Sample records for vapour-diffusion method diffraction

  1. Crystallization and preliminary X-ray diffraction study of thermostable RNase HIII from Bacillus stearothermophilus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chon, Hyongi; Matsumura, Hiroyoshi; Koga, Yuichi

    2005-03-01

    A thermostable ribonuclease HIII from B. stearothermophilus (Bst RNase HIII) was crystallized and preliminary crystallographic studies were performed. Plate-like overlapping polycrystals were grown by the sitting-drop vapour-diffusion method at 283 K.

  2. Expression, purification and crystallization of a human protein SH3BGRL at atomic resolution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yin, Lei; Zhu, De-Yu; Yang, Na

    2005-04-01

    The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The crystals diffract to 0.88 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 28.8886, b = 34.9676, c = 98.0016 Å. Preliminary analysis indicates that the asymmetric unit contains one molecule and has a solvent content of about 34%.

  3. Crystallization and preliminary X-ray diffraction studies of NP24-I, an isoform of a thaumatin-like protein from ripe tomato fruits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghosh, Raka; Chakrabarti, Chandana, E-mail: chandana.chakrabarti@saha.ac.in

    2005-08-01

    A thaumatin-like antifungal protein, NP24-I, has been isolated from ripe tomato fruits. It was crystallized by the vapour-diffusion method and data were collected to 2.45 Å. The structure was solved by molecular replacement. NP24 is a 24 kDa (207-amino-acid) antifungal thaumatin-like protein (TLP) found in tomato fruits. An isoform of the protein, NP24-I, is reported to play a possible role in ripening of the fruit in addition to its antifungal properties. The protein has been isolated and purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the tetragonal space group P4{sub 3}, with unit-cell parameters a =more » b = 61.01, c = 62.90 Å and one molecule per asymmetric unit. X-ray diffraction data were processed to a resolution of 2.45 Å and the structure was solved by molecular replacement.« less

  4. Crystallization and initial X-ray analysis of polyhydroxyalkanoate granule-associated protein from Aeromonas hydrophila

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Minglian; Li, Zhenguo; Zheng, Wei

    The phasin PhaP{sub Ah} from A. hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Polyhydroxyalkanoate (PHA) granule-associated proteins (phasins) were discovered in PHA-accumulating bacteria. They play a crucial role as a structural protein during initial PHA-granule formation and granule growth and also serve as interfaces for granule stabilization in vivo. The phasin PhaP{sub Ah} from Aeromonas hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Single crystals were cryocooled for X-ray diffraction analysis. The phasin crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 80.8, b = 108.9, c = 134.4 Å.

  5. Crystallization and preliminary crystallographic analysis of the catechol 2,3-dioxygenase PheB from Bacillus stearothermophilus BR219

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki

    2006-02-01

    PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less

  6. Improved expression, purification and crystallization of a putative N-acetyl-γ-glutamyl-phosphate reductase from rice (Oryza sativa)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miura-Ohnuma, Jun; Nonaka, Tsuyoshi; Katoh, Shizue

    2005-12-01

    Crystals of OsAGPR were obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å. N-Acetyl-γ-glutamyl-phosphate reductase (AGPR) catalyzes the third step in an eight-step arginine-biosynthetic pathway that starts with glutamate. This enzyme converts N-acetyl-γ-glutamyl phosphate to N-acetylglutamate-γ-semialdehyde by an NADPH-dependent reductive dephosphorylation. AGPR from Oryza sativa (OsAGPR) was expressed in Escherichia coli at 291 K as a soluble fusion protein with an upstream thioredoxin-hexahistidine [Trx-(His){sub 6}] extension. OsAGPR(Ala50–Pro366) was purified and crystals weremore » obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å.« less

  7. Crystallization and preliminary X-ray diffraction studies of choline-binding protein F from Streptococcus pneumoniae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Molina, Rafael; González, Ana; Moscoso, Miriam

    2007-09-01

    The modular choline-binding protein F (CbpF) from S. pneumoniae has been crystallized by the hanging-drop vapour-diffusion method. A SAD data set from a gadolinium-complex derivative has been collected to 2.1 Å resolution. Choline-binding protein F (CbpF) is a modular protein that is bound to the pneumococcal cell wall through noncovalent interactions with choline moieties of the bacterial teichoic and lipoteichoic acids. Despite being one of the more abundant proteins on the surface, along with the murein hydrolases LytA, LytB, LytC and Pce, its function is still unknown. CbpF has been crystallized using the hanging-drop vapour-diffusion method at 291 K. Diffraction-qualitymore » orthorhombic crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 49.13, b = 114.94, c = 75.69 Å. A SAD data set from a Gd-HPDO3A-derivatized CbpF crystal was collected to 2.1 Å resolution at the gadolinium L{sub III} absorption edge using synchrotron radiation.« less

  8. Batch crystallization of rhodopsin for structural dynamics using an X-ray free-electron laser

    DOE PAGES

    Wu, Wenting; Nogly, Przemyslaw; Rheinberger, Jan; ...

    2015-06-27

    Rhodopsin is a membrane protein from the G protein-coupled receptor family. Together with its ligand retinal, it forms the visual pigment responsible for night vision. In order to perform ultrafast dynamics studies, a time-resolved serial femtosecond crystallography method is required owing to the nonreversible activation of rhodopsin. In such an approach, microcrystals in suspension are delivered into the X-ray pulses of an X-ray free-electron laser (XFEL) after a precise photoactivation delay. Here in this study, a millilitre batch production of high-density microcrystals was developed by four methodical conversion steps starting from known vapour-diffusion crystallization protocols: (i) screening the low-salt crystallizationmore » conditions preferred for serial crystallography by vapour diffusion, (ii) optimization of batch crystallization, (iii) testing the crystal size and quality using second-harmonic generation (SHG) imaging and X-ray powder diffraction and (iv) production of millilitres of rhodopsin crystal suspension in batches for serial crystallography tests; these crystals diffracted at an XFEL at the Linac Coherent Light Source using a liquid-jet setup.« less

  9. Preparation, crystallization and preliminary crystallographic analysis of old yellow enzyme from Trypanosoma cruzi

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sugiyama, Shigeru; Tokuoka, Keiji; Uchiyama, Nahoko

    2007-10-01

    Old yellow enzyme from Trypanosoma cruzi, has been crystallized using the hanging-drop vapour-diffusion method. Old yellow enzyme (OYE) is an NADPH oxidoreductase that contains a flavin mononucleotide as a prosthetic group. The OYE from Trypanosoma cruzi, which produces prostaglandin F{sub 2α}, a potent mediator of various physiological and pathological processes, from prostaglandin H2. The protein was recombinantly expressed and purified from Escherichia coli and was crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 56.3, b = 78.8, c = 78.8 Å, β = 93.4° and two moleculesmore » per asymmetric unit. The crystals were suitable for X-ray crystallographic studies and diffracted to 1.70 Å resolution. A Patterson search method is in progress using the structure of OYE from Pseudomonas putida as a starting model.« less

  10. Crystallization and X-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus furiosus

    PubMed Central

    Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi

    2006-01-01

    The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559

  11. Crystallization and preliminary crystallographic analysis of recombinant immunoglobulin G-binding protein from Streptococcus suis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khan, Abdul Hamid; Chu, Fuliang; Feng, Youjun

    2008-08-01

    Crystallization of recombinant IgG-binding protein expressed in Escherichia coli using the hanging-drop vapour-diffusion method is described. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c = 78.17 Å. Streptococcus suis, an important zoonotic pathogen, expresses immunoglobulin G-binding protein, which is thought to be helpful to the organism in eluding the host defence system. Recombinant IgG-binding protein expressed in Escherichia coli has been crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c =more » 78.17 Å and one molecule in the asymmetric unit. Diffraction data were collected to 2.60 Å resolution.« less

  12. Purification and crystallization of Kokobera virus helicase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Colibus, Luigi; Speroni, Silvia; Coutard, Bruno

    2007-03-01

    Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method and exhibit a diffraction limit of 2.3 Å. Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. The flavivirus genus is characterized by a positive-sense single-stranded RNA genome. The unique open reading frame of the viral RNA is transcribed and translated as a single polyprotein which is post-translationally cleaved to yield three structural and seven nonstructural proteins, one of which ismore » the NS3 gene that encodes a C-terminal helicase domain consisting of 431 amino acids. Helicase inhibitors are potential antiviral drugs as the helicase is essential to viral replication. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P3{sub 1}21 (or P3{sub 2}21), with unit-cell parameters a = 88.6, c = 138.6 Å, and exhibit a diffraction limit of 2.3 Å.« less

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao

    Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.

  14. Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp; Unno, Hideaki

    2007-09-01

    Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, cmore » = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.« less

  15. Expression, purification, crystallization and initial crystallographic characterization of the p-hydroxybenzoate hydroxylase from Corynebacterium glutamicum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kwon, Soo-Young; Kang, Beom Sik; Kim, Ghyung-Hwa

    2007-11-01

    PHBH from Corynebacterium glutamicum was crystallized using the hanging-drop vapour-diffusion method in the presence of NaH{sub 2}PO{sub 4} and K{sub 2}HPO{sub 4} as precipitants. X-ray diffraction data were collected to a maximum resolution of 2.5 Å on a synchrotron beamline. p-Hydroxybenzoate hydroxylase (PHBH) is an FAD-dependent monooxygenase that catalyzes the hydroxylation of p-hydroxybenzoate (pOHB) to 3,4-dihydroxybenzoate in an NADPH-dependent reaction and plays an important role in the biodegradation of aromatic compounds. PHBH from Corynebacterium glutamicum was crystallized using the hanging-drop vapour-diffusion method in the presence of NaH{sub 2}PO{sub 4} and K{sub 2}HPO{sub 4} as precipitants. X-ray diffraction data were collectedmore » to a maximum resolution of 2.5 Å on a synchrotron beamline. The crystal belongs to the hexagonal space group P6{sub 3}22, with unit-cell parameters a = b = 94.72, c = 359.68 Å, γ = 120°. The asymmetric unit contains two molecules, corresponding to a packing density of 2.65 Å{sup 3} Da{sup −1}. The structure was solved by molecular replacement. Structure refinement is in progress.« less

  16. Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus.

    PubMed

    Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J

    2008-06-01

    Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.

  17. Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Feifei; Gao, Feng; Li, Honglin

    The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

  18. Purification, crystallization and preliminary X-ray diffraction studies of N-acetylglucosamine-phosphate mutase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi

    2006-04-01

    Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.

  19. Crystallization and preliminary X-ray diffraction studies of the cysteine protease ervatamin A from Ervatamia coronaria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Sibani; Biswas, Sampa; Chakrabarti, Chandana

    2005-06-01

    Ervatamin A is a papain-family cysteine protease with high activity and stability. It has been isolated and purified from the latex of the medicinal flowering plant E. coronaria and crystallized by the vapour-diffusion technique. Crystals diffracted to 2.1 Å and the structure was solved by molecular replacement. The ervatamins are highly stable cysteine proteases that are present in the latex of the medicinal plant Ervatamia coronaria and belong to the papain family, members of which share similar amino-acid sequences and also a similar fold comprising two domains. Ervatamin A from this family, a highly active protease compared with others frommore » the same source, has been purified to homogeneity by ion-exchange chromatography and crystallized by the vapour-diffusion method. Needle-shaped crystals of ervatamin A diffract to 2.1 Å resolution and belong to space group C222{sub 1}, with unit-cell parameters a = 31.10, b = 144.17, c = 108.61 Å. The solvent content using an ervatamin A molecular weight of 27.6 kDa is 43.9%, with a V{sub M} value of 2.19 Å{sup 3} Da{sup −1} assuming one protein molecule in the asymmetric unit. A molecular-replacement solution has been found using the structure of ervatamin C as a search model.« less

  20. Crystallization and preliminary X-ray diffraction analysis of a chitin-binding domain of hyperthermophilic chitinase from Pyrococcus furiosus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa

    The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.

  1. Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus

    PubMed Central

    Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.

    2008-01-01

    Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065

  2. Crystallization and preliminary X-ray diffraction analysis of central structure domains from mumps virus F protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Yueyong; Xu, Yanhui; Zhu, Jieqing

    2005-09-01

    Single crystals of the central structure domains from mumps virus F protein have been obtained by the hanging-drop vapour-diffusion method. A diffraction data set has been collected to 2.2 Å resolution. Fusion of members of the Paramyxoviridae family involves two glycoproteins: the attachment protein and the fusion protein. Changes in the fusion-protein conformation were caused by binding of the attachment protein to the cellular receptor. In the membrane-fusion process, two highly conserved heptad-repeat (HR) regions, HR1 and HR2, are believed to form a stable six-helix coiled-coil bundle. However, no crystal structure has yet been determined for this state in themore » mumps virus (MuV, a member of the Paramyxoviridae family). In this study, a single-chain protein consisting of two HR regions connected by a flexible amino-acid linker (named 2-Helix) was expressed, purified and crystallized by the hanging-drop vapour-diffusion method. A complete X-ray data set was obtained in-house to 2.2 Å resolution from a single crystal. The crystal belongs to space group C2, with unit-cell parameters a = 161.2, b = 60.8, c = 40.1 Å, β = 98.4°. The crystal structure will help in understanding the molecular mechanism of Paramyxoviridae family membrane fusion.« less

  3. Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

    PubMed

    Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

    2014-06-01

    LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

  4. Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

    PubMed Central

    Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

    2014-01-01

    LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

  5. Crystallization and preliminary X-ray diffraction studies of a novel ferredoxin involved in the dioxygenation of carbazole by Novosphingobium sp. KA1

    PubMed Central

    Umeda, Takashi; Katsuki, Junichi; Usami, Yusuke; Inoue, Kengo; Noguchi, Haruko; Fujimoto, Zui; Ashikawa, Yuji; Yamane, Hisakazu; Nojiri, Hideaki

    2008-01-01

    Novosphingobium sp. KA1 uses carbazole 1,9a-dioxygenase (CARDO) as the first dioxygenase in its carbazole-degradation pathway. The CARDO of KA1 contains a terminal oxygenase component and two electron-transfer components: ferredoxin and ferredoxin reductase. In contrast to the CARDO systems of other species, the ferredoxin component of KA1 is a putidaredoxin-type protein. This novel ferredoxin was crystallized at 293 K by the hanging-drop vapour-diffusion method using PEG MME 550 as the precipitant under anaerobic conditions. The crystals belong to space group C2221 and diffraction data were collected to a resolution of 1.9 Å (the diffraction limit was 1.6 Å). PMID:18607094

  6. Crystallization and X-ray diffraction analysis of 6-­aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72

    PubMed Central

    Ohki, Taku; Mizuno, Nobuhiro; Shibata, Naoki; Takeo, Masahiro; Negoro, Seiji; Higuchi, Yoshiki

    2005-01-01

    To investigate the structure–function relationship between 6-aminohexanoate-dimer hydrolase (EII) from Arthrobacter sp. and a cryptic protein (EII′) which shows 88% sequence identity to EII, a hybrid protein (named Hyb-24) of EII and EII′ was overexpressed, purified and crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant in MES buffer pH 6.5. The crystal belongs to space group P3121 or P3221, with unit-cell parameters a = b = 96.37, c = 113.09 Å. Diffraction data were collected from native and methylmercuric chloride derivative crystals to resolutions of 1.75 and 1.80 Å, respectively. PMID:16511198

  7. Crystallization and preliminary X-ray diffraction analysis of Leishmania major dihydroorotate dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cordeiro, Artur T.; Feliciano, Patricia R.; Nonato, M. Cristina, E-mail: cristy@fcfrp.usp.br

    2006-10-01

    Dihydroorotate dehydrogenase from L. major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitant agent. A complete data set from a native crystal has been collected to 2.0 Å resolution using an in-house rotating-anode generator. Dihydroorotate dehydrogenases (DHODHs) are flavin-containing enzymes that catalyze the oxidation of l-dihydroorotate to orotate, the fourth step in the de novo pyrimidine nucleotide synthesis pathway. In this study, DHODH from Leishmania major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitating agent. The crystals belong to space group P6{sub 1}, with unit-cell parameters a = 143.7, cmore » = 69.8 Å. X-ray diffraction data were collected to 2.0 Å resolution using an in-house rotating-anode generator. Analysis of the solvent content and the self-rotation function indicate the presence of two molecules in the asymmetric unit. The structure has been solved by the molecular-replacement technique.« less

  8. Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

    2016-11-30

    A tetrahydrofolate-dependentO-demethylase, LigM, from Sphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtained P3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding using P3 121/P3 2 21 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space group P2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c = 128.1 Å. The P2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing themore » cryoconditions. Phasing using the single anomalous diffraction method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

  9. Purification, crystallization and preliminary X-ray diffraction analysis of GatD, a glutamine amidotransferase-like protein from Staphylococcus aureus peptidoglycan

    PubMed Central

    Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose

    2014-01-01

    Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aoki, Ken-ichi; Tanaka, Nobutada, E-mail: ntanaka@pharm.showa-u.ac.jp; Ishikura, Shuhei

    Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P4{sub 2}, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters amore » = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution.« less

  11. Expression, purification, crystallization and preliminary X-ray analysis of the ligand-binding domain of metabotropic glutamate receptor 7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muto, Takanori; Tsuchiya, Daisuke; Morikawa, Kosuke, E-mail: morikako@protein.osaka-u.ac.jp

    2007-07-01

    The ligand-binding domain of metabotropic glutamate receptor 7 has been overexpressed, purified, and crystallized by the hanging-drop vapour-diffusion method. A complete data set has been collected to 3.30 Å. Glutamate is the major excitatory neurotransmitter and its metabotropic glutamate receptor (mGluR) plays an important role in the central nervous system. The ligand-binding domain (LBD) of mGluR subtype 7 (mGluR7) was produced using the baculovirus expression system and purified from the culture medium. The purified protein was characterized by gel-filtration chromatography, SDS–PAGE and a ligand-binding assay. Crystals of mGluR7 LBD were grown at 293 K by the hanging-drop vapour-diffusion method. Themore » crystals diffracted X-rays to 3.30 Å resolution using synchrotron radiation and belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 92.4, c = 114.3 Å. Assuming the presence of one protomer per crystallographic asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.5 Å{sup 3} Da{sup −1} and the solvent content was 51%.« less

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marana, S. R.; Cançado, F. C.; Valério, A. A.

    The digestive lysozymes 1 and 2 from M. domestica were crystallized by vapour diffusion. The crystallographic data were processed to a maximum resolution of 1.9 Å in both cases. Lysozymes are mostly known for their defensive role against bacteria, but in several animals lysozymes have a digestive function. Here, the initial crystallographic characterization of two digestive lysozymes from Musca domestica are presented. The proteins were crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium sulfate or PEG/2-propanol as the precipitant. X-ray diffraction data were collected to a maximum resolution of 1.9 Å using synchrotron radiation. The lysozyme 1more » and 2 crystals belong to the monoclinic space group P2{sub 1} (unit-cell parameters a = 36.52, b = 79.44, c = 45.20 Å, β = 102.97°) and the orthorhombic space group P2{sub 1}2{sub 1}2 (unit-cell parameters a = 73.90, b = 96.40, c = 33.27 Å), respectively. The crystal structures were solved by molecular replacement and structure refinement is in progress.« less

  13. Crystallization and preliminary X-ray crystallographic analysis of BxlE, a xylobiose transporter from Streptomyces thermoviolaceus OPC-520

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seike, Kiho; Sato, Junji; Tomoo, Koji, E-mail: tomoo@gly.oups.ac.jp

    2007-07-01

    To clarify the structural basis of sugar binding by BxlE at the atomic level, recombinant BxlE was crystallized using the hanging-drop vapour-diffusion method at 290 K. Together with the integral membrane proteins BxlF and BxlG, BxlE isolated from Streptomyces thermoviolaceus OPC-520 forms an ATP-binding cassette (ABC) transport system that mediates the uptake of xylan. To clarify the structural basis of sugar binding by BxlE at the atomic level, recombinant BxlE was crystallized using the hanging-drop vapour-diffusion method at 290 K. The crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 44.63, b = 63.27, cmore » = 66.40 Å, β = 103.05°, and contained one 48 kDa molecule per asymmetric unit (V{sub M} = 1.96 Å{sup 3} Da{sup −1}). Diffraction data collected to a resolution of 1.65 Å using a rotating-anode X-ray source gave a data set with an overall R{sub merge} of 2.6% and a completeness of 91.3%. A data set from a platinum derivative is being used for phasing by the SAD method.« less

  14. Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

    2016-11-30

    A tetrahydrofolate-dependentO-demethylase, LigM, fromSphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtainedP3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding usingP3 121/P3 221 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space groupP2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c= 128.1 Å. TheP2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing the cryoconditions. Phasing using the single anomalous diffractionmore » method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

  15. Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya

    2007-11-01

    A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less

  16. Purification, crystallization and preliminary X-ray diffraction studies of UDP-N-acetylglucosamine pyrophosphorylase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi

    2006-12-01

    UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less

  17. Recombinant expression, purification, crystallization and preliminary X-ray diffraction analysis of the C-terminal DUF490(963-1138) domain of TamB from Escherichia coli.

    PubMed

    Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel

    2014-09-01

    TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.

  18. Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.

    2007-09-01

    The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less

  19. Purification, crystallization and preliminary X-ray diffraction of the C-terminal bromodomain from human BRD2

    PubMed Central

    Umehara, Takashi; Wakamori, Masatoshi; Tanaka, Akiko; Padmanabhan, Balasundaram; Yokoyama, Shigeyuki

    2007-01-01

    BRD2 is a bromodomain-containing BET-family protein that associates with acetylated histones throughout the cell cycle. Although the tertiary structures of the bromodomains involved in histone acetyl transfer are already known, the structures of the BET-type bromodomains, which are required for tight association with acetylated chromatin, are poorly understood. Here, the expression, purification and crystallization of the C-terminal bromodomain of human BRD2 are reported. The protein was crystallized by the sitting-drop vapour-diffusion method in the orthorhombic space group P21212, with unit-cell parameters a = 71.78, b = 52.60, c = 32.06 Å and one molecule per asymmetric unit. The crystal diffracted beyond 1.80 Å resolution using synchrotron radiation. PMID:17620725

  20. Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.

    PubMed

    Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

    2012-08-01

    Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.

  1. Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4

    PubMed Central

    Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

    2012-01-01

    Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128

  2. Preliminary X-ray diffraction analysis of a thermophilic β-1,3-1,4-glucanase from Clostridium thermocellum.

    PubMed

    Zhang, Lilan; Zhao, Puya; Chen, Chun-Chi; Huang, Chun-Hsiang; Ko, Tzu-Ping; Zheng, Yingying; Guo, Rey-Ting

    2014-07-01

    β-1,3-1,4-Glucanases catalyze the specific hydrolysis of internal β-1,4-glycosidic bonds adjacent to the 3-O-substituted glucose residues in mixed-linked β-glucans. The thermophilic glycoside hydrolase CtGlu16A from Clostridium thermocellum exhibits superior thermal profiles, high specific activity and broad pH adaptability. Here, the catalytic domain of CtGlu16A was expressed in Escherichia coli, purified and crystallized in the trigonal space group P3121, with unit-cell parameters a=b=74.5, c=182.9 Å, by the sitting-drop vapour-diffusion method and diffracted to 1.95 Å resolution. The crystal contains two protein molecules in an asymmetric unit. Further structural determination and refinement are in progress.

  3. Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase

    PubMed Central

    Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo

    2006-01-01

    Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-­ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269

  4. Crystallization and preliminary X-ray diffraction studies of two thermostable α-galactosidases from glycoside hydrolase family 36

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Foucault, M.; Watzlawick, H.; Mattes, R.

    2006-02-01

    The α-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8 Å resolution, respectively. α-Galactosidases from thermophilic organisms have gained interest owing to their applications in the sugar industry. The α-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8 Å resolution,more » respectively. Crystals of AgaB belong to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 87.5, b = 113.3, c = 161.6 Å. Crystals of AgaA A355E belong to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 150.1, c = 233.2 Å.« less

  5. Expression, purification, crystallization and preliminary X-ray crystallographic studies of Deinococcus radiodurans thioredoxin reductase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Obiero, Josiah; Bonderoff, Sara A.; Goertzen, Meghan M.

    2006-08-01

    Recombinant D. radiodurans TrxR with a His tag at the N-terminus was expressed in Escherichia coli and purified by metal-affinity chromatography. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of 35% PEG 4000, 0.2 M ammonium acetate and citric acid buffer pH 5.1 at 293 K. Deinococcus radiodurans, a Gram-positive bacterium capable of withstanding extreme ionizing radiation, contains two thioredoxins (Trx and Trx1) and a single thioredoxin reductase (TrxR) as part of its response to oxidative stress. Thioredoxin reductase is a member of the family of pyridine nucleotide-disulfide oxidoreductase flavoenzymes. Recombinant D. radiodurans TrxR with amore » His tag at the N-terminus was expressed in Escherichia coli and purified by metal-affinity chromatography. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of 35% PEG 4000, 0.2 M ammonium acetate and citric acid buffer pH 5.1 at 293 K. X-ray diffraction data were collected on a cryocooled crystal to a resolution of 1.9 Å using a synchrotron-radiation source. The space group was determined to be P3{sub 2}21, with unit-cell parameters a = b = 84.33, c = 159.88 Å. The structure of the enzyme has been solved by molecular-replacement methods and structure refinement is in progress.« less

  6. Crystallization screening test for the whole-cell project on Thermus thermophilus HB8

    PubMed Central

    Iino, Hitoshi; Naitow, Hisashi; Nakamura, Yuki; Nakagawa, Noriko; Agari, Yoshihiro; Kanagawa, Mayumi; Ebihara, Akio; Shinkai, Akeo; Sugahara, Mitsuaki; Miyano, Masashi; Kamiya, Nobuo; Yokoyama, Shigeyuki; Hirotsu, Ken; Kuramitsu, Seiki

    2008-01-01

    It was essential for the structural genomics of Thermus thermophilus HB8 to efficiently crystallize a number of proteins. To this end, three conventional robots, an HTS-80 (sitting-drop vapour diffusion), a Crystal Finder (hanging-drop vapour diffusion) and a TERA (modified microbatch) robot, were subjected to a crystallization condition screening test involving 18 proteins from T. thermophilus HB8. In addition, a TOPAZ (microfluidic free-interface diffusion) designed specifically for initial screening was also briefly examined. The number of diffraction-quality crystals and the time of appearance of crystals increased in the order HTS-80, Crystal Finder, TERA. With the HTS-80 and Crystal Finder, the time of appearance was short and the rate of salt crystallization was low. With the TERA, the number of diffraction-quality crystals was high, while the time of appearance was long and the rate of salt crystallization was relatively high. For the protein samples exhibiting low crystallization success rates, there were few crystallization conditions that were common to the robots used. In some cases, the success rate depended greatly on the robot used. The TOPAZ showed the shortest time of appearance and the highest success rate, although the crystals obtained were too small for diffraction studies. These results showed that the combined use of different robots significantly increases the chance of obtaining crystals, especially for proteins exhibiting low crystallization success rates. The structures of 360 of 944 purified proteins have been successfully determined through the combined use of an HTS-80 and a TERA. PMID:18540056

  7. Mixing of multiple metal vapours into an arc plasma in gas tungsten arc welding of stainless steel

    NASA Astrophysics Data System (ADS)

    Park, Hunkwan; Trautmann, Marcus; Tanaka, Keigo; Tanaka, Manabu; Murphy, Anthony B.

    2017-11-01

    A computational model of the mixing of multiple metal vapours, formed by vaporization of the surface of an alloy workpiece, into the thermal arc plasma in gas tungsten arc welding (GTAW) is presented. The model incorporates the combined diffusion coefficient method extended to allow treatment of three gases, and is applied to treat the transport of both chromium and iron vapour in the helium arc plasma. In contrast to previous models of GTAW, which predict that metal vapours are swept away to the edge of the arc by the plasma flow, it is found that the metal vapours penetrate strongly into the arc plasma, reaching the cathode region. The predicted results are consistent with published measurements of the intensity of atomic line radiation from the metal vapours. The concentration of chromium vapour is predicted to be higher than that of iron vapour due to its larger vaporization rate. An accumulation of chromium vapour is predicted to occur on the cathode at about 1.5 mm from the cathode tip, in agreement with published measurements. The arc temperature is predicted to be strongly reduced due to the strong radiative emission from the metal vapours. The driving forces causing the diffusion of metal vapours into the helium arc are examined, and it is found that diffusion due to the applied electric field (cataphoresis) is dominant. This is explained in terms of large ionization energies and the small mass of helium compared to those of the metal vapours.

  8. Expression, crystallization and phasing of vacuolar H(+)-ATPase subunit C (Vma5p) of Saccharomyces cerevisiae.

    PubMed

    Drory, Omri; Mor, Adi; Frolow, Felix; Nelson, Nathan

    2004-10-01

    The expression, crystallization and phasing of subunit C (Vma5p) of the yeast (Saccharomyces cerevisiae) vacuolar proton-translocating ATPase (V-ATPase) is described. The expressed protein consists of 412 residues: 392 from the reading frame of Vma5p and 20 N-terminal residues originating from the plasmid. Diffraction-quality crystals were obtained using the hanging-drop and sitting-drop vapour-diffusion methods assisted by streak-seeding, with PEG 3350 as precipitant. The crystals formed in hanging drops diffracted to 1.80 A and belong to space group P4(3)2(1)2(1), with unit-cell parameters a = b = 62.54, c = 327.37 A, alpha = beta = gamma = 90 degrees. The structure was solved using SIRAS with a Lu(O2C2H3)2 heavy-atom derivative.

  9. Crystallization and preliminary crystallographic studies of the Pasteurella multocida toxin catalytic domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyazawa, Masayuki; Kitadokoro, Kengo; Kamitani, Shigeki

    2006-09-01

    The C-terminal catalytic domain of P. multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. The C-terminal catalytic domain of Pasteurella multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. Native diffraction data to 1.9 Å resolution were obtained at the BL44XU beamline of SPring-8 from a flash-frozen crystal at 100 K. The crystals belong to space group C2, with unit-cell parameters a = 111.0, b = 150.4,more » c = 77.1 Å, β = 105.5°, and are likely to contain one C-PMT (726 residues) per asymmetric unit.« less

  10. Purification, Crystallization, and Preliminary Crystallographic Analysis of Deoxyuridine Triphosphate Nucleotidohydrolase from Arabidopsis Thaliana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajaj,M.; Moriyama, H.

    2007-01-01

    The deoxyuridine triphosphate nucleotidohydrolase gene from Arabidopsis thaliana was expressed and the gene product was purified. Crystallization was performed by the hanging-drop vapour-diffusion method at 298 K using 2 M ammonium sulfate as the precipitant. X-ray diffraction data were collected to 2.2 Angstroms resolution using Cu K{alpha} radiation. The crystal belongs to the orthorhombic space group P212121, with unit-cell parameters a = 69.90, b = 70.86 Angstroms, c = 75.55 Angstroms . Assuming the presence of a trimer in the asymmetric unit, the solvent content was 30%, with a VM of 1.8 Angstroms 3 Da-1.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, Feng; Jin, Tengchuan; Howard, Andrew

    The crystallization of the brazil nut allergen Ber e 2 is reported. Peanut and tree-nut allergies have attracted considerable attention because of their frequency and their lifelong persistence. Brazil-nut (Bertholletia excelsa) allergies have been well documented and the 11S legumin-like seed storage protein Ber e 2 (excelsin) is one of the two known brazil-nut allergens. In this study, Ber e 2 was extracted from brazil-nut kernels and purified to high purity by crystalline precipitation and gel-filtration chromatography. Well diffracting single crystals were obtained using the hanging-drop vapour-diffusion method. A molecular-replacement structural solution has been obtained. Refinement of the structure ismore » currently under way.« less

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, Xiong-Zhuo; National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871; Li, Lan-Fen

    The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction weremore » obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.« less

  13. From screen to structure with a harvestable microfluidic device.

    PubMed

    Stojanoff, Vivian; Jakoncic, Jean; Oren, Deena A; Nagarajan, V; Poulsen, Jens-Christian Navarro; Adams-Cioaba, Melanie A; Bergfors, Terese; Sommer, Morten O A

    2011-08-01

    Advances in automation have facilitated the widespread adoption of high-throughput vapour-diffusion methods for initial crystallization screening. However, for many proteins, screening thousands of crystallization conditions fails to yield crystals of sufficient quality for structural characterization. Here, the rates of crystal identification for thaumatin, catalase and myoglobin using microfluidic Crystal Former devices and sitting-drop vapour-diffusion plates are compared. It is shown that the Crystal Former results in a greater number of identified initial crystallization conditions compared with vapour diffusion. Furthermore, crystals of thaumatin and lysozyme obtained in the Crystal Former were used directly for structure determination both in situ and upon harvesting and cryocooling. On the basis of these results, a crystallization strategy is proposed that uses multiple methods with distinct kinetic trajectories through the protein phase diagram to increase the output of crystallization pipelines.

  14. Structure determination of an integral membrane protein at room temperature from crystals in situ

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Axford, Danny; Foadi, James; Imperial College London, London SW7 2AZ

    2015-05-14

    The X-ray structure determination of an integral membrane protein using synchrotron diffraction data measured in situ at room temperature is demonstrated. The structure determination of an integral membrane protein using synchrotron X-ray diffraction data collected at room temperature directly in vapour-diffusion crystallization plates (in situ) is demonstrated. Exposing the crystals in situ eliminates manual sample handling and, since it is performed at room temperature, removes the complication of cryoprotection and potential structural anomalies induced by sample cryocooling. Essential to the method is the ability to limit radiation damage by recording a small amount of data per sample from many samplesmore » and subsequently assembling the resulting data sets using specialized software. The validity of this procedure is established by the structure determination of Haemophilus influenza TehA at 2.3 Å resolution. The method presented offers an effective protocol for the fast and efficient determination of membrane-protein structures at room temperature using third-generation synchrotron beamlines.« less

  15. Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

    PubMed Central

    Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

    2009-01-01

    Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

  16. Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

    PubMed

    Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

    2009-11-01

    Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

  17. Crystallization and preliminary X-ray diffraction analysis of P30, the transmembrane domain of pertactin, an autotransporter from Bordetella pertussis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Yanshi; Black, Isobel; Roszak, Aleksander W.

    2007-07-01

    P30, the transmembrane C-terminal domain of pertactin from B. pertussis has been crystallized after refolding in vitro. Preliminary X-ray crystallographic data are reported. P30, the 32 kDa transmembrane C-terminal domain of pertactin from Bordetella pertussis, is supposed to form a β-barrel inserted into the outer membrane for the translocation of the passenger domain. P30 was cloned and expressed in inclusion bodies in Escherichia coli. After refolding and purification, the protein was crystallized using the sitting-drop vapour-diffusion method at 292 K. The crystals diffract to a resolution limit of 3.5 Å using synchrotron radiation and belong to the hexagonal space groupmore » P6{sub 1}22, with unit-cell parameters a = b = 123.27, c = 134.43 Å.« less

  18. Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen

    2006-10-01

    Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution.more » The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.« less

  19. Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Guan-Jing; Li, Lan-Fen; Li, Dan

    2007-09-01

    A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, withmore » unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.« less

  20. Preliminary X-ray crystallographic analysis of SMU.573, a putative sugar kinase from Streptococcus mutans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Yan-Feng; Li, Lan-Fen; Yang, Cheng

    2008-01-01

    SMU.573 from S. mutans was expressed in E. coli and crystallized. The crystals belong to space group I4 and 2.5 Å resolution diffraction data were collected at an in-house chromium radiation source. SMU.573 from Streptococcus mutans is a structurally and functionally uncharacterized protein that was selected for structural biology studies. Native and SeMet-labelled proteins were expressed with an N-His tag in Escherichia coli BL21 (DE3) and purified by Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals of the SeMet-labelled protein were obtained by the hanging-drop vapour-diffusion method and a 2.5 Å resolution diffraction data set was collected using an in-house chromium radiationmore » source. The crystals belong to space group I4, with unit-cell parameters a = b = 96.53, c = 56.26 Å, α = β = γ = 90°.« less

  1. Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin.

    PubMed

    Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S

    2014-11-01

    Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

  2. Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis

    PubMed Central

    Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

    2009-01-01

    RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733

  3. Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis.

    PubMed

    Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

    2009-11-01

    RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aravind, Penmatsa; Rajini, Bheemreddy; Sharma, Yogendra

    The crystallization and preliminary X-ray diffraction analysis of AIM1g1, a βγ-crystallin domain of absent in melanoma (AIM1) protein from H. sapiens, is reported. AIM1g1 is a single βγ-crystallin domain from the protein absent in melanoma 1 (AIM1), which appears to play a role in the suppression of melanomas. This domain is known to bind calcium and its structure would help in identifying calcium-coordinating sites in vertebrate crystallins, which have hitherto been believed to have lost this ability during evolution. Crystallization of this domain was performed by the hanging-drop vapour-diffusion method. Crystals diffracted to a maximum resolution of 1.86 Å andmore » were found to belong to space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 54.98, c = 59.73 Å. Solvent-content analysis indicated the presence of one monomer per asymmetric unit.« less

  5. Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morita, Hiroyuki; Kondo, Shin; Kato, Ryohei

    2007-07-01

    An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α =more » β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.« less

  6. Crystallization and preliminary X-ray diffraction analysis of the P3 RNA domain of yeast ribonuclease MRP in a complex with RNase P/MRP protein components Pop6 and Pop7.

    PubMed

    Perederina, Anna; Esakova, Olga; Quan, Chao; Khanova, Elena; Krasilnikov, Andrey S

    2010-01-01

    Eukaryotic ribonucleases P and MRP are closely related RNA-based enzymes which contain a catalytic RNA component and several protein subunits. The roles of the protein subunits in the structure and function of eukaryotic ribonucleases P and MRP are not clear. Crystals of a complex that included a circularly permuted 46-nucleotide-long P3 domain of the RNA component of Saccharomyces cerevisiae ribonuclease MRP and selenomethionine derivatives of the shared ribonuclease P/MRP protein components Pop6 (18.2 kDa) and Pop7 (15.8 kDa) were obtained using the sitting-drop vapour-diffusion method. The crystals belonged to space group P4(2)22 (unit-cell parameters a = b = 127.2, c = 76.8 A, alpha = beta = gamma = 90 degrees ) and diffracted to 3.25 A resolution.

  7. Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny

    2006-01-01

    Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less

  8. Crystallization and preliminary X-ray data analysis of β-alanine synthase from Drosophila melanogaster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lundgren, Stina; Andersen, Birgit; Piškur, Jure

    2007-10-01

    β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine. Crystals of the recombinant enzyme from D. melanogaster belong to space group C2. Diffraction data to 3.3 Å resolution were collected and analyzed. β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine, which represents the main clearance route for the widely used anticancer drug 5-fluorouracil. Crystals of the recombinant enzyme from Drosophila melanogaster, which is closely related to the human enzyme, were obtained by the hanging-drop vapour-diffusion method. They diffracted to 3.3 Å at a synchrotron-radiation source, belong tomore » space group C2 (unit-cell parameters a = 278.9, b = 95.0, c = 199.3 Å, β = 125.8°) and contain 8–10 molecules per asymmetric unit.« less

  9. Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

    PubMed

    Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

    2009-09-01

    Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

  10. Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1

    PubMed Central

    Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

    2010-01-01

    The hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe–2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-­terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 60.72, c = 83.31 Å. The asymmetric unit contains one protein molecule. PMID:20606288

  11. Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1.

    PubMed

    Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

    2010-07-01

    The hyperthermophilic archaeal Rieske-type [2Fe-2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe-2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 A resolution and belonged to the tetragonal space group P4(3)2(1)2, with unit-cell parameters a = 60.72, c = 83.31 A. The asymmetric unit contains one protein molecule.

  12. Expression, purification and crystallization of a dye-decolourizing peroxidase from Dictyostelium discoideum.

    PubMed

    Rai, Amrita; Fedorov, Roman; Manstein, Dietmar J

    2014-02-01

    Dye-decolourizing peroxidases are haem-containing peroxidases with broad substrate specificity. Using H2O2 as an electron acceptor, they efficiently decolourize various dyes that are of industrial and environmental relevance, such as anthraquninone- and azo-based dyes. In this study, the dye-decolourizing peroxidase DdDyP from Dictyostelium discoideum was overexpressed in Escherichia coli strain Rosetta(DE3)pLysS, purified and crystallized using the vapour-diffusion method. A native crystal diffracted to 1.65 Å resolution and belonged to space group P4(1)2(1)2, with unit-cell parameters a = b = 141.03, c = 95.56 Å, α = β = γ = 90°. The asymmetric unit contains two molecules.

  13. Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii

    PubMed Central

    Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.

    2005-01-01

    This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure. PMID:16508108

  14. Crystallization and X-ray diffraction analysis of an l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii and a d-xylonate dehydratase from Caulobacter crescentus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rahman, Mohammad Mubinur; Andberg, Martina; Koivula, Anu

    l-Arabinonate dehydratase and d-xylonate dehydratase from the IlvD/EDD family were crystallized by the vapour-diffusion method. Diffraction data sets were collected to resolutions of 2.40 and 2.66 Å from crystals of l-arabinonate dehydratase and d-xylonate dehydratase, respectively. l-Arabinonate dehydratase (EC 4.2.1.25) and d-xylonate dehydratase (EC 4.2.1.82) are two enzymes that are involved in a nonphosphorylative oxidation pathway of pentose sugars. l-Arabinonate dehydratase converts l-arabinonate into 2-dehydro-3-deoxy-l-arabinonate, and d-xylonate dehydratase catalyzes the dehydration of d-xylonate to 2-dehydro-3-deoxy-d-xylonate. l-Arabinonate and d-xylonate dehydratases belong to the IlvD/EDD family, together with 6-phosphogluconate dehydratases and dihydroxyacid dehydratases. No crystal structure of any l-arabinonate or d-xylonate dehydratasemore » is available in the PDB. In this study, recombinant l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii (RlArDHT) and d-xylonate dehydratase from Caulobacter crescentus (CcXyDHT) were heterologously expressed in Escherichia coli and purified by the use of affinity chromatography followed by gel-filtration chromatography. The purified proteins were crystallized using the hanging-drop vapour-diffusion method at 293 K. Crystals of RlArDHT that diffracted to 2.40 Å resolution were obtained using sodium formate as a precipitating agent. They belonged to space group P2{sub 1}, with unit-cell parameters a = 106.07, b = 208.61, c = 147.09 Å, β = 90.43°. Eight RlArDHT molecules (two tetramers) in the asymmetric unit give a V{sub M} value of 3.2 Å{sup 3} Da{sup −1} and a solvent content of 62%. Crystals of CcXyDHT that diffracted to 2.66 Å resolution were obtained using sodium formate and polyethylene glycol 3350. They belonged to space group C2, with unit-cell parameters a = 270.42, b = 236.13, c = 65.17 Å, β = 97.38°. Four CcXyDHT molecules (a tetramer) in the asymmetric unit give a V{sub M} value of 4.0 Å{sup 3} Da{sup −1} and a solvent content of 69%.« less

  15. Crystallization and preliminary X-ray diffraction analysis of the lectin from Dioclea rostrata Benth seeds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago

    2006-02-01

    D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less

  16. Purification and crystallization of the ABC-type transport substrate-binding protein OppA from Thermoanaerobacter tengcongensis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, Jinlan; Li, Xiaolu; Tsinghua-Peking Joint Center for Life Sciences, Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing 100084, People's Republic of China

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer We truncated the signal peptide of OppA{sub TTE0054} to make it express in Escherichia coli as a soluble protein. Black-Right-Pointing-Pointer Crystals of OppA{sub TTE0054} were grown by sitting-drop vapor diffusion method. Black-Right-Pointing-Pointer The crystal of OppA{sub TTE0054} diffracted to 2.25 A. -- Abstract: Di- and oligopeptide- binding protein OppAs play important roles in solute and nutrient uptake, sporulation, biofilm formation, cell wall muropeptides recycling, peptide-dependent quorum-sensing responses, adherence to host cells, and a variety of other biological processes. Soluble OppA from Thermoanaerobacter tengcongensis was expressed in Escherichia coli. The protein was found to be >95% pure with SDS-PAGEmore » after a series of purification steps and the purity was further verified by mass spectrometry. The protein was crystallized using the sitting-drop vapour-diffusion method with PEG 400 as the precipitant. Crystal diffraction extended to 2.25 A. The crystal belonged to space group C222{sub 1}, with unit-cell parameters of a = 69.395, b = 199.572, c = 131.673 A, and {alpha} = {beta} = {gamma} = 90 Degree-Sign .« less

  17. Crystallization and preliminary X-ray diffraction studies of the ferredoxin reductase component in the Rieske nonhaem iron oxygenase system carbazole 1,9a-dioxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui

    2007-06-01

    The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less

  18. Purification, crystallization and preliminary X-ray analysis of a thermostable glycoside hydrolase family 43 β-xylosidase from Geobacillus thermoleovorans IT-08

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko

    2007-11-01

    The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less

  19. Crystallization and preliminary X-ray diffraction analysis of mouse 3(17)α-hydroxysteroid dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin

    2005-07-01

    Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less

  20. Purification, partial characterization, crystallization and preliminary X-ray diffraction of a novel cardiotoxin-like basic protein from Naja naja atra (South Anhui) venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rong, Hui; Li, Yan; Lou, Xiao-hua

    2007-02-01

    A novel cardiotoxin-like basic protein from Naja naja atra was crystallized and diffraction data were collected to 2.35 Å resolution. A novel cardiotoxin-like basic protein was isolated from the venom of the Chinese cobra (Naja naja atra) from the south of Anhui in China. The protein inhibits the expression of vascular endothelial growth factor and basic fibroblast growth factor in human lung cancer cell line H1299 and induces the haemolysis of rabbit erythrocytes under low-lecithin conditions. After a two-step chromatographic purification, the resultant 7 kDa protein was crystallized by the hanging-drop vapour-diffusion method at room temperature. A complete data setmore » was collected to 2.35 Å resolution using an in-house X-ray diffraction system. The crystal belongs to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 43.2, c = 147.9 Å. There are two molecules in the crystallographic asymmetric unit.« less

  1. Crystallization and preliminary X-ray analysis of a protease inhibitor from the latex of Carica papaya

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid

    2006-12-01

    The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less

  2. Crystallization and preliminary X-ray diffraction analyses of the redox-controlled complex of terminal oxygenase and ferredoxin components in the Rieske nonhaem iron oxygenase carbazole 1,9a-dioxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matsuzawa, Jun; Aikawa, Hiroki; Umeda, Takashi

    2014-09-25

    A crystal was obtained of the complex between reduced terminal oxygenase and oxidized ferredoxin components of carbazole 1,9a-dioxygenase. The crystal belonged to space group P2{sub 1} and diffracted to 2.25 Å resolution. The initial reaction in bacterial carbazole degradation is catalyzed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase (Oxy), ferredoxin (Fd) and ferredoxin reductase components. The electron-transfer complex between reduced Oxy and oxidized Fd was crystallized at 293 K using the hanging-drop vapour-diffusion method with PEG 3350 as the precipitant under anaerobic conditions. The crystal diffracted to a maximum resolution of 2.25 Å and belonged to space group P2{submore » 1}, with unit-cell parameters a = 97.3, b = 81.6, c = 116.2 Å, α = γ = 90, β = 100.1°. The V{sub M} value is 2.85 Å{sup 3} Da{sup −1}, indicating a solvent content of 56.8%.« less

  3. Crystallization and crystallographic studies of kallistatin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Fang; Zhou, Aiwu; Wei, Zhenquan, E-mail: weizhq@gmail.com

    2015-08-25

    The crystallization of human kallistatin in the relaxed conformation is reported. Kallistatin is a serine protease inhibitor (serpin) which specifically inhibits human tissue kallikrein; however, its inhibitory activity is inhibited by heparin. In order to elucidate the underlying mechanism, recombinant human kallistatin was prepared in Escherichia coli and the protein was crystallized by the sitting-drop vapour-diffusion method. X-ray diffraction data were collected to 1.9 Å resolution. The crystals were found to belong to space group P6{sub 1}, with unit-cell parameters a = 113.51, b = 113.51, c = 76.17 Å. Initial analysis indicated that the crystallized kallistatin was in amore » relaxed conformation, with its reactive-centre loop inserted in the central β-sheet.« less

  4. Crystallization and preliminary crystallographic analysis of a surface antigen glycoprotein, SAG19, from Eimeria tenella

    PubMed Central

    Ramly, Nur Zazarina; Rouzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Baker, Patrick J.; Chow, Yock-Ping; Wan, Kiew-Lian; Nathan, Sheila; Rice, David W.

    2013-01-01

    Coccidiosis in chickens is caused by the apicomplexan parasite Eimeria tenella and is thought to involve a role for a superfamily of more than 20 cysteine-rich surface antigen glycoproteins (SAGs) in host–parasite interactions. A representative member of the family, SAG19, has been overexpressed in Escherichia coli, purified and crystallized by the hanging-drop method of vapour diffusion using ammonium sulfate as the precipitant. Crystals of SAG19 diffracted to beyond 1.50 Å resolution and belonged to space group I4, with unit-cell parameters a = b = 108.2, c = 37.5 Å. Calculation of possible values of V M suggests that there is a single molecule in the asymmetric unit. PMID:24316835

  5. Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

    PubMed Central

    Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder

    2006-01-01

    Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P21, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit. PMID:16511268

  6. Expression, purification, crystallization and preliminary X-ray diffraction analysis of Bifidobacterium adolescentis xylose isomerase

    PubMed Central

    dos Reis, Caio Vinicius; Bernardes, Amanda; Polikarpov, Igor

    2013-01-01

    Xylose isomerase (EC 5.3.1.5) is a key enzyme in xylose metabolism which is industrially important for the transformation of glucose and xylose into fructose and xylulose, respectively. The Bifidobacterium adolescentis xylA gene (NC_008618.1) encoding xylose isomerase (XI) was cloned and the enzyme was overexpressed in Escherichia coli. Purified recombinant XI was crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol 3350 as the precipitating agent. A complete native data set was collected to 1.7 Å resolution using a synchrotron-radiation source. The crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 88.78, b = 123.98, c = 78.63 Å. PMID:23695585

  7. Crystallization and preliminary X-ray analysis of PH1566, a putative ribosomal RNA-processing factor from the hyperthermophilic archaeon Pyrococcus horikoshii OT3

    PubMed Central

    Jia, Min Ze; Ohtsuka, Jun; Lee, Woo Cheol; Nagata, Koji; Tanokura, Masaru

    2006-01-01

    A putative ribosomal RNA-processing factor consisting of two KH domains from Pyrococcus horikoshii OT3 (PH1566; 25 kDa) was crystallized by the sitting-drop vapour-diffusion method using PEG 3000 as the precipitant. The crystals diffracted X-rays to beyond 2.0 Å resolution using a synchrotron-radiation source. The space group of the crystals was determined as primitive orthorhombic P212121, with unit-cell parameters a = 45.9, b = 47.4, c = 95.7 Å. The crystals contain one molecule in the asymmetric unit (V M = 2.5 Å3 Da−1) and have a solvent content of 50%. PMID:16511260

  8. Purification, crystallization and preliminary X-ray diffraction analysis of a novel keto-deoxy-d-galactarate (KDG) dehydratase from Agrobacterium tumefaciens

    PubMed Central

    Taberman, Helena; Andberg, Martina; Parkkinen, Tarja; Richard, Peter; Hakulinen, Nina; Koivula, Anu; Rouvinen, Juha

    2014-01-01

    d-Galacturonic acid is the main component of pectin. It could be used to produce affordable renewable fuels, chemicals and materials through biotechnical conversion. Keto-deoxy-d-galactarate (KDG) dehydratase is an enzyme in the oxidative pathway of d-galacturonic acid in Agrobacterium tumefaciens (At). It converts 3-deoxy-2-keto-l-threo-hexarate to α-ketoglutaric semialdehyde. At KDG dehydratase was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 169.1, b = 117.8, c = 74.3 Å, β = 112.4° and an asymmetric unit of four monomers. X-ray diffraction data were collected to 1.9 Å resolution using synchrotron radiation. The three-dimensional structure of At KDG dehydratase will provide valuable information on the function of the enzyme and will allow it to be engineered for biorefinery-based applications. PMID:24419616

  9. Purification, crystallization and preliminary X-ray analysis of the glucosamine-6-phosphate N-acetyltransferase from human liver

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Juan; Zhou, Yan-Feng; Li, Lan-Fen

    2006-11-01

    Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P4{sub 1}2{sub 1}2more » or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 50.08, c = 142.88 Å.« less

  10. Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jagadeesan, G.; Malathy, P.; Gunasekaran, K.

    2014-10-25

    The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less

  11. Crystallization and preliminary crystallographic study of the yeast Malassezia sympodialis allergen Mala s 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vilhelmsson, Monica, E-mail: monica.vilhelmsson@medks.ki.se; Center for Infectious Medicine, Department of Medicine, Karolinska University Hospital, Huddinge, Stockholm; Hallberg, B. Martin

    2006-02-01

    Crystals of the M. sympodialis allergen Mala s 1 have been obtained using the hanging-drop vapour-diffusion method. A diffraction data set has been collected from native crystals to 1.35 Å resolution. The opportunistic yeast Malassezia sympodialis can act as an allergen and elicit specific IgE- and T-cell reactivity in patients with atopic eczema. The first identified major allergen from M. sympodialis, Mala s 1, is present on the cell surface of the yeast. Recombinant Mala s 1 was expressed in Escherichia coli, purified and refolded in a soluble form. Crystals of Mala s 1 were obtained in 25% PEG 8K,more » 0.2 M (NH{sub 4}){sub 2}SO{sub 4}. Crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 44.4, b = 163.7, c = 50.6 Å, and diffract to 1.35 Å resolution.« less

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saijo, Shinya; Sato, Takao; Kumasaka, Takashi

    The reaction center–light-harvesting 1 core complex from R. viridis was crystallized and X-ray diffraction data were collected to 8.0 Å resolution. The reaction center–light-harvesting 1 (RC–LH1) core complex is the photosynthetic apparatus in the membrane of the purple photosynthetic bacterium Rhodopseudomonas viridis. The RC is surrounded by an LH1 complex that is constituted of oligomers of three types of apoproteins (α, β and γ chains) with associated bacteriochlorophyll bs and carotenoid. It has been crystallized by the sitting-drop vapour-diffusion method. A promising crystal diffracted to beyond 8.0 Å resolution. It belonged to space group P1, with unit-cell parameters a =more » 141.4, b = 136.9, c = 185.3 Å, α = 104.6, β = 94.0, γ = 110.7°. A Patterson function calculated using data between 15.0 and 8.0 Å resolution suggested that the LH1 complex is distributed with quasi-16-fold rotational symmetry around the RC.« less

  13. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the pectin methylesterase from the sugar cane weevil Sphenophorus levis.

    PubMed

    Evangelista, Danilo Elton; Schutzer de Godoy, Andre; Fonseca Pereira de Paula, Fernando; Henrique-Silva, Flavio; Polikarpov, Igor

    2014-03-01

    Pectin methylesterase removes the methyl groups from the main chain of pectin, the major component of the middle lamella of the plant cell wall. The enzyme is involved in plant cell-wall development, is part of the enzymatic arsenal used by microorganisms to attack plants and also has a wide range of applications in the industrial sector. Therefore, there is a considerable interest in studies of the structure and function of this enzyme. In this work, the pectin methylesterase from Sphenophorus levis was produced in Pichia pastoris and purified. Crystals belonging to the monoclinic space group C2, with unit-cell parameters a = 122.181, b = 82.213, c = 41.176 Å, β = 97.48°, were obtained by the sitting-drop vapour-diffusion method and an X-ray diffraction data set was collected to 2.1 Å resolution. Structure refinement and model building are in progress.

  14. Crystallization and preliminary crystallographic analysis of maganese(II)-dependent 2,3-dihydroxybiphenyl 1,2-dioxygenase from Bacillus sp. JF8

    PubMed Central

    Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya

    2010-01-01

    A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161

  15. Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

    2005-11-01

    The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

  16. Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

    2008-04-01

    Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

  17. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  18. Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kurz, M.; Iturbe-Ormaetxe, I.; Jarrott, R.

    2008-02-01

    The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, bmore » = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.« less

  19. Crystallization and preliminary X-ray diffraction studies of the glutaminyl cyclase from Carica papaya latex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Azarkan, Mohamed; Clantin, Bernard; Bompard, Coralie

    2005-01-01

    The glutaminyl cyclase isolated from C. papaya latex has been crystallized using the hanging-drop method. Diffraction data have been collected at ESRF beamline BM14 and processed to 1.7 Å resolution. In living systems, the intramolecular cyclization of N-terminal glutamine residues is accomplished by glutaminyl cyclase enzymes (EC 2.3.2.5). While in mammals these enzymes are involved in the synthesis of hormonal and neurotransmitter peptides, the physiological role played by the corresponding plant enzymes still remains to be unravelled. Papaya glutaminyl cyclase (PQC), a 33 kDa enzyme found in the latex of the tropical tree Carica papaya, displays an exceptional resistance tomore » chemical and thermal denaturation as well as to proteolysis. In order to elucidate its enzymatic mechanism and to gain insights into the structural determinants underlying its remarkable stability, PQC was isolated from papaya latex, purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 62.82, b = 81.23, c = 108.17 Å and two molecules per asymmetric unit. Diffraction data have been collected at ESRF beamline BM14 and processed to a resolution of 1.7 Å.« less

  20. Crystallization and preliminary X-ray diffraction analysis of the arginine repressor of the hyperthermophile Thermotoga neapolitana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Massant, Jan, E-mail: jan.massant@vub.ac.be; Peeters, Eveline; Charlier, Daniel

    2006-01-01

    The arginine repressor of the hyperthermophile T. neapolitana was crystallized with and without its corepressor arginine. Both crystals diffracted to high resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with similar unit-cell parameters. The arginine repressor of Thermotoga neapolitana (ArgRTnp) is a member of the family of multifunctional bacterial arginine repressors involved in the regulation of arginine metabolism. This hyperthermophilic repressor shows unique DNA-binding features that distinguish it from its homologues. ArgRTnp exists as a homotrimeric protein that assembles into hexamers at higher protein concentrations and/or in the presence of arginine. ArgRTnp was crystallized with andmore » without its corepressor arginine using the hanging-drop vapour-diffusion method. Crystals of the aporepressor diffracted to a resolution of 2.1 Å and belong to the orthorhombic P2{sub 1}2{sub 1}2{sub 1} space group, with unit-cell parameters a = 117.73, b = 134.15, c = 139.31 Å. Crystals of the repressor in the presence of its corepressor arginine diffracted to a resolution of 2.4 Å and belong to the same space group, with similar unit-cell parameters.« less

  1. Open-tube diffusion techniques for InP/LnGaAs heterojunctior bipolar transistors

    NASA Astrophysics Data System (ADS)

    Schuitemaker, P.; Houston, P. A.

    1986-11-01

    Open-tube diffusion techniques used between 450 and 600° C are described which involve the supply of diffusant from a vapour source (via a solution) and a solid evaporated metal source. Investigations of Zn into InP and InGaAs(P) have been undertaken using both sources. SIMS profile analyses show that in the case of the vapour source the profiles indicate a concentration-dependent diffusion coefficient while the solid source diffusions can be well described by a Gaussian-type profile. The usefulness of the vapour source method has been demonstrated in the fabrication of bipolar transistors which exhibit good d.c. characteristics. The solid source method is limited by the slow diffusion velocity and more gradual profile. The InGaAs(P)/InP materials system has important applications in optical communications and future high speed microwave and switching devices. Useful technologies allied to the introduction of impurities into Si by diffusion, have gradually been emerging for use in the III-V semiconductor family. Closed tube systems1 have been used in order to contain the volatile group V species and prevent surface erosion. In addition, simpler open tube systems2,3 have been developed that maintain a sufficient overpressure of the group V element. Zn and Cd p-dopants have been studied extensively because of the volatility and relatively large diffusion rates in III-V semiconductors. Opentube diffusion into both InP and InGaAs2-6 has been studied but little detail has appeared concerning InGaAs and InGaAsP. In this paper we describe a comprehensive study of the diffusion of Zn into InP and InGaAs(P) using both open-tube vapour source and a Au/Zn/Au evaporated solid source with SiNx acting both as a mask and also an encapsulant to prevent loss of Zn and decomposition of the substrate material. The techniques have been successfully applied to the fabrication of InP/lnGaAs heterojunction bipolar transistors which show good dc characteristics. Reference to InGaAs in the text implies the InP lattice-matched composition In0.53Ga0.47As.

  2. Crystallization and preliminary X-ray diffraction analysis of hemextin A: a unique anticoagulant protein from Hemachatus haemachatus venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banerjee, Yajnavalka; Kumar, Sundramurthy; Jobichen, Chacko

    2007-08-01

    Crystals of hemextin A, a three-finger toxin isolated and purified from African Ringhals cobra (H. haemachatus), are orthorhombic, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å, and diffract to 1.5 Å resolution. Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapour-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1more » M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å and two molecules in the asymmetric unit. They diffracted to 1.5 Å resolution at beamline X25 at BNL.« less

  3. A sensor of alcohol vapours based on thin polyaniline base film and quartz crystal microbalance.

    PubMed

    Ayad, Mohamad M; El-Hefnawey, Gad; Torad, Nagy L

    2009-08-30

    Thin films of polyaniline base, emeraldine base (EB), coating on the quartz crystal microbalance (QCM) electrode were used as a sensitive layer for the detection of a number of primary aliphatic alcohols such as ethanol, methanol, 2-propanol and 1-propanol vapours. The frequency shifts (Deltaf) of the QCM were increased due to the vapour adsorption into the EB film. Deltaf were found to be linearly correlated with the concentrations of alcohols vapour in part per million (ppm). The sensitivity of the sensor was found to be governed by the chemical structure of the alcohol. The sensor shows a good reproducibility and reversibility. The diffusions of different alcohols vapour were studied and the diffusion coefficients (D) were calculated. It is concluded that the diffusion of the vapours into the EB film follows Fickian kinetics.

  4. Crystallization and preliminary X-ray analysis of 2,3-diketo-5-methylthiopentyl-1-phosphate enolase from Bacillus subtilis

    PubMed Central

    Tamura, Haruka; Ashida, Hiroki; Koga, Shogo; Saito, Yohtaro; Yadani, Tomonori; Kai, Yasushi; Inoue, Tsuyoshi; Yokota, Akiho; Matsumura, Hiroyoshi

    2009-01-01

    2,3-Diketo-5-methylthiopentyl-1-phosphate enolase (DK-MTP-1P enolase) from Bacillus subtilis was crystallized using the hanging-drop vapour-diffusion method. Crystals grew using PEG 3350 as the precipitant at 293 K. The crystals diffracted to 2.3 Å resolution at 100 K using synchrotron radiation and were found to belong to the monoclinic space group P21, with unit-cell parameters a = 79.3, b = 91.5, c = 107.0 Å, β = 90.8°. The asymmetric unit contained four molecules of DK-MTP-1P enolase, with a V M value of 2.2 Å3 Da−1 and a solvent content of 43%. PMID:19194007

  5. Expression, Purification And Preliminary X-Ray Analysis of the C-Terminal Domain of An Arginine Repressor Protein From Mycobacterium Tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, G.J.; Garen, C.R.; Cherney, M.M.

    2009-06-03

    The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 {angstrom}. The crystals belong to space group P1 and the Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of sixmore » molecules per unit cell.« less

  6. Purification, crystallization and preliminary crystallographic analysis of a 6-pyruvoyltetrahydropterin synthase homologue from Esherichia coli.

    PubMed

    Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho

    2008-02-01

    6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 A resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 A , and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 A , and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement.

  7. Purification, crystallization and preliminary crystallographic analysis of a 6-pyruvoyltetrahydropterin synthase homologue from Esherichia coli

    PubMed Central

    Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho

    2008-01-01

    6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 Å resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 Å, and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 Å, and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement. PMID:18271114

  8. Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of SET/TAF-Iß δN from Homo sapiens.

    PubMed

    Xu, Zhen; Yang, Weili; Shi, Nuo; Gao, Yongxiang; Teng, Maikun; Niu, Liwen

    2010-08-01

    The histone chaperone SET encoded by the SET gene, which is also known as template-activating factor Iß (TAF-Iß), is a multifunctional molecule that is involved in many biological phenomena such as histone binding, nucleosome assembly, chromatin remodelling, replication, transcription and apoptosis. A truncated SET/TAF-Iß ΔN protein that lacked the first 22 residues of the N-terminus but contained the C-terminal acidic domain and an additional His6 tag at the C-terminus was overexpressed in Escherichia coli and crystallized by the hanging-drop vapour-diffusion method using sodium acetate as precipitant at 283 K. The crystals diffracted to 2.7 A resolution and belonged to space group P4(3)2(1)2.

  9. Expression, purification, crystallization and preliminary X-ray crystallographic data from TktA, a transketolase from the lactic acid bacterium Lactobacillus salivarius

    PubMed Central

    Horsham, Matt; Saxby, Harriet; Blake, James; Isaacs, Neil W.; Mitchell, Tim J.; Riboldi-Tunnicliffe, Alan

    2010-01-01

    The enzyme transketolase from the lactic acid bacterium Lactobacillus salivarius (subsp. salivarius UCC118) has been recombinantly expressed and purified using an Escherichia coli expression system. Purified transketolase from L. salivarius has been crystallized using the vapour-diffusion technique. The crystals belonged to the trigonal space group P3221, with unit-cell parameters a = b = 75.43, c = 184.11 Å, and showed diffraction to 2.3 Å resolution. PMID:20693662

  10. Purification, crystallization and preliminary X-ray diffraction analysis of the Escherichia coli common pilus chaperone EcpB

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garnett, James A.; Diallo, Mamou; Matthews, Steve J., E-mail: s.j.matthews@imperial.ac.uk

    In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological andmore » abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones, and it could be implemented in similar systems where it has not been possible to obtain highly ordered crystals.« less

  11. The quaternary structure of the amidase from Geobacillus pallidus RAPc8 is revealed by its crystal packing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Agarkar, Vinod B.; Kimani, Serah W.; Cowan, Donald A.

    2006-12-01

    The amidase from G. pallidus RAPc8, a moderate thermophile, converts amides to the corresponding acids and ammonia and has application as an industrial catalyst. RAPc8 amidase has been cloned, expressed and purified, and then crystallized using the hanging-drop vapour-diffusion method. The amidase from Geobacillus pallidus RAPc8, a moderate thermophile, is a member of the nitrilase enzyme superfamily. It converts amides to the corresponding acids and ammonia and has application as an industrial catalyst. RAPc8 amidase has been cloned and functionally expressed in Escherichia coli and has been purified by heat treatment and a number of chromatographic steps. The enzyme wasmore » crystallized using the hanging-drop vapour-diffusion method. Crystals produced in the presence of 1.2 M sodium citrate, 400 mM NaCl, 100 mM sodium acetate pH 5.6 were selected for X-ray diffraction studies. A data set having acceptable statistics to 1.96 Å resolution was collected under cryoconditions using an in-house X-ray source. The space group was determined to be primitive cubic P4{sub 2}32, with unit-cell parameter a = 130.49 (±0.05) Å. The structure was solved by molecular replacement using the backbone of the hypothetical protein PH0642 from Pyrococcus horikoshii (PDB code 1j31) with all non-identical side chains substituted with alanine as a probe. There is one subunit per asymmetric unit. The subunits are packed as trimers of dimers with D3 point-group symmetry around the threefold axis in such a way that the dimer interface seen in the homologues is preserved.« less

  12. Crystallization and preliminary X-ray analysis of ginkbilobin-2 from Ginkgo biloba seeds: a novel antifungal protein with homology to the extracellular domain of plant cysteine-rich receptor-like kinases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyakawa, Takuya; Sawano, Yoriko; Miyazono, Ken-ichi

    Purification and crystallization of ginkbilobin-2 and its selenomethionine derivative allowed the collection of complete data to 2.38 Å resolution and multiwavelength anomalous diffraction data sets, respectively. The antifungal protein ginkbilobin-2 (Gnk2) from Ginkgo biloba seeds does not show homology to other pathogenesis-related proteins, but does show homology to the extracellular domain of plant cysteine-rich receptor-like kinases. Native Gnk2 purified from ginkgo nuts and the selenomethionine derivative of recombinant Gnk2 (SeMet-rGnk2) were crystallized by the sitting-drop vapour-diffusion method using different precipitants. X-ray diffraction data were collected from Gnk2 at 2.38 Å resolution and from SeMet-rGnk2 at 2.79 Å resolution using amore » synchrotron-radiation source. The crystals of both proteins belonged to the primitive cubic space group P2{sub 1}3, with unit-cell parameters a = b = c = 143.2 Å.« less

  13. Crystallization and preliminary X-ray crystallographic analysis of two vascular apoptosis-inducing proteins (VAPs) from Crotalus atrox venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Igarashi, Tomoko; Oishi, Yuko; Araki, Satohiko

    Vascular apoptosis-inducing protein 1 (VAP1) and VAP2 from C. atrox venom were crystallized in variety of different crystal forms. Diffraction data sets were obtained to 2.5 and 2.15 Å resolution for VAP1 and VAP2, respectively. VAPs are haemorrhagic snake-venom toxins belonging to the reprolysin family of zinc metalloproteinases. In vitro, VAPs induce apoptosis specifically in cultured vascular endothelial cells. VAPs have a modular structure that bears structural homology to mammalian ADAMs (a disintegrin and metalloproteinases). VAP1 is a homodimer with a MW of 110 kDa in which the monomers are connected by a single disulfide bridge. VAP2 is homologous tomore » VAP1 and exists as a monomer with a MW of 55 kDa. In the current study, several crystal forms of VAP1 and VAP2 were obtained using the vapour-diffusion method and diffraction data sets were collected using SPring-8 beamlines. The best crystals of VAP1 and VAP2 generated data sets to 2.5 and 2.15 Å resolution, respectively.« less

  14. Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko

    2005-08-01

    This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6{sub 2}22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. Amore » crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6{sub 2}22, with unit-cell parameters a = b = 145.97, c = 118.03 Å.« less

  15. Crystallization and preliminary X-ray diffraction analysis of an endo-1,4-β-D-glucanase from Aspergillus aculeatus F-50.

    PubMed

    Chen, Yun; Huang, Jian Wen; Chen, Chun Chi; Lai, Hui Lin; Jin, Jian; Guo, Rey Ting

    2015-04-01

    Cellulose is the most abundant renewable biomass on earth, and its decomposition has proven to be very useful in a wide variety of industries. Endo-1,4-β-D-glucanase (EC 3.2.1.4; endoglucanase), which can catalyze the random hydrolysis of β-1,4-glycosidic bonds to cleave cellulose into smaller fragments, is a key cellulolytic enzyme. An endoglucanase isolated from Aspergillus aculeatus F-50 (FI-CMCase) that was classified into glycoside hydrolase family 12 has been found to be effectively expressed in the industrial strain Pichia pastoris. Here, recombinant FI-CMCase was crystallized. Crystals belonging to the orthorhombic space group C222₁, with unit-cell parameters a = 74.2, b = 75.1, c = 188.4 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.6 Å resolution. Initial phase determination by molecular replacement clearly shows that the crystal contains two protein molecules in the asymmetric unit. Further model building and structure refinement are in progress.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Che-Yen; Karolinska Institute Structural Virology, F68 Karolinska University Hospital, SE-14186 Stockholm; Institute of Public Health, National Yang-Ming University, 112 Taipei,Taiwan

    A recombinant virus-like particle that is a potential oral hepatitis E vaccine was crystallized. Diffraction data were collected to 8.3 Å resolution and the X-ray structure was phased with the aid of a low-resolution density map determined using cryo-electron microscopy data. Hepatitis E virus (HEV) accounts for the majority of enterically transmitted hepatitis infections worldwide. Currently, there is no specific treatment for or vaccine against HEV. The major structural protein is derived from open reading frame (ORF) 2 of the viral genome. A potential oral vaccine is provided by the virus-like particles formed by a protein construct of partial ORF3more » protein (residue 70–123) fused to the N-terminus of the ORF2 protein (residues 112–608). Single crystals obtained by the hanging-drop vapour-diffusion method at 293 K diffract X-rays to 8.3 Å resolution. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 337, b = 343, c = 346 Å, α = β = γ = 90°, and contain one particle per asymmetric unit.« less

  17. Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans

    PubMed Central

    Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

    2013-01-01

    YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (V M) of 2.05 Å3 Da−1 and a solvent content of 40.2%. PMID:23695570

  18. Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans.

    PubMed

    Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

    2013-05-01

    YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (VM) of 2.05 Å(3) Da(-1) and a solvent content of 40.2%.

  19. Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6

    PubMed Central

    Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

    2013-01-01

    (2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P212121, with unit-cell parameters a = 88.35, b = 128.73, c = 131.03 Å. PMID:24100567

  20. Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli.

    PubMed

    Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke

    2007-08-01

    Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7''-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 A and belongs to space group P3(2)21, with unit-cell parameters a = b = 71.0, c = 125.0 A. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.

  1. Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

    PubMed Central

    Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke

    2007-01-01

    Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3221, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein. PMID:17671368

  2. Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6.

    PubMed

    Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

    2013-10-01

    (2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P2₁2₁2₁, with unit-cell parameters a=88.35, b=128.73, c=131.03 Å.

  3. Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum.

    PubMed

    Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J; Ren, Bin

    2013-04-01

    Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell parameters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niemi, Merja, E-mail: merja.niemi@joensuu.fi; Jänis, Janne; Jylhä, Sirpa

    The high-resolution mass-spectrometric characterization, crystallization and X-ray diffraction studies of a recombinant IgE Fab fragment in complex with bovine β-lactoglobulin are reported. A D1 Fab fragment containing the allergen-binding variable domains of the IgE antibody was characterized by ESI FT–ICR mass spectrometry and crystallized with bovine β-lactoglobulin (BLG) using the hanging-drop vapour-diffusion method at 293 K. X-ray data suitable for structure determination were collected to 2.8 Å resolution using synchrotron radiation. The crystal belonged to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 67.0, b = 100.6, c = 168.1 Å. The three-dimensional structure ofmore » the D1 Fab fragment–BLG complex will provide the first insight into IgE antibody–allergen interactions at the molecular level.« less

  5. Preparation of crystals for characterizing the Grb7 SH2 domain before and after complex formation with a bicyclic peptide antagonist.

    PubMed

    Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A

    2014-02-01

    Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.

  6. Real-time fluorescence quenching-based detection of nitro-containing explosive vapours: what are the key processes?

    PubMed

    Shaw, P E; Burn, P L

    2017-11-15

    The detection of explosives continues to be a pressing global challenge with many potential technologies being pursued by the scientific research community. Luminescence-based detection of explosive vapours with an organic semiconductor has attracted much interest because of its potential for detectors that have high sensitivity, compact form factor, simple operation and low-cost. Despite the abundance of literature on novel sensor materials systems there are relatively few mechanistic studies targeted towards vapour-based sensing. In this Perspective, we will review the progress that has been made in understanding the processes that control the real-time luminescence quenching of thin films by analyte vapours. These are the non-radiative quenching process by which the sensor exciton decays, the analyte-sensor intermolecular binding interaction, and the diffusion process for the analyte vapours in the film. We comment on the contributions of each of these processes towards the sensing response and, in particular, the relative roles of analyte diffusion and exciton diffusion. While the latter has been historically judged to be one of, if not the primary, causes for the high sensitivity of many conjugated polymers to nitrated vapours, recent evidence suggests that long exciton diffusion lengths are unnecessary. The implications of these results on the development of sensor materials for real-time detection are discussed.

  7. Cloning, purification, crystallization and preliminary crystallographic analysis of SecA from Enterococcus faecalis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meining, Winfried, E-mail: wim@csb.ki.se; Scheuring, Johannes; Fischer, Markus

    2006-06-01

    SecA ATPase from E. faecalis has been cloned, overexpressed, purified and crystallized. Crystals belong to space group C2 and diffract to 2.4 Å resolution. The gene coding for SecA from Enterococcus faecalis was cloned and overexpressed in Escherichia coli. In this protein, the lysine at position 6 was replaced by an asparagine in order to reduce sensitivity towards proteases. The modified protein was purified and crystallized. Crystals diffracting to 2.4 Å resolution were obtained using the vapour-diffusion technique. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 203.4, b = 49.8, c = 100.8 Å,more » α = γ = 90.0, β = 119.1°. A selenomethionine derivative was prepared and is currently being tested in crystallization trials.« less

  8. Purification, crystallization and preliminary X-ray crystallographic analysis of rice Bowman–Birk inhibitor from Oryza sativa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Yi-Hung; Li, Hsin-Tai; Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan

    2006-06-01

    Rice Bowman–Birk inhibitor was expressed and crystallized. Bowman–Birk inhibitors (BBIs) are cysteine-rich proteins with inhibitory activity against proteases that are widely distributed in monocot and dicot species. The expression of rice BBI from Oryza sativa is up-regulated and induced by pathogens or insects during germination of rice seeds. The rice BBI (RBTI) of molecular weight 15 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of rice BBI crystals at a resolution of 2.07 Å, the unit cell belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 74.37, b = 96.69, cmore » = 100.36 Å. Preliminary analysis indicates four BBI molecules in an asymmetric unit, with a solvent content of 58.29%.« less

  9. Crystallization and preliminary X-ray crystallographic analysis of the extracellular domain of LePRK2 from Lycopersicon esculentum.

    PubMed

    Xu, Anbi; Huang, Laiqiang

    2014-02-01

    The tomato (Lycopersicon esculentum) pollen-specific receptor kinase 2 (LePRK2) is a member of the large receptor-like kinase (RLK) family and is expressed specifically in mature pollen and pollen tubes in L. esculentum. Like other RLKs, LePRK2 contains a characteristic N-terminal leucine-rich repeat (LRR) extracellular domain, the primary function of which is in protein-protein interactions. The LePRK2 LRR is likely to bind candidate ligands from the external environment, leading to a signal transduction cascade required for successful pollination. LePRK2-LRR was purified using an insect-cell secretion expression system and was crystallized using the vapour-diffusion method. The crystals diffracted to a resolution of 2.50 Å and belonged to space group I4(1)22, with unit-cell parameters a = b = 93.94, c = 134.44 Å and one molecule per asymmetric unit.

  10. Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum

    PubMed Central

    Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J.; Ren, Bin

    2013-01-01

    Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell paramters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution. PMID:23545659

  11. Purification, crystallization and preliminary crystallographic analysis of Streptococcus pyogenes laminin-binding protein Lbp

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Linke, Christian, E-mail: clin180@ec.auckland.ac.nz; Caradoc-Davies, Tom T.; Australian Synchrotron, Clayton, Victoria 3168

    2008-02-01

    The S. pyogenes laminin-binding protein Lbp, which is essential for adhesion to human laminin, has been expressed, purified and crystallized. The laminin-binding protein Lbp (Spy2007) from Streptococcus pyogenes (a group A streptococcus) mediates adhesion to the human basal lamina glycoprotein laminin. Accordingly, Lbp is essential in in vitro models of cell adhesion and invasion. However, the molecular and structural basis of laminin binding by bacteria remains unknown. Therefore, the lbp gene has been cloned for recombinant expression in Escherichia coli. Lbp has been purified and crystallized from 30%(w/v) PEG 1500 by the sitting-drop vapour-diffusion method. The crystals belonged to themore » monoclinic space group P2{sub 1}, with unit-cell parameters a = 42.62, b = 92.16, c = 70.61 Å, β = 106.27°, and diffracted to 2.5 Å resolution.« less

  12. Crystallization and preliminary X-ray crystallographic analysis of the variable domain of Scl2.3, a streptococcal collagen-like protein from invasive M3-type Streptococcus pyogenes.

    PubMed

    Squeglia, Flavia; Bachert, Beth; Romano, Maria; Lukomski, Slawomir; Berisio, Rita

    2013-09-01

    Streptococcal collagen-like proteins (Scls) are widely expressed by the well recognized human pathogen Streptococcus pyogenes. These surface proteins contain a signature central collagen-like region and an amino-terminal globular domain, termed the variable domain, which is protruded away from the cell surface by the collagen-like domain. Despite their recognized importance in bacterial pathogenicity, no structural information is presently available on proteins of the Scl class. The variable domain of Scl2 from invasive M3-type S. pyogenes has successfully been crystallized using vapour-diffusion methods. The crystals diffracted to 1.5 Å resolution and belonged to space group H32, with unit-cell parameters a = 44.23, b = 44.23, c = 227.83 Å. The crystal structure was solved by single-wavelength anomalous dispersion using anomalous signal from a europium chloride derivative.|

  13. Crystallization and preliminary X-ray analysis of CTP:phosphoethanolamine cytidylyltransferase (ECT) from Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ohtsuka, Jun; Nagata, Koji; Lee, Woo Cheol

    2006-10-01

    CTP:phosphoethanolamine cytidylyltransferase from S. cerevisiae has been expressed, purified and crystallized. CTP:phosphoethanolamine cytidylyltransferase (ECT) is the enzyme that catalyzes the conversion of phosphoethanolamine to CDP-ethanolamine in the phosphatidylethanolamine-biosynthetic pathway (Kennedy pathway). ECT from Saccharomyces cerevisiae was crystallized by the sitting-drop vapour-diffusion method using PEG 4000 as precipitant. The crystals diffracted X-rays from a synchrotron-radiation source to 1.88 Å resolution. The space group was assigned as primitive tetragonal, P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 66.3, c = 150.8 Å. The crystals contain one ECT molecule in the asymmetric unit (V{sub M} = 2.2more » Å{sup 3} Da{sup −1}), with a solvent content of 43%.« less

  14. Crystallization and preliminary X-ray analysis of the NADPH-dependent 3-quinuclidinone reductase from Rhodotorula rubra

    PubMed Central

    Takeshita, Daijiro; Kataoka, Michihiko; Miyakawa, Takuya; Miyazono, Ken-ichi; Uzura, Atsuko; Nagata, Koji; Shimizu, Sakayu; Tanokura, Masaru

    2009-01-01

    (R)-3-Quinuclidinol is a useful compound that is applicable to the synthesis of various pharmaceuticals. The NADPH-dependent carbonyl reductase 3-­quinuclidinone reductase from Rhodotorula rubra catalyzes the stereospecific reduction of 3-quinuclidinone to (R)-3-quinuclidinol and is expected to be utilized in industrial production of this alcohol. 3-Quinuclidinone reductase from R. rubra was expressed in Escherichia coli and purified using Ni-affinity and ion-exchange column chromatography. Crystals of the protein were obtained by the sitting-drop vapour-diffusion method using PEG 8000 as the precipitant. The crystals belonged to space group P41212, with unit-cell parameters a = b = 91.3, c = 265.4 Å, and diffracted X-rays to 2.2 Å resolution. The asymmetric unit contained four molecules of the protein and the solvent content was 48.4%. PMID:19478454

  15. Crystallization and preliminary X-ray diffraction analysis of FabG from Yersinia pestis.

    PubMed

    Nanson, Jeffrey David; Forwood, Jade Kenneth

    2014-01-01

    The type II fatty-acid biosynthesis pathway of bacteria provides enormous potential for antibacterial drug development owing to the structural differences between this and the type I fatty-acid biosynthesis system found in mammals. β-Ketoacyl-ACP reductase (FabG) is responsible for the reduction of the β-ketoacyl group linked to acyl carrier protein (ACP), and is essential for the formation of fatty acids and bacterial survival. Here, the cloning, expression, purification, crystallization and diffraction of FabG from Yersinia pestis (ypFabG), the highly virulent causative agent of plague, are reported. Recombinant FabG was expressed, purified to homogeneity and crystallized via the hanging-drop vapour-diffusion technique. Diffraction data were collected at the Australian Synchrotron to 2.30 Å resolution. The crystal displayed P2(1)2(1)2(1) symmetry, with unit-cell parameters a = 68.22, b = 98.68, c = 169.84 Å, and four ypFabG molecules in the asymmetric unit.

  16. Purification, characterization and preliminary crystallographic studies of a cysteine protease from Pachyrrhizus erosus seeds.

    PubMed

    Chang, Shaojie; Song, Xiaomin; Yan, Ming; Zhou, Zhaocai; Wu, Fang; Gong, Weimin

    2004-01-01

    The proteins Spe31 and Spe32, named after their respective molecular weights of about 31 and 32 kDa, were purified simultaneously from the seeds of Pachyrrhizus erosus. They cannot be separated from each other by column chromatography. N-terminal sequence analysis indicated that they belonged to the papain family of cysteine proteases. An in-gel activity assay revealed that Spe31 possesses proteolytic activity while Spe32 only displays very weak activity for protein degradation. Both of them are glycoproteins as detected by the periodic acid and Schiff's reagent method. Crystals were obtained from the protein mixture by the hanging-drop vapour-diffusion method; they diffracted to a resolution of 2.61 A on an in-house X-ray source. The crystals belong to space group P4(1(3))2(1)2, with unit-cell parameters a = b = 61.96, c = 145.61 A. Gel electrophoresis under non-denaturing conditions showed that the protein crystallized was Spe31.

  17. Crystallization and preliminary X-ray analysis of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1

    PubMed Central

    Taketa, Midori; Nakagawa, Hanae; Habukawa, Mao; Osuka, Hisao; Kihira, Kiyohito; Komori, Hirofumi; Shibata, Naoki; Ishii, Masaharu; Igarashi, Yasuo; Nishihara, Hirofumi; Yoon, Ki-Seok; Ogo, Seiji; Shomura, Yasuhito; Higuchi, Yoshiki

    2015-01-01

    NAD+-reducing [NiFe] hydrogenases catalyze the oxidoreduction of dihydrogen concomitant with the interconversion of NAD+ and NADH. Here, the isolation, purification and crystallization of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1 are reported. Crystals of the NAD+-reducing [NiFe] hydrogenase were obtained within one week from a solution containing polyethylene glycol using the sitting-drop vapour-diffusion method and micro-seeding. The crystal diffracted to 2.58 Å resolution and belonged to space group C2, with unit-cell parameters a = 131.43, b = 189.71, c = 124.59 Å, β = 109.42°. Assuming the presence of two NAD+-reducing [NiFe] hydrogenase molecules in the asymmetric unit, V M was calculated to be 2.2 Å3  Da−1, which corresponds to a solvent content of 43%. Initial phases were determined by the single-wavelength anomalous dispersion method using the anomalous signal from the Fe atoms. PMID:25615977

  18. Cloning, purification, crystallization and preliminary X-ray studies of a carbohydrate-binding module from family 64 (StX).

    PubMed

    Campos, Bruna Medeia; Liberato, Marcelo Vizona; Polikarpov, Igor; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

    2015-03-01

    In recent years, biofuels have attracted great interest as a source of renewable energy owing to the growing global demand for energy, the dependence on fossil fuels, limited natural resources and environmental pollution. However, the cost-effective production of biofuels from plant biomass is still a challenge. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases to polysaccharides, is crucial for enzyme development. Aiming at the structural and functional characterization of novel CBMs involved in plant polysaccharide deconstruction, an analysis of the CAZy database was performed and CBM family 64 was chosen owing to its capacity to bind with high specificity to microcrystalline cellulose and to the fact that is found in thermophilic microorganisms. In this communication, the CBM-encoding module named StX was expressed, purified and crystallized, and X-ray diffraction data were collected from native and derivatized crystals to 1.8 and 2.0 Å resolution, respectively. The crystals, which were obtained by the hanging-drop vapour-diffusion method, belonged to space group P3121, with unit-cell parameters a = b = 43.42, c = 100.96 Å for the native form. The phases were found using the single-wavelength anomalous diffraction method.

  19. Purification, crystallization and preliminary crystallographic study of an IDS-epimerase from Agrobacterium tumefaciens BY6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bäuerle, Bettina; Sandalova, Tatyana; Schneider, Gunter

    2006-08-01

    This is the first report of the crystallization of an IDS-epimerase from A. tumefaciens BY6 and its l-selenomethionine derivative. The initial degradation of all stereoisomers of the complexing agent iminodisuccinate (IDS) is enabled by an epimerase in the bacterial strain Agrobacterium tumefaciens BY6. This protein was produced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method. Crystals of IDS-epimerase were obtained under several conditions. The best diffracting crystals were grown in 22% PEG 3350, 0.2 M (NH{sub 4}){sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 7.2 at 293 K. These crystals belong to the monoclinic space groupmore » P2{sub 1}, with unit-cell parameters a = 55.4, b = 104.2, c = 78.6 Å, β = 103.3°, and diffracted to 1.7 Å resolution. They contain two protein molecules per asymmetric unit. In order to solve the structure using the MAD phasing method, crystals of the l-selenomethionine-substituted epimerase were grown in the presence of 20% PEG 3350, 0.2 M Na{sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 8.5.« less

  20. Purification, identification and preliminary crystallographic studies of an allergenic protein from Lathyrus sativus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qureshi, Insaf A.; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

    2006-09-01

    A 24 kDa protein was purified from the seeds of L. sativus by ammonium sulfate fractionation and ion-exchange chromatography. Crystals were obtained by the hanging-drop vapour-diffusion method. A 24 kDa protein was purified from the seeds of Lathyrus sativus by ammonium sulfate fractionation and ion-exchange chromatography. The N-terminal amino-acid sequence showed significant homology with the 2S albumin class of seed storage proteins. The protein showed 85% sequence homology with the seed albumin of Pisum sativum within the 40 N-terminal residues. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cellmore » parameters a = 43.5, b = 82.7, c = 153.4 Å.« less

  1. Analysis of corrosion layers on protective coatings and high temperature materials in simulated service environments of modern power plants using SNMS, SIMS, SEM, TEM, RBS and X-ray diffraction studies.

    PubMed

    Nickel, H; Quadakkers, W J; Singheiser, L

    2002-10-01

    In three different examples, the effects of the oxidation behaviour as well as the microstructural stability of high temperature materials and protective coatings was determined by combining the results of kinetic studies with extensive analytical investigations using, among other techniques, SNMS, SIMS, SEM, TEM, Rutherford back scattering (RBS) as well as X-ray diffraction. 1). The effect of water vapour on the oxidation behaviour of 9% Cr steels in simulated combustion gases has been determined. The effects of O2 and H2O content on the oxidation behaviour of 9% Cr steel in the temperature range 600-800 degrees C showed that in dry oxygen a protective scale was formed with an oxidation rate controlled by diffusion in the protective scale. In the presence of water vapour, after an incubation period, the scales became non-protective as a result of a change in the oxidation limiting process. The destruction of the protective scale by water vapour does not only depend on H2O content but also on the H2O/O2-ratio. 2). The increase of component surface temperature in modern gas turbines leads to an enhanced oxidation attack of the blade coating. Improvements in corrosion resistance and longer lifetime thermal barrier coatings in gas turbines have been achieved by improvement of the high temperature properties of MCrAlY coatings by additions of minor alloying elements such as yttrium, silicon and titanium. 3). The use of oxide dispersion strengthened (ODS) alloys provides excellent creep resistance up to much higher temperatures than can be achieved with conventional wrought or cast alloys in combination with suitable high temperature oxidation/corrosion resistance. Investigation of the growth mechanisms of protective chromia and alumina scales were examined by a two-stage oxidation method with 18O tracer. The distribution of the oxygen isotopes in the oxide scale was determined by SIMS and SNMS. The results show the positive influence of a Y2O3 dispersion on the oxidation resistance of the ODS alloys and its effect on growth mechanisms.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Dongwen; Sun, Jianping; Zhao, Wei

    The CRD domain of GRP from H. sapiens has been expressed, purified and crystallized and X-ray diffraction data have been collected to a resolution of 2.0 Å. Galectins are a family of animal lectins which share similar carbohydrate-recognition domains (CRDs) and an affinity for β-galactosides. A novel human galectin-related protein named GRP (galectin-related protein; previously known as HSPC159) comprises only one conserved CRD with 38 additional N-terminal residues. The C-terminal fragment of human GRP (GRP-C; residues 38–172) containing the CRD has been expressed and purified. The protein was crystallized using the hanging-drop vapour-diffusion method from a solution containing 2% PEGmore » 400 and 2M ammonium sulfate in 100 mM Tris–HCl buffer pH 7.5. Diffraction data were collected to a resolution limit of 2.0 Å at beamline 3W1A of Beijing Synchrotron Radiation Facility at 100 K. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 123.07, b = 96.67, c = 61.56 Å, β = 118.72°. The estimated Matthews coefficient was 2.6 Å{sup 3} Da{sup −1}, corresponding to 51.8% solvent content.« less

  3. Current trends in protein crystallization.

    PubMed

    Gavira, José A

    2016-07-15

    Proteins belong to the most complex colloidal system in terms of their physicochemical properties, size and conformational-flexibility. This complexity contributes to their great sensitivity to any external change and dictate the uncertainty of crystallization. The need of 3D models to understand their functionality and interaction mechanisms with other neighbouring (macro)molecules has driven the tremendous effort put into the field of crystallography that has also permeated other fields trying to shed some light into reluctant-to-crystallize proteins. This review is aimed at revising protein crystallization from a regular-laboratory point of view. It is also devoted to highlight the latest developments and achievements to produce, identify and deliver high-quality protein crystals for XFEL, Micro-ED or neutron diffraction. The low likelihood of protein crystallization is rationalized by considering the intrinsic polypeptide nature (folded state, surface charge, etc) followed by a description of the standard crystallization methods (batch, vapour diffusion and counter-diffusion), including high throughput advances. Other methodologies aimed at determining protein features in solution (NMR, SAS, DLS) or to gather structural information from single particles such as Cryo-EM are also discussed. Finally, current approaches showing the convergence of different structural biology techniques and the cross-methodologies adaptation to tackle the most difficult problems, are presented. Current advances in biomacromolecules crystallization, from nano crystals for XFEL and Micro-ED to large crystals for neutron diffraction, are covered with special emphasis in methodologies applicable at laboratory scale. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis.

    PubMed

    Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

    2006-03-01

    Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 A, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 A.

  5. Alcohol vapours sensor based on thin polyaniline salt film and quartz crystal microbalance.

    PubMed

    Ayad, Mohamad M; Torad, Nagy L

    2009-06-15

    A sensor based on the quartz crystal microbalance (QCM) technique was developed for detection of a number of primary aliphatic alcohols such as ethanol, methanol, 1-propanol, and 2-propanol vapours. Detection was based on a sensitive and a thin film of polyaniline, emeraldine salt (ES), coated the QCM electrode. The frequency shifts (Delta f) of the QCM were increased due to the vapour absorption into the ES film. The values of Delta f were found to be linearly correlated with the concentrations of alcohols vapour in mg L(-1). The changes in frequency are due to the hydrophilic character of the ES and the electrostatic interaction as well as the type of the alcohol. The sensor shows a good reproducibility and reversibility. The diffusion and diffusion coefficient (D) of different alcohols vapour were determined. It was found that the sensor follows Fickian kinetics.

  6. The frequency-dependent response of single aerosol particles to vapour phase oscillations and its application in measuring diffusion coefficients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Preston, Thomas C.; Davies, James F.; Wilson, Kevin R.

    A new method for measuring diffusion in the condensed phase of single aerosol particles is proposed and demonstrated. The technique is based on the frequency-dependent response of a binary particle to oscillations in the vapour phase of one of its chemical components. Here, we discuss how this physical situation allows for what would typically be a non-linear boundary value problem to be approximately reduced to a linear boundary value problem. For the case of aqueous aerosol particles, we investigate the accuracy of the closed-form analytical solution to this linear problem through a comparison with the numerical solution of the fullmore » problem. Then, using experimentally measured whispering gallery modes to track the frequency-dependent response of aqueous particles to relative humidity oscillations, we determine diffusion coefficients as a function of water activity. The measured diffusion coefficients are compared to previously reported values found using the two common experiments: (i) the analysis of the sorption/desorption of water from a particle after a step-wise change to the surrounding relative humidity and (ii) the isotopic exchange of water between a particle and the vapour phase. The technique presented here has two main strengths: first, when compared to the sorption/desorption experiment, it does not require the numerical evaluation of a boundary value problem during the fitting process as a closed-form expression is available. Second, when compared to the isotope exchange experiment, it does not require the use of labeled molecules. Therefore, the frequency-dependent experiment retains the advantages of these two commonly used methods but does not suffer from their drawbacks.« less

  7. The frequency-dependent response of single aerosol particles to vapour phase oscillations and its application in measuring diffusion coefficients

    DOE PAGES

    Preston, Thomas C.; Davies, James F.; Wilson, Kevin R.

    2017-01-13

    A new method for measuring diffusion in the condensed phase of single aerosol particles is proposed and demonstrated. The technique is based on the frequency-dependent response of a binary particle to oscillations in the vapour phase of one of its chemical components. Here, we discuss how this physical situation allows for what would typically be a non-linear boundary value problem to be approximately reduced to a linear boundary value problem. For the case of aqueous aerosol particles, we investigate the accuracy of the closed-form analytical solution to this linear problem through a comparison with the numerical solution of the fullmore » problem. Then, using experimentally measured whispering gallery modes to track the frequency-dependent response of aqueous particles to relative humidity oscillations, we determine diffusion coefficients as a function of water activity. The measured diffusion coefficients are compared to previously reported values found using the two common experiments: (i) the analysis of the sorption/desorption of water from a particle after a step-wise change to the surrounding relative humidity and (ii) the isotopic exchange of water between a particle and the vapour phase. The technique presented here has two main strengths: first, when compared to the sorption/desorption experiment, it does not require the numerical evaluation of a boundary value problem during the fitting process as a closed-form expression is available. Second, when compared to the isotope exchange experiment, it does not require the use of labeled molecules. Therefore, the frequency-dependent experiment retains the advantages of these two commonly used methods but does not suffer from their drawbacks.« less

  8. Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis

    PubMed Central

    Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

    2006-01-01

    Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 Å, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 Å. PMID:16511316

  9. Expression, purification, crystallization and preliminary X-ray crystallographic analysis of a resuscitation-promoting factor from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ruggiero, Alessia; Tizzano, Barbara; Geerlof, Arie

    2007-10-01

    The first crystallization of a resuscitation-promoting factor has been performed. Multiwavelength anomalous dispersion experiments have been carried out to obtain experimental phases using data at 2.9 Å resolution from a selenomethionine derivative. The resuscitation-promoting factor RpfB, the most complex of the five resuscitation-promoting factors produced by M. tuberculosis, is devoted to bacterial reactivation from the dormant state. RpfB consists of 362 residues predicted to form five domains. An RpfB fragment containing the protein catalytic domain and a G5 domain has been successfully crystallized using vapour-diffusion methods. This is the first crystallographic study of a resuscitation-promoting factor. Crystals of this proteinmore » belong to space group I422, with unit-cell parameters a = 97.63, b = 97.63, c = 114.87 Å. Diffraction data have also been collected from a selenomethionine derivative at 2.9 Å resolution. Model building using the phases derived from the multiwavelength anomalous dispersion experiment is in progress.« less

  10. Extracellular overproduction and preliminary crystallographic analysis of a family I.3 lipase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Angkawidjaja, Clement; You, Dong-Ju; Matsumura, Hiroyoshi

    2007-03-01

    A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. The crystal was grown at 277 K by the hanging-drop vapour-diffusion method. Native X-ray diffraction data were collected to 1.7 Å resolution using synchrotron radiation at station BL38B1, SPring-8. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 48.79, b = 84.06,more » c = 87.04 Å. Assuming the presence of one molecule per asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.73 Å{sup 3} Da{sup −1} and the solvent content was 55%.« less

  11. Purification, crystallization and preliminary crystallographic studies of haemoglobin from mongoose (Helogale parvula) in two different crystal forms induced by pH variation.

    PubMed

    Mohamed Abubakkar, M; Saraboji, K; Ponnuswamy, M N

    2013-02-01

    Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively.

  12. Expression, purification and preliminary X-ray analysis of the C-terminal domain of an arginine repressor protein from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, George J.; Garen, Craig R.; Cherney, Maia M.

    2007-11-01

    The C-terminal portion of the arginine repressor protein from M. tuberculosis H37Rv has been crystallized. The complete transcriptional factor regulates arginine biosynthesis by binding operator DNA when arginine is bound at the C-terminal domain. The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 Å. The crystals belong to space group P1 and themore » Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of six molecules per unit cell.« less

  13. Crystallization and initial crystallographic characterization of the Corynebacterium glutamicum nitrilotriacetate monooxygenase component A

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Kyung-Jin, E-mail: kkj@postech.ac.kr; Kim, Sujin; Lee, Sujin

    2006-11-01

    The Corynebacterium glutamicum NTA monooxygenase component A protein, which plays the central role in NTA biodegradation, was crystallized. The initial X-ray crystallographic characterization is reported. Safety and environmental concerns have recently dictated the proper disposal of nitrilotriacetate (NTA). Biodegradation of NTA is initiated by NTA monooxygenase, which is composed of two proteins: component A and component B. The NTA monooxygenase component A protein from Corynebacterium glutamicum was crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium sulfate as the precipitant. X-ray diffraction data were collected to a maximum resolution of 2.5 Å on a synchrotron beamline. The crystalmore » belongs to the monoclinic space group C2, with unit-cell parameters a = 111.04, b = 98.51, c = 171.61 Å, β = 101.94°. The asymmetric unit consists of four molecules, corresponding to a packing density of 2.3 Å{sup 3} Da{sup −1}. The structure was solved by molecular replacement. Structure refinement is in progress.« less

  14. Cloning, purification, crystallization and preliminary X-ray studies of a carbohydrate-binding module (CBM_E1) derived from sugarcane soil metagenome.

    PubMed

    Campos, Bruna Medeia; Alvarez, Thabata Maria; Liberato, Marcelo Vizona; Polikarpov, Igor; Gilbert, Harry J; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

    2014-09-01

    In recent years, owing to the growing global demand for energy, dependence on fossil fuels, limited natural resources and environmental pollution, biofuels have attracted great interest as a source of renewable energy. However, the production of biofuels from plant biomass is still considered to be an expensive technology. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases for polysaccharide degradation, is attracting growing attention. Aiming at the identification of new CBMs, a sugarcane soil metagenomic library was analyzed and an uncharacterized CBM (CBM_E1) was identified. In this study, CBM_E1 was expressed, purified and crystallized. X-ray diffraction data were collected to 1.95 Å resolution. The crystals, which were obtained by the sitting-drop vapour-diffusion method, belonged to space group I23, with unit-cell parameters a = b = c = 88.07 Å.

  15. Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika

    2007-08-01

    The crystallization and preliminary X-ray studies of the aminoglycoside antibiotic-modifying enzyme hygromycin B phosphotransferase from E. coli are reported. Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3{submore » 2}21, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.« less

  16. Crystallization and preliminary X-ray crystallographic analysis of BxlA, an intracellular beta-D-xylosidase from Streptomyces thermoviolaceus OPC-520.

    PubMed

    Morioka, Hideaki; Miki, Yasuhiro; Saito, Kei; Tomoo, Koji; Ishida, Toshimasa; Hasegawa, Tomokazu; Yamano, Akihito; Takada, Chiaki; Miyamoto, Katsushiro; Tsujibo, Hiroshi

    2010-07-01

    BxlA from Streptomyces thermoviolaceus OPC-520, together with the extracellular BxlE and the integral membrane proteins BxlF and BxlG, constitutes a xylanolytic system that participates in the intracellular transport of xylan-degradation products and the production of xylose. To elucidate the mechanism of the hydrolytic degradation of xylooligosaccharides to xylose at the atomic level, X-ray structural analysis of BxlA was attempted. The recombinant BxlA protein (molecular weight 82 kDa) was crystallized by the hanging-drop vapour-diffusion method at 289 K. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 142.2, b = 129.5, c = 101.4 A, beta = 119.8 degrees , and contained two molecules per asymmetric unit (V(M) = 2.47 A(3) Da(-1)). Diffraction data were collected to a resolution to 2.50 A and provided a data set with an overall R(merge) of 8.3%.

  17. Purification, identification and preliminary crystallographic studies of a 2S albumin seed protein from Lens culinaris

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gupta, Pankaj; Gaur, Vineet; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

    2008-08-01

    A 2S albumin from L. culinaris was purified and crystallized and preliminary crystallographic studies were carried out. Lens culinaris (lentil) is a widely consumed high-protein-content leguminous crop. A 2S albumin protein (26.5 kDa) has been identified using NH{sub 2}-terminal sequencing from a 90% ammonium sulfate saturation fraction of total L. culinaris seed protein extract. The NH{sub 2}-terminal sequence shows very high homology to PA2, an allergy-related protein from Pisum sativum. The 2S albumin protein was purified using a combination of size-exclusion and ion-exchange chromatography. Crystals of the 2S seed albumin obtained using the hanging-drop vapour-diffusion method diffracted to 2.5 Åmore » resolution and were indexed in space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 78.6, c = 135.2 Å.« less

  18. Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano

    The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.« less

  19. Crystallization and preliminary X-ray analysis of alginate lyases A1-II and A1-II′ from Sphingomonas sp. A1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamasaki, Masayuki; Ogura, Kohei; Moriwaki, Satoko

    The crystallization and preliminary characterization of the family PL-7 alginate lyases A1-II and A1-II′ from Sphingomonas sp. A1 are presented. Alginate lyases depolymerize alginate, a heteropolysaccharide consisting of α-l-guluronate and β-d-mannuronate, through a β-elimination reaction. The alginate lyases A1-II (25 kDa) and A1-II′ (25 kDa) from Sphingomonas sp. A1, which belong to polysaccharide lyase family PL-7, exhibit 68% homology in primary structure but have different substrate specificities. To determine clearly the structural basis for substrate recognition in the depolymerization mechanism by alginate lyases, both proteins were crystallized at 293 K using the vapour-diffusion method. A crystal of A1-II belonged tomore » space group P2{sub 1} and diffracted to 2.2 Å resolution, with unit-cell parameters a = 51.3, b = 30.1, c = 101.6 Å, β = 100.2°, while a crystal of A1-II′ belonged to space group P2{sub 1}2{sub 1}2{sub 1} and diffracted to 1.0 Å resolution, with unit-cell parameters a = 34.6, b = 68.5, c = 80.3 Å.« less

  20. Purification, crystallization and preliminary X-ray diffraction studies on avian haemoglobin from pigeon (Columba livia).

    PubMed

    Sathya Moorthy, Pon; Neelagandan, K; Balasubramanian, M; Ponnuswamy, M N

    2009-02-01

    Haemoglobin is a physiologically significant metalloprotein that is involved in the exchange of gases for sustaining life. The respiratory system of birds is unique and complex compared with that of mammals. Many investigations of avian haemoglobins have revealed the presence of inositol pentaphosphate (IP5), a principal allosteric effector that is involved in regulation of their function. Structural investigations of avian haemoglobins are presently not adequate to explain their function. Efforts have been made in this direction in order to understand the oxygen-binding affinity involved in adapting to hypoxia in avian haemoglobins. Fresh whole blood was collected from pigeon (Columba livia) and purified using a DEAE cellulose anion-exchange chromatographic column. Crystallization of pigeon haemoglobin was accomplished using the hanging-drop vapour-diffusion method using PEG 3350 as a precipitant in 50 mM sodium acetate buffer pH 5.5 with 1 M NaCl. Data collection was carried out using a MAR345 image-plate detector system. The crystals diffracted to 2 A resolution. Pigeon haemoglobin crystallizes in a triclinic space group, with two whole biological molecules in the asymmetric unit and with unit-cell parameters a = 55.005, b = 65.528, c = 104.370 A, alpha = 78.742, beta = 89.819, gamma = 65.320 degrees .

  1. Phormidium phycoerythrin forms hexamers in crystals: a crystallographic study

    PubMed Central

    Sonani, Ravi Raghav; Sharma, Mahima; Gupta, Gagan Deep; Kumar, Vinay; Madamwar, Datta

    2015-01-01

    The crystallographic analysis of a marine cyanobacterium (Phormidium sp. A09DM) phycoerythrin (PE) that shows distinct sequence features compared with known PE structures from cyanobacteria and red algae is reported. Phormidium PE was crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant. Diffraction data were collected on the protein crystallography beamline at the Indus-2 synchrotron. The crystals diffracted to about 2.1 Å resolution at 100 K. The crystals, with an apparent hexagonal morphology, belonged to space group P1, with unit-cell parameters a = 108.3, b = 108.4 Å, c = 116.6 Å, α = 78.94, β = 82.50, γ = 60.34°. The molecular-replacement solution confirmed the presence of 12 αβ monomers in the P1 cell. The Phormidium PE elutes as an (αβ)3 trimer of αβ monomers from a molecular-sieve column and exists as [(αβ)3]2 hexamers in the crystal lattice. Unlike red algal PE proteins, the hexamers of Phormidium PE do not form higher-order structures in the crystals. The existence of only one characteristic visual absorption band at 564 nm suggests the presence of phycoerythrobilin chromophores, and the absence of any other types of bilins, in the Phormidium PE assembly. PMID:26249689

  2. Crystallization and preliminary X-ray diffraction analysis of the CRISPR-Cas RNA-silencing Cmr complex.

    PubMed

    Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki

    2015-06-01

    Clustered regularly interspaced short palindromic repeat (CRISPR)-derived RNA (crRNA) and CRISPR-associated (Cas) proteins constitute a prokaryotic adaptive immune system (CRISPR-Cas system) that targets and degrades invading genetic elements. The type III-B CRISPR-Cas Cmr complex, composed of the six Cas proteins (Cmr1-Cmr6) and a crRNA, captures and cleaves RNA complementary to the crRNA guide sequence. Here, a Cmr1-deficient functional Cmr (CmrΔ1) complex composed of Pyrococcus furiosus Cmr2-Cmr3, Archaeoglobus fulgidus Cmr4-Cmr5-Cmr6 and the 39-mer P. furiosus 7.01-crRNA was prepared. The CmrΔ1 complex was cocrystallized with single-stranded DNA (ssDNA) complementary to the crRNA guide by the vapour-diffusion method. The crystals diffracted to 2.1 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 75.5, b = 76.2, c = 139.2 Å, α = 90.3, β = 104.8, γ = 118.6°. The asymmetric unit of the crystals is expected to contain one CmrΔ1-ssDNA complex, with a Matthews coefficient of 2.03 Å(3) Da(-1) and a solvent content of 39.5%.

  3. Crystallization and X-ray diffraction analysis of the CH domain of the cotton kinesin GhKCH2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qin, Xinghua; The Fourth Military Medical University, No. 169 Changlexi Road, Xincheng District, Xi’an 710032, People’s Republic of; Chen, Ziwei

    The cloning, expression, purification and crystallization of the CH domain of the plant-specific kinesin GhKCH2 is reported. GhKCH2 belongs to a group of plant-specific kinesins (KCHs) containing an actin-binding calponin homology (CH) domain in the N-terminus. Previous studies revealed that the GhKCH2 CH domain (GhKCH2-CH) had a higher affinity for F-actin (K{sub d} = 0.42 ± 0.02 µM) than most other CH-domain-containing proteins. To understand the underlying mechanism, prokaryotically expressed GhKCH2-CH (amino acids 30–166) was purified and crystallized. Crystals were grown by the sitting-drop vapour-diffusion method using 0.1 M Tris–HCl pH 7.0, 20%(w/v) PEG 8000 as a precipitant. The crystalsmore » diffracted to a resolution of 2.5 Å and belonged to space group P2{sub 1}, with unit-cell parameters a = 41.57, b = 81.92, c = 83.00 Å, α = 90.00, β = 97.31, γ = 90.00°. Four molecules were found in the asymmetric unit with a Matthews coefficient of 2.22 Å{sup 3} Da{sup −1}, corresponding to a solvent content of 44.8%.« less

  4. Growth of h-BN on copper (110) in a LEEM

    NASA Astrophysics Data System (ADS)

    Herrmann, Christoph; Omelchenko, Pavlo; Kavanagh, Karen L.

    2018-03-01

    Hexagonal boron nitride (h-BN) was grown by borazine vapour deposition on single crystalline Cu (110) substrates at 740 °C. The growth was investigated in situ using a Low-Energy Electron Microscope (LEEM). Substrates were prepared ex situ by mechanical and electrochemical methods and once in the LEEM system, by annealing in a H2 atmosphere resulting in a reconstructed surface. Exposure to borazine vapour resulted in the nucleation of well-aligned trigonal h-BN islands, which merged to ribbons along surface steps, and into larger, more irregularly shaped features. A coverage of up to 60% was achieved with an exposure of 3900 L. A diffraction ring in the low energy electron diffraction pattern was observed with a preferential alignment along the Cu 〈 111 〉 directions of the underlying substrate. Low-energy electron reflectivity scans, as well as x-ray photoelectron and Raman spectroscopies, confirmed the presence of a partial monolayer of h-BN on the surface.

  5. 4H-SiC p i n diodes grown by sublimation epitaxy in vacuum (SEV) and their application as microwave diodes

    NASA Astrophysics Data System (ADS)

    Camara, N.; Zekentes, K.; Zelenin, V. V.; Abramov, P. L.; Kirillov, A. V.; Romanov, L. P.; Boltovets, N. S.; Krivutsa, V. A.; Thuaire, A.; Bano, E.; Tsoi, E.; Lebedev, A. A.

    2008-02-01

    Sublimation epitaxy under vacuum (SEV) was investigated as a method for growing 4H-SiC epitaxial structures for p-i-n diode fabrication. The SEV-grown 4H-SiC material was investigated with scanning electron microscopy (SEM), atomic force microscopy (AFM), x-ray diffraction, photo-luminescence spectroscopy (PL), cathodo-luminescence (CL) spectroscopy, photocurrent method for carrier diffusion length determination, electro-luminescence microscopy (EL), deep level transient spectroscopy (DLTS), C-V profiling and Hall-effect measurements. When possible, the same investigation techniques were used in parallel with similar layers grown by chemical vapour deposition (CVD) epitaxy and the physical properties of the two kind of epitaxied layers were compared. p-i-n diodes were fabricated in parallel on SEV and CVD-grown layers and showed close electrical performances in dc mode in term of capacitance, resistance and transient time switching, despite the lower mobility and the diffusion length of the SEV-grown layers. X-band microwave switches based on the SEV-grown p-i-n diodes have been demonstrated with insertion loss lower than 4 dB and an isolation higher than 17 dB. These single-pole single-throw (SPST) switches were able to handle a pulsed power up to 1800 W in isolation mode, similar to the value obtained with switches incorporating diodes with CVD-grown layers.

  6. Crystallization and preliminary X-ray diffraction studies of delta-toxin from Clostridium perfringens.

    PubMed

    Huyet, Jessica; Gilbert, Maryse; Popoff, Michel R; Basak, Ajit

    2011-03-01

    Clostridium perfringens is a Gram-positive anaerobic bacterium that is responsible for a wide range of diseases in humans and both wild and domesticated animals, including birds. C. perfringens is notable for its ability to produce a plethora of toxins, e.g. phospholipases C (alpha-toxin), pore-forming toxins (epsilon-toxin, beta-toxin and enterotoxin) and binary toxins (iota-toxin). Based on alpha-, beta-, epsilon- and iota-toxin production, the bacterium is classified into five different toxinotypes (A-E). Delta-toxin, which is a 32.6 kDa protein with 290 amino acids, is one of three haemolysins released by type C and possibly by type B strains of C. perfringens. This toxin is immunogenic and lytic to erythrocytes from the even-toed ungulates sheep, goats and pigs, and is cytotoxic to other cell types such as rabbit macrophages, human monocytes and blood platelets from goats, rabbits, guinea pigs and humans. The recombinant delta-toxin has been cloned, expressed, purified and crystallized in two different crystal forms by the hanging-drop vapour-diffusion method. Of these two different crystal forms, only the form II crystal diffracted to atomic resolution (dmin=2.4 Å), while the form I crystal diffracted to only 15 Å resolution. The form II crystals belonged to space group P2(1)2(1)2, with one molecule in the crystallographic asymmetric unit and unit-cell parameters a=49.66, b=58.48, c=112.93 Å.

  7. Thermal stability of γ-Fe2O3 nanoparticles and their employment for sensing of acetone vapours

    NASA Astrophysics Data System (ADS)

    Luby, Š.; Ivančo, J.; Jergel, M.; Švec, P., Jr.; Kotlár, M.; Kostiuk, D.; Halahovets, J.; Kollár, J.; Mosnáček, J.; Majková, E.

    2017-12-01

    Stability of γ-Fe2O3 nanoparticles-based films upon an isochronal annealing in air was investigated by x-ray diffraction, differential scanning calorimetry, and thermogravimetry. The γ-α transformation temperature increased owing to the nanoscaling of Fe2O3; the higher stability of the γ phase was explained on the ground of the surface free energy of nanoparticles (with the size of about 6.4 nm). Further, chemiresistors based on the Fe2O3 nanoparticle bilayer prepared by the Langmuir-Schaefer method were fabricated and examined in terms of their sensitivity to acetone vapours down to 500 ppb concentration in air.

  8. Purification, crystallization and preliminary X-ray diffraction analysis of a soluble variant of the monoglyceride lipase Yju3p from the yeast Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rengachari, Srinivasan; Aschauer, Philipp; Sturm, Christian

    A soluble variant of the monoglyceride lipase Yju3p was successfully expressed, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. The protein Yju3p is the orthologue of monoglyceride lipases in the yeast Saccharomyces cerevisiae. A soluble variant of this lipase termed s-Yju3p (38.3 kDa) was generated and purified to homogeneity by affinity and size-exclusion chromatography. s-Yju3p was crystallized in a vapour-diffusion setup at 293 K and a complete data set was collected to 2.4 Å resolution. The crystal form was orthorhombic (space group P2{sub 1}2{sub 1}2{sub 1}), with unit-cell parameters a = 77.2, b = 108.6, c =more » 167.7 Å. The asymmetric unit contained four molecules with a solvent content of 46.4%.« less

  9. Crystallization, X-ray diffraction analysis and preliminary structure determination of the polygalacturonase PehA from Agrobacterium vitis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vordtriede, Paul B.; Yoder, Marilyn D., E-mail: yoderm@umkc.edu

    2008-07-01

    The acidic polygalacturonase PehA from A. vitis has been crystallized. A molecular-replacement solution indicated a right-handed parallel β-helix fold. Polygalacturonases are pectate-degrading enzymes that belong to glycoside hydrolase family 28 and hydrolyze the α-1,4 glycosidic bond between neighboring galacturonasyl residues of the homogalacturonan substrate. The acidic polygalacturonase PehA from Agrobacterium vitis was overexpressed in Escherichia coli, where it accumulated in the periplasmic fraction. It was purified to homogeneity via a two-step chromatography procedure and crystallized using the hanging-drop vapour-diffusion technique. PehA crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 52.387, b = 62.738, c = 149.165more » Å, β = 89.98°. Crystals diffracted to 1.59 Å resolution and contained two molecules per asymmetric unit. An initial structure determination by molecular replacement indicated a right-handed parallel β-helix fold.« less

  10. Optical and structural properties of protein/gold hybrid bio-nanofilms prepared by layer-by-layer method.

    PubMed

    Pál, Edit; Hornok, Viktória; Sebok, Dániel; Majzik, Andrea; Dékány, Imre

    2010-08-01

    Lysozyme/gold thin layers were prepared by layer-by-layer (LbL) self-assembly method. The build-up of the films was followed by UV-vis-absorbance spectra, quartz crystal microbalance (QCM) and surface plasmon resonance (SPR) techniques. The structural property of films was examined by X-ray diffraction (XRD) measurements, while their morphology was studied by scanning electron microscopy (SEM) and atomic force microscopy (AFM). It was found that gold nanoparticles (NPs) had cubic crystalline structure, the primary particles form aggregates in the thin layer due to the presence of lysozyme molecules. The UV-vis measurements prove change in particle size while the colour of the film changes from wine-red to blue. The layer thickness of films was determined using the above methods and the loose, porous structure of the films explains the difference in the results. The vapour adsorption property of hybrid layers was also studied by QCM using different saturated vapours and ammonia gas. The lysozyme/Au films were most sensitive for ammonia gas among the tested gases/vapours due to the strongest interaction between the functional groups of the protein. Copyright 2010 Elsevier B.V. All rights reserved.

  11. Crystallization and initial X-ray diffraction studies of scaffolding protein (gp7) of bacteriophage ϕ29

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Badasso, Mohammed O., E-mail: badas001@umn.edu; Anderson, Dwight L.; Department of Oral Science, University of Minnesota, Minneapolis, MN 55455

    2005-04-01

    ϕ29 bacteriophage scaffolding protein (gp7) has been overproduced in E. coli, purified, crystallized and characterized by X-ray diffraction. Two distinct crystal forms were obtained and a diffraction data set was collected to 1.8 Å resolution. The Bacillus subtilis bacteriophage ϕ29 scaffolding protein (gp7) has been crystallized by the hanging-drop vapour-diffusion method at 293 K. Two new distinct crystal forms that both differed from a previously crystallized and solved scaffolding protein were grown under the same conditions. Form I belongs to the primitive tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 77.13, c = 37.12 Å.more » Form II crystals exhibit an orthorhombic crystal form, with space group C222 and unit-cell parameters a = 107.50, b = 107. 80, c = 37.34 Å. Complete data sets have been collected to 1.78 and 1.80 Å for forms I and II, respectively, at 100 K using Cu Kα X-rays from a rotating-anode generator. Calculation of a V{sub M} value of 2.46 Å{sup 3} Da{sup −1} for form I suggests the presence of one molecule in the asymmetric unit, corresponding to a solvent content of 50.90%, whereas form II has a V{sub M} of 4.80 Å{sup 3} Da{sup −1} with a solvent content of 48.76% and two molecules in the asymmetric unit. The structures of both crystal forms are being determined by the molecular-replacement method using the coordinates of the published crystal structure of gp7.« less

  12. Predictive model to describe water migration in cellular solid foods during storage.

    PubMed

    Voogt, Juliën A; Hirte, Anita; Meinders, Marcel B J

    2011-11-01

    Water migration in cellular solid foods during storage causes loss of crispness. To improve crispness retention, physical understanding of this process is needed. Mathematical models are suitable tools to gain this physical knowledge. Water migration in cellular solid foods involves migration through both the air cells and the solid matrix. For systems in which the water migration distance is large compared with the cell wall thickness of the solid matrix, the overall water flux through the system is dominated by the flux through the air. For these systems, water migration can be approximated well by a Fickian diffusion model. The effective diffusion coefficient can be expressed in terms of the material properties of the solid matrix (i.e. the density, sorption isotherm and diffusion coefficient of water in the solid matrix) and the morphological properties of the cellular structure (i.e. water vapour permeability and volume fraction of the solid matrix). The water vapour permeability is estimated from finite element method modelling using a simplified model for the cellular structure. It is shown that experimentally observed dynamical water profiles of bread rolls that differ in crust permeability are predicted well by the Fickian diffusion model. Copyright © 2011 Society of Chemical Industry.

  13. Crystallization and X-ray diffraction analysis of salicylate synthase, a chorismate-utilizing enyme involved in siderophore biosynthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parsons, James F., E-mail: parsonsj@umbi.umd.edu; Shi, Katherine; Calabrese, Kelly

    2006-03-01

    Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have beenmore » grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2{sub 1}) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase.« less

  14. Measurement of the densities of Cu and Ag vapours in a low-voltage switch using the hook method

    NASA Astrophysics Data System (ADS)

    Lins, Günter

    2012-05-01

    In a research model of a low-voltage circuit breaker with fixed contacts and windows for optical access, arcs powered by either a high-current transformer or a capacitor bank were initiated by the explosion of tungsten wires. Air at atmospheric pressure was the switching medium. The number densities of neutral silver and copper vapours from contacts and arc runners were measured simultaneously by the hook method using a Mach-Zehnder interferometer combined with a 1 m spectrograph and a gated intensified CCD camera. When an arc current was flowing, a substantial fraction of the metal vapour was ionized, and thus not amenable to a density measurement with the technique chosen. To nevertheless obtain approximate density values, the arc current was forced to zero within 8 to 10 µs at a preset time and measurements were carried out 100 µs after extinction of the arc. At that time the metal vapour was expected to have recombined to a large extent but not yet diffused to the walls in significant amounts. Depending on the current amplitude reached within the arc duration the arc remained anchored to the silver contacts or commutated to the copper arc runners. At a maximum current amplitude of 650 A Ag vapour densities of the order of 1022 m-3 were observed near the anode outweighing the Cu vapour density by a factor of 20. When at 1600 A the arc commutated to the arc runners a Cu vapour density of 8 × 1021 m-3 was reached while the Ag density remained limited to 2 × 1021 m-3.

  15. Promoting protein crystallization using a plate with simple geometry.

    PubMed

    Chen, Rui-Qing; Yin, Da-Chuan; Liu, Yong-Ming; Lu, Qin-Qin; He, Jin; Liu, Yue

    2014-03-01

    Increasing the probability of obtaining protein crystals in crystallization screening is always an important goal for protein crystallography. In this paper, a new method called the cross-diffusion microbatch (CDM) method is presented, which aims to efficiently promote protein crystallization and increase the chance of obtaining protein crystals. In this method, a very simple crystallization plate was designed in which all crystallization droplets are in one sealed space, so that a variety of volatile components from one droplet can diffuse into any other droplet via vapour diffusion. Crystallization screening and reproducibility tests indicate that this method could be a potentially powerful technique in practical protein crystallization screening. It can help to obtain crystals with higher probability and at a lower cost, while using a simple and easy procedure.

  16. Expression, purification, crystallization and preliminary X-ray analysis of the Met244Ala variant of catalase–peroxidase (KatG) from the haloarchaeon Haloarcula marismortui

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ten-i, Tomomi; Kumasaka, Takashi; Higuchi, Wataru

    2007-11-01

    The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. The covalent modification of the side chains of Trp95, Tyr218 and Met244 within the active site of Haloarcula marismortui catalase–peroxidase (KatG) appears to be common to all KatGs and has been demonstrated to be particularly significant formore » its bifunctionality [Smulevich et al. (2006 ▶), J. Inorg. Biochem.100, 568–585; Jakopitsch, Kolarich et al. (2003 ▶), FEBS Lett.552, 135–140; Jakopitsch, Auer et al. (2003 ▶), J. Biol. Chem.278, 20185–20191; Jakopitsch et al. (2004 ▶), J. Biol. Chem.279, 46082–46095; Regelsberger et al. (2001 ▶), Biochem. Soc. Trans.29, 99–105; Ghiladi, Knudsen et al. (2005 ▶), J. Biol. Chem.280, 22651–22663; Ghiladi, Medzihradzky et al. (2005 ▶), Biochemistry, 44, 15093–15105]. The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant showed a complete loss of catalase activity, whereas the peroxidase activity of this mutant was highly enhanced owing to an increase in its affinity for the peroxidatic substrate. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. A crystal frozen using lithium sulfate as the cryoprotectant diffracted to beyond 2.0 Å resolution. Preliminary X-ray analysis suggests the presence of a dimer in the asymmetric unit.« less

  17. Crystallization and X-ray diffraction analysis of the HMG domain of the chondrogenesis master regulator Sox9 in complex with a ChIP-Seq-identified DNA element

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vivekanandan, Saravanan; Moovarkumudalvan, Balasubramanian; Lescar, Julien

    Sox9 is a fundamental sex-determining gene and the master regulator of chondrogenesis, and is involved in the development of various vital organs such as testes, kidney, heart and brain, and in skeletal development. Similar to other known Sox transcription factors, Sox9 recognizes and binds DNA with the consensus sequence C(T/A)TTG(T/A)(T/A) through the highly conserved HMG domain. Nonetheless, the molecular basis of the functional specificity of Sox9 in key developmental processes is still unclear. As an initial step towards a mechanistic understanding of Sox9 transcriptional regulation, the current work describes the details of the purification of the mouse Sox9 HMG domainmore » (mSox9HMG), its crystallization in complex with a ChIP-Seq-identified FOXP2 promoter DNA element and the X-ray diffraction data analysis of this complex. The mSox9HMG–FOXP2 promoter DNA complex was crystallized by the hanging-drop vapour-diffusion method using 20% PEG 3350 in 200 mMsodium/potassium phosphate with 100 mMbis-tris propane at pH 8.5. The crystals diffracted to 2.7 Å resolution and the complex crystallized in the tetragonal space groupP4 12 12, with unit-cell parametersa=b= 99.49,c= 45.89 Å. Crystal-packing parameters revealed that asymmetric unit contained one mSox9HMG–FOXP2 promoter DNA complex with an estimated solvent content of 64%.« less

  18. Cloning, purification, crystallization and preliminary structural studies of penicillin V acylase from Bacillus subtilis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rathinaswamy, Priya; Pundle, Archana V.; Prabhune, Asmita A.

    An unannotated protein reported from B. subtilis has been expressed in E. coli and identified as possessing penicillin V acylase activity. The crystallization and preliminary crystallographic analysis of this penicillin V acylase is presented. Penicillin acylase proteins are amidohydrolase enzymes that cleave penicillins at the amide bond connecting the side chain to their β-lactam nucleus. An unannotated protein from Bacillus subtilis has been expressed in Escherichia coli, purified and confirmed to possess penicillin V acylase activity. The protein was crystallized using the hanging-drop vapour-diffusion method from a solution containing 4 M sodium formate in 100 mM Tris–HCl buffer pH 8.2.more » Diffraction data were collected under cryogenic conditions to a spacing of 2.5 Å. The crystals belonged to the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 111.0, b = 308.0, c = 56.0 Å. The estimated Matthews coefficient was 3.23 Å{sup 3} Da{sup −1}, corresponding to 62% solvent content. The structure has been solved using molecular-replacement methods with B. sphaericus penicillin V acylase (PDB code 2pva) as the search model.« less

  19. Purification, crystallization and preliminary X-ray diffraction studies on avian haemoglobin from pigeon (Columba livia)

    PubMed Central

    Sathya Moorthy, Pon.; Neelagandan, K.; Balasubramanian, M.; Ponnuswamy, M. N.

    2009-01-01

    Haemoglobin is a physiologically significant metalloprotein that is involved in the exchange of gases for sustaining life. The respiratory system of birds is unique and complex compared with that of mammals. Many investigations of avian haemoglobins have revealed the presence of inositol pentaphosphate (IP5), a principal allosteric effector that is involved in regulation of their function. Structural investigations of avian haemoglobins are presently not adequate to explain their function. Efforts have been made in this direction in order to understand the oxygen-binding affinity involved in adapting to hypoxia in avian haemoglobins. Fresh whole blood was collected from pigeon (Columba livia) and purified using a DEAE cellulose anion-exchange chromatographic column. Crystallization of pigeon haemoglobin was accomplished using the hanging-drop vapour-diffusion method using PEG 3350 as a precipitant in 50 mM sodium acetate buffer pH 5.5 with 1 M NaCl. Data collection was carried out using a MAR345 image-plate detector system. The crystals diffracted to 2 Å resolution. Pigeon haemoglobin crystallizes in a triclinic space group, with two whole biological molecules in the asymmetric unit and with unit-cell parameters a = 55.005, b = 65.528, c = 104.370 Å, α = 78.742, β = 89.819, γ = 65.320°. PMID:19194000

  20. Purification, crystallization and preliminary crystallographic studies of plant S-adenosyl-l-homocysteine hydrolase (Lupinus luteus)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brzezinski, Krzysztof; Department of Crystallography, Faculty of Chemistry, A. Mickiewicz University, Poznan; Bujacz, Grzegorz

    2008-07-01

    Single crystals of recombinant S-adenosyl-l-homocysteine hydrolase from L. luteus in complex with adenosine diffract X-rays to 1.17 Å resolution at 100 K. The crystals are tetragonal, space group P4{sub 3}2{sub 1}2, and contain one copy of the dimeric enzyme in the asymmetric unit. By degrading S-adenosyl-l-homocysteine, which is a byproduct of S-adenosyl-l-methionine-dependent methylation reactions, S-adenosyl-l-homocysteine hydrolase (SAHase) acts as a regulator of cellular methylation processes. S-Adenosyl-l-homocysteine hydrolase from the leguminose plant yellow lupin (Lupinus luteus), LlSAHase, which is composed of 485 amino acids and has a molecular weight of 55 kDa, has been cloned, expressed in Escherichia coli and purified.more » Crystals of LlSAHase in complex with adenosine were obtained by the hanging-drop vapour-diffusion method using 20%(w/v) PEG 4000 and 10%(v/v) 2-propanol as precipitants in 0.1 M Tris–HCl buffer pH 8.0. The crystals were tetragonal, space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 122.4, c = 126.5 Å and contained two protein molecules in the asymmetric unit, corresponding to the functional dimeric form of the enzyme. Atomic resolution (1.17 Å) X-ray diffraction data have been collected using synchrotron radiation.« less

  1. Purification, crystallization and preliminary X-ray diffraction analysis of saxthrombin, a thrombin-like enzyme from Gloydius saxatilis venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wei, Wenqing; Zhao, Wei; Key Laboratory of Structural Biology, Chinese Academy of Sciences, 96 Jinzhai Road, Hefei, Anhui 230027

    2007-08-01

    The thrombin-like enzyme saxthrombin has been purified from G. saxatilis snake venom. Crystallization conditions were found and a data set was obtained to 1.43 Å. The snake-venom thrombin-like enzymes (SVTLEs) are a class of serine proteinases that show fibrinogen-clotting and esterolytic activities. Most TLEs convert fibrinogen to fibrin by releasing either fibrinopeptide A or fibrinopeptide B and cannot activate factor XIII. The enzymes hydrolyze fibrinogen to produce non-cross-linked fibrins, which are susceptible to the lytic action of plasmin. Because of these physiological properties, TLEs have important medical applications in myocardial infarction, ischaemic stroke and thrombotic diseases. Here, a three-step chromatographymore » procedure was used to purify saxthrombin (AAP20638) from Gloydius saxatilis venom to homogeneity. Its molecular weight is about 30 kDa as estimated by SDS–PAGE. A saxthrombin crystal was obtained using the hanging-drop vapour-diffusion method and diffracted to a resolution limit of 1.43 Å. The crystal belongs to space group C2, with unit-cell parameters a = 97.23, b = 52.21, c = 50.10 Å, β = 96.72°, and the Matthews coefficient (V{sub M}) was calculated to be 2.13 Å{sup 3} Da{sup −1} with one molecule in the asymmetric unit.« less

  2. Crystallization of Spätzle, a cystine-knot protein involved in embryonic development and innate immunity in Drosophila melanogaster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoffmann, Anita; Neumann, Piotr; Schierhorn, Angelika

    2008-08-01

    Crystallization of the cystine-knot protein Spätzle occurred following serendipitous limited degradation of the pro-Spätzle propeptide during the crystallization experiment. The Spätzle protein is involved in both the definition of the dorsal–ventral axis during embryonic development and in the adult innate immune response. The disulfide-linked dimeric cystine-knot protein has been expressed as a proprotein in inclusion bodies in Escherichia coli and refolded in vitro by rapid dilution. Initial orthorhombic crystals that diffracted to 7 Å resolution were obtained after three months by the sitting-drop vapour-diffusion method. Optimization of the crystallization conditions resulted in orthorhombic crystals (space group P2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = 53.0, b = 59.2, c = 62.5 Å) that diffracted to 2.8 Å resolution in-house. The small volume of the asymmetric unit indicated that it was not possible for the crystals to contain the complete pro-Spätzle dimer. Mass spectrometry, N-terminal sequencing and Western-blot analysis revealed that the crystals contained the C-terminal disulfide-linked cystine-knot dimer. Comparison of various crystallization experiments indicated that degradation of the N-terminal prodomain was dependent on the buffer conditions.« less

  3. Measurement of nanoscale three-dimensional diffusion in the interior of living cells by STED-FCS.

    PubMed

    Lanzanò, Luca; Scipioni, Lorenzo; Di Bona, Melody; Bianchini, Paolo; Bizzarri, Ranieri; Cardarelli, Francesco; Diaspro, Alberto; Vicidomini, Giuseppe

    2017-07-06

    The observation of molecular diffusion at different spatial scales, and in particular below the optical diffraction limit (<200 nm), can reveal details of the subcellular topology and its functional organization. Stimulated-emission depletion microscopy (STED) has been previously combined with fluorescence correlation spectroscopy (FCS) to investigate nanoscale diffusion (STED-FCS). However, stimulated-emission depletion fluorescence correlation spectroscopy has only been used successfully to reveal functional organization in two-dimensional space, such as the plasma membrane, while, an efficient implementation for measurements in three-dimensional space, such as the cellular interior, is still lacking. Here we integrate the STED-FCS method with two analytical approaches, the recent separation of photons by lifetime tuning and the fluorescence lifetime correlation spectroscopy, to simultaneously probe diffusion in three dimensions at different sub-diffraction scales. We demonstrate that this method efficiently provides measurement of the diffusion of EGFP at spatial scales tunable from the diffraction size down to ∼80 nm in the cytoplasm of living cells.The measurement of molecular diffusion at sub-diffraction scales has been achieved in 2D space using STED-FCS, but an implementation for 3D diffusion is lacking. Here the authors present an analytical approach to probe diffusion in 3D space using STED-FCS and measure the diffusion of EGFP at different spatial scales.

  4. Unambiguous detection of nitrated explosive vapours by fluorescence quenching of dendrimer films

    NASA Astrophysics Data System (ADS)

    Geng, Yan; Ali, Mohammad A.; Clulow, Andrew J.; Fan, Shengqiang; Burn, Paul L.; Gentle, Ian R.; Meredith, Paul; Shaw, Paul E.

    2015-09-01

    Unambiguous and selective standoff (non-contact) infield detection of nitro-containing explosives and taggants is an important goal but difficult to achieve with standard analytical techniques. Oxidative fluorescence quenching is emerging as a high sensitivity method for detecting such materials but is prone to false positives--everyday items such as perfumes elicit similar responses. Here we report thin films of light-emitting dendrimers that detect vapours of explosives and taggants selectively--fluorescence quenching is not observed for a range of common interferents. Using a combination of neutron reflectometry, quartz crystal microbalance and photophysical measurements we show that the origin of the selectivity is primarily electronic and not the diffusion kinetics of the analyte or its distribution in the film. The results are a major advance in the development of sensing materials for the standoff detection of nitro-based explosive vapours, and deliver significant insights into the physical processes that govern the sensing efficacy.

  5. Unambiguous detection of nitrated explosive vapours by fluorescence quenching of dendrimer films.

    PubMed

    Geng, Yan; Ali, Mohammad A; Clulow, Andrew J; Fan, Shengqiang; Burn, Paul L; Gentle, Ian R; Meredith, Paul; Shaw, Paul E

    2015-09-15

    Unambiguous and selective standoff (non-contact) infield detection of nitro-containing explosives and taggants is an important goal but difficult to achieve with standard analytical techniques. Oxidative fluorescence quenching is emerging as a high sensitivity method for detecting such materials but is prone to false positives—everyday items such as perfumes elicit similar responses. Here we report thin films of light-emitting dendrimers that detect vapours of explosives and taggants selectively—fluorescence quenching is not observed for a range of common interferents. Using a combination of neutron reflectometry, quartz crystal microbalance and photophysical measurements we show that the origin of the selectivity is primarily electronic and not the diffusion kinetics of the analyte or its distribution in the film. The results are a major advance in the development of sensing materials for the standoff detection of nitro-based explosive vapours, and deliver significant insights into the physical processes that govern the sensing efficacy.

  6. Unambiguous detection of nitrated explosive vapours by fluorescence quenching of dendrimer films

    PubMed Central

    Geng, Yan; Ali, Mohammad A.; Clulow, Andrew J.; Fan, Shengqiang; Burn, Paul L.; Gentle, Ian R.; Meredith, Paul; Shaw, Paul E.

    2015-01-01

    Unambiguous and selective standoff (non-contact) infield detection of nitro-containing explosives and taggants is an important goal but difficult to achieve with standard analytical techniques. Oxidative fluorescence quenching is emerging as a high sensitivity method for detecting such materials but is prone to false positives—everyday items such as perfumes elicit similar responses. Here we report thin films of light-emitting dendrimers that detect vapours of explosives and taggants selectively—fluorescence quenching is not observed for a range of common interferents. Using a combination of neutron reflectometry, quartz crystal microbalance and photophysical measurements we show that the origin of the selectivity is primarily electronic and not the diffusion kinetics of the analyte or its distribution in the film. The results are a major advance in the development of sensing materials for the standoff detection of nitro-based explosive vapours, and deliver significant insights into the physical processes that govern the sensing efficacy. PMID:26370931

  7. Purification, crystallization and preliminary crystallographic studies of haemoglobin from mongoose (Helogale parvula) in two different crystal forms induced by pH variation

    PubMed Central

    Mohamed Abubakkar, M.; Saraboji, K.; Ponnuswamy, M. N.

    2013-01-01

    Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively. PMID:23385751

  8. Crystallization and preliminary X-ray crystallographic analysis of MacA from Actinobacillus actinomycetemcomitans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Piao, Shunfu; Xu, Yongbin; Ha, Nam-Chul, E-mail: hnc@pusan.ac.kr

    2008-05-01

    A periplasmic membrane-fusion protein MacA from Actinobacillus actinomycetemcomitans, an essential component of the multidrug efflux pump in Gram-negative bacteria, was crystallized. Periplasmic membrane-fusion proteins (MFPs) are an essential component of the multidrug efflux pump in Gram-negative bacteria. They play a crucial role in bridging the outer membrane porin TolC and two distinct types of inner membrane transporters. The MFP MacA bridges the inner membrane ABC-type multidrug transporter MacB and the outer membrane porin TolC. MacA from the pathogenic bacterium Actinobacillus actinomycetemcomitans was expressed in Escherichia coli B834 (DE3) and the recombinant protein was purified using Ni–NTA affinity, Q anion-exchange andmore » gel-filtration chromatography. The purified MacA protein was crystallized using the vapour-diffusion method. A MAD diffraction data set was collected to a resolution of 3.0 Å at 100 K. The crystal belongs to space group P622, with unit-cell parameters a = b = 109.2, c = 255.4 Å, α = β = 90, γ = 120°, and contains one molecule in the asymmetric unit.« less

  9. Crystallization and preliminary X-ray crystallographic analysis of a carbonyl reductase from Candida parapsilosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Rongzhen; Xu, Yan, E-mail: biosean@yahoo.com.cn; Sun, Ying

    2008-04-01

    A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. Two distinct but related crystal forms of SCR were obtained using the hanging-drop vapour-diffusion method and a reservoir solution consisting of 18%(w/v) polyethylene glycol 2000 monomethyl ether and 8%(v/v) 2-propanol as the precipitant. The crystals were rhomboid in shape with average dimensions of 0.3 × 0.3 × 0.4 mm and diffracted to a resolution of 2.7–3.0 Å. The crystal forms both belong to space group P2{sub 1}2{sub 1}2{sub 1} and have unit-cell parameters a = 104.7, b = 142.8, cmore » = 151.8 Å and a = 101.1, b = 146.0, c = 159.8 Å. The calculated values of V{sub M}, rotation-function and translation-function solutions and consideration of potential crystal packing suggest that there are eight protein subunits per asymmetric unit.« less

  10. Purification, crystallization and preliminary X-ray crystallographic analysis of a cysteine-rich secretory protein (CRISP) from Naja atra venom.

    PubMed

    Wang, Yu-Ling; Goh, King-Xiang; Wu, Wen-guey; Chen, Chun-Jung

    2004-10-01

    Cysteine-rich secretory proteins (CRISPs) play an important role in the innate immune system and are transcriptionally regulated by androgens in several tissues. The proteins are mostly found in the epididymis and granules of mammals, whilst a number of snake venoms also contain CRISP-family proteins. The natrin protein from the venom of Naja atra (Taiwan cobra), which belongs to a family of CRISPs and has a cysteine-rich C-terminal amino-acid sequence, has been purified using a three-stage chromatography procedure and crystals suitable for X-ray analysis have been obtained using the hanging-drop vapour-diffusion method. X-ray diffraction data were collected to 1.58 A resolution using synchrotron radiation; the crystals belong to space group C222(1), with unit-cell parameters a = 59.172, b = 65.038, c = 243.156 A. There are two protein molecules in the asymmetric unit and the Matthews coefficient is estimated to be 2.35 A3 Da(-1), corresponding to a solvent content of 47.60%.

  11. Expression, purification and preliminary X-ray characterization of dl-2-haloacid dehalogenase from Methylobacterium sp. CPA1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Omi, Rie; Department of Chemistry, Graduate School of Science, Osaka City University, Sumiyoshi-ku, Osaka 558-8585; Jitsumori, Keiji

    A recombinant form of dl-2-haloacid dehalogenase from Methylobacterium sp. CPA1 has been expressed in E. coli, purified and crystallized. The crystal belongs to space group P6{sub 3}. Diffraction data have been collected to 1.75 Å resolution. dl-2-Haloacid dehalogenase from Methylobacterium sp. CPA1 (dl-DEX Mb) is a unique enzyme that catalyzes the dehalogenation reaction without the formation of an ester intermediate. A recombinant form of dl-DEX Mb has been expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the hexagonal space group P6{sub 3}, with unit-cell parameters a = b = 186.2, c =more » 114.4 Å. The crystals are likely to contain between four and eight monomers in the asymmetric unit, with a V{sub M} value of 4.20–2.10 Å{sup 3} Da{sup −1}. A self-rotation function revealed peaks on the χ = 180° section. X-ray data have been collected to 1.75 Å resolution.« less

  12. Crystallization and preliminary X-ray crystallographic analysis of hydroquinone dioxygenase from Sphingomonas sp. TTNP3

    PubMed Central

    Da Vela, Stefano; Ferraroni, Marta; Kolvenbach, Boris A.; Keller, Eva; Corvini, Philippe F. X.; Scozzafava, Andrea; Briganti, Fabrizio

    2012-01-01

    Hydroquinone dioxygenase (HQDO), a novel FeII ring-fission dioxygenase from Sphingomonas sp. strain TTNP3 which oxidizes a wide range of hydroquinones to the corresponding 4-hydroxymuconic semialdehydes, has been crystallized. The enzyme is an α2β2 heterotetramer constituted of two subunits of 19 and 38 kDa. Diffraction-quality crystals of HQDO were obtained using the sitting-drop vapour-diffusion method at 277 K from a solution consisting of 16% PEG 4000, 0.3 M MgCl2, 0.1 M Tris pH 8.5. The crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 88.4, b = 125.4, c = 90.8 Å, β = 105.3°. The asymmetric unit contained two heterotetramers, i.e. four copies of each of the two different subunits related by noncrystallographic 222 symmetry. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 0.980 Å. PMID:22691794

  13. Dimethylalkoxygallane incorporating a donor-functionalised alkoxide: the monomeric gas-phase structure.

    PubMed

    Knapp, Caroline E; Carmalt, Claire J; McMillan, Paul F; Wann, Derek A; Robertson, Heather E; Rankin, David W H

    2008-12-28

    The structure of the vapour produced upon heating the dimethylalkoxygallane [Me(2)GaOCH(2)CH(2)NMe(2)](2) has been studied by gas-phase electron diffraction and ab initio molecular orbital calculations; only the monomeric form [Me(2)GaOCH(2)CH(2)NMe(2)] is observed in the vapour, with the nitrogen atom forming a dative bond with the metal centre.

  14. Vaporization of a solid surface in an ambient gas

    NASA Astrophysics Data System (ADS)

    Benilov, M. S.; Jacobsson, S.; Kaddani, A.; Zahrai, S.

    2001-07-01

    The net flux of vapour from a solid surface in an ambient gas is analysed with the aim to estimate the effect of vaporization cooling on the energy balance of an arc cathode under conditions typical for a high-power current breaker. If the ratio of the equilibrium vapour pressure pv to the ambient pressure p∞ is smaller than unity, the removal of vapour from the surface is due to diffusion into the bulk of the gas. As a consequence, the net flux of the vapour from the surface is much smaller than the emitted flux. An estimate of the diffusion rate under conditions typical for a high-power current breaker indicates that vaporization cooling plays a minor role in the energy balance of the cathode in this case. If ratio pv/p∞ is above unity, the flow of the vapour from the surface appears and the net flux is comparable to the emitted flux. A simple analytical solution has been obtained for this case, which is in a good agreement with results of the Monte Carlo modelling of preceding authors. If pv/p∞ exceeds approximately 4.5, vaporization occurs as into vacuum and the net flux is about 0.82 of the emitted flux.

  15. New CVD-based method for the growth of high-quality crystalline zinc oxide layers

    NASA Astrophysics Data System (ADS)

    Huber, Florian; Madel, Manfred; Reiser, Anton; Bauer, Sebastian; Thonke, Klaus

    2016-07-01

    High-quality zinc oxide (ZnO) layers were grown using a new chemical vapour deposition (CVD)-based low-cost growth method. The process is characterized by total simplicity, high growth rates, and cheap, less hazardous precursors. To produce elementary zinc vapour, methane (CH4) is used to reduce a ZnO powder. By re-oxidizing the zinc with pure oxygen, highly crystalline ZnO layers were grown on gallium nitride (GaN) layers and on sapphire substrates with an aluminum nitride (AlN) nucleation layer. Using simple CH4 as precursor has the big advantage of good controllability and the avoidance of highly toxic gases like nitrogen oxides. In photoluminescence (PL) measurements the samples show a strong near-band-edge emission and a sharp line width at 5 K. The good crystal quality has been confirmed in high resolution X-ray diffraction (HRXRD) measurements. This new growth method has great potential for industrial large-scale production of high-quality single crystal ZnO layers.

  16. Purification, crystallization and preliminary X-ray diffraction of SecDF, a translocon-associated membrane protein, from Thermus thermophilus

    PubMed Central

    Tsukazaki, Tomoya; Mori, Hiroyuki; Fukai, Shuya; Numata, Tomoyuki; Perederina, Anna; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo; Vassylyev, Dmitry G.; Nureki, Osamu; Ito, Koreaki

    2006-01-01

    Thermus thermophilus has a multi-path membrane protein, TSecDF, as a single-chain homologue of Escherichia coli SecD and SecF, which form a translocon-associated complex required for efficient preprotein translocation and membrane-protein integration. Here, the cloning, expression in E. coli, purification and crystallization of TSecDF are reported. Overproduced TSecDF was solubilized with dodecylmaltoside, chromatographically purified and crystallized by vapour diffusion in the presence of polyethylene glycol. The crystals yielded a maximum resolution of 4.2 Å upon X-ray irradiation, revealing that they belonged to space group P43212. Attempts were made to improve the diffraction quality of the crystals by combinations of micro-stirring, laser-light irradiation and dehydration, which led to the eventual collection of complete data sets at 3.74 Å resolution and preliminary success in the single-wavelength anomalous dispersion analysis. These results provide information that is essential for the determination of the three-dimensional structure of this important membrane component of the protein-translocation machinery. PMID:16582489

  17. Growth of carbon nanotubes (CNTs) on metallic underlayers by diffusion plasma-enhanced chemical vapour deposition (DPECVD)

    NASA Astrophysics Data System (ADS)

    Kim, S. M.; Gangloff, L.

    2009-10-01

    Here, we demonstrate the low-temperature (480-612 °C) synthesis of carbon nanotubes (CNTs) on different metallic underlayers (i.e., NiV, Ir, Ag, Pt, W, and Ta) using diffusion (dc) plasma-enhanced (~20 W, -600 V) chemical vapour deposition (DPECVD). The catalyst used is bi-layered Fe/Al and the feedstock used is a mixture of C 2H 2 and NH 3 (1:4). The crucial component is the diffusion of radical ions and hydrogen generated such as H 2/H +/H 2+/NH 3+/CH 2+/C 2H 2+ (which are confirmed by in-situ mass spectroscopy) from the nozzle, where it is inserted for most effective plasma diffusion between a substrate and a gas distributor.

  18. Monitoring of exposure to methylpentanes by diffusive sampling and urine analysis for alcoholic metabolites.

    PubMed Central

    Kawai, T; Mizunuma, K; Yasugi, T; Horiguchi, S; Iguchi, H; Mutti, A; Ghittori, S; Ikeda, M

    1995-01-01

    OBJECTIVES--To investigate the possibilities of personal ambient monitoring and biological monitoring for methylpentane isomers. METHODS--The performance of activated carbon cloth to absorb 2- and 3-methylpentane was studied by experimental vapour exposure followed by solvent extraction and gas chromatography (GC). Urine from workers and rats exposed to 2- and 3-methylpentane was analysed by GC with or without acid or enzymatic hydrolysis. RESULTS--Carbon cloth absorbed 2- and 3-methylpentane linearly to exposures up to eight hours and to 400 ppm, and was sensitive enough to detect a 15 minute peak of exposure. The two isomers were clearly separated from hexane on a DB-1 column. For analysis of the urine, enzymatic hydrolysis was superior to acid hydrolysis. Exposure of rats to methylpentane vapours showed that 2-methyl-2-pentanol and 3-methyl-2-pentanol were excreted in urine in proportion to the dose of 2-methylpentane and 3-methylpentane, respectively. 2-Methyl derivatives of 1-, 3-, and 4-propanol, 2-methylpentane-2,4-diol, and 3-methyl-2-pentanol were minor metabolites. Analysis of urine from the exposed workers showed that 2-methyl- and 3-methyl-2-pentanol are leading urinary metabolites after exposure to the corresponding methylpentane. CONCLUSIONS--Diffusive sampling is applicable to monitor 2- and 3-methylpentane vapours as is the case for hexane vapour. 2-Methyl-2-pentanol and 3-methyl-2-pentanol will be markers of occupational exposure to 2-methylpentane and 3-methylpentane, respectively. Also, 2-methylpentane-2,4-diol might be a marker of exposure to 2-methylpentane. PMID:8535496

  19. Acetone sensor based on zinc oxide hexagonal tubes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hastir, Anita, E-mail: anitahastir@gmail.com; Singh, Onkar, E-mail: anitahastir@gmail.com; Anand, Kanika, E-mail: anitahastir@gmail.com

    2014-04-24

    In this work hexagonal tubes of zinc oxide have been synthesized by co-precipitation method. For structural, morphological, elemental and optical analysis synthesized powders were characterized by using x-ray diffraction, field emission scanning microscope, EDX, UV-visible and FTIR techniques. For acetone sensing thick films of zinc oxide have been deposited on alumina substrate. The fabricated sensors exhibited maximum sensing response towards acetone vapour at an optimum operating temperature of 400°C.

  20. The specific diffusion behaviour in paper and migration modelling from recycled board into dry foodstuffs.

    PubMed

    Hauder, J; Benz, H; Rüter, M; Piringer, O-G

    2013-01-01

    Recycled board plays an important role in food packaging, but the great variety of organic impurities must be considered as potential food contaminants. The diffusion behaviour of the impurities is significantly different from that in plastic materials. The two-layer concept for paper and board introduced recently is now treated in more detail. In the rate-determining surface region the diffusion coefficients of the n-alkanes in the homologous series with 15-35 carbon atoms decrease proportionally as their vapour pressures. This leads to a different equation of the diffusion coefficients in comparison with that for the core layer. Different polarities of the migrants have additional influences on the diffusion due to their interactions with the fibre matrix. A new analytical method for the quantification of aromatic impurities has previously been developed. Based on this method and on the described diffusion behaviour, a migration model for specific and global mass transfer of impurities from recycled board into dry food and food simulants is given.

  1. Surface holograms for sensing application

    NASA Astrophysics Data System (ADS)

    Zawadzka, M.; Naydenova, I.

    2018-01-01

    Surface gratings with periodicity of 2 μm and amplitude in the range of 175 and 240 nm were fabricated in a plasticized polyvinylchloride doped with a metalloporphyrin (ZnTPP), via a single laser pulse holographic ablation process. The effect of the laser pulse energy on the profiles of the fabricated surface structure was investigated. The sensing capabilities of the fabricated diffractive structures towards amines (triethylamine, diethylamine) and pyridine vapours were then explored; the holographic structures were exposed to the analyte vapours and changes in the intensity of the diffracted light were monitored in real time at 473 nm. It was demonstrated that surface structures, fabricated in a polymer doped with a metalloporphyrin which acts as analyte receptor, have a potential in sensing application.

  2. Pectins filled with LDH-antimicrobial molecules: preparation, characterization and physical properties.

    PubMed

    Gorrasi, Giuliana; Bugatti, Valeria; Vittoria, Vittoria

    2012-06-05

    Nanohybrids of layered double hydroxide (LDH) with intercalated active molecules: benzoate, 2,4-dichlorobenzoate, para-hydroxybenzoate and ortho-hydroxybenzoate, were incorporated into pectins from apples through high energy ball milling in the presence of water. Cast films were obtained and analysed. X-ray diffraction analysis showed a complete destructuration of all nanohybrids in the pectin matrix. Thermogravimetric analysis showed a better thermal resistance of pectin in the presence of fillers, especially para-hydroxybenzoate and ortho-hydroxybenzoate. Mechanical properties showed an improvement of elastic modulus in particular for LDH-para-hydroxybenzoate nanohybrid, due probably to a better interaction between pectin matrix and nanohybrid layers. Barrier properties (sorption and diffusion) to water vapour showed improvement in the dependence on the intercalated active molecule, the best improvement was achieved for composites containing para-hydroxybenzoate molecules, suggesting that the interaction between the filler phase and the polymer plays an important role in sorption and diffusion phenomena. Incorporation of these active molecules gave antimicrobial properties to the composite films giving opportunities in the field of active packaging. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Crystallization and preliminary X-ray diffraction studies of Seneca Valley Virus-001, a new member of the Picornaviridae family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Venkataraman, Sangita; Reddy, Seshidhar P.; Loo, Jackie

    2008-04-01

    Seneca Valley Virus-001 of the Picornavirdae family was crystallized in the space group R3 and X-ray diffraction data was collected to a resolution of 2.3 Å. Rotation-function studies suggested the presence of two distict sets of 20 protomers that belong to two different virus particles in the crystallographic asymmetric unit. Seneca Valley Virus-001 (SVV-001) is a newly found species in the Picornaviridae family. SVV-001 is the first naturally occurring nonpathogenic picorna@@virus observed to mediate selective cytotoxicity towards tumor cells with neuroendocrine cancer features. The nonsegmented (+)ssRNA genome of SVV-001 shares closest sequence similarity to the genomes of the members ofmore » the Cardiovirus genus. However, based on the distinct characteristics of the genome organization and other biochemical properties, it has been suggested that SVV-001 represents a new genus, namely ‘Senecavirus’, in the Picornaviridae family. In order to understand the oncolytic properties of SVV-001, the native virus was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group R3, with unit-cell parameters (in the hexagonal setting) a = b = 311.5, c = 1526.4 Å. Although the SVV crystals diffracted to better than 2.3 Å resolution, the data quality is acceptable [I/σ(I) > 2.0] to 2.6 Å resolution. The unit-cell volume and the locked rotation-function analysis suggest that six particles could be accommodated in the unit cell, with two distinct sets of one third of a particle, each containing 20 protomers, occupying the crystallographic asymmetric unit.« less

  4. Cloning, expression, purification and preliminary crystallographic characterization of a shikimate dehydrogenase from Corynebacterium glutamicum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schoepe, Jan, E-mail: jschoepe@smail.uni-koeln.de; Niefind, Karsten; Chatterjee, Shivani

    2006-07-01

    The crystallization and preliminary X-ray characterization of a shikimate dehydrogenase from C. glutamicum is presented. The shikimate dehydrogenase from Corynebacterium glutamicum has been cloned into an Escherichia coli expression vector, overexpressed and purified. Native crystals were obtained by the vapour-diffusion technique using 2-methyl-2,4-pentanediol as a precipitant. The crystals belong to the centred monoclinic space group C2, with unit-cell parameters a = 118.77, b = 63.17, c = 35.67 Å, β = 92.26° (at 100 K), and diffract to 1.64 Å on a synchrotron X-ray source. The asymmetric unit is likely to contain one molecule, corresponding to a packing density ofmore » 2.08 Å{sup 3} Da{sup −1} and a solvent content of about 41%.« less

  5. Crystallization and preliminary crystallographic studies of LipA, a secretory lipase/esterase from Xanthomonas oryzae pv. oryzae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aparna, Gudlur; Chatterjee, Avradip; Jha, Gopaljee

    2007-08-01

    The crystallization and preliminary crystallographic studies of LipA, a lipase/esterase secreted by X. oryzae pv. oryzae during its infection of rice plants, are reported. Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight, a serious disease of rice. Several enzymes that are secreted through the type II secretion system of this bacterium play an important role in the plant–microbe interaction, being important for virulence and also being able to induce potent host defence responses. One of these enzymes is a secretory lipase/esterase, LipA, which shows a very weak homology to other bacterial lipases and gives a positivemore » tributyrin plate assay. In this study, LipA was purified from the culture supernatant of an overexpressing clone of X. oryzae pv. oryzae and two types of crystals belonging to space group C2 but with two different unit-cell parameters were obtained using the hanging-drop vapour-diffusion method. Type I crystals diffract to a maximum resolution of 1.89 Å and have unit-cell parameters a = 93.1, b = 62.3, c = 66.1 Å, β = 90.8°. Type II crystals have unit-cell parameters a = 103.6, b = 54.6, c = 66.3 Å, β = 92.6° and diffract to 1.86 Å. Solvent-content analysis shows one monomer in the asymmetric unit in both the crystal forms.« less

  6. Purification, crystallization and characterization of the Pseudomonas outer membrane protein FapF, a functional amyloid transporter.

    PubMed

    Rouse, Sarah L; Hawthorne, Wlliam J; Lambert, Sebastian; Morgan, Marc L; Hare, Stephen A; Matthews, Stephen

    2016-12-01

    Bacteria often produce extracellular amyloid fibres via a multi-component secretion system. Aggregation-prone, unstructured subunits cross the periplasm and are secreted through the outer membrane, after which they self-assemble. Here, significant progress is presented towards solving the high-resolution crystal structure of the novel amyloid transporter FapF from Pseudomonas, which facilitates the secretion of the amyloid-forming polypeptide FapC across the bacterial outer membrane. This represents the first step towards obtaining structural insight into the products of the Pseudomonas fap operon. Initial attempts at crystallizing full-length and N-terminally truncated constructs by refolding techniques were not successful; however, after preparing FapF 106-430 from the membrane fraction, reproducible crystals were obtained using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.5 Å resolution. These crystals belonged to the monoclinic space group C121, with unit-cell parameters a = 143.4, b = 124.6, c = 80.4 Å, α = γ = 90, β = 96.32° and three monomers in the asymmetric unit. It was found that the switch to complete detergent exchange into C8E4 was crucial for forming well diffracting crystals, and it is suggested that this combined with limited proteolysis is a potentially useful protocol for membrane β-barrel protein crystallography. The three-dimensional structure of FapF will provide invaluable information on the mechanistic differences of biogenesis between the curli and Fap functional amyloid systems.

  7. Towards outperforming conventional sensor arrays with fabricated individual photonic vapour sensors inspired by Morpho butterflies

    PubMed Central

    Potyrailo, Radislav A.; Bonam, Ravi K.; Hartley, John G.; Starkey, Timothy A.; Vukusic, Peter; Vasudev, Milana; Bunning, Timothy; Naik, Rajesh R.; Tang, Zhexiong; Palacios, Manuel A.; Larsen, Michael; Le Tarte, Laurie A.; Grande, James C.; Zhong, Sheng; Deng, Tao

    2015-01-01

    Combining vapour sensors into arrays is an accepted compromise to mitigate poor selectivity of conventional sensors. Here we show individual nanofabricated sensors that not only selectively detect separate vapours in pristine conditions but also quantify these vapours in mixtures, and when blended with a variable moisture background. Our sensor design is inspired by the iridescent nanostructure and gradient surface chemistry of Morpho butterflies and involves physical and chemical design criteria. The physical design involves optical interference and diffraction on the fabricated periodic nanostructures and uses optical loss in the nanostructure to enhance the spectral diversity of reflectance. The chemical design uses spatially controlled nanostructure functionalization. Thus, while quantitation of analytes in the presence of variable backgrounds is challenging for most sensor arrays, we achieve this goal using individual multivariable sensors. These colorimetric sensors can be tuned for numerous vapour sensing scenarios in confined areas or as individual nodes for distributed monitoring. PMID:26324320

  8. Visible diffraction from quasi-crystalline arrays of carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Butler, Timothy P.; Butt, Haider; Wilkinson, Timothy D.; Amaratunga, Gehan A. J.

    2015-08-01

    Large area arrays of vertically-aligned carbon nanotubes (VACNTs) are patterned in a quasi-crystalline Penrose tile arrangement through electron beam lithography definition of Ni catalyst dots and subsequent nanotube growth by plasma-enhanced chemical vapour deposition. When illuminated with a 532 nm laser beam high-quality and remarkable diffraction patterns are seen. The diffraction is well matched to theoretical calculations which assume apertures to be present at the location of the VACNTs for transmitted light. The results show that VACNTs act as diffractive elements in reflection and can be used as spatially phased arrays for producing tailored diffraction patterns.

  9. Moisture diffusion and permeability characteristics of hydroxypropylmethylcellulose and hard gelatin capsules.

    PubMed

    Barham, Ahmad S; Tewes, Frederic; Healy, Anne Marie

    2015-01-30

    The primary objective of this paper is to compare the sorption characteristics of hydroxypropylmethylcellulose (HPMC) and hard gelatin (HG) capsules and their ability to protect capsule contents. Moisture sorption and desorption isotherms for empty HPMC and HG capsules have been investigated using dynamic vapour sorption (DVS) at 25°C. All sorption studies were analysed using the Young-Nelson model equations which distinguishes three moisture sorption types: monolayer adsorption moisture, condensation and absorption. Water vapour diffusion coefficients (D), solubility (S) and permeability (P) parameters of the capsule shells were calculated. ANOVA was performed with the Tukey comparison test to analyse the effect of %RH and capsule type on S, P, and D parameters. The moisture uptake of HG capsules were higher than HPMC capsules at all %RH conditions studied. It was found that values of D and P across HPMC capsules were greater than for HG capsules at 0-40 %RH; whereas over the same %RH range S values were higher for HG than for HPMC capsules. S values decreased gradually as the %RH was increased up to 60% RH. To probe the effect of moisture ingress, spray dried lactose was loaded into capsules. Phase evolution was characterised by scanning electron microscopy (SEM), X-ray powder diffraction (XRD), and differential scanning calorimetry (DSC). The capsules under investigation are not capable of protecting spray dried lactose from induced solid state changes as a result of moisture uptake. For somewhat less moisture sensitive formulations, HPMC would appear to be a better choice than HG in terms of protection of moisture induced deterioration. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. [Expression, crystallization and crystallographic study of the 1st IgV domain of human CD96].

    PubMed

    Jiang, Wenjing; Zhang, Shuijun; Yan, Jinghua; Guo, Ning

    2013-05-01

    CD96 (Tactile) is an adhesion receptor expressed mainly on activated T cells, NK cells. As a family member of the immunoglobulin-like cell receptor, CD96 consists of three immunoglobulin-like domains (V1, V2/C and C) in the extracellular region. Recent studies have shown that the 1st IgV domain of CD96 (CD96V1) plays an essential role in cell adhesion and NK cell-mediated killing. In this study, the 1st IgV domain of human CD96 (hCD96V1) was cloned and expressed in Escherichia coli (BL21). The soluble protein was obtained by refolding of the hCD96V1 inclusion bodies. From analytical ultracentrifugation, we could predict that CD96 V1 maily exists as dimer with approximate molecular weight of 26.9 kDa. The protein was then successfully crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.9 angstrom resolution and belonged to space group P21, with unit-cell parameters a = 35.1, b = 69.5, c = 49.6A, alpha=gamma=90 degrees, beta=105.4 degrees.

  11. CoO doping effects on the ZnO films through EBPDV technique

    NASA Astrophysics Data System (ADS)

    Inês Basso Bernardi, Maria; Queiroz Maia, Lauro June; Antonelli, Eduardo; Mesquita, Alexandre; Li, Maximo Siu; Gama, Lucianna

    2014-03-01

    Nanometric Zn1-xCo xO (x = 0.020, 0.025 and 0.030 in mol.%) nanopowders were obtained from low temperature calcination of a resin prepared using the Pechini's method. Firing the Zn1-xCoxO resin at 400 °C/2 h a powder with hexagonal structure was obtained as measured by X-ray diffraction (XRD). The powder presented average particle size of 40 nm observed by field emission scanning electronic microscopy (FE-SEM) micrographs and average crystallite size of 10 nm calculated from the XRD using Scherrer's equation. Nanocrystalline Zn1-xCo xO films with good homogeneity and optical quality were obtained with 280-980 nm thicknesses by electron beam physical vapour deposition (EBPVD) under vacuum onto silica substrate at 25 °C. Scanning electron microscopy with field emission gun showed that the film microstructure is composed by spherical grains and some needles. In these conditions of deposition the films presented only hexagonal phase observed by XRD. The UV-visible-NIR and diffuse reflectance properties of the films were measured and the electric properties were calculated using the reflectance and transmittance spectra.

  12. Crystallization and preliminary crystallographic analysis of l-asparaginase from Erwinia carotovora

    PubMed Central

    Wikman, Linnea E. K.; Krasotkina, Julya; Kuchumova, Anastasia; Sokolov, Nikolay N.; Papageorgiou, Anastassios C.

    2005-01-01

    Bacterial l-asparaginases have been used as therapeutic agents in the treatment of acute childhood lymphoblastic leukaemia for over 30 y. However, their use is limited owing to the glutaminase activity of the administered enzymes, which results in serious side effects. In contrast, l-asparaginase from Erwinia carotovora exhibits low glutaminase activity at physiological concentrations of l-asparagine and l-glutamine in the blood. Recombinant Er. carotovora l-­asparaginase was crystallized in the presence of l-glutamate by the hanging-drop vapour-diffusion method using 10 mg ml−1 purified enzyme, 16–18%(w/v) PEG 3350 and 0.2 M NaF. X-ray diffraction data were collected to 2.6 Å at 293 K using an in-house rotating-anode generator. The crystals belong to the monoclinic P21 space group, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. A molecular-replacement solution has been found and refinement is currently in progress. The crystal structure may provide leads towards protein-engineering efforts aimed at safer asparaginase administration in leukaemia treatment. PMID:16511054

  13. Trypanothione reductase from Leishmania infantum: cloning, expression, purification, crystallization and preliminary X-ray data analysis.

    PubMed

    Baiocco, Paola; Franceschini, Stefano; Ilari, Andrea; Colotti, Gianni

    2009-01-01

    The most promising targets for Leishmania-specific drug design are two key enzymes involved in the unique thiol-based metabolism, common to all parasites of the Trypanosomatidae family: trypanothione synthetase (TryS) and trypanothione reductase (TR). Recently, new inhibitors of TR have been identified such as polyamines and tricyclic compounds. The knowledge of the three-dimensional structure of Leishmania TR will shed light on the mechanism of interaction of these inhibitors with TR and will be the starting point to design novel lead candidates to facilitate the development of new effective and affordable drugs. Trypanothione reductase from Leishmania infantum has been cloned, expressed in E. coli and purified. Crystals were obtained at 294 K by the hanging drop vapour diffusion method using ammonium sulfate as precipitant agent and diffract to better than 2.95 A resolution using a synchrotron radiation source. The crystals exhibit an unusually high solvent content of 74 %, belong to the tetragonal space group P41 with units cell parameters a=b=103.45 A, c=192.62 A and two molecules in the asymmetric unit. The protein X-ray structure has been solved by Molecular Replacement and the model is under construction.

  14. Expression, purification and crystallization of a plant polyketide cyclase from Cannabis sativa

    PubMed Central

    Yang, Xinmei; Matsui, Takashi; Mori, Takahiro; Taura, Futoshi; Noguchi, Hiroshi; Abe, Ikuro; Morita, Hiroyuki

    2015-01-01

    Plant polyketides are a structurally diverse family of natural products. In the biosynthesis of plant polyketides, the construction of the carbocyclic scaffold is a key step in diversifying the polyketide structure. Olivetolic acid cyclase (OAC) from Cannabis sativa L. is the only known plant polyketide cyclase that catalyzes the C2–C7 intramolecular aldol cyclization of linear pentyl tetra-β-ketide-CoA to generate olivetolic acid in the biosynthesis of cannabinoids. The enzyme is also thought to belong to the dimeric α+β barrel (DABB) protein family. However, because of a lack of functional analysis of other plant DABB proteins and low sequence identity with the functionally distinct bacterial DABB proteins, the catalytic mechanism of OAC has remained unclear. To clarify the intimate catalytic mechanism of OAC, the enzyme was overexpressed in Escherichia coli and crystallized using the vapour-diffusion method. The crystals diffracted X-rays to 1.40 Å resolution and belonged to space group P3121 or P3221, with unit-cell parameters a = b = 47.3, c = 176.0 Å. Further crystallographic analysis will provide valuable insights into the structure–function relationship and catalytic mechanism of OAC. PMID:26625288

  15. Expression, purification and crystallization of a plant polyketide cyclase from Cannabis sativa.

    PubMed

    Yang, Xinmei; Matsui, Takashi; Mori, Takahiro; Taura, Futoshi; Noguchi, Hiroshi; Abe, Ikuro; Morita, Hiroyuki

    2015-12-01

    Plant polyketides are a structurally diverse family of natural products. In the biosynthesis of plant polyketides, the construction of the carbocyclic scaffold is a key step in diversifying the polyketide structure. Olivetolic acid cyclase (OAC) from Cannabis sativa L. is the only known plant polyketide cyclase that catalyzes the C2-C7 intramolecular aldol cyclization of linear pentyl tetra-β-ketide-CoA to generate olivetolic acid in the biosynthesis of cannabinoids. The enzyme is also thought to belong to the dimeric α+β barrel (DABB) protein family. However, because of a lack of functional analysis of other plant DABB proteins and low sequence identity with the functionally distinct bacterial DABB proteins, the catalytic mechanism of OAC has remained unclear. To clarify the intimate catalytic mechanism of OAC, the enzyme was overexpressed in Escherichia coli and crystallized using the vapour-diffusion method. The crystals diffracted X-rays to 1.40 Å resolution and belonged to space group P3121 or P3221, with unit-cell parameters a = b = 47.3, c = 176.0 Å. Further crystallographic analysis will provide valuable insights into the structure-function relationship and catalytic mechanism of OAC.

  16. Overexpression, purification, crystallization and preliminary structural studies of p-coumaric acid decarboxylase from Lactobacillus plantarum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rodríguez, Héctor; Rivas, Blanca de las; Muñoz, Rosario

    2007-04-01

    The enzyme p-coumaric acid decarboxylase (PDC) from L. plantarum has been recombinantly expressed, purified and crystallized. The structure has been solved at 2.04 Å resolution by the molecular-replacement method. The substrate-inducible p-coumaric acid decarboxylase (PDC) from Lactobacillus plantarum has been overexpressed in Escherichia coli, purified and confirmed to possess decarboxylase activity. The recombinant His{sub 6}-tagged enzyme was crystallized using the hanging-drop vapour-diffusion method from a solution containing 20%(w/v) PEG 4000, 12%(w/v) 2-propanol, 0.2 M sodium acetate, 0.1 M Tris–HCl pH 8.0 with 0.1 M barium chloride as an additive. Diffraction data were collected in-house to 2.04 Å resolution. Crystals belongedmore » to the tetragonal space group P4{sub 3}, with unit-cell parameters a = b = 43.15, c = 231.86 Å. The estimated Matthews coefficient was 2.36 Å{sup 3} Da{sup −1}, corresponding to 48% solvent content, which is consistent with the presence of two protein molecules in the asymmetric unit. The structure of PDC has been determined by the molecular-replacement method. Currently, the structure of PDC complexed with substrate analogues is in progress, with the aim of elucidating the structural basis of the catalytic mechanism.« less

  17. Atomic origins of water-vapour-promoted alloy oxidation

    NASA Astrophysics Data System (ADS)

    Luo, Langli; Su, Mao; Yan, Pengfei; Zou, Lianfeng; Schreiber, Daniel K.; Baer, Donald R.; Zhu, Zihua; Zhou, Guangwen; Wang, Yanting; Bruemmer, Stephen M.; Xu, Zhijie; Wang, Chongmin

    2018-06-01

    The presence of water vapour, intentional or unavoidable, is crucial to many materials applications, such as in steam generators, turbine engines, fuel cells, catalysts and corrosion1-4. Phenomenologically, water vapour has been noted to accelerate oxidation of metals and alloys5,6. However, the atomistic mechanisms behind such oxidation remain elusive. Through direct in situ atomic-scale transmission electron microscopy observations and density functional theory calculations, we reveal that water-vapour-enhanced oxidation of a nickel-chromium alloy is associated with proton-dissolution-promoted formation, migration, and clustering of both cation and anion vacancies. Protons derived from water dissociation can occupy interstitial positions in the oxide lattice, consequently lowering vacancy formation energy and decreasing the diffusion barrier of both cations and anions, which leads to enhanced oxidation in moist environments at elevated temperatures. This work provides insights into water-vapour-enhanced alloy oxidation and has significant implications in other material and chemical processes involving water vapour, such as corrosion, heterogeneous catalysis and ionic conduction.

  18. Atomic origins of water-vapour-promoted alloy oxidation.

    PubMed

    Luo, Langli; Su, Mao; Yan, Pengfei; Zou, Lianfeng; Schreiber, Daniel K; Baer, Donald R; Zhu, Zihua; Zhou, Guangwen; Wang, Yanting; Bruemmer, Stephen M; Xu, Zhijie; Wang, Chongmin

    2018-06-01

    The presence of water vapour, intentional or unavoidable, is crucial to many materials applications, such as in steam generators, turbine engines, fuel cells, catalysts and corrosion 1-4 . Phenomenologically, water vapour has been noted to accelerate oxidation of metals and alloys 5,6 . However, the atomistic mechanisms behind such oxidation remain elusive. Through direct in situ atomic-scale transmission electron microscopy observations and density functional theory calculations, we reveal that water-vapour-enhanced oxidation of a nickel-chromium alloy is associated with proton-dissolution-promoted formation, migration, and clustering of both cation and anion vacancies. Protons derived from water dissociation can occupy interstitial positions in the oxide lattice, consequently lowering vacancy formation energy and decreasing the diffusion barrier of both cations and anions, which leads to enhanced oxidation in moist environments at elevated temperatures. This work provides insights into water-vapour-enhanced alloy oxidation and has significant implications in other material and chemical processes involving water vapour, such as corrosion, heterogeneous catalysis and ionic conduction.

  19. Acoustic radiosity for computation of sound fields in diffuse environments

    NASA Astrophysics Data System (ADS)

    Muehleisen, Ralph T.; Beamer, C. Walter

    2002-05-01

    The use of image and ray tracing methods (and variations thereof) for the computation of sound fields in rooms is relatively well developed. In their regime of validity, both methods work well for prediction in rooms with small amounts of diffraction and mostly specular reflection at the walls. While extensions to the method to include diffuse reflections and diffraction have been made, they are limited at best. In the fields of illumination and computer graphics the ray tracing and image methods are joined by another method called luminous radiative transfer or radiosity. In radiosity, an energy balance between surfaces is computed assuming diffuse reflection at the reflective surfaces. Because the interaction between surfaces is constant, much of the computation required for sound field prediction with multiple or moving source and receiver positions can be reduced. In acoustics the radiosity method has had little attention because of the problems of diffraction and specular reflection. The utility of radiosity in acoustics and an approach to a useful development of the method for acoustics will be presented. The method looks especially useful for sound level prediction in industrial and office environments. [Work supported by NSF.

  20. Cloning, expression, purification and preliminary crystallographic analysis of the short-chain dehydrogenase enzymes WbmF, WbmG and WbmH from Bordetella bronchiseptica

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harmer, Nicholas J., E-mail: nic@cryst.bioc.cam.ac.uk; King, Jerry D.; Department of Veterinary Medicine, Cambridge CB3 0ES

    2007-08-01

    The expression, purification, and crystallisation of the short-chain dehydrogenases WbmF, WbmG and WbmH from B. bronchiseptica are described. Native diffraction data to 1.5, 2.0, and 2.2 Å were obtained for the three proteins, together with complexes with nucleotides. The short-chain dehydrogenase enzymes WbmF, WbmG and WbmH from Bordetella bronchiseptica were cloned into Escherichia coli expression vectors, overexpressed and purified to homogeneity. Crystals of all three wild-type enzymes were obtained using vapour-diffusion crystallization with high-molecular-weight PEGs as a primary precipitant at alkaline pH. Some of the crystallization conditions permitted the soaking of crystals with cofactors and nucleotides or nucleotide sugars, whichmore » are possible substrate compounds, and further conditions provided co-complexes of two of the proteins with these compounds. The crystals diffracted to resolutions of between 1.50 and 2.40 Å at synchrotron X-ray sources. The synchrotron data obtained were sufficient to determine eight structures of the three enzymes in complex with a variety of cofactors and substrate molecules.« less

  1. Protein Crystal Movements and Fluid Flows During Microgravity Growth

    NASA Technical Reports Server (NTRS)

    Boggon, Titus J.; Chayen, Naomi E.; Snell, Edward H.; Dong, Jun; Lautenschlager, Peter; Potthast, Lothar; Siddons, D. Peter; Stojanoff, Vivian; Gordon, Elspeth; Thompson, Andrew W.; hide

    1998-01-01

    The growth of protein crystals suitable for x-ray crystal structure analysis is an important topic. The quality (perfection) of protein crystals is now being evaluated by mosaicity analysis (rocking curves) and x-ray topographic images as well as the diffraction resolution limit and overall data quality. In yet another study, use of hanging drop vapour diffusion geometry on the IML-2 shuttle mission showed, again via CCD video monitoring, growing apocrustacyanin C(sub 1) protein crystal executing near cyclic movement, reminiscent of Marangoni convection flow of fluid, the crystals serving as "markers" of the fluid flow. A review is given here of existing results and experience over several microgravity missions. Some comment is given on gel protein crystal growth in attempts to 'mimic' the benefits of microgravity on Earth. Finally, the recent new results from our experiments on the shuttle mission LMS are described. These results include CCD video as well as interferometry during the mission, followed, on return to Earth, by reciprocal space mapping at the NSLS, Brookhaven, and full X-ray data collection on LMS and Earth control lysozyme crystals. Diffraction data recorded from LMS and ground control apocrustacyanin C(sub 1) crystals are also described.

  2. Expression, purification, crystallization and preliminary X-ray analysis of a C-terminal fragment of the Epstein–Barr virus ZEBRA protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morand, Patrice; Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble; Budayova-Spano, Monika

    A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiationmore » (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.« less

  3. Expression, purification, crystallization and preliminary X-ray analysis of perakine reductase, a new member of the aldo-keto reductase enzyme superfamily from higher plants

    PubMed Central

    Rosenthal, Cindy; Mueller, Uwe; Panjikar, Santosh; Sun, Lianli; Ruppert, Martin; Zhao, Yu; Stöckigt, Joachim

    2006-01-01

    Perakine reductase (PR) is a novel member of the aldo-keto reductase enzyme superfamily from higher plants. PR from the plant Rauvolfia serpentina is involved in the biosynthesis of monoterpenoid indole alkaloids by performing NADPH-dependent reduction of perakine, yielding raucaffrinoline. However, PR can also reduce cinnamic aldehyde and some of its derivatives. After heterologous expression of a triple mutant of PR in Escherichia coli, crystals of the purified and methylated enzyme were obtained by the hanging-drop vapour-diffusion technique at 293 K with 100 mM sodium citrate pH 5.6 and 27% PEG 4000 as precipitant. Crystals belong to space group C2221 and diffract to 2.0 Å, with unit-cell parameters a = 58.9, b = 93.0, c = 143.4 Å. PMID:17142919

  4. Crystallization and preliminary X-ray analysis of an exotype alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, a member of polysaccharide lyase family 15

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ochiai, Akihito; Yamasaki, Masayuki; Mikami, Bunzo

    2006-05-01

    The crystallization and preliminary X-ray characterization of a family PL-15 exotype alginate lyase are presented. Almost all alginate lyases depolymerize alginate in an endolytical fashion via a β-elimination reaction. The alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, consisting of 776 amino-acid residues, is a novel exotype alginate lyase classified into polysaccharide lyase family 15. The enzyme was crystallized at 293 K by sitting-drop vapour diffusion with polyethylene glycol 4000 as a precipitant. Preliminary X-ray analysis showed that the Atu3025 crystal belonged to space group P2{sub 1} and diffracted to 2.8 Å resolution, with unit-cell parameters a = 107.7, bmore » = 108.3, c = 149.5 Å, β = 91.5°.« less

  5. Theoretical model of the Bergeron-Findeisen mechanism of ice crystal growth in clouds

    NASA Astrophysics Data System (ADS)

    Castellano, N. E.; Avila, E. E.; Saunders, C. P. R.

    A numerical study of growth rate of ice particles in an array of water droplets (Bergeron-Findeisen mechanism) has used the method of electrostatic image charges to determine the vapour field in which a particle grows. Analysis of growth rate in various conditions of relevance to clouds has shown that it is proportional to liquid water content and to ice particle size, while it is inversely proportional to cloud droplet size. The results show that growth rate is enhanced by several percent relative to the usual treatment in which vapour is assumed to diffuse from infinity towards a growing ice particle. The study was performed for ice particles between 25 and 150 μm radii, water droplet sizes between 6 and 20 μm diameter and a wide range of liquid water contents. A study was also made to determine the effect of reducing the vapour source at infinity so that the droplets alone provided the vapour for particle growth. A parameterisation of ice particle growth rate is given as a function of liquid water content and ice particle and droplet sizes. These studies are of importance to considerations in thunderstorm electrification processes, where the mechanism of charge transfer between ice particles and graupel could take place.

  6. Prediction and validation of diffusion coefficients in a model drug delivery system using microsecond atomistic molecular dynamics simulation and vapour sorption analysis.

    PubMed

    Forrey, Christopher; Saylor, David M; Silverstein, Joshua S; Douglas, Jack F; Davis, Eric M; Elabd, Yossef A

    2014-10-14

    Diffusion of small to medium sized molecules in polymeric medical device materials underlies a broad range of public health concerns related to unintended leaching from or uptake into implantable medical devices. However, obtaining accurate diffusion coefficients for such systems at physiological temperature represents a formidable challenge, both experimentally and computationally. While molecular dynamics simulation has been used to accurately predict the diffusion coefficients, D, of a handful of gases in various polymers, this success has not been extended to molecules larger than gases, e.g., condensable vapours, liquids, and drugs. We present atomistic molecular dynamics simulation predictions of diffusion in a model drug eluting system that represent a dramatic improvement in accuracy compared to previous simulation predictions for comparable systems. We find that, for simulations of insufficient duration, sub-diffusive dynamics can lead to dramatic over-prediction of D. We present useful metrics for monitoring the extent of sub-diffusive dynamics and explore how these metrics correlate to error in D. We also identify a relationship between diffusion and fast dynamics in our system, which may serve as a means to more rapidly predict diffusion in slowly diffusing systems. Our work provides important precedent and essential insights for utilizing atomistic molecular dynamics simulations to predict diffusion coefficients of small to medium sized molecules in condensed soft matter systems.

  7. Controlled dehydration improves the diffraction quality of two RNA crystals.

    PubMed

    Park, HaJeung; Tran, Tuan; Lee, Jun Hyuck; Park, Hyun; Disney, Matthew D

    2016-11-03

    Post-crystallization dehydration methods, applying either vapor diffusion or humidity control devices, have been widely used to improve the diffraction quality of protein crystals. Despite the fact that RNA crystals tend to diffract poorly, there is a dearth of reports on the application of dehydration methods to improve the diffraction quality of RNA crystals. We use dehydration techniques with a Free Mounting System (FMS, a humidity control device) to recover the poor diffraction quality of RNA crystals. These approaches were applied to RNA constructs that model various RNA-mediated repeat expansion disorders. The method we describe herein could serve as a general tool to improve diffraction quality of RNA crystals to facilitate structure determinations.

  8. The effect of lemon, orange and bergamot essential oils and their components on the survival of Campylobacter jejuni, Escherichia coli O157, Listeria monocytogenes, Bacillus cereus and Staphylococcus aureus in vitro and in food systems.

    PubMed

    Fisher, K; Phillips, C A

    2006-12-01

    To investigate the effectiveness of oils and vapours of lemon (Citrus limon), sweet orange (Citrus sinensis) and bergamot (Citrus bergamia) and their components against a number of common foodborne pathogens. The disc diffusion method was used to screen the oils and vapours against Listeria monocytogenes, Staphylococcus aureus, Bacillus cereus, Escherichia coli O157 and Campylobacter jejuni. The survival of each species, demonstrated to be susceptible in the in vitro studies, was tested on cabbage leaf for 60 s by direct contact and on chicken skin for 10 min by direct contact and 24 h by vapour. The results indicate that bergamot was the most inhibitory essential oil (EO) and citral and linalool mimicked its effect (P > 0.001). Citral and linalool vapours produced 6 log reductions in L. monocytogenes, Staph. aureus and B. cereus populations on cabbage leaf after 8-10 h exposure but bergamot vapour exposure, while producing a similar reduction in L. monocytogenes and B. cereus populations, had no effect on Staph. aureus. Bergamot was the most effective of the oils tested and linalool the most effective anti-bacterial component. Gram-positive bacteria were more susceptible than Gram-negative bacteria in vitro, although Camp. jejuni and E. coli O157 were inhibited by bergamot and linalool oils and by linalool vapour. All bacteria tested were less susceptible in food systems than in vitro. Of the Gram-positive bacteria tested Staph. aureus was the least susceptible to both the oils and the components tested. Results suggest the possibility that citrus EOs, particularly bergamot, could be used as a way of combating the growth of common causes of food poisoning.

  9. Crystallization and preliminary crystallographic analysis of l-asparaginase from Erwinia carotovora

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wikman, Linnea E. K.; Krasotkina, Julya; Kuchumova, Anastasia

    2005-04-01

    Er. carotovoral-asparaginase, a potential antileukaemic agent, has been crystallized. Crystals diffract to 2.6 Å using a rotating-anode source and belong to space group P2{sub 1}, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. Bacterial l-asparaginases have been used as therapeutic agents in the treatment of acute childhood lymphoblastic leukaemia for over 30 y. However, their use is limited owing to the glutaminase activity of the administered enzymes, which results in serious side effects. In contrast, l-asparaginase from Erwinia carotovora exhibits low glutaminase activity atmore » physiological concentrations of l-asparagine and l-glutamine in the blood. Recombinant Er. carotovoral-asparaginase was crystallized in the presence of l-glutamate by the hanging-drop vapour-diffusion method using 10 mg ml{sup −1} purified enzyme, 16–18%(w/v) PEG 3350 and 0.2 M NaF. X-ray diffraction data were collected to 2.6 Å at 293 K using an in-house rotating-anode generator. The crystals belong to the monoclinic P2{sub 1} space group, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. A molecular-replacement solution has been found and refinement is currently in progress. The crystal structure may provide leads towards protein-engineering efforts aimed at safer asparaginase administration in leukaemia treatment.« less

  10. Crystallization and preliminary X-ray diffraction analysis of Val57 mutants of the amyloidogenic protein human cystatin C

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Orlikowska, Marta; Jankowska, Elzbieta; Borek, Dominika

    2012-03-15

    Human cystatin C (hCC) is a low-molecular-mass protein (120 amino-acid residues, 13 343 Da) found in all nucleated cells. Its main physiological role is regulation of the activity of cysteine proteases. Biologically active hCC is a monomeric protein, but all crystallization efforts have resulted in a dimeric domain-swapped structure. Recently, two monomeric structures were reported for cystatin C variants. In one of them stabilization was achieved by abolishing the possibility of domain swapping by the introduction of an additional disulfide bridge connecting the two protein domains (Cys47-Cys69). In the second structure, reported by this group, the monomeric hCC fold wasmore » preserved by stabilization of the conformationally constrained loop (L1) by a single-amino-acid substitution (V57N). To further assess the influence of changes in the sequence and properties of loop L1 on the dimerization propensity of cystatin C, two additional hCC mutants were obtained: one with a residue favoured in {beta}-turns (V57D) and another with proline (V57P), a residue that is known to be a structural element that can rigidify but also broaden turns. Here, the expression, purification and crystallization of V57D and V57P variants of recombinant human cystatin C are described. Crystals were grown by the vapour-diffusion method. Several diffraction data sets were collected using a synchrotron source at the Advanced Photon Source, Argonne National Laboratory, Chicago, USA.« less

  11. Growth of microorganisms in Martian-like shallow subsurface conditions: laboratory modelling

    NASA Astrophysics Data System (ADS)

    Pavlov, A. K.; Shelegedin, V. N.; Vdovina, M. A.; Pavlov, A. A.

    2010-01-01

    Low atmospheric pressures on Mars and the lack of substantial amounts of liquid water were suggested to be among the major limiting factors for the potential Martian biosphere. However, large amounts of ice were detected in the relatively shallow subsurface layers of Mars by the Odyssey Mission and when ice sublimates the water vapour can diffuse through the porous surface layer of the soil. Here we studied the possibility for the active growth of microorganisms in such a vapour diffusion layer. Our results showed the possibility of metabolism and the reproduction of non-extremophile terrestrial microorganisms (Vibrio sp.) under very low (0.01-0.1 mbar) atmospheric pressures in a Martian-like shallow subsurface regolith.

  12. Simplified conditions holding at the gas-liquid interface during evaporation

    NASA Astrophysics Data System (ADS)

    Morris, S. J. S.

    2017-11-01

    We show that on the gas side of the interface between a pure liquid and a binary mixture of its vapour with an insoluble gas, the normal derivative of vapour partial pressure pv satisfies ∂pv/∂n +αc/2 πpD (P -pv) (p -pv) = 0 . Constants α, c, D denote the dimensionless accommodation coefficient, a molecular speed and the diffusivity. Provided the continuum approximation holds within the gas, and α = O(1) , this boundary condition implies that evaporation can take one of two forms. (a) If the coexistence pressure P evaluated at the interface is less than the constant total gas pressure p, liquid at the interface is in local thermodynamic equilibrium with its vapour, and the evaporation rate is determined by diffusion through the gas. (b) Conversely, if P > p , gas at the interface consists of pure vapour, and the evaporation rate is determined by processes within the liquid. In the Wayner theory of the heated evaporating meniscus, such as that in a heat pipe, case (b) is assumed. As an application of our result, we show that some of the published experiments intended to test the Wayner theory instead operate under conditions in which case (a) holds. As a result, they do not perform the test intended.

  13. Optics for coherent X-ray applications.

    PubMed

    Yabashi, Makina; Tono, Kensuke; Mimura, Hidekazu; Matsuyama, Satoshi; Yamauchi, Kazuto; Tanaka, Takashi; Tanaka, Hitoshi; Tamasaku, Kenji; Ohashi, Haruhiko; Goto, Shunji; Ishikawa, Tetsuya

    2014-09-01

    Developments of X-ray optics for full utilization of diffraction-limited storage rings (DLSRs) are presented. The expected performance of DLSRs is introduced using the design parameters of SPring-8 II. To develop optical elements applicable to manipulation of coherent X-rays, advanced technologies on precise processing and metrology were invented. With propagation-based coherent X-rays at the 1 km beamline of SPring-8, a beryllium window fabricated with the physical-vapour-deposition method was found to have ideal speckle-free properties. The elastic emission machining method was utilized for developing reflective mirrors without distortion of the wavefronts. The method was further applied to production of diffraction-limited focusing mirrors generating the smallest spot size in the sub-10 nm regime. To enable production of ultra-intense nanobeams at DLSRs, a low-vibration cooling system for a high-heat-load monochromator and advanced diagnostic systems to characterize X-ray beam properties precisely were developed. Finally, new experimental schemes for combinative nano-analysis and spectroscopy realised with novel X-ray optics are discussed.

  14. Transport mechanisms through PE-CVD coatings: influence of temperature, coating properties and defects on permeation of water vapour

    NASA Astrophysics Data System (ADS)

    Kirchheim, Dennis; Jaritz, Montgomery; Mitschker, Felix; Gebhard, Maximilian; Brochhagen, Markus; Hopmann, Christian; Böke, Marc; Devi, Anjana; Awakowicz, Peter; Dahlmann, Rainer

    2017-03-01

    Gas transport mechanisms through plastics are usually described by the temperature-dependent Arrhenius-model and compositions of several plastic layers are represented by the CLT. When it comes to thin films such as plasma-enhanced chemical vapour deposition (PE-CVD) or plasma-enhanced atomic layer deposition (PE-ALD) coatings on substrates of polymeric material, a universal model is lacking. While existing models describe diffusion through defects, these models presume that permeation does not occur by other means of transport mechanisms. This paper correlates the existing transport models with data from water vapour transmission experiments.

  15. Cloning, overexpression, crystallization and preliminary X-ray crystallographic analysis of a slow-processing mutant of penicillin G acylase from Kluyvera citrophila.

    PubMed

    Varshney, Nishant Kumar; Ramasamy, Sureshkumar; Brannigan, James A; Wilkinson, Anthony J; Suresh, C G

    2013-08-01

    Kluyvera citrophila penicillin G acylase (KcPGA) has recently attracted increased attention relative to the well studied and commonly used Escherichia coli PGA (EcPGA) because KcPGA is more resilient to harsh conditions and is easier to immobilize for the industrial hydrolysis of natural penicillins to generate the 6-aminopenicillin (6-APA) nucleus, which is the starting material for semi-synthetic antibiotic production. Like other penicillin acylases, KcPGA is synthesized as a single-chain inactive pro-PGA, which upon autocatalytic processing becomes an active heterodimer of α and β chains. Here, the cloning of the pac gene encoding KcPGA and the preparation of a slow-processing mutant precursor are reported. The purification, crystallization and preliminary X-ray analysis of crystals of this precursor protein are described. The protein crystallized in two different space groups, P1, with unit-cell parameters a = 54.0, b = 124.6, c = 135.1 Å, α = 104.1, β = 101.4, γ = 96.5°, and C2, with unit-cell parameters a = 265.1, b = 54.0, c = 249.2 Å, β = 104.4°, using the sitting-drop vapour-diffusion method. Diffraction data were collected at 100 K and the phases were determined using the molecular-replacement method. The initial maps revealed electron density for the spacer peptide.

  16. Chemical vapour deposition growth of carbon nanotube forests: kinetics, morphology, composition, and their mechanisms

    NASA Astrophysics Data System (ADS)

    Vinten, Phillip

    This thesis analyzes the chemical vapour deposition (CVD) growth of vertically aligned carbon nanotube (CNT) forests in order to understand how CNT forests grow, why they stop growing, and how to control the properties of the synthesized CNTs. in situ kinetics data of the growth of CNT forests are gathered by in situ optical microscopy. The overall morphology of the forests and the characteristics of the individual CNTs in the forests are investigated using scanning electron microscopy and Raman spectroscopy. The in situ data show that forest growth and termination are activated processes (with activation energies on the order of 1 eV), suggesting a possible chemical origin. The activation energy changes at a critical temperature for ethanol CVD (approximately 870°C). These activation energies and critical temperature are also seen in the temperature dependence of several important characteristics of the CNTs, including the defect density as determined by Raman spectroscopy. This observation is seen across several CVD processes and suggests a mechanism of defect healing. The CNT diameter also depends on the growth temperature. In this thesis, a thermodynamic model is proposed. This model predicts a temperature and pressure dependence of the CNT diameter from the thermodynamics of the synthesis reaction and the effect of strain on the enthalpy of formation of CNTs. The forest morphology suggests significant interaction between the constituent CNTs. These interactions may play a role in termination. The morphology, in particular a microscale rippling feature that is capable of diffracting light, suggest a non-uniform growth rate across the forest. A gas phase diffusion model predicts a non-uniform distribution of the source gas. This gas phase diffusion is suggested as a possible explanation for the non-uniform growth rate. The gas phase diffusion is important because growth by acetylene CVD is found to be very efficient (approximately 30% of the acetylene is converted to CNTs). It is seen that multiple mechanisms are active during CNT growth. The results of this thesis provide insight into both the basic understanding of the microscopic processes involved in CVD growth and how to control the properties of the synthesized CNTs.

  17. Laterally Overgrown Structures as Substrates for Lattice Mismatched Epitaxy

    DTIC Science & Technology

    2002-06-03

    low supersaturation substrate [3]. Therefore, equilibrium growth techniques as liquid buffer with TD phase epitaxy (LPE) or vapour phase epitaxy (VPE...phase diffusion during MBE growth, so lateral over- low cost semiconductor devices. Therefore, vapour growth must rely on the surface mobility of...is replaced by graphite film not wetted For the GaAs on GaAs ELO system we attributed by the gallium melt [35]. Similarly, tungsten has been broadening

  18. A novel grating-imaging method to measure carrier diffusion coefficient in graphene

    NASA Astrophysics Data System (ADS)

    Chen, Ke; Wang, Yaguo; Akinwande, Deji; Bank, Seth; Lin, Jung-Fu

    Similar to carrier mobility, carrier diffusion coefficient in graphene determines the response rate of future graphene-based electronics. Here we present a simple, sensitive and non-destructive technique integrated with ultrafast pump-probe spectroscopy to measure carrier diffusion in CVD-grown graphene. In the method, the pump and the probe beams pass through the same area of a photomask with metal strips i.e. a transmission amplitude grating, and get diffracted. The diffracted light is collected by an objective lens and focused onto the sample to generate carrier density grating. Relaxation of this carrier density grating is governed by both carrier recombination and carrier diffusion in the sample. Transient transmission change of the probe beams, which reflects this relaxation process, is recorded. The measured diffusion coefficients of multilayer and monolayer CVD-grown graphene are 2000cm2/s and 10000cm2/s, respectively, comparable with the reported values of epitaxial graphene and reduced graphene. This transmission grating technique can be used to measure carrier dynamics in versatile 2D materials.

  19. Crystallization and preliminary X-ray studies of dUTPase from Mason–Pfizer monkey retrovirus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barabás, Orsolya; Németh, Veronika; Vértessy, Beáta G., E-mail: vertessy@enzim.hu

    2006-04-01

    Deoxyuridine 5′-triphosphate nucleotidohydrolase from Mason–Pfizer monkey retrovirus (M-PMV dUTPase) is a betaretroviral member of the dUTPase enzyme family. The nucleocapsid-free dUTPase (48426 Da) was co-crystallized with a dUTP substrate analogue using the hanging-drop vapour-diffusion method. Deoxyuridine 5′-triphosphate nucleotidohydrolase from Mason–Pfizer monkey retrovirus (M-PMV dUTPase) is a betaretroviral member of the dUTPase enzyme family. In the mature M-PMV virion, this enzyme is present as the C-terminal domain of the fusion protein nucleocapsid-dUTPase. The homotrimeric organization characteristic of dUTPases is retained in this bifunctional fusion protein. The fusion protein supposedly plays a role in adequate localization of dUTPase activity in the vicinitymore » of nucleic acids during reverse transcription and integration. Here, the nucleocapsid-free dUTPase (48 426 Da) was cocrystallized with a dUTP substrate analogue using the hanging-drop vapour-diffusion method. The obtained crystals belong to the primitive hexagonal space group P6{sub 3}, with unit-cell parameters a = 60.6, b = 60.6, c = 63.6 Å, α = 90, β = 90, γ = 120°. Native and PtCl{sub 4}-derivative data sets were collected using synchrotron radiation to 1.75 and 2.3 Å, respectively. Phasing was successfully performed by isomorphous replacement combined with anomalous scattering.« less

  20. Crystallization and preliminary X-ray diffraction studies of trypsin-like proteases from the gastric fluid of the marine crab Cancer pagurus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hehemann, Jan-Hendrik; Redecke, Lars; Perbandt, Markus

    2007-03-01

    Two trypsins from the gastric fluid of the marine crab C. pagurus were purified and crystallized and X-ray data were collected to 0.97 and 3.2 Å resolution. The digestive fluid of the marine crab Cancer pagurus (Decapoda, Brachyura) contains highly stable proteases which display enhanced activity in aqueous mixtures of organic solvents. Three trypsins were isolated from the gastric fluid and two of them, C.p.TryII and C.p.TryIII, were purified to homogeneity by anion-exchange chromatography and crystallized by hanging-drop vapour diffusion. Diffraction data were collected at a synchrotron to 0.97 and 3.2 Å resolution, respectively. The crystal of C.p.TryII belongs tomore » the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.06, b = 62.00, c = 71.66 Å. Based on the Matthews coefficient, one protein molecule per asymmetric unit is suggested. In contrast, crystals of C.p.TryIII, which belong to the cubic space group P2{sub 1}3 with unit-cell parameters a = b = c = 215.4 Å, are assumed to contain 12 molecules per asymmetric unit.« less

  1. Crystallization of the receptor-binding domain of parathyroid hormone-related protein in complex with a neutralizing monoclonal antibody Fab fragment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McKinstry, William J.; Polekhina, Galina; Diefenbach-Jagger, Hannelore

    Parathyroid hormone-related protein (PTHrP) plays an important role in regulating embryonic skeletal development and is abnormally regulated in the pathogenesis of skeletal complications observed with many cancers and osteoporosis. It exerts its action through binding to a G-protein-coupled seven-transmembrane cell-surface receptor (GPCR). Structurally, GPCRs are very difficult to study by X-ray crystallography. In this study, a monoclonal antibody Fab fragment which recognizes the same region of PTHrP as its receptor, PTH1R, was used to aid in the crystallization of PTHrP. The resultant protein complex was crystallized using the hanging-drop vapour-diffusion method with polyethylene glycol as a precipitant. The crystals belongedmore » to the orthorhombic space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 72.6, b = 96.3, c = 88.5 {angstrom}, and diffracted to 2.0 {angstrom} resolution using synchrotron radiation. The crystal structure will shed light on the nature of the key residues of PTHrP that interact with the antibody and will provide insights into how the antibody is able to discriminate between PTHrP and the related molecule parathyroid homone.« less

  2. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    NASA Astrophysics Data System (ADS)

    Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2016-11-01

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P1211 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.

  3. A comparison between protein crystals grown with vapor diffusion methods in microgravity and protein crystals using a gel liquid-liquid diffusion ground-based method

    NASA Technical Reports Server (NTRS)

    Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.

    1992-01-01

    Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.

  4. Major diffusion leaks of clamp-on leaf cuvettes still unaccounted: how erroneous are the estimates of Farquhar et al. model parameters?

    PubMed

    Rodeghiero, Mirco; Niinemets, Ulo; Cescatti, Alessandro

    2007-08-01

    Estimates of leaf gas-exchange characteristics using standard clamp-on leaf chambers are prone to errors because of diffusion leaks. While some consideration has been given to CO(2) diffusion leaks, potential water vapour diffusion leaks through chamber gaskets have been neglected. We estimated diffusion leaks of two clamp-on Li-Cor LI-6400 (Li-Cor, Inc., Lincoln, NE, USA) leaf chambers with polymer foam gaskets and enclosing either 2 or 6 cm(2) leaf area, and conducted a sensitivity analysis of the diffusion leak effects on Farquhar et al. photosynthesis model parameters - the maximum carboxylase activity of ribulose 1 x 5-bisphosphate carboxylase/oxygenase (Rubisco) (V(cmax)), capacity for photosynthetic electron transport (J(max)) and non-photorespiratory respiration rate in light (R(d)). In addition, net assimilation rate (A(n)) versus intercellular CO(2) (C(i)) responses were measured in leaves of Mediterranean evergreen species Quercus ilex L. enclosing the whole leaf chamber in a polyvinyl fluoride bag flushed with the exhaust air of leaf chamber, thereby effectively reducing the CO(2) and water vapour gradients between ambient air and leaf chamber. For the empty chambers, average diffusion leak for CO(2), K(CO2), (molar flow rate corresponding to unit CO(2) mole fraction difference) was ca. 0.40 micromol s(-1). K(CO2) increased ca. 50% if a dead leaf was clamped between the leaf chamber. Average diffusion leak for H(2)O was ca. 5- to 10-fold larger than the diffusion leak for CO(2). Sensitivity analyses demonstrated that the consequence of a CO(2) diffusion leak was apparent enhancement of A(n) at high CO(2) mole fraction and reduction at lower CO(2) mole fraction, and overall compression of C(i) range. As the result of these modifications, Farquhar et al. model parameters were overestimated. The degree of overestimation increased in the order of V(cmax) < J(max) < R(d), and was larger for smaller chambers and for leaves with lower photosynthetic capacity, leading to overestimation of all three parameters by 70-290% for 2 cm(2), and by 10-60% for 6 cm(2) chamber. Significant diffusion corrections (5-36%) were even required for leaves with high photosynthetic capacity measured in largest chamber. Water vapour diffusion leaks further enhanced the overestimation of model parameters. For small chambers and low photosynthetic capacities, apparent C(i) was simulated to decrease with increasing A(n) because of simultaneous CO(2) and H(2)O diffusion leaks. Measurements in low photosynthetic capacity Quercus ilex leaves enclosed in 2 cm(2) leaf chamber exhibited negative apparent C(i) values at highest A(n). For the same leaves measured with the entire leaf chamber enclosed in the polyvinyl fluoride bag, C(i) and A(n) increased monotonically. While the measurements without the bag could be corrected for diffusion leaks, the required correction in A(n) and transpiration rates was 100-500%, and there was large uncertainty in Farquhar et al. model parameters derived from 'corrected'A(n)/C(i) response curves because of uncertainties in true diffusion leaks. These data demonstrate that both CO(2) and water vapour diffusion leaks need consideration in measurements with clamp-on leaf cuvettes. As plants in natural environments are often characterized by low photosynthetic capacities, cuvette designs need to be improved for reliable measurements in such species.

  5. The survival of three strains of Arcobacter butzleri in the presence of lemon, orange and bergamot essential oils and their components in vitro and on food.

    PubMed

    Fisher, K; Rowe, C; Phillips, C A

    2007-05-01

    To test the effect of oils and vapours of lemon, sweet orange and bergamot and their components against three Arcobacter butzleri strains. The disc diffusion method was used to screen the oils and vapours against three strains of A. butzleri. In vitro bergamot was the most inhibitory essential oil (EO) and both citral and linalool were effective. On cabbage leaf, the water isolate was the least susceptible to bergamot EO, citral and linalool (1-2 log reduction), with the chicken isolate being the most susceptible (6-8 log reduction). However, the latter appeared not to be susceptible to vapours over 24 h although type strain and water isolate populations reduced by 8 logs. On chicken skin, the effectiveness of the oils was reduced compared with that on cabbage leaf. Bergamot was the most effective of the oils tested and linalool the most effective component. All strains tested were less susceptible in food systems than in vitro. Arcobacter isolates vary in their response to EO suggesting that the results of type strain studies should be interpreted with caution. Bergamot EO has the potential for the inhibition of this 'emerging' pathogen.

  6. New method to assess the water vapour permeance of wound coverings.

    PubMed

    Jonkman, M F; Molenaar, I; Nieuwenhuis, P; Bruin, P; Pennings, A J

    1988-05-01

    A new method for assessing the permeability to water vapour of wound coverings is presented, using the evaporimeter developed by Nilsson. This new method combines the water vapour transmission rate (WVTR) and the vapour pressure difference across a wound covering in one absolute measure: the water vapour permeance (WVP). The WVP of a wound covering is the steady flow (g) of water vapour per unit (m2) area of surface in unit (h) time induced by unit (kPa) vapour pressure difference, g.m-2.h-1.kPa-1. Since the WVP of a wound covering is a more accurate measure for the permeability than the WVTR is, it facilitates the prediction of the water exchange of a wound covering in clinical situations.

  7. Time-dependent calculations of molten pool formation and thermal plasma with metal vapour in gas tungsten arc welding

    NASA Astrophysics Data System (ADS)

    Tanaka, M.; Yamamoto, K.; Tashiro, S.; Nakata, K.; Yamamoto, E.; Yamazaki, K.; Suzuki, K.; Murphy, A. B.; Lowke, J. J.

    2010-11-01

    A gas tungsten arc (GTA) was modelled taking into account the contamination of the plasma by metal vapour from the molten anode. The whole region of GTA atmosphere including the tungsten cathode, the arc plasma and the anode was treated using a unified numerical model. A viscosity approximation was used to express the diffusion coefficient in terms of viscosity of the shielding gas and metal vapour. The transient two-dimensional distributions of temperature, velocity of plasma flow and iron vapour concentration were predicted, together with the molten pool as a function of time for a 150 A arc current at atmospheric pressure, both for helium and argon gases. It was shown that the thermal plasma in the GTA was influenced by iron vapour from the molten pool surface and that the concentration of iron vapour in the plasma was dependent on the temperature of the molten pool. GTA on high sulfur stainless steel was calculated to discuss the differences between a low sulfur and a high sulfur stainless steel anode. Helium was selected as the shielding gas because a helium GTA produces more metal vapour than an argon GTA. In the GTA on a high sulfur stainless steel anode, iron vapour and current path were constricted. Radiative emission density in the GTA on high sulfur stainless steel was also concentrated in the centre area of the arc plasma together with the iron vapour although the temperature distributions were almost the same as that in the case of a low sulfur stainless steel anode.

  8. Carrier and photon dynamics in a topological insulator Bi{sub 2}Te{sub 3}/GaN type II staggered heterostructure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chaturvedi, P.; Chouksey, S.; Banerjee, D.

    2015-11-09

    We have demonstrated a type-II band-aligned heterostructure between pulsed laser deposited topological insulator bismuth telluride and metal organic-chemical-vapour deposited GaN on a sapphire substrate. The heterostructure shows a large valence band-offset of 3.27 eV as determined from x-ray photoelectron spectroscopy, which is close to the bandgap of GaN (3.4 eV). Further investigation using x-ray diffraction, Raman spectroscopy, and energy-dispersive x-ray spectrum reveals the stoichiometric and material properties of bismuth telluride on GaN. Steady state photon emission from GaN is found to be modulated by the charge transfer process due to diffusion across the junction. The time constant involved with the charge transfermore » process is found to be 0.6 ns by transient absorption spectroscopy. The heterostructure can be used for designing devices with different functionalities and improving the performance of the existing devices on GaN.« less

  9. Cloning, expression, purification, crystallization and preliminary X-ray crystallographic analysis of bacterioferritin A from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gupta, Vibha; Gupta, Rakesh K.; Ram Lal Anand College, University of Delhi, Benito Juarez Road, New Delhi 110021

    2008-05-01

    The cloning, purification and crystallization of a bacterioferritin from M. tuberculosis together with preliminary X-ray characterization of its crystals are reported. Bacterioferritins (Bfrs) comprise a subfamily of the ferritin superfamily of proteins that play an important role in bacterial iron storage and homeostasis. Bacterioferritins differ from ferritins in that they have additional noncovalently bound haem groups. To assess the physiological role of this subfamily of ferritins, a greater understanding of the structural details of bacterioferritins from various sources is required. The gene encoding bacterioferritin A (BfrA) from Mycobacterium tuberculosis was cloned and expressed in Escherichia coli. The recombinant protein productmore » was purified by affinity chromatography on a Strep-Tactin column and crystallized with sodium chloride as a precipitant at pH 8.0 using the vapour-diffusion technique. The crystals diffracted to 2.1 Å resolution and belonged to space group P4{sub 2}, with unit-cell parameters a = 123.0, b = 123.0, c = 174.6 Å.« less

  10. Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir

    The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02more » Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry.« less

  11. Intrinsic Hydrophobicity of Rammed Earth

    NASA Astrophysics Data System (ADS)

    Holub, M.; Stone, C.; Balintova, M.; Grul, R.

    2015-11-01

    Rammed earth is well known for its vapour diffusion properties, its ability to regulate humidity within the built environment. Rammed earth is also an aesthetically iconic material such as marble or granite and therefore is preferably left exposed. However exposed rammed earth is often coated with silane/siloxane water repellents or the structure is modified architecturally (large roof overhangs) to accommodate for the hydrophilic nature of the material. This paper sets out to find out optimal hydrophobicity for rammed earth based on natural composite fibres and surface coating without adversely affecting the vapour diffusivity of the material. The material is not required to be waterproof, but should resist at least driving rain. In order to evaluate different approaches to increase hydrophobicity of rammed earth surface, peat fibres and four types of repellents were used.

  12. Crystallization and preliminary X-ray crystallographic analysis of an ice-binding protein (FfIBP) from Flavobacterium frigoris PS1.

    PubMed

    Do, Hackwon; Lee, Jun Hyuck; Lee, Sung Gu; Kim, Hak Jun

    2012-07-01

    Ice growth in a cold environment is fatal for polar organisms, not only because of the physical destruction of inner cell organelles but also because of the resulting chemical damage owing to processes such as osmotic shock. The properties of ice-binding proteins (IBPs), which include antifreeze proteins (AFPs), have been characterized and IBPs exhibit the ability to inhibit ice growth by binding to specific ice planes and lowering the freezing point. An ice-binding protein (FfIBP) from the Gram-negative bacterium Flavobacterium frigoris PS1, which was isolated from the Antarctic, has recently been overexpressed. Interestingly, the thermal hysteresis activity of FfIBP was approximately 2.5 K at 50 µM, which is ten times higher than that of the moderately active IBP from Arctic yeast (LeIBP). Although FfIBP closely resembles LeIBP in its amino-acid sequence, the antifreeze activity of FfIBP appears to be much greater than that of LeIBP. In an effort to understand the reason for this difference, an attempt was made to solve the crystal structure of FfIBP. Here, the crystallization and X-ray diffraction data of FfIBP are reported. FfIBP was crystallized using the hanging-drop vapour-diffusion method with 0.1 M sodium acetate pH 4.4 and 3 M sodium chloride as precipitant. A complete diffraction data set was collected to a resolution of 2.9 Å. The crystal belonged to space group P4(1)22, with unit-cell parameters a = b = 69.4, c = 178.2 Å. The asymmetric unit contained one monomer.

  13. Expression, purification and crystallization of two major envelope proteins from white spot syndrome virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang, Xuhua; Hew, Choy Leong, E-mail: dbshewcl@nus.edu.sg

    2007-07-01

    The crystallization of the N-terminal transmembrane region-truncated VP26 and VP28 of white spot syndrome virus is described. White spot syndrome virus (WSSV) is a major virulent pathogen known to infect penaeid shrimp and other crustaceans. VP26 and VP28, two major envelope proteins from WSSV, have been identified and overexpressed in Escherichia coli. In order to facilitate purification and crystallization, predicted N-terminal transmembrane regions of approximately 35 amino acids have been truncated from both VP26 and VP28. Truncated VP26 and VP28 and their corresponding SeMet-labelled proteins were purified and the SeMet proteins were crystallized by the hanging-drop vapour-diffusion method. Crystals ofmore » SeMet-labelled VP26 were obtained using a reservoir consisting of 0.1 M citric acid pH 3.5, 3.0 M sodium chloride and 1%(w/v) polyethylene glycol 3350, whereas SeMet VP28 was crystallized using a reservoir solution consisting of 25% polyethylene glycol 8000, 0.2 M calcium acetate, 0.1 M Na HEPES pH 7.5 and 1.5%(w/v) 1,2,3-heptanetriol. Crystals of SeMet-labelled VP26 diffract to 2.2 Å resolution and belong to space group R32, with unit-cell parameters a = b = 73.92, c = 199.31 Å. SeMet-labelled VP28 crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 105.33, b = 106.71, c = 200.37 Å, and diffracts to 2.0 Å resolution.« less

  14. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

    2016-11-15

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, βmore » = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.« less

  15. Optics for coherent X-ray applications

    PubMed Central

    Yabashi, Makina; Tono, Kensuke; Mimura, Hidekazu; Matsuyama, Satoshi; Yamauchi, Kazuto; Tanaka, Takashi; Tanaka, Hitoshi; Tamasaku, Kenji; Ohashi, Haruhiko; Goto, Shunji; Ishikawa, Tetsuya

    2014-01-01

    Developments of X-ray optics for full utilization of diffraction-limited storage rings (DLSRs) are presented. The expected performance of DLSRs is introduced using the design parameters of SPring-8 II. To develop optical elements applicable to manipulation of coherent X-rays, advanced technologies on precise processing and metrology were invented. With propagation-based coherent X-rays at the 1 km beamline of SPring-8, a beryllium window fabricated with the physical-vapour-deposition method was found to have ideal speckle-free properties. The elastic emission machining method was utilized for developing reflective mirrors without distortion of the wavefronts. The method was further applied to production of diffraction-limited focusing mirrors generating the smallest spot size in the sub-10 nm regime. To enable production of ultra-intense nanobeams at DLSRs, a low-vibration cooling system for a high-heat-load monochromator and advanced diagnostic systems to characterize X-ray beam properties precisely were developed. Finally, new experimental schemes for combinative nano-analysis and spectroscopy realised with novel X-ray optics are discussed. PMID:25177986

  16. Methods to improve the PVD coatability of brass by using diffusion barriers

    NASA Astrophysics Data System (ADS)

    Langer, Bernd

    Previous work involving PVD coatings on brass has used a combination of multilayers consisting of electroplated films like nickel or chromium and deposited decorative PVD coatings like TiN, TiAIN or ZrN systems. The disadvantages of these systems are the combination of wet electrochemistry and high tech vacuum processes. Furthermore the allergic reaction to nickel and the toxic nature of Cr(VI) must be considered.There is a need for intermediate layers to 'seal-off the brass in order to avoid the evaporation of zinc in vacuum using a diffusion barrier. Furthermore the intermediate layers are required to act as a corrosion barrier.This thesis reports on the development of PVD coatings on heat sensitive brass substrate materials utilising ABS technology with Al, CuAl8 and Nb targets as vapour sources.The brass pretreatment includes careful grinding, polishing and cleaning steps as well as steered arc metal ion etching using the above target materials. The coatings are produced at temperatures between 100 and 250°C in the unbalanced magnetron mode, including layers made from Al, Al-Nb, CuA18, CuAl8-Nb and Nb.Scratch adhesion and Rockwell indentation tests are found not to be directly applicable to the system of soft brass and ductile coating(s). Therefore a new classification for both scratch and indentation tests was defined. The best adhesion was shown by the CuA18 coatings on brass. Corrosion tests showed good results for the Al coatings and poor results for the pure Nb coatings directly applied on brass. The best corrosion result was obtained with a CuAl8-Nb layer system. This layer system also offers very good barrier behaviour concerning Zn diffusion.Other investigations like Glow Discharge Optical Emission Spectroscopy (GDOES), Scanning Electron Microscopy (SEM) imaging, Transmission Electron Microscopy (TEM) and X-ray Diffraction (XRD) were undertaken to characterise the new coating systems for brass.

  17. Coherent X-ray diffraction imaging of zinc oxide crystals

    NASA Astrophysics Data System (ADS)

    Leake, S. J.

    Zinc Oxide (ZnO) exhibits a plethora of physical properties potentially advantageous in many roles and is why it one of the most studied semiconductor compounds. When doped or in its intrinsic state ZnO demonstrates a multitude of electronic, optical and magnetic properties in a large variety of manufacturable morphologies. Thus it is inherently important to understand why these properties arise and the impact potentially invasive sample preparation methods have for both the function and durability of the material and its devices. Coherent X-ray Diffraction Imaging (CXDI) is a recently established non-destructive technique which can probe the whole three dimensional structure of small crystalline materials and has the potential for sub angstrom strain resolution. The iterative methods employed to overcome the `phase problem' are described fully. CXDI studies of wurtzite ZnO crystals in the rod morphology with high aspect ratio are presented. ZnO rods synthesised via Chemical Vapour Transport Deposition were studied in post growth state and during in-situ modification via metal evaporation processing and annealing. Small variations in post growth state were observed, the physical origin of which remains unidentified. The doping of a ZnO crystal with Iron, Nickel and Cobalt by thermal evaporation and subsequent annealing was studied. The evolution of diffusing ions into the crystal lattice from was not observed, decomposition was found to be the dominant process. Improvements in experimental technique allowed multiple Bragg reflections from a single ZnO crystal to be measured for the first time. Large aspect ratio ZnO rods were used to probe the coherence properties of the incident beam. The longitudinal coherence function of the illuminating radiation was mapped using the visibility of the interference pattern at each bragg reflection and an accurate estimate of the longitudinal coherence length obtained, xi(L) = 0.66pm 0.02 mu m. The consequences for data analysis are discussed. The combination of multiple Bragg reflections to realise three dimensional displacement fields was also approached.

  18. In-situ, time resolved monitoring of uranium in BFS:OPC grout. Part 1: Corrosion in water vapour.

    PubMed

    Stitt, C A; Paraskevoulakos, C; Banos, A; Harker, N J; Hallam, K R; Davenport, A; Street, S; Scott, T B

    2017-08-11

    Uranium encapsulated in grout was exposed to water vapour for extended periods of time. Through synchrotron x-ray powder diffraction and tomography measurements, uranium dioxide was determined the dominant corrosion product over a 50-week time period. The oxide growth rate initiated rapidly, with rates comparable to the U + H 2 O reaction. Over time, the reaction rate decreased and eventually plateaued to a rate similar to the U + H 2 O + O 2 reaction. This behaviour was not attributed to oxygen ingress, but instead the decreasing permeability of the grout, limiting oxidising species access to the metal surface.

  19. Crystallization and preliminary X-ray diffraction analysis of mouse galectin-4 N-terminal carbohydrate recognition domain in complex with lactose

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krejčiříková, Veronika; Fábry, Milan; Marková, Vladimíra

    2008-07-01

    Mouse galectin-4 carbohydrate binding domain was overexpressed in E. coli and crystallized in the presence of lactose. The crystals belong to tetragonal space group P42{sub 1}2 and diffraction data were collected to 2.1 Å resolution. Galectin-4 is thought to play a role in the process of tumour conversion of cells of the alimentary tract and the breast tissue; however, its exact function remains unknown. With the aim of elucidating the structural basis of mouse galectin-4 (mGal-4) binding specificity, we have undertaken X-ray analysis of the N-terminal domain, CRD1, of mGal-4 in complex with lactose (the basic building block of knownmore » galectin-4 carbohydrate ligands). Crystals of CRD1 in complex with lactose were obtained using vapour-diffusion techniques. The crystals belong to tetragonal space group P42{sub 1}2 with unit-cell parameters a = 91.1, b = 91.16, c = 57.10 Å and preliminary X-ray diffraction data were collected to 3.2 Å resolution. An optimized crystallization procedure and cryocooling protocol allowed us to extend resolution to 2.1 Å. Structure refinement is currently under way; the initial electron-density maps clearly show non-protein electron density in the vicinity of the carbohydrate binding site, indicating the presence of one lactose molecule. The structure will help to improve understanding of the binding specificity and function of the potential colon cancer marker galectin-4.« less

  20. Isolation, purification, crystallization, and preliminary X-ray diffraction study of the crystals of HU protein from M. gallisepticum

    NASA Astrophysics Data System (ADS)

    Nikolaeva, A. Yu.; Timofeev, V. I.; Boiko, K. M.; Korzhenevskii, D. A.; Rakitina, T. V.; Dorovatovskii, P. V.; Lipkin, A. V.

    2015-11-01

    HU proteins are involved in bacterial DNA and RNA repair. Since these proteins are absent in cells of higher organisms, inhibitors of HU proteins can be used as effective and safe antibiotics. The crystallization conditions for the M. gallisepticum HU protein were found and optimized by the vapor-diffusion method. The X-ray diffraction data set was collected to 2.91 Å resolution from the crystals grown by the vapor-diffusion method on a synchrotron source. The crystals of the HU protein belong to sp. gr. P41212 and have the following unit-cell parameters: a = b = 97.94 Å, c = 77.92 Å, α = β = γ = 90°.

  1. Fine Structure of Diffuse Scattering Rings in Al-Li-Cu Quasicrystal: A Comparative X-ray and Electron Diffraction Study

    NASA Astrophysics Data System (ADS)

    Donnadieu, P.; Dénoyer, F.

    1996-11-01

    A comparative X-ray and electron diffraction study has been performed on Al-Li-Cu icosahedral quasicrystal in order to investigate the diffuse scattering rings revealed by a previous work. Electron diffraction confirms the existence of rings but shows that the rings have a fine structure. The diffuse aspect on the X-ray diffraction patterns is then due to an averaging effect. Recent simulations based on the model of canonical cells related to the icosahedral packing give diffractions patterns in agreement with this fine structure effect. Nous comparons les diagrammes de diffraction des rayon-X et des électrons obtenus sur les mêmes échantillons du quasicristal icosaèdrique Al-Li-Cu. Notre but est d'étudier les anneaux de diffusion diffuse mis en évidence par un travail précédent. Les diagrammes de diffraction électronique confirment la présence des anneaux mais ils montrent aussi que ces anneaux possèdent une structure fine. L'aspect diffus des anneaux révélés par la diffraction des rayons X est dû à un effet de moyenne. Des simulations récentes basées sur la décomposition en cellules canoniques de l'empilement icosaédrique produisent des diagrammes de diffraction en accord avec ces effects de structure fine.

  2. Expression, purification and crystallization of Trypanosoma cruzi dihydroorotate dehydrogenase complexed with orotate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Inaoka, Daniel Ken; Takashima, Eizo; Osanai, Arihiro

    2005-10-01

    The Trypanosoma cruzi dihydroorotate dehydrogenase, a key enzyme in pyrimidine de novo biosynthesis and redox homeostasis, was crystallized in complex with its first reaction product, orotate. Dihydroorotate dehydrogenase (DHOD) catalyzes the oxidation of dihydroorotate to orotate, the fourth step and the only redox reaction in the de novo biosynthesis of pyrimidine. DHOD from Trypanosoma cruzi (TcDHOD) has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. Crystals of the TcDHOD–orotate complex were grown at 277 K by the sitting-drop vapour-diffusion technique using polyethylene glycol 3350 as a precipitant. The crystals diffract to better than 1.8 Åmore » resolution using synchrotron radiation (λ = 0.900 Å). X-ray diffraction data were collected at 100 K and processed to 1.9 Å resolution with 98.2% completeness and an overall R{sub merge} of 7.8%. The TcDHOD crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 67.87, b = 71.89, c = 123.27 Å. The presence of two molecules in the asymmetric unit (2 × 34 kDa) gives a crystal volume per protein weight (V{sub M}) of 2.2 Å{sup 3} Da{sup −1} and a solvent content of 44%.« less

  3. Crystallization and preliminary X-ray study of the common edible mushroom (Agaricus bisporus) lectin.

    PubMed

    Carrizo, Maria E; Irazoqui, Fernando J; Lardone, Ricardo D; Nores, Gustavo A; Curtino, Juan A; Capaldi, Stefano; Perduca, Massimiliano; Monaco, Hugo L

    2004-04-01

    The lectin from the common edible mushroom Agaricus bisporus (ABL) belongs to the group of proteins that have the property of binding the Thomsen-Friedenreich antigen (T-antigen) selectively and with high affinity, but does not show any sequence similarity to the other proteins that share this property. The ABL sequence is instead similar to those of members of the saline-soluble fungal lectins, a protein family with pesticidal properties. The presence of different isoforms has been reported. It has been found that in order to be able to grow diffraction-quality crystals of the lectin, it is essential to separate the isoforms, which was performed by preparative isoelectric focusing. Using standard procedures, it was possible to crystallize the most basic of the forms by either vapour diffusion or equilibrium dialysis, but attempts to grow crystals of the other more acidic forms were unsuccessful. The ABL crystals belong to the orthorhombic space group C222(1), with unit-cell parameters a = 93.06, b = 98.16, c = 76.38 A, and diffract to a resolution of 2.2 A on a conventional source at room temperature. It is expected that the solution of this structure will yield further valuable information on the differences in the T-antigen-binding folds and will perhaps help to clarify the details of the ligand binding to the protein.

  4. Theoretical and experimental morphologies of 4-aminobenzophenone (ABP) crystals

    NASA Astrophysics Data System (ADS)

    Wang, Qingwu; Sheen, D. B.; Shepherd, E. E. A.; Sherwood, J. N.; Simpson, G. S.; Hammond, R. B.

    1997-11-01

    The lattice energy (Elatt), slice energies (Eslice) and attachment energies (Eatt) of the different habit faces of ABP crystals have been calculated using the computer program HABIT. On the basis of the attachment energies of different crystal faces, the morphology was defined as {1 0 0}, {0 0 1}, {1 1 0}, {11bar0} and {1 01bar}. To confirm this theoretical prediction, we have grown ABP films and ABP crystals from the vapour phase. In both cases, the morphologically most important face was defined as {1 0 0} face using X-ray diffraction techniques. The remaining faces of the vapour-grown crystals were defined using a projection method, while the crystallites in the films were morphologically analysed by means of atomic force microscopy (AFM). The experimental morphologies are basically in agreement with the computation. Deviations from the equilibrium morphology can be ascribed to departure from equilibrium conditions during growth. For completeness, the results are compared with those for crystals grown from solutions for which deviations in morphology from the theoretical predictions can be ascribed to interaction between the crystal faces and solvent molecules.

  5. Improvement of laser molecular beam epitaxy grown SrTiO3 thin film properties by temperature gradient modulation growth

    NASA Astrophysics Data System (ADS)

    Li, Jin Long; Hao, J. H.; Li, Y. R.

    2007-09-01

    Oxygen diffusion at the SrTiO3/Si interface was analyzed. A method called temperature gradient modulation growth was introduced to control oxygen diffusion at the interface of SrTiO3/Si. Nanoscale multilayers were grown at different temperatures at the initial growing stage of films. Continuous growth of SrTiO3 films was followed to deposit on the grown sacrificial layers. The interface and crystallinity of SrTiO3/Si were investigated by in situ reflection high energy electron diffraction and x-ray diffraction measurements. It has been shown that the modulated multilayers may help suppress the interfacial diffusion, and therefore improve SrTiO3 thin film properties.

  6. The oxidative corrosion of carbide inclusions at the surface of uranium metal during exposure to water vapour.

    PubMed

    Scott, T B; Petherbridge, J R; Harker, N J; Ball, R J; Heard, P J; Glascott, J; Allen, G C

    2011-11-15

    The reaction between uranium and water vapour has been well investigated, however discrepancies exist between the described kinetic laws, pressure dependence of the reaction rate constant and activation energies. Here this problem is looked at by examining the influence of impurities in the form of carbide inclusions on the reaction. Samples of uranium containing 600 ppm carbon were analysed during and after exposure to water vapour at 19 mbar pressure, in an environmental scanning electron microscope (ESEM) system. After water exposure, samples were analysed using secondary ion mass spectrometry (SIMS), focused ion beam (FIB) imaging and sectioning and transmission electron microscopy (TEM) with X-ray diffraction (micro-XRD). The results of the current study indicate that carbide particles on the surface of uranium readily react with water vapour to form voluminous UO(3) · xH(2)O growths at rates significantly faster than that of the metal. The observation may also have implications for previous experimental studies of uranium-water interactions, where the presence of differing levels of undetected carbide may partly account for the discrepancies observed between datasets. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  7. Purification, characterization and preliminary crystallographic studies of a PR-10 protein from Pachyrrhizus erosus seeds.

    PubMed

    Wu, Fang; Li, Yikun; Chang, Shaojie; Zhou, Zhaocai; Wang, Fang; Song, Xiaomin; Lin, Yujuan; Gong, Weimin

    2002-12-01

    A 16 kDa protein SPE16 was purified from the seeds of Pachyrrhizus erosus. Its N-terminal amino-acid sequence showed significant sequence homology to pathogenesis-related proteins from the PR-10 family. An activity assay indicated that SPE16 possesses ribonuclease activity as do some other PR-10 proteins. SPE16 crystals were obtained by the hanging-drop vapour-diffusion method. The space group is P2(1)2(1)2(1), with unit-cell parameters a = 53.36, b = 63.70, c = 72.96 A.

  8. Synthesis, structural and optical properties of silver nanoparticles uniformly decorated ZnO nanowires

    NASA Astrophysics Data System (ADS)

    Zhang, Ke-Xin; Wen, Xing; Yao, Cheng-Bao; Li, Jin; Zhang, Meng; Li, Qiang-Hua; Sun, Wen-Jun; Wu, Jia-Da

    2018-04-01

    Silver (Ag) nanoparticles decorated Zinc oxide (A-ZnO) nanowires have been successfully synthesized by two-step chemical vapour deposition and magnetron sputtering method. The X-ray diffraction patterns revealed their hexagonal wurtzite structure. SEM images indicated the Ag nanoparticles are distributed uniformly on the surface of A-ZnO nanowires. By extending the sputtering time, the atomic percent of Ag increased gradually. Moreover, the photoluminescence results demonstrated two major emission peaks for the A-ZnO nanowires. Where, the visible emission peaks were stronger than those of unmodified ZnO nanowires. These studies promise their potential applications in multifunctional optical devices.

  9. Purification, crystallization and preliminary X-ray analysis of haemoglobin from ostrich (Struthio camelus).

    PubMed

    Sundaresan, S S; Ramesh, P; Sivakumar, K; Ponnuswamy, M N

    2009-07-01

    Haemoglobin is a tetrameric protein that carries oxygen from the lungs to tissues and carbon dioxide from tissues back to the lungs. The oxygen-binding properties of haemoglobin are regulated through the binding of allosteric effectors. The respiratory system of avian species is unique and complex in nature when compared with that of mammals. In avian species, inositol pentaphosphate (inositol-P(5)) is present in the erythrocytes of the adult and is thought to be the major factor responsible for the relatively high oxygen affinity of the whole blood. The ostrich (Struthio camelus) is a large flightless bird which contains inositol tetrakisphosphate (inositol-P(4)) in its erythrocytes and its whole blood oxygen affinity is higher. Efforts have been made to explore the structure-function relationship of ostrich haemoglobin. Ostrich haemoglobin was purified using ion-exchange chromatography. Haemoglobin crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350 as the precipitant in 50 mM phosphate buffer pH 7.2. Data were collected using a MAR345 image-plate detector system. The crystals of ostrich haemoglobin diffracted to 2.2 A resolution. They belonged to the orthorhombic space group P2(1)2(1)2(1) with one whole biological molecule in the asymmetric unit; the unit-cell parameters were a = 80.93, b = 81.68, c = 102.05 A.

  10. Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

    PubMed Central

    Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

    2014-01-01

    Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

  11. Preliminary X-ray analysis of twinned crystals of the Q88Y25_Lacpl esterase from Lactobacillus plantarum WCFS1

    PubMed Central

    Álvarez, Yanaisis; Esteban-Torres, María; Acebrón, Iván; de las Rivas, Blanca; Muñoz, Rosario; Martínez-Ripoll, Martín; Mancheño, José M.

    2011-01-01

    Q88Y25_Lacpl is an esterase produced by the lactic acid bacterium Lactobacillus plantarum WCFS1 that shows amino-acid sequence similarity to carboxyl­esterases from the hormone-sensitive lipase family, in particular the AFEST esterase from the archaeon Archaeoglobus fulgidus and the hyperthermophilic esterase EstEI isolated from a metagenomic library. N-­terminally His6-tagged Q88Y25_Lacpl has been overexpressed in Escherichia coli BL21 (DE3) cells, purified and crystallized at 291 K using the hanging-drop vapour-diffusion method. Mass spectrometry was used to determine the purity and homogeneity of the enzyme. Crystals of His6-tagged Q88Y25_Lacpl were prepared in a solution containing 2.8 M sodium acetate trihydrate pH 7.0. X-ray diffraction data were collected to 2.24 Å resolution on beamline ID29 at the ESRF. The apparent crystal point group was 422; however, initial global analysis of the intensity statistics (data processed with high symmetry in space group I422) and subsequent tests on data processed with low symmetry (space group I4) showed that the crystals were almost perfectly merohedrally twinned. Most probably, the true space group is I4, with unit-cell parameters a = 169.05, b = 169.05, c = 183.62 Å. PMID:22102251

  12. Tunable growth of TiO2 nanostructures on Ti substrates

    NASA Astrophysics Data System (ADS)

    Peng, Xinsheng; Wang, Jingpeng; Thomas, Dan F.; Chen, Aicheng

    2005-10-01

    A simple and facile method is described to directly synthesize TiO2 nanostructures on titanium substrates by oxidizing Ti foil using small organic molecules as the oxygen source. The effect of reaction temperature and oxygen source on the formation of the TiO2 nanostructures has been studied using scanning electron microscopy, x-ray diffraction, transmission electron microscopy, Raman spectroscopy and water contact angle measurement. Polycrystalline grains are formed when pure oxygen and formic acid are used as the oxygen source; elongated micro-crystals are produced when water vapour is used as the oxygen source; oriented and aligned TiO2 nanorod arrays are synthesized when ethanol, acetaldehyde or acetone are used as the oxygen source. The growth mechanism of the TiO2 nanostructures is discussed. The diffusion of Ti atoms to the oxide/gas interface via the network of the grain boundaries of the thin oxide layer is the determining factor for the formation of well-aligned TiO2 nanorod arrays. The wetting properties of the TiO2 nanostructured surfaces formed are dictated by their structure, varying from a hydrophilic surface to a strongly hydrophobic surface as the surface structure changes from polycrystalline grains to well-aligned nanorod arrays. This tunable growth of TiO2 nanostructures is desirable for promising applications of TiO2 nanostructures in the development of optical devices, sensors, photo-catalysts and self-cleaning coatings.

  13. A mechanical-force-driven physical vapour deposition approach to fabricating complex hydride nanostructures.

    PubMed

    Pang, Yuepeng; Liu, Yongfeng; Gao, Mingxia; Ouyang, Liuzhang; Liu, Jiangwen; Wang, Hui; Zhu, Min; Pan, Hongge

    2014-03-24

    Nanoscale hydrides desorb and absorb hydrogen at faster rates and lower temperatures than bulk hydrides because of their high surface areas, abundant grain boundaries and short diffusion distances. No current methods exist for the direct fabrication of nanoscale complex hydrides (for example, alanates, borohydrides) with unique morphologies because of their extremely high reducibility, relatively low thermodynamic stability and complicated elemental composition. Here, we demonstrate a mechanical-force-driven physical vapour deposition procedure for preparing nanoscale complex hydrides without scaffolds or supports. Magnesium alanate nanorods measuring 20-40 nm in diameter and lithium borohydride nanobelts measuring 10-40 nm in width are successfully synthesised on the basis of the one-dimensional structure of the corresponding organic coordination polymers. The dehydrogenation kinetics of the magnesium alanate nanorods are improved, and the nanorod morphology persists through the dehydrogenation-hydrogenation process. Our findings may facilitate the fabrication of such hydrides with improved hydrogen storage properties for practical applications.

  14. A mechanical-force-driven physical vapour deposition approach to fabricating complex hydride nanostructures

    NASA Astrophysics Data System (ADS)

    Pang, Yuepeng; Liu, Yongfeng; Gao, Mingxia; Ouyang, Liuzhang; Liu, Jiangwen; Wang, Hui; Zhu, Min; Pan, Hongge

    2014-03-01

    Nanoscale hydrides desorb and absorb hydrogen at faster rates and lower temperatures than bulk hydrides because of their high surface areas, abundant grain boundaries and short diffusion distances. No current methods exist for the direct fabrication of nanoscale complex hydrides (for example, alanates, borohydrides) with unique morphologies because of their extremely high reducibility, relatively low thermodynamic stability and complicated elemental composition. Here, we demonstrate a mechanical-force-driven physical vapour deposition procedure for preparing nanoscale complex hydrides without scaffolds or supports. Magnesium alanate nanorods measuring 20-40 nm in diameter and lithium borohydride nanobelts measuring 10-40 nm in width are successfully synthesised on the basis of the one-dimensional structure of the corresponding organic coordination polymers. The dehydrogenation kinetics of the magnesium alanate nanorods are improved, and the nanorod morphology persists through the dehydrogenation-hydrogenation process. Our findings may facilitate the fabrication of such hydrides with improved hydrogen storage properties for practical applications.

  15. Reflections in computer modeling of rooms: Current approaches and possible extensions

    NASA Astrophysics Data System (ADS)

    Svensson, U. Peter

    2005-09-01

    Computer modeling of rooms is most commonly done by some calculation technique that is based on decomposing the sound field into separate reflection components. In a first step, a list of possible reflection paths is found and in a second step, an impulse response is constructed from the list of reflections. Alternatively, the list of reflections is used for generating a simpler echogram, the energy decay as function of time. A number of geometrical acoustics-based methods can handle specular reflections, diffuse reflections, edge diffraction, curved surfaces, and locally/non-locally reacting surfaces to various degrees. This presentation gives an overview of how reflections are handled in the image source method and variants of the ray-tracing methods, which are dominating today in commercial software, as well as in the radiosity method and edge diffraction methods. The use of the recently standardized scattering and diffusion coefficients of surfaces is discussed. Possibilities for combining edge diffraction, surface scattering, and impedance boundaries are demonstrated for an example surface. Finally, the number of reflection paths becomes prohibitively high when all such combinations are included as demonstrated for a simple concert hall model. [Work supported by the Acoustic Research Centre through NFR, Norway.

  16. An in-vitro evaluation of silicone elastomer latex for topical drug delivery.

    PubMed

    Li, L C; Vu, N T

    1995-06-01

    A silicone elastomer latex was evaluated as a topical drug-delivery system. With the addition of a fumed silica and the removal of water, the latex produced elastomeric solid films. The water vapour permeability of the solid film was found to be a function of the film composition. An increase in silica content and the incorporation of a water-soluble component, PEG 3350, rendered the silicone elastomer-free film even more permeable to water vapour. The release of hydrocortisone from the elastomer film can be described by a matrix-diffusion-controlled mechanism. Drug diffusion is thought to occur through the hydrophobic silicone polymer network and the hydrated hydrophilic silica region in the film matrix. Silicone elastomer film with a higher silica content exhibited a faster drug-release rate. The addition of PEG 3350 to the film further enhanced the drug-release rate.

  17. Thaumatin crystallization aboard the International Space Station using liquid-liquid diffusion in the Enhanced Gaseous Nitrogen Dewar (EGN).

    PubMed

    Barnes, Cindy L; Snell, Edward H; Kundrot, Craig E

    2002-05-01

    This paper reports results from the first biological crystal-growth experiment on the International Space Station (ISS). Crystals of thaumatin were grown using liquid-liquid diffusion in Tygon tubing transported in the Enhanced Gaseous Nitrogen Dewar (EGN). Different volume ratios and concentrations of protein and precipitant were used to test different adaptations of the vapor-diffusion crystallization recipe to the liquid-liquid diffusion method. The EGN warmed up from 77 to 273 K in about 4 d, about the same time it took to warm from 273 to 293 K. The temperature within the EGN was 293-297 K for the majority of the experiment. Air gaps that blocked liquid-liquid diffusion formed in the tubes. Nonetheless, crystals were grown. Synchrotron diffraction data collected from the best space-grown crystal extended to 1.28 A, comparable to previous studies of space-grown thaumatin crystals. The resolution of the best ground-control crystal was only 1.47 A. It is not clear if the difference in diffraction limit arises from factors other than crystal size. Improvements in temperature control and the elimination of air gaps are needed, but the results show that the EGN on the ISS can be used to produce space-grown crystals that diffract to high resolution.

  18. Thaumatin Crystallization Aboard the International Space Station Using Liquid-Liquid Diffusion in the Enhanced Gaseous Nitrogen Dewar (EGN)

    NASA Technical Reports Server (NTRS)

    Kundrot, Craig; Barnes, Cindy L.; Snell, Edward H.; Stinson, Thomas N. (Technical Monitor)

    2002-01-01

    This paper reports results from the first biological crystal growth experiment on the International Space Station (ISS). Crystals of thaumatin were grown using liquid-liquid diffusion in Tygon tubing transported in the Enhanced Gaseous Nitrogen Dewar (EGN). Different Volume ratios and concentrations of protein and precipitant were used to test different adaptations of the vapor diffusion crystallization recipe to the liquid-liquid diffusion method. The EGN warmed up from -196 C to 0 C in about four days, about the same time it took to warm from 0 C to 20 C. The temperature within the EGN was 20 - 24 C for the majority of the experiment. Air gaps that blocked liquid-liquid diffusion formed in the tubes. Nonetheless, crystals were grown. Synchrotron diffraction data collected from the best space grown crystal extended to 1.28 Angstroms, comparable to previous studies of space-grown thaumatin crystals. The resolution of the best ground control crystal was only 1.47 Angstroms. It is not clear if the difference in diffraction limit is due to factors other than crystal size. Improvements in temperature control and the elimination of air gaps are needed, but the results show that EGN on the ISS can be used to produce space grown crystals that diffract to high resolution.

  19. A modified method for diffusive monitoring of 3-ethenylpyridine as a specific marker of environmental tobacco smoke

    NASA Astrophysics Data System (ADS)

    Kuusimäki, Leea; Peltonen, Kimmo; Vainiotalo, Sinikka

    A previously introduced method for monitoring environmental tobacco smoke (ETS) was further validated. The method is based on diffusive sampling of a vapour-phase marker, 3-ethenylpyridine (3-EP), with 3 M passive monitors (type 3500). Experiments were done in a dynamic chamber to assess diffusive sampling in comparison with active sampling in charcoal tubes or XAD-4 tubes. The sampling rate for 3-EP collected on the diffusive sampler was 23.1±0.6 mL min -1. The relative standard deviation for parallel samples ( n=6) ranged from 4% to 14% among experiments ( n=9). No marked reverse diffusion of 3-EP was detected nor any significant effect of relative humidity at 20%, 50% or 80%. The diffusive sampling of 3-EP was validated in field measurements in 15 restaurants in comparison with 3-EP and nicotine measurements using active sampling. The 3-EP concentration in restaurants ranged from 0.01 to 9.8 μg m -3, and the uptake rate for 3-EP based on 92 parallel samples was 24.0±0.4 mL min -1. A linear correlation ( r=0.98) was observed between 3-EP and nicotine concentrations, the average ratio of 3-EP to nicotine being 1:8. Active sampling of 3-EP and nicotine in charcoal tubes provided more reliable results than sampling in XAD-4 tubes. All samples were analysed using gas chromatography-mass spectrometry after elution with a 15% solution of pyridine in toluene. For nicotine, the limit of quantification of the charcoal tube method was 4 ng per sample, corresponding to 0.04 μg m -3 for an air sample of 96 L. For 3-EP, the limit of quantification of the diffusive method was 0.5-1.0 ng per sample, corresponding to 0.04-0.09 μg m -3 for 8 h sampling. The diffusive method proved suitable for ETS monitoring, even at low levels of ETS.

  20. Growth of raspberry-, prism- and flower-like ZnO particles using template-free low-temperature hydrothermal method and their application as humidity sensors

    NASA Astrophysics Data System (ADS)

    Pál, Edit; Hornok, Viktória; Kun, Robert; Chernyshev, Vladimir; Seemann, Torben; Dékány, Imre; Busse, Matthias

    2012-08-01

    Zinc oxide particles with different morphologies were prepared by hydrothermal method at 60-90 °C. The structure formation was controlled by the addition rate and temperature of hydrolyzing agent, while the particles size (10 nm-2.5 μm) was influenced by the preparation (hydrothermal) temperature. Scanning electron microscopy studies showed that raspberry-, prism- and flower-like ZnO particles were prepared, whose average size decreased with increasing reaction temperature. X-ray diffraction investigations confirmed that ZnO particles with hexagonal crystal structure formed in all syntheses. The raspberry-, prism- and flower-like ZnO particles showed a weak UV-emission in the range of 390-395 nm and strong visible emission with a maximum at 586, 593 and 598 nm, respectively. Morphology effect on electrical and water vapour sensing properties of ZnO samples was investigated by impedance spectroscopy and quartz crystal microbalance, respectively. The absolute impedance of raspberry-, prism- and flower-like ZnO particles was found to be strong dependent on the morphology. Space-charge-limited conductivity transport mechanism was proved by the oscillatory behaviour of impedance. Humidity sensor tests also revealed morphology and specific surface area dependency on the sensitivity and water vapour adsorption property.

  1. Synthesis and characterization of TiO2/graphitic carbon nanocomposites with enhanced photocatalytic performance

    NASA Astrophysics Data System (ADS)

    Wanag, Agnieszka; Kusiak-Nejman, Ewelina; Kowalczyk, Łukasz; Kapica-Kozar, Joanna; Ohtani, Bunsho; Morawski, Antoni W.

    2018-04-01

    In this paper titanium dioxide carbon modification with benzene as a carbon source is presented. A TiO2/graphitic carbon nanocomposites were synthesized by thermal modification in the presence of benzene vapours at different temperature (300-700 °C). The new materials were characterized by a various techniques, such as: X-ray diffraction (XRD), scanning electron microscopy (SEM), diffuse reflectance spectroscopy (UV-vis/DR), surface-enhanced Raman spectroscopy. BET specific surface area was also measured. The photocatalytic activity of obtained nanocomposites was measured by the decomposition of acetic acid and methylene blue under UV-vis irradiation. The results show that photocatalytic activity increasing with increase in carbon concentration and temperature of modification. It can be noted that adsorption degree has a very high impact on methylene blue decomposition. The highest photocatalytic activity was found for the photocatalyst modified at 600 °C contains 1.13 wt% of carbon. It should be noted that, the influence of crystallite size, crystal structure changes and specific surface area for photocatalytic activity are presented.

  2. Effect of screw threading dislocations and inverse domain boundaries in GaN on the shape of reciprocal-space maps.

    PubMed

    Barchuk, Mykhailo; Motylenko, Mykhaylo; Lukin, Gleb; Pätzold, Olf; Rafaja, David

    2017-04-01

    The microstructure of polar GaN layers, grown by upgraded high-temperature vapour phase epitaxy on [001]-oriented sapphire substrates, was studied by means of high-resolution X-ray diffraction and transmission electron microscopy. Systematic differences between reciprocal-space maps measured by X-ray diffraction and those which were simulated for different densities of threading dislocations revealed that threading dislocations are not the only microstructure defect in these GaN layers. Conventional dark-field transmission electron microscopy and convergent-beam electron diffraction detected vertical inversion domains as an additional microstructure feature. On a series of polar GaN layers with different proportions of threading dislocations and inversion domain boundaries, this contribution illustrates the capability and limitations of coplanar reciprocal-space mapping by X-ray diffraction to distinguish between these microstructure features.

  3. Detecting diffusion-diffraction patterns in size distribution phantoms using double-pulsed field gradient NMR: Theory and experiments.

    PubMed

    Shemesh, Noam; Ozarslan, Evren; Basser, Peter J; Cohen, Yoram

    2010-01-21

    NMR observable nuclei undergoing restricted diffusion within confining pores are important reporters for microstructural features of porous media including, inter-alia, biological tissues, emulsions and rocks. Diffusion NMR, and especially the single-pulsed field gradient (s-PFG) methodology, is one of the most important noninvasive tools for studying such opaque samples, enabling extraction of important microstructural information from diffusion-diffraction phenomena. However, when the pores are not monodisperse and are characterized by a size distribution, the diffusion-diffraction patterns disappear from the signal decay, and the relevant microstructural information is mostly lost. A recent theoretical study predicted that the diffusion-diffraction patterns in double-PFG (d-PFG) experiments have unique characteristics, such as zero-crossings, that make them more robust with respect to size distributions. In this study, we theoretically compared the signal decay arising from diffusion in isolated cylindrical pores characterized by lognormal size distributions in both s-PFG and d-PFG methodologies using a recently presented general framework for treating diffusion in NMR experiments. We showed the gradual loss of diffusion-diffraction patterns in broadening size distributions in s-PFG and the robustness of the zero-crossings in d-PFG even for very large standard deviations of the size distribution. We then performed s-PFG and d-PFG experiments on well-controlled size distribution phantoms in which the ground-truth is well-known a priori. We showed that the microstructural information, as manifested in the diffusion-diffraction patterns, is lost in the s-PFG experiments, whereas in d-PFG experiments the zero-crossings of the signal persist from which relevant microstructural information can be extracted. This study provides a proof of concept that d-PFG may be useful in obtaining important microstructural features in samples characterized by size distributions.

  4. Binarization of apodizers by adapted one-dimensional error diffusion method

    NASA Astrophysics Data System (ADS)

    Kowalczyk, Marek; Cichocki, Tomasz; Martinez-Corral, Manuel; Andres, Pedro

    1994-10-01

    Two novel algorithms for the binarization of continuous rotationally symmetric real positive pupil filters are presented. Both algorithms are based on 1-D error diffusion concept. The original gray-tone apodizer is substituted by a set of transparent and opaque concentric annular zones. Depending on the algorithm the resulting binary mask consists of either equal width or equal area zones. The diffractive behavior of binary filters is evaluated. It is shown that the pupils with equal width zones give Fraunhofer diffraction pattern more similar to that of the original continuous-tone pupil than those with equal area zones, assuming in both cases the same resolution limit of printing device.

  5. Studies of the kinetics and mechanism of the oxidation of uranium by dry and moist air A model for determining the oxidation rate over a wide range of temperatures and water vapour pressures

    NASA Astrophysics Data System (ADS)

    McGillivray, G. W.; Geeson, D. A.; Greenwood, R. C.

    1994-01-01

    The rate of oxidation of uranium metal by moist air has been measured at temperatures from 115 to 350°C and water vapour pressures from 0 to 47 kPa (350 Torr). From this and from previously reported data, a model has been developed which allows the rate of uranium oxidation to be calculated at any particular combination of temperature and water vapour pressure of interest, in the range 0-350°C and 0-101.3 kPa (760 Torr). The model is based on the assumption that the surface concentration of water determines the rate of reaction and that the adsorption of water onto the oxide follows a Langmuir type isotherm. Theoretical plots of rate as a function of water vapour pressure and Arrhenius plots derived from the model have been shown to be in good agreement with experimental data. The model assumes separate contributions to the overall observed rate from oxygen and water vapour. Surface studies have been carried out using SIMS (secondary ion mass spectrometry). Depth profiling of the oxide produced by isotopically labelled reagents ( 18O 2 and H 218O), has shown that oxygen from both reactants is incorporated into the oxide layer in the ratio predicted by the kinetic model. This supports a mechanism in which oxygen and water vapour produce separate diffusing species (possibly O 2- and OH -).

  6. 1-Methoxy-1-silacyclohexane: Synthesis, molecular structure and conformational behavior by gas electron diffraction, Raman spectroscopy and quantum chemical calculations

    NASA Astrophysics Data System (ADS)

    Shlykov, Sergey A.; Puchkov, Boris V.; Arnason, Ingvar; Wallevik, Sunna Ó.; Giricheva, Nina I.; Girichev, Georgiy V.; Zhabanov, Yuriy A.

    2018-02-01

    The synthesis and results of gas electron diffraction (GED), temperature-dependent Raman spectroscopy, along with detailed quantum chemical (QC) study of 1-methoxy-1-silacyclohexane 1 are reported. Within the series of the QC results, DFT(B3LYP, PBE0, M06, M062X), and MP2, the conformational preference predictions are rather contradictive. From the both GED and Raman experimental methods applied, the vapour and liquid phases of 1 were found to exist as a mixture of two conformers, gauche-axial and gauche-equatorial, with almost equal contributions, while the trans-forms are much less stable. In addition, theoretical calculations on the cyclohexane analog, methoxycyclohexane 2, are performed in order to compare with the conformational properties of 1. The latter is predicted not to diminish the axial/equatorial ratio, as contrasted to the expectations at switching the point of the substituent attachment from Si to C.

  7. Synthesis, Characterization, and Mechanism of Formation of Janus-Like Nanoparticles of Tantalum Silicide-Silicon (TaSi2/Si)

    PubMed Central

    Nomoev, Andrey V.; Bardakhanov, Sergey P.; Schreiber, Makoto; Bazarova, Dashima Zh.; Baldanov, Boris B.; Romanov, Nikolai A.

    2014-01-01

    Metal-semiconductor Janus-like nanoparticles with the composition tantalum silicide-silicon (TaSi2/Si) were synthesized for the first time by means of an evaporation method utilizing a high-power electron beam. The composition of the synthesized particles were characterized using high-resolution transmission electron microscopy (HRTEM), X-ray diffraction (XRD), selective area electron diffraction (SAED), and energy dispersive X-ray fluorescence (EDX) analysis. The system is compared to previously synthesized core-shell type particles in order to show possible differences responsible for the Janus-like structure forming instead of a core-shell architecture. It is proposed that the production of Janus-like as opposed to core-shell or monophase particles occurs due to the ability of Ta and Si to form compounds and the relative content of Ta and Si atoms in the produced vapour. Based on the results, a potential mechanism of formation for the TaSi2/Si nanoparticles is discussed. PMID:28346996

  8. Synthesis, Characterization, and Mechanism of Formation of Janus-Like Nanoparticles of Tantalum Silicide-Silicon (TaSi₂/Si).

    PubMed

    Nomoev, Andrey V; Bardakhanov, Sergey P; Schreiber, Makoto; Bazarova, Dashima Zh; Baldanov, Boris B; Romanov, Nikolai A

    2014-12-25

    Metal-semiconductor Janus-like nanoparticles with the composition tantalum silicide-silicon (TaSi₂/Si) were synthesized for the first time by means of an evaporation method utilizing a high-power electron beam. The composition of the synthesized particles were characterized using high-resolution transmission electron microscopy (HRTEM), X-ray diffraction (XRD), selective area electron diffraction (SAED), and energy dispersive X-ray fluorescence (EDX) analysis. The system is compared to previously synthesized core-shell type particles in order to show possible differences responsible for the Janus-like structure forming instead of a core-shell architecture. It is proposed that the production of Janus-like as opposed to core-shell or monophase particles occurs due to the ability of Ta and Si to form compounds and the relative content of Ta and Si atoms in the produced vapour. Based on the results, a potential mechanism of formation for the TaSi₂/Si nanoparticles is discussed.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Haishuang; Krysiak, Yaşar; Hoffmann, Kristin

    The crystal structure and disorder phenomena of Al{sub 4}B{sub 2}O{sub 9}, an aluminum borate from the mullite-type family, were studied using automated diffraction tomography (ADT), a recently established method for collection and analysis of electron diffraction data. Al{sub 4}B{sub 2}O{sub 9}, prepared by sol-gel approach, crystallizes in the monoclinic space group C2/m. The ab initio structure determination based on three-dimensional electron diffraction data from single ordered crystals reveals that edge-connected AlO{sub 6} octahedra expanding along the b axis constitute the backbone. The ordered structure (A) was confirmed by TEM and HAADF-STEM images. Furthermore, disordered crystals with diffuse scattering along themore » b axis are observed. Analysis of the modulation pattern implies a mean superstructure (AAB) with a threefold b axis, where B corresponds to an A layer shifted by ½a and ½c. Diffraction patterns simulated for the AAB sequence including additional stacking disorder are in good agreement with experimental electron diffraction patterns. - Graphical abstract: Crystal structure and disorder phenomena of B-rich Al{sub 4}B{sub 2}O{sub 9} studied by automated electron diffraction tomography (ADT) and described by diffraction simulation using DISCUS. - Highlights: • Ab-initio structure solution by electron diffraction from single nanocrystals. • Detected modulation corresponding mainly to three-fold superstructure. • Diffuse diffraction streaks caused by stacking faults in disordered crystals. • Observed streaks explained by simulated electron diffraction patterns.« less

  10. The boundary condition for vertical velocity and its interdependence with surface gas exchange

    NASA Astrophysics Data System (ADS)

    Kowalski, Andrew S.

    2017-07-01

    The law of conservation of linear momentum is applied to surface gas exchanges, employing scale analysis to diagnose the vertical velocity (w) in the boundary layer. Net upward momentum in the surface layer is forced by evaporation (E) and defines non-zero vertical motion, with a magnitude defined by the ratio of E to the air density, as w = E/ρ. This is true even right down at the surface where the boundary condition is w|0 = E/ρ|0 (where w|0 and ρ|0 represent the vertical velocity and density of air at the surface). This Stefan flow velocity implies upward transport of a non-diffusive nature that is a general feature of the troposphere but is of particular importance at the surface, where it assists molecular diffusion with upward gas migration (of H2O, for example) but opposes that of downward-diffusing species like CO2 during daytime. The definition of flux-gradient relationships (eddy diffusivities) requires rectification to exclude non-diffusive transport, which does not depend on scalar gradients. At the microscopic scale, the role of non-diffusive transport in the process of evaporation from inside a narrow tube - with vapour transport into an overlying, horizontal airstream - was described long ago in classical mechanics and is routinely accounted for by chemical engineers, but has been neglected by scientists studying stomatal conductance. Correctly accounting for non-diffusive transport through stomata, which can appreciably reduce net CO2 transport and marginally boost that of water vapour, should improve characterisations of ecosystem and plant functioning.

  11. Vapour-Phase Processes Control Liquid-Phase Isotope Profiles in Unsaturated Sphagnum Moss

    NASA Astrophysics Data System (ADS)

    Edwards, T. W.; Yi, Y.; Price, J. S.; Whittington, P. N.

    2009-05-01

    Seminal work in the early 1980s clearly established the basis for predicting patterns of heavy-isotope enrichment of pore waters in soils undergoing evaporation. A key feature of the process under steady-state conditions is the development of stable, convex-upward profiles whose shape is controlled by the balance between downward-diffusing heavy isotopologues concentrated by evaporative enrichment at the surface and the upward capillary flow of bulk water that maintains the evaporative flux. We conducted an analogous experiment to probe evaporation processes within 20-cm columns of unsaturated, living and dead (but undecomposed) Sphagnum moss evaporating under controlled conditions, while maintaining a constant water table. The experiment provided striking evidence of the importance of vapour-liquid mass and isotope exchange in the air-filled pores of the Sphagnum columns, as evidenced by the rapid development of hydrologic and isotopic steady-state within hours, rather than days, i.e., an order of magnitude faster than possible by liquid-phase processes alone. This is consistent with the notion that vapour-phase processes effectively "short-circuit" mass and isotope fluxes within the Sphagnum columns, as proposed also in recent characterizations of water dynamics in transpiring leaves. Additionally, advection-diffusion modelling of our results supports independent estimates of the effective liquid-phase diffusivities of the respective heavy water isotopologues, 2.380 x 10-5 cm2 s-1 for 1H1H18O and 2.415 x 10-5 cm2 s-1 for 1H2H16O, which are in notably good agreement with the "default" values that are typically assumed in soil and plant water studies.

  12. Oil mist and vapour concentrations from drilling fluids: inter- and intra-laboratory comparison of chemical analyses.

    PubMed

    Galea, Karen S; Searl, Alison; Sánchez-Jiménez, Araceli; Woldbæk, Torill; Halgard, Kristin; Thorud, Syvert; Steinsvåg, Kjersti; Krüger, Kirsti; Maccalman, Laura; Cherrie, John W; van Tongeren, Martie

    2012-01-01

    There are no recognized analytical methods for measuring oil mist and vapours arising from drilling fluids used in offshore petroleum drilling industry. To inform the future development of improved methods of analysis for oil mist and vapours this study assessed the inter- and intra-laboratory variability in oil mist and vapour analysis. In addition, sample losses during transportation and storage were assessed. Replicate samples for oil mist and vapour were collected using the 37-mm Millipore closed cassette and charcoal tube assembly. Sampling was conducted in a simulated shale shaker room, similar to that found offshore for processing drilling fluids. Samples were analysed at two different laboratories, one in Norway and one in the UK. Oil mist samples were analysed using Fourier transform infrared spectroscopy (FTIR), while oil vapour samples were analysed by gas chromatography (GC). The comparison of replicate samples showed substantial within- and between-laboratory variability in reported oil mist concentrations. The variability in oil vapour results was considerably reduced compared to oil mist, provided that a common method of calibration and quantification was adopted. The study also showed that losses can occur during transportation and storage of samples. There is a need to develop a harmonized method for the quantification of oil mist on filter and oil vapour on charcoal supported by a suitable proficiency testing scheme for laboratories involved in the analysis of occupational hygiene samples for the petroleum industry. The uncertainties in oil mist and vapour measurement have substantial implications in relation to compliance with occupational exposure limits and also in the reliability of any exposure-response information reported in epidemiological studies.

  13. Spectral characteristics of multimode semiconductor lasers with a high-order surface diffraction grating

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zolotarev, V V; Leshko, A Yu; Pikhtin, N A

    2014-10-31

    We have studied the spectral characteristics of multimode semiconductor lasers with high-order surface diffraction gratings based on asymmetric separate-confinement heterostructures grown by metalorganic vapour phase epitaxy (λ = 1070 nm). Experimental data demonstrate that, in the temperature range ±50 °C, the laser emission spectrum is ∼5 Å in width and contains a fine structure of longitudinal and transverse modes. A high-order (m = 15) surface diffraction grating is shown to ensure a temperature stability of the lasing spectrum dλ/dT = 0.9 Å K{sup -1} in this temperature range. From analysis of the fine structure of the lasing spectrum, we havemore » evaluated the mode spacing and, thus, experimentally determined the effective length of the Bragg diffraction grating, which was ∼400 μm in our samples. (lasers)« less

  14. A review of water recovery by vapour permeation through membranes.

    PubMed

    Bolto, Brian; Hoang, Manh; Xie, Zongli

    2012-02-01

    In vapour permeation the feed is a vapour, not a liquid as in pervaporation. The process employs a polymeric membrane as a semi-permeable barrier between the feed side under high pressure and the permeate side under low pressure. Separation is achieved by the different degrees to which components are dissolved in and diffuse through the membrane, the system working according to a solution-diffusion mechanism. The materials used in the membrane depend upon the types of compounds being separated, so water transport is favoured by hydrophilic material, whether organic or inorganic. The process is used for the dehydration of natural gas and various organic solvents, notably alcohol as biofuel, as well as the removal of water from air and its recovery from waste steam. Waste steam can be found in almost every plant/factory where steam is used. It is frequently contaminated and cannot be reused. Discharging the spent steam to the atmosphere is a serious energy loss and environmental issue. Recycling the steam can significantly improve the overall energy efficiency of an industry, which is responsible for massive CO(2) emissions. Steam separation at high fluxes and temperatures has been accomplished with a composite poly(vinyl alcohol) membrane containing silica nanoparticles, and also, less efficiently, with an inorganic zeolite membrane. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  15. A sensitivity study of diffusional mass transfer of gases in tropical storm hydrometeors

    NASA Astrophysics Data System (ADS)

    Ghosh, Satyajit; Gumber, Siddharth; Varotsos, C.

    2017-11-01

    This paper quantifies mass transfer and diffusional uptake rates of gases in liquid and solid hydrometeors within a cyclonic system. The non-availability of transfer rates for trace gases diffusing into storm hydrometeors, particularly over polluted urban conurbations, often constrain modellers the world over; however, this is an essential requirement to quantify the scavenging rates over the region concerned. The present paper seeks to provide modellers with such rates. Further, all of the earlier studies apply only to temperate regimes, and surprisingly identical formulations are assumed even for tropical conditions. The present analysis fills this research gap and couples cloud morphology with the associated thermodynamics through Weather Research and Forecasting (WRF) runs for cyclone Chapala (27 October 2015-04 November 2015) which battered the coasts of Yemen (Skamarock et al. 2008). It was a good example for undertaking this sensitivity study because the vertical extent spanned from around 0.75 to 16 km—enabling uptake rate calculations over both droplet and ice phases. Many of the diffusing gases were polar; the dipole moment of sulphur dioxide (SO2) and water vapour (H2O) was also included using a full Lennard-Jones model to compute the binary diffusivities of these gases as they diffused into the droplets mixed with water vapour. The first-order uptake rate constants ranged from 2.08 × 10-07 to 3.44 × 10-06 (s-1) and 1.97 × 10-07 to 7.81 × 10-07 (s-1) for H2O and SO2 respectively. The rates are of the order of 10-09 (s-1) for diffusion of water vapour into ice crystals further aloft. Closely linked with the gas uptake rates is another crucial parameter—the mass accommodation coefficient, α. The most widely used values are 1 and 0.036 (Pruppacher and Klett 1998)—the chosen values are restrictive and warrants a closer look. In storm systems, the vertical extents are in the kilometre range. Chapala with a large vertical extent warrants a full profile calculation. This study shows that for H2O vapour, α values range from a low of 0.004 reaching up to 0.046, and for SO2 impacting the liquid droplets, they are 0.004 to 0.077. Using these values in cloud droplet growth equations showed large changes in the positioning of the cloud base height up to about a maximum of 30%—a classic example illustrating the coupling of microphysics with dynamics suggesting that even large-scale models should cautiously use standard un-corrected accommodation and diffusion coefficients. Over polluted environments, aerosol number concentrations are very high—several hundreds of particles in a cubic centimetre—the cumulative effect involving such large-scale scavenging ends up in causing substantive changes in the actual scavenging rates. This is likely to affect overall radiative transfer calculations and must be corrected.

  16. Development of water movement model as a module of moisture content simulation in static pile composting.

    PubMed

    Seng, Bunrith; Kaneko, Hidehiro; Hirayama, Kimiaki; Katayama-Hirayama, Keiko

    2012-01-01

    This paper presents a mathematical model of vertical water movement and a performance evaluation of the model in static pile composting operated with neither air supply nor turning. The vertical moisture content (MC) model was developed with consideration of evaporation (internal and external evaporation), diffusion (liquid and vapour diffusion) and percolation, whereas additional water from substrate decomposition and irrigation was not taken into account. The evaporation term in the model was established on the basis of reference evaporation of the materials at known temperature, MC and relative humidity of the air. Diffusion of water vapour was estimated as functions of relative humidity and temperature, whereas diffusion of liquid water was empirically obtained from experiment by adopting Fick's law. Percolation was estimated by following Darcy's law. The model was applied to a column of composting wood chips with an initial MC of 60%. The simulation program was run for four weeks with calculation span of 1 s. The simulated results were in reasonably good agreement with the experimental results. Only a top layer (less than 20 cm) had a considerable MC reduction; the deeper layers were comparable to the initial MC, and the bottom layer was higher than the initial MC. This model is a useful tool to estimate the MC profile throughout the composting period, and could be incorporated into biodegradation kinetic simulation of composting.

  17. Preliminary crystallographic analysis of salicylate 1,2-dioxygenase from Pseudaminobacter salicylatoxidans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matera, I.; Ferraroni, M.; Bürger, S.

    2006-06-01

    Salicylate 1,2-dioxygenase, a new ring-fission dioxygenase from the naphthalenesulfonate-degrading strain P. salicylatoxidans, which oxidizes salicylate to 2-oxohepta-3,5-dienedioic acid by a novel ring-fission mechanism, has been crystallized. The crystals obtained give diffraction data to 2.9 Å resolution which could assist in the elucidation of the catalytic mechanism of this peculiar dioxygenase. Salicylate 1,2-dioxygenase, a new ring-fission dioxygenase from the naphthalenesulfonate-degrading strain Pseudaminobacter salicylatoxidans which oxidizes salicylate to 2-oxohepta-3,5-dienedioic acid by a novel ring-fission mechanism, has been crystallized. Diffraction-quality crystals of salicylate 1,2-dioxygenase were obtained using the sitting-drop vapour-diffusion method at 277 K from a solution containing 10%(w/v) ethanol, 6%(w/v) PEG 400,more » 0.1 M sodium acetate pH 4.6. Crystals belong to the primitive tetragonal space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2, with unit-cell parameters a = 133.3, c = 191.51 Å. A complete data set at 100 K extending to a maximum resolution of 2.9 Å was collected at a wavelength of 0.8423 Å. Molecular replacement using the coordinates of known extradiol dioxygenases structures as a model has so far failed to provide a solution for salicylate 1,2-dioxygenase. Attempts are currently being made to solve the structure of the enzyme by MAD experiments using the anomalous signal of the catalytic Fe{sup II} ions. The salicylate 1,2-dioxygenase structural model will assist in the elucidation of the catalytic mechanism of this ring-fission dioxygenase from P. salicylatoxidans, which differs markedly from the known gentisate 1,2-dioxygenases or 1-hydroxy-2-naphthoate dioxygenases because of its unique ability to oxidatively cleave salicylate, gentisate and 1-hydroxy-2-naphthoate with high catalytic efficiency.« less

  18. Infiltrating a thin or single-layer opal with an atomic vapour: Sub-Doppler signals and crystal optics

    NASA Astrophysics Data System (ADS)

    Moufarej, Elias; Maurin, Isabelle; Zabkov, Ilya; Laliotis, Athanasios; Ballin, Philippe; Klimov, Vasily; Bloch, Daniel

    2014-10-01

    Artificial thin glass opals can be infiltrated with a resonant alkali-metal vapour, providing novel types of hybrid systems. The reflection at the interface between the substrate and the opal yields a resonant signal, which exhibits sub-Doppler structures in linear spectroscopy for a range of oblique incidences. This result is suspected to originate in an effect of the three-dimensional confinement of the vapour in the opal interstices. It is here extended to a situation where the opal is limited to a few- or even a single-layer opal film, which is a kind of bidimensional grating. We have developed a flexible one-dimensional layered optical model, well suited for a Langmuir-Blodgett opal. Once extended to the case of a resonant infiltration, the model reproduces quick variations of the lineshape with incidence angle or polarization. Alternately, for an opal limited to a single layer of identical spheres, a three-dimensional numerical calculation was developed. It predicts crystalline anisotropy, which is demonstrated through diffraction on an empty opal made of a single layer of polystyrene spheres.

  19. Cloning, overexpression, purification and preliminary X-ray analysis of a feast/famine regulatory protein (Rv2779c) from Mycobacterium tuberculosis H37Rv.

    PubMed

    Dey, Abhishek; Ramachandran, Ravishankar

    2014-01-01

    Rv2779c from Mycobacterium tuberculosis is a feast/famine regulatory protein. This class of proteins are also known as the leucine-responsive regulatory protein/asparagine synthase C family (Lrp/AsnC) of transcriptional regulators and are known to be involved in various metabolic processes in bacteria and fungi. They contain a RAM (regulator of amino-acid metabolism) domain that is rarely found in humans and acts as the oligomerization domain. Since the oligomeric status is often linked to the particular functional role in these proteins, binding of ligands to the domain can elicit specific functional responses. Full-length Rv2779c corresponding to a molecular mass of 19.8 kDa and 179 residues was cloned and purified to homogeneity following transformation into Escherichia coli C41 (DE3) cells. Crystals were grown by vapour diffusion using the hanging-drop method. Diffraction data extending to 2.8 Å resolution were collected from a single crystal that belonged to space group P2(1)2(1)2, with unit-cell parameters a = 99.6, b = 146.0, c = 49.9 Å. Matthews coefficient (VM) calculations suggest that four molecules are present in the asymmetric unit, corresponding to a solvent content of ∼46%. Molecular-replacement calculations using the crystal structure of a homologue, Rv3291c, as the search model gave an unambiguous solution corresponding to four subunits in the asymmetric unit.

  20. Semi-volatile organic compounds at the leaf/atmosphere interface: numerical simulation of dispersal and foliar uptake.

    PubMed

    Riederer, Markus; Daiss, Andreas; Gilbert, Norbert; Köhle, Harald

    2002-08-01

    The behaviour of (semi-)volatile organic compounds at the interface between the leaf surface and the atmosphere was investigated by finite-element numerical simulation. Three model systems with increasing complexity and closeness to the real situation were studied. The three-dimensional model systems were translated into appropriate grid structures and diffusive and convective transport in the leaf/atmosphere interface was simulated. Fenpropimorph (cis-4-[3-(4-tert-butylphenyl)-2-methylpropyl]-2,6-dimethylmorpholine) and Kresoxim-methyl ((E)-methyl-2-methoxyimino-2-[2-(o-tolyloxy-methyl)phenyl] acetate) were used as model compounds. The simulation showed that under still and convective conditions the vapours emitted by a point source rapidly form stationary envelopes around the leaves. Vapour concentrations within these unstirred layers depend on the vapour pressure of the compound in question and on its affinity to the lipoid surface layers of the leaf (cuticular waxes, cutin). The rules deduced from the numerical simulation of organic vapour behaviour in the leaf/atmosphere interface are expected to help in assessing how (semi-)volatile plant products (e.g. hormones, pheromones, secondary metabolites) and xenobiotics (e.g. pesticides, pollutants) perform on plant surfaces.

  1. Sorbent-based sampling methods for volatile and semi-volatile organic compounds in air Part 1: Sorbent-based air monitoring options.

    PubMed

    Woolfenden, Elizabeth

    2010-04-16

    Sorbent tubes/traps are widely used in combination with gas chromatographic (GC) analytical methods to monitor the vapour-phase fraction of organic compounds in air. Target compounds range in volatility from acetylene and freons to phthalates and PCBs and include apolar, polar and reactive species. Airborne vapour concentrations will vary depending on the nature of the location, nearby pollution sources, weather conditions, etc. Levels can range from low percent concentrations in stack and vent emissions to low part per trillion (ppt) levels in ultra-clean outdoor locations. Hundreds, even thousands of different compounds may be present in any given atmosphere. GC is commonly used in combination with mass spectrometry (MS) detection especially for environmental monitoring or for screening uncharacterised workplace atmospheres. Given the complexity and variability of organic vapours in air, no one sampling approach suits every monitoring scenario. A variety of different sampling strategies and sorbent media have been developed to address specific applications. Key sorbent-based examples include: active (pumped) sampling onto tubes packed with one or more sorbents held at ambient temperature; diffusive (passive) sampling onto sorbent tubes/cartridges; on-line sampling of air/gas streams into cooled sorbent traps; and transfer of air samples from containers (canisters, Tedlar) bags, etc.) into cooled sorbent focusing traps. Whichever sampling approach is selected, subsequent analysis almost always involves either solvent extraction or thermal desorption (TD) prior to GC(/MS) analysis. The overall performance of the air monitoring method will depend heavily on appropriate selection of key sampling and analytical parameters. This comprehensive review of air monitoring using sorbent tubes/traps is divided into 2 parts. (1) Sorbent-based air sampling option. (2) Sorbent selection and other aspects of optimizing sorbent-based air monitoring methods. The paper presents current state-of-the-art and recent developments in relevant areas such as sorbent research, sampler design, enhanced approaches to analytical quality assurance and on-tube derivatisation. Copyright 2009 Elsevier B.V. All rights reserved.

  2. Refractive-index profile and physical process determination in thick gratings in electrooptic crystals

    NASA Technical Reports Server (NTRS)

    Su, S. F.; Gaylord, T. K.

    1976-01-01

    A method for determining the refractive index profile of thick phase gratings in linear electrooptic crystals is presented. This method also determines the effective photovoltaic electric field and the relative contributions of diffusion and drift during hologram recording. The method requires only a knowledge of the modulation ratio during hologram recording and the fundamental and the higher-order diffraction efficiencies of the grating. As an illustration of the method, the refractive index profile, the effective photovoltaic field, and the relative contributions of diffusion and drift are determined from experimental measurements for a lithium niobate holographic grating.

  3. Physics Notes.

    ERIC Educational Resources Information Center

    School Science Review, 1982

    1982-01-01

    Outlines methodology, demonstrations, and materials including: an inexpensive wave machine; speed of sound in carbon dioxide; diffraction grating method for measuring spectral line wavelength; linear electronic thermometer; analogy for bromine diffusion; direct reading refractice index meter; inexpensive integrated circuit spectrophotometer; and…

  4. Liquid-liquid diffusion crystallization improves the X-ray diffraction of EndoS, an endo-β-N-acetylglucosaminidase from Streptococcus pyogenes with activity on human IgG.

    PubMed

    Trastoy, Beatriz; Lomino, Joseph V; Wang, Lai Xi; Sundberg, Eric J

    2013-12-01

    Endoglycosidase S (EndoS) is an enzyme secreted by Streptococcus pyogenes that specifically hydrolyzes the β-1,4-di-N-acetylchitobiose core glycan on immunoglobulin G (IgG) antibodies. One of the most common human pathogens and the cause of group A streptococcal infections, S. pyogenes secretes EndoS in order to evade the host immune system by rendering IgG effector mechanisms dysfunctional. On account of its specificity for IgG, EndoS has also been used extensively for chemoenzymatic synthesis of homogeneous IgG glycoprotein preparations and is being developed as a novel therapeutic for a wide range of autoimmune diseases. The structural basis of its enzymatic activity and substrate specificity, however, remains unknown. Here, the purification and crystallization of EndoS are reported. Using traditional hanging-drop and sitting-drop vapor-diffusion crystallization, crystals of EndoS were grown that diffracted to a maximum of 3.5 Å resolution but suffered from severe anisotropy, the data from which could only be reasonably processed to 7.5 Å resolution. When EndoS was crystallized by liquid-liquid diffusion, it was possible to grow crystals with a different space group to those obtained by vapor diffusion. Crystals of wild-type endoglycosidase and glycosynthase constructs of EndoS grown by liquid-liquid diffusion diffracted to 2.6 and 1.9 Å resolution, respectively, with a greatly diminished anisotropy. Despite extensive efforts, the failure to reproduce these liquid-liquid diffusion-grown crystals by vapor diffusion suggests that these crystallization methods each sample a distinct crystallization space.

  5. Grazing-incidence X-ray diffraction from a crystal with subsurface defects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gaevskii, A. Yu., E-mail: transilv@mail.ru; Golentus, I. E.

    2015-03-15

    The diffraction of X rays incident on a crystal surface under grazing angles under conditions of total external reflection has been investigated. An approach is proposed in which exact solutions to the dynamic problem of grazing-incidence diffraction in an ideal crystal are used as initial functions to calculate the diffuse component of diffraction in a crystal with defects. The diffuse component of diffraction is calculated for a crystal with surface defects of a dilatation-center type. Exact formulas of the continuum theory which take into account the mirror-image forces are used for defect-induced atomic displacements. Scattering intensity maps near Bragg peaksmore » are constructed for different scan modes, and the conditions for detecting primarily the diffuse component are determined. The results of dynamic calculations of grazing-incidence diffraction in defect-containing crystals are compared with calculations in the kinematic approximation.« less

  6. Multi-wavelength speckle reduction for laser pico-projectors using diffractive optics

    NASA Astrophysics Data System (ADS)

    Thomas, Weston H.

    Personal electronic devices, such as cell phones and tablets, continue to decrease in size while the number of features and add-ons keep increasing. One particular feature of great interest is an integrated projector system. Laser pico-projectors have been considered, but the technology has not been developed enough to warrant integration. With new advancements in diode technology and MEMS devices, laser-based projection is currently being advanced for pico-projectors. A primary problem encountered when using a pico-projector is coherent interference known as speckle. Laser speckle can lead to eye irritation and headaches after prolonged viewing. Diffractive optical elements known as diffusers have been examined as a means to lower speckle contrast. Diffusers are often rotated to achieve temporal averaging of the spatial phase pattern provided by diffuser surface. While diffusers are unable to completely eliminate speckle, they can be utilized to decrease the resultant contrast to provide a more visually acceptable image. This dissertation measures the reduction in speckle contrast achievable through the use of diffractive diffusers. A theoretical Fourier optics model is used to provide the diffuser's stationary and in-motion performance in terms of the resultant contrast level. Contrast measurements of two diffractive diffusers are calculated theoretically and compared with experimental results. In addition, a novel binary diffuser design based on Hadamard matrices will be presented. Using two static in-line Hadamard diffusers eliminates the need for rotation or vibration of the diffuser for temporal averaging. Two Hadamard diffusers were fabricated and contrast values were subsequently measured, showing good agreement with theory and simulated values. Monochromatic speckle contrast values of 0.40 were achieved using the Hadamard diffusers. Finally, color laser projection devices require the use of red, green, and blue laser sources; therefore, using a monochromatic diffractive diffuser may not optimal for color speckle contrast reduction. A simulation of the Hadamard diffusers is conducted to determine the optimum spacing between the two diffusers for polychromatic speckle reduction. Experimental measured results are presented using the optimal spacing of Hadamard diffusers for RGB color speckle reduction, showing 60% reduction in contrast.

  7. Recent Progress in the Remote Detection of Vapours and Gaseous Pollutants.

    ERIC Educational Resources Information Center

    Moffat, A. J.; And Others

    Work has been continuing on the correlation spectrometry techniques described at previous remote sensing symposiums. Advances in the techniques are described which enable accurate quantitative measurements of diffused atmospheric gases to be made using controlled light sources, accurate quantitative measurements of gas clouds relative to…

  8. Role of hydrothermal temperature on crystallinity, photoluminescence, photocatalytic and gas sensing properties of TiO2 nanoparticles

    NASA Astrophysics Data System (ADS)

    Malligavathy, M.; Iyyapushpam, S.; Nishanthi, S. T.; Padiyan, D. Pathinettam

    2018-04-01

    TiO2 nanoparticles were synthesised by hydrothermal method. The degree of crystallinity and phase purity were confirmed from the Raman spectra and X-ray diffraction. By increasing the hydrothermal temperature, crystallinity and AC conductivity of the TiO2 nanoparticles increase. Nitrogen adsorption-desorption measurements confirmed that the samples were mesoporous with an average pore diameter of 4.4-7.45 nm. Photocatalytic activity of TiO2 nanoparticles was evaluated and the sample hydrothermally treated at 160°C has the highest photocatalytic activity. In gas sensing measurements, sensitivity increases as a function of concentration and the response to ethanol vapour was better compared to other gases for the sample synthesised at 160°C.

  9. Effects of copper vapour on thermophysical properties of CO2-N2 plasma

    NASA Astrophysics Data System (ADS)

    Zhong, Linlin; Wang, Xiaohua; Rong, Mingzhe; Cressault, Yann

    2016-10-01

    CO2-N2 mixtures are often used as arc quenching medium (to replace SF6) in circuit breakers and shielding gas in arc welding. In such applications, copper vapour resulting from electrode surfaces can modify characteristics of plasmas. This paper therefore presents an investigation of the effects of copper on thermophysical properties of CO2-N2 plasma. The equilibrium compositions, thermodynamic properties (including mass density, specific enthalpy, and specific heat), transport coefficients (including electrical conductivity, viscosity, and thermal conductivity), and four kinds of combined diffusion coefficients due to composition gradients, applied electric fields, temperature gradients, and pressure gradients respectively, were calculated and discussed for CO2-N2 (mixing ratio 7:3) plasma contaminated by different proportions of copper vapour. The significant influences of copper were observed on all the properties of CO2-N2-Cu mixtures. The better ionization ability and larger molar mass of copper and larger collision integrals related to copper, should be responsible for such influences.

  10. Steam stripping of the unsaturated zone of contaminated sub-soils: The effect of diffusion/dispersion in the start-up phase

    NASA Astrophysics Data System (ADS)

    Brouwers, H. J. H.; Gilding, B. H.

    2006-02-01

    The unsteady process of steam stripping of the unsaturated zone of soils contaminated with volatile organic compounds (VOCs) is addressed. A model is presented. It accounts for the effects of water and contaminants remaining in vapour phase, as well as diffusion and dispersion of contaminants in this phase. The model has two components. The first is a one-dimensional description of the propagation of a steam front in the start-up phase. This is based on Darcy's law and conservation laws of mass and energy. The second component describes the transport of volatile contaminants. Taking the view that non-equilibrium between liquid and vapour phases exists, it accounts for evaporation, transport, and condensation at the front. This leads to a moving-boundary problem. The moving-boundary problem is brought into a fixed domain by a suitable transformation of the governing partial differential equations, and solved numerically. For a broad range of the governing dimensionless numbers, such as the Henry, Merkel and Péclet numbers, computational results are discussed. A mathematical asymptotic analysis supports this discussion. The range of parameter values for which the model is valid is investigated. Diffusion and dispersion are shown to be of qualitative importance, but to have little quantitative effect in the start-up phase.

  11. The rational design of biomimetic skin barrier lipid formulations using biophysical methods.

    PubMed

    Bulsara, P A; Varlashkin, P; Dickens, J; Moore, D J; Rawlings, A V; Clarke, M J

    2017-04-01

    The focus of this communication was to study phospholipid-structured emulsions whose phase behaviour is modified with monoalkyl fatty amphiphiles. Ideally, these systems would mimic key physical and structural attributes observed in human stratum corneum (SC) so that they better alleviate xerotic skin conditions. Phosphatidylcholine-structured emulsions were prepared, and their phase behaviour modified with monoalkyl fatty amphiphiles. The effect of molecular volume, acyl chain length and head-group interactions was studied using a combination of physical methods. Water vapour transmission rate (WVTR) was used as a primary test to assess occlusive character. Changes in the vibrational modes observed in Fourier transform infrared (FTIR) spectroscopy and bilayer spacing measured by X-ray diffraction (XRD) were then applied to elucidate the lateral and lamellar microstructural characteristics in the systems. Water vapour transmission rate demonstrated that as the phosphatidylcholine acyl chain length increased from C14, to C18, to C22, there was a corresponding increase in occlusive character. The addition of monoalkyl fatty amphiphiles such as behenic acid, behenyl alcohol or cetostearyl alcohol to a base formulation incorporating dipalmitoyl and distearoylphosphatidylcholine (C18) was seen to further increase barrier characteristics of the emulsions. FTIR methods used to probe lipid-chain conformational ordering demonstrated that as phosphatidylcholine acyl chain lengths increased, there was a corresponding improvement in acyl chain ordering, with an increase in thermal transition temperatures. The addition of a monoalkyl fatty amphiphile resulted in conformational order and thermal transition temperature improvements trending towards those observed in stratum corneum. FTIR also demonstrated that systems containing behenic acid or behenyl alcohol exhibited features associated with orthorhombic character. X-ray diffraction data showed that addition of monoalkyl fatty amphiphile also resulted in thicker lamellar structures than when those agents are not present. The generalized approach described herein is shown to mechanistically describe the occlusive character of phospholipid-structured formulations in the presence of long-chain fatty acids or alcohols and that they exhibit characteristics mimicking those found in human SC lipids. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  12. Studies on Aspirin Crystals Generated by a Modified Vapor Diffusion Method.

    PubMed

    Mittal, Amit; Malhotra, Deepak; Jain, Preeti; Kalia, Anupama; Shunmugaperumal, Tamilvanan

    2016-08-01

    The objectives of the current investigation were (1) to study the influence of selected two different non-solvents (diethylether and dichloromethane) on the drug crystal formation of a model drug, aspirin (ASP-I) by the modified vapor diffusion method and (2) to characterize and compare the generated crystals (ASP-II and ASP-III) using different analytical techniques with that of unprocessed ASP-I. When compared to the classical vapor diffusion method which consumes about 15 days to generate drug crystals, the modified method needs only 12 h to get the same. Fourier transform-infrared spectroscopy (FT-IR) reveals that the internal structures of ASP-II and ASP-III crystals were identical when compared with ASP-I. Although the drug crystals showed a close similarity in X-ray diffraction patterns, the difference in the relative intensities of some of the diffraction peaks (especially at 2θ values of around 7.7 and 15.5) could be attributed to the crystal habit or crystal size modification. Similarly, the differential scanning calorimetry (DSC) study speculates that only the crystal habit modifications might occur but without involving any change in internal structure of the generated drug polymorphic form I. This is further substantiated from the scanning electron microscopy (SEM) pictures that indicated the formation of platy shape for the ASP-II crystals and needle shape for the ASP-III crystals. In addition, the observed slow dissolution of ASP crystals should indicate polymorph form I formation. Thus, the modified vapor diffusion method could routinely be used to screen and legally secure all possible forms of other drug entities too.

  13. Crystallization and preliminary X-ray diffraction studies of vitamin D3 hydroxylase, a novel cytochrome P450 isolated from Pseudonocardia autotrophica

    PubMed Central

    Yasutake, Yoshiaki; Fujii, Yoshikazu; Cheon, Woo-Kwang; Arisawa, Akira; Tamura, Tomohiro

    2009-01-01

    Vitamin D3 hydroxylase (Vdh) is a novel cytochrome P450 monooxygenase isolated from the actinomycete Pseudonocardia autotrophica and consisting of 403 amino-acid residues. Vdh catalyzes the activation of vitamin D3 via sequential hydroxylation reactions: these reactions involve the conversion of vitamin D3 (cholecalciferol or VD3) to 25-hydroxyvitamin D3 [25(OH)VD3] and the subsequent conversion of 25(OH)VD3 to 1α,25-dihydroxyvitamin D3 [calciferol or 1α,25(OH)2VD3]. Overexpression of recombinant Vdh was carried out using a Rhodococcus erythropolis expression system and the protein was subsequently purified and crystallized. Two different crystal forms were obtained by the hanging-drop vapour-diffusion method at 293 K using polyethylene glycol as a precipitant. The form I crystal belonged to the trigonal space group P31, with unit-cell parameters a = b = 61.7, c = 98.8 Å. There is one Vdh molecule in the asymmetric unit, with a solvent content of 47.6%. The form II crystal was grown in the presence of 25(OH)VD3 and belonged to the orthorhombic system P212121, with unit-cell parameters a = 63.4, b = 65.6 c = 102.2 Å. There is one Vdh molecule in the asymmetric unit, with a solvent content of 46.7%. Native data sets were collected to resolutions of 1.75 and 3.05 Å for form I and form II crystals, respectively, using synchrotron radiation. The structure solution was obtained by the molecular-replacement method and model refinement is in progress for the form I crystal. PMID:19342783

  14. Modelling and intepreting the isotopic composition of water vapour in convective updrafts

    NASA Astrophysics Data System (ADS)

    Bolot, M.; Legras, B.; Moyer, E. J.

    2012-08-01

    The isotopic compositions of water vapour and its condensates have long been used as tracers of the global hydrological cycle, but may also be useful for understanding processes within individual convective clouds. We review here the representation of processes that alter water isotopic compositions during processing of air in convective updrafts and present a unified model for water vapour isotopic evolution within undiluted deep convective cores, with a special focus on the out-of-equilibrium conditions of mixed phase zones where metastable liquid water and ice coexist. We use our model to show that a combination of water isotopologue measurements can constrain critical convective parameters including degree of supersaturation, supercooled water content and glaciation temperature. Important isotopic processes in updrafts include kinetic effects that are a consequence of diffusive growth or decay of cloud particles within a supersaturated or subsaturated environment; isotopic re-equilibration between vapour and supercooled droplets, which buffers isotopic distillation; and differing mechanisms of glaciation (droplet freezing vs. the Wegener-Bergeron-Findeisen process). As all of these processes are related to updraft strength, droplet size distribution and the retention of supercooled water, isotopic measurements can serve as a probe of in-cloud conditions of importance to convective processes. We study the sensitivity of the profile of water vapour isotopic composition to differing model assumptions and show how measurements of isotopic composition at cloud base and cloud top alone may be sufficient to retrieve key cloud parameters.

  15. Modelling and interpreting the isotopic composition of water vapour in convective updrafts

    NASA Astrophysics Data System (ADS)

    Bolot, M.; Legras, B.; Moyer, E. J.

    2013-08-01

    The isotopic compositions of water vapour and its condensates have long been used as tracers of the global hydrological cycle, but may also be useful for understanding processes within individual convective clouds. We review here the representation of processes that alter water isotopic compositions during processing of air in convective updrafts and present a unified model for water vapour isotopic evolution within undiluted deep convective cores, with a special focus on the out-of-equilibrium conditions of mixed-phase zones where metastable liquid water and ice coexist. We use our model to show that a combination of water isotopologue measurements can constrain critical convective parameters, including degree of supersaturation, supercooled water content and glaciation temperature. Important isotopic processes in updrafts include kinetic effects that are a consequence of diffusive growth or decay of cloud particles within a supersaturated or subsaturated environment; isotopic re-equilibration between vapour and supercooled droplets, which buffers isotopic distillation; and differing mechanisms of glaciation (droplet freezing vs. the Wegener-Bergeron-Findeisen process). As all of these processes are related to updraft strength, particle size distribution and the retention of supercooled water, isotopic measurements can serve as a probe of in-cloud conditions of importance to convective processes. We study the sensitivity of the profile of water vapour isotopic composition to differing model assumptions and show how measurements of isotopic composition at cloud base and cloud top alone may be sufficient to retrieve key cloud parameters.

  16. Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer.

    PubMed

    Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

    2010-05-01

    The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq-RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq-RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 A, while the type 2 Hfq-RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 A. Diffraction data were collected to a resolution of 2.20 A from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis.

  17. Expression, purification and preliminary crystallographic analysis of oligopeptidase B from Trypanosoma brucei

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rea, Dean; Hazell, Carole; Andrews, Norma W.

    2006-08-01

    Recombinant oligopeptidase B from T. brucei has been prepared and crystallized. Data were collected to 2.7 Å. Heavy-atom soaks and preparation of selenomethionine-substituted protein are in progress for structure determination by MAD or MIR. African sleeping sickness, also called trypanosomiasis, is a significant cause of morbidity and mortality in sub-Saharan Africa. Peptidases from Trypanosoma brucei, the causative agent, include the serine peptidase oligopeptidase B, a documented virulence factor and therapeutic target. Determination of the three-dimensional structure of oligopeptidase B is desirable to facilitate the development of novel inhibitors. Oligopeptidase B was overexpressed in Escherichia coli as an N-terminally hexahistidine-tagged fusionmore » protein, purified using metal-affinity chromatography and crystallized using the hanging-drop vapour-diffusion technique in 7%(w/v) polyethylene glycol 6000, 1 M LiCl, 0.1 M bis-tris propane pH 7.5. Diffraction data to 2.7 Å resolution were collected using synchrotron radiation. The crystals belong to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 124.5, c = 249.9 Å. A complete data set to 2.7 Å was collected using synchrotron radiation.« less

  18. Diffuse Scattering in the Icosahedral AL-Li-Cu Quasicrystal

    NASA Astrophysics Data System (ADS)

    Proult, A.; Donnadieu, P.; Wang, K.; Garoche, P.

    1995-12-01

    Electron diffraction patterns of icosahedral quasicrystals frequently exhibit diffuse scattering features. We report a detailed analysis of diffuse scattering in Al{6}Li{3}Cu (T2) quasicrystalline samples. The samples have been specifically heat-treated which allows to observe pronounced diffuse effects. Diffuse streaks are observed along the 5-fold and 2-fold symmetry axes and are elongated perpendicularly to these directions. These streaks are due to discs in the 3-dimensional reciprocal space. The diffuse disc positions are only indexable in the 6-dimensional hyperspace but the disc intensities do not agree with the ones predicted by the Cut-and-Project method. The diffuse discs we observed seem to be related to an original quasicrystalline phenomenon overlapping with the icosahedral phase. Les diagrammes de diffraction électronique des quasicristaux icosaédriques présentent fréquemment des diffusions diffuses. Nous les analysons ici en détails sur des échantillons de phase quasicristalline Al{6}Li{3}Cu (T2) traités thermiquement dans lesquels les diffusions diffuses sont trés prononcées. Les intensités diffuses forment des batônnets centrés sur des positions appartenant aux rangées réciproques d'ordre 5 et d'ordre 2 et allongés perpendiculairement à ces directions. On montre qu'il s'agit en fait de disques diffus. dans le réseau réciproque à 3 dimensions, dont les positions ne peuvent s'indexer que sur le réseau à 6 dimensions. Toutefois, les intensités ne correspondent pas à celle prédites par l'algorithme de Coupe-et-Projection. Les disques de diffusion diffuse semblent relever d'une organisation quasicristalline originale se superposant à la phase icosaédrique.

  19. Lithium diffusion in sputter-deposited Li4Ti5O12 thin films

    NASA Astrophysics Data System (ADS)

    Wunde, F.; Berkemeier, F.; Schmitz, G.

    2012-10-01

    Li4Ti5O12 (LTO) thin films are deposited by dc-ion beam sputtering at different oxygen partial pressures and different substrate temperatures. In order to investigate, how these two parameters influence the atomic structure, the specimens are characterized by X-ray diffraction and transmission electron microscopy. Electrochemical characterization of the films is done by cyclic voltammetry and chrono-potentiometry. To determine an averaged chemical diffusion coefficient of lithium, a method is developed, evaluating c-rate tests. The results obtained by this method are compared to results obtained by the well established galvanostatic intermittent titration technique (GITT), which is used to determine a concentration dependent diffusion coefficient of lithium in LTO.

  20. Mechanical and physicochemical properties of AlN thin films obtained by pulsed laser deposition

    NASA Astrophysics Data System (ADS)

    Cibert, C.; Tétard, F.; Djemia, P.; Champeaux, C.; Catherinot, A.; Tétard, D.

    2004-10-01

    AlN thin films have been deposited on Si(100) substrates by a pulsed laser deposition method. The deposition parameters (pressure, temperature, purity of target) play an important role in the mechanical and physicochemical properties. The films have been characterized using X-ray diffraction, atomic force microscopy, Brillouin light scattering, Fourier transform infrared spectroscopy and wettability testing. With a high purity target of AlN and a temperature deposition of 750 ∘C, the measured Rayleigh wave velocity is close to the one previously determined for AlN films grown at high temperature by metal-organic chemical vapour deposition. Growth of nanocrystalline AlN at low temperature and of AlN film with good crystallinity for samples deposited at higher temperature is confirmed by infrared spectroscopy, as it was by atomic force microscopy, in agreement with X-ray diffraction results. A high hydrophobicity has been measured with zero polar contribution for the surface energy. These results confirm that films made by pulsed laser deposition of pure AlN at relatively low temperature have good prospects for microelectromechanical systems applications.

  1. Structured illumination to spatially map chromatin motions.

    PubMed

    Bonin, Keith; Smelser, Amanda; Moreno, Naike Salvador; Holzwarth, George; Wang, Kevin; Levy, Preston; Vidi, Pierre-Alexandre

    2018-05-01

    We describe a simple optical method that creates structured illumination of a photoactivatable probe and apply this method to characterize chromatin motions in nuclei of live cells. A laser beam coupled to a diffractive optical element at the back focal plane of an excitation objective generates an array of near diffraction-limited beamlets with FWHM of 340  ±  30  nm, which simultaneously photoactivate a 7  ×  7 matrix pattern of GFP-labeled histones, with spots 1.70  μm apart. From the movements of the photoactivated spots, we map chromatin diffusion coefficients at multiple microdomains of the cell nucleus. The results show correlated motions of nearest chromatin microdomain neighbors, whereas chromatin movements are uncorrelated at the global scale of the nucleus. The method also reveals a DNA damage-dependent decrease in chromatin diffusion. The diffractive optical element instrumentation can be easily and cheaply implemented on commercial inverted fluorescence microscopes to analyze adherent cell culture models. A protocol to measure chromatin motions in nonadherent human hematopoietic stem and progenitor cells is also described. We anticipate that the method will contribute to the identification of the mechanisms regulating chromatin mobility, which influences most genomic processes and may underlie the biogenesis of genomic translocations associated with hematologic malignancies. (2018) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).

  2. Characterization of individual stacking faults in a wurtzite GaAs nanowire by nanobeam X-ray diffraction.

    PubMed

    Davtyan, Arman; Lehmann, Sebastian; Kriegner, Dominik; Zamani, Reza R; Dick, Kimberly A; Bahrami, Danial; Al-Hassan, Ali; Leake, Steven J; Pietsch, Ullrich; Holý, Václav

    2017-09-01

    Coherent X-ray diffraction was used to measure the type, quantity and the relative distances between stacking faults along the growth direction of two individual wurtzite GaAs nanowires grown by metalorganic vapour epitaxy. The presented approach is based on the general property of the Patterson function, which is the autocorrelation of the electron density as well as the Fourier transformation of the diffracted intensity distribution of an object. Partial Patterson functions were extracted from the diffracted intensity measured along the [000\\bar{1}] direction in the vicinity of the wurtzite 00\\bar{1}\\bar{5} Bragg peak. The maxima of the Patterson function encode both the distances between the fault planes and the type of the fault planes with the sensitivity of a single atomic bilayer. The positions of the fault planes are deduced from the positions and shapes of the maxima of the Patterson function and they are in excellent agreement with the positions found with transmission electron microscopy of the same nanowire.

  3. Characterization of individual stacking faults in a wurtzite GaAs nanowire by nanobeam X-ray diffraction

    PubMed Central

    Davtyan, Arman; Lehmann, Sebastian; Zamani, Reza R.; Dick, Kimberly A.; Bahrami, Danial; Al-Hassan, Ali; Leake, Steven J.; Pietsch, Ullrich; Holý, Václav

    2017-01-01

    Coherent X-ray diffraction was used to measure the type, quantity and the relative distances between stacking faults along the growth direction of two individual wurtzite GaAs nanowires grown by metalorganic vapour epitaxy. The presented approach is based on the general property of the Patterson function, which is the autocorrelation of the electron density as well as the Fourier transformation of the diffracted intensity distribution of an object. Partial Patterson functions were extracted from the diffracted intensity measured along the direction in the vicinity of the wurtzite Bragg peak. The maxima of the Patterson function encode both the distances between the fault planes and the type of the fault planes with the sensitivity of a single atomic bilayer. The positions of the fault planes are deduced from the positions and shapes of the maxima of the Patterson function and they are in excellent agreement with the positions found with transmission electron microscopy of the same nanowire. PMID:28862620

  4. Transient diffraction grating measurements of molecular diffusion in the undergraduate laboratory

    NASA Astrophysics Data System (ADS)

    Spiegel, Daniel R.; Tuli, Santona

    2011-07-01

    Diffusion is a central process in many biological, chemical, and physical systems. We describe an experiment that employs the interference of laser beams to allow the measurement of molecular diffusion on submillimeter length scales. The interference fringes of two intersecting pump beams within a dye solution create a sinusoidal distribution of long-lived molecular excited states. A third probe beam is incident at a wavelength at which the indices of refraction of the ground and excited states are different, so the probe beam diffracts from the spatially periodic excited-state pattern. After the pump beams are switched off, the excited-state periodicity washes out as the system diffuses back to equilibrium. The molecular diffusion constant is obtained from the rate constant of the exponential decay of the diffracted beam. It is also possible to measure the excited-state lifetime.

  5. Modelling of intermittent microwave convective drying: parameter sensitivity

    NASA Astrophysics Data System (ADS)

    Zhang, Zhijun; Qin, Wenchao; Shi, Bin; Gao, Jingxin; Zhang, Shiwei

    2017-06-01

    The reliability of the predictions of a mathematical model is a prerequisite to its utilization. A multiphase porous media model of intermittent microwave convective drying is developed based on the literature. The model considers the liquid water, gas and solid matrix inside of food. The model is simulated by COMSOL software. Its sensitivity parameter is analysed by changing the parameter values by ±20%, with the exception of several parameters. The sensitivity analysis of the process of the microwave power level shows that each parameter: ambient temperature, effective gas diffusivity, and evaporation rate constant, has significant effects on the process. However, the surface mass, heat transfer coefficient, relative and intrinsic permeability of the gas, and capillary diffusivity of water do not have a considerable effect. The evaporation rate constant has minimal parameter sensitivity with a ±20% value change, until it is changed 10-fold. In all results, the temperature and vapour pressure curves show the same trends as the moisture content curve. However, the water saturation at the medium surface and in the centre show different results. Vapour transfer is the major mass transfer phenomenon that affects the drying process.

  6. Analysis of a nanocrystalline polymer dispersion of ebselen using solid-state NMR, Raman microscopy, and powder X-ray diffraction.

    PubMed

    Vogt, Frederick G; Williams, Glenn R

    2012-07-01

    Nanocrystalline drug-polymer dispersions are of significant interest in pharmaceutical delivery. The purpose of this work is to demonstrate the applicability of methods based on two-dimensional (2D) and multinuclear solid-state NMR (SSNMR) to a novel nanocrystalline pharmaceutical dispersion of ebselen with polyvinylpyrrolidone-vinyl acetate (PVP-VA), after initial characterization with other techniques. A nanocrystalline dispersion of ebselen with PVP-VA was prepared and characterized by powder X-ray diffraction (PXRD), confocal Raman microscopy and mapping, and differential scanning calorimetry (DSC), and then subjected to detailed 1D and 2D SSNMR analysis involving ¹H, ¹³C, and ⁷⁷Se isotopes and ¹H spin diffusion. PXRD was used to show that dispersion contains nanocrystalline ebselen in the 35-60 nm size range. Confocal Raman microscopy and spectral mapping were able to detect regions where short-range interactions may occur between ebselen and PVP-VA. Spin diffusion effects were analyzed using 2D SSNMR experiments and are able to directly detect interactions between ebselen and the surrounding PVP-VA. The methods used here, particularly the 2D SSNMR methods based on spin diffusion, provided detailed structural information about a nanocrystalline polymer dispersion of ebselen, and should be useful in other studies of these types of materials.

  7. Numerical study of chemical reactions in a surface microdischarge tube with mist flow based on experiment

    NASA Astrophysics Data System (ADS)

    Shibata, T.; Nishiyama, H.

    2014-03-01

    Recently, a water treatment method of spraying solution into a discharge region has been developed and shows high energy efficiency. In this study, a simulation model of a water treatment method using a surface microdischarge (SMD) tube with mist flow is proposed for further understanding the detailed chemical reactions. Our model has three phases (plasma, gas and liquid) and three simulation steps. The carrier gas is humid air including 2% or 3% water vapour. The chemical species diffusion characteristics in the SMD tube and the concentrations in a droplet are clarified in a wide pH interval. The simulation results show that the chemical species generated on the SMD tube inner wall are diffused to the central axis and dissolved into fine droplets. Especially, OH radicals dissolve into droplets a few mm away from the SMD tube wall because of acidification of the droplets. Furthermore, the hydrogen peroxide density, which is the most important indicator of a radical reaction in water, is influenced by the initial solution pH. This pH dependence results from ozone self-decomposition in water.

  8. Improving and assessing vapour pressure estimation methods for organic compounds of atmospheric relevance using a Knudsen Effusion Mass Spectrometer (KEMS)

    NASA Astrophysics Data System (ADS)

    Booth, A. M.; Topping, D. O.; McFiggans, G. B.; Garforth, A.; Percival, C. J.

    2009-12-01

    Aerosol particles influence climate directly through the scattering and absorbing radiation and indirectly through their role as cloud condensation nuclei (CCN). Traditionally, models aiming to capture the behaviour of aerosols in the atmosphere have concentrated on the role of inorganic compounds. However, organic components, covering a huge range of chemical and physical properties (Jacobson et.al., 2000), may constitute a significant fraction depending on location (Houghton et.al., 2001). Knowledge of pure component vapour pressures is essential for calculations of gas/particle partitioning. There are many methods of estimating vapour pressures but most of the experimental data collected to date has been for intermediate or high pressure compounds (and often measured at temperatures considerably above ambient) and the proportion of experimental data for low (less than 100Pa) vapour pressure compounds has been very small. Hence the datasets used for developing the estimation methods have reflected this bias in addition to the fact that components studied tend to have one or two functional groups at the most. Thus it is unsurprising that some of the estimation methods can give errors in vapour pressure of several orders of magnitude for multifunctional compounds at ambient temperatures. Knudsen Effusion Mass Spectrometer (KEMS) has been used to measure solid state vapour pressures for multifunctional organic compounds based on dicarboxylic acids (Booth et al 2009). In the atmosphere these compounds are likely to exist in the sub-cooled state so Differential Scanning Calorimetry (DSC) was used to obtain thermochemical data to effect a correction between solid and sub-cooled vapour pressures. The group contribution method of Nanoolal and co-workers (Nanoolal et al., 2008) is one of the best predictive methods in terms of reproducing available low volatility vapour pressure data (barley et al., 2009). The Nanoolal method relies on the use of primary and secondary functional groups and interaction parameters, derived from experimental data, to reliably predict boiling points and vapour pressures. A sensitivity study was undertaken to establish the impact of the new experimentally determined vapour pressures on partitioning models. Jacobson, M.C., et al. Rev Geophys, 38 (2), 267-294, 2000. Houghton et al. Climate Change 2001: The Scientific Basis. Contribution of Working Group 1 to the Third Assessment Report of the IPCC., 881 pp., Cambridge University Press, 2001. Johnson, D. , et al. Atmo. Chem. Phys., Vol. 6, 419-431, 2006 Yu, J. Z., et al. J Atmos Chem. 34, 207-258, 1999 Booth, A.M. et al Atmos. Meas. Tech.,2,355-361, 2009 Nanoolal, Y. et al Fluid Phase Equilibria, 269,117-133., 2008. Barley, M. et al Atmos. Chem. Phys., -,to be submitted.

  9. Structural analysis of as-deposited and annealed low-temperature gallium arsenide

    NASA Astrophysics Data System (ADS)

    Matyi, R. J.; Melloch, M. R.; Woodall, J. M.

    1993-04-01

    The structure of GaAs grown at low substrate temperatures (LT-GaAs) by molecular beam epitaxy has been studied using high resolution X-ray diffraction methods. Double crystal rocking curves from the as-deposited LT-GaAs show well defined interference fringes, indicating a high level of structural perfection. Triple crystal diffraction analysis of the as-deposited sample showed significantly less diffuse scattering near the LT-GaAs 004 reciprocal lattice point compared with the substrate 004 reciprocal lattice point, suggesting that despite the incorporation of approximately 1% excess arsenic, the epitaxial layer had superior crystalline perfection than did the GaAs substrate. Triple crystal scans of annealed LT-GaAs showed an increase in the integrated diffuse intensity by approximately a factor of three as the anneal temperature was increased from 700 to 900°C. Analogous to the effects of SiO2 precipitates in annealed Czochralski silicon, the diffuse intensity is attributed to distortions in the epitaxial LT-GaAs lattice by arsenic precipitates.

  10. The speed of sound in a gas–vapour bubbly liquid

    PubMed Central

    Prosperetti, Andrea

    2015-01-01

    In addition to the vapour of the liquid, bubbles in cavitating flows usually contain also a certain amount of permanent gas that diffuses out of the liquid as they grow. This paper presents a simplified linear model for the propagation of monochromatic pressure waves in a bubbly liquid with these characteristics. Phase change effects are included in detail, while the gas is assumed to follow a polytropic law. It is shown that even a small amount of permanent gas can have a major effect on the behaviour of the system. Particular attention is paid to the low-frequency range, which is of special concern in flow cavitation. Numerical results for water and liquid oxygen illustrate the implications of the model. PMID:26442146

  11. The speed of sound in a gas-vapour bubbly liquid.

    PubMed

    Prosperetti, Andrea

    2015-10-06

    In addition to the vapour of the liquid, bubbles in cavitating flows usually contain also a certain amount of permanent gas that diffuses out of the liquid as they grow. This paper presents a simplified linear model for the propagation of monochromatic pressure waves in a bubbly liquid with these characteristics. Phase change effects are included in detail, while the gas is assumed to follow a polytropic law. It is shown that even a small amount of permanent gas can have a major effect on the behaviour of the system. Particular attention is paid to the low-frequency range, which is of special concern in flow cavitation. Numerical results for water and liquid oxygen illustrate the implications of the model.

  12. Purification, isolation, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 from Drosophila melanogaster

    NASA Astrophysics Data System (ADS)

    Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Popov, V. O.

    2017-11-01

    The spatial organization of the genome is controlled by a special class of architectural proteins, including proteins containing BTB domains that are able to dimerize or multimerize. The centrosomal protein 190 is one of such architectural proteins. The purification, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 are reported. The crystallization conditions were found by the vapor-diffusion technique. The crystals diffracted to 1.5 Å resolution and belonged to sp. gr. P3221. The structure was solved by the molecular replacement method. The structure refinement is currently underway.

  13. Structure of Mesorhizobium loti arylamine N-acetyltransferase 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Holton, Simon J.; Dairou, Julien; Sandy, James

    2005-01-01

    The crystal structure of a M. loti arylamine N-acetyltransferase 1 has been determined at 2.0 Å resolution. The arylamine N-acetyltransferase (NAT) enzymes have been found in a broad range of both eukaryotic and prokaryotic organisms. The NAT enzymes catalyse the transfer of an acetyl group from acetyl Co-enzyme A onto the terminal nitrogen of a range of arylamine, hydrazine and arylhydrazine compounds. Recently, several NAT structures have been reported from different prokaryotic sources including Salmonella typhimurium, Mycobacterium smegmatis and Pseudomonas aeruginosa. Bioinformatics analysis of the Mesorhizobium loti genome revealed two NAT paralogues, the first example of multiple NAT isoenzymes inmore » a eubacterial organism. The M. loti NAT 1 enzyme was recombinantly expressed and purified for X-ray crystallographic studies. The purified enzyme was crystallized in 0.5 M Ca(OAc){sub 2}, 16% PEG 3350, 0.1 M Tris–HCl pH 8.5 using the sitting-drop vapour-diffusion method. A data set diffracting to 2.0 Å was collected from a single crystal at 100 K. The crystal belongs to the orthorhombic spacegroup P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.2, b = 97.3, c = 114.3 Å. The structure was refined to a final free-R factor of 24.8%. The structure reveals that despite low sequence homology, M. loti NAT1 shares the common fold as reported in previous NAT structures and exhibits the same catalytic triad of residues (Cys-His-Asp) in the active site.« less

  14. Applications of thin-film sandwich crystallization platforms.

    PubMed

    Axford, Danny; Aller, Pierre; Sanchez-Weatherby, Juan; Sandy, James

    2016-04-01

    Examples are shown of protein crystallization in, and data collection from, solutions sandwiched between thin polymer films using vapour-diffusion and batch methods. The crystallization platform is optimal for both visualization and in situ data collection, with the need for traditional harvesting being eliminated. In wells constructed from the thinnest plastic and with a minimum of aqueous liquid, flash-cooling to 100 K is possible without significant ice formation and without any degradation in crystal quality. The approach is simple; it utilizes low-cost consumables but yields high-quality data with minimal sample intervention and, with the very low levels of background X-ray scatter that are observed, is optimal for microcrystals.

  15. Characterization of doped hydrogenated nanocrystalline silicon films prepared by plasma enhanced chemical vapour deposition

    NASA Astrophysics Data System (ADS)

    Wang, Jin-Liang; Wu, Er-Xing

    2007-03-01

    The B- and P-doped hydrogenated nanocrystalline silicon films (nc-Si:H) are prepared by plasma-enhanced chemical vapour deposition (PECVD). The microstructures of doped nc-Si:H films are carefully and systematically characterized by using high resolution electron microscopy (HREM), Raman scattering, x-ray diffraction (XRD), Auger electron spectroscopy (AES), and resonant nucleus reaction (RNR). The results show that as the doping concentration of PH3 increases, the average grain size (d) tends to decrease and the crystalline volume percentage (Xc) increases simultaneously. For the B-doped samples, as the doping concentration of B2H6 increases, no obvious change in the value of d is observed, but the value of Xc is found to decrease. This is especially apparent in the case of heavy B2H6 doped samples, where the films change from nanocrystalline to amorphous.

  16. Measurement and Interpretation of Diffuse Scattering in X-Ray Diffraction for Macromolecular Crystallography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wall, Michael E.

    X-ray diffraction from macromolecular crystals includes both sharply peaked Bragg reflections and diffuse intensity between the peaks. The information in Bragg scattering reflects the mean electron density in the unit cells of the crystal. The diffuse scattering arises from correlations in the variations of electron density that may occur from one unit cell to another, and therefore contains information about collective motions in proteins.

  17. Room temperature deposition of gold onto the diffuse and sharp diffraction spot Si(111)-( 3 × 3) R30° Au surfaces

    NASA Astrophysics Data System (ADS)

    Plass, Richard; Marks, Laurence D.

    1996-06-01

    Room temperature gold depositions onto Si(111)-( 3 × 3) R30° Au surfaces with diffuse and sharp diffraction spots [Surf. Sci. 242 (1991) 73] (diffuse and sharp 3 × 3 Au hereafter) under UHV conditions has been monitored using transmission electron diffraction (TED). Both systems display an increase in surface structure diffraction spot intensities up to the completion of 1.0 monolayer (ML) after which the surface beams display an exponential decrease in intensity with coverage. The exponential decay rate decreases after roughly 1.33 ML. These results can be attributed to gold initially diffusing to and filling 3 × 3 Au gold trimer sites in vacancy type surface domain walls [Surf. Sci. 342 (1995) 233], then filling one of three possible sites on the 3 × 3 Au structure with essentially no surface diffusion, disrupting nearby gold trimers. Gold deposition onto the diffuse type structure caused the formation and expansion of satellite arcs around the strongest 3 × 3 beams similar to those seen by others [Surf. Sci. 242 (1991) 73; Jpn. J. Appl. Phys. 16 (1977) 891; J. Vac. Sci. Technol. A 10 (1992) 3486] at elevated temperatures while the sharp structure displayed only a modest shoulder formation near the strongest 3 × 3 beams.

  18. Determination of diffusion and partition coefficients of model migrants by direct contact and vapour phase transfer from low-density polyethylene films into cake.

    PubMed

    Paseiro-Cerrato, Rafael; Rodríguez-Bernaldo de Quirós, Ana; Otero-Pazos, Pablo; Sendón, Raquel; Paseiro-Losada, Perfecto

    2018-03-01

    The aim of the present study was to determine the migration kinetics of one photoinitiator, benzophenone, and two optical brighteners, Uvitex OB and 1,4-diphenyl-1,3-butadiene (DPBD), from low-density polyethylene (LDPE) films into cake. Transfer was assessed by both direct contact and also the vapour phase. To perform the migration tests by direct contact, plastic films enriched with the additives were placed between two cake slices. To evaluate the migration through the gas phase, cake and the fortified LDPE film were placed with no direct contact in a glass container that was hermetically closed. Samples were stored at different time-temperature conditions. Target compounds were extracted from the films with ethanol (70°C, 24 h) and analysed by HPLC-DAD. Relevant parameters such as partition and diffusion coefficients between food and plastic film were calculated. The Arrhenius equation was applied to estimate the diffusion coefficient at any temperature. The data indicate that migration of benzophenone occurs in a significant extent into cake by both direct contact and through the gas phase (no direct contact). Conversely, very little migration occurred for Uvitex OB by direct contact and none through the gas phase. Results for benzophenone suggest that migration through the gas phase should be considered when evaluating migration from food packaging materials into food.

  19. Diffusion of radon through concrete block walls: A significant source of indoor radon

    USGS Publications Warehouse

    Lively, R.S.; Goldberg, L.F.

    1999-01-01

    Basement modules located in southern Minnesota have been the site of continuous radon and environmental measurements during heating seasons since 1993. Concentrations of radon within the basement modules ranged from 70 Bq.m-3 to over 4000 Bq.m-3 between November to April during the three measurement periods. In the soil gas for the same times, concentrations of radon ranged between 25,000 and 70,000 Bq.m-3. Levels of radon within the basement modules changed by factors of five or more within 24 h, in concert with pressure gradients of 4 to 20 Pa that developed between the basement modules and their surroundings. Diffusion is identified as the principal method by which radon is transferred into and out of the basement modules, and appears to be relatively independent of insulating materials and vapour retarders. The variability of radon and correlations with differential pressure gradients may be related to air currents in the block walls and soil that interrupt radon diffusing inward. This yields a net decrease of radon in the basement modules by decay and outward diffusion. Levels of radon within the basement modules increase when the pressure differential is zero and air flow ceases, allowing diffusion gradients to be re-established. Radon levels in both the soil and the basement modules then increase until an equilibrium is achieved.

  20. Aerosol assisted chemical vapour deposition of gas sensitive SnO2 and Au-functionalised SnO2 nanorods via a non-catalysed vapour solid (VS) mechanism

    PubMed Central

    Vallejos, Stella; Selina, Soultana; Annanouch, Fatima Ezahra; Gràcia, Isabel; Llobet, Eduard; Blackman, Chris

    2016-01-01

    Tin oxide nanorods (NRs) are vapour synthesised at relatively lower temperatures than previously reported and without the need for substrate pre-treatment, via a vapour-solid mechanism enabled using an aerosol-assisted chemical vapour deposition method. Results demonstrate that the growth of SnO2 NRs is promoted by a compression of the nucleation rate parallel to the substrate and a decrease of the energy barrier for growth perpendicular to the substrate, which are controlled via the deposition conditions. This method provides both single-step formation of the SnO2 NRs and their integration with silicon micromachined platforms, but also allows for in-situ functionalization of the NRs with gold nanoparticles via co-deposition with a gold precursor. The functional properties are demonstrated for gas sensing, with microsensors using functionalised NRs demonstrating enhanced sensing properties towards H2 compared to those based on non-functionalised NRs. PMID:27334232

  1. Maskless direct laser writing with visible light: Breaking through the optical resolving limit with cooperative manipulations of nonlinear reverse saturation absorption and thermal diffusion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wei, Jingsong, E-mail: weijingsong@siom.ac.cn; Wang, Rui; University of Chinese Academy of Sciences, Beijing 100049

    In this work, the resolving limit of maskless direct laser writing is overcome by cooperative manipulation from nonlinear reverse saturation absorption and thermal diffusion, where the nonlinear reverse saturation absorption can induce the formation of below diffraction-limited energy absorption spot, and the thermal diffusion manipulation can make the heat quantity at the central region of energy absorption spot propagate along the thin film thickness direction. The temperature at the central region of energy absorption spot transiently reaches up to melting point and realizes nanolithography. The sample “glass substrate/AgInSbTe” is prepared, where AgInSbTe is taken as nonlinear reverse saturation absorption thinmore » film. The below diffraction-limited energy absorption spot is simulated theoretically and verified experimentally by near-field spot scanning method. The “glass substrate/Al/AgInSbTe” sample is prepared, where the Al is used as thermal conductive layer to manipulate the thermal diffusion channel because the thermal diffusivity coefficient of Al is much larger than that of AgInSbTe. The direct laser writing is conducted by a setup with a laser wavelength of 650 nm and a converging lens of NA=0.85, the lithographic marks with a size of about 100 nm are obtained, and the size is only about 1/10 the incident focused spot. The experimental results indicate that the cooperative manipulation from nonlinear reverse saturation absorption and thermal diffusion is a good method to realize nanolithography in maskless direct laser writing with visible light.« less

  2. Ball lightning from atmospheric discharges via metal nanosphere oxidation: from soils, wood or metals.

    PubMed

    Abrahamson, John

    2002-01-15

    The slow (diffusion-limited) oxidation of metal nanoparticles has previously been proposed as the mechanism for ball lightning energy release, and argued to be the result of a normal lightning strike on soil. Here this basic model of networked nanoparticles is detailed further, and extended to lightning strikes on metal structures, and also to the action of other storm-related discharges or man-made discharges. The basic model predicted the important properties of "average" observed ball lightning, and the extension in this paper also covers high-energy examples of ball lightning. Laboratory checks of the theory are described, and predictions given of what conditions are necessary for observing ball lightning in the laboratory. Key requirements of the model are a sheltered region near the strike foot and starting materials which can generate a metal vapour under intensive heating, including soil, wood or a metal structure. The evolution of hydrocarbons (often plastics) along with metal vapour can ensure the local survival of the metal vapour even in an oxidizing atmosphere. Subsequent condensation of this vapour to metallic nanoparticles in networks provides the coherence of a ball structure, which also releases light over an extended time. Also discussed is the passage of ball lightning through a sheet of building material, including glass, and its occasional charring of flesh on close contact.

  3. In situ growth of capping-free magnetic iron oxide nanoparticles on liquid-phase exfoliated graphene

    NASA Astrophysics Data System (ADS)

    Tsoufis, T.; Syrgiannis, Z.; Akhtar, N.; Prato, M.; Katsaros, F.; Sideratou, Z.; Kouloumpis, A.; Gournis, D.; Rudolf, P.

    2015-05-01

    We report a facile approach for the in situ synthesis of very small iron oxide nanoparticles on the surface of high-quality graphene sheets. Our synthetic strategy involved the direct, liquid-phase exfoliation of highly crystalline graphite (avoiding any oxidation treatment) and the subsequent chemical functionalization of the graphene sheets via the well-established 1,3-dipolar cycloaddition reaction. The resulting graphene derivatives were employed for the immobilization of the nanoparticle precursor (Fe cations) at the introduced organic groups by a modified wet-impregnation method, followed by interaction with acetic acid vapours. The final graphene-iron oxide hybrid material was achieved by heating (calcination) in an inert atmosphere. Characterization by X-ray diffraction, transmission electron and atomic force microscopy, Raman and X-ray photoelectron spectroscopy gave evidence for the formation of rather small (<12 nm), spherical, magnetite-rich nanoparticles which were evenly distributed on the surface of few-layer (<1.2 nm thick) graphene. Due to the presence of the iron oxide nanoparticles, the hybrid material showed a superparamagnetic behaviour at room temperature.We report a facile approach for the in situ synthesis of very small iron oxide nanoparticles on the surface of high-quality graphene sheets. Our synthetic strategy involved the direct, liquid-phase exfoliation of highly crystalline graphite (avoiding any oxidation treatment) and the subsequent chemical functionalization of the graphene sheets via the well-established 1,3-dipolar cycloaddition reaction. The resulting graphene derivatives were employed for the immobilization of the nanoparticle precursor (Fe cations) at the introduced organic groups by a modified wet-impregnation method, followed by interaction with acetic acid vapours. The final graphene-iron oxide hybrid material was achieved by heating (calcination) in an inert atmosphere. Characterization by X-ray diffraction, transmission electron and atomic force microscopy, Raman and X-ray photoelectron spectroscopy gave evidence for the formation of rather small (<12 nm), spherical, magnetite-rich nanoparticles which were evenly distributed on the surface of few-layer (<1.2 nm thick) graphene. Due to the presence of the iron oxide nanoparticles, the hybrid material showed a superparamagnetic behaviour at room temperature. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr00765h

  4. Overexpression, purification, crystallization and preliminary structural studies of catabolic ornithine transcarbamylase from Lactobacillus hilgardii

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rivas, Blanca de las; Rodríguez, Héctor; Angulo, Iván

    2007-07-01

    The catabolic ornithine transcarbamylase (cOTC) from L. hilgardii has been overexpressed in E. coli, purified and crystallized under two different experimental conditions. The structure has been solved by the molecular-replacement method using the atomic coordinates of catabolic ornithine transcarbamylase from P. aeruginosa as the search model. The catabolic ornithine transcarbamylase (cOTC; EC 2.1.3.3) from the lactic acid bacteria Lactobacillus hilgardii is a key protein involved in the degradation of arginine during malolactic fermentation. cOTC containing an N-terminal His{sub 6} tag has been overexpressed in Escherichia coli, purified and crystallized under two different experimental conditions using the hanging-drop vapour-diffusion method. Crystalsmore » obtained from a solution containing 8%(w/v) PEG 4000, 75 mM sodium acetate pH 4.6 belong to the trigonal space group P321 and have unit-cell parameters a = b = 157.04, c = 79.28 Å. Conversely, crystals grown in 20%(v/v) 2-methyl-2,4-pentanediol, 7.5%(w/v) PEG 4000, 100 mM HEPES pH 7.8 belong to the monoclinic space group C2 and have unit-cell parameters a = 80.06, b = 148.90, c = 91.67 Å, β = 100.25°. Diffraction data were collected in-house to 3.00 and 2.91 Å resolution for trigonal and monoclinic crystals, respectively. The estimated Matthews coefficient for the crystal forms were 2.36 and 2.24 Å{sup 3} Da{sup −1}, respectively, corresponding to 48% and 45% solvent content. In both cases, the results are consistent with the presence of three protein subunits in the asymmetric unit. The structure of cOTC has been determined by the molecular-replacement method using the atomic coordinates of cOTC from Pseudomonas aeruginosa (PDB code) as the search model.« less

  5. Surface diffusion in homoepitaxial SrTiO3 thin films

    NASA Astrophysics Data System (ADS)

    Woo, Chang-Su; Chu, Kanghyun; Song, Jong-Hyun; Yang, Chan-Ho; Charm Lab Team; Nano Spintronics Lab Collaboration

    The development of growth techniques such as molecular beam epitaxy (MBE) and pulsed laser deposition (PLD) has facilitated growths of complex oxide thin films at the atomic level .... Systematic studies on surface diffusion process of adatoms using theoretical and experimental methods allow us to understand growth mechanism enabling atomically flat thin film surface. In this presentation, we introduce the synthesis of homoepitaxial SrTiO3 thin films using a PLD equipped with reflection of high energy electron diffraction (RHEED). We determine the surface diffusion time as a function of growth temperature and extract the activation energy of diffusion on the surface by in-situ monitoring the RHEED intensity recovery during the film deposition. From the extracted experimental results, we discuss the microscopic mechanism of the diffusion process

  6. The modelling routes for the chemical vapour deposition process: application to Si 1- xGe x deposition

    NASA Astrophysics Data System (ADS)

    Pons, M.; Bernard, C.; Rouch, H.; Madar, R.

    1995-10-01

    The purpose of this article is to present the modelling routes for the chemical vapour deposition process with a special emphasis on mass transport models with near local thermochemical equilibrium imposed in the gas-phase and at the deposition surface. The theoretical problems arising from the linking of the two selected approaches, thermodynamics and mass transport, are shown and a solution procedure is proposed. As an illustration, selected results of thermodynamic and mass transport analysis and of the coupled approach showed that, for the deposition of Si 1- xGe x solid solution at 1300 K (system SiGeClHAr), the thermodynamic heterogeneous stability of the reactive gases and the thermal diffusion led to the germanium depletion of the deposit.

  7. Sensing response of copper phthalocyanine salt dispersed glass with organic vapours

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ridhi, R.; Sachdeva, Sheenam; Saini, G. S. S.

    2016-05-06

    Copper Phthalocyanine and other Metal Phthalocyanines are very flexible and tuned easily to modify their structural, spectroscopic, optical and electrical properties by either functionalizing them with various substituent groups or by replacing or adding a ligand to the central metal atom in the phthalocyanine ring and accordingly can be made sensitive and selective to various organic species or gaseous vapours. In the present work, we have dispersed Copper Phthalocyanine Salt (CuPcS) in sol-gel glass form using chemical route sol-gel method and studied its sensing mechanism with organic vapours like methanol and benzene and found that current increases onto their exposuremore » with vapours. A variation in the activation energies was also observed with exposure of vapours.« less

  8. Sensing response of copper phthalocyanine salt dispersed glass with organic vapours

    NASA Astrophysics Data System (ADS)

    Ridhi, R.; Sachdeva, Sheenam; Saini, G. S. S.; Tripathi, S. K.

    2016-05-01

    Copper Phthalocyanine and other Metal Phthalocyanines are very flexible and tuned easily to modify their structural, spectroscopic, optical and electrical properties by either functionalizing them with various substituent groups or by replacing or adding a ligand to the central metal atom in the phthalocyanine ring and accordingly can be made sensitive and selective to various organic species or gaseous vapours. In the present work, we have dispersed Copper Phthalocyanine Salt (CuPcS) in sol-gel glass form using chemical route sol-gel method and studied its sensing mechanism with organic vapours like methanol and benzene and found that current increases onto their exposure with vapours. A variation in the activation energies was also observed with exposure of vapours.

  9. Water Vapour Effects in Mass Measurement

    NASA Astrophysics Data System (ADS)

    Khélifa, N.

    2008-01-01

    Water vapour density inside the mass comparator enclosure is a critical parameter whose fluctuations during mass weighing can lead to errors in the determination of an unknown mass. To monitor them, a method using DFB laser diode in the near infrared has been proposed and tested. Preliminary results of our observation of water vapour sorption and de-sorption processes from the walls and the mass standard are reported.

  10. Synchrotron Radial X-ray Diffraction Studies of Deformation of Polycrystalline MgO

    NASA Astrophysics Data System (ADS)

    Girard, J.; Tsujino, N.; Mohiuddin, A.; Karato, S. I.

    2016-12-01

    X-ray diffraction analyses have been used for decades to study mechanical properties of polycrystalline samples during in-situ high-pressure deformation. When polycrystalline materials are deformed, stresses develop in grains and lead to lattice distortion. Using X-ray diffraction we can estimate the lattice strain for each (hkl) diffraction plans and calculate the applied stress for each (hkl), using [Singh, 1993] relation. However, this method doesn't take into account plastic anisotropy. As a results of plastic anisotropy present in the material, stress estimated from this method can be largely differ depending on (hkl) diffraction planes [Karato, 2009]. Studying the stress estimate for each (hkl) plane, might help us distinguish dominant deformation mechanisms activated during deformation such as diffusion (we will observe small stress variation as a function of (hkl) diffraction planes) or dislocation creep (we will observe a stress variation as a function of (hkl) diffraction planes that could also give us clues on potential slip system activity). In this study we observed stress evolution in MgO polycrystalline samples deformed under mantle pressure and temperature for (200) and (220) diffraction planes. Using a range MgO grain sizes we were able to control the active deformation mechanism (for e.g. diffusion creep or dislocation creep). For coarse-grained specimens, we observed strong (hkl) dependence of radial strain indicating the operation of dislocation creep. The observed (hkl) dependence changes with pressure suggesting a change in the slip system: at pressures higher than 27 GPa, (200) shows larger stress estimate than (220). In contrast, at lower pressures, (220) shows larger stress estimate than (200). This might indicate a slip system transition in MgO occurring under lower mantle conditions. From {110} plane to {100} plane. This is in good agreement with theoretical predictions and numerical calculation [Amodeo et al., 2012] and has an important implication for the interpretation of seismic anisotropy in the D" layer [Karato, 1998]. Amodeo, J., Carrey P., and P. Cordier (2012), Philosophical Magazine, 92(12). Karato, S-I. (1998), Earth and planets Space, 50, 1019-1028 Karato, S.-I. (2009), Physical Review. B, 79(21). Singh, A. K., (1993), Journal of Applied Physic, 73, 4278.

  11. Liquid and vapour-phase antifungal activities of selected essential oils against candida albicans: microscopic observations and chemical characterization of cymbopogon citratus

    PubMed Central

    2010-01-01

    Background Use of essential oils for controlling Candida albicans growth has gained significance due to the resistance acquired by pathogens towards a number of widely-used drugs. The aim of this study was to test the antifungal activity of selected essential oils against Candida albicans in liquid and vapour phase and to determine the chemical composition and mechanism of action of most potent essential oil. Methods Minimum Inhibitory concentration (MIC) of different essential oils in liquid phase, assayed through agar plate dilution, broth dilution & 96-well micro plate dilution method and vapour phase activity evaluated through disc volatilization method. Reduction of C. albicans cells with vapour exposure was estimated by kill time assay. Morphological alteration in treated/untreated C. albicans cells was observed by the Scanning electron microscopy (SEM)/Atomic force microscopy (AFM) and chemical analysis of the strongest antifungal agent/essential oil has been done by GC, GC-MS. Results Lemon grass (Cymbopogon citratus) essential oil exhibited the strongest antifungal effect followed by mentha (Mentha piperita) and eucalyptus (Eucalyptus globulus) essential oil. The MIC of lemon grass essential oil in liquid phase (288 mg/l) was significantly higher than that in the vapour phase (32.7 mg/l) and a 4 h exposure was sufficient to cause 100% loss in viability of C. albicans cells. SEM/AFM of C. albicans cells treated with lemon grass essential oil at MIC level in liquid and vapour phase showed prominent shrinkage and partial degradation, respectively, confirming higher efficacy of vapour phase. GC-MS analysis revealed that lemon grass essential oil was dominated by oxygenated monoterpenes (78.2%); α-citral or geranial (36.2%) and β-citral or neral (26.5%), monoterpene hydrocarbons (7.9%) and sesquiterpene hydrocarbons (3.8%). Conclusion Lemon grass essential oil is highly effective in vapour phase against C. albicans, leading to deleterious morphological changes in cellular structures and cell surface alterations. PMID:21067604

  12. Structure and sublimation of water ice films grown in vacuo at 120-190 K studied by positron and positronium annihilation.

    PubMed

    Townrow, S; Coleman, P G

    2014-03-26

    The crystalline structure of ∼ 5-20 μm water ice films grown at 165 and 172 K has been probed by measuring the fraction of positrons forming ortho-positronium (ortho-Ps) and decaying into three gamma photons. It has been established that films grown at slower rates (water vapour pressure ≥ 1 mPa) have lower concentrations of lattice defects and closed pores, which act as Ps traps, than those grown at higher rates (vapour pressure ∼ 100 mPa), evidenced by ortho-Ps diffusion lengths being approximately four times greater in the former. By varying the growth temperature between 162 and 182 K it was found that films become less disordered at temperatures above ∼ 172 K, with the ortho-Ps diffusion length rising by ∼ 60%, in this range. The sublimation energy for water ice films grown on copper has been measured to be 0.462(5) eV using the time dependence of positron annihilation parameters from 165 to 195 K, in agreement with earlier studies and with no measurable dependence on growth rate and thermal history.

  13. Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

    NASA Astrophysics Data System (ADS)

    Hatakeyama, S.; Horiuchi, W.; Kohama, A.

    2018-05-01

    The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

  14. Method and apparatus for reducing diffraction-induced damage in high power laser amplifier systems

    DOEpatents

    Campillo, Anthony J.; Newnam, Brian E.; Shapiro, Stanley L.; Terrell, Jr., N. James

    1976-01-01

    Self-focusing damage caused by diffraction in laser amplifier systems may be minimized by appropriately tailoring the input optical beam profile by passing the beam through an aperture having a uniform high optical transmission within a particular radius r.sub.o and a transmission which drops gradually to a low value at greater radii. Apertures having the desired transmission characteristics may readily be manufactured by exposing high resolution photographic films and plates to a diffuse, disk-shaped light source and mask arrangement.

  15. The preparation of Fe2O3-ZSM-5 catalysts by metal-organic chemical vapour deposition method for catalytic wet peroxide oxidation of m-cresol.

    PubMed

    Yang, Yi; Zhang, Huiping; Yan, Ying

    2018-03-01

    Fe 2 O 3 -ZSM-5 catalysts (0.6 wt% Fe load) prepared by metal-organic chemical vapour deposition (MOCVD) method were evaluated in the catalytic wet peroxide oxidation (CWPO) of m -cresol in a batch reactor. The catalysts have a good iron dispersion and small iron crystalline size, and exhibit high stability during reaction. In addition, the kinetics of the reaction were studied and the initial oxidation rate equation was given. Catalysts were first characterized by N 2 adsorption-desorption isotherms, scanning electronic microscopy, energy-dispersive spectroscopy, X-ray diffraction and X-ray photoelectron spectroscopy. Results show that extra-framework Fe 3+ species (presenting in the form of Fe 2 O 3 ) are successfully loaded on ZSM-5 supports by MOCVD method. Performances of catalysts were tested and effects of different temperature, stirring rate, catalyst amount on hydrogen peroxide, m -cresol, total organic carbon (TOC) conversion and Fe leaching concentration were studied. Results reveal that catalytic activity increased with higher temperature, faster stirring rate and larger catalyst amount. In all circumstances, m -cresol conversion could reach 99% in 0.5-2.5 h, and the highest TOC removal (80.5%) is obtained after 3 h under conditions of 60°C, 400 r.p.m. and catalyst amount of 2.5 g l -1 . The iron-leaching concentrations are less than 1.1 mg l -1 under all conditions. The initial oxidation rate equation [Formula: see text] is obtained for m -cresol degradation with Fe 2 O 3 -ZSM-5 catalysts.

  16. Numerical Simulation of Pulsation Flow in the Vapour Channel of Short Low Temperature Heat Pipes at High Heat Loads

    NASA Astrophysics Data System (ADS)

    Seryakov, A. V.; Konkin, A. V.

    2017-11-01

    The results of the numerical simulation of pulsations in the Laval-liked vapour channel of short low-temperature range heat pipes (HPs) are presented. The numerical results confirmed the experimentally obtained increase of the frequency of pulsations in the vapour channel of short HPs with increasing overheat of the porous evaporator relative to the boiling point of the working fluid. The occurrence of pressure pulsations inside the vapour channel in a short HPs is a complex phenomenon associated with the boiling beginning in the capillary-porous evaporator at high heat loads, and appearance the excess amount of vapour above it, leading to the increase in pressure P to a value at which the boiling point TB of the working fluid becomes higher than the evaporator temperature Tev. Vapour clot spreads through the vapour channel and condense, and then a rarefaction wave return from condenser in the evaporator, the boiling in which is resumed and the next cycle of the pulsations is repeated. Numerical simulation was performed using finite element method implemented in the commercial program ANSYS Multiphisics 14.5 in the two-dimensional setting of axis symmetric moist vapour flow with third kind boundary conditions.

  17. Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer

    PubMed Central

    Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

    2010-01-01

    The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq–RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq–RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 Å, while the type 2 Hfq–RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 Å. Diffraction data were collected to a resolution of 2.20 Å from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis. PMID:20445260

  18. Expression, purification, crystallization and preliminary X-ray crystallographic analysis of fructose-1,6-bisphosphate aldolase from Escherichia coli.

    PubMed

    Zhang, Li; Guo, Zheng; Huang, Jing; Liu, Meiruo; Wang, Yuandong; Ji, Chaoneng

    2014-10-01

    Fructose-1,6-bisphosphate aldolase is one of the most important enzymes in the glycolytic pathway and catalyzes the reversible cleavage of fructose-1,6-bisphosphate to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate. The full-length fbaB gene encoding fructose-1,6-bisphosphate aldolase class I (FBPA I) was cloned from Escherichia coli strain BL21. FBPA I was overexpressed in E. coli and purified. Biochemical analysis found that the optimum reaction temperature of FBPA I is 330.5 K and that the enzyme has a high temperature tolerance. Crystals of recombinant FBPA I were obtained by the sitting-drop vapour-diffusion technique in a condition consisting of 19 mg ml(-1) FBPA I in 0.1 M Tris pH 9.0, 10%(w/v) polyethylene glycol 8000 and diffracted to 2.0 Å resolution. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 217.7, b = 114.9, c = 183.9 Å, β = 124.6°. The asymmetric unit of these crystals may contain ten molecules, giving a Matthews coefficient of 2.48 Å(3) Da(-1) and a solvent content of 50.5%.

  19. Relative contributions of scattering, diffraction and modal diffusion to focal ratio degradation in optical fibres

    NASA Astrophysics Data System (ADS)

    Haynes, D. M.; Withford, M. J.; Dawes, J. M.; Lawrence, J. S.; Haynes, R.

    2011-06-01

    Focal ratio degradation (FRD) is a major contributor to light loss in astronomical instruments employing multimode optical fibres. We present a powerful diagnostic model that uniquely quantifies the various sources of FRD in multimode fibres. There are three main phenomena that can contribute to FRD: scattering, diffraction and modal diffusion. We propose a Voigt FRD model where the diffraction and modal diffusion are modelled by the Gaussian component and the end-face scattering is modelled by the Lorentzian component. The Voigt FRD model can be deconvolved into its Gaussian and Lorentzian components and used to analyse the contribution of each of the three major components. We used the Voigt FRD model to analyse the FRD of modern astronomical grade fibre for variations in (i) end-face surface roughness, (ii) wavelength, (iii) fibre length and (iv) external fibre stress. The elevated FRD we observed was mostly due to external factors, i.e. fibre end effects such as surface roughness, subsurface damage and environmentally induced microbending caused by the epoxy, ferrules and fibre cable design. The Voigt FRD model has numerous applications such as a diagnostic tool for current fibre instrumentation that show elevated FRD, as a quality control method for fibre manufacture and fibre cable assembly and as a research and development tool for the characterization of new fibre technologies.

  20. Pan-derived isotopic composition of atmospheric vapour in a Mediterranean wetland (Rhône River Delta, France).

    PubMed

    Vallet-Coulomb, Christine; Cartapanis, Olivier; Radakovitch, Olivier; Sonzogni, Corinne; Pichaud, Marc

    2010-03-01

    A continuous record of atmospheric vapour isotopic composition (delta(A)) can be derived from the isotope mass balance of a water body submitted to natural evaporation. In this paper, we present preliminary results of the application of this method to a drying evaporation pan, located in a Mediterranean wetland, during a two-month summer period. Results seem consistent with few atmospheric vapour data based on the assumption of isotopic equilibrium with precipitation, but we observed a shift between pan-derived delta(A) and the composition of vapour samples collected by cold trapping. These results suggest that further investigations are necessary to evaluate the effect of diurnal variations of atmospheric conditions on the applicability of the pan-evaporation method, and on the representative of grab atmospheric samples. We also propose a sensitivity analysis for evaluating the impact of the different measured components on delta(A) calculation, and show an improvement in the method efficiency as the pan is drying.

  1. Mesure de haute resolution de la fonction de distribution radiale du silicium amorphe pur

    NASA Astrophysics Data System (ADS)

    Laaziri, Khalid

    1999-11-01

    Cette these porte sur l'etude de la structure du silicium amorphe prepare par irradiation ionique. Elle presente des mesures de diffraction de rayons X sur de la poudre de silicium cristallin, du silicium amorphe relaxe et non relaxe, ainsi que tous les developpements mathematiques et physiques necessaires pour extraire la fonction de distribution radiale correspondant a chaque echantillon. Au Chapitre I, nous presentons une methode de fabrication de membranes minces de silicium amorphe pur. Il y a deux etapes majeures lors du processus de fabrication: l'implantation ionique, afin de creer une couche amorphe de plusieurs microns et l'attaque chimique, pour enlever le reste du materiau cristallin. Nous avons caracterise premierement les membranes de silicium amorphe par spectroscopie Raman pour verifier qu'il ne reste plus de trace de materiau cristallin dans les films amorphes. Une deuxieme caracterisation par detection de recul elastique (ERD-TOF) sur ces memes membranes a montre qu'il y a moins de 0.1% atomique de contaminants tels que l'oxygene, le carbone, et l'hydrogene. Au Chapitre II, nous proposons une nouvelle methode de correction de la contribution inelastique "Compton" des spectres de diffusion totale afin d'extraire les pics de diffusion elastique, responsable de la diffraction de Bragg. L'article presente tout d'abord une description simplifiee d'une theorie sur la diffusion inelastique dite "Impulse Approximation" (IA) qui permet de calculer des profils de Compton en fonction de l'energie et de l'angle de diffusion 2theta. Ces profils sont utilises comme fonction de lissage de la diffusion Compton experimentale. Pour lisser les pics de diffusion elastique, nous avons utilise une fonction pic de nature asymetrique. Aux Chapitre III, nous exposons de maniere detaillee les resultats des experiences de diffraction de rayons X sur les membranes de silicium amorphe et la poudre de silicium cristallin que nous avons preparees. Nous abordons aussi les differentes etapes experimentales, d'analyse ainsi que les methodes de determination et de filtrage des transformees de Fourier des donnees de diffraction. Une comparaison des fonctions de distribution radiale du silicium amorphe relaxe et non relaxe indique que la relaxation structurelle dans le silicium amorphe est probablement due en grande partie a une annihilation des defauts plutot qu'a une reorganisation atomique globale du reseau de silicium amorphe. La deduction de la coordination des pics correspondants au premiers voisins atomiques par lissage de fonctions gaussienne indique que la coordination du silicium amorphe relaxe est de 3.88, celle du non-relaxe est de 3.79, alors que la mesure de reference sur la poudre de silicium cristallin donne une valeur de 4 tel que prevu. La sous-coordination du silicium amorphe expliquerait pourquoi sa densite est inferieure a celle du silicium cristallin. (Abstract shortened by UMI.)

  2. Reducing ingress of organic vapours into homes situated on contaminated land.

    PubMed

    Crump, D; Brown, V; Rowley, J; Squire, R

    2004-04-01

    The efficacy of current landfill gas and radon mitigation measures for the prevention of ingress of organic vapours was investigated by the study of four houses situated on contaminated land in North West England. The chemical present in the ground of greatest concern for health due to exposure to vapour in the indoor air was hexachlorobutadiene (HCBD) and the concentration of this compound was used to assess the effectiveness of the remedial measures. A two stage remediation was undertaken. For a house with a solid floor the top surface of the floor was sealed and then for the second stage a fan was used to pressurise the soil gas beneath the house. In a house with a suspended timber floor, extra air bricks were installed to increase ventilation of the floor void and then a fan to further increase air exchange in the void. HCBD in air was monitored by both pumped and diffusive sampling methods. Control houses were also monitored that were not subject to remediation. It is concluded that the remedial measures used for radon protection of a suspended floor have the potential to reduce indoor HCBD concentrations by about 80%, at least in downstairs rooms (where initial levels were highest). The two techniques used for properties with solid floors do not appear to be as effective, and no benefit at all was seen without making allowances for changes in concentration that occurred in the control house over the same period. Further work is required to test the efficacy of the techniques over a longer period and under different circumstances of type of contamination and building characteristics.

  3. Vapor Cartesian diver

    NASA Astrophysics Data System (ADS)

    Grebenev, Igor V.; Lebedeva, Olga V.; Polushkina, Svetlana V.

    2018-07-01

    The article proposes a new research object for a general physics course—the vapour Cartesian diver, designed to study the properties of saturated water vapour. Physics education puts great importance on the study of the saturated vapour state, as it is related to many fundamental laws and theories. For example, the temperature dependence of the saturated water vapour pressure allows the teacher to demonstrate the Le Chatelier’s principle: increasing the temperature of a system in a dynamic equilibrium favours the endothermic change. That means that increasing the temperature increases the amount of vapour present, and so increases the saturated vapour pressure. The experimental setup proposed in this paper can be used as an example of an auto-oscillatory system, based on the properties of saturated vapour. The article describes a mathematical model of physical processes that occur in the experiment, and proposes a numerical solution method for the acquired system of equations. It shows that the results of numerical simulation coincide with the self-oscillation parameters from the real experiment. The proposed installation can also be considered as a model of a thermal engine.

  4. X-ray scattering by edge-dislocations in the S_A phase of mesomorphic side chain polyacrylates

    NASA Astrophysics Data System (ADS)

    Davidson, P.; Pansu, B.; Levelut, A. M.; Strzelecki, L.

    1991-01-01

    The X-ray diffraction patterns of mesomorphic side chain polymers in the S_A phase present diffuse streaks in shape of “butterfly wings”. We show that this diffuse scattering may be due to the presence of edge dislocations. On the basis of a previous description of edge dislocations within the framework of the elastic continuum theory of the S_A phase given by De Gennes, we have calculated the Fourier transform of the deformation field. Optical diffraction experiments on sketches of defects have also been made to reproduce the X-ray scattering patterns. Both methods show that this diffuse scattering may indeed be due to the presence of edge dislocations. Their density may be roughly estimated to some 10^8/cm^2. The size of their cores should be only a few Ångströms. From the decay of their elastic deformation field, a typical length λ = (K/B)^{1/2}≈ 1,5 Å can be obtained which shows that the elastic constant B of compression of the layers should be about two orders of magnitude larger in the “polymeric” S_A phase than in the “conventional” one. Les clichés de diffraction des rayons X par des polymères mésomorphes en peigne, en phase S_A, présentent des trainées diffuses en forme d'“ ailes de papillon ”. Nous montrons que cette diffusion diffuse peut s'expliquer par la présence de dislocations-coin. En partant de la description des dislocations-coin donnée par De Gennes dans le cadre de la théorie du continuum élastique de la phase S_A, nous avons calculé la transformée de Fourier du champ de déformation. Des expériences de diffraction optique sur des modèles de défauts ont aussi été effectuées afin de reproduire les clichés de diffraction des rayons X. Les deux méthodes montrent que cette diffusion diffuse peut en effet bien s'expliquer par la présence de dislocations-coin. Leur densité a été grossièrement estimée à quelques 10^8/cm^2. La taille de leurs coeurs ne devrait pas dépasser quelques Ångströms. D'après l'allure du champ de déformation élastique, on peut tirer une longueur typique λ = (K/B)^{1/2}≈ 1,5 Å, ce qui montre que la constante élastique B de compression des couches devrait être environ 100 fois plus élevée en phase S_A “ polymérique ” qu'en phase S_A “ usuelle ”.

  5. Applications of thin-film sandwich crystallization platforms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Axford, Danny, E-mail: danny.axford@diamond.ac.uk; Aller, Pierre; Sanchez-Weatherby, Juan

    2016-03-24

    Crystallization via sandwiches of thin polymer films is presented and discussed. Examples are shown of protein crystallization in, and data collection from, solutions sandwiched between thin polymer films using vapour-diffusion and batch methods. The crystallization platform is optimal for both visualization and in situ data collection, with the need for traditional harvesting being eliminated. In wells constructed from the thinnest plastic and with a minimum of aqueous liquid, flash-cooling to 100 K is possible without significant ice formation and without any degradation in crystal quality. The approach is simple; it utilizes low-cost consumables but yields high-quality data with minimal samplemore » intervention and, with the very low levels of background X-ray scatter that are observed, is optimal for microcrystals.« less

  6. Reliable determination of oxygen and hydrogen isotope ratios in atmospheric water vapour adsorbed on 3A molecular sieve.

    PubMed

    Han, Liang-Feng; Gröning, Manfred; Aggarwal, Pradeep; Helliker, Brent R

    2006-01-01

    The isotope ratio of atmospheric water vapour is determined by wide-ranging feedback effects from the isotope ratio of water in biological water pools, soil surface horizons, open water bodies and precipitation. Accurate determination of atmospheric water vapour isotope ratios is important for a broad range of research areas from leaf-scale to global-scale isotope studies. In spite of the importance of stable isotopic measurements of atmospheric water vapour, there is a paucity of published data available, largely because of the requirement for liquid nitrogen or dry ice for quantitative trapping of water vapour. We report results from a non-cryogenic method for quantitatively trapping atmospheric water vapour using 3A molecular sieve, although water is removed from the column using standard cryogenic methods. The molecular sieve column was conditioned with water of a known isotope ratio to 'set' the background signature of the molecular sieve. Two separate prototypes were developed, one for large collection volumes (3 mL) and one for small collection volumes (90 microL). Atmospheric water vapour was adsorbed to the column by pulling air through the column for several days to reach the desired final volume. Water was recovered from the column by baking at 250 degrees C in a dry helium or nitrogen air stream and cryogenically trapped. For the large-volume apparatus, the recovered water differed from water that was simultaneously trapped by liquid nitrogen (the experimental control) by 2.6 per thousand with a standard deviation (SD) of 1.5 per thousand for delta(2)H and by 0.3 per thousand with a SD of 0.2 per thousand for delta(18)O. Water-vapour recovery was not satisfactory for the small volume apparatus. Copyright (c) 2006 John Wiley & Sons, Ltd.

  7. Density of bunched threading dislocations in epitaxial GaN layers as determined using X-ray diffraction

    NASA Astrophysics Data System (ADS)

    Barchuk, M.; Holý, V.; Rafaja, D.

    2018-04-01

    X-ray diffraction is one of the most popular experimental methods employed for determination of dislocation densities, as it can recognize both the strain fields and the local lattice rotations produced by dislocations. The main challenge of the quantitative analysis of the dislocation density is the formulation of a suitable microstructure model, which describes the dislocation arrangement and the effect of the interactions between the strain fields from neighboring dislocations reliably in order to be able to determine the dislocation densities precisely. The aim of this study is to prove the capability of X-ray diffraction and two computational methods, which are frequently used for quantification of the threading dislocation densities from X-ray diffraction measurements, in the special case of partially bunched threading dislocations. The first method is based on the analysis of the dislocation-controlled crystal mosaicity, and the other one on the analysis of diffuse X-ray scattering from threading dislocations. The complementarity of both methods is discussed. Furthermore, it is shown how the complementarity of these methods can be used to improve the results of the quantitative analysis of bunched and thus inhomogeneously distributed threading dislocations and to get a better insight into the dislocation arrangement.

  8. Properties of the carbon-palladium nanocomposites studied by Raman spectroscopy method

    NASA Astrophysics Data System (ADS)

    Belka, Radosław; Suchańska, Małgorzata

    2013-10-01

    In this paper, the results for thin carbon-palladium (C-Pd) nanocomposites obtained by PVD (Physical Vapour Deposition) and PVD/CVD (Chemical Vapour Deposition) method, carried out using Raman spectroscopy method are presented. Studies reveal the dominance of fullerene-like structure for PVD samples and graphite-like structures for CVD samples. The type of substrate and metal content have great impact on spectra shapes.

  9. An advanced model of heat and mass transfer in the protective clothing - verification

    NASA Astrophysics Data System (ADS)

    Łapka, P.; Furmański, P.

    2016-09-01

    The paper presents an advanced mathematical and numerical models of heat and mass transfer in the multi-layers protective clothing and in elements of the experimental stand subjected to either high surroundings temperature or high radiative heat flux emitted by hot objects. The model included conductive-radiative heat transfer in the hygroscopic porous fabrics and air gaps as well as conductive heat transfer in components of the stand. Additionally, water vapour diffusion in the pores and air spaces as well as phase transition of the bound water in the fabric fibres (sorption and desorption) were accounted for. The thermal radiation was treated in the rigorous way e.g.: semi-transparent absorbing, emitting and scattering fabrics were assumed a non-grey and all optical phenomena at internal or external walls were modelled. The air was assumed transparent. Complex energy and mass balance as well as optical conditions at internal or external interfaces were formulated in order to find exact values of temperatures, vapour densities and radiation intensities at these interfaces. The obtained highly non-linear coupled system of discrete equation was solve by the in-house iterative algorithm which was based on the Finite Volume Method. The model was then successfully partially verified against the results obtained from commercial software for simplified cases.

  10. Structural and magnetic properties of ultra-thin Fe films on metal-organic chemical vapour deposited GaN(0001)

    NASA Astrophysics Data System (ADS)

    Kim, Jun-Young; Ionescu, Adrian; Mansell, Rhodri; Farrer, Ian; Oehler, Fabrice; Kinane, Christy J.; Cooper, Joshaniel F. K.; Steinke, Nina-Juliane; Langridge, Sean; Stankiewicz, Romuald; Humphreys, Colin J.; Cowburn, Russell P.; Holmes, Stuart N.; Barnes, Crispin H. W.

    2017-01-01

    Structural and magnetic properties of 1-10 nm thick Fe films deposited on GaN(0001) were investigated. In-situ reflecting high energy electron diffraction images indicated a α-Fe(110)/GaN(0001) growth of the 3D Volmer-Weber type. The α-Fe(110) X-ray diffraction peak showed a 1° full-width at half-maximum, indicating ≈20 nm grain sizes. A significant reduction in Fe atomic moment from its bulk value was observed for films thinner than 4 nm. Both GaN/Fe interface roughness and Fe film coercivity increased with Fe thickness, indicating a possible deterioration of Fe crystalline quality. Magnetic anisotropy was mainly uniaxial for all films while hexagonal anisotropies appeared for thicknesses higher than 3.7 nm.

  11. Iron-filled multi-walled carbon nanotubes for terahertz applications: effects of interfacial polarization, screening and anisotropy.

    PubMed

    Sedelnikova, O V; Korovin, E Yu; Dorozhkin, K V; Kanygin, M A; Arkhipov, V E; Shubin, Yu V; Zhuravlev, V A; Suslyaev, V I; Bulusheva, L G; Okotrub, A V

    2018-04-27

    Interface interactions in multicomponent nanoparticles can affect electromagnetic properties of an absorbing system. In this work, we investigate the electromagnetic response of multi-walled carbon nanotubes (MWCNTs) filled with iron-containing nanoparticles (ICNs) in the terahertz frequency range. MWCNTs with different iron content have been synthesized by aerosol-assisted catalytic chemical vapour deposition method from toluene containing a certain quantity of ferrocene used as a catalyst. According to the x-ray diffraction analysis, encapsulated ICNs were mainly in the form of iron carbide. Thin composite films were prepared from the iron-filled MWCNTs and polymethylmethacrylate (PMMA) by casting and stretching methods. The composites showed an enhanced permittivity and anisotropy in the transmittance spectra when iron content increased. This behaviour was related to the mechanism based on electrical conductivity and polarization of ICNs and ICN/MWCNT interfaces. Since terahertz field penetrates inside MWCNTs, the filling of their cavities can be a way of varying the electromagnetic properties of MWCNT-containing composites.

  12. Iron-filled multi-walled carbon nanotubes for terahertz applications: effects of interfacial polarization, screening and anisotropy

    NASA Astrophysics Data System (ADS)

    Sedelnikova, O. V.; Korovin, E. Yu; Dorozhkin, K. V.; Kanygin, M. A.; Arkhipov, V. E.; Shubin, Yu V.; Zhuravlev, V. A.; Suslyaev, V. I.; Bulusheva, L. G.; Okotrub, A. V.

    2018-04-01

    Interface interactions in multicomponent nanoparticles can affect electromagnetic properties of an absorbing system. In this work, we investigate the electromagnetic response of multi-walled carbon nanotubes (MWCNTs) filled with iron-containing nanoparticles (ICNs) in the terahertz frequency range. MWCNTs with different iron content have been synthesized by aerosol-assisted catalytic chemical vapour deposition method from toluene containing a certain quantity of ferrocene used as a catalyst. According to the x-ray diffraction analysis, encapsulated ICNs were mainly in the form of iron carbide. Thin composite films were prepared from the iron-filled MWCNTs and polymethylmethacrylate (PMMA) by casting and stretching methods. The composites showed an enhanced permittivity and anisotropy in the transmittance spectra when iron content increased. This behaviour was related to the mechanism based on electrical conductivity and polarization of ICNs and ICN/MWCNT interfaces. Since terahertz field penetrates inside MWCNTs, the filling of their cavities can be a way of varying the electromagnetic properties of MWCNT-containing composites.

  13. Sticking non-stick: Surface and Structure control of Diamond-like Carbon in Plasma Enhanced Chemical Vapour Deposition

    NASA Astrophysics Data System (ADS)

    Jones, B. J.; Nelson, N.

    2016-10-01

    This short review article explores the practical use of diamond-like carbon (DLC) produced by plasma enhanced chemical vapour deposition (PECVD). Using as an example issues relating to the DLC coating of a hand-held surgical device, we draw on previous works using atomic force microscopy, X-ray photoelectron spectroscopy, Raman spectroscopy, scanning electron microscopy, tensiometry and electron paramagnetic resonance. Utilising data from these techniques, we examine the surface structure, substrate-film interface and thin film microstructure, such as sp2/sp3 ratio (graphitic/diamond-like bonding ratio) and sp2 clustering. We explore the variations in parameters describing these characteristics, and relate these to the final device properties such as friction, wear resistance, and diffusion barrier integrity. The material and device characteristics are linked to the initial plasma and substrate conditions.

  14. Maxwell-Stefan diffusion: a framework for predicting condensed phase diffusion and phase separation in atmospheric aerosol

    NASA Astrophysics Data System (ADS)

    Fowler, Kathryn; Connolly, Paul J.; Topping, David O.; O'Meara, Simon

    2018-02-01

    The composition of atmospheric aerosol particles has been found to influence their micro-physical properties and their interaction with water vapour in the atmosphere. Core-shell models have been used to investigate the relationship between composition, viscosity and equilibration timescales. These models have traditionally relied on the Fickian laws of diffusion with no explicit account of non-ideal interactions. We introduce the Maxwell-Stefan diffusion framework as an alternative method, which explicitly accounts for non-ideal interactions through activity coefficients. e-folding time is the time it takes for the difference in surface and bulk concentration to change by an exponential factor and was used to investigate the interplay between viscosity and solubility and the effect this has on equilibration timescales within individual aerosol particles. The e-folding time was estimated after instantaneous increases in relative humidity to binary systems of water and an organic component. At low water mole fractions, viscous effects were found to dominate mixing. However, at high water mole fractions, equilibration times were more sensitive to a range in solubility, shown through the greater variation in e-folding times. This is the first time the Maxwell-Stefan framework has been applied to an atmospheric aerosol core-shell model and shows that there is a complex interplay between the viscous and solubility effects on aerosol composition that requires further investigation.

  15. Crystallographic analysis of ground and space thermostable T1 lipase crystal obtained via counter diffusion method approach.

    PubMed

    Mohamad Aris, Sayangku Nor Ariati; Thean Chor, Adam Leow; Mohamad Ali, Mohd Shukuri; Basri, Mahiran; Salleh, Abu Bakar; Raja Abd Rahman, Raja Noor Zaliha

    2014-01-01

    Three-dimensional structure of thermostable lipase is much sought after nowadays as it is important for industrial application mainly found in the food, detergent, and pharmaceutical sectors. Crystallization utilizing the counter diffusion method in space was performed with the aim to obtain high resolution diffracting crystals with better internal order to improve the accuracy of the structure. Thermostable T1 lipase enzyme has been crystallized in laboratory on earth and also under microgravity condition aboard Progress spacecraft to the ISS in collaboration with JAXA (Japanese Aerospace Exploration Agency). This study is conducted with the aims of improving crystal packing and structure resolution. The diffraction data set for ground grown crystal was collected to 1.3 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.40 Å, b = 80.95 Å, and c = 99.81 Å, whereas the diffraction data set for space grown crystal was collected to 1.1 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.31 Å, b = 80.85 Å, and c = 99.81 Å. The major difference between the two crystal growth systems is the lack of convection and sedimentation in microgravity environment resulted in the growth of much higher quality crystals of T1 lipase.

  16. Twinned or not twinned, that is the question: crystallization and preliminary crystallographic analysis of the 2F1(3)F1 module pair of human fibronectin.

    PubMed

    Rudiño-Piñera, Enrique; Schwarz-Linek, Ulrich; Potts, Jennifer R; Garman, Elspeth F

    2004-07-01

    Human fibronectin (Fn) is a large multidomain protein found in the extracellular matrix and plasma. It is involved in many cellular processes, including cell adhesion and migration during embryogenesis and wound healing. The ability to bind Fn is a characteristic that has been demonstrated for a number of pathogens. For Staphylococcus aureus and Streptococcus pyogenes in particular, Fn-binding bacterial proteins (FnBPs) have been shown to mediate not only bacterial adhesion to host cells but also the uptake of bacteria by the cells. FnBPs interact with the amino-terminal region of Fn, where five type I ((1-5)F1) Fn modules are located. Although the structures of two F1 module pairs have been determined by NMR, no X-ray structures have been reported. To explore the conformational interactions between modules and the binding properties of FnBPs, the (2)F1(3)F1 module pair was crystallized using the vapour-diffusion method at 298 K. 12 X-ray diffraction data sets have been collected: six on an in-house rotating anode (three native, one Pt derivative and two peptide-bound) and six at synchrotron-radiation sources (two native and four derivative). Following analysis of these data, some of which have very high multiplicity (up to 50), probable space-group assignments were made (P42(1)2, P4(1)2(1)2 or P4(3)2(1)2) and the possibly twinned nature of the crystals was investigated using six different tests. The results presented here suggest that the crystals are not twinned.

  17. Silicon etch with chromium ions generated by a filtered or non-filtered cathodic arc discharge

    PubMed Central

    Scopece, Daniele; Döbeli, Max; Passerone, Daniele; Maeder, Xavier; Neels, Antonia; Widrig, Beno; Dommann, Alex; Müller, Ulrich; Ramm, Jürgen

    2016-01-01

    Abstract The pre-treatment of substrate surfaces prior to deposition is important for the adhesion of physical vapour deposition coatings. This work investigates Si surfaces after the bombardment by energetic Cr ions which are created in cathodic arc discharges. The effect of the pre-treatment is analysed by X-ray diffraction, Rutherford backscattering spectroscopy, scanning electron microscopy and in-depth X-ray photoemission spectroscopy and compared for Cr vapour produced from a filtered and non-filtered cathodic arc discharge. Cr coverage as a function of ion energy was also predicted by TRIDYN Monte Carlo calculations. Discrepancies between measured and simulated values in the transition regime between layer growth and surface removal can be explained by the chemical reactions between Cr ions and the Si substrate or between the substrate surface and the residual gases. Simulations help to find optimum and more stable parameters for specific film and substrate combinations faster than trial-and-error procedure. PMID:27877854

  18. Highly efficient volume hologram multiplexing in thick dye-doped jelly-like gelatin.

    PubMed

    Katarkevich, Vasili M; Rubinov, Anatoli N; Efendiev, Terlan Sh

    2014-08-01

    Dye-doped jelly-like gelatin is a thick-layer self-developing photosensitive medium that allows single and multiplexed volume phase holograms to be successfully recorded using pulsed laser radiation. In this Letter, we present a method for multiplexed recording of volume holograms in a dye-doped jelly-like gelatin, which provides significant increase in their diffraction efficiency. The method is based on the recovery of the photobleached dye molecule concentration in the hologram recording zone of gel, thanks to molecule diffusion from other unexposed gel areas. As an example, an optical recording of a multiplexed hologram consisting of three superimposed Bragg gratings with mean values of the diffraction efficiency and angular selectivity of ∼75% and ∼21', respectively, is demonstrated by using the proposed method.

  19. In Situ Neutron Diffraction of Rare-Earth Phosphate Proton Conductors Sr/Ca-doped LaPO4 at Elevated Temperatures

    NASA Astrophysics Data System (ADS)

    Al-Wahish, Amal; Al-Binni, Usama; Bridges, C. A.; Huq, A.; Bi, Z.; Paranthaman, M. P.; Tang, S.; Kaiser, H.; Mandrus, D.

    Acceptor-doped lanthanum orthophosphates are potential candidate electrolytes for proton ceramic fuel cells. We combined neutron powder diffraction (NPD) at elevated temperatures up to 800° C , X-ray powder diffraction (XRD) and scanning electron microscopy (SEM) to investigate the crystal structure, defect structure, thermal stability and surface topography. NPD shows an average bond length distortion in the hydrated samples. We employed Quasi-Elastic Neutron Scattering (QENS) and electrochemical impedance spectroscopy (EIS) to study the proton dynamics of the rare-earth phosphate proton conductors 4.2% Sr/Ca-doped LaPO4. We determined the bulk diffusion and the self-diffusion coefficients. Our results show that QENS and EIS are probing fundamentally different proton diffusion processes. Supported by the U.S. Department of Energy.

  20. Determination of mass and heat transfer parameters during freeze-drying cycles of pharmaceutical products.

    PubMed

    Hottot, A; Vessot, S; Andrieu, J

    2005-01-01

    The principal aim of this study was to evaluate the water vapour mass transfer resistance of the dried layer and the vial heat transfer coefficient values of a pharmaceutical product during the primary drying period. First, overall vial heat transfer coefficient values, Kv, were determined by a gravimetric method based on pure ice sublimation experiments. Thus, it was possible to set up a map of the total heat flux received by each vial throughout the plate surface of our pilot scale freeze-dryer. Important heterogeneities were observed for the vials placed at the plate edges and for the vials placed at the center of the plate. As well, the same gravimetric method was also used to precisely determine the influence of main lyophilization operating parameters (shelf temperature and gas total pressure) or the vial types and sizes on these overall heat transfer coefficient values. A semi-empirical relationship as a function of total gas pressure was proposed. The transient method by pressure rise analysis (PRA method) after interrupting the water vapour flow between the sublimation chamber and the condenser, previously set up and validated in our laboratory, was then extensively used with an amorphous BSA-based formulation to identify the dried layer mass transfer resistance values, Rp, the ice front temperature, and the total heat transfer coefficient values, Kv, with or without annealing treatment. It was proved that this method gave accurate and coherent data only during the first half of the sublimation period when the totality of the vials of the set was still sublimating. Thus, this rapid method allowed estimation of, on line and in situ, the sublimation front temperature and the characterization of the morphology and structure of the freeze-dried layer, all along the first part of the sublimation period. The estimated sublimation temperatures shown by the PRA model were about 2 degrees C lower than the experimental values obtained using thermocouples inserted inside the vial, in accordance with previous data given by this method for similar freeze-drying conditions. As well, by using this method we could confirm the homogenization of the dried layer porous structure by annealing treatment after the freezing step. Furthermore, frozen matrix structure analysis (mean pore diameter) using optical microscopy and mass transfer modelling of water vapour by molecular diffusion (Knudsen regime) allowed, in some cases, to predict the experimental values of this overall mass transfer resistance directly related to the freeze-dried cake permeability.

  1. A field evaluation of a SO 2 passive sampler in tropical industrial and urban air

    NASA Astrophysics Data System (ADS)

    Cruz, Lícia P. S.; Campos, Vânia P.; Silva, Adriana M. C.; Tavares, Tania M.

    Passive samplers have been widely used for over 30 years in the measurement of personal exposure to vapours and gases in the workplace. These samplers have just recently been applied in the monitoring of ambient air, which presents concentrations that are normally much smaller than those found in occupational environments. The locally constructed passive sampler was based on gas molecular diffusion through static air layer. The design used minimizes particle interference and turbulent diffusion. After exposure, the SO 2 trapped in impregnated filters with Na 2CO 3 was extracted by means of an ultrasonic bath, for 15 min, using 1.0×10 -2 mol L -1 H 2O 2. It was determined as SO 4-2 by ion chromatography. The performance of the passive sampler was evaluated at different exposure periods, being applied in industrial and urban areas. Method precision as relative standard deviation for three simultaneously applied passive samplers was within 10%. Passive sampling, when compared to active monitoring methods under real conditions, used in urban and industrial areas, showed an overall accuracy of 15%. A statistical comparison with an active method was performed to demonstrate the validity of the passive method. Sampler capacity varied between 98 and 421 μg SO 2 m -3 for exposure periods of one month and one week, respectively, which allows its use in highly polluted areas.

  2. Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

    2010-11-12

    Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

  3. Crystallization and diffraction analysis of [beta]-N-acetylhexosaminidase from Aspergillus oryzae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vanek, Ondrej; Brynd, Jirí; Hofbauerová, Katerina

    2012-05-08

    Fungal {beta}-N-acetylhexosaminidases are enzymes that are used in the chemoenzymatic synthesis of biologically interesting oligosaccharides. The enzyme from Aspergillus oryzae was produced and purified from its natural source and crystallized using the hanging-drop vapor-diffusion method. Diffraction data from two crystal forms (primitive monoclinic and primitive tetragonal) were collected to resolutions of 3.2 and 2.4 {angstrom}, respectively. Electrophoretic and quantitative N-terminal protein-sequencing analyses confirmed that the crystals are formed by a complete biologically active enzyme consisting of a glycosylated catalytic unit and a noncovalently attached propeptide.

  4. Ultrafast electron diffraction pattern simulations using GPU technology. Applications to lattice vibrations.

    PubMed

    Eggeman, A S; London, A; Midgley, P A

    2013-11-01

    Graphical processing units (GPUs) offer a cost-effective and powerful means to enhance the processing power of computers. Here we show how GPUs can greatly increase the speed of electron diffraction pattern simulations by the implementation of a novel method to generate the phase grating used in multislice calculations. The increase in speed is especially apparent when using large supercell arrays and we illustrate the benefits of fast encoding the transmission function representing the atomic potentials through the simulation of thermal diffuse scattering in silicon brought about by specific vibrational modes. © 2013 Elsevier B.V. All rights reserved.

  5. Thermal evaporation and condensation synthesis of metallic Zn layered polyhedral microparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khan, Waheed S.; Cao, Chuanbao, E-mail: cbcao@bit.edu.cn; Usman, Zahid

    2011-12-15

    Highlights: Black-Right-Pointing-Pointer Zn polyhedral microparticles prepared by thermal evaporation and condensation route. Black-Right-Pointing-Pointer Vapour-solid process based growth model governs the formation of Zn microparticles. Black-Right-Pointing-Pointer A strong PL emission band is observed at 369 nm in UV region. Black-Right-Pointing-Pointer Radiative recombination of electrons in the s, p conduction band and the holes in the d bands causes this emission. -- Abstract: Metallic zinc layered polyhedral microparticles have been fabricated by thermal evaporation and condensation technique using zinc as precursor at 750 Degree-Sign C for 120 min and NH{sub 3} as a carrier gas. The zinc polyhedral microparticles with oblate sphericalmore » shape are observed to be 2-9 {mu}m in diameter along major axes and 1-7 {mu}m in thickness along minor axes. The structural, compositional and morphological characterizations were performed by X-ray diffraction (XRD), energy dispersive X-ray spectroscopy (EDS), scanning electron microscopy (SEM), transmission electron microscopy (TEM) and selected area electron diffraction (SAED). A vapour-solid (VS) mechanism based growth model has been proposed for the formation of Zn microparticles. Room temperature photoluminescence (PL) emission spectrum of the product exhibited a strong emission band at 369 nm attributed to the radiative recombination of electrons in the s, p conduction band near Fermi surface and the holes in the d bands generated by the optical excitation.« less

  6. Towards metal chalcogenide nanowire-based colour-sensitive photodetectors

    NASA Astrophysics Data System (ADS)

    Butanovs, Edgars; Butikova, Jelena; Zolotarjovs, Aleksejs; Polyakov, Boris

    2018-01-01

    In recent years, nanowires have been shown to exhibit high photosensitivities, and, therefore are of interest in a variety of optoelectronic applications, for example, colour-sensitive photodetectors. In this study, we fabricated two-terminal PbS, In2S3, CdS and ZnSe single-nanowire photoresistor devices and tested applicability of these materials under the same conditions for colour-sensitive (405 nm, 532 nm and 660 nm) light detection. Nanowires were grown via atmospheric pressure chemical vapour transport method, their structure and morphology were characterized by scanning and transmission electron microscopy (SEM and TEM), X-ray diffraction (XRD), and optical properties were investigated with photoluminescence (PL) measurements. Single-nanowire photoresistors were fabricated via in situ nanomanipulations inside SEM, using focused ion beam (FIB) cutting and electron-beam-assisted platinum welding; their current-voltage characteristics and photoresponse values were measured. Applicability of the tested nanowire materials for colour-sensitive light detection is discussed.

  7. A new technique to assess dermal absorption of volatile chemicals in vitro by thermal gravimetric analysis.

    PubMed

    Rauma, Matias; Isaksson, Tina S; Johanson, Gunnar

    2006-10-01

    Potential health hazards of dermal exposure, variability in reported dermal absorption rates and potential losses from the skin by evaporation indicate a need for a simple, inexpensive and standardized procedure to measure dermal absorption and desorption of chemical substances. The aim of this study was to explore the possibility to measure dermal absorption and desorption of volatile chemicals using a new gravimetric technique, namely thermal gravimetric analysis (TGA), and trypsinated stratum corneum from pig. Changes in skin weight were readily detected before, during and after exposure to vapours of water, 2-propanol, methanol and toluene. The shape and height of the weight curves differed between the four chemicals, reflecting differences in diffusivity and partial pressure and skin:air partitioning, respectively. As the skin weight is highly sensitive to the partial pressure of volatile chemicals, including water, this technique requires carefully controlled conditions with respect to air flow, temperature, chemical vapour generation and humidity. This new technique may help in the assessment of dermal uptake of volatile chemicals. Only a small piece of skin is needed and skin integrity is not necessary, facilitating the use of human samples. The high resolution weight-time curves obtained may also help to elucidate the characteristics of absorption, desorption and diffusion of chemicals in skin.

  8. Crystallization and preliminary X-ray diffraction study of recombinant adenine phosphoribosyltransferase from the thermophilic bacterium Thermus thermophilus strain HB27

    NASA Astrophysics Data System (ADS)

    Sinitsyna, E. V.; Timofeev, V. I.; Tuzova, E. S.; Kostromina, M. A.; Murav'eva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2017-07-01

    Adenine phosphoribosyltransferase (APRT) belongs to the type I phosphoribosyltransferase family and catalyzes the formation of adenosine monophosphate via transfer of the 5-phosphoribosyl group from phosphoribosyl pyrophosphate to the nitrogen atom N9 of the adenine base. Proteins of this family are involved in a salvage pathway of nucleotide synthesis, thus providing purine base utilization and maintaining the optimal level of purine bases in the body. Adenine phosphoribosyltransferase from the extremely thermophilic Thermus thermophilus strain HB27 was produced using a highly efficient E. coli producer strain and was then purified by affinity and gel-filtration chromatography. This enzyme was successfully employed as a catalyst for the cascade biosynthesis of biologically important nucleotides. The screening of crystallization conditions for recombinant APRT from T. thermophilus HB27 was performed in order to determine the enzyme structure by X-ray diffraction. The crystallization conditions, which were found by the vapor-diffusion technique, were then optimized to apply the counter-diffusion technique. The crystals of the enzyme were grown by the capillary counter-diffusion method. The crystals belong to sp. gr. P1211 and have the following unitcell parameters: a = 69.86 Å, b = 82.16 Å, c = 91.39 Å, α = γ = 90°, β = 102.58°. The X-ray diffraction data set suitable for the determination of the APRT structure at 2.6 Å resolution was collected from the crystals at the SPring-8 synchrotron facility (Japan).

  9. Medical cannabis use in Canada: vapourization and modes of delivery.

    PubMed

    Shiplo, Samantha; Asbridge, Mark; Leatherdale, Scott T; Hammond, David

    2016-10-29

    The mode of medical cannabis delivery-whether cannabis is smoked, vapourized, or consumed orally-may have important implications for its therapeutic efficacy and health risks. However, there is very little evidence on current patterns of use among Canadian medical cannabis users, particularly with respect to modes of delivery. The current study examined modes of medical cannabis delivery following regulatory changes in 2014 governing how Canadians access medical cannabis. A total of 364 approved adult Canadian medical cannabis users completed an online cross-sectional survey between April and June 2015. The survey examined patterns of medical cannabis use, modes of delivery used, and reasons for use. Participants were recruited through a convenience sample from nine Health Canada licensed producers. Using a vapourizer was the most popular mode of delivery for medical cannabis (53 %), followed by smoking a joint (47 %). The main reason for using a vapourizer was to reduce negative health consequences associated with smoking. A majority of current vapourizer users reported using a portable vapourizer (67.2 %), followed by a stationary vapourizer (41.7 %), and an e-cigarette or vape pen (19.3 %). Current use of a vapourizer was associated with fewer respiratory symptoms (AOR = 1.28, 95 % CI 1.05-1.56, p = 0.01). The findings suggest an increase in the popularity of vapourizers as the primary mode of delivery among approved medical users. Using vapourizers has the potential to prevent some of the adverse respiratory health consequences associated with smoking and may serve as an effective harm reduction method. Monitoring implications of such current and future changes to medical cannabis regulations may be beneficial to policymakers.

  10. Tuning crystalline ordering by annealing and additives to study its effect on exciton diffusion in a polyalkylthiophene copolymer.

    PubMed

    Chowdhury, Mithun; Sajjad, Muhammad T; Savikhin, Victoria; Hergué, Noémie; Sutija, Karina B; Oosterhout, Stefan D; Toney, Michael F; Dubois, Philippe; Ruseckas, Arvydas; Samuel, Ifor D W

    2017-05-17

    The influence of various processing conditions on the singlet exciton diffusion is explored in films of a conjugated random copolymer poly-(3-hexylthiophene-co-3-dodecylthiophene) (P3HT-co-P3DDT) and correlated with the degree of crystallinity probed by grazing incidence X-ray scattering and with exciton bandwidth determined from absorption spectra. The exciton diffusion coefficient is deduced from exciton-exciton annihilation measurements and is found to increase by more than a factor of three when thin films are annealed using CS 2 solvent vapour. A doubling of exciton diffusion coefficient is observed upon melt annealing at 200 °C and the corresponding films show about 50% enhancement in the degree of crystallinity. In contrast, films fabricated from polymer solutions containing a small amount of either solvent additive or nucleating agent show a decrease in exciton diffusion coefficient possibly due to formation of traps for excitons. Our results suggest that the enhancement of exciton diffusivity occurs because of increased crystallinity of alkyl-stacking and longer conjugation of aggregated chains which reduces the exciton bandwidth.

  11. Simulations of molecular diffusion in lattices of cells: insights for NMR of red blood cells.

    PubMed Central

    Regan, David G; Kuchel, Philip W

    2002-01-01

    The pulsed field-gradient spin-echo (PGSE) nuclear magnetic resonance (NMR) experiment, conducted on a suspension of red blood cells (RBC) in a strong magnetic field yields a q-space plot consisting of a series of maxima and minima. This is mathematically analogous to a classical optical diffraction pattern. The method provides a noninvasive and novel means of characterizing cell suspensions that is sensitive to changes in cell shape and packing density. The positions of the features in a q-space plot characterize the rate of exchange across the membrane, cell dimensions, and packing density. A diffusion tensor, containing information regarding the diffusion anisotropy of the system, can also be derived from the PGSE NMR data. In this study, we carried out Monte Carlo simulations of diffusion in suspensions of "virtual" cells that had either biconcave disc (as in RBC) or oblate spheroid geometry. The simulations were performed in a PGSE NMR context thus enabling predictions of q-space and diffusion tensor data. The simulated data were compared with those from real PGSE NMR diffusion experiments on RBC suspensions that had a range of hematocrit values. Methods that facilitate the processing of q-space data were also developed. PMID:12080109

  12. Simulations of molecular diffusion in lattices of cells: insights for NMR of red blood cells.

    PubMed

    Regan, David G; Kuchel, Philip W

    2002-07-01

    The pulsed field-gradient spin-echo (PGSE) nuclear magnetic resonance (NMR) experiment, conducted on a suspension of red blood cells (RBC) in a strong magnetic field yields a q-space plot consisting of a series of maxima and minima. This is mathematically analogous to a classical optical diffraction pattern. The method provides a noninvasive and novel means of characterizing cell suspensions that is sensitive to changes in cell shape and packing density. The positions of the features in a q-space plot characterize the rate of exchange across the membrane, cell dimensions, and packing density. A diffusion tensor, containing information regarding the diffusion anisotropy of the system, can also be derived from the PGSE NMR data. In this study, we carried out Monte Carlo simulations of diffusion in suspensions of "virtual" cells that had either biconcave disc (as in RBC) or oblate spheroid geometry. The simulations were performed in a PGSE NMR context thus enabling predictions of q-space and diffusion tensor data. The simulated data were compared with those from real PGSE NMR diffusion experiments on RBC suspensions that had a range of hematocrit values. Methods that facilitate the processing of q-space data were also developed.

  13. Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis.

    PubMed

    Gaur, Vineet; Sethi, Dhruv K; Salunke, Dinakar M

    2008-01-01

    Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presence of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P4(1) (or P4(3)), with unit-cell parameters a = b = 150.7, c = 164.9 A.

  14. Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis

    PubMed Central

    Gaur, Vineet; Sethi, Dhruv K.; Salunke, Dinakar M.

    2008-01-01

    Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presence of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P41 (or P43), with unit-cell parameters a = b = 150.7, c = 164.9 Å. PMID:18097098

  15. Electrophoretically deposited multiwalled carbon nanotube based amperometric genosensor for E.coli detection

    NASA Astrophysics Data System (ADS)

    Bhardwaj, Hema; Solanki, Shipra; Sumana, Gajjala

    2016-04-01

    This work reports on a sensitive and selective genosensor fabrication method for Escherichia coli (E.coli) detection. The functionalized multiwalled carbon nanotubes (MWCNT) synthesized via chemical vapour deposition have been deposited electrophoretically onto indium tin oxide coated glass surface and have been utilized as matrices for the covalent immobilization of E.coli specific probe oligonucleotide that was identified from the 16s rRNA coding region of the E.coli genome. This fabricated functionalized MWCNT based platform sought to provide improved fundamental characteristics to electrode interface in terms of electro-active surface area and diffusion coefficient. Electrochemical cyclic voltammetry revealed that this genosensor exhibits a linear response to complementary DNA in the concentration range of 10-7 to 10-12 M with a detection limit of 1×10-12 M.

  16. Long distance spin communication in chemical vapour deposited graphene

    NASA Astrophysics Data System (ADS)

    Kamalakar, M. Venkata; Groenveld, Christiaan; Dankert, André; Dash, Saroj P.

    2015-04-01

    Graphene is an ideal medium for long-distance spin communication in future spintronic technologies. So far, the prospect is limited by the smaller sizes of exfoliated graphene flakes and lower spin transport properties of large-area chemical vapour-deposited (CVD) graphene. Here we demonstrate a high spintronic performance in CVD graphene on SiO2/Si substrate at room temperature. We show pure spin transport and precession over long channel lengths extending up to 16 μm with a spin lifetime of 1.2 ns and a spin diffusion length ~6 μm at room temperature. These spin parameters are up to six times higher than previous reports and highest at room temperature for any form of pristine graphene on industrial standard SiO2/Si substrates. Our detailed investigation reinforces the observed performance in CVD graphene over wafer scale and opens up new prospects for the development of lateral spin-based memory and logic applications.

  17. Growth and microtopographic study of CuInSe{sub 2} single crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chauhan, Sanjaysinh M.; Chaki, Sunil, E-mail: sunilchaki@yahoo.co.in; Deshpande, M. P.

    2016-05-23

    The CuInSe{sub 2} single crystals were grown by chemical vapour transport (CVT) technique using iodine as transporting agent. The elemental composition of the as-grown CuInSe{sub 2} single crystals was determined by energy dispersive analysis of X-ray (EDAX). The unit cell crystal structure and lattice parameters were determined by X-ray diffraction (XRD) technique. The surface microtopographic study of the as-grown CuInSe{sub 2} single crystals surfaces were done to study the defects, growth mechanism, etc. of the CVT grown crystals.

  18. Numerical analysis of fume formation mechanism in arc welding

    NASA Astrophysics Data System (ADS)

    Tashiro, Shinichi; Zeniya, Tasuku; Yamamoto, Kentaro; Tanaka, Manabu; Nakata, Kazuhiro; Murphy, Anthony B.; Yamamoto, Eri; Yamazaki, Kei; Suzuki, Keiichi

    2010-11-01

    In order to clarify the fume formation mechanism in arc welding, a quantitative investigation based on the knowledge of interaction among the electrode, arc and weld pool is indispensable. A fume formation model consisting of a heterogeneous condensation model, a homogeneous nucleation model and a coagulation model has been developed and coupled with the GTA or GMA welding model. A series of processes from evaporation of metal vapour to fume formation from the metal vapour was totally investigated by employing this simulation model. The aim of this paper is to visualize the fume formation process and clarify the fume formation mechanism theoretically through a numerical analysis. Furthermore, the reliability of the simulation model was also evaluated through a comparison of the simulation result with the experimental result. As a result, it was found that the size of the secondary particles consisting of small particles with a size of several tens of nanometres reached 300 nm at maximum and the secondary particle was in a U-shaped chain form in helium GTA welding. Furthermore, it was also clarified that most part of the fume was produced in the downstream region of the arc originating from the metal vapour evaporated mainly from the droplet in argon GMA welding. The fume was constituted by particles with a size of several tens of nanometres and had similar characteristics to that of GTA welding. On the other hand, if the metal transfer becomes unstable and the metal vapour near the droplet diffuses directly towards the surroundings of the arc not getting into the plasma flow, the size of the particles reaches several hundred nanometres.

  19. Recent results and new hardware developments for protein crystal growth in microactivity

    NASA Technical Reports Server (NTRS)

    Delucas, L. J.; Long, M. M.; Moore, K. M.; Smith, C.; Carson, M.; Narayana, S. V. L.; Carter, D.; Clark, A. D., Jr.; Nanni, R. G.; Ding, J.

    1993-01-01

    Protein crystal growth experiments have been performed on 16 space shuttle missions since April, 1985. The initial experiments utilized vapor diffusion crystallization techniques similar to those used in laboratories for earth-based experiments. More recent experiments have utilized temperature induced crystallization as an alternative method for growing high quality protein crystals in microgravity. Results from both vapor diffusion and temperature induced crystallization experiments indicate that proteins grown in microgravity may be larger, display more uniform morphologies, and yield diffraction data to significantly higher resolutions than the best crystals of these proteins grown on earth.

  20. The physics of confined flow and its application to water leaks, water permeation and water nanoflows: a review.

    PubMed

    Lei, Wenwen; Rigozzi, Michelle K; McKenzie, David R

    2016-02-01

    This review assesses the current state of understanding of the calculation of the rate of flow of gases, vapours and liquids confined in channels, in porous media and in permeable materials with an emphasis on the flow of water and its vapour. One motivation is to investigate the relation between the permeation rate of moisture and that of a noncondensable test gas such as helium, another is to assist in unifying theory and experiment across disparate fields. Available theories of single component ideal gas flows in channels of defined geometry (cylindrical, rectangular and elliptical) are described and their predictions compared with measurement over a wide range of conditions defined by the Knudsen number. Theory for two phase flows is assembled in order to understand the behaviour of four standard water leak configurations: vapour, slug, Washburn and liquid flow, distinguished by the number and location of phase boundaries (menisci). Air may or may not be present as a background gas. Slip length is an important parameter that greatly affects leak rates. Measurements of water vapour flows confirm that water vapour shows ideal gas behaviour. Results on carbon nanotubes show that smooth walls may lead to anomalously high slip lengths arising from the properties of 'confined' water. In porous media, behaviour can be matched to the four standard leaks. Traditional membrane permeation models consider that the permeant dissolves, diffuses and evaporates at the outlet side, ideas we align with those from channel flow. Recent results on graphite oxide membranes show examples where helium which does not permeate while at the same time moisture is almost unimpeded, again a result of confined water. We conclude that while there is no a priori relation between a noncondensable gas flow and a moisture flow, measurements using helium will give results within two orders of magnitude of the moisture flow rate, except in the case where there is anomalous slip or confined water, when moisture specific measurements are essential.

  1. Regolith-atmosphere exchange of water in Mars' recent past

    NASA Astrophysics Data System (ADS)

    Steele, Liam J.; Balme, Matthew R.; Lewis, Stephen R.

    2017-03-01

    We investigate the exchange of water vapour between the regolith and atmosphere of Mars, and how it varies with different orbital parameters, atmospheric dust contents and surface water ice reservoirs. This is achieved through the coupling of a global circulation model (GCM) and a regolith diffusion model. GCM simulations are performed for hundreds of Mars years, with additional one-dimensional simulations performed for 50 kyr. At obliquities ɛ =15∘ and 30°, the thermal inertia and albedo of the regolith have more control on the subsurface water distribution than changes to the eccentricity or solar longitude of perihelion. At ɛ =45∘ , atmospheric water vapour abundances become much larger, allowing stable subsurface ice to form in the tropics and mid-latitudes. The circulation of the atmosphere is important in producing the subsurface water distribution, with increased water content in various locations due to vapour transport by topographically-steered flows and stationary waves. As these circulation patterns are due to topographic features, it is likely the same regions will also experience locally large amounts of subsurface water at different epochs. The dustiness of the atmosphere plays an important role in the distribution of subsurface water, with a dusty atmosphere resulting in a wetter water cycle and increased stability of subsurface ice deposits.

  2. Ge-rich islands grown on patterned Si substrates by low-energy plasma-enhanced chemical vapour deposition.

    PubMed

    Bollani, M; Chrastina, D; Fedorov, A; Sordan, R; Picco, A; Bonera, E

    2010-11-26

    Si(1-x)Ge(x) islands grown on Si patterned substrates have received considerable attention during the last decade for potential applications in microelectronics and optoelectronics. In this work we propose a new methodology to grow Ge-rich islands using a chemical vapour deposition technique. Electron-beam lithography is used to pre-pattern Si substrates, creating material traps. Epitaxial deposition of thin Ge films by low-energy plasma-enhanced chemical vapour deposition then leads to the formation of Ge-rich Si(1-x)Ge(x) islands (x > 0.8) with a homogeneous size distribution, precisely positioned with respect to the substrate pattern. The island morphology was characterized by atomic force microscopy, and the Ge content and strain in the islands was studied by μRaman spectroscopy. This characterization indicates a uniform distribution of islands with high Ge content and low strain: this suggests that the relatively high growth rate (0.1 nm s(-1)) and low temperature (650 °C) used is able to limit Si intermixing, while maintaining a long enough adatom diffusion length to prevent nucleation of islands outside pits. This offers the novel possibility of using these Ge-rich islands to induce strain in a Si cap.

  3. The ESA DUE GlobVapour Project

    NASA Astrophysics Data System (ADS)

    Schröder, M.; ESA Due Globvapour Project Team

    2010-12-01

    The European Space Agency (ESA) Data User Element (DUE) project series aims at bridging the gap between research projects and the sustainable provision of Earth Observation (EO) climate data products at an information level that fully responds to the operational needs of user communities. The ultimate objective of GlobVapour is to provide long-term coherent water vapour data sets exploiting the synergistic capabilities of different EO missions aiming at improved accuracies and enhanced temporal and spatial sampling better than those provided by the single sources. The project seeks to utilize the increasing potential of the synergistic capabilities of past, existing and upcoming satellite missions (ERS-1 and -2, ENVISAT, METOP, MSG as well as relevant non-European missions and in-situ data) in order to meet the increasing needs for coherent long-term water vapour datasets required by the scientific community. GlobVapour develops, validates and applies novel water vapour climate data sets derived from various sensors. More specifically, the primary objectives of the GlobVapour project are: 1)The development of multi-annual global water vapour data sets inclusive of error estimates based on carefully calibrated and inter-calibrated radiances. 2)The validation of the water vapour products against ground based, airborne and other satellite based measurements. 3) The provision of an assessment of the quality of different IASI water vapour profile algorithms developed by the project partners and other groups. 4) The provision of a complete processing system that can further strengthen operational production of the developed products. 5) A demonstration of the use of the products in the field of climate modelling, including applying alternative ways of climate model validation using forward radiation operators. 6) The promotion of the strategy of data set construction and the data sets themselves to the global research and operational community. The ultimate goal of the DUE GlobVapour project is the preparation of recognised data sets and successful concepts that can be used to ensure a sustainable provision of such data from operational entities such as the European Organisation for the Exploitation of Meteorological Satellites (EUMETSAT) Satellite Application Facility (SAF) network. Key scientific questions which GlobVapour data can contribute to are climate monitoring and attribution, assimilation of different water vapour datasets to form a consistent analysis, model process studies, evaluation of in-situ water vapour measurements, validation of climate models and reanalyses, assessing the relationship between water vapour and dynamics, research and development for operational applications and input to atmospheric reanalyses. This presentation will introduce the GlobVapour project and concept as well as the products which are the global total column water vapour (TCWV) time series from a combination of MERIS and SSM/I as well as TCWV data sets derived from the GOME/SCIAMACHY/GOME-2 and the (A)ATSR instruments. A shorter time series of water vapour profiles will be derived from a combination of IASI and SEVIRI. The retrieval and combination methods as well as first validation results will also be discussed.

  4. Preliminary crystallographic analysis of the major capsid protein P2 of the lipid-containing bacteriophage PM2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abrescia, Nicola G. A.; Kivelä, Hanna M.; Grimes, Jonathan M.

    2005-08-01

    The viral capsid protein P2 of bacteriophage PM2 has been crystallized. Preliminary X-ray analysis demonstrates the position and orientation of the two trimers in the asymmetric unit. PM2 (Corticoviridae) is a dsDNA bacteriophage which contains a lipid membrane beneath its icosahedral capsid. In this respect it resembles bacteriophage PRD1 (Tectiviridae), although it is not known whether the similarity extends to the detailed molecular architecture of the virus, for instance the fold of the major coat protein P2. Structural analysis of PM2 has been initiated and virus-derived P2 has been crystallized by sitting-nanodrop vapour diffusion. Crystals of P2 have been obtainedmore » in space group P2{sub 1}2{sub 1}2, with two trimers in the asymmetric unit and unit-cell parameters a = 171.1, b = 78.7, c = 130.1 Å. The crystals diffract to 4 Å resolution at the ESRF BM14 beamline (Grenoble, France) and the orientation of the non-crystallographic threefold axes, the spatial relationship between the two trimers and the packing of the trimers within the unit cell have been determined. The trimers form tightly packed layers consistent with the crystal morphology, possibly recapitulating aspects of the arrangement of subunits in the virus.« less

  5. Alkaline fuel cell: carbon nanobeads coated with metal catalyst over porous ceramic for hydrogen electrode

    NASA Astrophysics Data System (ADS)

    Chatterjee, A. K.; Sharon, Maheshwar; Banerjee, Rangan

    The development of a hydrogen electrode using a porous ceramic coated with carbon nanobeads for an alkaline fuel cell (AFC) is reported. This electrode can provide necessary strength and porosity to enable hydrogen to diffuse without allowing electrolyte to percolate inside the electrode. Various catalysts (Pt, Ni, Co and Fe) are electrochemically dispersed over the carbon nanobeads to examine their performance in the alkaline fuel cell. Turpentine oil has been used as a precursor for preparing the carbon nanobeads by a chemical vapour deposition technique. Scanning electron microscopic and transmission electron microscopic images show that the carbon nanobeads have sizes between 500 and 650 nm and are spread uniformly over the entire ceramic substrate. X-ray diffraction (XRD) patterns indicate that the nanobeads are graphitic in nature. Thus, the electrode is highly conductive. The current-voltage characteristics and chronopotentiometry of a half cell (i.e. hydrogen electrode coated with different electrocatalysts) and a full cell (using both hydrogen and oxygen electrodes) with 30% KOH solution are measured. About 93% of the theoretical hydrogen dissociation voltage is obtained with Ni and Pt catalyst. All other metals (Co and Fe) give a lower voltage. Ni-coated carbon nanobeads deposited over a ceramic oxide can be used in place of Raney nickel electrode as their characteristics are similar to those of a platinum electrode.

  6. Cloning, expression, purification, crystallization and preliminary X-ray characterization of the full-length single-stranded DNA-binding protein from the hyperthermophilic bacterium Aquifex aeolicus.

    PubMed

    Clarke, David J; Northey, Christopher G; Mack, Lynsey A; McNae, Iain W; Alexeev, Dmitriy; Sawyer, Lindsay; Campopiano, Dominic J

    2004-11-01

    Single-stranded DNA-binding (SSB) proteins stabilize single-stranded DNA, which is exposed by separation of the duplex during DNA replication, recombination and repair. The SSB protein from the hyperthermophile Aquifex aeolicus has been overexpressed in Escherichia coli, purified and characterized and crystals of the full-length protein (147 amino acids; M(r) 17 131.20) have been grown by vapour diffusion from ammonium sulfate pH 7.5 in both the absence and presence of ssDNA [dT(pT)(68)]. All crystals diffract to around 2.9 A resolution and those without bound DNA (native) belong to space group P2(1), with two tetramers in the asymmetric unit and unit-cell parameters a = 80.97, b = 73.40, c = 109.76 A, beta = 95.11 degrees . Crystals containing DNA have unit-cell parameters a = 108.65, b = 108.51, c = 113.24 A and could belong to three closely related space groups (I222, I2(1)2(1)2(1) or I4(1)) with one tetramer in the asymmetric unit. Electrospray mass spectrometry of the crystals confirmed that the protein was intact. Molecular replacement with a truncated E. coli SSB structure has revealed the position of the molecules in the unit cell and refinement of both native and DNA-bound forms is under way.

  7. Structure and Refinement of Ordered Aromatic Heterocyclic Polymers by Diffraction Methods: Application of Results to Electro-Optic Phenomena.

    DTIC Science & Technology

    1988-02-01

    0 396 3.93 2248 2528 C25 0.111 -0.18 0495 1 1 6 3.42 341 496 356 C26 -0.011 0.107 0.624 2 I 3 3.09 3.10 1075 563 C2’ -0083 -0.104 0.630 0 2 0 298 298...crystalline material. The diffuseness of diffraction maxima, especially along the meridian, and the streaking visible along the hkl and hk2 layer lines are...3 . The measured density obtained by flotation in a cyclohexane/carbon tetrachloride mixture is 1.46 g cm-3 . The systematic absences ( hkl , h+k odd

  8. Bulk synthesis of monodisperse magnetic FeNi3 nanopowders by flow levitation method.

    PubMed

    Chen, Shanjun; Chen, Yan; Kang, Xiaoli; Li, Song; Tian, Yonghong; Wu, Weidong; Tang, Yongjian

    2013-10-01

    In this work, a novel bulk synthesis method for monodisperse FeNi3 nanoparticles was developed by flow levitation method (FL). The Fe and Ni vapours ascending from the high temperature levitated droplet was condensed by cryogenic Ar gas under atmospheric pressure. X-ray diffraction was used to identify and characterize the crystal phase of prepared powders exhibiting a FeNi3 phase. The morphology and size of nanopowders were observed by transmission electron microscopy (TEM). The chemical composition of the nanoparticles was determined with energy dispersive spectrometer (EDS). The results indicated that the FeNi3 permalloy powders are nearly spherical-shaped with diameter about 50-200 nm. Measurement of the magnetic property of nanopowders by a superconducting quantum interference device (SQUID, Quantum Design MPMS-7) showed a symmetric hysteresis loop of ferromagnetic behavior with coercivity of 220 Oe and saturation magnetization of 107.17 emu/g, at 293 K. At 5 K, the obtained saturation magnetization of the sample was 102.16 emu/g. The production rate of FeNi3 nanoparticles was estimated to be about 6 g/h. This method has great potential in mass production of FeNi3 nannoparticles.

  9. Eucalyptus essential oil as a natural food preservative: in vivo and in vitro antiyeast potential.

    PubMed

    Tyagi, Amit Kumar; Bukvicki, Danka; Gottardi, Davide; Tabanelli, Giulia; Montanari, Chiara; Malik, Anushree; Guerzoni, Maria Elisabetta

    2014-01-01

    In this study, the application of eucalyptus essential oil/vapour as beverages preservative is reported. The chemical composition of eucalyptus oil was determined by gas chromatography-mass spectrometry (GC-MS) and solid phase microextraction GC-MS (SPME/GC-MS) analyses. GC-MS revealed that the major constituents were 1,8-cineole (80.5%), limonene (6.5%), α-pinene (5%), and γ-terpinene (2.9%) while SPME/GC-MS showed a relative reduction of 1,8-cineole (63.9%) and an increase of limonene (13.8%), α-pinene (8.87%), and γ-terpinene (3.98%). Antimicrobial potential of essential oil was initially determined in vitro against 8 different food spoilage yeasts by disc diffusion, disc volatilization, and microdilution method. The activity of eucalyptus vapours was significantly higher than the eucalyptus oil. Minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) varied from 0.56 to 4.50 mg/mL and from 1.13 to 9 mg/mL, respectively. Subsequently, the combined efficacy of essential oil and thermal treatment were used to evaluate the preservation of a mixed fruit juice in a time-dependent manner. These results suggest eucalyptus oil as a potent inhibitor of food spoilage yeasts not only in vitro but also in a real food system. Currently, this is the first report that uses eucalyptus essential oil for fruit juice preservation against food spoiling yeast.

  10. Eucalyptus Essential Oil as a Natural Food Preservative: In Vivo and In Vitro Antiyeast Potential

    PubMed Central

    Bukvicki, Danka; Gottardi, Davide; Malik, Anushree; Guerzoni, Maria Elisabetta

    2014-01-01

    In this study, the application of eucalyptus essential oil/vapour as beverages preservative is reported. The chemical composition of eucalyptus oil was determined by gas chromatography-mass spectrometry (GC-MS) and solid phase microextraction GC-MS (SPME/GC-MS) analyses. GC-MS revealed that the major constituents were 1,8-cineole (80.5%), limonene (6.5%), α-pinene (5%), and γ-terpinene (2.9%) while SPME/GC-MS showed a relative reduction of 1,8-cineole (63.9%) and an increase of limonene (13.8%), α-pinene (8.87%), and γ-terpinene (3.98%). Antimicrobial potential of essential oil was initially determined in vitro against 8 different food spoilage yeasts by disc diffusion, disc volatilization, and microdilution method. The activity of eucalyptus vapours was significantly higher than the eucalyptus oil. Minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) varied from 0.56 to 4.50 mg/mL and from 1.13 to 9 mg/mL, respectively. Subsequently, the combined efficacy of essential oil and thermal treatment were used to evaluate the preservation of a mixed fruit juice in a time-dependent manner. These results suggest eucalyptus oil as a potent inhibitor of food spoilage yeasts not only in vitro but also in a real food system. Currently, this is the first report that uses eucalyptus essential oil for fruit juice preservation against food spoiling yeast. PMID:25177704

  11. Crystallization of Membrane Proteins by Vapor Diffusion

    PubMed Central

    Delmar, Jared A.; Bolla, Jani Reddy; Su, Chih-Chia; Yu, Edward W.

    2016-01-01

    X-ray crystallography remains the most robust method to determine protein structure at the atomic level. However, the bottlenecks of protein expression and purification often discourage further study. In this chapter, we address the most common problems encountered at these stages. Based on our experiences in expressing and purifying antimicrobial efflux proteins, we explain how a pure and homogenous protein sample can be successfully crystallized by the vapor diffusion method. We present our current protocols and methodologies for this technique. Case studies show step-by-step how we have overcome problems related to expression and diffraction, eventually producing high quality membrane protein crystals for structural determinations. It is our hope that a rational approach can be made of the often anecdotal process of membrane protein crystallization. PMID:25950974

  12. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

    2017-01-15

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample,more » which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.« less

  13. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    NASA Astrophysics Data System (ADS)

    Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S.; Kuranova, I. P.

    2017-01-01

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus ( T. th HB27) has high thermal stability and shows maximum activity at 75°C, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P21 and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.

  14. Two-dimensional simulation of holographic data storage medium for multiplexed recording.

    PubMed

    Toishi, Mitsuru; Takeda, Takahiro; Tanaka, Kenji; Tanaka, Tomiji; Fukumoto, Atsushi; Watanabe, Kenjiro

    2008-02-18

    In this paper, we propose a new analysis model for photopolymer recording processes that calculate the two-dimensional refractive index distribution of multiplexed holograms. For the simulation of the photopolymer medium, time evolution of monomer diffusion and polymerization need to be calculated simultaneously. The distribution of the refractive index inside the medium is induced by these processes. By evaluating the refractive index pattern on each layer, the diffraction beams from the multiplexed hologram can be read out by beam propagation method (BPM). This is the first paper to determine the diffraction beam from a multiplexed hologram in a simulated photopolymer medium process. We analyze the time response of the multiplexed hologram recording processes in the photopolymer, and estimate the degradation of diffraction efficiency with multiplexed recording. This work can greatly contribute to understanding the process of hologram recording.

  15. A dilute Cu(Ni) alloy for synthesis of large-area Bernal stacked bilayer graphene using atmospheric pressure chemical vapour deposition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Madito, M. J.; Bello, A.; Dangbegnon, J. K.

    2016-01-07

    A bilayer graphene film obtained on copper (Cu) foil is known to have a significant fraction of non-Bernal (AB) stacking and on copper/nickel (Cu/Ni) thin films is known to grow over a large-area with AB stacking. In this study, annealed Cu foils for graphene growth were doped with small concentrations of Ni to obtain dilute Cu(Ni) alloys in which the hydrocarbon decomposition rate of Cu will be enhanced by Ni during synthesis of large-area AB-stacked bilayer graphene using atmospheric pressure chemical vapour deposition. The Ni doped concentration and the Ni homogeneous distribution in Cu foil were confirmed with inductively coupledmore » plasma optical emission spectrometry and proton-induced X-ray emission. An electron backscatter diffraction map showed that Cu foils have a single (001) surface orientation which leads to a uniform growth rate on Cu surface in early stages of graphene growth and also leads to a uniform Ni surface concentration distribution through segregation kinetics. The increase in Ni surface concentration in foils was investigated with time-of-flight secondary ion mass spectrometry. The quality of graphene, the number of graphene layers, and the layers stacking order in synthesized bilayer graphene films were confirmed by Raman and electron diffraction measurements. A four point probe station was used to measure the sheet resistance of graphene films. As compared to Cu foil, the prepared dilute Cu(Ni) alloy demonstrated the good capability of growing large-area AB-stacked bilayer graphene film by increasing Ni content in Cu surface layer.« less

  16. A dilute Cu(Ni) alloy for synthesis of large-area Bernal stacked bilayer graphene using atmospheric pressure chemical vapour deposition

    NASA Astrophysics Data System (ADS)

    Madito, M. J.; Bello, A.; Dangbegnon, J. K.; Oliphant, C. J.; Jordaan, W. A.; Momodu, D. Y.; Masikhwa, T. M.; Barzegar, F.; Fabiane, M.; Manyala, N.

    2016-01-01

    A bilayer graphene film obtained on copper (Cu) foil is known to have a significant fraction of non-Bernal (AB) stacking and on copper/nickel (Cu/Ni) thin films is known to grow over a large-area with AB stacking. In this study, annealed Cu foils for graphene growth were doped with small concentrations of Ni to obtain dilute Cu(Ni) alloys in which the hydrocarbon decomposition rate of Cu will be enhanced by Ni during synthesis of large-area AB-stacked bilayer graphene using atmospheric pressure chemical vapour deposition. The Ni doped concentration and the Ni homogeneous distribution in Cu foil were confirmed with inductively coupled plasma optical emission spectrometry and proton-induced X-ray emission. An electron backscatter diffraction map showed that Cu foils have a single (001) surface orientation which leads to a uniform growth rate on Cu surface in early stages of graphene growth and also leads to a uniform Ni surface concentration distribution through segregation kinetics. The increase in Ni surface concentration in foils was investigated with time-of-flight secondary ion mass spectrometry. The quality of graphene, the number of graphene layers, and the layers stacking order in synthesized bilayer graphene films were confirmed by Raman and electron diffraction measurements. A four point probe station was used to measure the sheet resistance of graphene films. As compared to Cu foil, the prepared dilute Cu(Ni) alloy demonstrated the good capability of growing large-area AB-stacked bilayer graphene film by increasing Ni content in Cu surface layer.

  17. Modelling the Effect of Fruit Growth on Surface Conductance to Water Vapour Diffusion

    PubMed Central

    GIBERT, CAROLINE; LESCOURRET, FRANÇOISE; GÉNARD, MICHEL; VERCAMBRE, GILLES; PÉREZ PASTOR, ALEJANDRO

    2005-01-01

    • Background and Aims A model of fruit surface conductance to water vapour diffusion driven by fruit growth is proposed. It computes the total fruit conductance by integrating each of its components: stomata, cuticle and cracks. • Methods The stomatal conductance is computed from the stomatal density per fruit and the specific stomatal conductance. The cuticular component is equal to the proportion of cuticle per fruit multiplied by its specific conductance. Cracks are assumed to be generated when pulp expansion rate exceeds cuticle expansion rate. A constant percentage of cracks is assumed to heal each day. The proportion of cracks to total fruit surface area multiplied by the specific crack conductance accounts for the crack component. The model was applied to peach fruit (Prunus persica) and its parameters were estimated from field experiments with various crop load and irrigation regimes. • Key Results The predictions were in good agreement with the experimental measurements and for the different conditions (irrigation and crop load). Total fruit surface conductance decreased during early growth as stomatal density, and hence the contribution of the stomatal conductance, decreased from 80 to 20 % with fruit expansion. Cracks were generated for fruits exhibiting high growth rates during late growth and the crack component could account for up to 60 % of the total conductance during the rapid fruit growth. The cuticular contribution was slightly variable (around 20 %). Sensitivity analysis revealed that simulated conductance was highly affected by stomatal parameters during the early period of growth and by both crack and stomatal parameters during the late period. Large fruit growth rate leads to earlier and greater increase of conductance due to higher crack occurrence. Conversely, low fruit growth rate accounts for a delayed and lower increase of conductance. • Conclusions By predicting crack occurrence during fruit growth, this model could be helpful in managing cropping practices for integrated plant protection. PMID:15655107

  18. Oxidation behaviour of ferritic stainless steel grade Crofer 22 APU at 700 °C in flowing Ar-75%CO2-12%H2O

    NASA Astrophysics Data System (ADS)

    Shariff, Nurul Atikah; Othman, Norinsan Kamil; Jalar, Azman

    2013-11-01

    The oxidation of Ferritic Stainless Steel (FSS) grade Crofer 22 APU has been investigated. FSS alloys were exposed to isothermal conditions in a horizontal tube furnace at a 700 °C in flowing Ar-75%CO2-12%H2O at a pressure of approximately 1 atm. The results showed that the growth of non protective Fe2O3 and spinel was observed after 50 h exposure in the presence of 12% H2O. The weight was increased significantly with time of exposure. The formation of different oxides is presented on the interface of the specimen such as MnCr2O4, Fe3O4 and Fe2O3 were revealed by X-ray diffraction and supported by EDAX analysis. FSS did not form a protective Cr2O3 layer due to water vapour accelerates the kinetics oxidation. Data of microstructure observation is presented and discussed in this paper in term of water vapour effects.

  19. Characteristics of Mg-doped and In-Mg co-doped p-type GaN epitaxial layers grown by metal organic chemical vapour deposition

    NASA Astrophysics Data System (ADS)

    Chung, S. J.; Senthil Kumar, M.; Lee, Y. S.; Suh, E.-K.; An, M. H.

    2010-05-01

    Mg-doped and In-Mg co-doped p-type GaN epilayers were grown using the metal organic chemical vapour deposition technique. The effect of In co-doping on the physical properties of p-GaN layer was examined by high resolution x-ray diffraction (HRXRD), transmission electron microscopy (TEM), Hall effect, photoluminescence (PL) and persistent photoconductivity (PPC) at room temperature. An improved crystalline quality and a reduction in threading dislocation density are evidenced upon In doping in p-GaN from HRXRD and TEM images. Hole conductivity, mobility and carrier density also significantly improved by In co-doping. PL studies of the In-Mg co-doped sample revealed that the peak position is blue shifted to 3.2 eV from 2.95 eV of conventional p-GaN and the PL intensity is increased by about 25%. In addition, In co-doping significantly reduced the PPC effect in p-type GaN layers. The improved electrical and optical properties are believed to be associated with the active participation of isolated Mg impurities.

  20. Fundamental mass transfer modeling of emission of volatile organic compounds from building materials

    NASA Astrophysics Data System (ADS)

    Bodalal, Awad Saad

    In this study, a mass transfer theory based model is presented for characterizing the VOC emissions from building materials. A 3-D diffusion model is developed to describe the emissions of volatile organic compounds (VOCs) from individual sources. Then the formulation is extended to include the emissions from composite sources (system comprising an assemblage of individual sources). The key parameters for the model (The diffusion coefficient of the VOC in the source material D, and the equilibrium partition coefficient k e) were determined independently (model parameters are determined without the use of chamber emission data). This procedure eliminated to a large extent the need for emission testing using environmental chambers, which is costly, time consuming, and may be subject to confounding sink effects. An experimental method is developed and implemented to measure directly the internal diffusion (D) and partition coefficients ( ke). The use of the method is illustrated for three types of VOC's: (i) Aliphatic Hydrocarbons, (ii) Aromatic Hydrocarbons and ( iii) Aldehydes, through typical dry building materials (carpet, plywood, particleboard, vinyl floor tile, gypsum board, sub-floor tile and OSB). Then correlations for predicting D and ke based solely on commonly available properties such as molecular weight and vapour pressure were proposed for each product and type of VOC. These correlations can be used to estimate the D and ke when direct measurement data are not available, and thus facilitate the prediction of VOC emissions from the building materials using mass transfer theory. The VOC emissions from a sub-floor material (made of the recycled automobile tires), and a particleboard are measured and predicted. Finally, a mathematical model to predict the diffusion coefficient through complex sources (floor adhesive) as a function of time was developed. Then this model (for diffusion coefficient in complex sources) was used to predict the emission rate from material system (namely, substrate//glue//vinyl tile).

  1. Efficient quantification of water content in edible oils by headspace gas chromatography with vapour phase calibration.

    PubMed

    Xie, Wei-Qi; Gong, Yi-Xian; Yu, Kong-Xian

    2018-06-01

    An automated and accurate headspace gas chromatographic (HS-GC) technique was investigated for rapidly quantifying water content in edible oils. In this method, multiple headspace extraction (MHE) procedures were used to analyse the integrated water content from the edible oil sample. A simple vapour phase calibration technique with an external vapour standard was used to calibrate both the water content in the gas phase and the total weight of water in edible oil sample. After that the water in edible oils can be quantified. The data showed that the relative standard deviation of the present HS-GC method in the precision test was less than 1.13%, the relative differences between the new method and a reference method (i.e. the oven-drying method) were no more than 1.62%. The present HS-GC method is automated, accurate, efficient, and can be a reliable tool for quantifying water content in edible oil related products and research. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  2. Purification, crystallization and preliminary crystallographic study of low oxygen-affinity haemoglobin from cat (Felis silvestris catus) in two different crystal forms.

    PubMed

    Balasubramanian, M; Moorthy, Pon Sathya; Neelagandan, K; Ponnuswamy, M N

    2009-03-01

    Haemoglobin is a metalloprotein which plays a major role in the transportation of oxygen from the lungs to tissues and of carbon dioxide back to the lungs. The present work reports the preliminary crystallographic study of low oxygen-affinity haemoglobin from cat in different crystal forms. Cat blood was collected, purified by anion-exchange chromatography and crystallized in two different conditions by the hanging-drop vapour-diffusion method under unbuffered low-salt and buffered high-salt concentrations using PEG 3350 as a precipitant. Intensity data were collected using MAR345 and MAR345dtb image-plate detector systems. Cat haemoglobin crystallizes in monoclinic and orthorhombic crystal forms with one and two whole biological molecules (alpha(2)beta(2)), respectively, in the asymmetric unit.

  3. Synthesis of Ordered Mesoporous Phenanthrenequinone-Carbon via π-π Interaction-Dependent Vapor Pressure for Rechargeable Batteries

    PubMed Central

    Kwon, Mi-Sook; Choi, Aram; Park, Yuwon; Cheon, Jae Yeong; Kang, Hyojin; Jo, Yong Nam; Kim, Young-Jun; Hong, Sung You; Joo, Sang Hoon; Yang, Changduk; Lee, Kyu Tae

    2014-01-01

    The π-π interaction-dependent vapour pressure of phenanthrenequinone can be used to synthesize a phenanthrenequinone-confined ordered mesoporous carbon. Intimate contact between the insulating phenanthrenequinone and the conductive carbon framework improves the electrical conductivity. This enables a more complete redox reaction take place. The confinement of the phenanthrenequinone in the mesoporous carbon mitigates the diffusion of the dissolved phenanthrenequinone out of the mesoporous carbon, and improves cycling performance. PMID:25490893

  4. Cooperative interactions in dense thermal Rb vapour confined in nm-scale cells

    NASA Astrophysics Data System (ADS)

    Keaveney, James

    Gravitational wave detectors are a new class of observatories aiming to detect gravitational waves from cosmic sources. All-reflective interferometer configurations have been proposed for future detectors, replacing transmissive optics with diffractive elements, thereby reducing thermal issues associated with power absorption. However, diffraction gratings introduce additional phase noise, creating more stringent conditions for alignment stability, and further investigations are required into all-reflective interferometers. A suitable mathematical framework using Gaussian modes is required for analysing the alignment stability using diffraction gratings. Such a framework was created, whereby small beam displacements are modelled using a modal technique. It was confirmed that the original modal-based model does not contain the phase changes associated with grating displacements. Experimental tests verified that the phase of a diffracted Gaussian beam is independent of the beam shape. Phase effects were further examined using a rigorous time-domain simulation tool. These findings show that the perceived phase difference is based on an intrinsic change of coordinate system within the modal-based model, and that the extra phase can be added manually to the modal expansion. This thesis provides a well-tested and detailed mathematical framework that can be used to develop simulation codes to model more complex layouts of all-reflective interferometers.

  5. Predicting X-ray diffuse scattering from translation–libration–screw structural ensembles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van Benschoten, Andrew H.; Afonine, Pavel V.; Terwilliger, Thomas C.

    2015-07-28

    A method of simulating X-ray diffuse scattering from multi-model PDB files is presented. Despite similar agreement with Bragg data, different translation–libration–screw refinement strategies produce unique diffuse intensity patterns. Identifying the intramolecular motions of proteins and nucleic acids is a major challenge in macromolecular X-ray crystallography. Because Bragg diffraction describes the average positional distribution of crystalline atoms with imperfect precision, the resulting electron density can be compatible with multiple models of motion. Diffuse X-ray scattering can reduce this degeneracy by reporting on correlated atomic displacements. Although recent technological advances are increasing the potential to accurately measure diffuse scattering, computational modeling andmore » validation tools are still needed to quantify the agreement between experimental data and different parameterizations of crystalline disorder. A new tool, phenix.diffuse, addresses this need by employing Guinier’s equation to calculate diffuse scattering from Protein Data Bank (PDB)-formatted structural ensembles. As an example case, phenix.diffuse is applied to translation–libration–screw (TLS) refinement, which models rigid-body displacement for segments of the macromolecule. To enable the calculation of diffuse scattering from TLS-refined structures, phenix.tls-as-xyz builds multi-model PDB files that sample the underlying T, L and S tensors. In the glycerophosphodiesterase GpdQ, alternative TLS-group partitioning and different motional correlations between groups yield markedly dissimilar diffuse scattering maps with distinct implications for molecular mechanism and allostery. These methods demonstrate how, in principle, X-ray diffuse scattering could extend macromolecular structural refinement, validation and analysis.« less

  6. Photocatalytic degradation of diethyl phthalate using TiO{sub 2} nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singla, Pooja, E-mail: pooja.singla@thapar.edu; Pandey, O. P., E-mail: pooja.singla@thapar.edu; Singh, K., E-mail: pooja.singla@thapar.edu

    2014-04-24

    TiO{sub 2} nanoparticles predominantly in rutile phase are synthesized by ultrasonication assisted sol-gel method. TiO{sub 2} powder is characterized using X-ray powder diffraction and UV-vis diffuse reflectance. TiO{sub 2} is used as catalyst in photocatalytic degradation of Diethyl Phthalate. TiO{sub 2} exhibits good photocatalytic activity for the degradation of diethyl phthalate.

  7. A Calibration of the MeteoSwiss RAman Lidar for Meteorological Observations (RALMO)Water Vapour Mixing Ratio Measurements using a Radiosonde Trajectory Method

    NASA Astrophysics Data System (ADS)

    Hicks-Jalali, Shannon; Sica, R. J.; Haefele, Alexander; Martucci, Giovanni

    2018-04-01

    With only 50% downtime from 2007-2016, the RALMO lidar in Payerne, Switzerland, has one of the largest continuous lidar data sets available. These measurements will be used to produce an extensive lidar water vapour climatology using the Optimal Estimation Method introduced by Sica and Haefele (2016). We will compare our improved technique for external calibration using radiosonde trajectories with the standard external methods, and present the evolution of the lidar constant from 2007 to 2016.

  8. Structural disorder in the decagonal Al-Co-Ni. I. Patterson analysis of diffuse x-ray scattering data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kobas, Miroslav; Weber, Thomas; Steurer, Walter

    The three-dimensional (3D) difference Patterson (autocorrelation) function of a disordered quasicrystal (Edagawa phase) has been analyzed. 3D diffuse x-ray diffraction data were collected in situ at 300, 1070, and 1120 K. A method, the punch-and-fill technique, has been developed for separating diffuse scattering and Bragg reflections. Its potential and limits are discussed in detail. The different Patterson maps are interpreted in terms of intercluster correlations as a function of temperature. Both at high and low temperatures, the clusters decorate the vertices of the same quasiperiodic covering. At low temperatures, for the disordered part of the structure, short-range intercluster correlations aremore » present, whereas at higher temperatures, medium-range intercluster correlations are formed. This indicates disorder mainly inside clusters at low temperatures, whereas at higher temperatures disorder takes place inside larger superclusters. Qualitatively, the Patterson maps may be interpreted by intercluster correlations mainly inside pentagonal superclusters below 1120 K, and inside the larger decagonal superclusters at 1120 K. The results of our diffraction study are published in two parts. Part I focuses on the 3D Patterson analysis based on experimental data, Part II reports modeling of structural disorder in decagonal Al-Co-Ni.« less

  9. [Eco-physiological investigations on wild and cultivated plants in the Negev Desert : II. The influence of climatic factors on carbon dioxide exchange and transpiration at the end of the dry period].

    PubMed

    Schulze, E -D; Lange, O L; Koch, W

    1972-12-01

    The influence of climatic factors on net photosynthesis, dark respiration and transpiration was investigated in the Negev Desert at the end of the dry summer period when plant water stress was at a maximum. Species studied included: dominant species of the natural vegetation (Artemisia herba-alba, Hammada scoparia, Noaea mucronata, Reaumuria negevensis, Salsola inermis, Zygophyllum dumosum), cultivated plants receiving rainfall and run-off water during the winter season in the run-off farm Avdat (Prunus armeniaca, Vitis vinifera), and irrigated cultivated plants receiving additional water during the summer season (Citrullus colocynthis, Datura metel). 1. Light saturation of net photosynthesis was reached at 60-90 klx conforming to the high solar radiation intensities of the desert. 2. Maximum rates of CO 2 uptake per unit of dry weight for the irrigated mesomorphic plants was ten times that of the wild plants. However, in comparison to the other species, maximal rates of CO 2 uptake for wild plants were higher when calculated on a leaf area basis than when represented on a dry weight basis. Maximum rates of net photosynthesis per unit chlorophyll content for some of the wild plants (Salsola and Noaea) were comparable to those of the cultivated Vitis and irrigated Citrullus and Datura, Hammada exhibited even higher rates than Prunus. This demonstrates the great photosynthetic capacity of the wild plants even at the end of the dry season. 3. The upper temperature compensation point for net photosynthesis of the wild plants was unusually high as an adaptation to the temperatures of the habitat. Compensation points higher than 49°C exceed the maxima known so far for other flowering species. Maximum rates of net photosynthesis of Hammada were measured when the temperature of the photosynthetic organs was 37°C; at 49°C photosynthesis was only reduced by 50%. 4. Leaf temperature affects plant gas exchange by influencing stomatal aperture. Diffusion resistance of leaves to water vapour was reduced at low temperatures and increased at high temperatures. Reduction of net photosynthesis and transpiration of desert plants at midday may, therefore, be the result of temperature-induced stomatal closure. The possible influence of peristomatal transpiration on stomatal aperture is also discussed. Peristomatal transpiration is directly related to the vapour pressure gradient between the leaf mesophyll and the ambient air which increases with increasing temperatures. 5. Diffusion resistance to water vapour was reduced at high temperatures approaching the limits of heat resistance, due to increased stomatal aperture. This resulted in greater transpirational cooling. 6. Under conditions of increased leaf water stress, diffusion resistance increased, either by sudden stomatal closure at specific threshold values of water stress or through a continuous increase in resistance. This increased resistance is coupled with decreases in transpiration and photosynthesis. 7. In several plant species increased diffusion resistance during the course of the day caused decreased transpiration without a corresponding decrease in photosynthesis. Under these conditions, the ratio of CO 2 uptake to transpiration became more favourable as the day progressed. The possibility that this favourable gas exchange response is the result of an increased mesophyll resistance to water vapour loss is discussed.

  10. Functional Iron Oxide-Silver Hetero-Nanocomposites: Controlled Synthesis and Antibacterial Activity

    NASA Astrophysics Data System (ADS)

    Trang, Vu Thi; Tam, Le Thi; Van Quy, Nguyen; Huy, Tran Quang; Thuy, Nguyen Thanh; Tri, Doan Quang; Cuong, Nguyen Duy; Tuan, Pham Anh; Van Tuan, Hoang; Le, Anh-Tuan; Phan, Vu Ngoc

    2017-06-01

    Iron oxide-silver nanocomposites are of great interest for their antibacterial and antifungal activities. We report a two-step synthesis of functional magnetic hetero-nanocomposites of iron oxide nanoparticles and silver nanoparticles (Fe3O4-Ag). Iron oxide nanoparticles were prepared first by a co-precipitation method followed by the deposition of silver nanoparticles via a hydrothermal route. The prepared Fe3O4-Ag hetero-nanocomposites were characterized by x-ray diffraction, transmission electron microscopy, high resolution transmission electron microscopy and vibrating sample magnetometry. Their antibacterial activities were investigated by using paper-disc diffusion and direct-drop diffusion methods. The results indicate that the Fe3O4-Ag hetero-nanocomposites exhibit excellent antibacterial activities against two Gram-negative bacterial strains ( Salmonella enteritidis and Klebsiella pneumoniae).

  11. Refractometry studies of the optical properties of polymer films and the development of polymer coated refractive index sensors

    NASA Astrophysics Data System (ADS)

    Saunders, John Edward

    Sensors for real-time monitoring of environmental contaminants are essential for protecting ecosystems and human health. Refractive index sensing is a non-selective technique that can be used to measure almost any analyte. Miniaturized refractive index sensors, such as silicon-on-insulator (SOI) microring resonators are one possible platform, but require coatings selective to the analytes of interest. A homemade prism refractometer is reported and used to characterize the interactions between polymer films and liquid or vapour-phase analytes. A camera was used to capture both Fresnel reflection and total internal reflection within the prism. For thin-films (d = 10 μm - 100 μm), interference fringes were also observed. Fourier analysis of the interferogram allowed for simultaneous extraction of the average refractive index and film thickness with accuracies of Δn = 1-7 x10-4 and Δd < 3-5%. The refractive indices of 29 common organic solvents as well as aqueous solutions of sodium chloride, sucrose, ethylene glycol, glycerol, and dimethylsulfoxide were measured at λ = 1550 nm. These measurements will be useful for future calibrations of near-infrared refractive index sensors. A mathematical model is presented, where the concentration of analyte adsorbed in a film can be calculated from the refractive index and thickness changes during uptake. This model can be used with Fickian diffusion models to measure the diffusion coefficients through the bulk film and at the film-substrate interface. The diffusion of water and other organic solvents into SU-8 epoxy was explored using refractometry and the diffusion coefficient of water into SU-8 is presented. Exposure of soft baked SU-8 films to acetone, acetonitrile and methanol resulted in rapid delamination. The diffusion of volatile organic compound (VOC) vapours into polydimethylsiloxane and polydimethyl-co-polydiphenylsiloxane polymers was also studied using refractometry. Diffusion and partition coefficients are reported for several analytes. As a model system, polydimethyl-co-diphenylsiloxane films were coated onto SOI microring resonators. After the development of data acquisition software, coated devices were exposed to VOCs and the refractive index response was assessed. More studies with other polymers are required to test the viability of this platform for environmental sensing applications.

  12. Crystallization and preliminary X-ray diffraction study of phosphopantetheine adenylyltransferase from M. tuberculosis crystallizing in space group P3{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Timofeev, V. I., E-mail: tostars@mail.ru; Chupova, L. A.; Esipov, R. S.

    Crystals of M. tuberculosis phosphopantetheine adenylyltransferase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 2.00-Å resolution. The crystals belong to sp. gr. P3{sub 2} and have the following unit-cell parameters: a = b = 106.47 Å, c = 71.32 Å, α = γ = 90°, β = 120°. The structure was solved by the molecular-replacement method. There are six subunits of the enzyme comprising a hexamer per asymmetricmore » unit. The hexamer is a biologically active form of phosphopantetheine adenylyltransferase from M. tuberculosis.« less

  13. Characterization of aqueous interactions of copper-doped phosphate-based glasses by vapour sorption.

    PubMed

    Stähli, Christoph; Shah Mohammadi, Maziar; Waters, Kristian E; Nazhat, Showan N

    2014-07-01

    Owing to their adjustable dissolution properties, phosphate-based glasses (PGs) are promising materials for the controlled release of bioinorganics, such as copper ions. This study describes a vapour sorption method that allowed for the investigation of the kinetics and mechanisms of aqueous interactions of PGs of the formulation 50P2O5-30CaO-(20-x)Na2O-xCuO (x=0, 1, 5 and 10mol.%). Initial characterization was performed using (31)P magic angle spinning nuclear magnetic resonance and attenuated total reflectance-Fourier transform infrared spectroscopy. Increasing CuO content resulted in chemical shifts of the predominant Q(2) NMR peak and of the (POP)as and (PO(-)) Fourier transform infrared absorptions, owing to the higher strength of the POCu bond compared to PONa. Vapour sorption and desorption were gravimetrically measured in PG powders exposed to variable relative humidity (RH). Sorption was negligible below 70% RH and increased exponentially with RH from 70 to 90%, where it exhibited a negative correlation with CuO content. Vapour sorption in 0% and 1% CuO glasses resulted in phosphate chain hydration and hydrolysis, as evidenced by protonated Q(0)(1H) and Q(1)(1H) species. Dissolution rates in deionized water showed a linear correlation (R(2)>0.99) with vapour sorption. Furthermore, cation release rates could be predicted based on dissolution rates and PG composition. The release of orthophosphate and short polyphosphate species corroborates the action of hydrolysis and was correlated with pH changes. In conclusion, the agreement between vapour sorption and routine characterization techniques in water demonstrates the potential of this method for the study of PG aqueous reactions. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  14. Compatibility of stainless steels and lithiated ceramics with beryllium

    NASA Astrophysics Data System (ADS)

    Flament, T.; Fauvet, P.; Sannier, J.

    1988-07-01

    The introduction of beryllium as a neutron multiplier in ceramic blankets of thermonuclear fusion reactors may give rise to the following compatibility problems: (i) oxidation of Be by ceramics (lithium aluminate and silicates) or by water vapour; (ii) interaction between beryllium and austenitic and martensitic steels. The studies were done in contact tests under vacuum and in tests under wet sweeping helium. The contact tests under vacuum have revealed that the interaction of beryllium with ceramics seems to be low up to 700°C, the interaction of beryllium with steels is significant and is characterized by the formation of a diffusion layer and of a brittle Be-Fe-Ni compound. With type 316 L austenitic steel, this interaction appears quite large at 600°C whereas it is noticeable only at 700°C with martensitic steels. The experiments carried out with sweeping wet helium at 600°C have evidenced a slight oxidation of beryllium due to water vapour which can be enhanced in the front of uncompletely dehydrated ceramics.

  15. A novel method of measuring the concentration of anaesthetic vapours using a dew-point hygrometer.

    PubMed

    Wilkes, A R; Mapleson, W W; Mecklenburgh, J S

    1994-02-01

    The Antoine equation relates the saturated vapour pressure of a volatile substance, such as an anaesthetic agent, to the temperature. The measurement of the 'dew-point' of a dry gas mixture containing a volatile anaesthetic agent by a dew-point hygrometer permits the determination of the partial pressure of the anaesthetic agent. The accuracy of this technique is limited only by the accuracy of the Antoine coefficients and of the temperature measurement. Comparing measurements by the dew-point method with measurements by refractometry showed systematic discrepancies up to 0.2% and random discrepancies with SDS up to 0.07% concentration in the 1% to 5% range for three volatile anaesthetics. The systematic discrepancies may be due to errors in available data for the vapour pressures and/or the refractive indices of the anaesthetics.

  16. Closed-chamber transepidermal water loss measurement: microclimate, calibration and performance.

    PubMed

    Imhof, R E; De Jesus, M E P; Xiao, P; Ciortea, L I; Berg, E P

    2009-04-01

    The importance of transepidermal water loss (TEWL) as a measure of the skin barrier is well recognized. Currently, the open-chamber method is dominant, but it is increasingly challenged by newer closed-chamber technologies. Whilst there is familiarity with open-chamber characteristics, there is uncertainty about the capabilities of the challengers. The main issues are related to how microclimate affects TEWL measurements. The aim of this paper is to provide a framework for understanding the effects of microclimate on TEWL measurement. Part of the problem is that TEWL measurement is indirect. TEWL is the diffusion of condensed water through the stratum corneum (SC), whereas TEWL methods measure water vapour flux in the air above the SC. This vapour flux depends on (i) the rate of supply of water to the skin surface and (ii) the rate of evaporation of water from the skin surface. Rate (i) is a skin property (TEWL), rate (ii) is a microclimate property. The controlling rate for the combined process is the lower of the above two rates. Therefore, TEWL instruments measure TEWL only when TEWL is the rate-limiting process. Another problem is that SC barrier property and SC hydration are affected by the microclimate adjacent to the skin surface. This is discussed insofar as it affects the measurement of TEWL. The conclusion is that such changes occur on a timescale that is long compared with TEWL measurement times. An important aspect of TEWL measurement is calibration. We present an analysis of the traditional wet-cup method and a new droplet method that is traceable and has been independently verified by a standards laboratory. Finally, we review performance indicators of commercial closed-chamber instruments with reference to open-chamber instruments. The main findings are that TEWL readings correlate well, but there are significant differences in the other aspects of performance.

  17. Modelling Soil Heat and Water Flow as a Coupled Process in Land Surface Models

    NASA Astrophysics Data System (ADS)

    García González, Raquel; Verhoef, Anne; Vidale, Pier Luigi; Braud, Isabelle

    2010-05-01

    To improve model estimates of soil water and heat flow by land surface models (LSMs), in particular in the first few centimetres of the near-surface soil profile, we have to consider in detail all the relevant physical processes involved (see e.g. Milly, 1982). Often, thermal and iso-thermal vapour fluxes in LSMs are neglected and the simplified Richard's equation is used as a result. Vapour transfer may affect the water fluxes and heat transfer in LSMs used for hydrometeorological and climate simulations. Processes occurring in the top 50 cm soil may be relevant for water and heat flux dynamics in the deeper layers, as well as for estimates of evapotranspiration and heterotrophic respiration, or even for climate and weather predictions. Water vapour transfer, which was not incorporated in previous versions of the MOSES/JULES model (Joint UK Land Environment Simulator; Cox et al., 1999), has now been implemented. Furthermore, we also assessed the effect of the soil vertical resolution on the simulated soil moisture and temperature profiles and the effect of the processes occurring at the upper boundary, mainly in terms of infiltration rates and evapotranspiration. SiSPAT (Simple Soil Plant Atmosphere Transfer Model; Braud et al., 1995) was initially used to quantify the changes that we expect to find when we introduce vapour transfer in JULES, involving parameters such as thermal vapour conductivity and diffusivity. Also, this approach allows us to compare JULES to a more complete and complex numerical model. Water vapour flux varied with soil texture, depth and soil moisture content, but overall our results suggested that water vapour fluxes change temperature gradients in the entire soil profile and introduce an overall surface cooling effect. Increasing the resolution smoothed and reduced temperature differences between liquid (L) and liquid/vapour (LV) simulations at all depths, and introduced a temperature increase over the entire soil profile. Thermal gradients rather than soil water potential gradients seem to cause temporal and spatial (vertical) soil temperature variability. We conclude that a multi-soil layer configuration may improve soil water dynamics, heat transfer and coupling of these processes, as well as evapotranspiration estimates and land surface-atmosphere coupling. However, a compromise should be reached between numerical and process-simulation aspects. References: Braud I., A.C. Dantas-Antonino, M. Vauclin, J.L. Thony and P. Ruelle, 1995b: A Simple Soil Plant Atmo- sphere Transfer model (SiSPAT), Development and field verification, J. Hydrol, 166: 213-250 Cox, P.M., R.A. Betts, C.B. Bunton, R.L.H. Essery, P.R. Rowntree, and J. Smith (1999), The impact of new land surface physics on the GCM simulation of climate and climate sensitivity. Clim. Dyn., 15, 183-203. Milly, P.C.D., 1982. Moisture and heat transport in hysteric inhomogeneous porous media: a matric head- based formulation and a numerical model, Water Resour. Res., 18:489-498

  18. The structure of denisovite, a fibrous nanocrystalline polytypic disordered ‘very complex’ silicate, studied by a synergistic multi-disciplinary approach employing methods of electron crystallography and X-ray powder diffraction

    PubMed Central

    Schowalter, Marco; Schmidt, Martin U.; Czank, Michael; Depmeier, Wulf; Rosenauer, Andreas

    2017-01-01

    Denisovite is a rare mineral occurring as aggregates of fibres typically 200–500 nm diameter. It was confirmed as a new mineral in 1984, but important facts about its chemical formula, lattice parameters, symmetry and structure have remained incompletely known since then. Recently obtained results from studies using microprobe analysis, X-ray powder diffraction (XRPD), electron crystallography, modelling and Rietveld refinement will be reported. The electron crystallography methods include transmission electron microscopy (TEM), selected-area electron diffraction (SAED), high-angle annular dark-field imaging (HAADF), high-resolution transmission electron microscopy (HRTEM), precession electron diffraction (PED) and electron diffraction tomography (EDT). A structural model of denisovite was developed from HAADF images and later completed on the basis of quasi-kinematic EDT data by ab initio structure solution using direct methods and least-squares refinement. The model was confirmed by Rietveld refinement. The lattice parameters are a = 31.024 (1), b = 19.554 (1) and c = 7.1441 (5) Å, β = 95.99 (3)°, V = 4310.1 (5) Å3 and space group P12/a1. The structure consists of three topologically distinct dreier silicate chains, viz. two xonotlite-like dreier double chains, [Si6O17]10−, and a tubular loop-branched dreier triple chain, [Si12O30]12−. The silicate chains occur between three walls of edge-sharing (Ca,Na) octahedra. The chains of silicate tetrahedra and the octahedra walls extend parallel to the z axis and form a layer parallel to (100). Water molecules and K+ cations are located at the centre of the tubular silicate chain. The latter also occupy positions close to the centres of eight-membered rings in the silicate chains. The silicate chains are geometrically constrained by neighbouring octahedra walls and present an ambiguity with respect to their z position along these walls, with displacements between neighbouring layers being either Δz = c/4 or −c/4. Such behaviour is typical for polytypic sequences and leads to disorder along [100]. In fact, the diffraction pattern does not show any sharp reflections with l odd, but continuous diffuse streaks parallel to a* instead. Only reflections with l even are sharp. The diffuse scattering is caused by (100) nano­lamellae separated by stacking faults and twin boundaries. The structure can be described according to the order–disorder (OD) theory as a stacking of layers parallel to (100). PMID:28512570

  19. Hydroxyapatite thin films grown by pulsed laser deposition and matrix assisted pulsed laser evaporation: Comparative study

    NASA Astrophysics Data System (ADS)

    Popescu-Pelin, G.; Sima, F.; Sima, L. E.; Mihailescu, C. N.; Luculescu, C.; Iordache, I.; Socol, M.; Socol, G.; Mihailescu, I. N.

    2017-10-01

    Pulsed Laser Deposition (PLD) and Matrix Assisted Pulsed Laser Evaporation (MAPLE) techniques were applied for growing hydroxyapatite (HA) thin films on titanium substrates. All experiments were conducted in a reaction chamber using a KrF* excimer laser source (λ = 248 nm, τFWHM ≈ 25 ns). Half of the samples were post-deposition thermally treated at 500 °C in a flux of water vapours in order to restore crystallinity and improve adherence. Coating surface morphologies and topographies specific to the deposition method were evidenced by scanning electron, atomic force microscopy investigations and profilometry. They were shown to depend on deposition technique and also on the post-deposition treatment. Crystalline structure of the coatings evaluated by X-ray diffraction was improved after thermal treatment. Biocompatibility of coatings, cellular adhesion, proliferation and differentiation tests were conducted using human mesenchymal stem cells (MSCs). Results showed that annealed MAPLE deposited HA coatings were supporting MSCs proliferation, while annealed PLD obtained films were stimulating osteogenic differentiation.

  20. Hexagonal OsB 2 reduction upon heating in H 2 containing environment

    DOE PAGES

    Xie, Zhilin; Blair, Richard G.; Orlovskaya, Nina; ...

    2014-10-23

    The stability of hexagonal ReB 2 type OsB 2 powder upon heating under reforming gas was investigated. Pure Os metal particles were detected by powder X-ray diffraction starting at 375⁰ C and complete transformation of OsB 2 to metallic Os was observed at 725⁰ C. The mechanisms of precipitation of metallic Os is proposed and changes in the lattice parameters of OsB 2 upon heating are analysed in terms of the presence of oxygen or water vapour in the heating chamber. Previous studies suggested that Os atoms possess (0) valence, while B atoms possess both (+3) and ( 3) valencesmore » in the alternating boron/osmium sheet structure of hexagonal (P63/mmc, No. 194) OsB 2; if controllable method for Os removal from the lattice could be found, the opportunity would arise to form two-dimensional (2D) layers consisting of pure B atoms.« less

  1. Effect of titanium on the structural and optical property of NiO nano powders

    NASA Astrophysics Data System (ADS)

    Amin, Ruhul; Mishra, Prashant; Khatun, Nasima; Ayaz, Saniya; Srivastava, Tulika; Sen, Somaditya

    2018-05-01

    Nickel Oxide (NiO) and Ti doped NiO nanoparticles were prepared by sol-gel auto combustion method. Powder x-ray diffraction (PXRD) structural studies revealed face centered cubic (FCC) structure of the NiO nanopowders. The crystallite size decreased with Ti incorporation. UV-Vis spectroscopy carried out in diffused reflectance mode revealed decrease in band gap with increment in Urbach energy with doping.

  2. Magnetic Resonance Imaging of Solids Using Oscillating Field Gradients

    NASA Astrophysics Data System (ADS)

    Daud, Yaacob Mat

    1992-01-01

    Available from UMI in association with The British Library. A fully automatic solid state NMR imaging spectrometer is described. Use has been made of oscillating field gradients to frequency and phase encode the spatial localisation of the nuclear spins. The RF pulse is applied during the zero crossing of the field gradient, so only low RF power is needed to cover the narrow spectral width of the spins. The oscillating field gradient coils were operated on resonance hence large gradient strength could be applied (up to 200G/cm). Two image reconstruction methods were used, filtered back-projection and two dimensional Fourier transformation. The use of phase encoding, both with oscillating and with pulsed field gradients, enabled us to acquire the data when the gradients were off, and this method proved to be insensitive to eddy currents. It also allowed the use of narrow bandwidth receiver thus improving the signal to noise ratio. The maximum entropy method was used in an effort to remove data truncation effects, although the results were not too convincing. The application of these new imaging schemes, was tested by mapping the T_1 and T_2 of polymers. The calculated relaxation maps produced precise spatial information about T_1 and T_2 which is not possible to achieve by conventional relaxation weight mapping. In a second application, the diffusion of water vapour into dried zeolite powder was studied. We found that the diffusion process is not Fickian.

  3. Locating bomb factories by detecting hydrogen peroxide.

    PubMed

    Romolo, Francesco Saverio; Connell, Samantha; Ferrari, Carlotta; Suarez, Guillaume; Sauvain, Jean-Jacques; Hopf, Nancy B

    2016-11-01

    The analytical capability to detect hydrogen peroxide vapour can play a key role in localizing a site where a H2O2 based Improvised Explosive (IE) is manufactured. In security activities it is very important to obtain information in a short time. For this reason, an analytical method to be used in security activity needs portable devices. The authors have developed the first analytical method based on a portable luminometer, specifically designed and validated to locate IE manufacturing sites using quantitative on-site vapour analysis for H2O2. The method was tested both indoor and outdoor. The results demonstrate that the detection of H2O2 vapours could allow police forces to locate the site, while terrorists are preparing an attack. The collected data are also very important in developing new sensors, able to give an early alarm if located at a proper distance from a site where an H2O2 based IE is prepared. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Characterization of sorption properties of selected soils from Lublin region by using water vapour adsorption method

    NASA Astrophysics Data System (ADS)

    Skic, Kamil; Boguta, Patrycja; Sokołowska, Zofia

    2016-04-01

    *The studies were carried out within the framework of a research project. The project was financed from funds of National Science Center on the base of decision number DEC-2013/11/D/NZ9/02545 Among many methods proposed to study sorption properties of soils an analysis of adsorption/ desorption isotherm is probably the easiest and most convenient one. It characterizes both quantity and quality of mineral and organic components and also their physical and physicochemical properties. The main aim of this study is comparison of sorption properties of selected Polish soils by using water vapour adsorption method. Samples were taken from the depth of 0-20 cm, from the Lublin region, eastern Poland. Soils were selected on the basis of their different physicochemical properties and were classified as: Haplic Fluvisol, Haplic Chernozem, Mollic Gleysol, Rendzic Phaeozem, Stagnic Luvisol, Haplic Cambisol (WG WRB 2006). Data taken from experimental adsorption isotherms were used to determine parameters of monolayer capacity, specific surface area and the total amount of vapour adsorbed at relative pressure of 0.974. Obtained adsorption and desorption isotherms reviled that adsorbate molecules interacted with the soil particles in different extent. Similar monolayer capacity was observed for Haplic Fluvisol, Haplic Chernozem and Stagnic Luvisol, while for Mollic Gleysol was more than 4 times higher. Mollic Gleysol was also characterized by highest values of specific surface area as well as quantity of adsorbed vapour at relative pressure of 0.974. Higher sorption was caused by presence of soil colloids which contains functional groups of a polar nature (mainly hydroxyls, phenolic and carboxyls). These groups similarly to silicates, oxides, hydratable cations as well as electric charge form adsorption centres for water vapour molecules.

  5. Numerical stability of the error diffusion concept

    NASA Astrophysics Data System (ADS)

    Weissbach, Severin; Wyrowski, Frank

    1992-10-01

    The error diffusion algorithm is an easy implementable mean to handle nonlinearities in signal processing, e.g. in picture binarization and coding of diffractive elements. The numerical stability of the algorithm depends on the choice of the diffusion weights. A criterion for the stability of the algorithm is presented and evaluated for some examples.

  6. Experimental determination of pore shapes using phase retrieval from q -space NMR diffraction

    NASA Astrophysics Data System (ADS)

    Demberg, Kerstin; Laun, Frederik Bernd; Bertleff, Marco; Bachert, Peter; Kuder, Tristan Anselm

    2018-05-01

    This paper presents an approach to solving the phase problem in nuclear magnetic resonance (NMR) diffusion pore imaging, a method that allows imaging the shape of arbitrary closed pores filled with an NMR-detectable medium for investigation of the microstructure of biological tissue and porous materials. Classical q -space imaging composed of two short diffusion-encoding gradient pulses yields, analogously to diffraction experiments, the modulus squared of the Fourier transform of the pore image which entails an inversion problem: An unambiguous reconstruction of the pore image requires both magnitude and phase. Here the phase information is recovered from the Fourier modulus by applying a phase retrieval algorithm. This allows omitting experimentally challenging phase measurements using specialized temporal gradient profiles. A combination of the hybrid input-output algorithm and the error reduction algorithm was used with dynamically adapting support (shrinkwrap extension). No a priori knowledge on the pore shape was fed to the algorithm except for a finite pore extent. The phase retrieval approach proved successful for simulated data with and without noise and was validated in phantom experiments with well-defined pores using hyperpolarized xenon gas.

  7. Experimental determination of pore shapes using phase retrieval from q-space NMR diffraction.

    PubMed

    Demberg, Kerstin; Laun, Frederik Bernd; Bertleff, Marco; Bachert, Peter; Kuder, Tristan Anselm

    2018-05-01

    This paper presents an approach to solving the phase problem in nuclear magnetic resonance (NMR) diffusion pore imaging, a method that allows imaging the shape of arbitrary closed pores filled with an NMR-detectable medium for investigation of the microstructure of biological tissue and porous materials. Classical q-space imaging composed of two short diffusion-encoding gradient pulses yields, analogously to diffraction experiments, the modulus squared of the Fourier transform of the pore image which entails an inversion problem: An unambiguous reconstruction of the pore image requires both magnitude and phase. Here the phase information is recovered from the Fourier modulus by applying a phase retrieval algorithm. This allows omitting experimentally challenging phase measurements using specialized temporal gradient profiles. A combination of the hybrid input-output algorithm and the error reduction algorithm was used with dynamically adapting support (shrinkwrap extension). No a priori knowledge on the pore shape was fed to the algorithm except for a finite pore extent. The phase retrieval approach proved successful for simulated data with and without noise and was validated in phantom experiments with well-defined pores using hyperpolarized xenon gas.

  8. Detecting vapour bubbles in simulations of metastable water

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    González, Miguel A.; Abascal, Jose L. F.; Valeriani, Chantal, E-mail: christoph.dellago@univie.ac.at, E-mail: cvaleriani@quim.ucm.es

    2014-11-14

    The investigation of cavitation in metastable liquids with molecular simulations requires an appropriate definition of the volume of the vapour bubble forming within the metastable liquid phase. Commonly used approaches for bubble detection exhibit two significant flaws: first, when applied to water they often identify the voids within the hydrogen bond network as bubbles thus masking the signature of emerging bubbles and, second, they lack thermodynamic consistency. Here, we present two grid-based methods, the M-method and the V-method, to detect bubbles in metastable water specifically designed to address these shortcomings. The M-method incorporates information about neighbouring grid cells to distinguishmore » between liquid- and vapour-like cells, which allows for a very sensitive detection of small bubbles and high spatial resolution of the detected bubbles. The V-method is calibrated such that its estimates for the bubble volume correspond to the average change in system volume and are thus thermodynamically consistent. Both methods are computationally inexpensive such that they can be used in molecular dynamics and Monte Carlo simulations of cavitation. We illustrate them by computing the free energy barrier and the size of the critical bubble for cavitation in water at negative pressure.« less

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.

    A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

  10. A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids.

    PubMed

    Zipper, Lauren E; Aristide, Xavier; Bishop, Dylan P; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B; Santiago, Brianna M; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M; Soares, Alexei S

    2014-12-01

    A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63-82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.

  11. Raoult's law revisited: accurately predicting equilibrium relative humidity points for humidity control experiments.

    PubMed

    Bowler, Michael G; Bowler, David R; Bowler, Matthew W

    2017-04-01

    The humidity surrounding a sample is an important variable in scientific experiments. Biological samples in particular require not just a humid atmosphere but often a relative humidity (RH) that is in equilibrium with a stabilizing solution required to maintain the sample in the same state during measurements. The controlled dehydration of macromolecular crystals can lead to significant increases in crystal order, leading to higher diffraction quality. Devices that can accurately control the humidity surrounding crystals while monitoring diffraction have led to this technique being increasingly adopted, as the experiments become easier and more reproducible. Matching the RH to the mother liquor is the first step in allowing the stable mounting of a crystal. In previous work [Wheeler, Russi, Bowler & Bowler (2012). Acta Cryst. F 68 , 111-114], the equilibrium RHs were measured for a range of concentrations of the most commonly used precipitants in macromolecular crystallography and it was shown how these related to Raoult's law for the equilibrium vapour pressure of water above a solution. However, a discrepancy between the measured values and those predicted by theory could not be explained. Here, a more precise humidity control device has been used to determine equilibrium RH points. The new results are in agreement with Raoult's law. A simple argument in statistical mechanics is also presented, demonstrating that the equilibrium vapour pressure of a solvent is proportional to its mole fraction in an ideal solution: Raoult's law. The same argument can be extended to the case where the solvent and solute molecules are of different sizes, as is the case with polymers. The results provide a framework for the correct maintenance of the RH surrounding a sample.

  12. Solvent vapour monitoring in work space by solid phase micro extraction.

    PubMed

    Li, K; Santilli, A; Goldthorp, M; Whiticar, S; Lambert, P; Fingas, M

    2001-05-07

    Solid phase micro extraction (SPME) is a fast, solvent-less alternative to conventional charcoal tube sampling/carbon disulfide extraction for volatile organic compounds (VOC). In this work, SPME was compared to the active sampling technique in a typical lab atmosphere. Two different types of fibre coatings were evaluated for solvent vapour at ambient concentration. A general purpose 100 microm film polydimethylsiloxane (PDMS) fibre was found to be unsuitable for VOC work, despite the thick coating. The mixed-phase carboxen/PDMS fibre was found to be suitable. Sensitivity of the SPME was far greater than charcoal sorbent tube method. Calibration studies using typical solvent such as dichloromethane (DCM), benzene (B) and toluene (T) showed an optimal exposure time of 5 min, with a repeatability of less than 20% for a broad spectrum of organic vapour. Minimum detectable amount for DCM is in the range of 0.01 microg/l (0.003 ppmv). Variation among different fibres was generally within 30% at a vapour concentration of 1 microg DCM/l, which was more than adequate for field monitoring purpose. Adsorption characteristics and calibration procedures were studied. An actual application of SPME was carried out to measure background level of solvent vapour at a bench where DCM was used extensively. Agreement between the SPME and the charcoal sampling method was generally within a factor of two. No DCM concentration was found to be above the regulatory limit of 50 ppmv.

  13. Reflectometric measurement of n-hexane adsorption on ZnO2 nanohybrid film modified by hydrophobic gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Sebők, Dániel; Csapó, Edit; Ábrahám, Nóra; Dékány, Imre

    2015-04-01

    Zinc-peroxide/poly(styrenesulfonate) nanohybrid thin films (containing 20 bilayers: [ZnO2/PSS]20, d ∼ 500 nm) were prepared using layer-by-layer (LbL) method. The thin film surface was functionalized by different surface modifying agents (silanes, alkylthiols and hydrophobized nanoparticles). Based on the experimental results of quartz crystal microbalance (QCM) and contact angle measurements (as prequalifications) the octanethiol covered gold nanoparticles (OT-AuNPs) were selected for further vapour adsorption studies. Reflectometric interference spectroscopy (RIfS) was used to measure n-hexane vapour adsorption on the original and modified nanohybrid films in a gas flow platform. The thin film provides only the principle of the measurement (by interference phenomenon), the selectivity and hydrophobicity is controlled and enhanced by surface functionalization (by dispersion interaction between the alkyl chains). The interference pattern shift (Δλ) caused by the increase of the optical thickness of the thin film due to vapour adsorption was investigated. It was found that due to the surface functionalization by hydrophobic nanoparticles the effect of water vapour adsorption decreased significantly, while for n-hexane opposite tendency was observed (the effective refractive index and thus the interference pattern shift increased drastically). The correlation between QCM technique and optical method (RIfS) was specified: linear specific adsorbed amount vs. wavelength shift calibration curves were determined in the pr = 0-0.4 relative vapour pressure range. The thin film is suitable for sensorial application (e.g. volatile organic compound/VOC sensor).

  14. Image processing of vaporizing GDI sprays: a new curvature-based approach

    NASA Astrophysics Data System (ADS)

    Lazzaro, Maurizio; Ianniello, Roberto

    2018-01-01

    This article introduces an innovative method for the segmentation of Mie-scattering and schlieren images of GDI sprays. The contours of the liquid phase are obtained by segmenting the scattering images of the spray by means of optimal filtering of the image, relying on variational methods, and an original thresholding procedure based on an iterative application of Otsu’s method. The segmentation of schlieren images, to get the contours of the spray vapour phase, is obtained by exploiting the surface curvature of the image to strongly enhance the intensity texture due to the vapour density gradients. This approach allows one to unambiguously discern the whole vapour phase of the spray from the background. Additional information about the spray liquid phase can be obtained by thresholding filtered schlieren images. The potential of this method has been substantiated in the segmentation of schlieren and scattering images of a GDI spray of isooctane. The fuel, heated to 363 K, was injected into nitrogen at a density of 1.12 and 3.5 kg m-3 with temperatures of 333 K and 573 K.

  15. Thermal diffusivity study of aged Li-ion batteries using flash method

    NASA Astrophysics Data System (ADS)

    Nagpure, Shrikant C.; Dinwiddie, Ralph; Babu, S. S.; Rizzoni, Giorgio; Bhushan, Bharat; Frech, Tim

    Advanced Li-ion batteries with high energy and power density are fast approaching compatibility with automotive demands. While the mechanism of operation of these batteries is well understood, the aging mechanisms are still under investigation. Investigation of aging mechanisms in Li-ion batteries becomes very challenging, as aging does not occur due to a single process, but because of multiple physical processes occurring at the same time in a cascading manner. As the current characterization techniques such as Raman spectroscopy, X-ray diffraction, and atomic force microscopy are used independent of each other they do not provide a comprehensive understanding of material degradation at different length (nm 2 to m 2) scales. Thus to relate the damage mechanisms of the cathode at mm length scale to micro/nanoscale, data at an intermediate length scale is needed. As such, we demonstrate here the use of thermal diffusivity analysis by flash method to bridge the gap between different length scales. In this paper we present the thermal diffusivity analysis of an unaged and aged cell. Thermal diffusivity analysis maps the damage to the cathode samples at millimeter scale lengths. Based on these maps we also propose a mechanism leading to the increase of the thermal diffusivity as the cells are aged.

  16. Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gaur, Vineet; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

    The purification, identification, crystallization and preliminary crystallographic studies of an allergy-related protein, Pru du amandin, from P. dulcis nuts are reported. Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presencemore » of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 150.7, c = 164.9 Å.« less

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Staliulionis, Ž.; Jabbari, M.; Hattel, J. H.

    The number of electronics used in outdoor environment is constantly growing. The humidity causes about 19 % of all electronics failures and, especially, moisture increases these problems due to the ongoing process of miniaturization and lower power consumption of electronic components. Moisture loads are still not understood well by design engineers, therefore this field has become one of the bottlenecks in the electronics system design. The objective of this paper is to model moisture ingress into an electronics enclosure under isothermal conditions. The moisture diffusion model is based on a 1D quasi-steady state (QSS) approximation for Fick’s second law. Thismore » QSS approach is also described with an electrical analogy which gives a fast tool in modelling of the moisture response. The same QSS method is applied to ambient water vapour variations. The obtained results are compared to an analytical solution and very good agreement is found.« less

  18. Comparative study of qualitative and quantitative methods to determine toxicity level of Aspergillus flavus isolates in maize.

    PubMed

    Shekhar, Meena; Singh, Nirupma; Dutta, Ram; Kumar, Shrvan; Mahajan, Vinay

    2017-01-01

    An attempt was made to compare between easy and inexpensive qualitative method (ammonia vapour test) and analytical methods (thin layer chromatography and enzyme-linked immunosorbent assay) for identification of aflatoxigenic isolates of Aspergillus flavus in maize. In this comparative study the toxicity level of A. flavus isolates exhibited 100% agreement among ammonia vapour test, ELISA and TLC for highly toxigenic (>2000 ppb) and toxigenic (501-2000 ppb) isolates while 88.5% agreement observed for least toxic (<20 ppb) isolates. In ammonia vapour test 51% of A. flavus isolates showed creamish or no colour change corresponding to least toxic/atoxic (<20ppb) category estimated by ELISA. Similarly 22% highly toxic isolates exhibited plum red colour, 12% moderately toxic indicated pink colour and 10% toxic isolates showed red colour. However, 11.5% isolates were found to be false positive in cream colour category (least toxic) and 28.5% false negatives in pink colour (moderately toxic) category. The isolates from different agroclimatic zones of maize in India showed high variability for aflatoxin B1 (AFB1) production potential ranging from 0.214-8116.61 ppb. Toxigenic potential of Aspergillus flavus isolates in culture was further validated by inoculating maize grain sample with four different isolates with varied toxin producing ability. With good agreement percentage between cultural and analytical methods the study concludes the ammonia vapour test to be easy, inexpensive, reliable and time saving method that can be used for segregating or pre-screening of contaminated samples from bulk food/feed stock.

  19. Hydrogenated amorphous carbon coatings on implants drastically reduce biofilm formation and water permeation

    NASA Astrophysics Data System (ADS)

    Bernsmann, Falk; Laube, Norbert; Baldsiefen, Gerhard; Castellucci, Mattia

    2014-11-01

    Inflammations and crystalline bacterial biofilms (encrustations) remain a major complication in long-term artificial urinary tract drainage. To solve this problem we present urological implants with coatings made of amorphous hydrogenated carbon (a-C:H) that show excellent protection from encrustation in-vitro as well as in-vivo. Part of the success of a-C:H coatings is attributed to their ability to act as a diffusion barrier between an implant and the body, which prevents leaching of solvents from polymeric implants. To further enhance their barrier properties a-C:H coatings are combined with parylene coatings to develop diffusion-barrier multilayer coatings with a total thickness between 0.2 μm and 0.8 μm. The combination of the two types of coatings leads to a reduction of water diffusion by a factor of up to ten with respect to uncoated 25 μm thick polyimide sub-strates. The diffusion of water vapour from a controlled atmospheric pressure chamber through coated foils to a vacuum chamber is measured in a custom-built device.

  20. Levels of selected carcinogens and toxicants in vapour from electronic cigarettes.

    PubMed

    Goniewicz, Maciej Lukasz; Knysak, Jakub; Gawron, Michal; Kosmider, Leon; Sobczak, Andrzej; Kurek, Jolanta; Prokopowicz, Adam; Jablonska-Czapla, Magdalena; Rosik-Dulewska, Czeslawa; Havel, Christopher; Jacob, Peyton; Benowitz, Neal

    2014-03-01

    Electronic cigarettes, also known as e-cigarettes, are devices designed to imitate regular cigarettes and deliver nicotine via inhalation without combusting tobacco. They are purported to deliver nicotine without other toxicants and to be a safer alternative to regular cigarettes. However, little toxicity testing has been performed to evaluate the chemical nature of vapour generated from e-cigarettes. The aim of this study was to screen e-cigarette vapours for content of four groups of potentially toxic and carcinogenic compounds: carbonyls, volatile organic compounds, nitrosamines and heavy metals. Vapours were generated from 12 brands of e-cigarettes and the reference product, the medicinal nicotine inhaler, in controlled conditions using a modified smoking machine. The selected toxic compounds were extracted from vapours into a solid or liquid phase and analysed with chromatographic and spectroscopy methods. We found that the e-cigarette vapours contained some toxic substances. The levels of the toxicants were 9-450 times lower than in cigarette smoke and were, in many cases, comparable with trace amounts found in the reference product. Our findings are consistent with the idea that substituting tobacco cigarettes with e-cigarettes may substantially reduce exposure to selected tobacco-specific toxicants. E-cigarettes as a harm reduction strategy among smokers unwilling to quit, warrants further study. (To view this abstract in Polish and German, please see the supplementary files online.).

  1. Increased understanding of cellulose crystallinity

    USDA-ARS?s Scientific Manuscript database

    According to the International Union of Crystallography, “material is a crystal if it has essentially a sharp diffraction pattern. The word essentially means that most of the intensity of the diffraction is concentrated in relatively sharp Bragg peaks, besides the always present diffuse scattering.”...

  2. Large scale synthesis of α-Si3N4 nanowires through a kinetically favored chemical vapour deposition process

    NASA Astrophysics Data System (ADS)

    Liu, Haitao; Huang, Zhaohui; Zhang, Xiaoguang; Fang, Minghao; Liu, Yan-gai; Wu, Xiaowen; Min, Xin

    2018-01-01

    Understanding the kinetic barrier and driving force for crystal nucleation and growth is decisive for the synthesis of nanowires with controllable yield and morphology. In this research, we developed an effective reaction system to synthesize very large scale α-Si3N4 nanowires (hundreds of milligrams) and carried out a comparative study to characterize the kinetic influence of gas precursor supersaturation and liquid metal catalyst. The phase composition, morphology, microstructure and photoluminescence properties of the as-synthesized products were characterized by X-ray diffraction, fourier-transform infrared spectroscopy, field emission scanning electron microscopy, transmission electron microscopy and room temperature photoluminescence measurement. The yield of the products not only relates to the reaction temperature (thermodynamic condition) but also to the distribution of gas precursors (kinetic condition). As revealed in this research, by controlling the gas diffusion process, the yield of the nanowire products could be greatly improved. The experimental results indicate that the supersaturation is the dominant factor in the as-designed system rather than the catalyst. With excellent non-flammability and high thermal stability, the large scale α-Si3N4 products would have potential applications to the improvement of strength of high temperature ceramic composites. The photoluminescence spectrum of the α-Si3N4 shows a blue shift which could be valued for future applications in blue-green emitting devices. There is no doubt that the large scale products are the base of these applications.

  3. Multiscale simulations of the early stages of the growth of graphene on copper

    NASA Astrophysics Data System (ADS)

    Gaillard, P.; Chanier, T.; Henrard, L.; Moskovkin, P.; Lucas, S.

    2015-07-01

    We have performed multiscale simulations of the growth of graphene on defect-free copper (111) in order to model the nucleation and growth of graphene flakes during chemical vapour deposition and potentially guide future experimental work. Basic activation energies for atomic surface diffusion were determined by ab initio calculations. Larger scale growth was obtained within a kinetic Monte Carlo approach (KMC) with parameters based on the ab initio results. The KMC approach counts the first and second neighbours to determine the probability of surface diffusion. We report qualitative results on the size and shape of the graphene islands as a function of deposition flux. The dominance of graphene zigzag edges for low deposition flux, also observed experimentally, is explained by its larger dynamical stability that the present model fully reproduced.

  4. Capillary microextraction: A new method for sampling methamphetamine vapour.

    PubMed

    Nair, M V; Miskelly, G M

    2016-11-01

    Clandestine laboratories pose a serious health risk to first responders, investigators, decontamination companies, and the public who may be inadvertently exposed to methamphetamine and other chemicals used in its manufacture. Therefore there is an urgent need for reliable methods to detect and measure methamphetamine at such sites. The most common method for determining methamphetamine contamination at former clandestine laboratory sites is selected surface wipe sampling, followed by analysis with gas chromatography-mass spectrometry (GC-MS). We are investigating the use of sampling for methamphetamine vapour to complement such wipe sampling. In this study, we report the use of capillary microextraction (CME) devices for sampling airborne methamphetamine, and compare their sampling efficiency with a previously reported dynamic SPME method. The CME devices consisted of PDMS-coated glass filter strips inside a glass tube. The devices were used to dynamically sample methamphetamine vapour in the range of 0.42-4.2μgm -3 , generated by a custom-built vapour dosing system, for 1-15min, and methamphetamine was analysed using a GC-MS fitted with a ChromatoProbe thermal desorption unit. The devices showed good reproducibility (RSD<15%), and a curvilinear pre-equilibrium relationship between sampling times and peak area, which can be utilised for calibration. Under identical sampling conditions, the CME devices were approximately 30 times more sensitive than the dynamic SPME method. The CME devices could be stored for up to 3days after sampling prior to analysis. Consecutive sampling of methamphetamine and its isotopic substitute, d-9 methamphetamine showed no competitive displacement. This suggests that CME devices, pre-loaded with an internal standard, could be a feasible method for sampling airborne methamphetamine at former clandestine laboratories. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. Infrared Laser Optoacoustic Detection Of Gases And Vapours

    NASA Astrophysics Data System (ADS)

    Johnson, S. A.; Cummins, P. G.; Bone, S. A.; Davies, P. B.

    1988-10-01

    Mid-infrared laser optoacoustic spectroscopy has been used to detect a variety of gases and vapours. Performance was calibrated using the signal from a known concentration of ethene, and then the method applied to the perfume alcohol geraniol. Detection limits were found to be 1 ppb for ethene and 70 ppb for geraniol on their strongest absorption lines for a few seconds measurement time.

  6. Oxidation behaviour of ferritic stainless steel grade Crofer 22 APU at 700 °C in flowing Ar−75%CO{sub 2}−12%H{sub 2}O

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shariff, Nurul Atikah; Othman, Norinsan Kamil; Jalar, Azman

    2013-11-27

    The oxidation of Ferritic Stainless Steel (FSS) grade Crofer 22 APU has been investigated. FSS alloys were exposed to isothermal conditions in a horizontal tube furnace at a 700 °C in flowing Ar−75%CO{sub 2}−12%H{sub 2}O at a pressure of approximately 1 atm. The results showed that the growth of non protective Fe{sub 2}O{sub 3} and spinel was observed after 50 h exposure in the presence of 12% H{sub 2}O. The weight was increased significantly with time of exposure. The formation of different oxides is presented on the interface of the specimen such as MnCr{sub 2}O{sub 4}, Fe{sub 3}O{sub 4} andmore » Fe{sub 2}O{sub 3} were revealed by X-ray diffraction and supported by EDAX analysis. FSS did not form a protective Cr{sub 2}O{sub 3} layer due to water vapour accelerates the kinetics oxidation. Data of microstructure observation is presented and discussed in this paper in term of water vapour effects.« less

  7. Chemical and morphological characterization of III-V strained layered heterostructures

    NASA Astrophysics Data System (ADS)

    Gray, Allen Lindsay

    This dissertation describes investigations into the chemical and morphological characterization of III-V strained layered heterostructures by high-resolution x-ray diffraction. The purpose of this work is two-fold. The first was to use high-resolution x-ray diffraction coupled with transmission electron microscopy to characterize structurally a quaternary AlGaAsSb/InGaAsSb multiple quantum well heterostructure laser device. A method for uniquely determining the chemical composition of the strain quaternary quantum well, information previously thought to be unattainable using high resolution x-ray diffraction is thoroughly described. The misconception that high-resolution x-ray diffraction can separately find the well and barrier thickness of a multi-quantum well from the pendellosung fringe spacing is corrected, and thus the need for transmission electron microscopy is motivated. Computer simulations show that the key in finding the well composition is the intensity of the -3rd order satellite peaks in the diffraction pattern. The second part of this work addresses the evolution of strain relief in metastable multi-period InGaAs/GaAs multi-layered structures by high-resolution x-ray reciprocal space maps. Results are accompanied by transmission electron and differential contrast microscopy. The evolution of strain relief is tracked from a coherent "pseudomorphic" growth to a dislocated state as a function of period number by examining the x-ray diffuse scatter emanating from the average composition (zeroth-order) of the multi-layer. Relaxation is determined from the relative positions of the substrate with respect to the zeroth-order peak. For the low period number, the diffuse scatter from the multi-layer structure region arises from periodic, coherent crystallites. For the intermediate period number, the displacement fields around the multi-layer structure region transition to random coherent crystallites. At the higher period number, displacement fields of overlapping dislocations from relaxation of the random crystallites cause the initial stages of relaxation of the multi-layer structure. At the highest period number studied, relaxation of the multi-layer structure becomes bi-modal characterized by overlapping dislocations caused by mosaic block relaxation and periodically spaced misfit dislocations formed by 60°-type dislocations. The relaxation of the multi-layer structure has an exponential dependence on the diffuse scatter length-scale, which is shown to be a sensitive measure of the onset of relaxation.

  8. Dislocations limited electronic transport in hydride vapour phase epitaxy grown GaN templates: A word of caution for the epitaxial growers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chatterjee, Abhishek, E-mail: cabhishek@rrcat.gov.in; Khamari, Shailesh K.; Kumar, R.

    2015-01-12

    GaN templates grown by hydride vapour phase epitaxy (HVPE) and metal organic vapour phase epitaxy (MOVPE) techniques are compared through electronic transport measurements. Carrier concentration measured by Hall technique is about two orders larger than the values estimated by capacitance voltage method for HVPE templates. It is learnt that there exists a critical thickness of HVPE templates below which the transport properties of epitaxial layers grown on top of them are going to be severely limited by the density of charged dislocations lying at layer-substrate interface. On the contrary MOVPE grown templates are found to be free from such limitations.

  9. Crystallization and identification of the glycosylated moieties of two isoforms of the main allergen Hev b 2 and preliminary X-ray analysis of two polymorphs of isoform II

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fuentes-Silva, D.; Mendoza-Hernández, G.; Stojanoff, V.

    2007-09-01

    Crystallization of important glycoenzymes involved in IgE-mediated latex allergy. Latex from Hevea brasiliensis contains several allergenic proteins that are involved in type I allergy. One of them is Hev b 2, which is a β-1,3-glucanase enzyme that exists in different isoforms with variable glycosylation content. Two glucanase isoforms were isolated from trees of the GV-42 clone by gel filtration, affinity and ion-exchange chromatography. Isoform I had a carbohydrate content of about 20%, with N-linked N-acetyl-glucosamine, N-acetyl-galactosamine, fucose and galactose residues as the main sugars, while isoform II showed 6% carbohydrate content constisting of N-acetyl-glucosamine, fucose, mannose and xylose. Both isoformsmore » were crystallized by the hanging-drop vapour-diffusion method. Isoform I crystals were grown using 0.2 M trisodium citrate dihydrate, 0.1 M Na HEPES pH 7.5 and 20%(v/v) 2-propanol, but these crystals were not appropriate for data collection. Isoform II crystals were obtained under two conditions and X-ray diffraction data were collected from both. In the first condition (0.2 M trisodium citrate, 0.1 M sodium cacodylate pH 6.5, 30% 2-propanol), crystals belonging to the tetragonal space group P4{sub 1} with unit-cell parameters a = b = 150.17, c = 77.41 Å were obtained. In the second condition [0.2 M ammonium acetate, 0.1 M trisodium citrate dihydrate pH 5.6, 30%(w/v) polyethylene glycol 4000] the isoform II crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 85.08, b = 89.67, c = 101.80 Å, β = 113.6°. Preliminary analysis suggests that there are four molecules of isoform II in both asymmetric units.« less

  10. X-ray crystallographic studies on C-phycocyanins from cyanobacteria from different habitats: marine and freshwater

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Satyanarayana, L.; Suresh, C. G., E-mail: cgsuresh@ncl.res.in; Patel, Anamika

    2005-09-01

    The protein C-phycocyanin, involved in photosynthesis, has been purified from three cyanobacterial species: Spirulina, Phormidium and Lyngbya. These three proteins have been crystallized and characterized using X-ray crystallography. C-phycocyanins from three cyanobacterial cultures of freshwater and marine habitat, Spirulina, Phormidium and Lyngbya spp., were purified to homogeneity and crystallized using the hanging-drop vapour-diffusion method. Blue-coloured crystals in different crystal forms, monoclinic and hexagonal, were obtained for the three species. The crystals took 1–12 weeks to grow to full size using polyethylene glycols of different molecular weights as precipitants. The amino-acid sequences of these proteins show high similarity to other knownmore » C-phycocyanins from related organisms; however, the C-phycocyanins reported here showed different biochemical and biophysical properties, i.e. molecular weight, stability etc. The X-ray diffraction data were collected at resolutions of 3.0 Å for the monoclinic and 3.2 and 3.6 Å for the hexagonal forms. The unit-cell parameters corresponding to the monoclinic space group P2{sub 1} are a = 107.33, b = 115.64, c = 183.26 Å, β = 90.03° for Spirulina sp. C-phycocyanin and are similar for crystals of Phormidium and Lyngbya spp. C-phycocyanins. Crystals belonging to the hexagonal space group P6{sub 3}, with unit-cell parameters a = b = 154.97, c = 40.35 Å and a = b = 151.96, c = 39.06 Å, were also obtained for the C-phycocyanins from Spirulina and Lyngbya spp., respectively. The estimated solvent content is around 50% for the monoclinic crystals of all three species assuming the presence of two hexamers per asymmetric unit. The solvent content is 66.5 and 64.1% for the hexagonal crystals of C-phycocyanin from Spirulina and Lyngbya spp. assuming the presence of one αβ monomer per asymmetric unit.« less

  11. Analysis of δ18O and δD values of environmental waters at high temporal and spatial resolution by continuous diffusion sampling cavity ring-down spectrometry

    NASA Astrophysics Data System (ADS)

    Munksgaard, Niels; Bass, Adrian; Wurster, Chris; Bird, Michael

    2013-04-01

    A novel sampling device utilises diffusion through porous PTFE tubing to deliver water vapour continuously from a liquid water source for analysis of δ18O and δD values by Cavity Ring-Down Spectrometry (CRDS). Comparison of isotopic data for a range of water samples analysed by Diffusion Sampling-CRDS (DS-CRDS) and Isotope Ratio Mass Spectrometry (IRMS) shows significant linear correlations between the two methods allowing for accurate standardisation of DS-CRDS data. The internal precision for an integration period of 3 min (standard deviation = 0.1 ‰ and 0.3 ‰ for δ18O and δD values, respectively) is similar to analysis of water by injection/evaporation CRDS of discrete water samples. The isotopic effects of variable air and water temperature, water vapour concentration and water pumping rate were found to be either negligible or correctable by analysis of water standards. Separation of the analysed water vapour from non-volatile dissolved and particulate contaminants in the liquid sample minimises interferences associated with CRDS analyses of many aqueous samples. Coupling of the DS-CRDS instrument to an auto sampler enables rapid analysis (10 min) of discrete water samples. The DS-CRDS system was used in the first continuous shipboard measurement of δ18O and δD of water. Combined with continuous salinity recordings, a data set of nearly 6,000 isotope measurements was made at 30-s intervals during a 3-day voyage through the Great Barrier Reef Lagoon. Precise identification of river plumes within the Great Barrier Reef Lagoon was possible because unique δ18O/δD-salinity relationships of individual plumes were measured at high spatial and temporal resolution. Continuous shipboard measurement of δ18O/δD values by DS-CRDS provides additional discriminatory power for assessing water mass formation processes and histories at a small fraction of the cost of traditional isotope analysis of discrete samples. In a second application of DS-CRDS, continuous real-time analysis, at 30-s intervals, of precipitation at an Australian tropical location revealed extreme and rapidly changing δ18O and δD values related to variations in moisture source areas, transport paths and precipitation histories. The range of δ18O (-19.6 ‰ to +2.6 ‰) and δD (-140 ‰ to +13 ‰) values from almost 6,000 measurements of nine rain events over 15 days during an 8-month period at a single location was comparable with the range measured in 1532 monthly samples from all seven Australian Global Network of Isotopes in Precipitation stations from 1962 to 2002. Extreme variations in δ18O (-8.7 ‰ to -19.6 ‰) and δD (-54 ‰ to -140 ‰) were recorded within a single 4-h period. Real-time stable isotope monitoring of environmental waters at high temporal and spatial resolution enables new and powerful tracer applications in climatology, hydrology, eco-physiology and palaeo-climatology.

  12. Crystallization and preliminary X-ray diffraction study of phosphoribosyl pyrophosphate synthetase from E. Coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Abramchik, Yu. A., E-mail: tostars@mail.ru; Zhukhlistova, N. E., E-mail: ugama@yandex.ru

    2015-09-15

    Enzymes of the phosphoribosyl pyrophosphate synthetase family (PRPPS, EC 2.7.6.1) catalyze the formation of 5-phosphoribosyl pyrophosphate (5-PRPP) from adenosine triphosphate and ribose 5-phosphate. 5-Phosphoribosyl pyrophosphate is an important intermediate in the synthesis of purine, pyrimidine, and pyridine nucleotides, as well as of the amino acids histidine and tryptophan. The crystallization conditions for E. coli PRPPS were found by the vapor-diffusion technique and were optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals grown by the counter-diffusion technique using a synchrotron radiation source to 3.1-Å resolution. The crystals of PRPPS belong to sp.more » gr. P6{sub 3}22 and have the following unit-cell parameters: a = b = 104.44 Å, c = 124.98 Å, α = β = 90°, γ = 120°. The collected X-ray diffraction data set is suitable for the solution of the three-dimensional structure of PRPPS at 3.1-Å resolution.« less

  13. Quantitative theory of diffraction by cylindrical scroll nanotubes.

    PubMed

    Khadiev, Azat; Khalitov, Zufar

    2018-05-01

    A quantitative theory of Fraunhofer diffraction by right- and left-handed multiwalled cylindrical scroll nanotubes is developed on the basis of the kinematical approach. The proposed theory is mainly dedicated to structural studies of individual nanotubes by the selected-area electron diffraction technique. Strong and diffuse reflections of the scroll nanotube were studied and explicit formulas that govern relations between the direct and reciprocal lattice of the scroll nanotube are achieved.

  14. Dip-coating of nano-sized CeO2 on SiC membrane and its effect on thermal diffusivity.

    PubMed

    Park, Jihye; Jung, Miewon

    2014-05-01

    CeO2-SiC mixed composite membrane was fabricated with porous SiC ceramic and cerium oxide powder synthesized by sol-gel process. This CeO2-SiC membrane and SiC membrane which is made by the purified SiC ceramic were pressed and sintered in Ar atmosphere. And then, the SiC membrane was dip-coated by cerium oxide precursor sol solution and heat-treated in air. The surface morphology, particle size, porosity and structure analysis of the mixing and dip-coating SiC membrane were monitored by FE-SEM and X-ray diffraction analysis. Surface area, pore volume and pore diameter were determined by BET instrument. Thermal diffusivity was measured by laser flash method with increasing temperature. The relation between porosity and thermal diffusivity from different preparation process has been discussed on this study.

  15. Intercomparison of TCCON and MUSICA Water Vapour Products

    NASA Astrophysics Data System (ADS)

    Weaver, D.; Strong, K.; Deutscher, N. M.; Schneider, M.; Blumenstock, T.; Robinson, J.; Notholt, J.; Sherlock, V.; Griffith, D. W. T.; Barthlott, S.; García, O. E.; Smale, D.; Palm, M.; Jones, N. B.; Hase, F.; Kivi, R.; Ramos, Y. G.; Yoshimura, K.; Sepúlveda, E.; Gómez-Peláez, Á. J.; Gisi, M.; Kohlhepp, R.; Warneke, T.; Dohe, S.; Wiegele, A.; Christner, E.; Lejeune, B.; Demoulin, P.

    2014-12-01

    We present an intercomparison between the water vapour products from the Total Carbon Column Observing Network (TCCON) and the MUlti-platform remote Sensing of Isotopologues for investigating the Cycle of Atmospheric water (MUSICA), two datasets from ground-based Fourier Transform InfraRed (FTIR) spectrometers with good global representation. Where possible, comparisons to radiosondes are also included. The near-infrared TCCON measurements are optimized to provide precise monitoring of greenhouse gases for carbon cycle studies; however, TCCON's retrievals also produce water vapour products. The mid-infrared MUSICA products result from retrievals optimized to give precise and accurate information about H2O, HDO, and δD. The MUSICA water vapour products have been validated by extensive intercomparisons with H2O and δD in-situ measurements made from ground, radiosonde, and aircraft (Schneider et al. 2012, 2014), as well as by intercomparisons with satellite-based H2O and δD remote sensing measurements (Wiegele et al., 2014). This dataset provides a valuable reference point for other measurements of water vapour. This study is motivated by the limited intercomparisons performed for TCCON water vapour products and limited characterisation of their uncertainties. We compare MUSICA and TCCON products to assess the potential for TCCON measurements to contribute to studies of the water cycle, water vapour's role in climate and use as a tracer for atmospheric dynamics, and to evaluate the performance of climate models. The TCCON and MUSICA products result from measurements taken using the same FTIR instruments, enabling a comparison with constant instrumentation. The retrieval techniques differ, however, in their method and a priori information. We assess the impact of these differences and characterize the comparability of the TCCON and MUSICA datasets.

  16. Vapour-liquid interfacial properties of square-well chains from density functional theory and Monte Carlo simulation.

    PubMed

    Martínez-Ruiz, Francisco José; Blas, Felipe J; Moreno-Ventas Bravo, A Ignacio; Míguez, José Manuel; MacDowell, Luis G

    2017-05-17

    The statistical associating fluid theory for attractive potentials of variable range (SAFT-VR) density functional theory (DFT) developed by [Gloor et al., J. Chem. Phys., 2004, 121, 12740-12759] is used to predict the interfacial behaviour of molecules modelled as fully-flexible square-well chains formed from tangentially-bonded monomers of diameter σ and potential range λ = 1.5σ. Four different model systems, comprising 4, 8, 12, and 16 monomers per molecule, are considered. In addition to that, we also compute a number of interfacial properties of molecular chains from direct simulation of the vapour-liquid interface. The simulations are performed in the canonical ensemble, and the vapour-liquid interfacial tension is evaluated using the wandering interface (WIM) method, a technique based on the thermodynamic definition of surface tension. Apart from surface tension, we also obtain density profiles, coexistence densities, vapour pressures, and critical temperature and density, paying particular attention to the effect of the chain length on these properties. According to our results, the main effect of increasing the chain length (at fixed temperature) is to sharpen the vapour-liquid interface and to increase the width of the biphasic coexistence region. As a result, the interfacial thickness decreases and the surface tension increases as the molecular chains get longer. The interfacial thickness and surface tension appear to exhibit an asymptotic limiting behaviour for long chains. A similar behaviour is also observed for the coexistence densities and critical properties. Agreement between theory and simulation results indicates that SAFT-VR DFT is only able to predict qualitatively the interfacial properties of the model. Our results are also compared with simulation data taken from the literature, including the vapour-liquid coexistence densities, vapour pressures, and surface tension.

  17. An advanced expiratory circuit for the recovery of perfluorocarbon liquid from non-saturated perfluorocarbon vapour during partial liquid ventilation: an experimental model

    PubMed Central

    Dunster, Kimble R; Davies, Mark W; Fraser, John F

    2006-01-01

    Background The loss of perfluorocarbon (PFC) vapour in the expired gases during partial liquid ventilation should be minimized both to prevent perfluorocarbon vapour entering the atmosphere and to re-use the recovered PFC liquid. Using a substantially modified design of our previously described condenser, we aimed to determine how much perfluorocarbon liquid could be recovered from gases containing PFC and water vapour, at concentrations found during partial liquid ventilation, and to determine if the amount recovered differed with background flow rate (at flow rates suitable for use in neonates). Methods The expiratory line of a standard ventilator circuit set-up was mimicked, with the addition of two condensers. Perfluorocarbon (30 mL of FC-77) and water vapour, at concentrations found during partial liquid ventilation, were passed through the circuit at a number of flow rates and the percentage recovery of the liquids measured. Results From 14.2 mL (47%) to 27.3 mL (91%) of the infused 30 mL of FC-77 was recovered at the flow rates studied. Significantly higher FC-77 recovery was obtained at lower flow rates (ANOVA with Bonferroni's multiple comparison test, p < 0.0001). As a percentage of the theoretical maximum recovery, 64 to 95% of the FC-77 was recovered. Statistically significantly less FC-77 was recovered at 5 Lmin-1 (ANOVA with Bonferroni's multiple comparison test, p < 0.0001). Amounts of perfluorocarbon vapour recovered were 47%, 50%, 81% and 91% at flow rates of 10, 5, 2 and 1 Lmin-1, respectively. Conclusion Using two condensers in series 47% to 91% of perfluorocarbon liquid can be recovered, from gases containing perfluorocarbon and water vapour, at concentrations found during partial liquid ventilation. PMID:16457722

  18. Comparisons of xylem sap flow and water vapour flux at the stand level and derivation of canopy conductance for Scots pine

    NASA Astrophysics Data System (ADS)

    Granier, A.; Biron, P.; Köstner, B.; Gay, L. W.; Najjar, G.

    1996-03-01

    Simultaneous measurements of xylem sap flow and water vapour flux over a Scots pine ( Pinus sylvestris) forest (Hartheim, Germany), were carried out during the Hartheim Experiment (HartX), an intensive observation campaign of the international programme REKLIP. Sap flow was measured every 30 min using both radial constant heating (Granier, 1985) and two types of Cermak sap flowmeters installed on 24 trees selected to cover a wide range of the diameter classes of the stand (min 8 cm; max 17.5 cm). Available energy was high during the observation period (5.5 to 6.9 mm.day-1), and daily cumulated sap flow on a ground area basis varied between 2.0 and 2.7 mm day-1 depending on climate conditions. Maximum hourly values of sap flow reached 0.33 mm h-1, i.e., 230 W m-2. Comparisons of sap flow with water vapour flux as measured with two OPEC (One Propeller Eddy Correlation, University of Arizona) systems showed a time lag between the two methods, sap flow lagging about 90 min behind vapour flux. After taking into account this time lag in the sap flow data set, a good agreement was found between both methods: sap flow = 0.745* vapour flux, r 2 = 0.86. The difference between the two estimates was due to understory transpiration. Canopy conductance ( g c ) was calculated from sap flow measurements using the reverse form of Penman-Monteith equation and climatic data measured 4 m above the canopy. Variations of g c were well correlated ( r 2 = 0.85) with global radiation ( R) and vapour pressure deficit ( vpd). The quantitative expression for g c = f ( R, vpd) was very similar to that previously found with maritime pine ( Pinus pinaster) in the forest of Les Landes, South Western France.

  19. Evaluation of Direct Vapour Equilibration for Stable Isotope Analysis of Plant Water.

    NASA Astrophysics Data System (ADS)

    Millar, C. B.; McDonnell, J.; Pratt, D.

    2017-12-01

    The stable isotopes of water (2H and 18O), extracted from plants, have been utilized in a variety of ecohydrological, biogeochemical and climatological studies. The array of methods used to extract water from plants are as varied as the studies themselves. Here we perform a comprehensive inter-method comparison of six plant water extraction techniques: direct vapour equilibration, microwave extraction, two unique versions of cryogenic extraction, centrifugation, and high pressure mechanical squeezing. We applied these methods to four isotopically unique plant portions (heads, stems, leaves and root crown) of spring wheat (Triticum aestivum L.). The spring wheat was grown under controlled conditions with irrigation inputs of a known isotopic composition. Our results show that the methods of extraction return significantly different plant water isotopic signals. Centrifugation, microwave extraction, direct vapour equilibration, and squeezing returned more enriched results. Both cryogenic systems and squeezing returned more depleted results, depending upon the plant portion extracted. While cryogenic extraction is currently the most widely used method in the literature, our results suggest that direct vapor equilibration method outperforms it in terms of accuracy, sample throughput and replicability. More research is now needed with other plant species (especially woody plants) to see how far the findings from this study could be extended.

  20. Analysis of Arc Characteristics and Flow Field in Arc Chamber of High-Voltage SF6 Auto-Expansion Circuit Breaker

    NASA Astrophysics Data System (ADS)

    Zhang, Junmin; Chen, Zhang

    2008-10-01

    A new magnetic hydro-dynamics model for nozzle arc emphasizing the interaction of arc with PTFE (polytetrafluorethylene) vapour is established based on the conservation equations. The interruption of auto-expansion circuit breaker is simulated numerically by finite element method and the influence of PTFE vapour on the arc is analysed with this model. The results reveal that the flow field inside the arc chamber is determined by the arc current, the arcing time, the nozzle arc and the clogging of its thermal boundary. The establishment of quenching pressure relies on both SF6 gas and PTFE vapour that absorbed arc energy in the nozzle. The PTFE vapour leads to an increase in the pressure of nozzle arc obviously, and a decrease in the temperature of arc. But it enhances the temperature of arc at zero current and slows down the decreasing rate of arc temperature as the current decreases.

  1. Frostbite in Ski Boots for Marines

    DTIC Science & Technology

    2005-05-01

    tested with regards to thermal comfort , manifested by insulation measurements, water vapour transport and water tightness of the combination. In the...et.al. 2004), you can determine the water vapour transport and heat resistance as important parameters for thermal comfort . On three subsequent...morbidity and risk factors. (in Dutch). Schols, E.H.M., Eijnde, W. van den & Heus, R (2004). A method for assessing thermal comfort of shoes using a

  2. Glass Fiber Used in Light Communications.

    DTIC Science & Technology

    1980-11-05

    narrow pulse width is extended about 4 millimicroseconds/ kilometer, the gallium arsenide emptying into the laser is extended about 0.1...glass for the core forms quartz glass fiber. Possibly the use of the chemical vapour deposition method can make low ref racting glass for the...directly from the vapour phase and reaches a very high optical homogeneity. When the temperature of the high frequency induction plasma flame is very

  3. Proceedings of the 1987 Scientific Conference on Obscuration and Aerosol Research

    DTIC Science & Technology

    1988-10-01

    anodized aluminum plate on the other, is intended to simulate a semi-infinite medium. The mirrors M1 and M2, aperture, and lens L3 collect the light... OXIDATION OF SULFUR DIOXIDE WITH OH RADICAL IN THE PRESENCE OF WATER VAPOUR AND AMMlONIA TO FORM CONDENSATION NUCLEI Patrick M. Nolan and James P. Friend...determined from the relation p pRT Aao 2D,Mf ý_t where temperature, Dg is the gas phase diffusion coefficient, and Mw is the molecular weight of the

  4. Predicting X-ray diffuse scattering from translation–libration–screw structural ensembles

    PubMed Central

    Van Benschoten, Andrew H.; Afonine, Pavel V.; Terwilliger, Thomas C.; Wall, Michael E.; Jackson, Colin J.; Sauter, Nicholas K.; Adams, Paul D.; Urzhumtsev, Alexandre; Fraser, James S.

    2015-01-01

    Identifying the intramolecular motions of proteins and nucleic acids is a major challenge in macromolecular X-ray crystallography. Because Bragg diffraction describes the average positional distribution of crystalline atoms with imperfect precision, the resulting electron density can be compatible with multiple models of motion. Diffuse X-ray scattering can reduce this degeneracy by reporting on correlated atomic displacements. Although recent technological advances are increasing the potential to accurately measure diffuse scattering, computational modeling and validation tools are still needed to quantify the agreement between experimental data and different parameterizations of crystalline disorder. A new tool, phenix.diffuse, addresses this need by employing Guinier’s equation to calculate diffuse scattering from Protein Data Bank (PDB)-formatted structural ensembles. As an example case, phenix.diffuse is applied to translation–libration–screw (TLS) refinement, which models rigid-body displacement for segments of the macromolecule. To enable the calculation of diffuse scattering from TLS-refined structures, phenix.tls_as_xyz builds multi-model PDB files that sample the underlying T, L and S tensors. In the glycerophos­phodiesterase GpdQ, alternative TLS-group partitioning and different motional correlations between groups yield markedly dissimilar diffuse scattering maps with distinct implications for molecular mechanism and allostery. These methods demonstrate how, in principle, X-ray diffuse scattering could extend macromolecular structural refinement, validation and analysis. PMID:26249347

  5. Predicting X-ray diffuse scattering from translation–libration–screw structural ensembles

    DOE PAGES

    Van Benschoten, Andrew H.; Afonine, Pavel V.; Terwilliger, Thomas C.; ...

    2015-07-28

    Identifying the intramolecular motions of proteins and nucleic acids is a major challenge in macromolecular X-ray crystallography. Because Bragg diffraction describes the average positional distribution of crystalline atoms with imperfect precision, the resulting electron density can be compatible with multiple models of motion. Diffuse X-ray scattering can reduce this degeneracy by reporting on correlated atomic displacements. Although recent technological advances are increasing the potential to accurately measure diffuse scattering, computational modeling and validation tools are still needed to quantify the agreement between experimental data and different parameterizations of crystalline disorder. A new tool, phenix.diffuse, addresses this need by employing Guinier'smore » equation to calculate diffuse scattering from Protein Data Bank (PDB)-formatted structural ensembles. As an example case, phenix.diffuse is applied to translation–libration–screw (TLS) refinement, which models rigid-body displacement for segments of the macromolecule. To enable the calculation of diffuse scattering from TLS-refined structures, phenix.tls_as_xyz builds multi-model PDB files that sample the underlying T, L and S tensors. In the glycerophosphodiesterase GpdQ, alternative TLS-group partitioning and different motional correlations between groups yield markedly dissimilar diffuse scattering maps with distinct implications for molecular mechanism and allostery. In addition, these methods demonstrate how, in principle, X-ray diffuse scattering could extend macromolecular structural refinement, validation and analysis.« less

  6. X-ray diffraction study of laser-driven solid-state diffusional mixing and new phase formation in Ni-Pt multilayers [X-ray diffraction study of laser-driven solid-state diffusional mixing and new phase formation

    DOE PAGES

    Kelly, B. G.; Loether, A.; Unruh, K. M.; ...

    2017-02-01

    An in situ optical pump and x-ray probe technique has been utilized to study photoinitiated solid-state diffusion in a Ni-Pt multilayer system. Hard x-ray diffraction has been used to follow the systematic growth of the NiPt alloy as a function of laser intensity and total energy deposited. It is observed that new phase growth can be driven in as little as one laser pulse, and that repeated photoexcitation can completely convert the entire multilayer structure into a single metallic alloy. In conclusion, the data suggest that lattice strain relaxation takes place prior to atomic diffusion and the formation of amore » NiPt alloy.« less

  7. X-ray diffraction study of laser-driven solid-state diffusional mixing and new phase formation in Ni-Pt multilayers [X-ray diffraction study of laser-driven solid-state diffusional mixing and new phase formation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kelly, B. G.; Loether, A.; Unruh, K. M.

    An in situ optical pump and x-ray probe technique has been utilized to study photoinitiated solid-state diffusion in a Ni-Pt multilayer system. Hard x-ray diffraction has been used to follow the systematic growth of the NiPt alloy as a function of laser intensity and total energy deposited. It is observed that new phase growth can be driven in as little as one laser pulse, and that repeated photoexcitation can completely convert the entire multilayer structure into a single metallic alloy. In conclusion, the data suggest that lattice strain relaxation takes place prior to atomic diffusion and the formation of amore » NiPt alloy.« less

  8. UV-laser-based longitudinal illuminated diffuser (LID) incorporating diffractive and Lambertian reflectance for the disinfection of beverages

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd

    2010-08-01

    A novel laser beam shaping system was designed to demonstrate the potential of using high power UV laser sources for large scale disinfection of liquids used in the production of food products, such as juices, beer, milk and other beverage types. The design incorporates a patented assembly of optical components including a diffractive beam splitting/shaping element and a faceted pyramidal or conically shaped Lambertian diffuser made from a compression molded PTFE compounds. When properly sintered to an appropriate density, as an example between 1.10 and 1.40 grams per cubic centimeter, the compressed PTFE compounds show a ~99% reflectance at wavelengths ranging from 300 nm to 1500 nm, and a ~98.5% refection of wavelengths from 250 nm to 2000 nm [1]. The unique diffuser configuration also benefits from the fact that the PTFE compounds do not degrade when exposed to ultraviolet radiation as do barium sulfate materials and silver or aluminized mirror coatings [2]. These components are contained within a hermetically sealed quartz tube. Once assembled a laser beam is directed through one end of the tube. This window takes the form of a computer generated diffractive splitter or other diffractive shaper element to split the laser beam into a series of spot beamlets, circular rings or other geometric shapes. As each of the split beamlets or rings cascade downward, they illuminate various points along the tapered PTFE cone or faceted pyramidal form. As they strike the surface they each diffuse in a Lambertian reflectance pattern creating a pseudo-uniform circumferential illuminator along the length of the quartz tube enclosing the assembly. The compact tubular structure termed Longitudinal Illuminated Diffuser (LID) provides a unique UV disinfection source that can be placed within a centrifugal reactor or a pipe based reactor chamber. This paper will review the overall design principle, key component design parameters, preliminary analytic and bench operational testing results.

  9. Preparation and Analysis of RNA Crystals

    NASA Technical Reports Server (NTRS)

    Todd, Paul

    2000-01-01

    The crystallization of RiboNucleic Acids (RNA) was studied from the standpoint of mechanisms of crystal growth in three tasks: (1) preparation of high-quality crystals of oligonuclotides for X-ray diffraction, (2) finding pathways to the growth of high-quality crystals for X-ray diffraction and (3) investigation of mechanisms of action of inertial acceleration on crystal growth. In these tasks: (1) RNA crystals were prepared and studied by X-ray diffraction; (2) a pathway to high-quality crystals was discovered and characterized; a combination of kinetic and equilibrium factors could be optimized as described below; and (3) an interplay between purity and gravity was found in a combination of space and ground experiments with nucleic acids and proteins. Most significantly, the rate of concentration of precipitant and RNA can be controlled by membrane-based methods of water removal or by diffusion of multivalent cations across an interface stabilized by a membrane. Oligonucleotide solutions are electrokinetically stabilized colloids, and crystals can form by the controlled addition of multivalent cations.

  10. A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

    PubMed Central

    Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B.; Santiago, Brianna M.; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M.; Soares, Alexei S.

    2014-01-01

    A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations. PMID:25484231

  11. A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

    DOE PAGES

    Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; ...

    2014-11-28

    A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

  12. Wideband Scattering Diffusion by using Diffraction of Periodic Surfaces and Optimized Unit Cell Geometries

    PubMed Central

    Costa, Filippo; Monorchio, Agostino; Manara, Giuliano

    2016-01-01

    A methodology to obtain wideband scattering diffusion based on periodic artificial surfaces is presented. The proposed surfaces provide scattering towards multiple propagation directions across an extremely wide frequency band. They comprise unit cells with an optimized geometry and arranged in a periodic lattice characterized by a repetition period larger than one wavelength which induces the excitation of multiple Floquet harmonics. The geometry of the elementary unit cell is optimized in order to minimize the reflection coefficient of the fundamental Floquet harmonic over a wide frequency band. The optimization of FSS geometry is performed through a genetic algorithm in conjunction with periodic Method of Moments. The design method is verified through full-wave simulations and measurements. The proposed solution guarantees very good performance in terms of bandwidth-thickness ratio and removes the need of a high-resolution printing process. PMID:27181841

  13. GIS-NaP1 zeolite microspheres as potential water adsorption material: Influence of initial silica concentration on adsorptive and physical/topological properties

    PubMed Central

    Sharma, Pankaj; Song, Ju-Sub; Han, Moon Hee; Cho, Churl-Hee

    2016-01-01

    GIS-NaP1 zeolite samples were synthesized using seven different Si/Al ratios (5–11) of the hydrothermal reaction mixtures having chemical composition Al2O3:xSiO2:14Na2O:840H2O to study the impact of Si/Al molar ratio on the water vapour adsorption potential, phase purity, morphology and crystal size of as-synthesized GIS-NaP1 zeolite crystals. The X-ray diffraction (XRD) observations reveal that Si/Al ratio does not affect the phase purity of GIS-NaP1 zeolite samples as high purity GIS-NaP1 zeolite crystals were obtained from all Si/Al ratios. Contrary, Si/Al ratios have remarkable effect on the morphology, crystal size and porosity of GIS-NaP1 zeolite microspheres. Transmission electron microscopy (TEM) evaluations of individual GIS-NaP1 zeolite microsphere demonstrate the characteristic changes in the packaging/arrangement, shape and size of primary nano crystallites. Textural characterisation using water vapour adsorption/desorption, and nitrogen adsorption/desorption data of as-synthesized GIS-NaP1 zeolite predicts the existence of mix-pores i.e., microporous as well as mesoporous character. High water storage capacity 1727.5 cm3 g−1 (138.9 wt.%) has been found for as-synthesized GIS-NaP1 zeolite microsphere samples during water vapour adsorption studies. Further, the total water adsorption capacity values for P6 (1299.4 mg g−1) and P7 (1388.8 mg g−1) samples reveal that these two particular samples can absorb even more water than their own weights. PMID:26964638

  14. GIS-NaP1 zeolite microspheres as potential water adsorption material: Influence of initial silica concentration on adsorptive and physical/topological properties.

    PubMed

    Sharma, Pankaj; Song, Ju-Sub; Han, Moon Hee; Cho, Churl-Hee

    2016-03-11

    GIS-NaP1 zeolite samples were synthesized using seven different Si/Al ratios (5-11) of the hydrothermal reaction mixtures having chemical composition Al2O3:xSiO2:14Na2O:840H2O to study the impact of Si/Al molar ratio on the water vapour adsorption potential, phase purity, morphology and crystal size of as-synthesized GIS-NaP1 zeolite crystals. The X-ray diffraction (XRD) observations reveal that Si/Al ratio does not affect the phase purity of GIS-NaP1 zeolite samples as high purity GIS-NaP1 zeolite crystals were obtained from all Si/Al ratios. Contrary, Si/Al ratios have remarkable effect on the morphology, crystal size and porosity of GIS-NaP1 zeolite microspheres. Transmission electron microscopy (TEM) evaluations of individual GIS-NaP1 zeolite microsphere demonstrate the characteristic changes in the packaging/arrangement, shape and size of primary nano crystallites. Textural characterisation using water vapour adsorption/desorption, and nitrogen adsorption/desorption data of as-synthesized GIS-NaP1 zeolite predicts the existence of mix-pores i.e., microporous as well as mesoporous character. High water storage capacity 1727.5 cm(3) g(-1) (138.9 wt.%) has been found for as-synthesized GIS-NaP1 zeolite microsphere samples during water vapour adsorption studies. Further, the total water adsorption capacity values for P6 (1299.4 mg g(-1)) and P7 (1388.8 mg g(-1)) samples reveal that these two particular samples can absorb even more water than their own weights.

  15. Density Determination of Metallic Melts from Diffuse X-Ray Scattering

    NASA Astrophysics Data System (ADS)

    Brauser, N.; Davis, A.; Greenberg, E.; Prakapenka, V. B.; Campbell, A.

    2017-12-01

    Liquids comprise several important structural components of the deep Earth, for example, the present outer core and a hypothesized magma ocean early in Earth history. However, the physical properties of the constituent materials of these structures at high pressures and temperatures are less well constrained than their crystalline counterparts. Determination of the physical properties of these liquids can inform geophysical models of the composition and structure of the Earth, but methods for studying the physical properties of liquids at high pressure and temperatures are underdeveloped. One proposed method for direct determination of density of a melt requires analysis of the diffuse scattered X-ray signal of the liquid. Among the challenges to applying this technique to high-pressure melts within a laser heated diamond anvil cell are the low signal-to-noise ratio and overlapping diffraction peaks from the crystalline components of the sample assembly interfering with the diffuse scattering from the liquid. Recent advances in instrumentation at synchrotron X-ray sources have made this method more accessible for determination of density of melted material. In this work we present the technique and report the densities of three high-pressure melts of the FCC metals iron, nickel, and gold derived from diffuse scattered X-ray spectra collected from in situ laser-heated diamond anvil cell synchrotron experiments. The results are compared to densities derived from shock wave experiments.

  16. Evaluation of environmental levels of aromatic hydrocarbons in gasoline service stations by gas chromatography.

    PubMed

    Periago, J F; Zambudio, A; Prado, C

    1997-08-22

    The volume of gasoline sold in refuelling operations and the ambient temperature, can increase significantly the environmental levels of aromatic hydrocarbon vapours and subsequently, the occupational risk of gasoline service station attendants, specially in the case of benzene. We have evaluated the occupational exposure to aromatic hydrocarbons by means of personal-breathing-zone samples of gasoline vapours in a service station attendant population. This evaluation was carried out using diffusive samplers, in two periods at quite different temperatures (March and July). A significant relationship between the volume of gasoline sold during the shift and the ambient concentration of benzene, toluene, and xylenes was found for each worker sampled. Furthermore a significant difference was found between the time-weighted average concentration of aromatic compounds measured in March, with ambient temperatures of 14-15 degrees C and July, with temperatures of 28-30 degrees C. In addition, 20% of the population sampled in the last period were exposed to a time-weighted average concentration of benzene above the proposed Threshold Limit Value of 960 micrograms/m(3) of the American Conference of Governmental Industrial Hygienists (ACGIH).

  17. Towards engineered branch placement: Unreal™ match between vapour-liquid-solid glancing angle deposition nanowire growth and simulation

    NASA Astrophysics Data System (ADS)

    Taschuk, M. T.; Tucker, R. T.; LaForge, J. M.; Beaudry, A. L.; Kupsta, M. R.; Brett, M. J.

    2013-12-01

    The vapour-liquid-solid glancing angle deposition (VLS-GLAD) process is capable of producing complex nanotree structures with control over azimuthal branch orientation and height. We have developed a thin film growth simulation including ballistic deposition, simplified surface diffusion, and droplet-mediated cubic crystal growth for the VLS-GLAD process using the UnrealTM Development Kit. The use of a commercial game engine has provided an interactive environment while allowing a custom physics implementation. Our simulation's output is verified against experimental data, including a volumetric film reconstruction produced using focused ion beam and scanning-electron microscopy (SEM), crystallographic texture, and morphological characteristics such as branch orientation. We achieve excellent morphological and texture agreement with experimental data, as well as qualitative agreement with SEM imagery. The simplified physics in our model reproduces the experimental films, indicating that the dominant role flux geometry plays in the VLS-GLAD competitive growth process responsible for azimuthally oriented branches and biaxial crystal texture evolution. The simulation's successful reproduction of experimental data indicates that it should have predictive power in designing novel VLS-GLAD structures.

  18. Optical second-harmonic diffraction study of anisotropic surface diffusion: CO on Ni(110)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiao, X.; Zhu, X.D.; Daum, W.

    We describe in detail a technique using optical second-harmonic (SH) diffraction from a one-dimensional laser-induced monolayer grating to probe surface diffusion of adsorbates and its anisotropy on a solid surface. The case of CO on Ni(110) is used as a demonstration. The two orthogonal and independent diffusion tensor components along (1{bar 1}0) and (001) are measured, exhibiting a strong anisotropy in both the activation energy {ital E}{sub diff} and the preexponential factor {ital D}{sub 0} in the diffusion coefficients. A compensation effect between {ital E}{sub diff} and {ital D}{sub 0} is observed. In comparison with CO/Ni(111) and CO/Ni(100), our resultmore » suggests that the Ni(110) surface seen by CO is much smoother than Ni(111) and Ni(100). Both advantages and limitations of the present technique are mentioned and possible complications in the data analysis are discussed.« less

  19. Holographic investigation of silver electromigration in nano-sized As2S3 films

    NASA Astrophysics Data System (ADS)

    Sainov, S.; Todorov, R.; Bodurov, I.; Yovcheva, Temenuzhka

    2013-10-01

    Holographic gratings with a diffraction efficiency (DE) greater than 8% and a spatial resolution of 2237 mm-1 are recorded in very thin As2S3 films with a thickness of 100 nm. Silver photo-diffusion is observed during the holographic recording process while applying a corona discharge. We use the method of holographic grating relaxation spectroscopy (forced Rayleigh scattering) based on the evanescent waves to determine that the silver diffusion coefficient in the thin As2S3 film is in the range of (0.9-10.3) × 10-13 cm2 s-1 depending on the corona charge polarity. This work is dedicated to the 90th anniversary of the birth of Academician Jordan Malinowski.

  20. The Role of Subsurface Properties on Transport of Water and Trace Gases: 1D Simulations at Selected Mars Landing Sites.

    NASA Astrophysics Data System (ADS)

    Karatekin, O.; Gloesener, E.; Dehant, V. M. A.

    2017-12-01

    In this work, water ice stability and water vapour transport through porous martian subsurface are studied using a 1D diffusive model. The role of adsorption on water transfer in martian conditions is investigated as well as the range of parameters that have the largest effect on gas transport. In addition, adsorption kinetics is considered to examine its influence on the water vapor exchange between the subsurface and the atmosphere. As methane has been detected in the martian atmosphere, the subsurface model is then used to study methane diffusion in the CH4/CO2/H2O system from variable depths under the surface. The results of subsurface gas transport at selected locations/landing sites are shown and implications for present/future observations are discussed.

Top