43212. Attempts were made to improve the diffraction quality of the crystals by combinations of micro-stirring, laser-light irradiation and dehydration, which led to the eventual collection of complete data sets at 3.74 Å resolution and preliminary success in the single-wavelength anomalous dispersion analysis. These results provide information that is essential for the determination of the three-dimensional structure of this important membrane component of the protein-translocation machinery. PMID:16582489

Infiltrating a thin or single-layer opal with an atomic vapour: Sub-Doppler signals and crystal optics

NASA Astrophysics Data System (ADS)

Moufarej, Elias; Maurin, Isabelle; Zabkov, Ilya; Laliotis, Athanasios; Ballin, Philippe; Klimov, Vasily; Bloch, Daniel

2014-10-01

Artificial thin glass opals can be infiltrated with a resonant alkali-metal vapour, providing novel types of hybrid systems. The reflection at the interface between the substrate and the opal yields a resonant signal, which exhibits sub-Doppler structures in linear spectroscopy for a range of oblique incidences. This result is suspected to originate in an effect of the three-dimensional confinement of the vapour in the opal interstices. It is here extended to a situation where the opal is limited to a few- or even a single-layer opal film, which is a kind of bidimensional grating. We have developed a flexible one-dimensional layered optical model, well suited for a Langmuir-Blodgett opal. Once extended to the case of a resonant infiltration, the model reproduces quick variations of the lineshape with incidence angle or polarization. Alternately, for an opal limited to a single layer of identical spheres, a three-dimensional numerical calculation was developed. It predicts crystalline anisotropy, which is demonstrated through diffraction on an empty opal made of a single layer of polystyrene spheres.

A Calibration of the MeteoSwiss RAman Lidar for Meteorological Observations (RALMO)Water Vapour Mixing Ratio Measurements using a Radiosonde Trajectory Method

NASA Astrophysics Data System (ADS)

Hicks-Jalali, Shannon; Sica, R. J.; Haefele, Alexander; Martucci, Giovanni

2018-04-01

With only 50% downtime from 2007-2016, the RALMO lidar in Payerne, Switzerland, has one of the largest continuous lidar data sets available. These measurements will be used to produce an extensive lidar water vapour climatology using the Optimal Estimation Method introduced by Sica and Haefele (2016). We will compare our improved technique for external calibration using radiosonde trajectories with the standard external methods, and present the evolution of the lidar constant from 2007 to 2016.

Infrared Laser Optoacoustic Detection Of Gases And Vapours

NASA Astrophysics Data System (ADS)

Johnson, S. A.; Cummins, P. G.; Bone, S. A.; Davies, P. B.

1988-10-01

Mid-infrared laser optoacoustic spectroscopy has been used to detect a variety of gases and vapours. Performance was calibrated using the signal from a known concentration of ethene, and then the method applied to the perfume alcohol geraniol. Detection limits were found to be 1 ppb for ethene and 70 ppb for geraniol on their strongest absorption lines for a few seconds measurement time.

Diffusion via space discretization method to study the concentration dependence of self-diffusivity under confinement

NASA Astrophysics Data System (ADS)

Sant, Marco; Papadopoulos, George K.; Theodorou, Doros N.

2010-04-01

The concentration dependence of self-diffusivity is investigated by means of a novel method, extending our previously developed second-order Markov process model to periodic media. Introducing the concept of minimum-crossing surface, we obtain a unique decomposition of the self-diffusion coefficient into two parameters with specific physical meanings. Two case studies showing a maximum in self-diffusivity as a function of concentration are investigated, along with two cases where such a maximum cannot be present. Subsequently, the method is applied to the large cavity pore network of the ITQ-1 (Mobil tWenty tWo, MWW) zeolite for methane (displaying a maximum in self-diffusivity) and carbon dioxide (no maximum), explaining the diffusivity trend on the basis of the evolution of the model parameters as a function of concentration.

Coherent X-ray diffraction imaging of zinc oxide crystals

NASA Astrophysics Data System (ADS)

Leake, S. J.

Zinc Oxide (ZnO) exhibits a plethora of physical properties potentially advantageous in many roles and is why it one of the most studied semiconductor compounds. When doped or in its intrinsic state ZnO demonstrates a multitude of electronic, optical and magnetic properties in a large variety of manufacturable morphologies. Thus it is inherently important to understand why these properties arise and the impact potentially invasive sample preparation methods have for both the function and durability of the material and its devices. Coherent X-ray Diffraction Imaging (CXDI) is a recently established non-destructive technique which can probe the whole three dimensional structure of small crystalline materials and has the potential for sub angstrom strain resolution. The iterative methods employed to overcome the `phase problem' are described fully. CXDI studies of wurtzite ZnO crystals in the rod morphology with high aspect ratio are presented. ZnO rods synthesised via Chemical Vapour Transport Deposition were studied in post growth state and during in-situ modification via metal evaporation processing and annealing. Small variations in post growth state were observed, the physical origin of which remains unidentified. The doping of a ZnO crystal with Iron, Nickel and Cobalt by thermal evaporation and subsequent annealing was studied. The evolution of diffusing ions into the crystal lattice from was not observed, decomposition was found to be the dominant process. Improvements in experimental technique allowed multiple Bragg reflections from a single ZnO crystal to be measured for the first time. Large aspect ratio ZnO rods were used to probe the coherence properties of the incident beam. The longitudinal coherence function of the illuminating radiation was mapped using the visibility of the interference pattern at each bragg reflection and an accurate estimate of the longitudinal coherence length obtained, xi(L) = 0.66pm 0.02 mu m. The consequences for data analysis

Modeling laser beam diffraction and propagation by the mode-expansion method.

PubMed

Snyder, James J

2007-08-01

In the mode-expansion method for modeling propagation of a diffracted beam, the beam at the aperture can be expanded as a weighted set of orthogonal modes. The parameters of the expansion modes are chosen to maximize the weighting coefficient of the lowest-order mode. As the beam propagates, its field distribution can be reconstructed from the set of weighting coefficients and the Gouy phase of the lowest-order mode. We have developed a simple procedure to implement the mode-expansion method for propagation through an arbitrary ABCD matrix, and we have demonstrated that it is accurate in comparison with direct calculations of diffraction integrals and much faster.

Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurz, M.; Iturbe-Ormaetxe, I.; Jarrott, R.

2008-02-01

The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, bmore » = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.« less

Numerical Simulation of Pulsation Flow in the Vapour Channel of Short Low Temperature Heat Pipes at High Heat Loads

NASA Astrophysics Data System (ADS)

Seryakov, A. V.; Konkin, A. V.

2017-11-01

The results of the numerical simulation of pulsations in the Laval-liked vapour channel of short low-temperature range heat pipes (HPs) are presented. The numerical results confirmed the experimentally obtained increase of the frequency of pulsations in the vapour channel of short HPs with increasing overheat of the porous evaporator relative to the boiling point of the working fluid. The occurrence of pressure pulsations inside the vapour channel in a short HPs is a complex phenomenon associated with the boiling beginning in the capillary-porous evaporator at high heat loads, and appearance the excess amount of vapour above it, leading to the increase in pressure P to a value at which the boiling point TB of the working fluid becomes higher than the evaporator temperature Tev. Vapour clot spreads through the vapour channel and condense, and then a rarefaction wave return from condenser in the evaporator, the boiling in which is resumed and the next cycle of the pulsations is repeated. Numerical simulation was performed using finite element method implemented in the commercial program ANSYS Multiphisics 14.5 in the two-dimensional setting of axis symmetric moist vapour flow with third kind boundary conditions.

Polymeric hydrogen diffusion barrier, high-pressure storage tank so equipped, method of fabricating a storage tank and method of preventing hydrogen diffusion

DOEpatents

Lessing, Paul A [Idaho Falls, ID

2008-07-22

An electrochemically active hydrogen diffusion barrier which comprises an anode layer, a cathode layer, and an intermediate electrolyte layer, which is conductive to protons and substantially impermeable to hydrogen. A catalytic metal present in or adjacent to the anode layer catalyzes an electrochemical reaction that converts any hydrogen that diffuses through the electrolyte layer to protons and electrons. The protons and electrons are transported to the cathode layer and reacted to form hydrogen. The hydrogen diffusion barrier is applied to a polymeric substrate used in a storage tank to store hydrogen under high pressure. A storage tank equipped with the electrochemically active hydrogen diffusion barrier, a method of fabricating the storage tank, and a method of preventing hydrogen from diffusing out of a storage tank are also disclosed.

Polymeric hydrogen diffusion barrier, high-pressure storage tank so equipped, method of fabricating a storage tank and method of preventing hydrogen diffusion

DOEpatents

Lessing, Paul A.

2004-09-07

An electrochemically active hydrogen diffusion barrier which comprises an anode layer, a cathode layer, and an intermediate electrolyte layer, which is conductive to protons and substantially impermeable to hydrogen. A catalytic metal present in or adjacent to the anode layer catalyzes an electrochemical reaction that converts any hydrogen that diffuses through the electrolyte layer to protons and electrons. The protons and electrons are transported to the cathode layer and reacted to form hydrogen. The hydrogen diffusion barrier is applied to a polymeric substrate used in a storage tank to store hydrogen under high pressure. A storage tank equipped with the electrochemically active hydrogen diffusion barrier, a method of fabricating the storage tank, and a method of preventing hydrogen from diffusing out of a storage tank are also disclosed.

Analysis of corrosion layers on protective coatings and high temperature materials in simulated service environments of modern power plants using SNMS, SIMS, SEM, TEM, RBS and X-ray diffraction studies.

PubMed

Nickel, H; Quadakkers, W J; Singheiser, L

2002-10-01

In three different examples, the effects of the oxidation behaviour as well as the microstructural stability of high temperature materials and protective coatings was determined by combining the results of kinetic studies with extensive analytical investigations using, among other techniques, SNMS, SIMS, SEM, TEM, Rutherford back scattering (RBS) as well as X-ray diffraction. 1). The effect of water vapour on the oxidation behaviour of 9% Cr steels in simulated combustion gases has been determined. The effects of O2 and H2O content on the oxidation behaviour of 9% Cr steel in the temperature range 600-800 degrees C showed that in dry oxygen a protective scale was formed with an oxidation rate controlled by diffusion in the protective scale. In the presence of water vapour, after an incubation period, the scales became non-protective as a result of a change in the oxidation limiting process. The destruction of the protective scale by water vapour does not only depend on H2O content but also on the H2O/O2-ratio. 2). The increase of component surface temperature in modern gas turbines leads to an enhanced oxidation attack of the blade coating. Improvements in corrosion resistance and longer lifetime thermal barrier coatings in gas turbines have been achieved by improvement of the high temperature properties of MCrAlY coatings by additions of minor alloying elements such as yttrium, silicon and titanium. 3). The use of oxide dispersion strengthened (ODS) alloys provides excellent creep resistance up to much higher temperatures than can be achieved with conventional wrought or cast alloys in combination with suitable high temperature oxidation/corrosion resistance. Investigation of the growth mechanisms of protective chromia and alumina scales were examined by a two-stage oxidation method with 18O tracer. The distribution of the oxygen isotopes in the oxide scale was determined by SIMS and SNMS. The results show the positive influence of a Y2O3 dispersion on the

Three-dimensional Diffusive Strip Method

NASA Astrophysics Data System (ADS)

Martinez-Ruiz, Daniel; Meunier, Patrice; Duchemin, Laurent; Villermaux, Emmanuel

2016-11-01

The Diffusive Strip Method (DSM) is a near-exact numerical method developed for mixing computations at large Péclet number in two-dimensions. The method consists in following stretched material lines to compute a-posteriori the resulting scalar field is extended here to three-dimensional flows, following surfaces. We describe its 3D peculiarities, and show how it applies to a simple Taylor-Couette configuration with non-rotating boundary conditions at the top end, bottom and outer cylinder. This flow produces an elaborate, although controlled, steady 3D flow which relies on the Ekman pumping arising from the rotation of the inner cylinder is both studied experimentally, and numerically modeled. A recurrent two-cells structure appears formed by stream tubes shaped as nested tori. A scalar blob in the flow experiences a Lagrangian oscillating dynamics with stretchings and compressions, driving the mixing process, and yielding both rapidly-mixed and nearly pure-diffusive regions. A triangulated-surface method is developed to calculate the blob elongation and scalar concentration PDFs through a single variable computation along the advected blob surface, capturing the rich evolution observed in the experiments.

Near-field diffraction from amplitude diffraction gratings: theory, simulation and results

NASA Astrophysics Data System (ADS)

Abedin, Kazi Monowar; Rahman, S. M. Mujibur

2017-08-01

We describe a computer simulation method by which the complete near-field diffract pattern of an amplitude diffraction grating can be generated. The technique uses the method of iterative Fresnel integrals to calculate and generate the diffraction images. Theoretical background as well as the techniques to perform the simulation is described. The program is written in MATLAB, and can be implemented in any ordinary PC. Examples of simulated diffraction images are presented and discussed. The generated images in the far-field where they reduce to Fraunhofer diffraction pattern are also presented for a realistic grating, and compared with the results predicted by the grating equation, which is applicable in the far-field. The method can be used as a tool to teach the complex phenomenon of diffraction in classrooms.

The millennium water vapour drop in chemistry-climate model simulations

NASA Astrophysics Data System (ADS)

Brinkop, Sabine; Dameris, Martin; Jöckel, Patrick; Garny, Hella; Lossow, Stefan; Stiller, Gabriele

2016-07-01

This study investigates the abrupt and severe water vapour decline in the stratosphere beginning in the year 2000 (the "millennium water vapour drop") and other similarly strong stratospheric water vapour reductions by means of various simulations with the state-of-the-art Chemistry-Climate Model (CCM) EMAC (ECHAM/MESSy Atmospheric Chemistry Model). The model simulations differ with respect to the prescribed sea surface temperatures (SSTs) and whether nudging is applied or not. The CCM EMAC is able to most closely reproduce the signature and pattern of the water vapour drop in agreement with those derived from satellite observations if the model is nudged. Model results confirm that this extraordinary water vapour decline is particularly obvious in the tropical lower stratosphere and is related to a large decrease in cold point temperature. The drop signal propagates under dilution to the higher stratosphere and to the poles via the Brewer-Dobson circulation (BDC). We found that the driving forces for this significant decline in water vapour mixing ratios are tropical sea surface temperature (SST) changes due to a coincidence with a preceding strong El Niño-Southern Oscillation event (1997/1998) followed by a strong La Niña event (1999/2000) and supported by the change of the westerly to the easterly phase of the equatorial stratospheric quasi-biennial oscillation (QBO) in 2000. Correct (observed) SSTs are important for triggering the strong decline in water vapour. There are indications that, at least partly, SSTs contribute to the long period of low water vapour values from 2001 to 2006. For this period, the specific dynamical state of the atmosphere (overall atmospheric large-scale wind and temperature distribution) is important as well, as it causes the observed persistent low cold point temperatures. These are induced by a period of increased upwelling, which, however, has no corresponding pronounced signature in SSTs anomalies in the tropics. Our free

Computational methods for diffusion-influenced biochemical reactions.

PubMed

Dobrzynski, Maciej; Rodríguez, Jordi Vidal; Kaandorp, Jaap A; Blom, Joke G

2007-08-01

We compare stochastic computational methods accounting for space and discrete nature of reactants in biochemical systems. Implementations based on Brownian dynamics (BD) and the reaction-diffusion master equation are applied to a simplified gene expression model and to a signal transduction pathway in Escherichia coli. In the regime where the number of molecules is small and reactions are diffusion-limited predicted fluctuations in the product number vary between the methods, while the average is the same. Computational approaches at the level of the reaction-diffusion master equation compute the same fluctuations as the reference result obtained from the particle-based method if the size of the sub-volumes is comparable to the diameter of reactants. Using numerical simulations of reversible binding of a pair of molecules we argue that the disagreement in predicted fluctuations is due to different modeling of inter-arrival times between reaction events. Simulations for a more complex biological study show that the different approaches lead to different results due to modeling issues. Finally, we present the physical assumptions behind the mesoscopic models for the reaction-diffusion systems. Input files for the simulations and the source code of GMP can be found under the following address: http://www.cwi.nl/projects/sic/bioinformatics2007/

In-situ, time resolved monitoring of uranium in BFS:OPC grout. Part 1: Corrosion in water vapour.

PubMed

Stitt, C A; Paraskevoulakos, C; Banos, A; Harker, N J; Hallam, K R; Davenport, A; Street, S; Scott, T B

2017-08-11

Uranium encapsulated in grout was exposed to water vapour for extended periods of time. Through synchrotron x-ray powder diffraction and tomography measurements, uranium dioxide was determined the dominant corrosion product over a 50-week time period. The oxide growth rate initiated rapidly, with rates comparable to the U + H 2 O reaction. Over time, the reaction rate decreased and eventually plateaued to a rate similar to the U + H 2 O + O 2 reaction. This behaviour was not attributed to oxygen ingress, but instead the decreasing permeability of the grout, limiting oxidising species access to the metal surface.

Novel method for water vapour monitoring using wireless communication networks measurements

NASA Astrophysics Data System (ADS)

David, N.; Alpert, P.; Messer, H.

2010-09-01

We propose a new technique for monitoring near-surface water vapour, by estimating humidity from data collected through existing wireless communication networks. Weather conditions and atmospheric phenomena affect the electromagnetic channel, causing attenuations to the radio signals. Thus, wireless communication networks are in effect built-in environmental monitoring facilities. The wireless microwave links, used in these networks, are widely deployed by cellular providers for backhaul communication between base stations, a few tens of meters above ground level. As a result, if all available measurements are used, the proposed method can provide moisture observations with high spatial resolution and potentially high temporal resolution. Further, the implementation cost is minimal, since the data used are already collected and saved by the cellular operators. In addition - many of these links are installed in areas where access is difficult such as orographic terrain and complex topography. As such, our method enables measurements in places that have been hard to measure in the past, or have never been measured before. The technique is restricted to weather conditions which exclude rain, fog or clouds along the propagation path. Strong winds that may cause movement of the link transmitter or receiver (or both) may also interfere with the ability to conduct accurate measurements. We present results from real-data measurements taken from microwave links used in a backhaul cellular network that show very good correlation with surface station humidity measurements (comparisons were performed for several links, found at different locations, during different time periods, showing correlations in the range of 0.5-0.9).

Pan-derived isotopic composition of atmospheric vapour in a Mediterranean wetland (Rhône River Delta, France).

PubMed

Vallet-Coulomb, Christine; Cartapanis, Olivier; Radakovitch, Olivier; Sonzogni, Corinne; Pichaud, Marc

2010-03-01

A continuous record of atmospheric vapour isotopic composition (delta(A)) can be derived from the isotope mass balance of a water body submitted to natural evaporation. In this paper, we present preliminary results of the application of this method to a drying evaporation pan, located in a Mediterranean wetland, during a two-month summer period. Results seem consistent with few atmospheric vapour data based on the assumption of isotopic equilibrium with precipitation, but we observed a shift between pan-derived delta(A) and the composition of vapour samples collected by cold trapping. These results suggest that further investigations are necessary to evaluate the effect of diurnal variations of atmospheric conditions on the applicability of the pan-evaporation method, and on the representative of grab atmospheric samples. We also propose a sensitivity analysis for evaluating the impact of the different measured components on delta(A) calculation, and show an improvement in the method efficiency as the pan is drying.

GPS water vapour tomography: preliminary results from the ESCOMPTE field experiment

NASA Astrophysics Data System (ADS)

Champollion, C.; Masson, F.; Bouin, M.-N.; Walpersdorf, A.; Doerflinger, E.; Bock, O.; Van Baelen, J.

2005-03-01

Water vapour plays a major role in atmospheric processes but remains difficult to quantify due to its high variability in time and space and the sparse set of available measurements. The GPS has proved its capacity to measure the integrated water vapour at zenith with the same accuracy as other methods. Recent studies show that it is possible to quantify the integrated water vapour in the line of sight of the GPS satellite. These observations can be used to study the 3D heterogeneity of the troposphere using tomographic techniques. We develop three-dimensional tomographic software to model the three-dimensional distribution of the tropospheric water vapour from GPS data. First, the tomographic software is validated by simulations based on the realistic ESCOMPTE GPS network configuration. Without a priori information, the absolute value of water vapour is less resolved as opposed to relative horizontal variations. During the ESCOMPTE field experiment, a dense network of 17 dual frequency GPS receivers was operated for 2 weeks within a 20×20-km area around Marseille (southern France). The network extends from sea level to the top of the Etoile chain (˜700 m high). Optimal results have been obtained with time windows of 30-min intervals and input data evaluation every 15 min. The optimal grid for the ESCOMTE geometrical configuration has a horizontal step size of 0.05°×0.05° and 500 m vertical step size. Second, we have compared the results of real data inversions with independent observations. Three inversions have been compared to three successive radiosonde launches and shown to be consistent. A good resolution compared to the a priori information is obtained up to heights of 3000 m. A humidity spike at 4000-m altitude remains unresolved. The reason is probably that the signal is spread homogeneously over the whole network and that such a feature is not resolvable by tomographic techniques. The results of our pure GPS inversion show a correlation with

Comparison of Experimental Methods for Estimating Matrix Diffusion Coefficients for Contaminant Transport Modeling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Telfeyan, Katherine Christina; Ware, Stuart Douglas; Reimus, Paul William

Diffusion cell and diffusion wafer experiments were conducted to compare methods for estimating matrix diffusion coefficients in rock core samples from Pahute Mesa at the Nevada Nuclear Security Site (NNSS). A diffusion wafer method, in which a solute diffuses out of a rock matrix that is pre-saturated with water containing the solute, is presented as a simpler alternative to the traditional through-diffusion (diffusion cell) method. Both methods yielded estimates of matrix diffusion coefficients that were within the range of values previously reported for NNSS volcanic rocks. The difference between the estimates of the two methods ranged from 14 to 30%,more » and there was no systematic high or low bias of one method relative to the other. From a transport modeling perspective, these differences are relatively minor when one considers that other variables (e.g., fracture apertures, fracture spacings) influence matrix diffusion to a greater degree and tend to have greater uncertainty than diffusion coefficients. For the same relative random errors in concentration measurements, the diffusion cell method yields diffusion coefficient estimates that have less uncertainty than the wafer method. However, the wafer method is easier and less costly to implement and yields estimates more quickly, thus allowing a greater number of samples to be analyzed for the same cost and time. Given the relatively good agreement between the methods, and the lack of any apparent bias between the methods, the diffusion wafer method appears to offer advantages over the diffusion cell method if better statistical representation of a given set of rock samples is desired.« less

Comparison of experimental methods for estimating matrix diffusion coefficients for contaminant transport modeling

NASA Astrophysics Data System (ADS)

Telfeyan, Katherine; Ware, S. Doug; Reimus, Paul W.; Birdsell, Kay H.

2018-02-01

Diffusion cell and diffusion wafer experiments were conducted to compare methods for estimating effective matrix diffusion coefficients in rock core samples from Pahute Mesa at the Nevada Nuclear Security Site (NNSS). A diffusion wafer method, in which a solute diffuses out of a rock matrix that is pre-saturated with water containing the solute, is presented as a simpler alternative to the traditional through-diffusion (diffusion cell) method. Both methods yielded estimates of effective matrix diffusion coefficients that were within the range of values previously reported for NNSS volcanic rocks. The difference between the estimates of the two methods ranged from 14 to 30%, and there was no systematic high or low bias of one method relative to the other. From a transport modeling perspective, these differences are relatively minor when one considers that other variables (e.g., fracture apertures, fracture spacings) influence matrix diffusion to a greater degree and tend to have greater uncertainty than effective matrix diffusion coefficients. For the same relative random errors in concentration measurements, the diffusion cell method yields effective matrix diffusion coefficient estimates that have less uncertainty than the wafer method. However, the wafer method is easier and less costly to implement and yields estimates more quickly, thus allowing a greater number of samples to be analyzed for the same cost and time. Given the relatively good agreement between the methods, and the lack of any apparent bias between the methods, the diffusion wafer method appears to offer advantages over the diffusion cell method if better statistical representation of a given set of rock samples is desired.

Electron diffraction covering a wide angular range from Bragg diffraction to small-angle diffraction.

PubMed

Nakajima, Hiroshi; Kotani, Atsuhiro; Harada, Ken; Mori, Shigeo

2018-04-09

We construct an electron optical system to investigate Bragg diffraction (the crystal lattice plane, 10-2 to 10-3 rad) with the objective lens turned off by adjusting the current in the intermediate lenses. A crossover was located on the selected-area aperture plane. Thus, the dark-field imaging can be performed by using a selected-area aperture to select Bragg diffraction spots. The camera length can be controlled in the range of 0.8-4 m without exciting the objective lens. Furthermore, we can observe the magnetic-field dependence of electron diffraction using the objective lens under weak excitation conditions. The diffraction mode for Bragg diffraction can be easily switched to a small-angle electron diffraction mode having a camera length of more than 100 m. We propose this experimental method to acquire electron diffraction patterns that depict an extensive angular range from 10-2 to 10-7 rad. This method is applied to analyze the magnetic microstructures in three distinct magnetic materials, i.e. a uniaxial magnetic structure of BaFe10.35Sc1.6Mg0.05O19, a martensite of a Ni-Mn-Ga alloy, and a helical magnetic structure of Ba0.5Sr1.5Zn2Fe12O22.

Expression, purification, crystallization and preliminary X-ray analysis of the ligand-binding domain of metabotropic glutamate receptor 7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muto, Takanori; Tsuchiya, Daisuke; Morikawa, Kosuke, E-mail: morikako@protein.osaka-u.ac.jp

2007-07-01

The ligand-binding domain of metabotropic glutamate receptor 7 has been overexpressed, purified, and crystallized by the hanging-drop vapour-diffusion method. A complete data set has been collected to 3.30 Å. Glutamate is the major excitatory neurotransmitter and its metabotropic glutamate receptor (mGluR) plays an important role in the central nervous system. The ligand-binding domain (LBD) of mGluR subtype 7 (mGluR7) was produced using the baculovirus expression system and purified from the culture medium. The purified protein was characterized by gel-filtration chromatography, SDS–PAGE and a ligand-binding assay. Crystals of mGluR7 LBD were grown at 293 K by the hanging-drop vapour-diffusion method. Themore » crystals diffracted X-rays to 3.30 Å resolution using synchrotron radiation and belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 92.4, c = 114.3 Å. Assuming the presence of one protomer per crystallographic asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.5 Å{sup 3} Da{sup −1} and the solvent content was 51%.« less

New methods for indexing multi-lattice diffraction data

PubMed Central

Gildea, Richard J.; Waterman, David G.; Parkhurst, James M.; Axford, Danny; Sutton, Geoff; Stuart, David I.; Sauter, Nicholas K.; Evans, Gwyndaf; Winter, Graeme

2014-01-01

A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of diffraction data. The method takes advantage of a simplification of Fourier transform-based methods that is applicable when the unit-cell dimensions are known a priori. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-lattice data recorded from crystals of ∼1 µm in size, where it is shown that up to six lattices can be successfully indexed and subsequently integrated from a 1° wedge of data. Analysis is presented which shows that improvements in data-quality indicators can be obtained through accurate identification and rejection of overlapping reflections prior to scaling. PMID:25286849

New methods for indexing multi-lattice diffraction data.

PubMed

Gildea, Richard J; Waterman, David G; Parkhurst, James M; Axford, Danny; Sutton, Geoff; Stuart, David I; Sauter, Nicholas K; Evans, Gwyndaf; Winter, Graeme

2014-10-01

A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of diffraction data. The method takes advantage of a simplification of Fourier transform-based methods that is applicable when the unit-cell dimensions are known a priori. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-lattice data recorded from crystals of ∼1 µm in size, where it is shown that up to six lattices can be successfully indexed and subsequently integrated from a 1° wedge of data. Analysis is presented which shows that improvements in data-quality indicators can be obtained through accurate identification and rejection of overlapping reflections prior to scaling.

New methods for indexing multi-lattice diffraction data

DOE PAGES

Gildea, Richard J.; Waterman, David G.; Parkhurst, James M.; ...

2014-09-27

A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of diffraction data. The method takes advantage of a simplification of Fourier transform-based methods that is applicable when the unit-cell dimensions are known a priori. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-lattice data recorded from crystals of ~1 µm in size, where it is shown that up to six lattices can be successfully indexed and subsequently integrated from a 1° wedge of data. Analysis is presented which shows that improvements in data-quality indicators can bemore » obtained through accurate identification and rejection of overlapping reflections prior to scaling.« less

Coherent diffractive imaging methods for semiconductor manufacturing

NASA Astrophysics Data System (ADS)

Helfenstein, Patrick; Mochi, Iacopo; Rajeev, Rajendran; Fernandez, Sara; Ekinci, Yasin

2017-12-01

The paradigm shift of the semiconductor industry moving from deep ultraviolet to extreme ultraviolet lithography (EUVL) brought about new challenges in the fabrication of illumination and projection optics, which constitute one of the core sources of cost of ownership for many of the metrology tools needed in the lithography process. For this reason, lensless imaging techniques based on coherent diffractive imaging started to raise interest in the EUVL community. This paper presents an overview of currently on-going research endeavors that use a number of methods based on lensless imaging with coherent light.

Reliable determination of oxygen and hydrogen isotope ratios in atmospheric water vapour adsorbed on 3A molecular sieve.

PubMed

Han, Liang-Feng; Gröning, Manfred; Aggarwal, Pradeep; Helliker, Brent R

2006-01-01

The isotope ratio of atmospheric water vapour is determined by wide-ranging feedback effects from the isotope ratio of water in biological water pools, soil surface horizons, open water bodies and precipitation. Accurate determination of atmospheric water vapour isotope ratios is important for a broad range of research areas from leaf-scale to global-scale isotope studies. In spite of the importance of stable isotopic measurements of atmospheric water vapour, there is a paucity of published data available, largely because of the requirement for liquid nitrogen or dry ice for quantitative trapping of water vapour. We report results from a non-cryogenic method for quantitatively trapping atmospheric water vapour using 3A molecular sieve, although water is removed from the column using standard cryogenic methods. The molecular sieve column was conditioned with water of a known isotope ratio to 'set' the background signature of the molecular sieve. Two separate prototypes were developed, one for large collection volumes (3 mL) and one for small collection volumes (90 microL). Atmospheric water vapour was adsorbed to the column by pulling air through the column for several days to reach the desired final volume. Water was recovered from the column by baking at 250 degrees C in a dry helium or nitrogen air stream and cryogenically trapped. For the large-volume apparatus, the recovered water differed from water that was simultaneously trapped by liquid nitrogen (the experimental control) by 2.6 per thousand with a standard deviation (SD) of 1.5 per thousand for delta(2)H and by 0.3 per thousand with a SD of 0.2 per thousand for delta(18)O. Water-vapour recovery was not satisfactory for the small volume apparatus. Copyright (c) 2006 John Wiley & Sons, Ltd.

Moisture diffusion and permeability characteristics of hydroxypropylmethylcellulose and hard gelatin capsules.

PubMed

Barham, Ahmad S; Tewes, Frederic; Healy, Anne Marie

2015-01-30

The primary objective of this paper is to compare the sorption characteristics of hydroxypropylmethylcellulose (HPMC) and hard gelatin (HG) capsules and their ability to protect capsule contents. Moisture sorption and desorption isotherms for empty HPMC and HG capsules have been investigated using dynamic vapour sorption (DVS) at 25°C. All sorption studies were analysed using the Young-Nelson model equations which distinguishes three moisture sorption types: monolayer adsorption moisture, condensation and absorption. Water vapour diffusion coefficients (D), solubility (S) and permeability (P) parameters of the capsule shells were calculated. ANOVA was performed with the Tukey comparison test to analyse the effect of %RH and capsule type on S, P, and D parameters. The moisture uptake of HG capsules were higher than HPMC capsules at all %RH conditions studied. It was found that values of D and P across HPMC capsules were greater than for HG capsules at 0-40 %RH; whereas over the same %RH range S values were higher for HG than for HPMC capsules. S values decreased gradually as the %RH was increased up to 60% RH. To probe the effect of moisture ingress, spray dried lactose was loaded into capsules. Phase evolution was characterised by scanning electron microscopy (SEM), X-ray powder diffraction (XRD), and differential scanning calorimetry (DSC). The capsules under investigation are not capable of protecting spray dried lactose from induced solid state changes as a result of moisture uptake. For somewhat less moisture sensitive formulations, HPMC would appear to be a better choice than HG in terms of protection of moisture induced deterioration. Copyright © 2014 Elsevier B.V. All rights reserved.

Application of focused-beam flat-sample method to synchrotron powder X-ray diffraction with anomalous scattering effect

NASA Astrophysics Data System (ADS)

Tanaka, M.; Katsuya, Y.; Matsushita, Y.

2013-03-01

The focused-beam flat-sample method (FFM), which is a method for high-resolution and rapid synchrotron X-ray powder diffraction measurements by combination of beam focusing optics, a flat shape sample and an area detector, was applied for diffraction experiments with anomalous scattering effect. The advantages of FFM for anomalous diffraction were absorption correction without approximation, rapid data collection by an area detector and good signal-to-noise ratio data by focusing optics. In the X-ray diffraction experiments of CoFe2O4 and Fe3O4 (By FFM) using X-rays near the Fe K absorption edge, the anomalous scattering effect between Fe/Co or Fe2+/Fe3+ can be clearly detected, due to the change of diffraction intensity. The change of observed diffraction intensity as the incident X-ray energy was consistent with the calculation. The FFM is expected to be a method for anomalous powder diffraction.

Rietveld analysis using powder diffraction data with anomalous scattering effect obtained by focused beam flat sample method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Masahiko, E-mail: masahiko@spring8.or.jp; Katsuya, Yoshio, E-mail: katsuya@spring8.or.jp; Sakata, Osami, E-mail: SAKATA.Osami@nims.go.jp

2016-07-27

Focused-beam flat-sample method (FFM) is a new trial for synchrotron powder diffraction method, which is a combination of beam focusing optics, flat shape powder sample and area detectors. The method has advantages for X-ray diffraction experiments applying anomalous scattering effect (anomalous diffraction), because of 1. Absorption correction without approximation, 2. High intensity X-rays of focused incident beams and high signal noise ratio of diffracted X-rays 3. Rapid data collection with area detectors. We applied the FFM to anomalous diffraction experiments and collected synchrotron X-ray powder diffraction data of CoFe{sub 2}O{sub 4} (inverse spinel structure) using X-rays near Fe K absorptionmore » edge, which can distinguish Co and Fe by anomalous scattering effect. We conducted Rietveld analyses with the obtained powder diffraction data and successfully determined the distribution of Co and Fe ions in CoFe{sub 2}O{sub 4} crystal structure.« less

Dynamical electron diffraction simulation for non-orthogonal crystal system by a revised real space method.

PubMed

Lv, C L; Liu, Q B; Cai, C Y; Huang, J; Zhou, G W; Wang, Y G

2015-01-01

In the transmission electron microscopy, a revised real space (RRS) method has been confirmed to be a more accurate dynamical electron diffraction simulation method for low-energy electron diffraction than the conventional multislice method (CMS). However, the RRS method can be only used to calculate the dynamical electron diffraction of orthogonal crystal system. In this work, the expression of the RRS method for non-orthogonal crystal system is derived. By taking Na2 Ti3 O7 and Si as examples, the correctness of the derived RRS formula for non-orthogonal crystal system is confirmed by testing the coincidence of numerical results of both sides of Schrödinger equation; moreover, the difference between the RRS method and the CMS for non-orthogonal crystal system is compared at the accelerating voltage range from 40 to 10 kV. Our results show that the CMS method is almost the same as the RRS method for the accelerating voltage above 40 kV. However, when the accelerating voltage is further lowered to 20 kV or below, the CMS method introduces significant errors, not only for the higher-order Laue zone diffractions, but also for zero-order Laue zone. These indicate that the RRS method for non-orthogonal crystal system is necessary to be used for more accurate dynamical simulation when the accelerating voltage is low. Furthermore, the reason for the increase of differences between those diffraction patterns calculated by the RRS method and the CMS method with the decrease of the accelerating voltage is discussed. © 2015 The Authors Journal of Microscopy © 2015 Royal Microscopical Society.

Diffuse Scattering in the Icosahedral AL-Li-Cu Quasicrystal

NASA Astrophysics Data System (ADS)

Proult, A.; Donnadieu, P.; Wang, K.; Garoche, P.

1995-12-01

Electron diffraction patterns of icosahedral quasicrystals frequently exhibit diffuse scattering features. We report a detailed analysis of diffuse scattering in Al{6}Li{3}Cu (T2) quasicrystalline samples. The samples have been specifically heat-treated which allows to observe pronounced diffuse effects. Diffuse streaks are observed along the 5-fold and 2-fold symmetry axes and are elongated perpendicularly to these directions. These streaks are due to discs in the 3-dimensional reciprocal space. The diffuse disc positions are only indexable in the 6-dimensional hyperspace but the disc intensities do not agree with the ones predicted by the Cut-and-Project method. The diffuse discs we observed seem to be related to an original quasicrystalline phenomenon overlapping with the icosahedral phase. Les diagrammes de diffraction électronique des quasicristaux icosaédriques présentent fréquemment des diffusions diffuses. Nous les analysons ici en détails sur des échantillons de phase quasicristalline Al{6}Li{3}Cu (T2) traités thermiquement dans lesquels les diffusions diffuses sont trés prononcées. Les intensités diffuses forment des batônnets centrés sur des positions appartenant aux rangées réciproques d'ordre 5 et d'ordre 2 et allongés perpendiculairement à ces directions. On montre qu'il s'agit en fait de disques diffus. dans le réseau réciproque à 3 dimensions, dont les positions ne peuvent s'indexer que sur le réseau à 6 dimensions. Toutefois, les intensités ne correspondent pas à celle prédites par l'algorithme de Coupe-et-Projection. Les disques de diffusion diffuse semblent relever d'une organisation quasicristalline originale se superposant à la phase icosaédrique.

Comparison of experimental methods for estimating matrix diffusion coefficients for contaminant transport modeling

DOE PAGES

Telfeyan, Katherine Christina; Ware, Stuart Doug; Reimus, Paul William; ...

2018-01-31

Here, diffusion cell and diffusion wafer experiments were conducted to compare methods for estimating effective matrix diffusion coefficients in rock core samples from Pahute Mesa at the Nevada Nuclear Security Site (NNSS). A diffusion wafer method, in which a solute diffuses out of a rock matrix that is pre-saturated with water containing the solute, is presented as a simpler alternative to the traditional through-diffusion (diffusion cell) method. Both methods yielded estimates of effective matrix diffusion coefficients that were within the range of values previously reported for NNSS volcanic rocks. The difference between the estimates of the two methods ranged frommore » 14 to 30%, and there was no systematic high or low bias of one method relative to the other. From a transport modeling perspective, these differences are relatively minor when one considers that other variables (e.g., fracture apertures, fracture spacings) influence matrix diffusion to a greater degree and tend to have greater uncertainty than effective matrix diffusion coefficients. For the same relative random errors in concentration measurements, the diffusion cell method yields effective matrix diffusion coefficient estimates that have less uncertainty than the wafer method. However, the wafer method is easier and less costly to implement and yields estimates more quickly, thus allowing a greater number of samples to be analyzed for the same cost and time. Given the relatively good agreement between the methods, and the lack of any apparent bias between the methods, the diffusion wafer method appears to offer advantages over the diffusion cell method if better statistical representation of a given set of rock samples is desired.« less

Comparison of experimental methods for estimating matrix diffusion coefficients for contaminant transport modeling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Telfeyan, Katherine Christina; Ware, Stuart Doug; Reimus, Paul William

Here, diffusion cell and diffusion wafer experiments were conducted to compare methods for estimating effective matrix diffusion coefficients in rock core samples from Pahute Mesa at the Nevada Nuclear Security Site (NNSS). A diffusion wafer method, in which a solute diffuses out of a rock matrix that is pre-saturated with water containing the solute, is presented as a simpler alternative to the traditional through-diffusion (diffusion cell) method. Both methods yielded estimates of effective matrix diffusion coefficients that were within the range of values previously reported for NNSS volcanic rocks. The difference between the estimates of the two methods ranged frommore » 14 to 30%, and there was no systematic high or low bias of one method relative to the other. From a transport modeling perspective, these differences are relatively minor when one considers that other variables (e.g., fracture apertures, fracture spacings) influence matrix diffusion to a greater degree and tend to have greater uncertainty than effective matrix diffusion coefficients. For the same relative random errors in concentration measurements, the diffusion cell method yields effective matrix diffusion coefficient estimates that have less uncertainty than the wafer method. However, the wafer method is easier and less costly to implement and yields estimates more quickly, thus allowing a greater number of samples to be analyzed for the same cost and time. Given the relatively good agreement between the methods, and the lack of any apparent bias between the methods, the diffusion wafer method appears to offer advantages over the diffusion cell method if better statistical representation of a given set of rock samples is desired.« less

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

PubMed Central

Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder

2006-01-01

Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P21, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit. PMID:16511268

Crystallographic analysis of ground and space thermostable T1 lipase crystal obtained via counter diffusion method approach.

PubMed

Mohamad Aris, Sayangku Nor Ariati; Thean Chor, Adam Leow; Mohamad Ali, Mohd Shukuri; Basri, Mahiran; Salleh, Abu Bakar; Raja Abd Rahman, Raja Noor Zaliha

2014-01-01

Three-dimensional structure of thermostable lipase is much sought after nowadays as it is important for industrial application mainly found in the food, detergent, and pharmaceutical sectors. Crystallization utilizing the counter diffusion method in space was performed with the aim to obtain high resolution diffracting crystals with better internal order to improve the accuracy of the structure. Thermostable T1 lipase enzyme has been crystallized in laboratory on earth and also under microgravity condition aboard Progress spacecraft to the ISS in collaboration with JAXA (Japanese Aerospace Exploration Agency). This study is conducted with the aims of improving crystal packing and structure resolution. The diffraction data set for ground grown crystal was collected to 1.3 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.40 Å, b = 80.95 Å, and c = 99.81 Å, whereas the diffraction data set for space grown crystal was collected to 1.1 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.31 Å, b = 80.85 Å, and c = 99.81 Å. The major difference between the two crystal growth systems is the lack of convection and sedimentation in microgravity environment resulted in the growth of much higher quality crystals of T1 lipase.

X-Ray Diffraction Wafer Mapping Method for Rhombohedral Super-Hetero-Epitaxy

NASA Technical Reports Server (NTRS)

Park, Yoonjoon; Choi, Sang Hyouk; King, Glen C.; Elliott, James R.; Dimarcantonio, Albert L.

2010-01-01

A new X-ray diffraction (XRD) method is provided to acquire XY mapping of the distribution of single crystals, poly-crystals, and twin defects across an entire wafer of rhombohedral super-hetero-epitaxial semiconductor material. In one embodiment, the method is performed with a point or line X-ray source with an X-ray incidence angle approximating a normal angle close to 90 deg, and in which the beam mask is preferably replaced with a crossed slit. While the wafer moves in the X and Y direction, a narrowly defined X-ray source illuminates the sample and the diffracted X-ray beam is monitored by the detector at a predefined angle. Preferably, the untilted, asymmetric scans are of {440} peaks, for twin defect characterization.

Claims in vapour device (e-cigarette) regulation: A Narrative Policy Framework analysis.

PubMed

O'Leary, Renée; Borland, Ron; Stockwell, Tim; MacDonald, Marjorie

2017-06-01

The electronic cigarette or e-cigarette (vapour device) is a consumer product undergoing rapid growth, and governments have been adopting regulations on the sale of the devices and their nicotine liquids. Competing claims about vapour devices have ignited a contentious debate in the public health community. What claims have been taken up in the state arena, and how have they possibly influenced regulatory outcomes? This study utilized Narrative Policy Framework to analyze the claims made about vapour devices in legislation recommendation reports from Queensland Australia, Canada, and the European Union, and the 2016 deeming rule legislation from the United States, and examined the claims and the regulatory outcomes in these jurisdictions. The vast majority of claims in the policy documents represented vapour devices as a threat: an unsafe product harming the health of vapour device users, a gateway product promoting youth tobacco uptake, and a quasi-tobacco product impeding tobacco control. The opportunity for vapour devices to promote cessation or reduce exposure to toxins was very rarely presented, and these positive claims were not discussed at all in two of the four documents studied. The dominant claims of vapour devices as a public health threat have supported regulations that have limited their potential as a harm reduction strategy. Future policy debates should evaluate the opportunities for vapour devices to decrease the health and social burdens of the tobacco epidemic. Copyright © 2017 Elsevier B.V. All rights reserved.

Synchrotron Radial X-ray Diffraction Studies of Deformation of Polycrystalline MgO

NASA Astrophysics Data System (ADS)

Girard, J.; Tsujino, N.; Mohiuddin, A.; Karato, S. I.

2016-12-01

X-ray diffraction analyses have been used for decades to study mechanical properties of polycrystalline samples during in-situ high-pressure deformation. When polycrystalline materials are deformed, stresses develop in grains and lead to lattice distortion. Using X-ray diffraction we can estimate the lattice strain for each (hkl) diffraction plans and calculate the applied stress for each (hkl), using [Singh, 1993] relation. However, this method doesn't take into account plastic anisotropy. As a results of plastic anisotropy present in the material, stress estimated from this method can be largely differ depending on (hkl) diffraction planes [Karato, 2009]. Studying the stress estimate for each (hkl) plane, might help us distinguish dominant deformation mechanisms activated during deformation such as diffusion (we will observe small stress variation as a function of (hkl) diffraction planes) or dislocation creep (we will observe a stress variation as a function of (hkl) diffraction planes that could also give us clues on potential slip system activity). In this study we observed stress evolution in MgO polycrystalline samples deformed under mantle pressure and temperature for (200) and (220) diffraction planes. Using a range MgO grain sizes we were able to control the active deformation mechanism (for e.g. diffusion creep or dislocation creep). For coarse-grained specimens, we observed strong (hkl) dependence of radial strain indicating the operation of dislocation creep. The observed (hkl) dependence changes with pressure suggesting a change in the slip system: at pressures higher than 27 GPa, (200) shows larger stress estimate than (220). In contrast, at lower pressures, (220) shows larger stress estimate than (200). This might indicate a slip system transition in MgO occurring under lower mantle conditions. From {110} plane to {100} plane. This is in good agreement with theoretical predictions and numerical calculation [Amodeo et al., 2012] and has an important

Atrial and ventricular septal changes in ethanol vapour exposed chick embryos.

PubMed

Kamran, Kiran; Khan, Muhammad Yunus; Minhas, Liaqat Ali

2015-03-01

To study the effects of ethanol vapour exposure on development of atrial and ventricular septa of chick embryo. The experimental study was conducted at the College of Physicians and Surgeons, Islamabad, from 2006 to 2007. The experimental and control groups were further divided into three subgroups based on the day of sacrifice. The experimental group was exposed to ethanol vapours produced in a specially-designed vapour chamber and then compared with age-matched controls. There were 90 eggs in each of the two groups. The development of inter-ventricular septum completed at day 7 of development in chick embryo. Ethanol vapour exposure produced a small discontinuity at day 10 of development in a chick embryo which may be labelled as ventricular septal defect since ventricular development is completed by day 7. Interatrial septum formed till day 7 with small perforations which persisted till hatching. Ethanol vapour exposure may lead to ventricular septal defect.

Final Report for X-ray Diffraction Sample Preparation Method Development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ely, T. M.; Meznarich, H. K.; Valero, T.

WRPS-1500790, “X-ray Diffraction Saltcake Sample Preparation Method Development Plan/Procedure,” was originally prepared with the intent of improving the specimen preparation methodology used to generate saltcake specimens suitable for XRD-based solid phase characterization. At the time that this test plan document was originally developed, packed powder in cavity supports with collodion binder was the established XRD specimen preparation method. An alternate specimen preparation method less vulnerable, if not completely invulnerable to preferred orientation effects, was desired as a replacement for the method.

Monitoring of exposure to methylpentanes by diffusive sampling and urine analysis for alcoholic metabolites.

PubMed Central

Kawai, T; Mizunuma, K; Yasugi, T; Horiguchi, S; Iguchi, H; Mutti, A; Ghittori, S; Ikeda, M

1995-01-01

OBJECTIVES--To investigate the possibilities of personal ambient monitoring and biological monitoring for methylpentane isomers. METHODS--The performance of activated carbon cloth to absorb 2- and 3-methylpentane was studied by experimental vapour exposure followed by solvent extraction and gas chromatography (GC). Urine from workers and rats exposed to 2- and 3-methylpentane was analysed by GC with or without acid or enzymatic hydrolysis. RESULTS--Carbon cloth absorbed 2- and 3-methylpentane linearly to exposures up to eight hours and to 400 ppm, and was sensitive enough to detect a 15 minute peak of exposure. The two isomers were clearly separated from hexane on a DB-1 column. For analysis of the urine, enzymatic hydrolysis was superior to acid hydrolysis. Exposure of rats to methylpentane vapours showed that 2-methyl-2-pentanol and 3-methyl-2-pentanol were excreted in urine in proportion to the dose of 2-methylpentane and 3-methylpentane, respectively. 2-Methyl derivatives of 1-, 3-, and 4-propanol, 2-methylpentane-2,4-diol, and 3-methyl-2-pentanol were minor metabolites. Analysis of urine from the exposed workers showed that 2-methyl- and 3-methyl-2-pentanol are leading urinary metabolites after exposure to the corresponding methylpentane. CONCLUSIONS--Diffusive sampling is applicable to monitor 2- and 3-methylpentane vapours as is the case for hexane vapour. 2-Methyl-2-pentanol and 3-methyl-2-pentanol will be markers of occupational exposure to 2-methylpentane and 3-methylpentane, respectively. Also, 2-methylpentane-2,4-diol might be a marker of exposure to 2-methylpentane. PMID:8535496

Long distance spin communication in chemical vapour deposited graphene

NASA Astrophysics Data System (ADS)

Kamalakar, M. Venkata; Groenveld, Christiaan; Dankert, André; Dash, Saroj P.

2015-04-01

Graphene is an ideal medium for long-distance spin communication in future spintronic technologies. So far, the prospect is limited by the smaller sizes of exfoliated graphene flakes and lower spin transport properties of large-area chemical vapour-deposited (CVD) graphene. Here we demonstrate a high spintronic performance in CVD graphene on SiO2/Si substrate at room temperature. We show pure spin transport and precession over long channel lengths extending up to 16 μm with a spin lifetime of 1.2 ns and a spin diffusion length ~6 μm at room temperature. These spin parameters are up to six times higher than previous reports and highest at room temperature for any form of pristine graphene on industrial standard SiO2/Si substrates. Our detailed investigation reinforces the observed performance in CVD graphene over wafer scale and opens up new prospects for the development of lateral spin-based memory and logic applications.

Crystallization and preliminary X-ray crystallographic analysis of BxlE, a xylobiose transporter from Streptomyces thermoviolaceus OPC-520

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seike, Kiho; Sato, Junji; Tomoo, Koji, E-mail: tomoo@gly.oups.ac.jp

2007-07-01

To clarify the structural basis of sugar binding by BxlE at the atomic level, recombinant BxlE was crystallized using the hanging-drop vapour-diffusion method at 290 K. Together with the integral membrane proteins BxlF and BxlG, BxlE isolated from Streptomyces thermoviolaceus OPC-520 forms an ATP-binding cassette (ABC) transport system that mediates the uptake of xylan. To clarify the structural basis of sugar binding by BxlE at the atomic level, recombinant BxlE was crystallized using the hanging-drop vapour-diffusion method at 290 K. The crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 44.63, b = 63.27, cmore » = 66.40 Å, β = 103.05°, and contained one 48 kDa molecule per asymmetric unit (V{sub M} = 1.96 Å{sup 3} Da{sup −1}). Diffraction data collected to a resolution of 1.65 Å using a rotating-anode X-ray source gave a data set with an overall R{sub merge} of 2.6% and a completeness of 91.3%. A data set from a platinum derivative is being used for phasing by the SAD method.« less

Diode laser-induced infrared fluorescence of water vapour

NASA Astrophysics Data System (ADS)

Li, Hejie; Hanson, Ronald K.; Jeffries, Jay B.

2004-07-01

Infrared laser-induced fluorescence (LIF) of water vapour was investigated for its potential as a spatially resolved gasdynamic diagnostic. A cw diode laser operating near 1392 nm was scanned across a single absorption transition in the ngr1 + ngr3 band of H2O in a static cell, and the resulting fluorescence signal was collected near 2.7 µm (both ngr1 and ngr3 bands). Experiments were conducted at low pressure in pure water vapour and mixtures of water vapour and N2 using a 20 mW laser in a double-pass arrangement. A simple analytical model was developed to relate LIF intensity to gas properties as a function of laser power. The spectrally resolved, single-line excitation spectrum was fitted with a Voigt profile, allowing inference of the water vapour temperature from the Doppler-broadened component of the measured fluorescence lineshape. A two-line excitation scheme was also investigated as a means of measuring temperature with reduced measurement time. From these initial measurements, we estimate that a practical sensor for atmospheric pressure applications would require a minimum of 1-2 W of laser power for two-line, fixed-wavelength temperature measurements and a minimum of about 70 W of power for scanned-wavelength measurements.

Expression, purification, crystallization and preliminary X-ray diffraction analysis of Bifidobacterium adolescentis xylose isomerase

PubMed Central

dos Reis, Caio Vinicius; Bernardes, Amanda; Polikarpov, Igor

2013-01-01

Xylose isomerase (EC 5.3.1.5) is a key enzyme in xylose metabolism which is industrially important for the transformation of glucose and xylose into fructose and xylulose, respectively. The Bifidobacterium adolescentis xylA gene (NC_008618.1) encoding xylose isomerase (XI) was cloned and the enzyme was overexpressed in Escherichia coli. Purified recombinant XI was crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol 3350 as the precipitating agent. A complete native data set was collected to 1.7 Å resolution using a synchrotron-radiation source. The crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 88.78, b = 123.98, c = 78.63 Å. PMID:23695585

Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.

PubMed

Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

2012-08-01

Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.

Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4

PubMed Central

Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

2012-01-01

Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128

Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase

PubMed Central

Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo

2006-01-01

Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-­ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269

A hybrid continuous-discrete method for stochastic reaction-diffusion processes.

PubMed

Lo, Wing-Cheong; Zheng, Likun; Nie, Qing

2016-09-01

Stochastic fluctuations in reaction-diffusion processes often have substantial effect on spatial and temporal dynamics of signal transductions in complex biological systems. One popular approach for simulating these processes is to divide the system into small spatial compartments assuming that molecules react only within the same compartment and jump between adjacent compartments driven by the diffusion. While the approach is convenient in terms of its implementation, its computational cost may become prohibitive when diffusive jumps occur significantly more frequently than reactions, as in the case of rapid diffusion. Here, we present a hybrid continuous-discrete method in which diffusion is simulated using continuous approximation while reactions are based on the Gillespie algorithm. Specifically, the diffusive jumps are approximated as continuous Gaussian random vectors with time-dependent means and covariances, allowing use of a large time step, even for rapid diffusion. By considering the correlation among diffusive jumps, the approximation is accurate for the second moment of the diffusion process. In addition, a criterion is obtained for identifying the region in which such diffusion approximation is required to enable adaptive calculations for better accuracy. Applications to a linear diffusion system and two nonlinear systems of morphogens demonstrate the effectiveness and benefits of the new hybrid method.

A hybrid continuous-discrete method for stochastic reaction–diffusion processes

PubMed Central

Zheng, Likun; Nie, Qing

2016-01-01

Stochastic fluctuations in reaction–diffusion processes often have substantial effect on spatial and temporal dynamics of signal transductions in complex biological systems. One popular approach for simulating these processes is to divide the system into small spatial compartments assuming that molecules react only within the same compartment and jump between adjacent compartments driven by the diffusion. While the approach is convenient in terms of its implementation, its computational cost may become prohibitive when diffusive jumps occur significantly more frequently than reactions, as in the case of rapid diffusion. Here, we present a hybrid continuous-discrete method in which diffusion is simulated using continuous approximation while reactions are based on the Gillespie algorithm. Specifically, the diffusive jumps are approximated as continuous Gaussian random vectors with time-dependent means and covariances, allowing use of a large time step, even for rapid diffusion. By considering the correlation among diffusive jumps, the approximation is accurate for the second moment of the diffusion process. In addition, a criterion is obtained for identifying the region in which such diffusion approximation is required to enable adaptive calculations for better accuracy. Applications to a linear diffusion system and two nonlinear systems of morphogens demonstrate the effectiveness and benefits of the new hybrid method. PMID:27703710

CO 2-fluxing collapses metal mobility in magmatic vapour

DOE PAGES

van Hinsberg, V. J.; Berlo, K.; Migdisov, A. A.; ...

2016-05-18

Magmatic systems host many types of ore deposits, including world-class deposits of copper and gold. Magmas are commonly an important source of metals and ore-forming fluids in these systems. In many magmatic-hydrothermal systems, low-density aqueous fluids, or vapours, are significant metal carriers. Such vapours are water-dominated shallowly, but fluxing of CO 2-rich vapour exsolved from deeper magma is now recognised as ubiquitous during open-system magma degassing. Furthermore, we show that such CO 2-fluxing leads to a sharp drop in element solubility, up to a factor of 10,000 for Cu, and thereby provides a highly efficient, but as yet unrecognised mechanismmore » for metal deposition.« less

The preparation of Fe2O3-ZSM-5 catalysts by metal-organic chemical vapour deposition method for catalytic wet peroxide oxidation of m-cresol.

PubMed

Yang, Yi; Zhang, Huiping; Yan, Ying

2018-03-01

Fe 2 O 3 -ZSM-5 catalysts (0.6 wt% Fe load) prepared by metal-organic chemical vapour deposition (MOCVD) method were evaluated in the catalytic wet peroxide oxidation (CWPO) of m -cresol in a batch reactor. The catalysts have a good iron dispersion and small iron crystalline size, and exhibit high stability during reaction. In addition, the kinetics of the reaction were studied and the initial oxidation rate equation was given. Catalysts were first characterized by N 2 adsorption-desorption isotherms, scanning electronic microscopy, energy-dispersive spectroscopy, X-ray diffraction and X-ray photoelectron spectroscopy. Results show that extra-framework Fe 3+ species (presenting in the form of Fe 2 O 3 ) are successfully loaded on ZSM-5 supports by MOCVD method. Performances of catalysts were tested and effects of different temperature, stirring rate, catalyst amount on hydrogen peroxide, m -cresol, total organic carbon (TOC) conversion and Fe leaching concentration were studied. Results reveal that catalytic activity increased with higher temperature, faster stirring rate and larger catalyst amount. In all circumstances, m -cresol conversion could reach 99% in 0.5-2.5 h, and the highest TOC removal (80.5%) is obtained after 3 h under conditions of 60°C, 400 r.p.m. and catalyst amount of 2.5 g l -1 . The iron-leaching concentrations are less than 1.1 mg l -1 under all conditions. The initial oxidation rate equation [Formula: see text] is obtained for m -cresol degradation with Fe 2 O 3 -ZSM-5 catalysts.

Diffracted diffraction radiation and its application to beam diagnostics

NASA Astrophysics Data System (ADS)

Goponov, Yu. A.; Shatokhin, R. A.; Sumitani, K.; Syshchenko, V. V.; Takabayashi, Y.; Vnukov, I. E.

2018-03-01

We present theoretical considerations for diffracted diffraction radiation and also propose an application of this process to diagnosing ultra-relativistic electron (positron) beams for the first time. Diffraction radiation is produced when relativistic particles move near a target. If the target is a crystal or X-ray mirror, diffraction radiation in the X-ray region is expected to be diffracted at the Bragg angle and therefore be detectable. We present a scheme for applying this process to measurements of the beam angular spread, and consider how to conduct a proof-of-principle experiment for the proposed method.

Quantitative theory of diffraction by cylindrical scroll nanotubes.

PubMed

Khadiev, Azat; Khalitov, Zufar

2018-05-01

A quantitative theory of Fraunhofer diffraction by right- and left-handed multiwalled cylindrical scroll nanotubes is developed on the basis of the kinematical approach. The proposed theory is mainly dedicated to structural studies of individual nanotubes by the selected-area electron diffraction technique. Strong and diffuse reflections of the scroll nanotube were studied and explicit formulas that govern relations between the direct and reciprocal lattice of the scroll nanotube are achieved.

[An Improved Spectral Quaternion Interpolation Method of Diffusion Tensor Imaging].

PubMed

Xu, Yonghong; Gao, Shangce; Hao, Xiaofei

2016-04-01

Diffusion tensor imaging(DTI)is a rapid development technology in recent years of magnetic resonance imaging.The diffusion tensor interpolation is a very important procedure in DTI image processing.The traditional spectral quaternion interpolation method revises the direction of the interpolation tensor and can preserve tensors anisotropy,but the method does not revise the size of tensors.The present study puts forward an improved spectral quaternion interpolation method on the basis of traditional spectral quaternion interpolation.Firstly,we decomposed diffusion tensors with the direction of tensors being represented by quaternion.Then we revised the size and direction of the tensor respectively according to different situations.Finally,we acquired the tensor of interpolation point by calculating the weighted average.We compared the improved method with the spectral quaternion method and the Log-Euclidean method by the simulation data and the real data.The results showed that the improved method could not only keep the monotonicity of the fractional anisotropy(FA)and the determinant of tensors,but also preserve the tensor anisotropy at the same time.In conclusion,the improved method provides a kind of important interpolation method for diffusion tensor image processing.

Vapour phase motion in cryogenic systems containing superheated and subcooled liquids

NASA Astrophysics Data System (ADS)

Kirichenko, Yu. A.; Chernyakov, P. S.; Seregin, V. E.

The development of vent pipelines, and venting storage tanks for cryogenic liquids requires the knowledge of the law of motion as well as regularities of vapour content variation in the liquid and heat dissipation by the vapour phase. This is a theoretical study of the effect of superheating (subcooling) of the liquid, relative acceleration and reduced pressure upon the size and velocity of noninteracting vapour bubbles, moving in the liquid, and upon their resistance and heat transfer coefficients.

A water vapour monitor at Paranal Observatory

NASA Astrophysics Data System (ADS)

Kerber, Florian; Rose, Thomas; Chacón, Arlette; Cuevas, Omar; Czekala, Harald; Hanuschik, Reinhard; Momany, Yazan; Navarrete, Julio; Querel, Richard R.; Smette, Alain; van den Ancker, Mario E.; Cure, Michel; Naylor, David A.

2012-09-01

We present the performance characteristics of a water vapour monitor that has been permanently deployed at ESO's Paranal observatory as a part of the VISIR upgrade project. After a careful analysis of the requirements and an open call for tender, the Low Humidity and Temperature Profiling microwave radiometer (LHATPRO), manufactured by Radiometer Physics GmbH (RPG), has been selected. The unit measures several channels across the strong water vapour emission line at 183 GHz, necessary for resolving the low levels of precipitable water vapour (PWV) that are prevalent on Paranal (median ~2.5 mm). The unit comprises the above humidity profiler (183-191 GHz), a temperature profiler (51-58 GHz), and an infrared radiometer (~10 μm) for cloud detection. The instrument has been commissioned during a 2.5 week period in Oct/Nov 2011, by comparing its measurements of PWV and atmospheric profiles with the ones obtained by 22 radiosonde balloons. In parallel an IR radiometer (Univ. Lethbridge) has been operated, and various observations with ESO facility spectrographs have been taken. The RPG radiometer has been validated across the range 0.5 - 9 mm demonstrating an accuracy of better than 0.1 mm. The saturation limit of the radiometer is about 20 mm. Currently, the radiometer is being integrated into the Paranal infrastructure to serve as a high time-resolution monitor in support of VLT science operations. The water vapour radiometer's ability to provide high precision, high time resolution information on this important aspect of the atmosphere will be most useful for conducting IR observations with the VLT under optimal conditions.

Diffusion NMR methods applied to xenon gas for materials study

NASA Technical Reports Server (NTRS)

Mair, R. W.; Rosen, M. S.; Wang, R.; Cory, D. G.; Walsworth, R. L.

2002-01-01

We report initial NMR studies of (i) xenon gas diffusion in model heterogeneous porous media and (ii) continuous flow laser-polarized xenon gas. Both areas utilize the pulsed gradient spin-echo (PGSE) techniques in the gas phase, with the aim of obtaining more sophisticated information than just translational self-diffusion coefficients--a brief overview of this area is provided in the Introduction. The heterogeneous or multiple-length scale model porous media consisted of random packs of mixed glass beads of two different sizes. We focus on observing the approach of the time-dependent gas diffusion coefficient, D(t) (an indicator of mean squared displacement), to the long-time asymptote, with the aim of understanding the long-length scale structural information that may be derived from a heterogeneous porous system. We find that D(t) of imbibed xenon gas at short diffusion times is similar for the mixed bead pack and a pack of the smaller sized beads alone, hence reflecting the pore surface area to volume ratio of the smaller bead sample. The approach of D(t) to the long-time limit follows that of a pack of the larger sized beads alone, although the limiting D(t) for the mixed bead pack is lower, reflecting the lower porosity of the sample compared to that of a pack of mono-sized glass beads. The Pade approximation is used to interpolate D(t) data between the short- and long-time limits. Initial studies of continuous flow laser-polarized xenon gas demonstrate velocity-sensitive imaging of much higher flows than can generally be obtained with liquids (20-200 mm s-1). Gas velocity imaging is, however, found to be limited to a resolution of about 1 mm s-1 owing to the high diffusivity of gases compared with liquids. We also present the first gas-phase NMR scattering, or diffusive-diffraction, data, namely flow-enhanced structural features in the echo attenuation data from laser-polarized xenon flowing through a 2 mm glass bead pack. c2002 John Wiley & Sons, Ltd.

Stratospheric water vapour in the vicinity of the Arctic polar vortex

NASA Astrophysics Data System (ADS)

Maturilli, M.; Fierli, F.; Yushkov, V.; Lukyanov, A.; Khaykin, S.; Hauchecorne, A.

2006-07-01

The stratospheric water vapour mixing ratio inside, outside, and at the edge of the polar vortex has been accurately measured by the FLASH-B Lyman-Alpha hygrometer during the LAUTLOS campaign in Sodankylä, Finland, in January and February 2004. The retrieved H2O profiles reveal a detailed view on the Arctic lower stratospheric water vapour distribution, and provide a valuable dataset for the validation of model and satellite data. Analysing the measurements with the semi-lagrangian advection model MIMOSA, water vapour profiles typical for the polar vortex' interior and exterior have been identified, and laminae in the observed profiles have been correlated to filamentary structures in the potential vorticity field. Applying the validated MIMOSA transport scheme to specific humidity fields from operational ECMWF analyses, large discrepancies from the observed profiles arise. Although MIMOSA is able to reproduce weak water vapour filaments and improves the shape of the profiles compared to operational ECMWF analyses, both models reveal a dry bias of about 1 ppmv in the lower stratosphere above 400 K, accounting for a relative difference from the measurements in the order of 20%. The large dry bias in the analysis representation of stratospheric water vapour in the Arctic implies the need for future regular measurements of water vapour in the polar stratosphere to allow the validation and improvement of climate models.

An X-ray diffraction method for semiquantitative mineralogical analysis of Chilean nitrate ore

USGS Publications Warehouse

Jackson, J.C.; Ericksent, G.E.

1997-01-01

Computer analysis of X-ray diffraction (XRD) data provides a simple method for determining the semiquantitative mineralogical composition of naturally occurring mixtures of saline minerals. The method herein described was adapted from a computer program for the study of mixtures of naturally occurring clay minerals. The program evaluates the relative intensities of selected diagnostic peaks for the minerals in a given mixture, and then calculates the relative concentrations of these minerals. The method requires precise calibration of XRD data for the minerals to be studied and selection of diffraction peaks that minimize inter-compound interferences. The calculated relative abundances are sufficiently accurate for direct comparison with bulk chemical analyses of naturally occurring saline mineral assemblages.

An x-ray diffraction method for semiquantitative mineralogical analysis of chilean nitrate ore

USGS Publications Warehouse

John, C.; George, J.; Ericksen, E.

1997-01-01

Computer analysis of X-ray diffraction (XRD) data provides a simple method for determining the semiquantitative mineralogical composition of naturally occurring mixtures of saline minerals. The method herein described was adapted from a computer program for the study of mixtures of naturally occurring clay minerals. The program evaluates the relative intensities of selected diagnostic peaks for the minerals in a given mixture, and then calculates the relative concentrations of these minerals. The method requires precise calibration of XRD data for the minerals to be studied and selection of diffraction peaks that minimize inter-compound interferences. The calculated relative abundances are sufficiently accurate for direct comparison with bulk chemical analyses of naturally occurring saline mineral assemblages.

Development of advanced methods for analysis of experimental data in diffusion

NASA Astrophysics Data System (ADS)

Jaques, Alonso V.

There are numerous experimental configurations and data analysis techniques for the characterization of diffusion phenomena. However, the mathematical methods for estimating diffusivities traditionally do not take into account the effects of experimental errors in the data, and often require smooth, noiseless data sets to perform the necessary analysis steps. The current methods used for data smoothing require strong assumptions which can introduce numerical "artifacts" into the data, affecting confidence in the estimated parameters. The Boltzmann-Matano method is used extensively in the determination of concentration - dependent diffusivities, D(C), in alloys. In the course of analyzing experimental data, numerical integrations and differentiations of the concentration profile are performed. These methods require smoothing of the data prior to analysis. We present here an approach to the Boltzmann-Matano method that is based on a regularization method to estimate a differentiation operation on the data, i.e., estimate the concentration gradient term, which is important in the analysis process for determining the diffusivity. This approach, therefore, has the potential to be less subjective, and in numerical simulations shows an increased accuracy in the estimated diffusion coefficients. We present a regression approach to estimate linear multicomponent diffusion coefficients that eliminates the need pre-treat or pre-condition the concentration profile. This approach fits the data to a functional form of the mathematical expression for the concentration profile, and allows us to determine the diffusivity matrix directly from the fitted parameters. Reformulation of the equation for the analytical solution is done in order to reduce the size of the problem and accelerate the convergence. The objective function for the regression can incorporate point estimations for error in the concentration, improving the statistical confidence in the estimated diffusivity matrix

Twin-domain size and bulk oxygen in-diffusion kinetics of YBa 2Cu 3O 6+x studied by neutron powder diffraction and gas volumetry

NASA Astrophysics Data System (ADS)

Poulsen, H. F.; Andersen, N. H.; Lebech, B.

1991-02-01

We report experimental results of twin-domain size and bulk oxygen in-diffusion kinetics of YBa 2Cu 3O 6+ x, which supplement a previous and simultaneous study of the structural phase diagram and oxygen equilibrium partial pressure. Analysis of neutron powder diffraction peak broadening show features which are identified to result from temperature independent twin-domain formation in to different orthorhombic phases with domain sizes and 250 and 350Å, respectively. The oxygen in-diffusion flow shows simple relaxation type behaviour J=J 0 exp( {-t}/{τ}) despite a rather broad particle size distribution. At higher temperatures, τ is activated with activation energies 0.55 and 0.25 eV in the tetragonal and orthorhombic phases, respectively. Comparison between twin-domain sizes and bulk oxygen in-diffusion time constants indicates that the twin-domain boundaries may contribute to the effective bulk oxygen in-diffusion. All our results may be interpreted in terms of the 2D ASYNNNI model description of the oxygen basal plane ordering, and they suggest that recent first principles interaction parameters should be modified.

Crystallization and preliminary X-ray diffraction analysis of mouse galectin-4 N-terminal carbohydrate recognition domain in complex with lactose

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krejčiříková, Veronika; Fábry, Milan; Marková, Vladimíra

2008-07-01

Mouse galectin-4 carbohydrate binding domain was overexpressed in E. coli and crystallized in the presence of lactose. The crystals belong to tetragonal space group P42{sub 1}2 and diffraction data were collected to 2.1 Å resolution. Galectin-4 is thought to play a role in the process of tumour conversion of cells of the alimentary tract and the breast tissue; however, its exact function remains unknown. With the aim of elucidating the structural basis of mouse galectin-4 (mGal-4) binding specificity, we have undertaken X-ray analysis of the N-terminal domain, CRD1, of mGal-4 in complex with lactose (the basic building block of knownmore » galectin-4 carbohydrate ligands). Crystals of CRD1 in complex with lactose were obtained using vapour-diffusion techniques. The crystals belong to tetragonal space group P42{sub 1}2 with unit-cell parameters a = 91.1, b = 91.16, c = 57.10 Å and preliminary X-ray diffraction data were collected to 3.2 Å resolution. An optimized crystallization procedure and cryocooling protocol allowed us to extend resolution to 2.1 Å. Structure refinement is currently under way; the initial electron-density maps clearly show non-protein electron density in the vicinity of the carbohydrate binding site, indicating the presence of one lactose molecule. The structure will help to improve understanding of the binding specificity and function of the potential colon cancer marker galectin-4.« less

Evaluation of Direct Vapour Equilibration for Stable Isotope Analysis of Plant Water.

NASA Astrophysics Data System (ADS)

Millar, C. B.; McDonnell, J.; Pratt, D.

2017-12-01

The stable isotopes of water (2H and 18O), extracted from plants, have been utilized in a variety of ecohydrological, biogeochemical and climatological studies. The array of methods used to extract water from plants are as varied as the studies themselves. Here we perform a comprehensive inter-method comparison of six plant water extraction techniques: direct vapour equilibration, microwave extraction, two unique versions of cryogenic extraction, centrifugation, and high pressure mechanical squeezing. We applied these methods to four isotopically unique plant portions (heads, stems, leaves and root crown) of spring wheat (Triticum aestivum L.). The spring wheat was grown under controlled conditions with irrigation inputs of a known isotopic composition. Our results show that the methods of extraction return significantly different plant water isotopic signals. Centrifugation, microwave extraction, direct vapour equilibration, and squeezing returned more enriched results. Both cryogenic systems and squeezing returned more depleted results, depending upon the plant portion extracted. While cryogenic extraction is currently the most widely used method in the literature, our results suggest that direct vapor equilibration method outperforms it in terms of accuracy, sample throughput and replicability. More research is now needed with other plant species (especially woody plants) to see how far the findings from this study could be extended.

An enriched finite element method to fractional advection-diffusion equation

NASA Astrophysics Data System (ADS)

Luan, Shengzhi; Lian, Yanping; Ying, Yuping; Tang, Shaoqiang; Wagner, Gregory J.; Liu, Wing Kam

2017-08-01

In this paper, an enriched finite element method with fractional basis [ 1,x^{α }] for spatial fractional partial differential equations is proposed to obtain more stable and accurate numerical solutions. For pure fractional diffusion equation without advection, the enriched Galerkin finite element method formulation is demonstrated to simulate the exact solution successfully without any numerical oscillation, which is advantageous compared to the traditional Galerkin finite element method with integer basis [ 1,x] . For fractional advection-diffusion equation, the oscillatory behavior becomes complex due to the introduction of the advection term which can be characterized by a fractional element Peclet number. For the purpose of addressing the more complex numerical oscillation, an enriched Petrov-Galerkin finite element method is developed by using a dimensionless fractional stabilization parameter, which is formulated through a minimization of the residual of the nodal solution. The effectiveness and accuracy of the enriched finite element method are demonstrated by a series of numerical examples of fractional diffusion equation and fractional advection-diffusion equation, including both one-dimensional and two-dimensional, steady-state and time-dependent cases.

Diffraction based method to reconstruct the spectrum of the Thomson scattering x-ray source

NASA Astrophysics Data System (ADS)

Chi, Zhijun; Yan, Lixin; Zhang, Zhen; Zhou, Zheng; Zheng, Lianmin; Wang, Dong; Tian, Qili; Wang, Wei; Nie, Zan; Zhang, Jie; Du, Yingchao; Hua, Jianfei; Shi, Jiaru; Pai, Chihao; Lu, Wei; Huang, Wenhui; Chen, Huaibi; Tang, Chuanxiang

2017-04-01

As Thomson scattering x-ray sources based on the collision of intense laser and relativistic electrons have drawn much attention in various scientific fields, there is an increasing demand for the effective methods to reconstruct the spectrum information of the ultra-short and high-intensity x-ray pulses. In this paper, a precise spectrum measurement method for the Thomson scattering x-ray sources was proposed with the diffraction of a Highly Oriented Pyrolytic Graphite (HOPG) crystal and was demonstrated at the Tsinghua Thomson scattering X-ray source. The x-ray pulse is diffracted by a 15 mm (L) ×15 mm (H)× 1 mm (D) HOPG crystal with 1° mosaic spread. By analyzing the diffraction pattern, both x-ray peak energies and energy spectral bandwidths at different polar angles can be reconstructed, which agree well with the theoretical value and simulation. The higher integral reflectivity of the HOPG crystal makes this method possible for single-shot measurement.

Diffraction based method to reconstruct the spectrum of the Thomson scattering x-ray source.

PubMed

Chi, Zhijun; Yan, Lixin; Zhang, Zhen; Zhou, Zheng; Zheng, Lianmin; Wang, Dong; Tian, Qili; Wang, Wei; Nie, Zan; Zhang, Jie; Du, Yingchao; Hua, Jianfei; Shi, Jiaru; Pai, Chihao; Lu, Wei; Huang, Wenhui; Chen, Huaibi; Tang, Chuanxiang

2017-04-01

As Thomson scattering x-ray sources based on the collision of intense laser and relativistic electrons have drawn much attention in various scientific fields, there is an increasing demand for the effective methods to reconstruct the spectrum information of the ultra-short and high-intensity x-ray pulses. In this paper, a precise spectrum measurement method for the Thomson scattering x-ray sources was proposed with the diffraction of a Highly Oriented Pyrolytic Graphite (HOPG) crystal and was demonstrated at the Tsinghua Thomson scattering X-ray source. The x-ray pulse is diffracted by a 15 mm (L) ×15 mm (H)× 1 mm (D) HOPG crystal with 1° mosaic spread. By analyzing the diffraction pattern, both x-ray peak energies and energy spectral bandwidths at different polar angles can be reconstructed, which agree well with the theoretical value and simulation. The higher integral reflectivity of the HOPG crystal makes this method possible for single-shot measurement.

Liquid and vapour-phase antifungal activities of selected essential oils against candida albicans: microscopic observations and chemical characterization of cymbopogon citratus

PubMed Central

2010-01-01

Background Use of essential oils for controlling Candida albicans growth has gained significance due to the resistance acquired by pathogens towards a number of widely-used drugs. The aim of this study was to test the antifungal activity of selected essential oils against Candida albicans in liquid and vapour phase and to determine the chemical composition and mechanism of action of most potent essential oil. Methods Minimum Inhibitory concentration (MIC) of different essential oils in liquid phase, assayed through agar plate dilution, broth dilution & 96-well micro plate dilution method and vapour phase activity evaluated through disc volatilization method. Reduction of C. albicans cells with vapour exposure was estimated by kill time assay. Morphological alteration in treated/untreated C. albicans cells was observed by the Scanning electron microscopy (SEM)/Atomic force microscopy (AFM) and chemical analysis of the strongest antifungal agent/essential oil has been done by GC, GC-MS. Results Lemon grass (Cymbopogon citratus) essential oil exhibited the strongest antifungal effect followed by mentha (Mentha piperita) and eucalyptus (Eucalyptus globulus) essential oil. The MIC of lemon grass essential oil in liquid phase (288 mg/l) was significantly higher than that in the vapour phase (32.7 mg/l) and a 4 h exposure was sufficient to cause 100% loss in viability of C. albicans cells. SEM/AFM of C. albicans cells treated with lemon grass essential oil at MIC level in liquid and vapour phase showed prominent shrinkage and partial degradation, respectively, confirming higher efficacy of vapour phase. GC-MS analysis revealed that lemon grass essential oil was dominated by oxygenated monoterpenes (78.2%); α-citral or geranial (36.2%) and β-citral or neral (26.5%), monoterpene hydrocarbons (7.9%) and sesquiterpene hydrocarbons (3.8%). Conclusion Lemon grass essential oil is highly effective in vapour phase against C. albicans, leading to deleterious morphological

The dynamic effects of metal vapour in gas metal arc welding

NASA Astrophysics Data System (ADS)

Haidar, Jawad

2010-04-01

Numerical simulations for the dynamic effects of metal vapour in gas metal arc welding (GMAW) suggest that vapour from the welding droplet at the tip of the welding wire has a significant influence on the plasma properties. It is found that for the evaporation rates calculated for arcs in pure argon, the dynamic effects of metal vapour markedly cool down the plasma in the central region of the arc, leading to the formation of a low temperature zone centred on the arc axis, in agreement with experimental measurements in the literature. Radiation effects, omitted in this paper, may produce further cooling of the plasma gas. The results highlight major deficiencies in the common approach to modelling the GMAW process and suggest that accurate description of GMAW must include the influence of metal vapour on the plasma.

Optical and structural properties of protein/gold hybrid bio-nanofilms prepared by layer-by-layer method.

PubMed

Pál, Edit; Hornok, Viktória; Sebok, Dániel; Majzik, Andrea; Dékány, Imre

2010-08-01

Lysozyme/gold thin layers were prepared by layer-by-layer (LbL) self-assembly method. The build-up of the films was followed by UV-vis-absorbance spectra, quartz crystal microbalance (QCM) and surface plasmon resonance (SPR) techniques. The structural property of films was examined by X-ray diffraction (XRD) measurements, while their morphology was studied by scanning electron microscopy (SEM) and atomic force microscopy (AFM). It was found that gold nanoparticles (NPs) had cubic crystalline structure, the primary particles form aggregates in the thin layer due to the presence of lysozyme molecules. The UV-vis measurements prove change in particle size while the colour of the film changes from wine-red to blue. The layer thickness of films was determined using the above methods and the loose, porous structure of the films explains the difference in the results. The vapour adsorption property of hybrid layers was also studied by QCM using different saturated vapours and ammonia gas. The lysozyme/Au films were most sensitive for ammonia gas among the tested gases/vapours due to the strongest interaction between the functional groups of the protein. Copyright 2010 Elsevier B.V. All rights reserved.

Properties of meso-Erythritol; phase state, accommodation coefficient and saturation vapour pressure

NASA Astrophysics Data System (ADS)

Emanuelsson, Eva; Tschiskale, Morten; Bilde, Merete

2016-04-01

Introduction Saturation vapour pressure and the associated temperature dependence (enthalpy ΔH), are key parameters for improving predictive atmospheric models. Generally, the atmospheric aerosol community lack experimentally determined values of these properties for relevant organic aerosol compounds (Bilde et al., 2015). In this work we have studied the organic aerosol component meso-Erythritol. Methods Sub-micron airborne particles of meso-Erythritol were generated by nebulization from aqueous solution, dried, and a mono disperse fraction of the aerosol was selected using a differential mobility analyser. The particles were then allowed to evaporate in the ARAGORN (AaRhus Atmospheric Gas phase OR Nano particle) flow tube. It is a temperature controlled 3.5 m long stainless steel tube with an internal diameter of 0.026 m (Bilde et al., 2003, Zardini et al., 2010). Changes in particle size as function of evaporation time were determined using a scanning mobility particle sizer system. Physical properties like air flow, temperature, humidity and pressure were controlled and monitored on several places in the setup. The saturation vapour pressures were then inferred from the experimental results in the MATLAB® program AU_VaPCaP (Aarhus University_Vapour Pressure Calculation Program). Results Following evaporation, meso-Erythriol under some conditions showed a bimodal particle size distribution indicating the formation of particles of two different phase states. The issue of physical phase state, along with critical assumptions e.g. the accommodation coefficient in the calculations of saturation vapour pressures of atmospheric relevant compounds, will be discussed. Saturation vapour pressures from the organic compound meso-Erythritol will be presented at temperatures between 278 and 308 K, and results will be discussed in the context of atmospheric chemistry. References Bilde, M. et al., (2015), Chemical Reviews, 115 (10), 4115-4156. Bilde, M. et. al., (2003

Some basic mathematical methods of diffusion theory. [emphasis on atmospheric applications

NASA Technical Reports Server (NTRS)

Giere, A. C.

1977-01-01

An introductory treatment of the fundamentals of diffusion theory is presented, starting with molecular diffusion and leading up to the statistical methods of turbulent diffusion. A multilayer diffusion model, designed to permit concentration and dosage calculations downwind of toxic clouds from rocket vehicles, is described. The concepts and equations of diffusion are developed on an elementary level, with emphasis on atmospheric applications.

GPS tomographic experiment on water vapour dynamics in the troposphere over Lisbon

NASA Astrophysics Data System (ADS)

Benevides, Pedro; Catalao, Joao; Miranda, Pedro

2015-04-01

Quantification of the water vapour variability on the atmosphere remains a difficult task, affecting the weather prediction. Coarse water vapour resolution measurements in space and time affect the numerical weather prediction solution models causing artifacts in the prediction of severe weather phenomena. The GNSS atmospheric processing has been developed in the past years providing integrated water vapour estimates comparable with the meteorological sensor measurements, with studies registering 1 to 2 kg/m2 bias, but lack a vertical determination of the atmospheric processes. The GNSS tomography in the troposphere is one of the most promising techniques for sensing the three-dimensional water vapour state of the atmosphere. The determination of the integrated water vapour profile by means of the widely accepted GNSS meteorology techniques, allows the reconstruction of several slant path delay rays in the satellite line of view, providing an opportunity to sense the troposphere at tree-dimensions plus time. The tomographic system can estimate an image solution of the water vapour but impositions have to be introduced to the system of equations inversion because of the non-optimal GNSS observation geometry. Application of this technique on atmospheric processes like large convective precipitation or mesoscale water vapour circulation have been able to describe its local dynamic vertical variation. A 3D tomographic experiment was developed over an area of 60x60 km2 around Lisbon (Portugal). The GNSS network available composed by 9 receivers was used for an experiment of densification of the permanent network using 8 temporarily installed GPS receivers (totalling 17 stations). This study was performed during several weeks in July 2013, where a radiosonde campaign was also held in order to validate the tomographic inversion solution. 2D integrated water vapour maps directly obtained from the GNSS processing were also evaluated and local coastal breeze circulation

New methods for indexing multi-lattice diffraction data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gildea, Richard J.; Waterman, David G.; CCP4, Research Complex at Harwell, Rutherford Appleton Laboratory, Didcot OX11 0FA

2014-10-01

A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of data. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-lattice data recorded from microcrystals of ∼1 µm in size. A new indexing method is presented which is capable of indexing multiple crystal lattices from narrow wedges of diffraction data. The method takes advantage of a simplification of Fourier transform-based methods that is applicable when the unit-cell dimensions are known a priori. The efficacy of this method is demonstrated with both semi-synthetic multi-lattice data and real multi-latticemore » data recorded from crystals of ∼1 µm in size, where it is shown that up to six lattices can be successfully indexed and subsequently integrated from a 1° wedge of data. Analysis is presented which shows that improvements in data-quality indicators can be obtained through accurate identification and rejection of overlapping reflections prior to scaling.« less

Purification, Crystallization, and Preliminary Crystallographic Analysis of Deoxyuridine Triphosphate Nucleotidohydrolase from Arabidopsis Thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajaj,M.; Moriyama, H.

2007-01-01

The deoxyuridine triphosphate nucleotidohydrolase gene from Arabidopsis thaliana was expressed and the gene product was purified. Crystallization was performed by the hanging-drop vapour-diffusion method at 298 K using 2 M ammonium sulfate as the precipitant. X-ray diffraction data were collected to 2.2 Angstroms resolution using Cu K{alpha} radiation. The crystal belongs to the orthorhombic space group P212121, with unit-cell parameters a = 69.90, b = 70.86 Angstroms, c = 75.55 Angstroms . Assuming the presence of a trimer in the asymmetric unit, the solvent content was 30%, with a VM of 1.8 Angstroms 3 Da-1.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aoki, Ken-ichi; Tanaka, Nobutada, E-mail: ntanaka@pharm.showa-u.ac.jp; Ishikura, Shuhei

Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P4{sub 2}, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters amore » = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution.« less

Measurements of the levels of organic solvent vapours by personal air samplers and the levels of urinary metabolites of workers. Part 2. Toluene vapour in a shipbuilding yard (author's transl).

PubMed

Kira, S

1977-05-01

Personal air samplers were applied to shipyard's painters putting on gas masks during the spraying work, and the levels of toluene vapour surrounding the workers were measured. On the other hand, levels of urinary hippuric acid (metabolites of toluene) of the workers were measured, and the levels of toluene vapour inhaled were calculated from the levels of urinary hippuric acid. Then the actual removing-efficiencies of toluene vapours by the use of gas masks were estimated from these two levels (i.e., toluene vapours exposed and inhaled). The values of removing-efficiencies were found to be 65.9-98.1%. The concentrations of hippuric and methylhippuric acids in the urine of workers exposed to toluene and xylene for 3 hours, collected just after the exposure, are valuable indices of these organic solvent vapours inhaled. A minute amount of urinary methylhippuric acid can be determined by means of gas chromatography.

Point-particle method to compute diffusion-limited cellular uptake.

PubMed

Sozza, A; Piazza, F; Cencini, M; De Lillo, F; Boffetta, G

2018-02-01

We present an efficient point-particle approach to simulate reaction-diffusion processes of spherical absorbing particles in the diffusion-limited regime, as simple models of cellular uptake. The exact solution for a single absorber is used to calibrate the method, linking the numerical parameters to the physical particle radius and uptake rate. We study the configurations of multiple absorbers of increasing complexity to examine the performance of the method by comparing our simulations with available exact analytical or numerical results. We demonstrate the potential of the method to resolve the complex diffusive interactions, here quantified by the Sherwood number, measuring the uptake rate in terms of that of isolated absorbers. We implement the method in a pseudospectral solver that can be generalized to include fluid motion and fluid-particle interactions. As a test case of the presence of a flow, we consider the uptake rate by a particle in a linear shear flow. Overall, our method represents a powerful and flexible computational tool that can be employed to investigate many complex situations in biology, chemistry, and related sciences.

Multiple defocused coherent diffraction imaging: method for simultaneously reconstructing objects and probe using X-ray free-electron lasers.

PubMed

Hirose, Makoto; Shimomura, Kei; Suzuki, Akihiro; Burdet, Nicolas; Takahashi, Yukio

2016-05-30

The sample size must be less than the diffraction-limited focal spot size of the incident beam in single-shot coherent X-ray diffraction imaging (CXDI) based on a diffract-before-destruction scheme using X-ray free electron lasers (XFELs). This is currently a major limitation preventing its wider applications. We here propose multiple defocused CXDI, in which isolated objects are sequentially illuminated with a divergent beam larger than the objects and the coherent diffraction pattern of each object is recorded. This method can simultaneously reconstruct both objects and a probe from the coherent X-ray diffraction patterns without any a priori knowledge. We performed a computer simulation of the prposed method and then successfully demonstrated it in a proof-of-principle experiment at SPring-8. The prposed method allows us to not only observe broad samples but also characterize focused XFEL beams.

Vapour sensitivity of an ALD hierarchical photonic structure inspired by Morpho.

PubMed

Poncelet, Olivier; Tallier, Guillaume; Mouchet, Sébastien R; Crahay, André; Rasson, Jonathan; Kotipalli, Ratan; Deparis, Olivier; Francis, Laurent A

2016-05-09

The unique architecture of iridescent Morpho butterfly scales is known to exhibit different optical responses to various vapours. However, the mechanism behind this phenomenon is not fully quantitatively understood. This work reports on process developments in the micro-fabrication of a Morpho-inspired photonic structure in atomic layer deposited (ALD) materials in order to investigate the vapour optical sensitivity of such artificial nanostructures. By developing recipes for dry and wet etching of ALD oxides, we micro-fabricated two structures: one combining Al2O3 and TiO2, and the other combining Al2O3 and HfO2. For the first time, we report the optical response of such ALD Morpho-like structures measured under a controlled flow of either ethanol or isopropyl alcohol (IPA) vapour. In spite of the small magnitude of the effect, the results show a selective vapour response (depending on the materials used).

Nonuniform fast Fourier transform method for numerical diffraction simulation on tilted planes.

PubMed

Xiao, Yu; Tang, Xiahui; Qin, Yingxiong; Peng, Hao; Wang, Wei; Zhong, Lijing

2016-10-01

The method, based on the rotation of the angular spectrum in the frequency domain, is generally used for the diffraction simulation between the tilted planes. Due to the rotation of the angular spectrum, the interval between the sampling points in the Fourier domain is not even. For the conventional fast Fourier transform (FFT)-based methods, a spectrum interpolation is needed to get the approximate sampling value on the equidistant sampling points. However, due to the numerical error caused by the spectrum interpolation, the calculation accuracy degrades very quickly as the rotation angle increases. Here, the diffraction propagation between the tilted planes is transformed into a problem about the discrete Fourier transform on the uneven sampling points, which can be evaluated effectively and precisely through the nonuniform fast Fourier transform method (NUFFT). The most important advantage of this method is that the conventional spectrum interpolation is avoided and the high calculation accuracy can be guaranteed for different rotation angles, even when the rotation angle is close to π/2. Also, its calculation efficiency is comparable with that of the conventional FFT-based methods. Numerical examples as well as a discussion about the calculation accuracy and the sampling method are presented.

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

PubMed

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-11-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

Expression, crystallization and phasing of vacuolar H(+)-ATPase subunit C (Vma5p) of Saccharomyces cerevisiae.

PubMed

Drory, Omri; Mor, Adi; Frolow, Felix; Nelson, Nathan

2004-10-01

The expression, crystallization and phasing of subunit C (Vma5p) of the yeast (Saccharomyces cerevisiae) vacuolar proton-translocating ATPase (V-ATPase) is described. The expressed protein consists of 412 residues: 392 from the reading frame of Vma5p and 20 N-terminal residues originating from the plasmid. Diffraction-quality crystals were obtained using the hanging-drop and sitting-drop vapour-diffusion methods assisted by streak-seeding, with PEG 3350 as precipitant. The crystals formed in hanging drops diffracted to 1.80 A and belong to space group P4(3)2(1)2(1), with unit-cell parameters a = b = 62.54, c = 327.37 A, alpha = beta = gamma = 90 degrees. The structure was solved using SIRAS with a Lu(O2C2H3)2 heavy-atom derivative.

Estimating past leaf-to-air vapour pressure deficit from terrestrial plant 13C

NASA Astrophysics Data System (ADS)

Turney, Chris S. M.; Barringer, James; Hunt, John E.; McGlone, Matt S.

1999-08-01

13C was determined in lignin extracted from present-day cladodes of Phyllocladus alpinus (a small coniferous tree) from seven well-lit sites across New Zealand. The 13C values ranged from -30.9 to -23.6 and were compared with monthly means of temperature, precipitation, relative humidity and vapour pressure deficit from the nearest recording stations. Of these parameters, the leaf-to-air vapour pressure deficit of the first month of cladode growth and expansion proved to be the most significantly correlated with lignin 13C, over a range of 0.3 to 0.8 kPa, confirming the importance of atmospheric moisture content on stomatal conductance. The carbon isotopic signature of lignin from fossilised cladodes preserved under the Kawakawa Tephra (22.6 k 14C yr BP) on the North Island is identical to that of the whole tissue, suggesting that for this species at least, fossil material can be used to approximate the lignin 13C. The 13C of species- and organ-specific fossil terrestrial plant material therefore provides an excellent method to quantify past changes in leaf-to-air vapour pressure deficit.

Vertical structure of stratospheric water vapour trends derived from merged satellite data

PubMed Central

Hegglin, M. I.; Plummer, D. A.; Shepherd, T. G.; Scinocca, J. F.; Anderson, J.; Froidevaux, L.; Funke, B.; Hurst, D.; Rozanov, A.; Urban, J.; von Clarmann, T.; Walker, K. A.; Wang, H. J.; Tegtmeier, S.; Weigel, K.

2017-01-01

Stratospheric water vapour is a powerful greenhouse gas. The longest available record from balloon observations over Boulder, Colorado, USA shows increases in stratospheric water vapour concentrations that cannot be fully explained by observed changes in the main drivers, tropical tropopause temperatures and methane. Satellite observations could help resolve the issue, but constructing a reliable long-term data record from individual short satellite records is challenging. Here we present an approach to merge satellite data sets with the help of a chemistry-climate model nudged to observed meteorology. We use the models' water vapour as a transfer function between data sets that overcomes issues arising from instrument drift and short overlap periods. In the lower stratosphere, our water vapour record extends back to 1988 and water vapour concentrations largely follow tropical tropopause temperatures. Lower and mid-stratospheric long-term trends are negative, and the trends from Boulder are shown not to be globally representative. In the upper stratosphere, our record extends back to 1986 and shows positive long-term trends. The altitudinal differences in the trends are explained by methane oxidation together with a strengthened lower-stratospheric and a weakened upper-stratospheric circulation inferred by this analysis. Our results call into question previous estimates of surface radiative forcing based on presumed global long-term increases in water vapour concentrations in the lower stratosphere. PMID:29263751

Vertical structure of stratospheric water vapour trends derived from merged satellite data.

PubMed

Hegglin, M I; Plummer, D A; Shepherd, T G; Scinocca, J F; Anderson, J; Froidevaux, L; Funke, B; Hurst, D; Rozanov, A; Urban, J; von Clarmann, T; Walker, K A; Wang, H J; Tegtmeier, S; Weigel, K

2014-01-01

Stratospheric water vapour is a powerful greenhouse gas. The longest available record from balloon observations over Boulder, Colorado, USA shows increases in stratospheric water vapour concentrations that cannot be fully explained by observed changes in the main drivers, tropical tropopause temperatures and methane. Satellite observations could help resolve the issue, but constructing a reliable long-term data record from individual short satellite records is challenging. Here we present an approach to merge satellite data sets with the help of a chemistry-climate model nudged to observed meteorology. We use the models' water vapour as a transfer function between data sets that overcomes issues arising from instrument drift and short overlap periods. In the lower stratosphere, our water vapour record extends back to 1988 and water vapour concentrations largely follow tropical tropopause temperatures. Lower and mid-stratospheric long-term trends are negative, and the trends from Boulder are shown not to be globally representative. In the upper stratosphere, our record extends back to 1986 and shows positive long-term trends. The altitudinal differences in the trends are explained by methane oxidation together with a strengthened lower-stratospheric and a weakened upper-stratospheric circulation inferred by this analysis. Our results call into question previous estimates of surface radiative forcing based on presumed global long-term increases in water vapour concentrations in the lower stratosphere.

Water vapour correction of the daily 1 km AVHRR global land dataset: Part I validation and use of the Water Vapour input field

USGS Publications Warehouse

DeFelice, Thomas P.; Lloyd, D.; Meyer, D.J.; Baltzer, T. T.; Piraina, P.

2003-01-01

An atmospheric correction algorithm developed for the 1 km Advanced Very High Resolution Radiometer (AVHRR) global land dataset was modified to include a near real-time total column water vapour data input field to account for the natural variability of atmospheric water vapour. The real-time data input field used for this study is the Television and Infrared Observational Satellite (TIROS) Operational Vertical Sounder (TOVS) Pathfinder A global total column water vapour dataset. It was validated prior to its use in the AVHRR atmospheric correction process using two North American AVHRR scenes, namely 13 June and 28 November 1996. The validation results are consistent with those reported by others and entail a comparison between TOVS, radiosonde, experimental sounding, microwave radiometer, and data from a hand-held sunphotometer. The use of this data layer as input to the AVHRR atmospheric correction process is discussed.

Initial evaluation of airborne water vapour measurements by the IAGOS-GHG CRDS system

NASA Astrophysics Data System (ADS)

Filges, Annette; Gerbig, Christoph; Smit, Herman G. J.; Krämer, Martina; Spelten, Nicole

2013-04-01

. This setup ensures full compatibility with the future deployment of the analyser within IAGOS. For the initial water calibration of the instrument, a calibration of a similar instrument performed at MPI-BGC Jena against a dew point mirror (Dewmet, Michell instruments Ltd., UK) in the range from 0.7 to 3.0% was transferred to all subsequently manufactured CRDS instruments by Picarro. During the campaign the analyzer was compared against a reference frost point hygrometer, which is also used for calibration of the reference instrument FISH. The dew point mirror calibration was within 0.7 % of the FISH calibrator, but showed an offset of 14.45 ppm, which is consistent with the H2O content of dry tank air and diffusion effects through the inlet line (FEP). Furthermore, a new independent calibration method, based on the dilution effect of water vapour on CO2, was tested. It showed a 9 % low bias compared to the dew point mirror calibration. Comparison of the in-flight data against the reference systems showed that the analyzer is reliable and has a good long-term stability. Flight data from the DENCHAR campaign suggest a conservative precision estimate for measurements made at 0.4 Hz of 4 ppm for H2O < 100 ppm, and 4 % (relative) for H2O > 100 ppm. Accuracy at mixing ratios below 50 ppm was difficult to assess, as the reference instruments suffered from lack of stability. We present the results of the campaign flights and comparison with the reference instruments. The different calibration methods will be discussed.

Spectroscopic interaction studies of substituted and unsubstituted copper phthalocyanine with adsorbed organic vapours

NASA Astrophysics Data System (ADS)

Ridhi, R.; Kang, Jasmeen; Saini, G. S. S.; Tripathi, S. K.

2018-05-01

The present study deals with comparing the interaction mechanism of adsorbed organic vapours with Copper Phthalocyanine thin films in its substituted and unsubstituted forms. For this purpose, the variations in vibrational levels of substituted CuPc (CuPcS) functionalized with tetrasulfonic acid tetrasodium salt and unsubstituted CuPc after exposure with methanol and benzene vapours is analyzed. Fourier transform infrared (FTIR) is used to study the interaction behaviour. The bulkier group tetrasulfonic acid tetrasodium salt added to CuPc leads to occupation of more space in the molecular arrangement as compared to unsubstituted CuPc and hence alteration of its properties. FTIR spectra of CuPc and CuPcS before and after vapours exposures highlighted the effect of these vapours on the various bonds and the role of functional group in altering the molecular structure of CuPcS during interaction with adsorbed vapours.

Investigation of diffusion length distribution on polycrystalline silicon wafers via photoluminescence methods

PubMed Central

Lou, Shishu; Zhu, Huishi; Hu, Shaoxu; Zhao, Chunhua; Han, Peide

2015-01-01

Characterization of the diffusion length of solar cells in space has been widely studied using various methods, but few studies have focused on a fast, simple way to obtain the quantified diffusion length distribution on a silicon wafer. In this work, we present two different facile methods of doing this by fitting photoluminescence images taken in two different wavelength ranges or from different sides. These methods, which are based on measuring the ratio of two photoluminescence images, yield absolute values of the diffusion length and are less sensitive to the inhomogeneity of the incident laser beam. A theoretical simulation and experimental demonstration of this method are presented. The diffusion length distributions on a polycrystalline silicon wafer obtained by the two methods show good agreement. PMID:26364565

New CVD-based method for the growth of high-quality crystalline zinc oxide layers

NASA Astrophysics Data System (ADS)

Huber, Florian; Madel, Manfred; Reiser, Anton; Bauer, Sebastian; Thonke, Klaus

2016-07-01

High-quality zinc oxide (ZnO) layers were grown using a new chemical vapour deposition (CVD)-based low-cost growth method. The process is characterized by total simplicity, high growth rates, and cheap, less hazardous precursors. To produce elementary zinc vapour, methane (CH4) is used to reduce a ZnO powder. By re-oxidizing the zinc with pure oxygen, highly crystalline ZnO layers were grown on gallium nitride (GaN) layers and on sapphire substrates with an aluminum nitride (AlN) nucleation layer. Using simple CH4 as precursor has the big advantage of good controllability and the avoidance of highly toxic gases like nitrogen oxides. In photoluminescence (PL) measurements the samples show a strong near-band-edge emission and a sharp line width at 5 K. The good crystal quality has been confirmed in high resolution X-ray diffraction (HRXRD) measurements. This new growth method has great potential for industrial large-scale production of high-quality single crystal ZnO layers.

Vapour-liquid interfacial properties of square-well chains from density functional theory and Monte Carlo simulation.

PubMed

Martínez-Ruiz, Francisco José; Blas, Felipe J; Moreno-Ventas Bravo, A Ignacio; Míguez, José Manuel; MacDowell, Luis G

2017-05-17

The statistical associating fluid theory for attractive potentials of variable range (SAFT-VR) density functional theory (DFT) developed by [Gloor et al., J. Chem. Phys., 2004, 121, 12740-12759] is used to predict the interfacial behaviour of molecules modelled as fully-flexible square-well chains formed from tangentially-bonded monomers of diameter σ and potential range λ = 1.5σ. Four different model systems, comprising 4, 8, 12, and 16 monomers per molecule, are considered. In addition to that, we also compute a number of interfacial properties of molecular chains from direct simulation of the vapour-liquid interface. The simulations are performed in the canonical ensemble, and the vapour-liquid interfacial tension is evaluated using the wandering interface (WIM) method, a technique based on the thermodynamic definition of surface tension. Apart from surface tension, we also obtain density profiles, coexistence densities, vapour pressures, and critical temperature and density, paying particular attention to the effect of the chain length on these properties. According to our results, the main effect of increasing the chain length (at fixed temperature) is to sharpen the vapour-liquid interface and to increase the width of the biphasic coexistence region. As a result, the interfacial thickness decreases and the surface tension increases as the molecular chains get longer. The interfacial thickness and surface tension appear to exhibit an asymptotic limiting behaviour for long chains. A similar behaviour is also observed for the coexistence densities and critical properties. Agreement between theory and simulation results indicates that SAFT-VR DFT is only able to predict qualitatively the interfacial properties of the model. Our results are also compared with simulation data taken from the literature, including the vapour-liquid coexistence densities, vapour pressures, and surface tension.

Antifungal activity of clove essential oil and its volatile vapour against dermatophytic fungi.

PubMed

Chee, Hee Youn; Lee, Min Hee

2007-12-01

Antifungal activities of clove essential oil and its volatile vapour against dermatophytic fungi including Candida albicans, Epidermophyton floccosum. Microsporum audouinii, Trichophyton mentagrophytes, and Trichophyton rubrum were investigated. Both clove essential oil and its volatile vapour strongly inhibit spore germination and mycelial growth of the dermatophytic fungi tested. The volatile vapour of clove essential oil showed fungistatic activity whereas direct application of clove essential oil showed fungicidal activity.

Post-Contamination Vapour Hazards from Military Vehicles Contaminated with Thickened and Unthickened GD

DTIC Science & Technology

1979-02-01

The residual vapour hazards from four types of military vehicles previously contaminated with either thickened or unthickened GD have been measured...magnitude of these hazards have been investigated and an assessment made of their relevance to contamination control. It was found that on permeable... contamination had been applied were ineffective in reducing the subsequent vapour hazard; the vapour hazard arising from thickened GD contamination was less

Characterization of doped hydrogenated nanocrystalline silicon films prepared by plasma enhanced chemical vapour deposition

NASA Astrophysics Data System (ADS)

Wang, Jin-Liang; Wu, Er-Xing

2007-03-01

The B- and P-doped hydrogenated nanocrystalline silicon films (nc-Si:H) are prepared by plasma-enhanced chemical vapour deposition (PECVD). The microstructures of doped nc-Si:H films are carefully and systematically characterized by using high resolution electron microscopy (HREM), Raman scattering, x-ray diffraction (XRD), Auger electron spectroscopy (AES), and resonant nucleus reaction (RNR). The results show that as the doping concentration of PH3 increases, the average grain size (d) tends to decrease and the crystalline volume percentage (Xc) increases simultaneously. For the B-doped samples, as the doping concentration of B2H6 increases, no obvious change in the value of d is observed, but the value of Xc is found to decrease. This is especially apparent in the case of heavy B2H6 doped samples, where the films change from nanocrystalline to amorphous.

Surface diffusion in homoepitaxial SrTiO3 thin films

NASA Astrophysics Data System (ADS)

Woo, Chang-Su; Chu, Kanghyun; Song, Jong-Hyun; Yang, Chan-Ho; Charm Lab Team; Nano Spintronics Lab Collaboration

The development of growth techniques such as molecular beam epitaxy (MBE) and pulsed laser deposition (PLD) has facilitated growths of complex oxide thin films at the atomic level .... Systematic studies on surface diffusion process of adatoms using theoretical and experimental methods allow us to understand growth mechanism enabling atomically flat thin film surface. In this presentation, we introduce the synthesis of homoepitaxial SrTiO3 thin films using a PLD equipped with reflection of high energy electron diffraction (RHEED). We determine the surface diffusion time as a function of growth temperature and extract the activation energy of diffusion on the surface by in-situ monitoring the RHEED intensity recovery during the film deposition. From the extracted experimental results, we discuss the microscopic mechanism of the diffusion process

The Seasonal Cycle of Water Vapour on Mars from Assimilation of Thermal Emission Spectrometer Data

NASA Technical Reports Server (NTRS)

Steele, Liam J.; Lewis, Stephen R.; Patel, Manish R.; Montmessin, Franck; Forget, Francois; Smith, Michael D.

2014-01-01

We present for the first time an assimilation of Thermal Emission Spectrometer (TES) water vapour column data into a Mars global climate model (MGCM). We discuss the seasonal cycle of water vapour, the processes responsible for the observed water vapour distribution, and the cross-hemispheric water transport. The assimilation scheme is shown to be robust in producing consistent reanalyses, and the global water vapour column error is reduced to around 2-4 pr micron depending on season. Wave activity is shown to play an important role in the water vapour distribution, with topographically steered flows around the Hellas and Argyre basins acting to increase transport in these regions in all seasons. At high northern latitudes, zonal wavenumber 1 and 2 stationary waves during northern summer are responsible for spreading the sublimed water vapour away from the pole. Transport by the zonal wavenumber 2 waves occurs primarily to the west of Tharsis and Arabia Terra and, combined with the effects of western boundary currents, this leads to peak water vapour column abundances here as observed by numerous spacecraft. A net transport of water to the northern hemisphere over the course of one Mars year is calculated, primarily because of the large northwards flux of water vapour which occurs during the local dust storm around L(sub S) = 240-260deg. Finally, outlying frost deposits that surround the north polar cap are shown to be important in creating the peak water vapour column abundances observed during northern summer.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marana, S. R.; Cançado, F. C.; Valério, A. A.

The digestive lysozymes 1 and 2 from M. domestica were crystallized by vapour diffusion. The crystallographic data were processed to a maximum resolution of 1.9 Å in both cases. Lysozymes are mostly known for their defensive role against bacteria, but in several animals lysozymes have a digestive function. Here, the initial crystallographic characterization of two digestive lysozymes from Musca domestica are presented. The proteins were crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium sulfate or PEG/2-propanol as the precipitant. X-ray diffraction data were collected to a maximum resolution of 1.9 Å using synchrotron radiation. The lysozyme 1more » and 2 crystals belong to the monoclinic space group P2{sub 1} (unit-cell parameters a = 36.52, b = 79.44, c = 45.20 Å, β = 102.97°) and the orthorhombic space group P2{sub 1}2{sub 1}2 (unit-cell parameters a = 73.90, b = 96.40, c = 33.27 Å), respectively. The crystal structures were solved by molecular replacement and structure refinement is in progress.« less

Comparison of interaction mechanisms of copper phthalocyanine and nickel phthalocyanine thin films with chemical vapours

NASA Astrophysics Data System (ADS)

Ridhi, R.; Singh, Sukhdeep; Saini, G. S. S.; Tripathi, S. K.

2018-04-01

The present study deals with comparing interaction mechanisms of copper phthalocyanine and nickel phthalocyanine with versatile chemical vapours: reducing, stable aromatic and oxidizing vapours namely; diethylamine, benzene and bromine. The variation in electrical current of phthalocyanines with exposure of chemical vapours is used as the detection parameter for studying interaction behaviour. Nickel phthalocyanine is found to exhibit anomalous behaviour after exposure of reducing vapour diethylamine due to alteration in its spectroscopic transitions and magnetic states. The observed sensitivities of copper phthalocyanine and nickel phthalcyanine films are different in spite of their similar bond numbers, indicating significant role of central metal atom in interaction mechanism. The variations in electronic transition levels after vapours exposure, studied using UV-Visible spectroscopy confirmed our electrical sensing results. Bromine exposure leads to significant changes in vibrational bands of metal phthalocyanines as compared to other vapours.

Crystallization and preliminary X-ray diffraction analysis of Val57 mutants of the amyloidogenic protein human cystatin C

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orlikowska, Marta; Jankowska, Elzbieta; Borek, Dominika

2012-03-15

Human cystatin C (hCC) is a low-molecular-mass protein (120 amino-acid residues, 13 343 Da) found in all nucleated cells. Its main physiological role is regulation of the activity of cysteine proteases. Biologically active hCC is a monomeric protein, but all crystallization efforts have resulted in a dimeric domain-swapped structure. Recently, two monomeric structures were reported for cystatin C variants. In one of them stabilization was achieved by abolishing the possibility of domain swapping by the introduction of an additional disulfide bridge connecting the two protein domains (Cys47-Cys69). In the second structure, reported by this group, the monomeric hCC fold wasmore » preserved by stabilization of the conformationally constrained loop (L1) by a single-amino-acid substitution (V57N). To further assess the influence of changes in the sequence and properties of loop L1 on the dimerization propensity of cystatin C, two additional hCC mutants were obtained: one with a residue favoured in {beta}-turns (V57D) and another with proline (V57P), a residue that is known to be a structural element that can rigidify but also broaden turns. Here, the expression, purification and crystallization of V57D and V57P variants of recombinant human cystatin C are described. Crystals were grown by the vapour-diffusion method. Several diffraction data sets were collected using a synchrotron source at the Advanced Photon Source, Argonne National Laboratory, Chicago, USA.« less

Crystallization and preliminary crystallographic studies of the Pasteurella multocida toxin catalytic domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyazawa, Masayuki; Kitadokoro, Kengo; Kamitani, Shigeki

2006-09-01

The C-terminal catalytic domain of P. multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. The C-terminal catalytic domain of Pasteurella multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. Native diffraction data to 1.9 Å resolution were obtained at the BL44XU beamline of SPring-8 from a flash-frozen crystal at 100 K. The crystals belong to space group C2, with unit-cell parameters a = 111.0, b = 150.4,more » c = 77.1 Å, β = 105.5°, and are likely to contain one C-PMT (726 residues) per asymmetric unit.« less

Impact of major volcanic eruptions on stratospheric water vapour

NASA Astrophysics Data System (ADS)

Löffler, Michael; Brinkop, Sabine; Jöckel, Patrick

2016-05-01

Volcanic eruptions can have a significant impact on the Earth's weather and climate system. Besides the subsequent tropospheric changes, the stratosphere is also influenced by large eruptions. Here changes in stratospheric water vapour after the two major volcanic eruptions of El Chichón in Mexico in 1982 and Mount Pinatubo on the Philippines in 1991 are investigated with chemistry-climate model simulations. This study is based on two simulations with specified dynamics of the European Centre for Medium-Range Weather Forecasts Hamburg - Modular Earth Submodel System (ECHAM/MESSy) Atmospheric Chemistry (EMAC) model, performed within the Earth System Chemistry integrated Modelling (ESCiMo) project, of which only one includes the long-wave volcanic forcing through prescribed aerosol optical properties. The results show a significant increase in stratospheric water vapour induced by the eruptions, resulting from increased heating rates and the subsequent changes in stratospheric and tropopause temperatures in the tropics. The tropical vertical advection and the South Asian summer monsoon are identified as sources for the additional water vapour in the stratosphere. Additionally, volcanic influences on tropospheric water vapour and El Niño-Southern Oscillation (ENSO) are evident, if the long-wave forcing is strong enough. Our results are corroborated by additional sensitivity simulations of the Mount Pinatubo period with reduced nudging and reduced volcanic aerosol extinction.

Characterization of individual stacking faults in a wurtzite GaAs nanowire by nanobeam X-ray diffraction.

PubMed

Davtyan, Arman; Lehmann, Sebastian; Kriegner, Dominik; Zamani, Reza R; Dick, Kimberly A; Bahrami, Danial; Al-Hassan, Ali; Leake, Steven J; Pietsch, Ullrich; Holý, Václav

2017-09-01

Coherent X-ray diffraction was used to measure the type, quantity and the relative distances between stacking faults along the growth direction of two individual wurtzite GaAs nanowires grown by metalorganic vapour epitaxy. The presented approach is based on the general property of the Patterson function, which is the autocorrelation of the electron density as well as the Fourier transformation of the diffracted intensity distribution of an object. Partial Patterson functions were extracted from the diffracted intensity measured along the [000\\bar{1}] direction in the vicinity of the wurtzite 00\\bar{1}\\bar{5} Bragg peak. The maxima of the Patterson function encode both the distances between the fault planes and the type of the fault planes with the sensitivity of a single atomic bilayer. The positions of the fault planes are deduced from the positions and shapes of the maxima of the Patterson function and they are in excellent agreement with the positions found with transmission electron microscopy of the same nanowire.

Characterization of individual stacking faults in a wurtzite GaAs nanowire by nanobeam X-ray diffraction

PubMed Central

Davtyan, Arman; Lehmann, Sebastian; Zamani, Reza R.; Dick, Kimberly A.; Bahrami, Danial; Al-Hassan, Ali; Leake, Steven J.; Pietsch, Ullrich; Holý, Václav

2017-01-01

Coherent X-ray diffraction was used to measure the type, quantity and the relative distances between stacking faults along the growth direction of two individual wurtzite GaAs nanowires grown by metalorganic vapour epitaxy. The presented approach is based on the general property of the Patterson function, which is the autocorrelation of the electron density as well as the Fourier transformation of the diffracted intensity distribution of an object. Partial Patterson functions were extracted from the diffracted intensity measured along the direction in the vicinity of the wurtzite Bragg peak. The maxima of the Patterson function encode both the distances between the fault planes and the type of the fault planes with the sensitivity of a single atomic bilayer. The positions of the fault planes are deduced from the positions and shapes of the maxima of the Patterson function and they are in excellent agreement with the positions found with transmission electron microscopy of the same nanowire. PMID:28862620

Kinetic model of water vapour adsorption by gluten-free starch

NASA Astrophysics Data System (ADS)

Ocieczek, Aneta; Kostek, Robert; Ruszkowska, Millena

2015-01-01

This study evaluated the kinetics of water vapour adsorption on the surface of starch molecules derived from wheat. The aim of the study was to determine an equation that would allow estimation of water content in tested material in any timepoint of the adsorption process aimed at settling a balance with the environment. An adsorption isotherm of water vapour on starch granules was drawn. The parameters of the Guggenheim, Anderson, and De Boer equation were determined by characterizing the tested product and adsorption process. The equation of kinetics of water vapour adsorption on the surface of starch was determined based on the Guggenheim, Anderson, and De Boer model describing the state of equilibrium and on the model of a first-order linear inert element describing the changes in water content over time.

Mechanism of two-step vapour-crystal nucleation in a pore

NASA Astrophysics Data System (ADS)

van Meel, J. A.; Liu, Y.; Frenkel, D.

2015-09-01

We present a numerical study of the effect of hemispherical pores on the nucleation of Lennard-Jones crystals from the vapour phase. As predicted by Page and Sear, there is a narrow range of pore radii, where vapour-liquid nucleation can become a two-step process. A similar observation was made for different pore geometries by Giacomello et al. We find that the maximum nucleation rate depends on both the size and the adsorption strength of the pore. Moreover, a poe can be more effective than a planar wall with the same strength of attraction. Pore-induced vapour-liquid nucleation turns out to be the rate-limiting step for crystal nucleation. This implies that crystal nucleation can be enhanced by a judicious choice of the wetting properties of a microporous nucleating agent.

Ge-rich islands grown on patterned Si substrates by low-energy plasma-enhanced chemical vapour deposition.

PubMed

Bollani, M; Chrastina, D; Fedorov, A; Sordan, R; Picco, A; Bonera, E

2010-11-26

Si(1-x)Ge(x) islands grown on Si patterned substrates have received considerable attention during the last decade for potential applications in microelectronics and optoelectronics. In this work we propose a new methodology to grow Ge-rich islands using a chemical vapour deposition technique. Electron-beam lithography is used to pre-pattern Si substrates, creating material traps. Epitaxial deposition of thin Ge films by low-energy plasma-enhanced chemical vapour deposition then leads to the formation of Ge-rich Si(1-x)Ge(x) islands (x > 0.8) with a homogeneous size distribution, precisely positioned with respect to the substrate pattern. The island morphology was characterized by atomic force microscopy, and the Ge content and strain in the islands was studied by μRaman spectroscopy. This characterization indicates a uniform distribution of islands with high Ge content and low strain: this suggests that the relatively high growth rate (0.1 nm s(-1)) and low temperature (650 °C) used is able to limit Si intermixing, while maintaining a long enough adatom diffusion length to prevent nucleation of islands outside pits. This offers the novel possibility of using these Ge-rich islands to induce strain in a Si cap.

Isolation, purification, crystallization, and preliminary X-ray diffraction study of the crystals of HU protein from M. gallisepticum

NASA Astrophysics Data System (ADS)

Nikolaeva, A. Yu.; Timofeev, V. I.; Boiko, K. M.; Korzhenevskii, D. A.; Rakitina, T. V.; Dorovatovskii, P. V.; Lipkin, A. V.

2015-11-01

HU proteins are involved in bacterial DNA and RNA repair. Since these proteins are absent in cells of higher organisms, inhibitors of HU proteins can be used as effective and safe antibiotics. The crystallization conditions for the M. gallisepticum HU protein were found and optimized by the vapor-diffusion method. The X-ray diffraction data set was collected to 2.91 Å resolution from the crystals grown by the vapor-diffusion method on a synchrotron source. The crystals of the HU protein belong to sp. gr. P41212 and have the following unit-cell parameters: a = b = 97.94 Å, c = 77.92 Å, α = β = γ = 90°.

A hybrid method combining the surface integral equation method and ray tracing for the numerical simulation of high frequency diffraction involved in ultrasonic NDT

NASA Astrophysics Data System (ADS)

Bonnet, M.; Collino, F.; Demaldent, E.; Imperiale, A.; Pesudo, L.

2018-05-01

Ultrasonic Non-Destructive Testing (US NDT) has become widely used in various fields of applications to probe media. Exploiting the surface measurements of the ultrasonic incident waves echoes after their propagation through the medium, it allows to detect potential defects (cracks and inhomogeneities) and characterize the medium. The understanding and interpretation of those experimental measurements is performed with the help of numerical modeling and simulations. However, classical numerical methods can become computationally very expensive for the simulation of wave propagation in the high frequency regime. On the other hand, asymptotic techniques are better suited to model high frequency scattering over large distances but nevertheless do not allow accurate simulation of complex diffraction phenomena. Thus, neither numerical nor asymptotic methods can individually solve high frequency diffraction problems in large media, as those involved in UNDT controls, both quickly and accurately, but their advantages and limitations are complementary. Here we propose a hybrid strategy coupling the surface integral equation method and the ray tracing method to simulate high frequency diffraction under speed and accuracy constraints. This strategy is general and applicable to simulate diffraction phenomena in acoustic or elastodynamic media. We provide its implementation and investigate its performances for the 2D acoustic diffraction problem. The main features of this hybrid method are described and results of 2D computational experiments discussed.

Method for applying a diffusion barrier interlayer for high temperature components

DOEpatents

Wei, Ronghua; Cheruvu, Narayana S.

2016-03-08

A coated substrate and a method of forming a diffusion barrier coating system between a substrate and a MCrAl coating, including a diffusion barrier coating deposited onto at least a portion of a substrate surface, wherein the diffusion barrier coating comprises a nitride, oxide or carbide of one or more transition metals and/or metalloids and a MCrAl coating, wherein M includes a transition metal or a metalloid, deposited on at least a portion of the diffusion barrier coating, wherein the diffusion barrier coating restricts the inward diffusion of aluminum of the MCrAl coating into the substrate.

Crystallization screening test for the whole-cell project on Thermus thermophilus HB8

PubMed Central

Iino, Hitoshi; Naitow, Hisashi; Nakamura, Yuki; Nakagawa, Noriko; Agari, Yoshihiro; Kanagawa, Mayumi; Ebihara, Akio; Shinkai, Akeo; Sugahara, Mitsuaki; Miyano, Masashi; Kamiya, Nobuo; Yokoyama, Shigeyuki; Hirotsu, Ken; Kuramitsu, Seiki

2008-01-01

It was essential for the structural genomics of Thermus thermophilus HB8 to efficiently crystallize a number of proteins. To this end, three conventional robots, an HTS-80 (sitting-drop vapour diffusion), a Crystal Finder (hanging-drop vapour diffusion) and a TERA (modified microbatch) robot, were subjected to a crystallization condition screening test involving 18 proteins from T. thermophilus HB8. In addition, a TOPAZ (microfluidic free-interface diffusion) designed specifically for initial screening was also briefly examined. The number of diffraction-quality crystals and the time of appearance of crystals increased in the order HTS-80, Crystal Finder, TERA. With the HTS-80 and Crystal Finder, the time of appearance was short and the rate of salt crystallization was low. With the TERA, the number of diffraction-quality crystals was high, while the time of appearance was long and the rate of salt crystallization was relatively high. For the protein samples exhibiting low crystallization success rates, there were few crystallization conditions that were common to the robots used. In some cases, the success rate depended greatly on the robot used. The TOPAZ showed the shortest time of appearance and the highest success rate, although the crystals obtained were too small for diffraction studies. These results showed that the combined use of different robots significantly increases the chance of obtaining crystals, especially for proteins exhibiting low crystallization success rates. The structures of 360 of 944 purified proteins have been successfully determined through the combined use of an HTS-80 and a TERA. PMID:18540056

Studies of the kinetics and mechanism of the oxidation of uranium by dry and moist air A model for determining the oxidation rate over a wide range of temperatures and water vapour pressures

NASA Astrophysics Data System (ADS)

McGillivray, G. W.; Geeson, D. A.; Greenwood, R. C.

1994-01-01

The rate of oxidation of uranium metal by moist air has been measured at temperatures from 115 to 350°C and water vapour pressures from 0 to 47 kPa (350 Torr). From this and from previously reported data, a model has been developed which allows the rate of uranium oxidation to be calculated at any particular combination of temperature and water vapour pressure of interest, in the range 0-350°C and 0-101.3 kPa (760 Torr). The model is based on the assumption that the surface concentration of water determines the rate of reaction and that the adsorption of water onto the oxide follows a Langmuir type isotherm. Theoretical plots of rate as a function of water vapour pressure and Arrhenius plots derived from the model have been shown to be in good agreement with experimental data. The model assumes separate contributions to the overall observed rate from oxygen and water vapour. Surface studies have been carried out using SIMS (secondary ion mass spectrometry). Depth profiling of the oxide produced by isotopically labelled reagents ( 18O 2 and H 218O), has shown that oxygen from both reactants is incorporated into the oxide layer in the ratio predicted by the kinetic model. This supports a mechanism in which oxygen and water vapour produce separate diffusing species (possibly O 2- and OH -).

Water vapour retrieval using the Precision Solar Spectroradiometer

NASA Astrophysics Data System (ADS)

Raptis, Panagiotis-Ioannis; Kazadzis, Stelios; Gröbner, Julian; Kouremeti, Natalia; Doppler, Lionel; Becker, Ralf; Helmis, Constantinos

2018-02-01

The Precision Solar Spectroradiometer (PSR) is a new spectroradiometer developed at Physikalisch-Meteorologisches Observatorium Davos - World Radiation Center (PMOD-WRC), Davos, measuring direct solar irradiance at the surface, in the 300-1020 nm spectral range and at high temporal resolution. The purpose of this work is to investigate the instrument's potential to retrieve integrated water vapour (IWV) using its spectral measurements. Two different approaches were developed in order to retrieve IWV: the first one uses single-channel and wavelength measurements, following a theoretical water vapour high absorption wavelength, and the second one uses direct sun irradiance integrated at a certain spectral region. IWV results have been validated using a 2-year data set, consisting of an AERONET sun-photometer Cimel CE318, a Global Positioning System (GPS), a microwave radiometer profiler (MWP) and radiosonde retrievals recorded at Meteorological Observatorium Lindenberg, Germany. For the monochromatic approach, better agreement with retrievals from other methods and instruments was achieved using the 946 nm channel, while for the spectral approach the 934-948 nm window was used. Compared to other instruments' retrievals, the monochromatic approach leads to mean relative differences up to 3.3 % with the coefficient of determination (R2) being in the region of 0.87-0.95, while for the spectral approach mean relative differences up to 0.7 % were recorded with R2 in the region of 0.96-0.98. Uncertainties related to IWV retrieval methods were investigated and found to be less than 0.28 cm for both methods. Absolute IWV deviations of differences between PSR and other instruments were determined the range of 0.08-0.30 cm and only in extreme cases would reach up to 15 %.

Efficient quantification of water content in edible oils by headspace gas chromatography with vapour phase calibration.

PubMed

Xie, Wei-Qi; Gong, Yi-Xian; Yu, Kong-Xian

2018-06-01

An automated and accurate headspace gas chromatographic (HS-GC) technique was investigated for rapidly quantifying water content in edible oils. In this method, multiple headspace extraction (MHE) procedures were used to analyse the integrated water content from the edible oil sample. A simple vapour phase calibration technique with an external vapour standard was used to calibrate both the water content in the gas phase and the total weight of water in edible oil sample. After that the water in edible oils can be quantified. The data showed that the relative standard deviation of the present HS-GC method in the precision test was less than 1.13%, the relative differences between the new method and a reference method (i.e. the oven-drying method) were no more than 1.62%. The present HS-GC method is automated, accurate, efficient, and can be a reliable tool for quantifying water content in edible oil related products and research. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

WALES: water vapour lidar experiment in space

NASA Astrophysics Data System (ADS)

Guerin, F.; Pain, Th.; Palmade, J.-L.; Pailharey, E.; Giraud, D.; Jubineau, F.

2017-11-01

The WAter vapour Lidar Experiment in Space (WALES) mission aims at providing water vapour profiles with high accuracy and vertical resolution through the troposphere and the lower stratosphere on a global scale using an instrument based on Differential Absorption Lidar (DIAL) observation technique, and mounted on an Earth orbiting satellite. This active DIAL technique will also provide data on the cloud coverage by means of the signal reflection on the cloud layers. In DIAL operation, backscatter lidar signals at two wavelengths - at least - are detected. One wavelength (λ ON) is highly absorbed by the species of interest, while the other (λ OFF) is backscattered with minimal absorption. This difference in absorption at the two transmitted wavelengths leads to the determination of the concentration of the species of interest. The DIAL is therefore a dual-wavelength lidar in which the signals detected at the two wavelengths are processed to extract the absolute density of water vapour. The Phase A study performed by ALCATEL Space and their partners under contract of the European Space Agency has led to a credible and innovative concept of instrument, based on a mission performance modelling. The challenge is to foster the scientific return while minimising the development risks and costs of instrument development, in particular the laser transmitter. The paper describes the payload design and the implementation on a low Earth orbiting (LEO) satellite.

WALES: WAter vapour Lidar Experiment in Space

NASA Astrophysics Data System (ADS)

Guerin, F.; Pain, Th.; Palmade, J. L.; Pailharey, E.; Giraud, D.; Jubineau, F.

2004-06-01

The WAter vapour Lidar Experiment in Space (WALES) mission aims at providing water vapour profiles with high accuracy and vertical resolution through the troposphere and the lower stratosphere on a global scale using an instrument based on Differential Absorption Lidar (DIAL) observation technique, and mounted on an Earth orbiting satellite. This active DIAL technique will also provide data on the cloud coverage by means of the signal reflection on the cloud layers. In DIAL operation, backscatter lidar signals at two wavelengths - at least - are detected. One wavelength (λ ON) is highly absorbed by the species of interest, while the other (λ OFF) is backscattered with minimal absorption. This difference in absorption at the two transmitted wavelengths leads to the determination of the concentration of the species of interest. The DIAL is therefore a dual-wavelength lidar in which the signals detected at the two wavelengths are processed to extract the absolute density of water vapour. The Phase A study performed by ALCATEL Space and their partners under contract of the European Space Agency has led to a credible and innovative concept of instrument, based on a mission performance modelling. The challenge is to foster the scientific return while minimising the development risks and costs of instrument development, in particular the laser transmitter. The paper describes the payload design and the implementation on a low Earth orbiting (LEO) satellite.

Unsaturation of vapour pressure inside leaves of two conifer species

DOE PAGES

Cernusak, Lucas A.; Ubierna, Nerea; Jenkins, Michael W.; ...

2018-05-16

Stomatal conductance (g s) impacts both photosynthesis and transpiration, and is therefore fundamental to the global carbon and water cycles, food production, and ecosystem services. Mathematical models provide the primary means of analysing this important leaf gas exchange parameter. A nearly universal assumption in such models is that the vapour pressure inside leaves (e i) remains saturated under all conditions. The validity of this assumption has not been well tested, because so far e i cannot be measured directly. Here, we test this assumption using a novel technique, based on coupled measurements of leaf gas exchange and the stable isotopemore » compositions of CO 2 and water vapour passing over the leaf. We applied this technique to mature individuals of two semiarid conifer species. In both species, e i routinely dropped below saturation when leaves were exposed to moderate to high air vapour pressure deficits. Typical values of relative humidity in the intercellular air spaces were as low 0.9 in Juniperus monosperma and 0.8 in Pinus edulis. These departures of e i from saturation caused significant biases in calculations of g s and the intercellular CO 2 concentration. Thus, our results refute the longstanding assumption of saturated vapour pressure in plant leaves under all conditions.« less

Unsaturation of vapour pressure inside leaves of two conifer species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cernusak, Lucas A.; Ubierna, Nerea; Jenkins, Michael W.

Stomatal conductance (g s) impacts both photosynthesis and transpiration, and is therefore fundamental to the global carbon and water cycles, food production, and ecosystem services. Mathematical models provide the primary means of analysing this important leaf gas exchange parameter. A nearly universal assumption in such models is that the vapour pressure inside leaves (e i) remains saturated under all conditions. The validity of this assumption has not been well tested, because so far e i cannot be measured directly. Here, we test this assumption using a novel technique, based on coupled measurements of leaf gas exchange and the stable isotopemore » compositions of CO 2 and water vapour passing over the leaf. We applied this technique to mature individuals of two semiarid conifer species. In both species, e i routinely dropped below saturation when leaves were exposed to moderate to high air vapour pressure deficits. Typical values of relative humidity in the intercellular air spaces were as low 0.9 in Juniperus monosperma and 0.8 in Pinus edulis. These departures of e i from saturation caused significant biases in calculations of g s and the intercellular CO 2 concentration. Thus, our results refute the longstanding assumption of saturated vapour pressure in plant leaves under all conditions.« less

Anomalous Diffraction in Crystallographic Phase Evaluation

PubMed Central

Hendrickson, Wayne A.

2014-01-01

X-ray diffraction patterns from crystals of biological macromolecules contain sufficient information to define atomic structures, but atomic positions are inextricable without having electron-density images. Diffraction measurements provide amplitudes, but the computation of electron density also requires phases for the diffracted waves. The resonance phenomenon known as anomalous scattering offers a powerful solution to this phase problem. Exploiting scattering resonances from diverse elements, the methods of multiwavelength anomalous diffraction (MAD) and single-wavelength anomalous diffraction (SAD) now predominate for de novo determinations of atomic-level biological structures. This review describes the physical underpinnings of anomalous diffraction methods, the evolution of these methods to their current maturity, the elements, procedures and instrumentation used for effective implementation, and the realm of applications. PMID:24726017

Maxwell-Stefan diffusion: a framework for predicting condensed phase diffusion and phase separation in atmospheric aerosol

NASA Astrophysics Data System (ADS)

Fowler, Kathryn; Connolly, Paul J.; Topping, David O.; O'Meara, Simon

2018-02-01

The composition of atmospheric aerosol particles has been found to influence their micro-physical properties and their interaction with water vapour in the atmosphere. Core-shell models have been used to investigate the relationship between composition, viscosity and equilibration timescales. These models have traditionally relied on the Fickian laws of diffusion with no explicit account of non-ideal interactions. We introduce the Maxwell-Stefan diffusion framework as an alternative method, which explicitly accounts for non-ideal interactions through activity coefficients. e-folding time is the time it takes for the difference in surface and bulk concentration to change by an exponential factor and was used to investigate the interplay between viscosity and solubility and the effect this has on equilibration timescales within individual aerosol particles. The e-folding time was estimated after instantaneous increases in relative humidity to binary systems of water and an organic component. At low water mole fractions, viscous effects were found to dominate mixing. However, at high water mole fractions, equilibration times were more sensitive to a range in solubility, shown through the greater variation in e-folding times. This is the first time the Maxwell-Stefan framework has been applied to an atmospheric aerosol core-shell model and shows that there is a complex interplay between the viscous and solubility effects on aerosol composition that requires further investigation.

Crystallization and diffraction analysis of [beta]-N-acetylhexosaminidase from Aspergillus oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vanek, Ondrej; Brynd, Jirí; Hofbauerová, Katerina

2012-05-08

Fungal {beta}-N-acetylhexosaminidases are enzymes that are used in the chemoenzymatic synthesis of biologically interesting oligosaccharides. The enzyme from Aspergillus oryzae was produced and purified from its natural source and crystallized using the hanging-drop vapor-diffusion method. Diffraction data from two crystal forms (primitive monoclinic and primitive tetragonal) were collected to resolutions of 3.2 and 2.4 {angstrom}, respectively. Electrophoretic and quantitative N-terminal protein-sequencing analyses confirmed that the crystals are formed by a complete biologically active enzyme consisting of a glycosylated catalytic unit and a noncovalently attached propeptide.

Water vapour and methane coupling in the stratosphere observed using SCIAMACHY solar occultation measurements

NASA Astrophysics Data System (ADS)

Noël, Stefan; Weigel, Katja; Bramstedt, Klaus; Rozanov, Alexei; Weber, Mark; Bovensmann, Heinrich; Burrows, John P.

2018-04-01

An improved stratospheric water vapour data set has been retrieved from SCIAMACHY/ENVISAT solar occultation measurements. It is similar to that successfully applied to methane and carbon dioxide. There is now a consistent set of data products for the three constituents covering the altitudes 17-45 km, the latitude range between about 50 and 70° N, and the period August 2002 to April 2012. The new water vapour concentration profiles agree with collocated results from ACE-FTS and MLS/Aura to within ˜ 5 %. A significant positive linear change in water vapour for the time 2003-2011 is observed at lower stratospheric altitudes with a value of about 0.015 ± 0.008 ppmv year-1 around 17 km. Between 30 and 37 km the changes become significantly negative (about -0.01 ± 0.008 ppmv year-1); all errors are 2σ values. The combined analysis of the SCIAMACHY methane and water vapour time series shows the expected anti-correlation between stratospheric methane and water vapour and a clear temporal variation related to the Quasi-Biennial Oscillation (QBO). Above about 20 km most of the additional water vapour is attributed to the oxidation of methane. In addition short-term fluctuations and longer-term variations on a timescale of 5-6 years are observed. The SCIAMACHY data confirm that at lower altitudes the amount of water vapour and methane are transported from the tropics to higher latitudes via the shallow branch of the Brewer-Dobson circulation.

Boundary particle method for Laplace transformed time fractional diffusion equations

NASA Astrophysics Data System (ADS)

Fu, Zhuo-Jia; Chen, Wen; Yang, Hai-Tian

2013-02-01

This paper develops a novel boundary meshless approach, Laplace transformed boundary particle method (LTBPM), for numerical modeling of time fractional diffusion equations. It implements Laplace transform technique to obtain the corresponding time-independent inhomogeneous equation in Laplace space and then employs a truly boundary-only meshless boundary particle method (BPM) to solve this Laplace-transformed problem. Unlike the other boundary discretization methods, the BPM does not require any inner nodes, since the recursive composite multiple reciprocity technique (RC-MRM) is used to convert the inhomogeneous problem into the higher-order homogeneous problem. Finally, the Stehfest numerical inverse Laplace transform (NILT) is implemented to retrieve the numerical solutions of time fractional diffusion equations from the corresponding BPM solutions. In comparison with finite difference discretization, the LTBPM introduces Laplace transform and Stehfest NILT algorithm to deal with time fractional derivative term, which evades costly convolution integral calculation in time fractional derivation approximation and avoids the effect of time step on numerical accuracy and stability. Consequently, it can effectively simulate long time-history fractional diffusion systems. Error analysis and numerical experiments demonstrate that the present LTBPM is highly accurate and computationally efficient for 2D and 3D time fractional diffusion equations.

Major diffusion leaks of clamp-on leaf cuvettes still unaccounted: how erroneous are the estimates of Farquhar et al. model parameters?

PubMed

Rodeghiero, Mirco; Niinemets, Ulo; Cescatti, Alessandro

2007-08-01

Estimates of leaf gas-exchange characteristics using standard clamp-on leaf chambers are prone to errors because of diffusion leaks. While some consideration has been given to CO(2) diffusion leaks, potential water vapour diffusion leaks through chamber gaskets have been neglected. We estimated diffusion leaks of two clamp-on Li-Cor LI-6400 (Li-Cor, Inc., Lincoln, NE, USA) leaf chambers with polymer foam gaskets and enclosing either 2 or 6 cm(2) leaf area, and conducted a sensitivity analysis of the diffusion leak effects on Farquhar et al. photosynthesis model parameters - the maximum carboxylase activity of ribulose 1 x 5-bisphosphate carboxylase/oxygenase (Rubisco) (V(cmax)), capacity for photosynthetic electron transport (J(max)) and non-photorespiratory respiration rate in light (R(d)). In addition, net assimilation rate (A(n)) versus intercellular CO(2) (C(i)) responses were measured in leaves of Mediterranean evergreen species Quercus ilex L. enclosing the whole leaf chamber in a polyvinyl fluoride bag flushed with the exhaust air of leaf chamber, thereby effectively reducing the CO(2) and water vapour gradients between ambient air and leaf chamber. For the empty chambers, average diffusion leak for CO(2), K(CO2), (molar flow rate corresponding to unit CO(2) mole fraction difference) was ca. 0.40 micromol s(-1). K(CO2) increased ca. 50% if a dead leaf was clamped between the leaf chamber. Average diffusion leak for H(2)O was ca. 5- to 10-fold larger than the diffusion leak for CO(2). Sensitivity analyses demonstrated that the consequence of a CO(2) diffusion leak was apparent enhancement of A(n) at high CO(2) mole fraction and reduction at lower CO(2) mole fraction, and overall compression of C(i) range. As the result of these modifications, Farquhar et al. model parameters were overestimated. The degree of overestimation increased in the order of V(cmax) < J(max) < R(d), and was larger for smaller chambers and for leaves with lower photosynthetic capacity

Purification, crystallization and preliminary X-ray analysis of a thermostable glycoside hydrolase family 43 β-xylosidase from Geobacillus thermoleovorans IT-08

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko

2007-11-01

The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less

Neutron diffraction study and theoretical analysis of the antiferromagnetic order and the diffuse scattering in the layered kagome system CaBaCo2Fe2O7

NASA Astrophysics Data System (ADS)

Reim, J. D.; Rosén, E.; Zaharko, O.; Mostovoy, M.; Robert, J.; Valldor, M.; Schweika, W.

2018-04-01

The hexagonal swedenborgite, CaBaCo2Fe2O7 , is a chiral frustrated antiferromagnet, in which magnetic ions form alternating kagome and triangular layers. We observe a long-range √{3 }×√{3 } antiferromagnetic order setting in below TN=160 K by neutron diffraction on single crystals of CaBaCo2Fe2O7 . Both magnetization and polarized neutron single crystal diffraction measurements show that close to TN spins lie predominantly in the a b plane, while upon cooling the spin structure becomes increasingly canted due to Dzyaloshinskii-Moriya interactions. The ordered structure can be described and refined within the magnetic space group P 31 m' . Diffuse scattering between the magnetic peaks reveals that the spin order is partial. Monte Carlo simulations based on a Heisenberg model with two nearest-neighbor exchange interactions show a similar diffuse scattering and coexistence of the √{3 }×√{3 } order with disorder. The coexistence can be explained by the freedom to vary spins without affecting the long-range order, which gives rise to ground-state degeneracy. Polarization analysis of the magnetic peaks indicates the presence of long-period cycloidal spin correlations resulting from the broken inversion symmetry of the lattice, in agreement with our symmetry analysis.

Suppressing Ghost Diffraction in E-Beam-Written Gratings

NASA Technical Reports Server (NTRS)

Wilson, Daniel; Backlund, Johan

2009-01-01

A modified scheme for electron-beam (E-beam) writing used in the fabrication of convex or concave diffraction gratings makes it possible to suppress the ghost diffraction heretofore exhibited by such gratings. Ghost diffraction is a spurious component of diffraction caused by a spurious component of grating periodicity as described below. The ghost diffraction orders appear between the main diffraction orders and are typically more intense than is the diffuse scattering from the grating. At such high intensity, ghost diffraction is the dominant source of degradation of grating performance. The pattern of a convex or concave grating is established by electron-beam writing in a resist material coating a substrate that has the desired convex or concave shape. Unfortunately, as a result of the characteristics of electrostatic deflectors used to control the electron beam, it is possible to expose only a small field - typically between 0.5 and 1.0 mm wide - at a given fixed position of the electron gun relative to the substrate. To make a grating larger than the field size, it is necessary to move the substrate to make it possible to write fields centered at different positions, so that the larger area is synthesized by "stitching" the exposed fields.

Crystallization and preliminary X-ray analysis of PH1566, a putative ribosomal RNA-processing factor from the hyperthermophilic archaeon Pyrococcus horikoshii OT3

PubMed Central

Jia, Min Ze; Ohtsuka, Jun; Lee, Woo Cheol; Nagata, Koji; Tanokura, Masaru

2006-01-01

A putative ribosomal RNA-processing factor consisting of two KH domains from Pyrococcus horikoshii OT3 (PH1566; 25 kDa) was crystallized by the sitting-drop vapour-diffusion method using PEG 3000 as the precipitant. The crystals diffracted X-rays to beyond 2.0 Å resolution using a synchrotron-radiation source. The space group of the crystals was determined as primitive orthorhombic P212121, with unit-cell parameters a = 45.9, b = 47.4, c = 95.7 Å. The crystals contain one molecule in the asymmetric unit (V M = 2.5 Å3 Da−1) and have a solvent content of 50%. PMID:16511260

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

PubMed Central

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Guan-Jing; Li, Lan-Fen; Li, Dan

2007-09-01

A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, withmore » unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.« less

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis.

PubMed

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-11-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.

A Robust and Efficient Method for Steady State Patterns in Reaction-Diffusion Systems

PubMed Central

Lo, Wing-Cheong; Chen, Long; Wang, Ming; Nie, Qing

2012-01-01

An inhomogeneous steady state pattern of nonlinear reaction-diffusion equations with no-flux boundary conditions is usually computed by solving the corresponding time-dependent reaction-diffusion equations using temporal schemes. Nonlinear solvers (e.g., Newton’s method) take less CPU time in direct computation for the steady state; however, their convergence is sensitive to the initial guess, often leading to divergence or convergence to spatially homogeneous solution. Systematically numerical exploration of spatial patterns of reaction-diffusion equations under different parameter regimes requires that the numerical method be efficient and robust to initial condition or initial guess, with better likelihood of convergence to an inhomogeneous pattern. Here, a new approach that combines the advantages of temporal schemes in robustness and Newton’s method in fast convergence in solving steady states of reaction-diffusion equations is proposed. In particular, an adaptive implicit Euler with inexact solver (AIIE) method is found to be much more efficient than temporal schemes and more robust in convergence than typical nonlinear solvers (e.g., Newton’s method) in finding the inhomogeneous pattern. Application of this new approach to two reaction-diffusion equations in one, two, and three spatial dimensions, along with direct comparisons to several other existing methods, demonstrates that AIIE is a more desirable method for searching inhomogeneous spatial patterns of reaction-diffusion equations in a large parameter space. PMID:22773849

Thaumatin crystallization aboard the International Space Station using liquid-liquid diffusion in the Enhanced Gaseous Nitrogen Dewar (EGN).

PubMed

Barnes, Cindy L; Snell, Edward H; Kundrot, Craig E

2002-05-01

This paper reports results from the first biological crystal-growth experiment on the International Space Station (ISS). Crystals of thaumatin were grown using liquid-liquid diffusion in Tygon tubing transported in the Enhanced Gaseous Nitrogen Dewar (EGN). Different volume ratios and concentrations of protein and precipitant were used to test different adaptations of the vapor-diffusion crystallization recipe to the liquid-liquid diffusion method. The EGN warmed up from 77 to 273 K in about 4 d, about the same time it took to warm from 273 to 293 K. The temperature within the EGN was 293-297 K for the majority of the experiment. Air gaps that blocked liquid-liquid diffusion formed in the tubes. Nonetheless, crystals were grown. Synchrotron diffraction data collected from the best space-grown crystal extended to 1.28 A, comparable to previous studies of space-grown thaumatin crystals. The resolution of the best ground-control crystal was only 1.47 A. It is not clear if the difference in diffraction limit arises from factors other than crystal size. Improvements in temperature control and the elimination of air gaps are needed, but the results show that the EGN on the ISS can be used to produce space-grown crystals that diffract to high resolution.

Thaumatin Crystallization Aboard the International Space Station Using Liquid-Liquid Diffusion in the Enhanced Gaseous Nitrogen Dewar (EGN)

NASA Technical Reports Server (NTRS)

Kundrot, Craig; Barnes, Cindy L.; Snell, Edward H.; Stinson, Thomas N. (Technical Monitor)

2002-01-01

This paper reports results from the first biological crystal growth experiment on the International Space Station (ISS). Crystals of thaumatin were grown using liquid-liquid diffusion in Tygon tubing transported in the Enhanced Gaseous Nitrogen Dewar (EGN). Different Volume ratios and concentrations of protein and precipitant were used to test different adaptations of the vapor diffusion crystallization recipe to the liquid-liquid diffusion method. The EGN warmed up from -196 C to 0 C in about four days, about the same time it took to warm from 0 C to 20 C. The temperature within the EGN was 20 - 24 C for the majority of the experiment. Air gaps that blocked liquid-liquid diffusion formed in the tubes. Nonetheless, crystals were grown. Synchrotron diffraction data collected from the best space grown crystal extended to 1.28 Angstroms, comparable to previous studies of space-grown thaumatin crystals. The resolution of the best ground control crystal was only 1.47 Angstroms. It is not clear if the difference in diffraction limit is due to factors other than crystal size. Improvements in temperature control and the elimination of air gaps are needed, but the results show that EGN on the ISS can be used to produce space grown crystals that diffract to high resolution.

Structure determination of an integral membrane protein at room temperature from crystals in situ

DOE Office of Scientific and Technical Information (OSTI.GOV)

Axford, Danny; Foadi, James; Imperial College London, London SW7 2AZ

2015-05-14

The X-ray structure determination of an integral membrane protein using synchrotron diffraction data measured in situ at room temperature is demonstrated. The structure determination of an integral membrane protein using synchrotron X-ray diffraction data collected at room temperature directly in vapour-diffusion crystallization plates (in situ) is demonstrated. Exposing the crystals in situ eliminates manual sample handling and, since it is performed at room temperature, removes the complication of cryoprotection and potential structural anomalies induced by sample cryocooling. Essential to the method is the ability to limit radiation damage by recording a small amount of data per sample from many samplesmore » and subsequently assembling the resulting data sets using specialized software. The validity of this procedure is established by the structure determination of Haemophilus influenza TehA at 2.3 Å resolution. The method presented offers an effective protocol for the fast and efficient determination of membrane-protein structures at room temperature using third-generation synchrotron beamlines.« less

Development of Methods for Low Temperature Diffusion Bonding.

DTIC Science & Technology

1987-09-01

Hazlett, T. H., " High Strength Low Temperature Bonding of Beryllium and Other Metals," Welding Journal, 60(11), pp. 301-s to 310-s, 1970. 12. 1986 Annual...34CIPLU’q *flBQ~ P 0.(4 ".Oq’J 4 Low Temperature , Methods for Diffusion Rl ,’..’S olid deveoped ~’~ ~ ’State Bonding, or Diffusion Welding An apparatus lor...low t’empeaur R~u on’ nding of dissimilar metals has been develped.Experiments varying the bonding temperature at constant pressure and time were

An Improved X-ray Diffraction Method For Cellulose Crystallinity Measurement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ju, Xiaohui; Bowden, Mark E.; Brown, Elvie E.

2015-06-01

We show in this work a modified X-ray diffraction method to determine cellulose crystallinity index (CrI). Nanocrystalline cellulose (NCC) dervided from bleached wood pulp was used as a model substrate. Rietveld refinement was applied with consideration of March-Dollase preferred orientation at the (001) plane. In contrast to most previous methods, three distinct amorphous peaks identified from new model samples which are used to calculate CrI. A 2 theta range from 10° to 75° was found to be more suitable to determine CrI and crystallite structural parameters such as d-spacing and crystallite size. This method enables a more reliable measurement ofmore » CrI of cellulose and may be applicable to other types of cellulose polymorphs.« less

A novel method for effective diffusion coefficient measurement in gas diffusion media of polymer electrolyte fuel cells

NASA Astrophysics Data System (ADS)

Yang, Linlin; Sun, Hai; Fu, Xudong; Wang, Suli; Jiang, Luhua; Sun, Gongquan

2014-07-01

A novel method for measuring effective diffusion coefficient of porous materials is developed. The oxygen concentration gradient is established by an air-breathing proton exchange membrane fuel cell (PEMFC). The porous sample is set in a sample holder located in the cathode plate of the PEMFC. At a given oxygen flux, the effective diffusion coefficients are related to the difference of oxygen concentration across the samples, which can be correlated with the differences of the output voltage of the PEMFC with and without inserting the sample in the cathode plate. Compared to the conventional electrical conductivity method, this method is more reliable for measuring non-wetting samples.

Three-dimensional analysis by electron diffraction methods of nanocrystalline materials.

PubMed

Gammer, Christoph; Mangler, Clemens; Karnthaler, Hans-Peter; Rentenberger, Christian

2011-12-01

To analyze nanocrystalline structures quantitatively in 3D, a novel method is presented based on electron diffraction. It allows determination of the average size and morphology of the coherently scattering domains (CSD) in a straightforward way without the need to prepare multiple sections. The method is applicable to all kinds of bulk nanocrystalline materials. As an example, the average size of the CSD in nanocrystalline FeAl made by severe plastic deformation is determined in 3D. Assuming ellipsoidal CSD, it is deduced that the CSD have a width of 19 ± 2 nm, a length of 18 ± 1 nm, and a height of 10 ± 1 nm.

Numerical stability of the error diffusion concept

NASA Astrophysics Data System (ADS)

Weissbach, Severin; Wyrowski, Frank

1992-10-01

The error diffusion algorithm is an easy implementable mean to handle nonlinearities in signal processing, e.g. in picture binarization and coding of diffractive elements. The numerical stability of the algorithm depends on the choice of the diffusion weights. A criterion for the stability of the algorithm is presented and evaluated for some examples.

Supercooled liquid vapour pressures and related thermodynamic properties of polycyclic aromatic hydrocarbons determined by gas chromatography.

PubMed

Haftka, Joris J H; Parsons, John R; Govers, Harrie A J

2006-11-24

A gas chromatographic method using Kováts retention indices has been applied to determine the liquid vapour pressure (P(i)), enthalpy of vaporization (DeltaH(i)) and difference in heat capacity between gas and liquid phase (DeltaC(i)) for a group of polycyclic aromatic hydrocarbons (PAHs). This group consists of 19 unsubstituted, methylated and sulphur containing PAHs. Differences in log P(i) of -0.04 to +0.99 log units at 298.15K were observed between experimental values and data from effusion and gas saturation studies. These differences in log P(i) have been fitted with multilinear regression resulting in a compound and temperature dependent correction. Over a temperature range from 273.15 to 423.15K, differences in corrected log P(i) of a training set (-0.07 to +0.03 log units) and a validation set (-0.17 to 0.19 log units) were within calculated error ranges. The corrected vapour pressures also showed a good agreement with other GC determined vapour pressures (average -0.09 log units).

A moving mesh finite difference method for equilibrium radiation diffusion equations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xiaobo, E-mail: xwindyb@126.com; Huang, Weizhang, E-mail: whuang@ku.edu; Qiu, Jianxian, E-mail: jxqiu@xmu.edu.cn

2015-10-01

An efficient moving mesh finite difference method is developed for the numerical solution of equilibrium radiation diffusion equations in two dimensions. The method is based on the moving mesh partial differential equation approach and moves the mesh continuously in time using a system of meshing partial differential equations. The mesh adaptation is controlled through a Hessian-based monitor function and the so-called equidistribution and alignment principles. Several challenging issues in the numerical solution are addressed. Particularly, the radiation diffusion coefficient depends on the energy density highly nonlinearly. This nonlinearity is treated using a predictor–corrector and lagged diffusion strategy. Moreover, the nonnegativitymore » of the energy density is maintained using a cutoff method which has been known in literature to retain the accuracy and convergence order of finite difference approximation for parabolic equations. Numerical examples with multi-material, multiple spot concentration situations are presented. Numerical results show that the method works well for radiation diffusion equations and can produce numerical solutions of good accuracy. It is also shown that a two-level mesh movement strategy can significantly improve the efficiency of the computation.« less

A method to investigate the diffusion properties of nuclear calcium.

PubMed

Queisser, Gillian; Wittum, Gabriel

2011-10-01

Modeling biophysical processes in general requires knowledge about underlying biological parameters. The quality of simulation results is strongly influenced by the accuracy of these parameters, hence the identification of parameter values that the model includes is a major part of simulating biophysical processes. In many cases, secondary data can be gathered by experimental setups, which are exploitable by mathematical inverse modeling techniques. Here we describe a method for parameter identification of diffusion properties of calcium in the nuclei of rat hippocampal neurons. The method is based on a Gauss-Newton method for solving a least-squares minimization problem and was formulated in such a way that it is ideally implementable in the simulation platform uG. Making use of independently published space- and time-dependent calcium imaging data, generated from laser-assisted calcium uncaging experiments, here we could identify the diffusion properties of nuclear calcium and were able to validate a previously published model that describes nuclear calcium dynamics as a diffusion process.

Density of bunched threading dislocations in epitaxial GaN layers as determined using X-ray diffraction

NASA Astrophysics Data System (ADS)

Barchuk, M.; Holý, V.; Rafaja, D.

2018-04-01

X-ray diffraction is one of the most popular experimental methods employed for determination of dislocation densities, as it can recognize both the strain fields and the local lattice rotations produced by dislocations. The main challenge of the quantitative analysis of the dislocation density is the formulation of a suitable microstructure model, which describes the dislocation arrangement and the effect of the interactions between the strain fields from neighboring dislocations reliably in order to be able to determine the dislocation densities precisely. The aim of this study is to prove the capability of X-ray diffraction and two computational methods, which are frequently used for quantification of the threading dislocation densities from X-ray diffraction measurements, in the special case of partially bunched threading dislocations. The first method is based on the analysis of the dislocation-controlled crystal mosaicity, and the other one on the analysis of diffuse X-ray scattering from threading dislocations. The complementarity of both methods is discussed. Furthermore, it is shown how the complementarity of these methods can be used to improve the results of the quantitative analysis of bunched and thus inhomogeneously distributed threading dislocations and to get a better insight into the dislocation arrangement.

Intercomparison of atmospheric water vapour measurements at a Canadian High Arctic site

NASA Astrophysics Data System (ADS)

Weaver, Dan; Strong, Kimberly; Schneider, Matthias; Rowe, Penny M.; Sioris, Chris; Walker, Kaley A.; Mariani, Zen; Uttal, Taneil; McElroy, C. Thomas; Vömel, Holger; Spassiani, Alessio; Drummond, James R.

2017-08-01

Water vapour is a critical component of the Earth system. Techniques to acquire and improve measurements of atmospheric water vapour and its isotopes are under active development. This work presents a detailed intercomparison of water vapour total column measurements taken between 2006 and 2014 at a Canadian High Arctic research site (Eureka, Nunavut). Instruments include radiosondes, sun photometers, a microwave radiometer, and emission and solar absorption Fourier transform infrared (FTIR) spectrometers. Close agreement is observed between all combination of datasets, with mean differences ≤ 1.0 kg m-2 and correlation coefficients ≥ 0.98. The one exception in the observed high correlation is the comparison between the microwave radiometer and a radiosonde product, which had a correlation coefficient of 0.92.A variety of biases affecting Eureka instruments are revealed and discussed. A subset of Eureka radiosonde measurements was processed by the Global Climate Observing System (GCOS) Reference Upper Air Network (GRUAN) for this study. Comparisons reveal a small dry bias in the standard radiosonde measurement water vapour total columns of approximately 4 %. A recently produced solar absorption FTIR spectrometer dataset resulting from the MUSICA (MUlti-platform remote Sensing of Isotopologues for investigating the Cycle of Atmospheric water) retrieval technique is shown to offer accurate measurements of water vapour total columns (e.g. average agreement within -5.2 % of GRUAN and -6.5 % of a co-located emission FTIR spectrometer). However, comparisons show a small wet bias of approximately 6 % at the high-latitude Eureka site. In addition, a new dataset derived from Atmospheric Emitted Radiance Interferometer (AERI) measurements is shown to provide accurate water vapour measurements (e.g. average agreement was within 4 % of GRUAN), which usefully enables measurements to be taken during day and night (especially valuable during polar night).

The Droplets Condensate Centering in the Vapour Channel of Short Low Temperature Heat Pipes at High Heat Loads

NASA Astrophysics Data System (ADS)

Seryakov, A. V.; Shakshin, S. L.; Alekseev, A. P.

2017-11-01

The results of experimental studies of the process of condensate microdroplets centering contained in the moving moist vapour in the vapour channel of short heat pipes (HPs) for large thermal loads are presented. A vapour channel formed by capillary-porous insert in the form of the inner Laval-liked nozzle along the entire length of the HP. In the upper cover forming a condensation surface in the HP, on the diametrical line are installed capacitive sensors, forming three capacitors located at different distances from the longitudinal axis of the vapour channel. With increasing heat load and the boil beginning in the evaporator a large amount of moist vapour in the vapour channel of HP occur the pressure pulsation with frequency of 400-500 Hz and amplitude up to 1·104Pa. These pulsations affect the moving of the inertial droplets subsystem of the vapour and due to the heterogeneity of the velocity profile around the particle flow in the vapour channel at the diameter of microdroplets occurs transverse force, called the Saffman force and shear microdroplets to the center of vapour channel. Using installed in the top cover capacitors we can record the radial displacement of the condensable microdroplets.

From screen to structure with a harvestable microfluidic device.

PubMed

Stojanoff, Vivian; Jakoncic, Jean; Oren, Deena A; Nagarajan, V; Poulsen, Jens-Christian Navarro; Adams-Cioaba, Melanie A; Bergfors, Terese; Sommer, Morten O A

2011-08-01

Advances in automation have facilitated the widespread adoption of high-throughput vapour-diffusion methods for initial crystallization screening. However, for many proteins, screening thousands of crystallization conditions fails to yield crystals of sufficient quality for structural characterization. Here, the rates of crystal identification for thaumatin, catalase and myoglobin using microfluidic Crystal Former devices and sitting-drop vapour-diffusion plates are compared. It is shown that the Crystal Former results in a greater number of identified initial crystallization conditions compared with vapour diffusion. Furthermore, crystals of thaumatin and lysozyme obtained in the Crystal Former were used directly for structure determination both in situ and upon harvesting and cryocooling. On the basis of these results, a crystallization strategy is proposed that uses multiple methods with distinct kinetic trajectories through the protein phase diagram to increase the output of crystallization pipelines.

Saturated Vapour Pressure and Refrigeration - Part I

ERIC Educational Resources Information Center

Bunker, C. A.

1973-01-01

The first part of a two-part article describes an experimental approach that can be used in teaching the concept of saturated vapour pressure. This leads to a discussion of refrigeration cycles in the second part of the article. (JR)

First-Order Hyperbolic System Method for Time-Dependent Advection-Diffusion Problems

NASA Technical Reports Server (NTRS)

Mazaheri, Alireza; Nishikawa, Hiroaki

2014-01-01

A time-dependent extension of the first-order hyperbolic system method for advection-diffusion problems is introduced. Diffusive/viscous terms are written and discretized as a hyperbolic system, which recovers the original equation in the steady state. The resulting scheme offers advantages over traditional schemes: a dramatic simplification in the discretization, high-order accuracy in the solution gradients, and orders-of-magnitude convergence acceleration. The hyperbolic advection-diffusion system is discretized by the second-order upwind residual-distribution scheme in a unified manner, and the system of implicit-residual-equations is solved by Newton's method over every physical time step. The numerical results are presented for linear and nonlinear advection-diffusion problems, demonstrating solutions and gradients produced to the same order of accuracy, with rapid convergence over each physical time step, typically less than five Newton iterations.

Diffractive optics fabricated by direct write methods with an electron beam

NASA Technical Reports Server (NTRS)

Kress, Bernard; Zaleta, David; Daschner, Walter; Urquhart, Kris; Stein, Robert; Lee, Sing H.

1993-01-01

State-of-the-art diffractive optics are fabricated using e-beam lithography and dry etching techniques to achieve multilevel phase elements with very high diffraction efficiencies. One of the major challenges encountered in fabricating diffractive optics is the small feature size (e.g. for diffractive lenses with small f-number). It is not only the e-beam system which dictates the feature size limitations, but also the alignment systems (mask aligner) and the materials (e-beam and photo resists). In order to allow diffractive optics to be used in new optoelectronic systems, it is necessary not only to fabricate elements with small feature sizes but also to do so in an economical fashion. Since price of a multilevel diffractive optical element is closely related to the e-beam writing time and the number of etching steps, we need to decrease the writing time and etching steps without affecting the quality of the element. To do this one has to utilize the full potentials of the e-beam writing system. In this paper, we will present three diffractive optics fabrication techniques which will reduce the number of process steps, the writing time, and the overall fabrication time for multilevel phase diffractive optics.

A deterministic Lagrangian particle separation-based method for advective-diffusion problems

NASA Astrophysics Data System (ADS)

Wong, Ken T. M.; Lee, Joseph H. W.; Choi, K. W.

2008-12-01

A simple and robust Lagrangian particle scheme is proposed to solve the advective-diffusion transport problem. The scheme is based on relative diffusion concepts and simulates diffusion by regulating particle separation. This new approach generates a deterministic result and requires far less number of particles than the random walk method. For the advection process, particles are simply moved according to their velocity. The general scheme is mass conservative and is free from numerical diffusion. It can be applied to a wide variety of advective-diffusion problems, but is particularly suited for ecological and water quality modelling when definition of particle attributes (e.g., cell status for modelling algal blooms or red tides) is a necessity. The basic derivation, numerical stability and practical implementation of the NEighborhood Separation Technique (NEST) are presented. The accuracy of the method is demonstrated through a series of test cases which embrace realistic features of coastal environmental transport problems. Two field application examples on the tidal flushing of a fish farm and the dynamics of vertically migrating marine algae are also presented.

Kinetic studies of BTEX vapour adsorption onto surfaces of calix-4-resorcinarene films

NASA Astrophysics Data System (ADS)

Hassan, A. K.; Ray, A. K.; Nabok, A. V.; Wilkop, T.

2001-10-01

The exposure of spun films of an amphiphilic calix-4-resorcinarene (C-4-RA) derivative to vapours of benzene, toluene, ethylbenzene, and m-xylene (BTEX) has produced a graded response, promising for the development of multisensor arrays. Fast and reversible adsorption of ethylbenzene was associated with changing the refractive index of the sensing layer and is believed to be due to the host-guest interaction between the cavitand C-4-RA molecules and the vapour molecules. Prolonged irradiation of the films with a focused laser beam has resulted in an initial increase of film sensitivity to the different organic vapours.

Diffusion method of seperating gaseous mixtures

DOEpatents

Pontius, Rex B.

1976-01-01

A method of effecting a relatively large change in the relative concentrations of the components of a gaseous mixture by diffusion which comprises separating the mixture into heavier and lighter portions according to major fraction mass recycle procedure, further separating the heavier portions into still heavier subportions according to a major fraction mass recycle procedure, and further separating the lighter portions into still lighter subportions according to a major fraction equilibrium recycle procedure.

Technical Note: Novel method for water vapour monitoring using wireless communication networks measurements

NASA Astrophysics Data System (ADS)

David, N.; Alpert, P.; Messer, H.

2009-04-01

We propose a new technique that overcomes the obstacles of the existing methods for monitoring near-surface water vapour, by estimating humidity from data collected through existing wireless communication networks. Weather conditions and atmospheric phenomena affect the electromagnetic channel, causing attenuations to the radio signals. Thus, wireless communication networks are in effect built-in environmental monitoring facilities. The wireless microwave links, used in these networks, are widely deployed by cellular providers for backhaul communication between base stations, a few tens of meters above ground level. As a result, if all available measurements are used, the proposed method can provide moisture observations with high spatial resolution and potentially high temporal resolution. Further, the implementation cost is minimal, since the data used are already collected and saved by the cellular operators. In addition - many of these links are installed in areas where access is difficult such as orographic terrain and complex topography. As such, our method enables measurements in places that have been hard to measure in the past, or have never been measured before. The technique is restricted to weather conditions which exclude rain, fog or clouds along the propagation path. Strong winds that may cause movement of the link transmitter or receiver (or both) may also interfere with the ability to conduct accurate measurements. We present results from real-data measurements taken from two microwave links used in a backhaul cellular network that show convincing correlation to surface station humidity measurements. The measurements were taken daily in two sites, one in northern Israel (28 measurements), the other in central Israel (29 measurements). The correlation between the microwave link measurements and the humidity gauges were 0.9 and 0.82 for the north and central sites, respectively. The Root Mean Square Differences (RMSD) were 1.8 g/m3 and 3.4 g/m3 for

Diffusion of radon through concrete block walls: A significant source of indoor radon

USGS Publications Warehouse

Lively, R.S.; Goldberg, L.F.

1999-01-01

Basement modules located in southern Minnesota have been the site of continuous radon and environmental measurements during heating seasons since 1993. Concentrations of radon within the basement modules ranged from 70 Bq.m-3 to over 4000 Bq.m-3 between November to April during the three measurement periods. In the soil gas for the same times, concentrations of radon ranged between 25,000 and 70,000 Bq.m-3. Levels of radon within the basement modules changed by factors of five or more within 24 h, in concert with pressure gradients of 4 to 20 Pa that developed between the basement modules and their surroundings. Diffusion is identified as the principal method by which radon is transferred into and out of the basement modules, and appears to be relatively independent of insulating materials and vapour retarders. The variability of radon and correlations with differential pressure gradients may be related to air currents in the block walls and soil that interrupt radon diffusing inward. This yields a net decrease of radon in the basement modules by decay and outward diffusion. Levels of radon within the basement modules increase when the pressure differential is zero and air flow ceases, allowing diffusion gradients to be re-established. Radon levels in both the soil and the basement modules then increase until an equilibrium is achieved.

Electron Diffraction Using Transmission Electron Microscopy

PubMed Central

Bendersky, Leonid A.; Gayle, Frank W.

2001-01-01

Electron diffraction via the transmission electron microscope is a powerful method for characterizing the structure of materials, including perfect crystals and defect structures. The advantages of electron diffraction over other methods, e.g., x-ray or neutron, arise from the extremely short wavelength (≈2 pm), the strong atomic scattering, and the ability to examine tiny volumes of matter (≈10 nm3). The NIST Materials Science and Engineering Laboratory has a history of discovery and characterization of new structures through electron diffraction, alone or in combination with other diffraction methods. This paper provides a survey of some of this work enabled through electron microscopy. PMID:27500060

Diffuse-Interface Capturing Methods for Compressible Two-Phase Flows

NASA Astrophysics Data System (ADS)

Saurel, Richard; Pantano, Carlos

2018-01-01

Simulation of compressible flows became a routine activity with the appearance of shock-/contact-capturing methods. These methods can determine all waves, particularly discontinuous ones. However, additional difficulties may appear in two-phase and multimaterial flows due to the abrupt variation of thermodynamic properties across the interfacial region, with discontinuous thermodynamical representations at the interfaces. To overcome this difficulty, researchers have developed augmented systems of governing equations to extend the capturing strategy. These extended systems, reviewed here, are termed diffuse-interface models, because they are designed to compute flow variables correctly in numerically diffused zones surrounding interfaces. In particular, they facilitate coupling the dynamics on both sides of the (diffuse) interfaces and tend to the proper pure fluid-governing equations far from the interfaces. This strategy has become efficient for contact interfaces separating fluids that are governed by different equations of state, in the presence or absence of capillary effects, and with phase change. More sophisticated materials than fluids (e.g., elastic-plastic materials) have been considered as well.

Expression, purification, crystallization and preliminary X-ray crystallographic studies of Deinococcus radiodurans thioredoxin reductase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Obiero, Josiah; Bonderoff, Sara A.; Goertzen, Meghan M.

2006-08-01

Recombinant D. radiodurans TrxR with a His tag at the N-terminus was expressed in Escherichia coli and purified by metal-affinity chromatography. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of 35% PEG 4000, 0.2 M ammonium acetate and citric acid buffer pH 5.1 at 293 K. Deinococcus radiodurans, a Gram-positive bacterium capable of withstanding extreme ionizing radiation, contains two thioredoxins (Trx and Trx1) and a single thioredoxin reductase (TrxR) as part of its response to oxidative stress. Thioredoxin reductase is a member of the family of pyridine nucleotide-disulfide oxidoreductase flavoenzymes. Recombinant D. radiodurans TrxR with amore » His tag at the N-terminus was expressed in Escherichia coli and purified by metal-affinity chromatography. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of 35% PEG 4000, 0.2 M ammonium acetate and citric acid buffer pH 5.1 at 293 K. X-ray diffraction data were collected on a cryocooled crystal to a resolution of 1.9 Å using a synchrotron-radiation source. The space group was determined to be P3{sub 2}21, with unit-cell parameters a = b = 84.33, c = 159.88 Å. The structure of the enzyme has been solved by molecular-replacement methods and structure refinement is in progress.« less

Numerical approximations for fractional diffusion equations via a Chebyshev spectral-tau method

NASA Astrophysics Data System (ADS)

Doha, Eid H.; Bhrawy, Ali H.; Ezz-Eldien, Samer S.

2013-10-01

In this paper, a class of fractional diffusion equations with variable coefficients is considered. An accurate and efficient spectral tau technique for solving the fractional diffusion equations numerically is proposed. This method is based upon Chebyshev tau approximation together with Chebyshev operational matrix of Caputo fractional differentiation. Such approach has the advantage of reducing the problem to the solution of a system of algebraic equations, which may then be solved by any standard numerical technique. We apply this general method to solve four specific examples. In each of the examples considered, the numerical results show that the proposed method is of high accuracy and is efficient for solving the time-dependent fractional diffusion equations.

Airborne hygrometer calibration inter-comparison against a metrological water vapour standard

NASA Astrophysics Data System (ADS)

Smorgon, Denis; Boese, Norbert; Ebert, Volker

2014-05-01

of PTB and a validated, two-pressure generator acting as a highly stable and reproducible source of water vapour. The aim of AV2-B was to perform an absolute, metrological comparison of the field instruments/calibration infrastructures to the metrological humidity scale, and to collect essential information about methods and procedures used by the atmospheric community for instrument calibration and validation, in order to investigate e.g. the necessity and possible comparability advantage by a standardized calibration procedure. The work will give an overview over the concept of the AV2-B inter-comparison, the various general measurement and calibration principles, and discuss the outcome and consequences of the comparison effort. The AQUAVIT effort is linked to the EMRP project METEOMET (ENV07) and partially supported by the EMRP and ENV07. The EMRP is jointly funded by the EMRP participating countries within EURAMET and the European Union. [1] H. Saathoff, C. Schiller, V. Ebert, D. W. Fahey, R.-S. Gao, O. Möhler, and the aquavit team, The AQUAVIT formal intercomparison of atmospheric water measurement methods, 5th General Assembly of the European Geosciences Union, 13-18 April 2008, Vienna, Austria Keywords: humidity, water vapour, inter-comparison, airborne instruments.

Exposure to oil mist and oil vapour during offshore drilling in norway, 1979-2004.

PubMed

Steinsvåg, Kjersti; Bråtveit, Magne; Moen, Bente E

2006-03-01

To describe personal exposure to airborne hydrocarbon contaminants (oil mist and oil vapour) from 1979 to 2004 in the mud-handling areas of offshore drilling facilities operating on the Norwegian continental shelf when drilling with oil-based muds. Qualitative and quantitative information was gathered during visits to companies involved in offshore oil and gas production in Norway. Monitoring reports on oil mist and oil vapour exposure covered 37 drilling facilities. Exposure data were analysed using descriptive statistics and by constructing linear mixed-effects models. Samples had been taken during the use of three generations of hydrocarbon base oils, namely diesel oils (1979-1984), low-aromatic mineral oils (1985-1997) and non-aromatic mineral oils (1998-2004). Sampling done before 1984 showed high exposure to diesel vapour (arithmetic mean, AM = 1217 mg m(-3)). When low-aromatic mineral oils were used, the exposure to oil mist and oil vapour was 4.3 and 36 mg m(-3), and the respective AMs for non-aromatic mineral oils were reduced to 0.54 and 16 mg m(-3). Downward time trends were indicated for both oil mist (6% per year) and oil vapour (8% per year) when the year of monitoring was introduced as a fixed effect in a linear mixed-effects model analysis. Rig type, technical control measures and mud temperature significantly determined exposure to oil mist. Rig type, type of base oil, viscosity of the base oil, work area, mud temperature and season significantly determined exposure to oil vapour. Major decreases in variability were found for the between-rig components. Exposure to oil mist and oil vapour declined over time in the mud-handling areas of offshore drilling facilities. Exposure levels were associated with rig type, mud temperature, technical control measures, base oil, viscosity of the base oil, work area and season.

In-vitro and in-vivo anti-Trichophyton activity of essential oils by vapour contact.

PubMed

Inouye, S; Uchida, K; Yamaguchi, H

2001-05-01

The minimum inhibitory doses (MIDs) of essential oils by vapour contact to inhibit the growth of Trichophyton mentagrophytes and Trichophyton rubrum on agar medium were determined using airtight boxes. Among seven essential oils examined, cinnamon bark oil showed the least MID, followed by lemongrass, thyme and perilla oils. Lavender and tea tree oils showed moderate MID, and citron oil showed the highest MID, being 320 times higher than that of cinnamon bark oil. The MID values were less than the minimum inhibitory concentration (MIC) values determined by agar dilution assay. Furthermore, the minimum agar concentration (MAC) of essential oils absorbed from vapour was determined at the time of MID determination as the second antifungal measure. The MAC value by vapour contact was 1.4 to 4.7 times less than the MAC remaining in the agar at the time of MIC determination by agar dilution assay. Using selected essential oils, the anti-Trichophyton activity by vapour contact was examined in more detail. Lemongrass, thyme and perilla oils killed the conidia, inhibited germination and hyphal elongation at 1-4 micrograms ml-1 air, whereas lavender oil was effective at 40-160 micrograms ml-1 air. The in-vivo efficacy of thyme and perilla oils by vapour contact was shown against an experimental tinea pedis in guinea pigs infected with T. mentagrophytes. These results indicated potent anti-Trichophyton action of essential oils by vapour contact.

Structure and Refinement of Ordered Aromatic Heterocyclic Polymers by Diffraction Methods: Application of Results to Electro-Optic Phenomena.

DTIC Science & Technology

1988-02-01

0 396 3.93 2248 2528 C25 0.111 -0.18 0495 1 1 6 3.42 341 496 356 C26 -0.011 0.107 0.624 2 I 3 3.09 3.10 1075 563 C2’ -0083 -0.104 0.630 0 2 0 298 298...crystalline material. The diffuseness of diffraction maxima, especially along the meridian, and the streaking visible along the hkl and hk2 layer lines are...3 . The measured density obtained by flotation in a cyclohexane/carbon tetrachloride mixture is 1.46 g cm-3 . The systematic absences ( hkl , h+k odd

The effect of perfluorocarbon vapour on the measurement of respiratory tidal volume during partial liquid ventilation.

PubMed

Davies, M W; Dunster, K R

2000-08-01

During partial liquid ventilation perfluorocarbon vapour is present in the exhaled gases. The volumes of these gases are measured by pneumotachometers. Error in measuring tidal volumes will give erroneous measurement of lung compliance during partial liquid ventilation. We aim to compare measured tidal volumes with and without perfluorocarbon vapour using tidal volumes suitable for use in neonates. Tidal volumes were produced with a 100 ml calibration syringe from 20 to 100 ml and with a calibrated Harvard rodent ventilator from 2.5 to 20 ml. Control tidal volumes were drawn from a humidifier chamber containing water vapour and the PFC tidal volumes were drawn from a humidifier chamber containing water and perfluorocarbon (FC-77) vapour. Tidal volumes were measured by a fixed orifice, target, differential pressure flowmeter (VenTrak) or a hot-wire anenometer (Bear Cub) placed between the calibration syringe or ventilator and the humidifier chamber. All tidal volumes measured with perfluorocarbon vapour were increased compared with control (ANOVA p < 0.001 and post t-test p < 0.0001). Measured tidal volume increased from 7 to 16% with the fixed orifice type flow-meter, and from 35 to 41% with the hot-wire type. In conclusion, perfluorocarbon vapour flowing through pneumotachometers gives falsely high tidal volume measurements. Calculation of lung compliance must take into account the effect of perfluorocarbon vapour on the measurement of tidal volume.

Lithium diffusion in sputter-deposited Li4Ti5O12 thin films

NASA Astrophysics Data System (ADS)

Wunde, F.; Berkemeier, F.; Schmitz, G.

2012-10-01

Li4Ti5O12 (LTO) thin films are deposited by dc-ion beam sputtering at different oxygen partial pressures and different substrate temperatures. In order to investigate, how these two parameters influence the atomic structure, the specimens are characterized by X-ray diffraction and transmission electron microscopy. Electrochemical characterization of the films is done by cyclic voltammetry and chrono-potentiometry. To determine an averaged chemical diffusion coefficient of lithium, a method is developed, evaluating c-rate tests. The results obtained by this method are compared to results obtained by the well established galvanostatic intermittent titration technique (GITT), which is used to determine a concentration dependent diffusion coefficient of lithium in LTO.

An integral equation method for calculating sound field diffracted by a rigid barrier on an impedance ground.

PubMed

Zhao, Sipei; Qiu, Xiaojun; Cheng, Jianchun

2015-09-01

This paper proposes a different method for calculating a sound field diffracted by a rigid barrier based on the integral equation method, where a virtual boundary is assumed above the rigid barrier to divide the whole space into two subspaces. Based on the Kirchhoff-Helmholtz equation, the sound field in each subspace is determined with the source inside and the boundary conditions on the surface, and then the diffracted sound field is obtained by using the continuation conditions on the virtual boundary. Simulations are carried out to verify the feasibility of the proposed method. Compared to the MacDonald method and other existing methods, the proposed method is a rigorous solution for whole space and is also much easier to understand.

Dew-point measurements at high water vapour pressure

NASA Astrophysics Data System (ADS)

Lomperski, S.; Dreier, J.

1996-05-01

A dew-point meter capable of measuring humidity at high vapour pressure and high temperature has been constructed and tested. Humidity measurements in pure steam were made over the temperature range 100 - 1500957-0233/7/5/003/img1C and a vapour pressure range of 1 - 4 bar. The dew-point meter performance was assessed by comparing measurements with a pressure transmitter and agreement between the two was within 0957-0233/7/5/003/img2% relative humidity. Humidity measurements in steam - air mixtures were also made and the dew-point meter readings were compared to those of a zirconia oxygen sensor. For these tests the dew-point meter readings were generally within 0957-0233/7/5/003/img2% relative humidity of the oxygen sensor measurements.

Crystallization and preliminary X-ray diffraction studies of trypsin-like proteases from the gastric fluid of the marine crab Cancer pagurus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hehemann, Jan-Hendrik; Redecke, Lars; Perbandt, Markus

2007-03-01

Two trypsins from the gastric fluid of the marine crab C. pagurus were purified and crystallized and X-ray data were collected to 0.97 and 3.2 Å resolution. The digestive fluid of the marine crab Cancer pagurus (Decapoda, Brachyura) contains highly stable proteases which display enhanced activity in aqueous mixtures of organic solvents. Three trypsins were isolated from the gastric fluid and two of them, C.p.TryII and C.p.TryIII, were purified to homogeneity by anion-exchange chromatography and crystallized by hanging-drop vapour diffusion. Diffraction data were collected at a synchrotron to 0.97 and 3.2 Å resolution, respectively. The crystal of C.p.TryII belongs tomore » the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.06, b = 62.00, c = 71.66 Å. Based on the Matthews coefficient, one protein molecule per asymmetric unit is suggested. In contrast, crystals of C.p.TryIII, which belong to the cubic space group P2{sub 1}3 with unit-cell parameters a = b = c = 215.4 Å, are assumed to contain 12 molecules per asymmetric unit.« less

The arbitrary order mixed mimetic finite difference method for the diffusion equation

DOE PAGES

Gyrya, Vitaliy; Lipnikov, Konstantin; Manzini, Gianmarco

2016-05-01

Here, we propose an arbitrary-order accurate mimetic finite difference (MFD) method for the approximation of diffusion problems in mixed form on unstructured polygonal and polyhedral meshes. As usual in the mimetic numerical technology, the method satisfies local consistency and stability conditions, which determines the accuracy and the well-posedness of the resulting approximation. The method also requires the definition of a high-order discrete divergence operator that is the discrete analog of the divergence operator and is acting on the degrees of freedom. The new family of mimetic methods is proved theoretically to be convergent and optimal error estimates for flux andmore » scalar variable are derived from the convergence analysis. A numerical experiment confirms the high-order accuracy of the method in solving diffusion problems with variable diffusion tensor. It is worth mentioning that the approximation of the scalar variable presents a superconvergence effect.« less

Generalized method calculating the effective diffusion coefficient in periodic channels.

PubMed

Kalinay, Pavol

2015-01-07

The method calculating the effective diffusion coefficient in an arbitrary periodic two-dimensional channel, presented in our previous paper [P. Kalinay, J. Chem. Phys. 141, 144101 (2014)], is generalized to 3D channels of cylindrical symmetry, as well as to 2D or 3D channels with particles driven by a constant longitudinal external driving force. The next possible extensions are also indicated. The former calculation was based on calculus in the complex plane, suitable for the stationary diffusion in 2D domains. The method is reformulated here using standard tools of functional analysis, enabling the generalization.

The Local Discontinuous Galerkin Method for Time-Dependent Convection-Diffusion Systems

NASA Technical Reports Server (NTRS)

Cockburn, Bernardo; Shu, Chi-Wang

1997-01-01

In this paper, we study the Local Discontinuous Galerkin methods for nonlinear, time-dependent convection-diffusion systems. These methods are an extension of the Runge-Kutta Discontinuous Galerkin methods for purely hyperbolic systems to convection-diffusion systems and share with those methods their high parallelizability, their high-order formal accuracy, and their easy handling of complicated geometries, for convection dominated problems. It is proven that for scalar equations, the Local Discontinuous Galerkin methods are L(sup 2)-stable in the nonlinear case. Moreover, in the linear case, it is shown that if polynomials of degree k are used, the methods are k-th order accurate for general triangulations; although this order of convergence is suboptimal, it is sharp for the LDG methods. Preliminary numerical examples displaying the performance of the method are shown.

Diffusion accessibility as a method for visualizing macromolecular surface geometry.

PubMed

Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

2015-10-01

Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

The modelling routes for the chemical vapour deposition process: application to Si 1- xGe x deposition

NASA Astrophysics Data System (ADS)

Pons, M.; Bernard, C.; Rouch, H.; Madar, R.

1995-10-01

The purpose of this article is to present the modelling routes for the chemical vapour deposition process with a special emphasis on mass transport models with near local thermochemical equilibrium imposed in the gas-phase and at the deposition surface. The theoretical problems arising from the linking of the two selected approaches, thermodynamics and mass transport, are shown and a solution procedure is proposed. As an illustration, selected results of thermodynamic and mass transport analysis and of the coupled approach showed that, for the deposition of Si 1- xGe x solid solution at 1300 K (system SiGeClHAr), the thermodynamic heterogeneous stability of the reactive gases and the thermal diffusion led to the germanium depletion of the deposit.

The vapour of imidazolium-based ionic liquids: a mass spectrometry study.

PubMed

Deyko, A; Lovelock, K R J; Licence, P; Jones, R G

2011-10-06

Eight common dialkylimidazolium-based ionic liquids have been successfully evaporated in ultra-high vacuum and their vapours analysed by line of sight mass spectrometry using electron ionisation. The ionic liquids investigated were 1-alkyl-3-methylimidazolium bis[(trifluoromethane)sulfonyl]imide, [C(n)C(1)Im][Tf(2)N] (where n = 2, 4, 6, 8), 1-alkyl-3-methylimidazolium tetrafluoroborate, [C(n)C(1)Im][BF(4)] (where n = 4, 8), 1-butyl-3-methylimidazolium octylsulfate, [C(4)C(1)Im][C(8)OSO(3)] and 1-butyl-3-methylimidazolium tetrachloroferrate, [C(4)C(1)Im][FeCl(4)]. All ionic liquids studied here evaporated as neutral ion pairs; no evidence of decomposition products in the vapour phase were observed. Key fragment cations of the ionised vapour of the ionic liquids are identified. The appearance energies, E(app), of the parent cation were measured and used to estimate the ionisation energies, E(i), for the vapour phase neutral ion pairs. Measured ionisation energies ranged from 10.5 eV to 13.0 eV. Using both the identity and E(app) values, the fragmentation pathways for a number of fragment cations are postulated. It will be shown that the enthalpy of vaporisation, Δ(vap)H, can successfully be measured using more than one fragment cation, although caution is required as many fragment cations can also be formed by ionisation of decomposition products.

Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen

2006-10-01

Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution.more » The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.« less

Preliminary X-ray crystallographic analysis of SMU.573, a putative sugar kinase from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Yan-Feng; Li, Lan-Fen; Yang, Cheng

2008-01-01

SMU.573 from S. mutans was expressed in E. coli and crystallized. The crystals belong to space group I4 and 2.5 Å resolution diffraction data were collected at an in-house chromium radiation source. SMU.573 from Streptococcus mutans is a structurally and functionally uncharacterized protein that was selected for structural biology studies. Native and SeMet-labelled proteins were expressed with an N-His tag in Escherichia coli BL21 (DE3) and purified by Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals of the SeMet-labelled protein were obtained by the hanging-drop vapour-diffusion method and a 2.5 Å resolution diffraction data set was collected using an in-house chromium radiationmore » source. The crystals belong to space group I4, with unit-cell parameters a = b = 96.53, c = 56.26 Å, α = β = γ = 90°.« less

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis

PubMed Central

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-01-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733

Crystallization and preliminary crystallographic analysis of maganese(II)-dependent 2,3-dihydroxybiphenyl 1,2-dioxygenase from Bacillus sp. JF8

PubMed Central

Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya

2010-01-01

A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161

Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morita, Hiroyuki; Kondo, Shin; Kato, Ryohei

2007-07-01

An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α =more » β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.« less

Crystallization and preliminary X-ray data analysis of β-alanine synthase from Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lundgren, Stina; Andersen, Birgit; Piškur, Jure

2007-10-01

β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine. Crystals of the recombinant enzyme from D. melanogaster belong to space group C2. Diffraction data to 3.3 Å resolution were collected and analyzed. β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine, which represents the main clearance route for the widely used anticancer drug 5-fluorouracil. Crystals of the recombinant enzyme from Drosophila melanogaster, which is closely related to the human enzyme, were obtained by the hanging-drop vapour-diffusion method. They diffracted to 3.3 Å at a synchrotron-radiation source, belong tomore » space group C2 (unit-cell parameters a = 278.9, b = 95.0, c = 199.3 Å, β = 125.8°) and contain 8–10 molecules per asymmetric unit.« less

Gradual tilting of crystallographic orientation and configuration of dislocations in GaN selectively grown by vapour phase epitaxy methods

PubMed

Kuwan; Tsukamoto; Taki; Horibuchi; Oki; Kawaguchi; Shibata; Sawaki; Hiramatsu

2000-01-01

Cross-sectional transmission electron microscope (TEM) observation was performed for selectively grown gallium nitride (GaN) in order to examine the dependence of GaN microstructure on the growth conditions. The GaN films were grown by hydride vapour phase epitaxy (HVPE) or metalorganic vapour phase epitaxy (MOVPE) on GaN covered with a patterned mask. Thin foil specimens for TEM observation were prepared with focused ion beam (FIB) machining apparatus. It was demonstrated that the c-axis of GaN grown over the terrace of the mask tilts towards the centre of the terrace when the GaN is grown in a carrier gas of N2. The wider terrace results in a larger tilting angle if other growth conditions are identical. The tilting is attributed to 'horizontal dislocations' (HDs) generated during the overgrowth of GaN on the mask terrace. The HDs in HVPE-GaN have a semi-loop shape and are tangled with one another, while those in MOVPE-GaN are straight and lined up to form low-angle grain boundaries.

Data collection strategies for time-resolved X-ray free-electron laser diffraction, and 2-color methods

PubMed Central

Li, Chufeng; Schmidt, Kevin; Spence, John C.

2015-01-01

We compare three schemes for time-resolved X-ray diffraction from protein nanocrystals using an X-ray free-electron laser. We find expressions for the errors in structure factor measurement using the Monte Carlo pump-probe method of data analysis with a liquid jet, the fixed sample pump-probe (goniometer) method (both diffract-and-destroy, and below the safe damage dose), and a proposed two-color method. Here, an optical pump pulse arrives between X-ray pulses of slightly different energies which hit the same nanocrystal, using a weak first X-ray pulse which does not damage the sample. (Radiation damage is outrun in the other cases.) This two-color method, in which separated Bragg spots are impressed on the same detector readout, eliminates stochastic fluctuations in crystal size, shape, and orientation and is found to require two orders of magnitude fewer diffraction patterns than the currently used Monte Carlo liquid jet method, for 1% accuracy. Expressions are given for errors in structure factor measurement for the four approaches, and detailed simulations provided for cathepsin B and IC3 crystals. While the error is independent of the number of shots for the dose-limited goniometer method, it falls off inversely as the square root of the number of shots for the two-color and Monte Carlo methods, with a much smaller pre-factor for the two-color mode, when the first shot is below the damage threshold. PMID:26798813

Purification and crystallization of the ABC-type transport substrate-binding protein OppA from Thermoanaerobacter tengcongensis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Jinlan; Li, Xiaolu; Tsinghua-Peking Joint Center for Life Sciences, Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing 100084, People's Republic of China

2012-06-22

Highlights: Black-Right-Pointing-Pointer We truncated the signal peptide of OppA{sub TTE0054} to make it express in Escherichia coli as a soluble protein. Black-Right-Pointing-Pointer Crystals of OppA{sub TTE0054} were grown by sitting-drop vapor diffusion method. Black-Right-Pointing-Pointer The crystal of OppA{sub TTE0054} diffracted to 2.25 A. -- Abstract: Di- and oligopeptide- binding protein OppAs play important roles in solute and nutrient uptake, sporulation, biofilm formation, cell wall muropeptides recycling, peptide-dependent quorum-sensing responses, adherence to host cells, and a variety of other biological processes. Soluble OppA from Thermoanaerobacter tengcongensis was expressed in Escherichia coli. The protein was found to be >95% pure with SDS-PAGEmore » after a series of purification steps and the purity was further verified by mass spectrometry. The protein was crystallized using the sitting-drop vapour-diffusion method with PEG 400 as the precipitant. Crystal diffraction extended to 2.25 A. The crystal belonged to space group C222{sub 1}, with unit-cell parameters of a = 69.395, b = 199.572, c = 131.673 A, and {alpha} = {beta} = {gamma} = 90 Degree-Sign .« less

Predicting X-ray diffuse scattering from translation–libration–screw structural ensembles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Benschoten, Andrew H.; Afonine, Pavel V.; Terwilliger, Thomas C.

2015-07-28

A method of simulating X-ray diffuse scattering from multi-model PDB files is presented. Despite similar agreement with Bragg data, different translation–libration–screw refinement strategies produce unique diffuse intensity patterns. Identifying the intramolecular motions of proteins and nucleic acids is a major challenge in macromolecular X-ray crystallography. Because Bragg diffraction describes the average positional distribution of crystalline atoms with imperfect precision, the resulting electron density can be compatible with multiple models of motion. Diffuse X-ray scattering can reduce this degeneracy by reporting on correlated atomic displacements. Although recent technological advances are increasing the potential to accurately measure diffuse scattering, computational modeling andmore » validation tools are still needed to quantify the agreement between experimental data and different parameterizations of crystalline disorder. A new tool, phenix.diffuse, addresses this need by employing Guinier’s equation to calculate diffuse scattering from Protein Data Bank (PDB)-formatted structural ensembles. As an example case, phenix.diffuse is applied to translation–libration–screw (TLS) refinement, which models rigid-body displacement for segments of the macromolecule. To enable the calculation of diffuse scattering from TLS-refined structures, phenix.tls-as-xyz builds multi-model PDB files that sample the underlying T, L and S tensors. In the glycerophosphodiesterase GpdQ, alternative TLS-group partitioning and different motional correlations between groups yield markedly dissimilar diffuse scattering maps with distinct implications for molecular mechanism and allostery. These methods demonstrate how, in principle, X-ray diffuse scattering could extend macromolecular structural refinement, validation and analysis.« less

Different physiological and behavioural effects of e-cigarette vapour and cigarette smoke in mice.

PubMed

Ponzoni, L; Moretti, M; Sala, M; Fasoli, F; Mucchietto, V; Lucini, V; Cannazza, G; Gallesi, G; Castellana, C N; Clementi, F; Zoli, M; Gotti, C; Braida, D

2015-10-01

Nicotine is the primary addictive substance in tobacco smoke and electronic cigarette (e-cig) vapour. Methodological limitations have made it difficult to compare the role of the nicotine and non-nicotine constituents of tobacco smoke. The aim of this study was to compare the effects of traditional cigarette smoke and e-cig vapour containing the same amount of nicotine in male BALB/c mice exposed to the smoke of 21 cigarettes or e-cig vapour containing 16.8 mg of nicotine delivered by means of a mechanical ventilator for three 30-min sessions/day for seven weeks. One hour after the last session, half of the animals were sacrificed for neurochemical analysis, and the others underwent mecamylamine-precipitated or spontaneous withdrawal for the purposes of behavioural analysis. Chronic intermittent non-contingent, second-hand exposure to cigarette smoke or e-cig vapour led to similar brain cotinine and nicotine levels, similar urine cotinine levels and the similar up-regulation of α4β2 nicotinic acetylcholine receptors in different brain areas, but had different effects on body weight, food intake, and the signs of mecamylamine-precipitated and spontaneous withdrawal episodic memory and emotional responses. The findings of this study demonstrate for the first time that e-cig vapour induces addiction-related neurochemical, physiological and behavioural alterations. The fact that inhaled cigarette smoke and e-cig vapour have partially different dependence-related effects indicates that compounds other than nicotine contribute to tobacco dependence. Copyright © 2015 Elsevier B.V. and ECNP. All rights reserved.

Diffraction-Based Optical Switch

NASA Technical Reports Server (NTRS)

Sperno, Stevan M. (Inventor); Fuhr, Peter L. (Inventor); Schipper, John F. (Inventor)

2005-01-01

Method and system for controllably redirecting a light beam, having a central wavelength lambda, from a first light-receiving site to a second light-receiving site. A diffraction grating is attached to or part of a piezoelectric substrate, which is connected to one or two controllable voltage difference sources. When a substrate voltage difference is changed and the diffraction grating length in each of one or two directions is thereby changed, at least one of the diffraction angle, the diffraction order and the central wavelength is controllably changed. A diffracted light beam component, having a given wavelength, diffraction angle and diffraction order, that is initially received at a first light receiving site (e.g., a detector or optical fiber) is thereby controllably shifted or altered and can be received at a second light receiving site. A polynomially stepped, chirped grating is used in one embodiment. In another embodiment, an incident light beam, having at least one of first and second wavelengths, lambda1 and lambda2, is received and diffracted at a first diffraction grating to provide a first diffracted beam. The first diffracted beam is received and diffracted at a second diffraction grating to produce a second diffracted beam. The second diffracted beam is received at a light-sensitive transducer, having at least first and second spaced apart light detector elements that are positioned so that, when the incident light beam has wavelength lambda1 or lambda2 (lambda1 not equal to lambda2), the second diffracted beam is received at the first element or at the second element, respectively; change in a selected physical parameter at the second grating can also be sensed or measured. A sequence of spaced apart light detector elements can be positioned along a linear or curvilinear segment with equal or unequal spacing.

Comparisons of xylem sap flow and water vapour flux at the stand level and derivation of canopy conductance for Scots pine

NASA Astrophysics Data System (ADS)

Granier, A.; Biron, P.; Köstner, B.; Gay, L. W.; Najjar, G.

1996-03-01

Simultaneous measurements of xylem sap flow and water vapour flux over a Scots pine ( Pinus sylvestris) forest (Hartheim, Germany), were carried out during the Hartheim Experiment (HartX), an intensive observation campaign of the international programme REKLIP. Sap flow was measured every 30 min using both radial constant heating (Granier, 1985) and two types of Cermak sap flowmeters installed on 24 trees selected to cover a wide range of the diameter classes of the stand (min 8 cm; max 17.5 cm). Available energy was high during the observation period (5.5 to 6.9 mm.day-1), and daily cumulated sap flow on a ground area basis varied between 2.0 and 2.7 mm day-1 depending on climate conditions. Maximum hourly values of sap flow reached 0.33 mm h-1, i.e., 230 W m-2. Comparisons of sap flow with water vapour flux as measured with two OPEC (One Propeller Eddy Correlation, University of Arizona) systems showed a time lag between the two methods, sap flow lagging about 90 min behind vapour flux. After taking into account this time lag in the sap flow data set, a good agreement was found between both methods: sap flow = 0.745* vapour flux, r 2 = 0.86. The difference between the two estimates was due to understory transpiration. Canopy conductance ( g c ) was calculated from sap flow measurements using the reverse form of Penman-Monteith equation and climatic data measured 4 m above the canopy. Variations of g c were well correlated ( r 2 = 0.85) with global radiation ( R) and vapour pressure deficit ( vpd). The quantitative expression for g c = f ( R, vpd) was very similar to that previously found with maritime pine ( Pinus pinaster) in the forest of Les Landes, South Western France.

Atomic-scale Studies of Uranium Oxidation and Corrosion by Water Vapour.

PubMed

Martin, T L; Coe, C; Bagot, P A J; Morrall, P; Smith, G D W; Scott, T; Moody, M P

2016-07-12

Understanding the corrosion of uranium is important for its safe, long-term storage. Uranium metal corrodes rapidly in air, but the exact mechanism remains subject to debate. Atom Probe Tomography was used to investigate the surface microstructure of metallic depleted uranium specimens following polishing and exposure to moist air. A complex, corrugated metal-oxide interface was observed, with approximately 60 at.% oxygen content within the oxide. Interestingly, a very thin (~5 nm) interfacial layer of uranium hydride was observed at the oxide-metal interface. Exposure to deuterated water vapour produced an equivalent deuteride signal at the metal-oxide interface, confirming the hydride as originating via the water vapour oxidation mechanism. Hydroxide ions were detected uniformly throughout the oxide, yet showed reduced prominence at the metal interface. These results support a proposed mechanism for the oxidation of uranium in water vapour environments where the transport of hydroxyl species and the formation of hydride are key to understanding the observed behaviour.

Atomic-scale Studies of Uranium Oxidation and Corrosion by Water Vapour

NASA Astrophysics Data System (ADS)

Martin, T. L.; Coe, C.; Bagot, P. A. J.; Morrall, P.; Smith, G. D. W.; Scott, T.; Moody, M. P.

2016-07-01

Understanding the corrosion of uranium is important for its safe, long-term storage. Uranium metal corrodes rapidly in air, but the exact mechanism remains subject to debate. Atom Probe Tomography was used to investigate the surface microstructure of metallic depleted uranium specimens following polishing and exposure to moist air. A complex, corrugated metal-oxide interface was observed, with approximately 60 at.% oxygen content within the oxide. Interestingly, a very thin (~5 nm) interfacial layer of uranium hydride was observed at the oxide-metal interface. Exposure to deuterated water vapour produced an equivalent deuteride signal at the metal-oxide interface, confirming the hydride as originating via the water vapour oxidation mechanism. Hydroxide ions were detected uniformly throughout the oxide, yet showed reduced prominence at the metal interface. These results support a proposed mechanism for the oxidation of uranium in water vapour environments where the transport of hydroxyl species and the formation of hydride are key to understanding the observed behaviour.

Preliminary Martian Atmospheric Water Vapour Column Abundances with Mars Climate Sounder

NASA Astrophysics Data System (ADS)

Lolachi, Ramin; Irwin, P. G. J.; Teanby, N.; Calcutt, S.; Howett, C. J. A.; Bowles, N. E.; Taylor, F. W.; Schofield, J. T.; Kleinboehl, A.; McCleese, D. J.

2007-12-01

Mars Climate Sounder (MCS) is an infra-red radiometer on board NASA's Mars Reconnaissance Orbiter (MRO) launched in August 2005 and now orbiting Mars in a near circular polar orbit. MCS has nine spectral channels in the range 0.3-50 µm. Goals of MCS include global characterization of atmospheric temperature, dust and water profiles observing temporal and spatial variation. Using Oxford University's multivariate retrieval algorithm, NEMESIS, we present preliminary determinations of the water vapour column abundance in the Martian atmosphere during the period September-October 2006 (Ls range 111-129°, i.e. northern hemisphere summer). A combination of spectral channels inside and outside the water vapour rotation band (at 50 µm) are used to retrieve the column abundances mainly using nadir observations (as aerosol opacity is less important relative to water vapour opacity in nadir viewing geometry). We then compare these column abundances to earlier results from the Viking Orbiter Mars Atmospheric Water Detectors (MAWD) and the Thermal Emission Spectrometer (TES) on Mars Global Surveyor.

Atomic-scale Studies of Uranium Oxidation and Corrosion by Water Vapour

PubMed Central

Martin, T. L.; Coe, C.; Bagot, P. A. J.; Morrall, P.; Smith, G. D. W; Scott, T.; Moody, M. P.

2016-01-01

Understanding the corrosion of uranium is important for its safe, long-term storage. Uranium metal corrodes rapidly in air, but the exact mechanism remains subject to debate. Atom Probe Tomography was used to investigate the surface microstructure of metallic depleted uranium specimens following polishing and exposure to moist air. A complex, corrugated metal-oxide interface was observed, with approximately 60 at.% oxygen content within the oxide. Interestingly, a very thin (~5 nm) interfacial layer of uranium hydride was observed at the oxide-metal interface. Exposure to deuterated water vapour produced an equivalent deuteride signal at the metal-oxide interface, confirming the hydride as originating via the water vapour oxidation mechanism. Hydroxide ions were detected uniformly throughout the oxide, yet showed reduced prominence at the metal interface. These results support a proposed mechanism for the oxidation of uranium in water vapour environments where the transport of hydroxyl species and the formation of hydride are key to understanding the observed behaviour. PMID:27403638

Multipath analysis diffraction calculations

NASA Technical Reports Server (NTRS)

Statham, Richard B.

1996-01-01

This report describes extensions of the Kirchhoff diffraction equation to higher edge terms and discusses their suitability to model diffraction multipath effects of a small satellite structure. When receiving signals, at a satellite, from the Global Positioning System (GPS), reflected signals from the satellite structure result in multipath errors in the determination of the satellite position. Multipath error can be caused by diffraction of the reflected signals and a method of calculating this diffraction is required when using a facet model of the satellite. Several aspects of the Kirchhoff equation are discussed and numerical examples, in the near and far fields, are shown. The vector form of the extended Kirchhoff equation, by adding the Larmor-Tedone and Kottler edge terms, is given as a mathematical model in an appendix. The Kirchhoff equation was investigated as being easily implemented and of good accuracy in the basic form, especially in phase determination. The basic Kirchhoff can be extended for higher accuracy if desired. A brief discussion of the method of moments and the geometric theory of diffraction is included, but seems to offer no clear advantage in implementation over the Kirchhoff for facet models.

MEDUSA: The ExoMars experiment for in-situ monitoring of dust and water vapour

NASA Astrophysics Data System (ADS)

Colangeli, L.; Lopez-Moreno, J. J.; Nørnberg, P.; Della Corte, V.; Esposito, F.; Mazzotta Epifani, E.; Merrison, J.; Molfese, C.; Palumbo, P.; Rodriguez-Gomez, J. F.; Rotundi, A.; Visconti, G.; Zarnecki, J. C.; The International Medusa Team

2009-07-01

Dust and water vapour are fundamental components of the Martian atmosphere. In view of tracing the past environmental conditions on Mars, that possibly favoured the appearing of life forms, it is important to study the present climate and its evolution. Here dust and water vapour have (and have had) strong influence. Of major scientific interest is the quantity and physical, chemical and electrical properties of dust and the abundance of water vapour dispersed in the atmosphere and their exchange with the surface. Moreover, in view of the exploration of the planet with automated systems and in the future by manned missions, it is of primary importance to analyse the hazards linked to these environmental factors. The Martian Environmental Dust Systematic Analyser (MEDUSA) experiment, included in the scientific payload of the ESA ExoMars mission, accommodates a complement of sensors, based on optical detection and cumulative mass deposition, that aims to study dust and water vapour in the lower Martian atmosphere. The goals are to study, for the first time, in-situ and quantitatively, physical properties of the airborne dust, including the cumulative dust mass flux, the dust deposition rate, the physical and electrification properties, the size distribution of sampled particles and the atmospheric water vapour abundance versus time.

Expression, purification and crystallization of a dye-decolourizing peroxidase from Dictyostelium discoideum.

PubMed

Rai, Amrita; Fedorov, Roman; Manstein, Dietmar J

2014-02-01

Dye-decolourizing peroxidases are haem-containing peroxidases with broad substrate specificity. Using H2O2 as an electron acceptor, they efficiently decolourize various dyes that are of industrial and environmental relevance, such as anthraquninone- and azo-based dyes. In this study, the dye-decolourizing peroxidase DdDyP from Dictyostelium discoideum was overexpressed in Escherichia coli strain Rosetta(DE3)pLysS, purified and crystallized using the vapour-diffusion method. A native crystal diffracted to 1.65 Å resolution and belonged to space group P4(1)2(1)2, with unit-cell parameters a = b = 141.03, c = 95.56 Å, α = β = γ = 90°. The asymmetric unit contains two molecules.

Crystallization and preliminary crystallographic analysis of a surface antigen glycoprotein, SAG19, from Eimeria tenella

PubMed Central

Ramly, Nur Zazarina; Rouzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Baker, Patrick J.; Chow, Yock-Ping; Wan, Kiew-Lian; Nathan, Sheila; Rice, David W.

2013-01-01

Coccidiosis in chickens is caused by the apicomplexan parasite Eimeria tenella and is thought to involve a role for a superfamily of more than 20 cysteine-rich surface antigen glycoproteins (SAGs) in host–parasite interactions. A representative member of the family, SAG19, has been overexpressed in Escherichia coli, purified and crystallized by the hanging-drop method of vapour diffusion using ammonium sulfate as the precipitant. Crystals of SAG19 diffracted to beyond 1.50 Å resolution and belonged to space group I4, with unit-cell parameters a = b = 108.2, c = 37.5 Å. Calculation of possible values of V M suggests that there is a single molecule in the asymmetric unit. PMID:24316835

Expression, Purification And Preliminary X-Ray Analysis of the C-Terminal Domain of An Arginine Repressor Protein From Mycobacterium Tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, G.J.; Garen, C.R.; Cherney, M.M.

2009-06-03

The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 {angstrom}. The crystals belong to space group P1 and the Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of sixmore » molecules per unit cell.« less

Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of SET/TAF-Iß δN from Homo sapiens.

PubMed

Xu, Zhen; Yang, Weili; Shi, Nuo; Gao, Yongxiang; Teng, Maikun; Niu, Liwen

2010-08-01

The histone chaperone SET encoded by the SET gene, which is also known as template-activating factor Iß (TAF-Iß), is a multifunctional molecule that is involved in many biological phenomena such as histone binding, nucleosome assembly, chromatin remodelling, replication, transcription and apoptosis. A truncated SET/TAF-Iß ΔN protein that lacked the first 22 residues of the N-terminus but contained the C-terminal acidic domain and an additional His6 tag at the C-terminus was overexpressed in Escherichia coli and crystallized by the hanging-drop vapour-diffusion method using sodium acetate as precipitant at 283 K. The crystals diffracted to 2.7 A resolution and belonged to space group P4(3)2(1)2.

Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii

PubMed Central

Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.

2005-01-01

This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure. PMID:16508108

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Feng; Jin, Tengchuan; Howard, Andrew

The crystallization of the brazil nut allergen Ber e 2 is reported. Peanut and tree-nut allergies have attracted considerable attention because of their frequency and their lifelong persistence. Brazil-nut (Bertholletia excelsa) allergies have been well documented and the 11S legumin-like seed storage protein Ber e 2 (excelsin) is one of the two known brazil-nut allergens. In this study, Ber e 2 was extracted from brazil-nut kernels and purified to high purity by crystalline precipitation and gel-filtration chromatography. Well diffracting single crystals were obtained using the hanging-drop vapour-diffusion method. A molecular-replacement structural solution has been obtained. Refinement of the structure ismore » currently under way.« less

Vapours of US and EU Market Leader Electronic Cigarette Brands and Liquids Are Cytotoxic for Human Vascular Endothelial Cells.

PubMed

Putzhammer, Raphaela; Doppler, Christian; Jakschitz, Thomas; Heinz, Katharina; Förste, Juliane; Danzl, Katarina; Messner, Barbara; Bernhard, David

2016-01-01

The present study was conducted to provide toxicological data on e-cigarette vapours of different e-cigarette brands and liquids from systems viewed as leaders in the e-cigarette market and to compare e-cigarette vapour toxicity to the toxicity of conventional strong high-nicotine cigarette smoke. Using an adapted version of a previously constructed cigarette smoke constituent sampling device, we collected the hydrophilic fraction of e-cigarette vapour and exposed human umbilical vein endothelial cells (HUVECs) to the mixture of compounds present in the vapour of 4 different single-use e-cigarettes, 6 different liquid vapours produced by the same refillable e-cigarette, and one e-cigarette with an exchangeable liquid cartridge. After incubation of cells with various concentrations and for various periods of time we analysed cell death induction, proliferation rates, the occurrence of intra-cellular reactive oxygen species, cell morphology, and we also measured e-cigarette heating coil temperatures. Overall, conventional cigarette smoke extract showed the most severe impact on endothelial cells. However, some e-cigarette vapour extracts showed high cytotoxicity, inhibition of cell proliferation, and alterations in cell morphology, which were comparable to conventional high-nicotine cigarettes. The vapours generated from different liquids using the same e-cigarette show substantial differences, pointing to the liquids as an important source for toxicity. E-cigarette vapour-mediated induction of oxidative stress was significant in one out of the 11 analysed vapours. There is a high variability in the acute cytotoxicity of e-cigarette vapours depending on the liquid and on the e-cigarettes used. Some products showed toxic effects close to a conventional high-nicotine cigarette. Liquid nicotine, menthol content, and the formation of acute intracellular reactive oxygen species do not seem to be the central elements in e-cigarette vapour toxicity.

Vapours of US and EU Market Leader Electronic Cigarette Brands and Liquids Are Cytotoxic for Human Vascular Endothelial Cells

PubMed Central

Putzhammer, Raphaela; Doppler, Christian; Jakschitz, Thomas; Heinz, Katharina; Förste, Juliane; Danzl, Katarina; Messner, Barbara; Bernhard, David

2016-01-01

The present study was conducted to provide toxicological data on e-cigarette vapours of different e-cigarette brands and liquids from systems viewed as leaders in the e-cigarette market and to compare e-cigarette vapour toxicity to the toxicity of conventional strong high-nicotine cigarette smoke. Using an adapted version of a previously constructed cigarette smoke constituent sampling device, we collected the hydrophilic fraction of e-cigarette vapour and exposed human umbilical vein endothelial cells (HUVECs) to the mixture of compounds present in the vapour of 4 different single-use e-cigarettes, 6 different liquid vapours produced by the same refillable e-cigarette, and one e-cigarette with an exchangeable liquid cartridge. After incubation of cells with various concentrations and for various periods of time we analysed cell death induction, proliferation rates, the occurrence of intra-cellular reactive oxygen species, cell morphology, and we also measured e-cigarette heating coil temperatures. Overall, conventional cigarette smoke extract showed the most severe impact on endothelial cells. However, some e-cigarette vapour extracts showed high cytotoxicity, inhibition of cell proliferation, and alterations in cell morphology, which were comparable to conventional high-nicotine cigarettes. The vapours generated from different liquids using the same e-cigarette show substantial differences, pointing to the liquids as an important source for toxicity. E-cigarette vapour-mediated induction of oxidative stress was significant in one out of the 11 analysed vapours. There is a high variability in the acute cytotoxicity of e-cigarette vapours depending on the liquid and on the e-cigarettes used. Some products showed toxic effects close to a conventional high-nicotine cigarette. Liquid nicotine, menthol content, and the formation of acute intracellular reactive oxygen species do not seem to be the central elements in e-cigarette vapour toxicity. PMID:27351725

Ion Exchange Method - Diffusion Barrier Investigations

NASA Astrophysics Data System (ADS)

Pielak, G.; Szustakowski, M.; Kiezun, A.

1990-01-01

Ion exchange method is used to GRIN-rod lenses manufacturing. In this process the ion exchange occurs between bulk glass (rod) and a molten salt. It was find that diffusion barrier exists on a border of glass surface and molten salt. The investigations of this barrier show that it value varies with ion exchange time and process temperature. It was find that in the case when thalium glass rod was treated in KNO3, bath, the minimum of the potential after 24 h was in temperature of 407°C, after 48 h in 422°C, after 72 h in 438°C and so on. So there are the possibility to keep the minimum of diffusion barrier by changing the temperature of the process and then the effectiveness of ion exchange process is the most effective. The time needed to obtain suitable refractive index distribution in a process when temperature was linearly changed from 400°C to 460°C was shorter of about 30% compare with the process in which temperature was constant and equal 450°C.

Ultrafast electron diffraction pattern simulations using GPU technology. Applications to lattice vibrations.

PubMed

Eggeman, A S; London, A; Midgley, P A

2013-11-01

Graphical processing units (GPUs) offer a cost-effective and powerful means to enhance the processing power of computers. Here we show how GPUs can greatly increase the speed of electron diffraction pattern simulations by the implementation of a novel method to generate the phase grating used in multislice calculations. The increase in speed is especially apparent when using large supercell arrays and we illustrate the benefits of fast encoding the transmission function representing the atomic potentials through the simulation of thermal diffuse scattering in silicon brought about by specific vibrational modes. © 2013 Elsevier B.V. All rights reserved.

Purification, isolation, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 from Drosophila melanogaster

NASA Astrophysics Data System (ADS)

Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Popov, V. O.

2017-11-01

The spatial organization of the genome is controlled by a special class of architectural proteins, including proteins containing BTB domains that are able to dimerize or multimerize. The centrosomal protein 190 is one of such architectural proteins. The purification, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 are reported. The crystallization conditions were found by the vapor-diffusion technique. The crystals diffracted to 1.5 Å resolution and belonged to sp. gr. P3221. The structure was solved by the molecular replacement method. The structure refinement is currently underway.

The estimation method on diffusion spot energy concentration of the detection system

NASA Astrophysics Data System (ADS)

Gao, Wei; Song, Zongxi; Liu, Feng; Dan, Lijun; Sun, Zhonghan; Du, Yunfei

2016-09-01

We propose a method to estimate the diffusion spot energy of the detection system. We do outdoor observation experiments in Xinglong Observatory, by using a detection system which diffusion spot energy concentration is estimated (the correlation coefficient is approximate 0.9926).The aperture of system is 300mm and limiting magnitude of system is 14.15Mv. Observation experiments show that the highest detecting magnitude of estimated system is 13.96Mv, and the average detecting magnitude of estimated system is about 13.5Mv. The results indicate that this method can be used to evaluate the energy diffusion spot concentration level of detection system efficiently.

Phononic crystal diffraction gratings

NASA Astrophysics Data System (ADS)

Moiseyenko, Rayisa P.; Herbison, Sarah; Declercq, Nico F.; Laude, Vincent

2012-02-01

When a phononic crystal is interrogated by an external source of acoustic waves, there is necessarily a phenomenon of diffraction occurring on the external enclosing surfaces. Indeed, these external surfaces are periodic and the resulting acoustic diffraction grating has a periodicity that depends on the orientation of the phononic crystal. This work presents a combined experimental and theoretical study on the diffraction of bulk ultrasonic waves on the external surfaces of a 2D phononic crystal that consists of a triangular lattice of steel rods in a water matrix. The results of transmission experiments are compared with theoretical band structures obtained with the finite-element method. Angular spectrograms (showing frequency as a function of angle) determined from diffraction experiments are then compared with finite-element simulations of diffraction occurring on the surfaces of the crystal. The experimental results show that the diffraction that occurs on its external surfaces is highly frequency-dependent and has a definite relation with the Bloch modes of the phononic crystal. In particular, a strong influence of the presence of bandgaps and deaf bands on the diffraction efficiency is found. This observation opens perspectives for the design of efficient phononic crystal diffraction gratings.

Diffraction-based optical correlator

NASA Technical Reports Server (NTRS)

Spremo, Stevan M. (Inventor); Fuhr, Peter L. (Inventor); Schipper, John F. (Inventor)

2005-01-01

Method and system for wavelength-based processing of a light beam. A light beam, produced at a chemical or physical reaction site and having at least first and second wavelengths, ?1 and ?2, is received and diffracted at a first diffraction grating to provide first and second diffracted beams, which are received and analyzed in terms of wavelength and/or time at two spaced apart light detectors. In a second embodiment, light from first and second sources is diffracted and compared in terms of wavelength and/or time to determine if the two beams arise from the same source. In a third embodiment, a light beam is split and diffracted and passed through first and second environments to study differential effects. In a fourth embodiment, diffracted light beam components, having first and second wavelengths, are received sequentially at a reaction site to determine whether a specified reaction is promoted, based on order of receipt of the beams. In a fifth embodiment, a cylindrically shaped diffraction grating (uniform or chirped) is rotated and translated to provide a sequence of diffracted beams with different wavelengths. In a sixth embodiment, incident light, representing one or more symbols, is successively diffracted from first and second diffraction gratings and is received at different light detectors, depending upon the wavelengths present in the incident light.

Preparation of fungal conidia impacts their susceptibility to inactivation by ethanol vapours.

PubMed

Dao, Thien; Dantigny, Philippe

2009-11-15

A common protocol employed for the preparation of conidia employs flooding a fungal colony grown on semi-solid media under optimum conditions with an aqueous solution. In contrast, conidia produced in a natural environment are usually not hydrated when disseminated in air and can be produced under water stress. In order to simulate the latter conditions, cultures were grown at different water activities and conidia were dry-harvested on the lid by turning the dishes upside-down then gently tapping the bottom of the box. This study aimed at assessing the effect of the preparation of fungal conidia on their inactivation by ethanol vapours. Firstly ethanol vapours (either 0.30 or 0.45 kPa) were applied to conidia obtained from the standardised protocol and to dry-harvested conidia for some species of Penicillium. While all dry-harvested conidia remained viable after 24 h of treatment, about 1.0, 3.5 and 2.5 log(10) reductions were observed for hydrated conidia of Penicillium chrysogenum, Penicillium digitatum and Penicillium italicum respectively. Secondly ethanol vapours (0.67 kPa) were applied to dry-harvested conidia obtained from cultures grown at 0.99 a(w) and at reduced water activities. For all species, the susceptibility to ethanol vapours of conidia obtained at 0.99 a(w) was significantly greater than that of conidia obtained at reduced water activities. Conidia produced in a natural environment under non-optimal conditions would be much more resistant to ethanol vapours than those produced in the laboratory. This phenomenon may be due to a reduced intracellular water activity of dry-harvested conidia.

Diffusion archeology for diffusion progression history reconstruction.

PubMed

Sefer, Emre; Kingsford, Carl

2016-11-01

Diffusion through graphs can be used to model many real-world processes, such as the spread of diseases, social network memes, computer viruses, or water contaminants. Often, a real-world diffusion cannot be directly observed while it is occurring - perhaps it is not noticed until some time has passed, continuous monitoring is too costly, or privacy concerns limit data access. This leads to the need to reconstruct how the present state of the diffusion came to be from partial diffusion data. Here, we tackle the problem of reconstructing a diffusion history from one or more snapshots of the diffusion state. This ability can be invaluable to learn when certain computer nodes are infected or which people are the initial disease spreaders to control future diffusions. We formulate this problem over discrete-time SEIRS-type diffusion models in terms of maximum likelihood. We design methods that are based on submodularity and a novel prize-collecting dominating-set vertex cover (PCDSVC) relaxation that can identify likely diffusion steps with some provable performance guarantees. Our methods are the first to be able to reconstruct complete diffusion histories accurately in real and simulated situations. As a special case, they can also identify the initial spreaders better than the existing methods for that problem. Our results for both meme and contaminant diffusion show that the partial diffusion data problem can be overcome with proper modeling and methods, and that hidden temporal characteristics of diffusion can be predicted from limited data.

The structure of denisovite, a fibrous nanocrystalline polytypic disordered ‘very complex’ silicate, studied by a synergistic multi-disciplinary approach employing methods of electron crystallography and X-ray powder diffraction

PubMed Central

Schowalter, Marco; Schmidt, Martin U.; Czank, Michael; Depmeier, Wulf; Rosenauer, Andreas

2017-01-01

Denisovite is a rare mineral occurring as aggregates of fibres typically 200–500 nm diameter. It was confirmed as a new mineral in 1984, but important facts about its chemical formula, lattice parameters, symmetry and structure have remained incompletely known since then. Recently obtained results from studies using microprobe analysis, X-ray powder diffraction (XRPD), electron crystallography, modelling and Rietveld refinement will be reported. The electron crystallography methods include transmission electron microscopy (TEM), selected-area electron diffraction (SAED), high-angle annular dark-field imaging (HAADF), high-resolution transmission electron microscopy (HRTEM), precession electron diffraction (PED) and electron diffraction tomography (EDT). A structural model of denisovite was developed from HAADF images and later completed on the basis of quasi-kinematic EDT data by ab initio structure solution using direct methods and least-squares refinement. The model was confirmed by Rietveld refinement. The lattice parameters are a = 31.024 (1), b = 19.554 (1) and c = 7.1441 (5) Å, β = 95.99 (3)°, V = 4310.1 (5) Å3 and space group P12/a1. The structure consists of three topologically distinct dreier silicate chains, viz. two xonotlite-like dreier double chains, [Si6O17]10−, and a tubular loop-branched dreier triple chain, [Si12O30]12−. The silicate chains occur between three walls of edge-sharing (Ca,Na) octahedra. The chains of silicate tetrahedra and the octahedra walls extend parallel to the z axis and form a layer parallel to (100). Water molecules and K+ cations are located at the centre of the tubular silicate chain. The latter also occupy positions close to the centres of eight-membered rings in the silicate chains. The silicate chains are geometrically constrained by neighbouring octahedra walls and present an ambiguity with respect to their z position along these walls, with displacements between neighbouring layers being either

Parameters estimation using the first passage times method in a jump-diffusion model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khaldi, K., E-mail: kkhaldi@umbb.dz; LIMOSE Laboratory, Boumerdes University, 35000; Meddahi, S., E-mail: samia.meddahi@gmail.com

2016-06-02

The main purposes of this paper are two contributions: (1) it presents a new method, which is the first passage time (FPT method) generalized for all passage times (GPT method), in order to estimate the parameters of stochastic Jump-Diffusion process. (2) it compares in a time series model, share price of gold, the empirical results of the estimation and forecasts obtained with the GPT method and those obtained by the moments method and the FPT method applied to the Merton Jump-Diffusion (MJD) model.

Numerical method for angle-of-incidence correction factors for diffuse radiation incident photovoltaic modules

DOE PAGES

Marion, Bill

2017-03-27

Here, a numerical method is provided for solving the integral equation for the angle-of-incidence (AOI) correction factor for diffuse radiation incident photovoltaic (PV) modules. The types of diffuse radiation considered include sky, circumsolar, horizon, and ground-reflected. The method permits PV module AOI characteristics to be addressed when calculating AOI losses associated with diffuse radiation. Pseudo code is provided to aid users in the implementation, and results are shown for PV modules with tilt angles from 0° to 90°. Diffuse AOI losses are greatest for small PV module tilt angles. Including AOI losses associated with the diffuse irradiance will improve predictionsmore » of PV system performance.« less

Effect of drilling fluid systems and temperature on oil mist and vapour levels generated from shale shaker.

PubMed

Steinsvåg, Kjersti; Galea, Karen S; Krüger, Kirsti; Peikli, Vegard; Sánchez-Jiménez, Araceli; Sætvedt, Esther; Searl, Alison; Cherrie, John W; van Tongeren, Martie

2011-05-01

Workers in the drilling section of the offshore petroleum industry are exposed to air pollutants generated by drilling fluids. Oil mist and oil vapour concentrations have been measured in the drilling fluid processing areas for decades; however, little work has been carried out to investigate exposure determinants such as drilling fluid viscosity and temperature. A study was undertaken to investigate the effect of two different oil-based drilling fluid systems and their temperature on oil mist, oil vapour, and total volatile organic compounds (TVOC) levels in a simulated shale shaker room at a purpose-built test centre. Oil mist and oil vapour concentrations were sampled simultaneously using a sampling arrangement consisting of a Millipore closed cassette loaded with glass fibre and cellulose acetate filters attached to a backup charcoal tube. TVOCs were measured by a PhoCheck photo-ionization detector direct reading instrument. Concentrations of oil mist, oil vapour, and TVOC in the atmosphere surrounding the shale shaker were assessed during three separate test periods. Two oil-based drilling fluids, denoted 'System 2.0' and 'System 3.5', containing base oils with a viscosity of 2.0 and 3.3-3.7 mm(2) s(-1) at 40°C, respectively, were used at temperatures ranging from 40 to 75°C. In general, the System 2.0 yielded low oil mist levels, but high oil vapour concentrations, while the opposite was found for the System 3.5. Statistical significant differences between the drilling fluid systems were found for oil mist (P = 0.025),vapour (P < 0.001), and TVOC (P = 0.011). Increasing temperature increased the oil mist, oil vapour, and TVOC levels. Oil vapour levels at the test facility exceeded the Norwegian oil vapour occupational exposure limit (OEL) of 30 mg m(-3) when the drilling fluid temperature was ≥50°C. The practice of testing compliance of oil vapour exposure from drilling fluids systems containing base oils with viscosity of ≤2.0 mm(2) s(-1) at 40�

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Xiong-Zhuo; National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871; Li, Lan-Fen

The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction weremore » obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.« less

Crystallization and preliminary X-ray analysis of a protease inhibitor from the latex of Carica papaya

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid

2006-12-01

The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less

Method of applying a cerium diffusion coating to a metallic alloy

DOEpatents

Jablonski, Paul D [Salem, OR; Alman, David E [Benton, OR

2009-06-30

A method of applying a cerium diffusion coating to a preferred nickel base alloy substrate has been discovered. A cerium oxide paste containing a halide activator is applied to the polished substrate and then dried. The workpiece is heated in a non-oxidizing atmosphere to diffuse cerium into the substrate. After cooling, any remaining cerium oxide is removed. The resulting cerium diffusion coating on the nickel base substrate demonstrates improved resistance to oxidation. Cerium coated alloys are particularly useful as components in a solid oxide fuel cell (SOFC).

Method for measurement of diffusivity: Calorimetric studies of Fe/Ni multilayer thin films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, JX; Barmak, K

2015-07-15

A calorimetric method for the measurement of diffusivity in thin film multilayers is introduced and applied to the Fe Ni system. Using this method, the diffusivity in [Fe (25 nm)/Ni (25 nm)](20) multilayer thin films is measured as 4 x 10(-3)exp(-1.6 +/- 0.1 eV/ k(B)T) cm(2)/s, respectively. The diffusion mechanism in the multilayers and its relevance to laboratory synthesis of L1(0) ordered FeNi are discussed. (C) 2015 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Land cover change and water vapour flows: learning from Australia.

PubMed Central

Gordon, Line; Dunlop, Michael; Foran, Barney

2003-01-01

Australia is faced with large-scale dryland salinization problems, largely as a consequence of the clearing of native vegetation for cropland and grassland. We estimate the change in continental water vapour flow (evapotranspiration) of Australia during the past 200 years. During this period there has been a substantial decrease in woody vegetation and a corresponding increase in croplands and grasslands. The shift in land use has caused a ca. 10% decrease in water vapour flows from the continent. This reduction corresponds to an annual freshwater flow of almost 340 km(3). The society-induced alteration of freshwater flows is estimated at more than 15 times the volume of run-off freshwater that is diverted and actively managed in the Australian society. These substantial water vapour flow alterations were previously not addressed in water management but are now causing serious impacts on the Australian society and local economies. Global and continental freshwater assessments and policy often neglects the interplay between freshwater flows and landscape dynamics. Freshwater issues on both regional and global levels must be rethought and the interplay between terrestrial ecosystems and freshwater better incorporated in freshwater and ecosystem management. PMID:14728792

An asymptotic induced numerical method for the convection-diffusion-reaction equation

NASA Technical Reports Server (NTRS)

Scroggs, Jeffrey S.; Sorensen, Danny C.

1988-01-01

A parallel algorithm for the efficient solution of a time dependent reaction convection diffusion equation with small parameter on the diffusion term is presented. The method is based on a domain decomposition that is dictated by singular perturbation analysis. The analysis is used to determine regions where certain reduced equations may be solved in place of the full equation. Parallelism is evident at two levels. Domain decomposition provides parallelism at the highest level, and within each domain there is ample opportunity to exploit parallelism. Run time results demonstrate the viability of the method.

Review of vortex tube expansion in vapour compression refrigeration system

NASA Astrophysics Data System (ADS)

Liu, Yefeng; Yu, Jun

2018-05-01

A vortex tube expansion device replacing the throttle valve is proposed to improve the efficiency of vapour compression refrigeration cycle by reducing the loss of irreversibility in expansion process. The vortex tube is well-suited for these applications because it is simple, compact, light, quiet. Thus, this paper presents an overview of the thermodynamic analysis of vapour compression refrigeration cycle with vortex tube expansion device using different refrigerants. The paper also reviews the experiments and the calculations presented in previous studies on temperature separation in the vortex tube. The temperature separation mechanism and the flow-field inside the vortex tubes is explored by measuring the pressure, velocity, and temperature fields.

Diffusion archeology for diffusion progression history reconstruction

PubMed Central

Sefer, Emre; Kingsford, Carl

2015-01-01

Diffusion through graphs can be used to model many real-world processes, such as the spread of diseases, social network memes, computer viruses, or water contaminants. Often, a real-world diffusion cannot be directly observed while it is occurring — perhaps it is not noticed until some time has passed, continuous monitoring is too costly, or privacy concerns limit data access. This leads to the need to reconstruct how the present state of the diffusion came to be from partial diffusion data. Here, we tackle the problem of reconstructing a diffusion history from one or more snapshots of the diffusion state. This ability can be invaluable to learn when certain computer nodes are infected or which people are the initial disease spreaders to control future diffusions. We formulate this problem over discrete-time SEIRS-type diffusion models in terms of maximum likelihood. We design methods that are based on submodularity and a novel prize-collecting dominating-set vertex cover (PCDSVC) relaxation that can identify likely diffusion steps with some provable performance guarantees. Our methods are the first to be able to reconstruct complete diffusion histories accurately in real and simulated situations. As a special case, they can also identify the initial spreaders better than the existing methods for that problem. Our results for both meme and contaminant diffusion show that the partial diffusion data problem can be overcome with proper modeling and methods, and that hidden temporal characteristics of diffusion can be predicted from limited data. PMID:27821901

On the relationship between atmospheric water vapour transport and extra-tropical cyclones development

NASA Astrophysics Data System (ADS)

Ferreira, Juan A.; Liberato, Margarida L. R.; Ramos, Alexandre M.

2016-08-01

In this study we seek to investigate the role of atmospheric water vapour on the intensification of extra-tropical cyclones over the North Atlantic Ocean and more specifically to investigate the linkage between atmospheric rivers' conditions leading to the explosive development of extra-tropical cyclones. Several WRF-ARW simulations for three recent extra-tropical storms that had major negative socio-economic impacts in the Iberian Peninsula and south-western Europe (Klaus, 2009; Gong, 2013 and Stephanie, 2014) are performed in which the water vapour content of the initial and boundary conditions are tuned. Analyses of the vertically integrated vapour transport show the dependence of the storms' development on atmospheric water vapour. In addition, results also show changes in the shape of the jet stream resulting in a reduction of the upper wind divergence, which in turn affects the intensification of the extra-tropical cyclones studied. This study suggests that atmospheric rivers tend to favour the conditions for explosive extra-tropical storms' development in the three case studies, as simulations performed without the existence of atmospheric rivers produce shallow mid-latitude cyclones, that is, cyclones that are not so intense as those on the reference simulations.

Tactile objects based on an amplitude disturbed diffraction pattern method

NASA Astrophysics Data System (ADS)

Liu, Yuan; Nikolovski, Jean-Pierre; Mechbal, Nazih; Hafez, Moustapha; Vergé, Michel

2009-12-01

Tactile sensing is becoming widely used in human-computer interfaces. Recent advances in acoustic approaches demonstrated the possibilities to transform ordinary solid objects into interactive interfaces. This letter proposes a static finger contact localization process using an amplitude disturbed diffraction pattern method. The localization method is based on the following physical phenomenon: a finger contact modifies the energy distribution of acoustic wave in a solid; these variations depend on the wave frequency and the contact position. The presented method first consists of exciting the object with an acoustic signal with plural frequency components. In a second step, a measured acoustic signal is compared with prerecorded values to deduce the contact position. This position is then used for human-machine interaction (e.g., finger tracking on computer screen). The selection of excitation signals is discussed and a frequency choice criterion based on contrast value is proposed. Tests on a sandwich plate (liquid crystal display screen) prove the simplicity and easiness to apply the process in various solids.

1-Methoxy-1-silacyclohexane: Synthesis, molecular structure and conformational behavior by gas electron diffraction, Raman spectroscopy and quantum chemical calculations

NASA Astrophysics Data System (ADS)

Shlykov, Sergey A.; Puchkov, Boris V.; Arnason, Ingvar; Wallevik, Sunna Ó.; Giricheva, Nina I.; Girichev, Georgiy V.; Zhabanov, Yuriy A.

2018-02-01

The synthesis and results of gas electron diffraction (GED), temperature-dependent Raman spectroscopy, along with detailed quantum chemical (QC) study of 1-methoxy-1-silacyclohexane 1 are reported. Within the series of the QC results, DFT(B3LYP, PBE0, M06, M062X), and MP2, the conformational preference predictions are rather contradictive. From the both GED and Raman experimental methods applied, the vapour and liquid phases of 1 were found to exist as a mixture of two conformers, gauche-axial and gauche-equatorial, with almost equal contributions, while the trans-forms are much less stable. In addition, theoretical calculations on the cyclohexane analog, methoxycyclohexane 2, are performed in order to compare with the conformational properties of 1. The latter is predicted not to diminish the axial/equatorial ratio, as contrasted to the expectations at switching the point of the substituent attachment from Si to C.

A fast semi-discrete Kansa method to solve the two-dimensional spatiotemporal fractional diffusion equation

NASA Astrophysics Data System (ADS)

Sun, HongGuang; Liu, Xiaoting; Zhang, Yong; Pang, Guofei; Garrard, Rhiannon

2017-09-01

Fractional-order diffusion equations (FDEs) extend classical diffusion equations by quantifying anomalous diffusion frequently observed in heterogeneous media. Real-world diffusion can be multi-dimensional, requiring efficient numerical solvers that can handle long-term memory embedded in mass transport. To address this challenge, a semi-discrete Kansa method is developed to approximate the two-dimensional spatiotemporal FDE, where the Kansa approach first discretizes the FDE, then the Gauss-Jacobi quadrature rule solves the corresponding matrix, and finally the Mittag-Leffler function provides an analytical solution for the resultant time-fractional ordinary differential equation. Numerical experiments are then conducted to check how the accuracy and convergence rate of the numerical solution are affected by the distribution mode and number of spatial discretization nodes. Applications further show that the numerical method can efficiently solve two-dimensional spatiotemporal FDE models with either a continuous or discrete mixing measure. Hence this study provides an efficient and fast computational method for modeling super-diffusive, sub-diffusive, and mixed diffusive processes in large, two-dimensional domains with irregular shapes.

Viewing-zone enlargement method for sampled hologram that uses high-order diffraction.

PubMed

Mishina, Tomoyuki; Okui, Makoto; Okano, Fumio

2002-03-10

We demonstrate a method of enlarging the viewing zone for holography that has holograms with a pixel structure. First, aliasing generated by the sampling of a hologram by pixel is described. Next the high-order diffracted beams reproduced from the hologram that contains aliasing are explained. Finally, we show that the viewing zone can be enlarged by combining these high-order reconstructed beams from the hologram with aliasing.

Expression, purification, crystallization and preliminary X-ray crystallographic data from TktA, a transketolase from the lactic acid bacterium Lactobacillus salivarius

PubMed Central

Horsham, Matt; Saxby, Harriet; Blake, James; Isaacs, Neil W.; Mitchell, Tim J.; Riboldi-Tunnicliffe, Alan

2010-01-01

The enzyme transketolase from the lactic acid bacterium Lactobacillus salivarius (subsp. salivarius UCC118) has been recombinantly expressed and purified using an Escherichia coli expression system. Purified transketolase from L. salivarius has been crystallized using the vapour-diffusion technique. The crystals belonged to the trigonal space group P3221, with unit-cell parameters a = b = 75.43, c = 184.11 Å, and showed diffraction to 2.3 Å resolution. PMID:20693662

Hybrid Monte Carlo-Diffusion Method For Light Propagation in Tissue With a Low-Scattering Region

NASA Astrophysics Data System (ADS)

Hayashi, Toshiyuki; Kashio, Yoshihiko; Okada, Eiji

2003-06-01

The heterogeneity of the tissues in a head, especially the low-scattering cerebrospinal fluid (CSF) layer surrounding the brain has previously been shown to strongly affect light propagation in the brain. The radiosity-diffusion method, in which the light propagation in the CSF layer is assumed to obey the radiosity theory, has been employed to predict the light propagation in head models. Although the CSF layer is assumed to be a nonscattering region in the radiosity-diffusion method, fine arachnoid trabeculae cause faint scattering in the CSF layer in real heads. A novel approach, the hybrid Monte Carlo-diffusion method, is proposed to calculate the head models, including the low-scattering region in which the light propagation does not obey neither the diffusion approximation nor the radiosity theory. The light propagation in the high-scattering region is calculated by means of the diffusion approximation solved by the finite-element method and that in the low-scattering region is predicted by the Monte Carlo method. The intensity and mean time of flight of the detected light for the head model with a low-scattering CSF layer calculated by the hybrid method agreed well with those by the Monte Carlo method, whereas the results calculated by means of the diffusion approximation included considerable error caused by the effect of the CSF layer. In the hybrid method, the time-consuming Monte Carlo calculation is employed only for the thin CSF layer, and hence, the computation time of the hybrid method is dramatically shorter than that of the Monte Carlo method.

Hybrid Monte Carlo-diffusion method for light propagation in tissue with a low-scattering region.

PubMed

Hayashi, Toshiyuki; Kashio, Yoshihiko; Okada, Eiji

2003-06-01

The heterogeneity of the tissues in a head, especially the low-scattering cerebrospinal fluid (CSF) layer surrounding the brain has previously been shown to strongly affect light propagation in the brain. The radiosity-diffusion method, in which the light propagation in the CSF layer is assumed to obey the radiosity theory, has been employed to predict the light propagation in head models. Although the CSF layer is assumed to be a nonscattering region in the radiosity-diffusion method, fine arachnoid trabeculae cause faint scattering in the CSF layer in real heads. A novel approach, the hybrid Monte Carlo-diffusion method, is proposed to calculate the head models, including the low-scattering region in which the light propagation does not obey neither the diffusion approximation nor the radiosity theory. The light propagation in the high-scattering region is calculated by means of the diffusion approximation solved by the finite-element method and that in the low-scattering region is predicted by the Monte Carlo method. The intensity and mean time of flight of the detected light for the head model with a low-scattering CSF layer calculated by the hybrid method agreed well with those by the Monte Carlo method, whereas the results calculated by means of the diffusion approximation included considerable error caused by the effect of the CSF layer. In the hybrid method, the time-consuming Monte Carlo calculation is employed only for the thin CSF layer, and hence, the computation time of the hybrid method is dramatically shorter than that of the Monte Carlo method.

Sticking non-stick: Surface and Structure control of Diamond-like Carbon in Plasma Enhanced Chemical Vapour Deposition

NASA Astrophysics Data System (ADS)

Jones, B. J.; Nelson, N.

2016-10-01

This short review article explores the practical use of diamond-like carbon (DLC) produced by plasma enhanced chemical vapour deposition (PECVD). Using as an example issues relating to the DLC coating of a hand-held surgical device, we draw on previous works using atomic force microscopy, X-ray photoelectron spectroscopy, Raman spectroscopy, scanning electron microscopy, tensiometry and electron paramagnetic resonance. Utilising data from these techniques, we examine the surface structure, substrate-film interface and thin film microstructure, such as sp2/sp3 ratio (graphitic/diamond-like bonding ratio) and sp2 clustering. We explore the variations in parameters describing these characteristics, and relate these to the final device properties such as friction, wear resistance, and diffusion barrier integrity. The material and device characteristics are linked to the initial plasma and substrate conditions.

Method and apparatus for determining minority carrier diffusion length in semiconductors

DOEpatents

Goldstein, Bernard; Dresner, Joseph; Szostak, Daniel J.

1983-07-12

Method and apparatus are provided for determining the diffusion length of minority carriers in semiconductor material, particularly amorphous silicon which has a significantly small minority carrier diffusion length using the constant-magnitude surface-photovoltage (SPV) method. An unmodulated illumination provides the light excitation on the surface of the material to generate the SPV. A manually controlled or automatic servo system maintains a constant predetermined value of the SPV. A vibrating Kelvin method-type probe electrode couples the SPV to a measurement system. The operating optical wavelength of an adjustable monochromator to compensate for the wavelength dependent sensitivity of a photodetector is selected to measure the illumination intensity (photon flux) on the silicon. Measurements of the relative photon flux for a plurality of wavelengths are plotted against the reciprocal of the optical absorption coefficient of the material. A linear plot of the data points is extrapolated to zero intensity. The negative intercept value on the reciprocal optical coefficient axis of the extrapolated linear plot is the diffusion length of the minority carriers.

New Quantum Diffusion Monte Carlo Method for strong field time dependent problems

NASA Astrophysics Data System (ADS)

Kalinski, Matt

2017-04-01

We have recently formulated the Quantum Diffusion Quantum Monte Carlo (QDMC) method for the solution of the time-dependent Schrödinger equation when it is equivalent to the reaction-diffusion system coupled by the highly nonlinear potentials of the type of Shay. Here we formulate a new Time Dependent QDMC method free of the nonlinearities described by the constant stochastic process of the coupled diffusion with transmutation. As before two kinds of diffusing particles (color walkers) are considered but which can further also transmute one into the other. Each of the species undergoes the hypothetical Einstein random walk progression with transmutation. The progressed particles transmute into the particles of the other kind before contributing to or annihilating the other particles density. This fully emulates the Time Dependent Schrödinger equation for any number of quantum particles. The negative sign of the real and the imaginary parts of the wave function is handled by the ``spinor'' densities carrying the sign as the degree of freedom. We apply the method for the exact time-dependent observation of our discovered two-electron Langmuir configurations in the magnetic and circularly polarized fields.

Method of independently operating a group of stages within a diffusion cascade

DOEpatents

Benedict, Manson; Fruit, Allen J.; Levey, Horace B.

1976-06-08

1. A method of operating a group of the diffusion stages of a productive diffusion cascade with countercurrent flow, said group comprising a top and a bottom stage, which comprises isolating said group from said cascade, circulating the diffused gas produced in said top stage to the feed of said bottom stage while at the same time circulating the undiffused gas from said bottom stage to the feed of said top stage whereby major changes in

Anomalous fast diffusion in Cu-NiFe nanolaminates.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jankowski, Alan F.

2017-09-01

For this work, the decomposition of the one-dimensional composition wave in Cu-NiFe nanolaminate structures is examined using x-ray diffraction to assess the kinetics of phase decomposition. The anomalously high diffusivity value found for long-term aging at room temperature is attributed to the inherent nanostructure that features paths for short-circuit diffusion in nanolaminates as attributed to interlayer grain boundaries.

Note on coefficient matrices from stochastic Galerkin methods for random diffusion equations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou Tao, E-mail: tzhou@lsec.cc.ac.c; Tang Tao, E-mail: ttang@hkbu.edu.h

2010-11-01

In a recent work by Xiu and Shen [D. Xiu, J. Shen, Efficient stochastic Galerkin methods for random diffusion equations, J. Comput. Phys. 228 (2009) 266-281], the Galerkin methods are used to solve stochastic diffusion equations in random media, where some properties for the coefficient matrix of the resulting system are provided. They also posed an open question on the properties of the coefficient matrix. In this work, we will provide some results related to the open question.

Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

2010-11-12

Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

Method for Measurement of Multi-Degrees-of-Freedom Motion Parameters Based on Polydimethylsiloxane Cross-Coupling Diffraction Gratings.

PubMed

Duan, Junping; Zhu, Qiang; Qian, Kun; Guo, Hao; Zhang, Binzhen

2017-08-30

This work presents a multi-degrees-of-freedom motion parameter measurement method based on the use of cross-coupling diffraction gratings that were prepared on the two sides of a polydimethylsiloxane (PDMS) substrate using oxygen plasma processing technology. The laser beam that travels pass the cross-coupling optical grating would be diffracted into a two-dimensional spot array. The displacement and the gap size of the spot-array were functions of the movement of the laser source, as explained by the Fraunhofer diffraction effect. A 480 × 640 pixel charge-coupled device (CCD) was used to acquire images of the two-dimensional spot-array in real time. A proposed algorithm was then used to obtain the motion parameters. Using this method and the CCD described above, the resolutions of the displacement and the deflection angle were 0.18 μm and 0.0075 rad, respectively. Additionally, a CCD with a higher pixel count could improve the resolutions of the displacement and the deflection angle to sub-nanometer and micro-radian scales, respectively. Finally, the dynamic positions of hovering rotorcraft have been tracked and checked using the proposed method, which can be used to correct the craft's position and provide a method for aircraft stabilization in the sky.

Method for Measurement of Multi-Degrees-of-Freedom Motion Parameters Based on Polydimethylsiloxane Cross-Coupling Diffraction Gratings

NASA Astrophysics Data System (ADS)

Duan, Junping; Zhu, Qiang; Qian, Kun; Guo, Hao; Zhang, Binzhen

2017-08-01

This work presents a multi-degrees-of-freedom motion parameter measurement method based on the use of cross-coupling diffraction gratings that were prepared on the two sides of a polydimethylsiloxane (PDMS) substrate using oxygen plasma processing technology. The laser beam that travels pass the cross-coupling optical grating would be diffracted into a two-dimensional spot array. The displacement and the gap size of the spot-array were functions of the movement of the laser source, as explained by the Fraunhofer diffraction effect. A 480 × 640 pixel charge-coupled device (CCD) was used to acquire images of the two-dimensional spot-array in real time. A proposed algorithm was then used to obtain the motion parameters. Using this method and the CCD described above, the resolutions of the displacement and the deflection angle were 0.18 μm and 0.0075 rad, respectively. Additionally, a CCD with a higher pixel count could improve the resolutions of the displacement and the deflection angle to sub-nanometer and micro-radian scales, respectively. Finally, the dynamic positions of hovering rotorcraft have been tracked and checked using the proposed method, which can be used to correct the craft's position and provide a method for aircraft stabilization in the sky.

Evaluating the virucidal efficacy of hydrogen peroxide vapour.

PubMed

Goyal, S M; Chander, Y; Yezli, S; Otter, J A

2014-04-01

Surface contamination has been implicated in the transmission of certain viruses, and surface disinfection can be an effective measure to interrupt the spread of these agents. To evaluate the in-vitro efficacy of hydrogen peroxide vapour (HPV), a vapour-phase disinfection method, for the inactivation of a number of structurally distinct viruses of importance in the healthcare, veterinary and public sectors. The viruses studied were: feline calicivirus (FCV, a norovirus surrogate); human adenovirus type 1; transmissible gastroenteritis coronavirus of pigs (TGEV, a severe acute respiratory syndrome coronavirus [SARS-CoV] surrogate); avian influenza virus (AIV); and swine influenza virus (SwIV). The viruses were dried on stainless steel discs in 20- or 40-μL aliquots and exposed to HPV produced by a Clarus L generator (Bioquell, Horsham, PA, USA) in a 0.2-m(3) environmental chamber. Three vaporized volumes of hydrogen peroxide were tested in triplicate for each virus: 25, 27 and 33 mL. No viable viruses were identified after HPV exposure at any of the vaporized volumes tested. HPV was virucidal (>4-log reduction) against FCV, adenovirus, TGEV and AIV at the lowest vaporized volume tested (25 mL). For SwIV, due to low virus titre on the control discs, >3.8-log reduction was shown for the 25-mL vaporized volume and >4-log reduction was shown for the 27-mL and 33-mL vaporized volumes. HPV was virucidal for structurally distinct viruses dried on surfaces, suggesting that HPV can be considered for the disinfection of virus-contaminated surfaces. Copyright © 2014 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Purification, crystallization and preliminary X-ray analysis of the glucosamine-6-phosphate N-acetyltransferase from human liver

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Juan; Zhou, Yan-Feng; Li, Lan-Fen

2006-11-01

Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P4{sub 1}2{sub 1}2more » or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 50.08, c = 142.88 Å.« less

Crystallization and preliminary X-ray analysis of ginkbilobin-2 from Ginkgo biloba seeds: a novel antifungal protein with homology to the extracellular domain of plant cysteine-rich receptor-like kinases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyakawa, Takuya; Sawano, Yoriko; Miyazono, Ken-ichi

Purification and crystallization of ginkbilobin-2 and its selenomethionine derivative allowed the collection of complete data to 2.38 Å resolution and multiwavelength anomalous diffraction data sets, respectively. The antifungal protein ginkbilobin-2 (Gnk2) from Ginkgo biloba seeds does not show homology to other pathogenesis-related proteins, but does show homology to the extracellular domain of plant cysteine-rich receptor-like kinases. Native Gnk2 purified from ginkgo nuts and the selenomethionine derivative of recombinant Gnk2 (SeMet-rGnk2) were crystallized by the sitting-drop vapour-diffusion method using different precipitants. X-ray diffraction data were collected from Gnk2 at 2.38 Å resolution and from SeMet-rGnk2 at 2.79 Å resolution using amore » synchrotron-radiation source. The crystals of both proteins belonged to the primitive cubic space group P2{sub 1}3, with unit-cell parameters a = b = c = 143.2 Å.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aravind, Penmatsa; Rajini, Bheemreddy; Sharma, Yogendra

The crystallization and preliminary X-ray diffraction analysis of AIM1g1, a βγ-crystallin domain of absent in melanoma (AIM1) protein from H. sapiens, is reported. AIM1g1 is a single βγ-crystallin domain from the protein absent in melanoma 1 (AIM1), which appears to play a role in the suppression of melanomas. This domain is known to bind calcium and its structure would help in identifying calcium-coordinating sites in vertebrate crystallins, which have hitherto been believed to have lost this ability during evolution. Crystallization of this domain was performed by the hanging-drop vapour-diffusion method. Crystals diffracted to a maximum resolution of 1.86 Å andmore » were found to belong to space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 54.98, c = 59.73 Å. Solvent-content analysis indicated the presence of one monomer per asymmetric unit.« less

Crystallization and preliminary crystallographic study of the yeast Malassezia sympodialis allergen Mala s 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vilhelmsson, Monica, E-mail: monica.vilhelmsson@medks.ki.se; Center for Infectious Medicine, Department of Medicine, Karolinska University Hospital, Huddinge, Stockholm; Hallberg, B. Martin

2006-02-01

Crystals of the M. sympodialis allergen Mala s 1 have been obtained using the hanging-drop vapour-diffusion method. A diffraction data set has been collected from native crystals to 1.35 Å resolution. The opportunistic yeast Malassezia sympodialis can act as an allergen and elicit specific IgE- and T-cell reactivity in patients with atopic eczema. The first identified major allergen from M. sympodialis, Mala s 1, is present on the cell surface of the yeast. Recombinant Mala s 1 was expressed in Escherichia coli, purified and refolded in a soluble form. Crystals of Mala s 1 were obtained in 25% PEG 8K,more » 0.2 M (NH{sub 4}){sub 2}SO{sub 4}. Crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 44.4, b = 163.7, c = 50.6 Å, and diffract to 1.35 Å resolution.« less

Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

2005-11-01

The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

A simplified counter diffusion method combined with a 1D simulation program for optimizing crystallization conditions.

PubMed

Tanaka, Hiroaki; Inaka, Koji; Sugiyama, Shigeru; Takahashi, Sachiko; Sano, Satoshi; Sato, Masaru; Yoshitomi, Susumu

2004-01-01

We developed a new protein crystallization method has been developed using a simplified counter-diffusion method for optimizing crystallization condition. It is composed of only a single capillary, the gel in the silicon tube and the screw-top test tube, which are readily available in the laboratory. The one capillary can continuously scan a wide range of crystallization conditions (combination of the concentrations of the precipitant and the protein) unless crystallization occurs, which means that it corresponds to many drops in the vapor-diffusion method. The amount of the precipitant and the protein solutions can be much less than in conventional methods. In this study, lysozyme and alpha-amylase were used as model proteins for demonstrating the efficiency of this method. In addition, one-dimensional (1-D) simulations of the crystal growth were performed based on the 1-D diffusion model. The optimized conditions can be applied to the initial crystallization conditions for both other counter-diffusion methods with the Granada Crystallization Box (GCB) and for the vapor-diffusion method after some modification.

Dislocations limited electronic transport in hydride vapour phase epitaxy grown GaN templates: A word of caution for the epitaxial growers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chatterjee, Abhishek, E-mail: cabhishek@rrcat.gov.in; Khamari, Shailesh K.; Kumar, R.

2015-01-12

GaN templates grown by hydride vapour phase epitaxy (HVPE) and metal organic vapour phase epitaxy (MOVPE) techniques are compared through electronic transport measurements. Carrier concentration measured by Hall technique is about two orders larger than the values estimated by capacitance voltage method for HVPE templates. It is learnt that there exists a critical thickness of HVPE templates below which the transport properties of epitaxial layers grown on top of them are going to be severely limited by the density of charged dislocations lying at layer-substrate interface. On the contrary MOVPE grown templates are found to be free from such limitations.

Evaluation of the direct and diffusion methods for the determination of fluoride content in table salt

PubMed Central

Martínez-Mier, E. Angeles; Soto-Rojas, Armando E.; Buckley, Christine M.; Margineda, Jorge; Zero, Domenick T.

2010-01-01

Objective The aim of this study was to assess methods currently used for analyzing fluoridated salt in order to identify the most useful method for this type of analysis. Basic research design Seventy-five fluoridated salt samples were obtained. Samples were analyzed for fluoride content, with and without pretreatment, using direct and diffusion methods. Element analysis was also conducted in selected samples. Fluoride was added to ultra pure NaCl and non-fluoridated commercial salt samples and Ca and Mg were added to fluoride samples in order to assess fluoride recoveries using modifications to the methods. Results Larger amounts of fluoride were found and recovered using diffusion than direct methods (96%–100% for diffusion vs. 67%–90% for direct). Statistically significant differences were obtained between direct and diffusion methods using different ion strength adjusters. Pretreatment methods reduced the amount of recovered fluoride. Determination of fluoride content was influenced both by the presence of NaCl and other ions in the salt. Conclusion Direct and diffusion techniques for analysis of fluoridated salt are suitable methods for fluoride analysis. The choice of method should depend on the purpose of the analysis. PMID:20088217

Principles of assessing bacterial susceptibility to antibiotics using the agar diffusion method.

PubMed

Bonev, Boyan; Hooper, James; Parisot, Judicaël

2008-06-01

The agar diffusion assay is one method for quantifying the ability of antibiotics to inhibit bacterial growth. Interpretation of results from this assay relies on model-dependent analysis, which is based on the assumption that antibiotics diffuse freely in the solid nutrient medium. In many cases, this assumption may be incorrect, which leads to significant deviations of the predicted behaviour from the experiment and to inaccurate assessment of bacterial susceptibility to antibiotics. We sought a theoretical description of the agar diffusion assay that takes into consideration loss of antibiotic during diffusion and provides higher accuracy of the MIC determined from the assay. We propose a new theoretical framework for analysis of agar diffusion assays. MIC was determined by this technique for a number of antibiotics and analysis was carried out using both the existing free diffusion and the new dissipative diffusion models. A theory for analysis of antibiotic diffusion in solid media is described, in which we consider possible interactions of the test antibiotic with the solid medium or partial antibiotic inactivation during diffusion. This is particularly relevant to the analysis of diffusion of hydrophobic or amphipathic compounds. The model is based on a generalized diffusion equation, which includes the existing theory as a special case and contains an additional, dissipative term. Analysis of agar diffusion experiments using the new model allows significantly more accurate interpretation of experimental results and determination of MICs. The model has more general validity and is applicable to analysis of other dissipative processes, for example to antigen diffusion and to calculations of substrate load in affinity purification.

A collisional-radiative model of iron vapour in a thermal arc plasma

NASA Astrophysics Data System (ADS)

Baeva, M.; Uhrlandt, D.; Murphy, A. B.

2017-06-01

A collisional-radiative model for the ground state and fifty effective excited levels of atomic iron, and one level for singly-ionized iron, is set up for technological plasmas. Attention is focused on the population of excited states of atomic iron as a result of excitation, de-excitation, ionization, recombination and spontaneous emission. Effective rate coefficients for ionization and recombination, required in non-equilibrium plasma transport models, are also obtained. The collisional-radiative model is applied to a thermal arc plasma. Input parameters for the collisional-radiative model are provided by a magnetohydrodynamic simulation of a gas-metal welding arc, in which local thermodynamic equilibrium is assumed and the treatment of the transport of metal vapour is based on combined diffusion coefficients. The results clearly identify the conditions in the arc, under which the atomic state distribution satisfies the Boltzmann distribution, with an excitation temperature equal to the plasma temperature. These conditions are met in the central part of the arc, even though a local temperature minimum occurs here. This provides assurance that diagnostic methods based on local thermodynamic equilibrium, in particular those of optical emission spectroscopy, are reliable here. In contrast, deviations from the equilibrium atomic-state distribution are obtained in the near-electrode and arc fringe regions. As a consequence, the temperatures determined from the ratio of line intensities and number densities obtained from the emission coefficient in these regions are questionable. In this situation, the collisional-radiative model can be used as a diagnostic tool to assist in the interpretation of spectroscopic measurements.

Distillation with Vapour Compression. An Undergraduate Experimental Facility.

ERIC Educational Resources Information Center

Pritchard, Colin

1986-01-01

Discusses the need to design distillation columns that are more energy efficient. Describes a "design and build" project completed by two college students aimed at demonstrating the principles of vapour compression distillation in a more energy efficient way. General design specifications are given, along with suggestions for teaching…

Multilayer dielectric diffraction gratings

DOEpatents

Perry, Michael D.; Britten, Jerald A.; Nguyen, Hoang T.; Boyd, Robert; Shore, Bruce W.

1999-01-01

The design and fabrication of dielectric grating structures with high diffraction efficiency used in reflection or transmission is described. By forming a multilayer structure of alternating index dielectric materials and placing a grating structure on top of the multilayer, a diffraction grating of adjustable efficiency, and variable optical bandwidth can be obtained. Diffraction efficiency into the first order in reflection varying between 1 and 98 percent has been achieved by controlling the design of the multilayer and the depth, shape, and material comprising the grooves of the grating structure. Methods for fabricating these gratings without the use of ion etching techniques are described.

Method for Calculating the Optical Diffuse Reflection Coefficient for the Ocular Fundus

NASA Astrophysics Data System (ADS)

Lisenko, S. A.; Kugeiko, M. M.

2016-07-01

We have developed a method for calculating the optical diffuse reflection coefficient for the ocular fundus, taking into account multiple scattering of light in its layers (retina, epithelium, choroid) and multiple refl ection of light between layers. The method is based on the formulas for optical "combination" of the layers of the medium, in which the optical parameters of the layers (absorption and scattering coefficients) are replaced by some effective values, different for cases of directional and diffuse illumination of the layer. Coefficients relating the effective optical parameters of the layers and the actual values were established based on the results of a Monte Carlo numerical simulation of radiation transport in the medium. We estimate the uncertainties in retrieval of the structural and morphological parameters for the fundus from its diffuse reflectance spectrum using our method. We show that the simulated spectra correspond to the experimental data and that the estimates of the fundus parameters obtained as a result of solving the inverse problem are reasonable.

A method of online quantitative interpretation of diffuse reflection profiles of biological tissues

NASA Astrophysics Data System (ADS)

Lisenko, S. A.; Kugeiko, M. M.

2013-02-01

We have developed a method of combined interpretation of spectral and spatial characteristics of diffuse reflection of biological tissues, which makes it possible to determine biophysical parameters of the tissue with a high accuracy in real time under conditions of their general variability. Using the Monte Carlo method, we have modeled a statistical ensemble of profiles of diffuse reflection coefficients of skin, which corresponds to a wave variation of its biophysical parameters. On its basis, we have estimated the retrieval accuracy of biophysical parameters using the developed method and investigated the stability of the method to errors of optical measurements. We have showed that it is possible to determine online the concentrations of melanin, hemoglobin, bilirubin, oxygen saturation of blood, and structural parameters of skin from measurements of its diffuse reflection in the spectral range 450-800 nm at three distances between the radiation source and detector.

A method for optimizing the cosine response of solar UV diffusers

NASA Astrophysics Data System (ADS)

Pulli, Tomi; Kärhä, Petri; Ikonen, Erkki

2013-07-01

Instruments measuring global solar ultraviolet (UV) irradiance at the surface of the Earth need to collect radiation from the entire hemisphere. Entrance optics with angular response as close as possible to the ideal cosine response are necessary to perform these measurements accurately. Typically, the cosine response is obtained using a transmitting diffuser. We have developed an efficient method based on a Monte Carlo algorithm to simulate radiation transport in the solar UV diffuser assembly. The algorithm takes into account propagation, absorption, and scattering of the radiation inside the diffuser material. The effects of the inner sidewalls of the diffuser housing, the shadow ring, and the protective weather dome are also accounted for. The software implementation of the algorithm is highly optimized: a simulation of 109 photons takes approximately 10 to 15 min to complete on a typical high-end PC. The results of the simulations agree well with the measured angular responses, indicating that the algorithm can be used to guide the diffuser design process. Cost savings can be obtained when simulations are carried out before diffuser fabrication as compared to a purely trial-and-error-based diffuser optimization. The algorithm was used to optimize two types of detectors, one with a planar diffuser and the other with a spherically shaped diffuser. The integrated cosine errors—which indicate the relative measurement error caused by the nonideal angular response under isotropic sky radiance—of these two detectors were calculated to be f2=1.4% and 0.66%, respectively.

An advanced expiratory circuit for the recovery of perfluorocarbon liquid from non-saturated perfluorocarbon vapour during partial liquid ventilation: an experimental model

PubMed Central

Dunster, Kimble R; Davies, Mark W; Fraser, John F

2006-01-01

Background The loss of perfluorocarbon (PFC) vapour in the expired gases during partial liquid ventilation should be minimized both to prevent perfluorocarbon vapour entering the atmosphere and to re-use the recovered PFC liquid. Using a substantially modified design of our previously described condenser, we aimed to determine how much perfluorocarbon liquid could be recovered from gases containing PFC and water vapour, at concentrations found during partial liquid ventilation, and to determine if the amount recovered differed with background flow rate (at flow rates suitable for use in neonates). Methods The expiratory line of a standard ventilator circuit set-up was mimicked, with the addition of two condensers. Perfluorocarbon (30 mL of FC-77) and water vapour, at concentrations found during partial liquid ventilation, were passed through the circuit at a number of flow rates and the percentage recovery of the liquids measured. Results From 14.2 mL (47%) to 27.3 mL (91%) of the infused 30 mL of FC-77 was recovered at the flow rates studied. Significantly higher FC-77 recovery was obtained at lower flow rates (ANOVA with Bonferroni's multiple comparison test, p < 0.0001). As a percentage of the theoretical maximum recovery, 64 to 95% of the FC-77 was recovered. Statistically significantly less FC-77 was recovered at 5 Lmin-1 (ANOVA with Bonferroni's multiple comparison test, p < 0.0001). Amounts of perfluorocarbon vapour recovered were 47%, 50%, 81% and 91% at flow rates of 10, 5, 2 and 1 Lmin-1, respectively. Conclusion Using two condensers in series 47% to 91% of perfluorocarbon liquid can be recovered, from gases containing perfluorocarbon and water vapour, at concentrations found during partial liquid ventilation. PMID:16457722

The effect of heat treatment on structural and electronic properties of niobium nitride prepared by a thermal diffusion method

DOE PAGES

Farha, Ashraf Hassan; Ozkendir, Osman Murat; Elsayed-Ali, Hani E.; ...

2016-11-15

NbN coatings are prepared onto Nb substrate by thermal diffusion at high temperatures. The formation of NbN coating by thermal diffusion was studied in the range of 1250-1500 °C at constant nitrogen background gas pressure (1.3x10 -3 Pa) and processing time (180 min). The electronic and crystal structures of the NbN coatings were investigated. It was found that nitrogen diffuses into Nb forming the Nb-N solid solution (bcc) a-NbN phase that starts to appear above 1250 °C. Increasing the processing temperature gives richer a-phase concentration. Besides, X-ray absorption spectroscopy (XAS) was performed to study the electronic structure of the NbNmore » layer. The results of the electronic structural study corroborate the crystal structural analysis. The Nb M 3,2 edge X-ray absorption spectroscopy (XAS) spectrum shows strong temperature dependence. At the highest processing temperature (1500 °C), the number of d holes increased. Nitrogen diffusion into Nb is resulting to increase electrostatic interaction between d electron and core hole. Lastly, for the studied conditions, only the α-NbN was observed in the X-ray diffraction patterns.« less

The effect of heat treatment on structural and electronic properties of niobium nitride prepared by a thermal diffusion method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Farha, Ashraf Hassan; Ozkendir, Osman Murat; Elsayed-Ali, Hani E.

NbN coatings are prepared onto Nb substrate by thermal diffusion at high temperatures. The formation of NbN coating by thermal diffusion was studied in the range of 1250-1500 °C at constant nitrogen background gas pressure (1.3x10 -3 Pa) and processing time (180 min). The electronic and crystal structures of the NbN coatings were investigated. It was found that nitrogen diffuses into Nb forming the Nb-N solid solution (bcc) a-NbN phase that starts to appear above 1250 °C. Increasing the processing temperature gives richer a-phase concentration. Besides, X-ray absorption spectroscopy (XAS) was performed to study the electronic structure of the NbNmore » layer. The results of the electronic structural study corroborate the crystal structural analysis. The Nb M 3,2 edge X-ray absorption spectroscopy (XAS) spectrum shows strong temperature dependence. At the highest processing temperature (1500 °C), the number of d holes increased. Nitrogen diffusion into Nb is resulting to increase electrostatic interaction between d electron and core hole. Lastly, for the studied conditions, only the α-NbN was observed in the X-ray diffraction patterns.« less

High efficiency coherent optical memory with warm rubidium vapour

PubMed Central

Hosseini, M.; Sparkes, B.M.; Campbell, G.; Lam, P.K.; Buchler, B.C.

2011-01-01

By harnessing aspects of quantum mechanics, communication and information processing could be radically transformed. Promising forms of quantum information technology include optical quantum cryptographic systems and computing using photons for quantum logic operations. As with current information processing systems, some form of memory will be required. Quantum repeaters, which are required for long distance quantum key distribution, require quantum optical memory as do deterministic logic gates for optical quantum computing. Here, we present results from a coherent optical memory based on warm rubidium vapour and show 87% efficient recall of light pulses, the highest efficiency measured to date for any coherent optical memory suitable for quantum information applications. We also show storage and recall of up to 20 pulses from our system. These results show that simple warm atomic vapour systems have clear potential as a platform for quantum memory. PMID:21285952

High efficiency coherent optical memory with warm rubidium vapour.

PubMed

Hosseini, M; Sparkes, B M; Campbell, G; Lam, P K; Buchler, B C

2011-02-01

By harnessing aspects of quantum mechanics, communication and information processing could be radically transformed. Promising forms of quantum information technology include optical quantum cryptographic systems and computing using photons for quantum logic operations. As with current information processing systems, some form of memory will be required. Quantum repeaters, which are required for long distance quantum key distribution, require quantum optical memory as do deterministic logic gates for optical quantum computing. Here, we present results from a coherent optical memory based on warm rubidium vapour and show 87% efficient recall of light pulses, the highest efficiency measured to date for any coherent optical memory suitable for quantum information applications. We also show storage and recall of up to 20 pulses from our system. These results show that simple warm atomic vapour systems have clear potential as a platform for quantum memory.

Wideband Scattering Diffusion by using Diffraction of Periodic Surfaces and Optimized Unit Cell Geometries

PubMed Central

Costa, Filippo; Monorchio, Agostino; Manara, Giuliano

2016-01-01